diff --git "a/deduped/dedup_0580.jsonl" "b/deduped/dedup_0580.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0580.jsonl"
@@ -0,0 +1,42 @@
+{"text": "Joel Cohen offers a historical and prospective analysis of the relationship between mathematics and biology Although mathematics has long been intertwined with the biological sciences, an explosive synergy between biology and mathematics seems poised to enrich and extend both fields greatly in the coming decades . BiologyThe discovery of the microscope in the late 17th century caused a revolution in biology by revealing otherwise invisible and previously unsuspected worlds. Western cosmology from classical times through the end of the Renaissance envisioned a system with three types of spheres: the sphere of man, exemplified by his imperfectly round head; the sphere of the world, exemplified by the imperfectly spherical earth; and the eight perfect spheres of the universe, in which the seven (then known) planets moved and the outer stars were fixed . The disMathematics broadly interpreted is a more general microscope. It can reveal otherwise invisible worlds in all kinds of data, not only optical. For example, computed tomography can reveal a cross-section of a human head from the density of X-ray beams without ever opening the head, by using the Radon transform to infer the densities of materials at each location within the head . CharlesConversely, mathematics will benefit increasingly from its involvement with biology, just as mathematics has already benefited and will continue to benefit from its historic involvement with physical problems. In classical times, physics, as first an applied then a basic science, stimulated enormous advances in mathematics. For example, geometry reveals by its very etymology (geometry) its origin in the needs to survey the lands and waters of Earth. Geometry was used to lay out fields in Egypt after the flooding of the Nile, to aid navigation, to aid city planning. The inventions of the calculus by Isaac Newton and Gottfried Leibniz in the later 17th century were stimulated by physical problems such as planetary orbits and optical calculations.In the coming century, biology will stimulate the creation of entirely new realms of mathematics. In this sense, biology is mathematics' next physics, only better. Biology will stimulate fundamentally new mathematics because living nature is qualitatively more heterogeneous than non-living nature. For example, it is estimated that there are 2,000\u20135,000 species of rocks and minerals in the earth's crust, generated from the hundred or so naturally occurring elements  (Harvey 1847), first published in 1628. Harvey's demonstration that the blood circulates was the pivotal founding event of the modern interaction between mathematics and biology. His elegant reasoning is worth understanding.The outstanding milestone in the early history of biological quantitation was the work of William Harvey, From the time of the ancient Greek physician Galen (131\u2013201 C.E.) until William Harvey studied medicine in Padua , it was believed that there were two kinds of blood, arterial blood and venous blood. Both kinds of blood were believed to ebb and flow under the motive power of the liver, just as the tides of the earth ebbed and flowed under the motive power of the moon. Harvey became physician to the king of England. He used his position of privilege to dissect deer from the king's deer park as well as executed criminals. Harvey observed that the veins in the human arm have one-way valves that permit blood to flow from the periphery toward the heart but not in the reverse direction. Hence the theory that the blood ebbs and flows in both veins and arteries could not be correct.Harvey also observed that the heart was a contractile muscle with one-way valves between the chambers on each side. He measured the volume of the left ventricle of dead human hearts and found that it held about two ounces (about 60 ml), varying from 1.5 to three ounces in different individuals. He estimated that at least one-eighth and perhaps as much as one-quarter of the blood in the left ventricle was expelled with each stroke of the heart. He measured that the heart beat 60\u2013100 times per minute. Therefore, the volume of blood expelled from the left ventricle per hour was about 60 ml \u00d7 1/8 \u00d7 60 beats/minute \u00d7 60 minutes/hour, or 27 liters/hour. However, the average human has only 5.5 liters of blood (a quantity that could be estimated by draining a cadaver). Therefore, the blood must be like a stage army that marches off one side of the stage, returns behind the scenes, and reenters from the other side of the stage, again and again. The large volume of blood pumped per hour could not possibly be accounted for by the then-prevalent theory that the blood originated from the consumption of food. Harvey inferred that there must be some small vessels that conveyed the blood from the outgoing arteries to the returning veins, but he was not able to see those small vessels. His theoretical prediction, based on his meticulous anatomical observations and his mathematical calculations, was spectacularly confirmed more than half a century later when Marcello Malpighi (1628\u20131694) saw the capillaries under a microscope. Harvey's discovery illustrates the enormous power of simple, off-the-shelf mathematics combined with careful observation and clear reasoning. It set a high standard for all later uses of mathematics in biology.Mathematics was crucial in the discovery of genes by Mendel  and in tOver the last 500 years, mathematics has made amazing progress in each of its three major fields: geometry and topology, algebra, and analysis. This progress has enriched all the biological sciences.In 1637, Ren\u00e9 Descartes linked the featureless plane of Greek geometry to the symbols and formulas of Arabic algebra by imposing a coordinate system  on the geometric plane and using numbers to measure distances between points. If every biologist who plotted data on x\u2013y coordinates acknowledged the contribution of Descartes to biological understanding, the key role of mathematics in biology would be uncontested.Another highlight of the last five centuries of geometry was the invention of non-Euclidean geometries (1823\u20131830). Shocking at first, these geometries unshackled the possibilities of mathematical reasoning from the intuitive perception of space. These non-Euclidean geometries have made significant contributions to biology in facilitating, for example, mapping the brain onto a flat surface .Nine Chapters of the Mathematical Art; In algebra, efforts to find the roots of equations led to the discovery of the symmetries of roots of equations and thence to the invention of group theory, which finds routine application in the study of crystallographic groups by structural biologists today. Generalizations of single linear equations to families of simultaneous multi-variable linear equations stimulated the development of linear algebra and the European re-invention and naming of matrices in the mid-19th century. The use of a matrix of numbers to solve simultaneous systems of linear equations can be traced back in Chinese mathematics to the period from 300 B.C.E. to 200 C.E. . The questions and the domains of biology behave differently on different temporal and spatial scales. The opportunities and the challenges that biology offers mathematics arise because the units at any given level of biological organization are heterogeneous, and the outcomes of their interactions  on any selected temporal and spatial scale may be substantially affected by the heterogeneity and interactions of biological components at lower and higher levels of biological organization and at smaller and larger temporal and spatial scales , 1995.The landscape of applied mathematics is better visualized as a tetrahedron (a pyramid with a triangular base) than as a matrix with temporal and spatial dimensions.  The four main points of the applied mathematical landscape are data structures, algorithms, theories and models , and computers and software. Data structures are ways to organize data, such as the matrix used above to describe the biological landscape. Algorithms are procedures for manipulating symbols. Some algorithms are used to analyze data, others to analyze models. Theories and models, including the theories of pure mathematics, are used to analyze both data and ideas. Mathematics and mathematical theories provide a testing ground for ideas in which the strength of competing theories can be measured. Computers and software are an important, and frequently the most visible, vertex of the applied mathematical landscape. However, cheap, easy computing increases the importance of theoretical understanding of the results of computation. Theoretical understanding is required as a check on the great risk of error in software, and to bridge the enormous gap between computational results and insight or understanding.The landscape of research in mathematics and biology contains all combinations of one or more biological questions, domains, time scales, and spatial scales with one or more data structures, algorithms, theories or models, and means of computation . The following example from cancer biology illustrates such a combination: the question, \u201chow does it work?\u201d is approached in the domain of cells  with algorithms for correlation and hierarchical clustering.http://discover.nci.nih.gov/arraytools/). They used two kinds of information from the drug discovery program of the National Cancer Institute. The first kind of information described gene expression in 1,375 genes of each of 60 human cancer cell lines. A target matrix T had, as the numerical entry in row g and column c, the relative abundance of the mRNA transcript of gene g in cell line c. The drug activity matrix A summarized the pharmacology of 1,400 drugs acting on each of the same 60 human cancer cell lines, including 118 drugs with \u201cknown mechanism of action.\u201d The number in row d and column c of the drug activity matrix A was the activity of drug d in suppressing the growth of cell line c, or, equivalently, the sensitivity of cell line c to drug d. The target matrix T for gene expression contained 82,500 numbers, while the drug activity matrix A had 84,000 numbers.Suppose a person has a cancer. Could information about the activities of the genes in the cells of the person's cancer guide the use of cancer-treatment drugs so that more effective drugs are used and less effective drugs are avoided? To suggest answers to this question, These two matrices have the same set of column headings but have different row labels. Given the two matrices, precisely five sets of possible correlations could be calculated, and Scherf et al. calculated all five. (1) The correlation between two different columns of the activity matrix A led to a clustering of cell lines according to their similarity of response to different drugs. (2) The correlation between two different columns of the target matrix T led to a clustering of the cell lines according to their similarity of gene expression. This clustering differed very substantially from the clustering of cell lines by drug sensitivity. (3) The correlation between different rows of the activity matrix A led to a clustering of drugs according to their activity patterns across all cell lines. (4) The correlation between different rows of the target matrix T led to a clustering of genes according to the pattern of mRNA expressed across the 60 cell lines. (5) Finally, the correlation between a row of the activity matrix A and a row of the target matrix T described the positive or negative covariation of drug activity with gene expression. A positive correlation meant that the higher the level of gene expression across the 60 cancer cell lines, the higher the effectiveness of the drug in suppressing the growth of those cell lines. The result of analyzing several hundred thousand experiments is summarized in a single picture called a clustered image map . This clWhat use is this? If a person's cancer cells have high expression for a particular gene, and the correlation of that gene with drug activity is highly positive, then that gene may serve as a marker for tumor cells likely to be inhibited effectively by that drug. If the correlation with drug activity is negative, then the marker gene may indicate when use of that drug is contraindicated.While important scientific questions about this approach remain open, its usefulness in generating hypotheses to be tested by further experiments is obvious. It is a very insightful way of organizing and extracting meaning from many individual observations. Without the microscope of mathematical methods and computational power, the insight given by the clustered image map could not be achieved.To realize the possibilities of effective synergy between biology and mathematics will require both avoiding potential problems and seizing potential opportunities.The productive interaction of biology and mathematics will face problems that concern education, intellectual property, and national security.Educating the next generation of scientists will require early emphasis on quantitative skills in primary and secondary schools and more opportunities for training in both biology and mathematics at undergraduate, graduate, and postdoctoral levels .Intellectual property rights may both stimulate and obstruct the potential synergy of biology and mathematics. Science is a potlatch culture. The bigger one's gift to the common pool of knowledge and techniques, the higher one's status, just as in the potlatch culture of the Native Americans of the northwest coast of North America. In the case of research in mathematics and biology, intellectual property rights to algorithms and databases need to balance the concerns of inventors, developers, and future researchers .A third area of potential problems as well as opportunities is national security. Scientists and national defenders can collaborate by supporting and doing open research on the optimal design of monitoring networks and mitigation strategies for all kinds of biological attacks . But opeMathematical models can circumvent ethical dilemmas. For example, in a study of the household transmission of Chagas disease in northwest Argentina, The future of a scientific field is probably less predictable than the future in general. Doubtless, though, there will be exciting opportunities for the collaboration of mathematics and biology. Mathematics can help biologists grasp problems that are otherwise too big (the biosphere) or too small (molecular structure); too slow (macroevolution) or too fast (photosynthesis); too remote in time (early extinctions) or too remote in space (life at extremes on the earth and in space); too complex (the human brain) or too dangerous or unethical (epidemiology of infectious agents). Here are five biological challenges that could stimulate, and benefit from, major innovations in mathematics.Understand cells, their diversity within and between organisms, and their interactions with the biotic and abiotic environments. The complex networks of gene interactions, proteins, and signaling between the cell and other cells and the abiotic environment is probably incomprehensible without some mathematical structure perhaps yet to be invented.Understand the brain, behavior, and emotion. This, too, is a system problem. A practical test of the depth of our understanding is this simple question: Can we understand why people choose to have children or choose not to have children ?http://www.life.umd.edu/labs/Delwiche/pubs/endosymbiosis.gif).Replace the tree of life with a network or tapestry to represent lateral transfers of heritable features such as genes, genomes, and prions (Couple atmospheric, terrestrial, and aquatic biospheres with global physicochemical processes.Monitor living systems to detect large deviations such as natural or induced epidemics or physiological or ecological pathologies.Here are five mathematical challenges that would contribute to the progress of biology.Understand computation. Find more effective ways to gain insight and prove theorems from numerical or symbolic computations and agent-based models. We recall Hamming: \u201cThe purpose of computing is insight, not numbers\u201d , p. 31.Find better ways to model multi-level systems, for example, cells within organs within people in human communities in physical, chemical, and biotic ecologies.Understand probability, risk, and uncertainty. Despite three centuries of great progress, we are still at the very beginning of a true understanding. Can we understand uncertainty and risk better by integrating frequentist, Bayesian, subjective, fuzzy, and other theories of probability, or is an entirely new approach required?Understand data mining, simultaneous inference, and statistical de-identification . Are praSet standards for clarity, performance, publication and permanence of software and computational results."}
+{"text": "Mention greenhouse gases to most people and they're apt to think of carbon dioxide, fossil fuels, and big cars. Though carbon dioxide emissions are the major source of greenhouse gases, methane is far more effective at trapping heat in the atmosphere. Like increasing carbon dioxide levels, rising levels of atmospheric methane have been attributed to human activity, mostly in the form of landfills, natural gas and oil processing (about 60%), domesticated livestock (cattle account for about 75% of livestock contributions), and rice fields .Ruminants\u2014from cows and water buffalo to llamas and vicunas\u2014emit methane gas as a natural by-product of their digestive process, which confers a unique ability to digest cellulose. Ruminants don't digest cellulose directly, but depend on a variety of microbes living in their rumen (main stomach) to do it for them. These microbes ferment cellulose, breaking it down into products the ruminant can digest. During this process, some microbes\u2014bacteria called methanogens\u2014produce methane, which ruminants expel by eructation (otherwise known as belching).PLoS Biology, a multidisciplinary team spanning the fields of genomics, bioinformatics, microbiology, evolutionary biology, and molecular biology report the complete genome sequence of Methylococcus capsulatus and shed light on the metabolism and biology of this ubiquitous microbe.Luckily, there are microbes, called methanotrophs, that consume methane. A type of aerobic bacteria, methanotrophs oxidize methane as an energy and carbon source using the enzyme methane monooxygenase. They've been found in soils, landfills, sediments, hotsprings, and peat bogs, among other environments. Methanotrophs have been the subject of increasing interest because they can use methane as a sole source of carbon and energy\u2014which means they play a major role in global carbon cycles\u2014and could dramatically reduce biologically generated methane emissions. They've also been the focus of bioremediation efforts aimed at environmental decontamination. And now, with the publication of the first complete genome sequence of a methanotroph, such efforts will be all the easier. In this issue of M. capsulatus genome comprises about 3.3 million base pairs\u2014which is about average for a free-living bacterium\u2014with an estimated 3,120 genes. The genome appears well-equipped to meet the specialized needs of this methanotroph, with what appear to be multiple pathways involved in the metabolism of methane and duplications of genes that code for methane monooxygenases, which are essential for the first step of methane oxidation.Contained in a single, circular molecule, the M. capsulatus employs different pathways depending on the availability of molecules needed to sustain cellular activities. Most surprising, the researchers note, was evidence that this methane specialist can turn into a sort of metabolic generalist\u2014with a capacity to use sugars, hydrogen, and sulfur\u2014and appears able to survive reduced oxygen levels. These genome-based hypotheses will require experimental validation, the authors note, but could have important implications for M. capsulatus ecology\u2014including what environments might be amenable to methanotroph-mediated bioremediation.Ward et al. also found evidence of \u201cgenomic redundancy\u201d in methane oxidation pathways, suggesting that M. capsulatus genome provides a platform for investigating the details of methanotroph biology and its potential as a biotech workhorse. It may also guide efforts to harness this bacterium's penchant for methane to reduce global greenhouse gas emissions, to degrade chlorinated hydrocarbons and other persistent pollutants, and to produce protein for animal feed.The genomes of important microbial players in the carbon cycle\u2014including microbes involved in photosynthesis and methanogenesis (methane production)\u2014have already been sequenced. With the addition of a sequenced methanotroph genome, scientists can systematically investigate different genes and regulatory elements to better understand how these methane consumers fit into this global cycle. The"}
+{"text": "Mathematical measures of complexity shed light on why some concepts are inherently more difficult to learn than others I suspect, nevertheless, that he was not very capable of thought. To think is to forget a difference, to generalize, to abstract. In the overly replete world of Funes there were nothing but details, almost contiguous details.\u201d \u2014Jorge Luis Borges, \u201cFunes the Memorius\u201dWe are told scientists are divided into experimentalists and theoreticians. The dialectic description of the dynamics of science, with one tribe gathering data and collecting evidence and another tribe providing form to these observations, has striking examples that argue for the importance of synthesis. The 16th century revolution, which settled the way in which we see the sky today, is probably one of the best examples of how comparatively ineffective each of these tribes can be in isolation. Tycho Brahe, the exquisite observer, who built, calibrated, and refined instruments to see in the sky what no one else could, collected the evidence to prove a theory that Copernicus had already stated years before (in a book he dedicated to the Pope). It was only many years later that Galileo established the bridge between theory and observation; he understood the data in terms of the theory and thereby cemented the revolution. Copernicus's statements, showed Galileo, were not only figments of his imagination; they were an adequate description of the universe as he and Brahe had observed it.Since my first steps in biology, after a prompt departure from physics and mathematics, I have looked for such encounters between theory and experiment. I began studying the visual system and the series of fundamental works by In the middle of the last century, working on the problem of communications, languages, codes, and channels, Claude Shannon proposed a very elegant theory that formalized intuitive ideas on the essence (and the limits) of communications . One of About four years ago, Jacob Feldman published a paper, similar in spirit, proposing a simple explanation for a long-standing problem in cognitive science about why some concepts are inherently more difficult to learn than others . An artiTo visualize the intuitive nature of his theory it helps to do a thought experiment. Imagine a set of objects defined by, say, three features: form, color, and size. And imagine, for simplicity, that each feature is binary, that is, there are only two possible cases. Size is big or small, color is yellow or red, and shape can be either a triangle or a circle. This defines, of course, a universe of eight objects. We can now define categories within this universe: for example, all the circles (a category of four exemplars), or all the big and yellow objects (two exemplars), or all the triangles that are not red (again two) . We can also define a category by enumeration, for example, the small red triangle, the big yellow circle, and the small yellow circle (three exemplars). Some rules (and thus the groups defined by these rules) are intuitively easier to define than others. \u201cAll the circles\u201d is an easier statement to make (and probably to remember) than \u201csmall circles and yellow big objects.\u201d This notion of difficulty is what Kolmogorov's theory formalized, stating that complexity was the length of the shortest definition  of a given set. From this thought experiment, we can understand the logic of Feldman's paper, which showed that. Kolmogrov complexity is very closely related to our intuitive notion of conceptual difficulty. Feldman presented subjects with all possible categories (of a fixed number of exemplars) in different universes and showed that the critical parameter to rank the difficulty of a given subset was its Kolmogrov complexity. Moreover by explicitly presenting all the members and the nonmembers of a category to na\u00efve subjects, he showed that we can spontaneously reduce a category to its minimal form and remember it without any explicit instruction. Thus, what Feldman found, following the original ideas of Shepard, was that our psychological measure of complexity\u2014our difficulty in defining and remembering a category or concept\u2014is also determined by the Kolmogorov complexity that describes it.This essay is, in a way, about how we avoid becoming Borges's character Funes, who could not understand repeated observations as exemplars of a common rule and thus could not synthesize and categorize. Simply, he could not think. Probably the most disappointing moment of Feldman's paper comes at the very end, where it deals with its (somehow unavoidable) recursive quest. Understanding why some concepts are difficult to learn may itself be difficult to learn. Modern mathematics, together with Kolmogorov complexity and information theory, has taught us another fundamental concept that may be relevant when trying to understand the logic of the mind. In a long series of paradoxes enumerated by Bertrand Russell, Kurt Goedel, and others, we learn that a formal system that looks at itself is bound to fail. At the very end of his paper, Feldman writes, \u201cIn a sense, this final conclusion [that psychological complexity is Boolean complexity] may seem negative: human conceptual difficulty reflects intrinsic mathematical complexity after all, rather than some idiosyncratic and uniquely human bias.\u201d Who invented mathematics? The Martians? On the contrary, I believe this result supports a more naturalistic and less Platonic conception of mathematics. Formal ideas in mathematics are not arbitrary constructions of an arbitrary architecture; rather, they reflect the workings of the brain like a massive collective cognitive experiment. Mathematics does not only serve to help us understand biology; mathematics is biology. We are not less original if our thoughts resemble our mental constructions, we are just consistent. It is within this loop, this unavoidable recursion\u2014mathematics understanding the logic of the brain\u2014that we will have an opportunity to test, as some conspire, whether among all the wonders evolution has come out with, the ultimate might be a brain good enough to avoid the risk of understanding itself."}
+{"text": "Another toe was present behind the heel giving the appearance of a partial duplication of the foot. Penoscrotal transposition, bifid scrotum with bilateral descended testis, and proximal penile hypospadias were noted. A large mucosal patch was seen in the perineum on the left side [A term male baby weighing 2490 gms was seen with a rare anomaly. The left knee was flexed secondary to a tight popliteal web. The left foot had talipes equinovarus deformity with absence of 4eft side . The anaThe popliteal pterygium syndrome is a rare autosomal dominant disorder seen in 1 in 300,000 live births. The characteristic feature is a web which usually extends from the heel to the ischial tuberosity. This contains a palpable cord of connective tissue and occasionally the popliteal artery and peroneal nerve. Absence of muscles or abnormal muscle and tendon insertion may be associated. Other anomalies show a wide range of expressivity and affect the face, limbs, and genitalia. Orofacial anomalies include cleft palate, cleft lip, micrognathia, ankyloblepharon, and choanal atresia. Anomalies of nail and digits, talipes equinovarus, spina bifida occulta, bifid ribs, and short sternum are described. Genital anomalies include hypoplastic labia majora, vagina and uterus, clitoral hypertrophy, cryptorchidism, bifid or absent scrotum and ambiguous genitalia. There is no growth disturbance and intelligence is usually normal.1Prenatal sonography may detect an associated cleft lip/ palate along with inability of the fetus to stretch the knee. Magnetic resonance imaging is the test of choice before resection of fibrous bands and Z-plasty of the web.4 Nerve g"}
+{"text": "IL-28B gene polymorphisms predict better therapeutic response and spontaneous clearance of HCV. Moreover, higher expression of IFN-lambda has been reported in patients with the rs12979860 CC favourable genotype. The study aim was to establish possible relationships between IL-28B rs12979860 genotypes and expression of IFN-alpha receptor-1 (IFNAR-1) in na\u00efve HCV patients, and to explore the possible role of IFN-lambda.IFNAR-1 mRNA levels were measured in PBMC from na\u00efve patients with chronic hepatitis C with different IL-28 genotypes. The ability of IFN-lambda to up-regulate the expression of IFNAR-1 was established in PBMC from healthy donors carrying different IL-28B genotypes.Lower IFNAR-1 mRNA levels were observed in PBMC from HCV-infected na\u00efve patients as compared to healthy donors. In healthy donors, IFNAR-1 mRNA levels were independent from IL-28B genotype, while in HCV patients, an increasing gradient was observed in TT vs CT vs CC carriers. In the latter group, a direct correlation between IFNAR-1 and endogenous IL-28B expression was observed. Moreover, IFN-lambda up-regulated IFNAR-1 expression in normal PBMC in a time-and dose-dependent manner, with a more effective response in CC vs TT carriers.Endogenous levels of IFN-lambda may be responsible for partial restoration of IFNAR-1 expression in HCV patients with favourable IL-28 genotype. This, in turn, may confer to CC carriers a response advantage to either endogenous or exogenous IFN-alpha, representing the biological basis for the observed association between CC genotype and favourable outcome of either natural infection (clearance vs chronicization) or IFN therapy. Hepatitis C virus (HCV) is the leading cause of chronic liver disease, cirrhosis, and hepatocellular carcinoma in developed countries A group of recently discovered cytokines , assigned to a new type of IFN (type III IFN) gained increased attention in the HCV field Genome-wide association studies (GWAS) identified several single-nucleotide polymorphisms (SNPs) in IL-28B gene region, that were strongly related to therapy-induced HCV clearance rate in CHC patients TypeI and III IFNs exhibit a distinct receptor complex but common functions, both in term of broad range of antiviral mechanisms, induction of the same pattern of ISGs, and stimulation of immune effector functions. Despite the functional similarity with type I IFNs, clear evidence exists that type III IFNs have unique mechanisms of action, concerning, in particular, the kinetics of signal transduction after receptor engagement. Conflicting data exist on the relationship between genetic variation of IL-28 and the basal ISGs levels. Recent studies have suggested that baseline hepatic expression of ISGs was associated with genetic variation of IL-28B In a previous study we have shown that reduced expression of the IFN-alpha receptor -1 (IFNAR-1) may represent the biological basis for reduced response to SOC in poorly performing patients The aim of the present study was to establish whether the IL-28B rs12979860 genotype could influence the endogenous expression IFNAR-1, and to explore the possible role of IFN-lambda.The project was approved by Comitato Etico \u201cIstituto Nazionale per le Malattie Infettive L. Spallanzani, I.R.C.C.S.\u201d and patients agreed to participate to the study by signing informed consent.PBMC and plasma samples from 40 treatment-naive patients, chronically infected with HCV (genotype 1 or 4), collected at the National Institute for Infectious Diseases and stored in the Institutional Biorepository, for whom IL-28B genotype at locus rs12979860 was known, were retrospectively selected, in order to include a sufficient number of patients harboring the CC genotype  to perform a comparative analysis. The distribution of IL-28B genotypes was: 9 CC (22.5%), 18 CT (45%), 13 TT (32.5%). Clinical characteristics of patients are shown in 5\u2032 GCC TGT CGT GTA CTG AAC CA 3\u2032 and 5\u2032 GCG CGG AGT GCA ATT CAA C 3\u2032, and TaqMan probes: VIC- TGG TTC GCG CCT TC-MGB and FAM-CTG GTT CAC GCC TTC\u2013MGB. Polymerase chain reactions (PCR) were performed with an SDS 7900 ht qPCR thermocycler  with the following amplification protocols: denaturation at 95\u00b0C for 10 minutes, followed by 40 cycles of denaturation at 92\u00b0C for 15 sec, and finished with annealing and extension at 60\u00b0C for a 1 minute. Genotype was attributed by SDS 1.3 software for allelic discrimination.IL-28B rs12979860 CC/CT/TT genotype was established on genomic DNA, using a custom made TaqMan assay with the following amplification primers: 6/mL in RPMI medium supplemented with 10% foetal bovine serum and then cultured for 3 h in the absence or presence of 103 IU/ml human recombinant IFN-alpha2b . Total cellular RNA was extracted from PBMC using Trizol  and reverse-transcribed by TaqMan Reverse Transcription Reagent kit  before and after treatment with IFN-alpha. The quantification of IFNAR-1 mRNA was performed by real-time RT-PCR; the results were normalized using beta-actin as housekeeping gene, and the results were expressed as ratio of IFNAR-1/beta-actin mRNA copy number, as previously described PBMC obtained by Ficoll/hyPaque  separation, frozen under liquid nitrogen, were thawed, suspended at 2\u00d710Basal mRNA levels for IFN-lambda were measured in freshly thawed PBMC by quantitative Real-time RT-PCR, according to a previously described method Plasma levels of IFN-lambda protein were measured by enzyme-linked immunosorbent assay (ELISA) namely DuoSet human IFN-lambda 1/3, measuring all isotypes of Hu-IFN-lambda , purchased from R&D System, Inc, Minneapolis, MN, USA. Result were expressed as pg/ml.PBMC from healthy donors carrying different IL-28B genotypes were exposed either to 10 ng/ml or 100 ng/ml human recombinant IL-28/IFN-lambda2  for different time points. Total cellular RNA was extracted by Trizol and IFNAR-1 mRNA levels were measured by real-time PCR as described above.Statistical analyses were performed by Prism 4 software . Differences were evaluated by the non parametric Mann-Whitney U test or by Student's t test, as appropriate. Correlations were analyzed by Pearson r test. Differences with p<0.05 were considered statistically significant.3 IU/ml) in PBMC obtained from naive HCV-infected patients carrying different IL-28B rs12979860 genotypes. Patients carrying CC genotype showed IFNAR-1 mRNA median basal levels significantly higher than patients with CT/TT genotype: 1.420 (IQR: 0.875\u20131.655) vs 0.629 (IQR: 0.504\u20131.005); p\u200a=\u200a0.0142; in addition, significantly higher levels in CC vs CT/TT genotypes was observed after exposure to IFN-alpha . More in detail, the most prominent difference was observed between CC and TT groups, both at basal level . However, a significant correlation between mRNA levels of IFN-lambda and IFNAR-1 was observed in CC carriers .To evaluate the possible role of IFN-lambda on IFNAR-1 mRNA expression, PBMC from 6 healthy donors carrying different IL-28B genotypes  were exposed either to 10 or 100 ng/ml of human recombinant IL-28/IFN-lambda2, and levels of IFNAR-1 mRNA were measured at different time points. The basal levels of IFNAR-1 mRNA in healthy donors were significantly higher than those observed in HCV patients , and seemed to be independent from IL-28B genotype. The dose dependent response after 3 h exposure to IFN-lambda is shown in In , we explored the possible relationships between IL-28 rs12979860 genotype and the expression of IFNAR-1 in naive HCV patients.Since 2009, several studies have shown that there is an important association between IL-28B polymorphisms and the outcome of standard anti-HCV therapy Our results highlighted a significant difference of IFNAR-1 mRNA expression in PBMC from patients carrying rs12979860 CC and CT/TT genotypes, with the most prominent difference in the absence of -C allele. It is to be underlined that the IFN-alpha treatment did not significantly affect the levels of IFNAR-1 mRNA, suggesting a marginal role of this cytokine in the observed differences. A significant correlation between endogenous levels of circulating IFN-lambda and spontaneous levels of IFNAR-1 mRNA in PBMC was observed in patients carrying CC genotype, although no differences of IFN-lambda levels could be appreciated between the different genotypes. The lack of detectable difference is probably due to the chronic infection state of our patients, where the reduced levels of circulating IFN-lambda might have hampered the comparison. This is in line with other groups that described lower levels of circulating IFN-lambda in HCV chronically infected patients as compared to spontaneously resolved infections Our findings suggest that IFN-lambda could play a crucial role in the modulation of IFNAR-1 expression, and that endogenous levels of IL-28B may be responsible for partial restoration of IFNAR-1 expression in HCV patients with favourable IL-28B genotypes. A number of published studies, show that the mRNA levels of IFNAR-1 are correlated with the extent of IFN response both in vivo and in vitro In summary, although the findings from the present study are preliminary, since they derive from a limited number of patients and might benefit from larger studies, they provide novel information, contributing to elucidate the mechanisms underlying the strong predictive value of IL-28B polymorphisms on the natural history and on the response to IFN therapy in HCV infection."}
+{"text": "An association between the metabolic syndrome and reduced testosterone levels has been identified, and a specific inverse relationship between insulin and testosterone levels suggests that an important metabolic crosstalk exists between these two hormonal axes; however, the mechanisms by which insulin and androgens may be reciprocally regulated are not well described. Androgen-dependant gene pathways regulate the growth and maintenance of both normal and malignant prostate tissue, and androgen-deprivation therapy (ADT) in patients exploits this dependence when used to treat recurrent and metastatic prostate cancer resulting in tumour regression. A major systemic side effect of ADT includes induction of key features of the metabolic syndrome and the consistent feature of hyperinsulinaemia. Recent studies have specifically identified a correlation between elevated insulin and high-grade PCa and more rapid progression to castrate resistant disease. This paper examines the relationship between insulin and androgens in the context of prostate cancer progression. Prostate cancer patients present a promising cohort for the exploration of insulin stabilising agents as adjunct treatments for hormone deprivation or enhancers of chemosensitivity for treatment of advanced prostate cancer. The metabolic syndrome describes a cluster of comorbidities including abdominal obesity, elevated blood glucose, high cholesterol, and hypertension, which increase the risk of developing diabetes and cardiovascular disease . Many ofEpidemiological studies have also shown that patients with existing obesity are more likely to be diagnosed with higher-grade cancers and higher Gleason scores, have a higher rate of positive surgical margins at radical prostatectomy, and suffer a higher incidence of prostate cancer recurrence and higher risk of dying of prostate cancer than men with a healthy body mass index (BMI) \u20139. A numde novo synthesis of free fatty acids have been shown to promote prostate cancer cell survival [Dyslipidaemia associated with the metabolic syndrome, including increased triglycerides and LDL and decreased HDL, is also associated with increased prostate cancer risk \u201313, and survival , 16, butsurvival , 18.The metabolic syndrome is associated with altered hormonal profiles for testosterone, insulin, IGFs, and oestrogen, all of which are linked to prostate cancer \u201322. An aProstate cancer (PCa) is the most commonly diagnosed lethal cancer in men accounting for approximately one-third of all cancers with a relative lifetime risk of 1 in 7. Its incidence continues to rise with an ageing population, and despite improved survival rates, it remains the second leading cause of cancer deaths in western men , 31. In de novo [Most patients initially respond to ADT; however, after a median 18\u201336 months patients recur with rising PSA levels despite castrate androgen levels in the serum. This is termed castrate-resistant prostate cancer (CRPC) and leads to significant comorbidities and inevitable mortality , 34\u201336. de novo , 40, 41 de novo steroidogenesis in prostate tumours as a mechanism driving CRPC has played a significant part in rationalising the newly approved steroidogenic CYP17A1 inhibitor, abiraterone, which is showing great clinical promise for improved control of CRPC [Current standard cytotoxic chemotherapies have shown limited benefit for the treatment of CRPC, with modest survival benefits of 2\u20135 months with docetaxel (Taxotere or cabazitaxel) . The dis of CRPC , 44. How of CRPC .What is striking in patients undergoing ADT is the rapid onset of several key features of the metabolic syndrome in men with no preexisting metabolic dysfunction.While ADT is initially an effective treatment for prostate cancer for most patients, the systemic side effects include key features of the metabolic syndrome. Patients typically experience a loss of muscle mass, increased fat mass, and the development of central adiposity, hyperlipidaemia, increased risk of cardiovascular mortality, hyperglycaemia, and the consistent feature of hyperinsulinaemia \u201348. ThesWhile we have just discussed the increased insulin resistance and hyperinsulinaemia which result from pharmacological inhibition of testicular testosterone production, it is also true that pre-existing hyperinsulinaemia, such as that seen in type II diabetes, is associated with reduced testosterone levels. The inverse relationship between testosterone and insulin in males without cancer has been well documented; yet the mechanisms linking these two hormonal pathways remain poorly understood , 55, 56.Reduced levels of free and total testosterone have been associated with type 2 diabetes (T2DM), central adiposity, dyslipidaemia, and hyperinsulinaemia in various studies , 57\u201361, Several mechanisms have been proposed which may contribute to reduced testosterone/insulin resistance in these cohorts. Testosterone can be converted to oestradiol through the irreversible action of aromatase in adipose tissue. Excess adipose tissue in obesity may increase the rate of conversion of testosterone to oestradiol, a more potent inhibitor of LHRH secretion from the hypothalamus. Studies investigating the levels of oestradiol in these patients, however, show mixed results. Decreased testosterone is coupled with increased oestradiol in some studies , 66 whilLHRH and LH secretion is suppressed in animal models by increased circulating cytokines which are elevated in obesity , 70. RelA recently published paper by Rubinow et al. manipulated testosterone levels in young\u2013middle-aged healthy men, excluding patients with confounding underlying conditions such as prostate cancer, diabetes, and hypogonadism . Groups These observations provide strong evidence for an important functional role for hyperinsulinaemia in PCa progression and CRPC following androgen deprivation. Major findings from recent studies , 80 of m50 values, calculated for each ligand and each receptor, reveal that IGF-1 can bind the INSR-A with ~2.5% the efficiency of insulin and with even weaker affinity to INSR-B. Likewise, insulin, at physiological levels, will not activate the IGF-1R [Traditionally insulin has been primarily considered a hormone essential for metabolic regulation; however, insulin can also activate lipogenesis, steroidogenesis, protein synthesis and antiapoptotic survival pathways in many cell types , 82. Inse IGF-1R . In conte IGF-1R .While the role of IGF-1 in cancer has been recognised for over 20 years, the presence of the INSR directly on prostate tumour tissue has only recently been reported and show that increased INSR expression correlates with increasing Gleason grade and CRPC  providin\u03b3 coactivator 1\u03b1 (PGC1\u03b1) which stimulates mitochondrial biogenesis and increases the oxidative potential of skeletal muscle; decreased testosterone levels are associated with decreased PGC1\u03b1 levels and increased insulin resistance. The activation of PGC1\u03b1 presents a potential mechanism for cancer cell survival that may confer increased resistance to oxidative stress and cellular senescence by increasing oxidative phosphorylation in the tumour cell [The molecular bases for the inverse clinical observations between levels of insulin and testosterone are less well described. The androgen receptor is a member of the steroid hormone receptor family and classically controls transcription of androgen-regulated genes in a ligand-dependent manner; however, androgens can also elicit rapid signalling responses independent of the AR , 87. Andour cell , 92.Recent reports have identified previously unappreciated crosstalk in prostate cancer cells between the AR pathway and PI3K signalling pathway, the major signalling pathway activated downstream of the INSR \u201396. The Hyperinsulinaemia and increased insulin signalling in prostate tumour cells as a result of androgen deprivation are likely to activate survival pathways downstream of the insulin receptor which have the potential to contribute to progression to castrate resistance; thus, these candidate molecules downstream of insulin receptor signalling may have therapeutic utility in advanced prostate cancer.Diabetes has been shown to be associated with increased risk of several cancers including colon, pancreatic, and breast cancer . In contIn vitro studies of metformin also demonstrate an antitumoral effect in prostate cancer cells by blocking cell cycle progression and decreasing cyclin D1 protein levels resulting in reduced LNCaP xenograft tumour growth [Based on these results, targeting AMP-activated protein kinase (AMPK) has been proposed as a therapeutic strategy in cancer , 115. Rer growth . AMPK acr growth .Activation of AMPK modulates insulin signalling downstream of the insulin receptor , most noRecent data suggests that AMPK activation may have more complex regulation in prostate cancer cells and may potentiate increased prostate cancer cell proliferation and migration when activated downstream of the androgen receptor (AR) , 123. UsIn studies where metformin activation of AMPK results in cessation of cancer cell growth, signalling is thought be through LKB-1 tumour suppressor ; therefoReactivation of the AR following ADT, heralded by rising serum PSA, is a hallmark of CRPC progression. We and others have demonstrated in recent years that intratumoral androgen synthesis is a major contributor to reactivation of AR in CRPC , 132. Mode novo steroid synthesis, insulin is capable of driving numerous transcriptional programs predominantly downstream of PI3K/AKT signalling. Pathways activated in response to cell stress  are associated with increased cancer cell survival, via both pro-proliferative and antiapoptotic mechanisms and underpin treatment resistance [In addition to activation of sistance \u2013140. Many of these pathways are modulated by highly conserved signalling molecules including insulin, target of rapamycin (mTOR) and AMP-activated protein kinase (AMPK), each of which maintain cellular homeostasis by sensing/signalling nutrient, energy, and oxygen availability. These molecules integrate cellular energy and metabolism with stress response pathways leading to cancer cell survival. More recently, the insulin-sensitising class of drugs, thiazolidinediones, has also been associated with improved survival of diabetic prostate cancer patients  revealinProstate cancer is the most common cancer in men , increasStandard chemotherapeutic agents have limited benefit in CRPC and while next-generation anti-androgen therapies are improving, they still result in resistance, highlighting the urgent need to understand mechanisms underlying treatment resistance and find rationally informed treatment options. Currently, ADT-induced hyperinsulinaemia is not addressed in prostate cancer patients, despite a significantly increased risk of cardiovascular and cancer-related mortality in these patients ; however"}
+{"text": "Obesity and type 2 diabetes are recognised risk factors for the development of some cancers and, increasingly, predict more aggressive disease, treatment failure, and cancer-specific mortality. Many factors may contribute to this clinical observation. Hyperinsulinaemia, dyslipidaemia, hypoxia, ER stress, and inflammation associated with expanded adipose tissue are thought to be among the main culprits driving malignant growth and cancer advancement. This observation has led to the proposal of the potential utility of \u201cold players\u201d for the treatment of type 2 diabetes and metabolic syndrome as new cancer adjuvant therapeutics. Androgen-regulated pathways drive proliferation, differentiation, and survival of benign and malignant prostate tissue. Androgen deprivation therapy (ADT) exploits this dependence to systemically treat advanced prostate cancer resulting in anticancer response and improvement of cancer symptoms. However, the initial therapeutic response from ADT eventually progresses to castrate resistant prostate cancer (CRPC) which is currently incurable. ADT rapidly induces hyperinsulinaemia which is associated with more rapid treatment failure. We discuss current observations of cancer in the context of obesity, diabetes, and insulin-lowering medication. We provide an update on current treatments for advanced prostate cancer and discuss whether metabolic dysfunction, developed during ADT, provides a unique therapeutic window for rapid translation of insulin-sensitising medication as combination therapy with antiandrogen targeting agents for the management of advanced prostate cancer. Retrospective observational studies and meta-analyses, using body mass index /height , or a ssing BMI . These dsing BMI . Also, tsing BMI . Adding sing BMI , have besing BMI . Notwithsing BMI  has founWhat is indisputable from the epidemiology is the impact of obesity on cancer behaviour. Obesity is consistently identified as a significant risk factor for more aggressive disease and an independent predictor of recurrence and cancer-specific mortality for breast , endomet\u03b1, and MCP1, from both adipocytes and resident immune cells. These, in turn, act as chemoattractants for further immune cells and thus create a feed-forward loop, perpetuating immune cell infiltration and cytokine production. Cell signalling is impacted, particularly insulin signalling in local and peripheral tissue  leading to systemic insulin resistance [The molecular link(s) between obesity and malignancy is the subject of current research and has been recently reviewed \u201321. Obessistance  and sustDysregulated lipid flux in obesity results in decreased HDL cholesterol and elevated LDL, circulating levels of triglycerides and free fatty acids which have been shown to promote prostate cancer cell survival , 25. Infin vitro cell proliferation and invasion [Altered hormonal profiles are also a hallmark of metabolic dysfunction with modulated adipokine production and secretion, including increased leptin, proportional to adipose mass, while adiponectin shows an inverse relationship . Elevateinvasion , 29, as invasion  includinHowever, it is hyperinsulinaemia, as a result of insulin resistance in classical metabolic tissues, which has been identified as a highly significant risk factor to progression of prostate and other cancers . In prosTogether, the altered hormonal and inflammatory milieu of obesity may contribute significantly to cancer growth and progression via promoting mitogenesis , angiogenesis , and invasion  .\u03b2-cells are unable to respond adequately to increased insulin required to maintain normoglycaemia. Diabetes has been independently associated with increased risk of several cancers including colon, pancreatic, and breast cancer [per se and prostate cancer, metabolic risk factors associated with T2DM with potential links to cancer, such as hyperinsulinaemia and inflammation, are likely to lose statistical impact by combining diabetic subtypes; the rate of obesity in T2DM is 52% (86% overweight), compared to 16% in type I diabetes (55.3% overweight), and, as such, the metabolic contribution to malignancy, described above, would be expected to have significantly different impact [loss of insulin and use of exogenous insulin analogues whereas T2DM is treated with a range of medications including metformin, sulphonylureas, and insulin which vary in cancer risk profiles [Obesity is a major risk factor for the development of T2DM, a condition defined by hyperglycaemia in a background of insulin resistance in metabolic organs . Diabetes generally develops as pancreatic t cancer , 44. In t cancer \u201347, perht cancer \u201348. Howet cancer , 49. Altt cancer , suggestt cancer , 49, 51.profiles \u201355, someprofiles , 53. Ind\u03b2-cells) [in vitro evidence is beginning to provide mechanistic detail to these observations. The observation of increased cancer risk with obesity and diabetes has led to the somewhat more hopeful speculation of potential therapeutic benefit of insulin-sensitizing drugs with the major clinical outcome of lowering systemic insulin levels. Studies have shown some cancer survival benefit in type 2 diabetes patients treated with the biguanide and metformin compared to those treated with insulin or sulphonylureas (stimulate insulin secretion from pancreatic \u03b2-cells) , 56\u201358. \u03b2-cells) , the lip\u03b2-cells) , 61 haveMetformin, which works in part by activating AMP-activated protein kinase (AMPK), is used clinically in obese and diabetic patients to normalise circulating insulin levels primarily via reduced hepatic glucose output and improve insulin/receptor interactions. Recent clinical studies have suggested that metformin may improve patient outcomes in prostate and other cancers , 62\u201364. Apart from normalising systemic insulin, the intracellular effects of metformin in tumour cells have been the subject of recent study and review . Metform\u03b2-oxidation). Thus, metformin effectively blocks lipogenesis by inhibiting activation or expression of lipid biosynthesis enzymes such as acetyl Co-A carboxylase (ACC) and fatty acid synthase (FASN), key regulators of the metabolic reprogramming identified in prostate cancer [The activation of AMPK in cancer cells blocks cell proliferation by negatively regulating mammalian target of rapamycin (mTOR) control of protein synthesis , 65\u201367. e cancer . Likewise cancer . Another proposed mechanism of metformin is preventing pathways which lead to invasion and metastasis evidenced by the demonstration of metformin to prevent invasiveness in cancer models , 73. Simin vitro and in vivo growth of the prostate cancer cell line PC3 and to induce apoptosis. [The pancreatic lipase inhibitor, orlistat, has its primary effect on reducing hydrolysis of triglycerides and preventing the absorption of dietary free fatty acids. Its major clinical benefit in obesity is preventing caloric intake, thus, reducing circulating lipid levels and improving insulin sensitivity . FASN exoptosis. . The inhoptosis.  and has optosis. , 84. Statins lower cholesterol levels by inhibiting a critical enzyme for cholesterol synthesis, HMGCoA reductase (HMGCR), which is upregulated in CaP and breast cancer tissue . The rol\u03b3, highly expressed in prostate cells [in vitro and in vivo cell growth via ERK-dependent regulation of p21 and cMyc [\u03b3 resulted in the dysregulation of cell cycle control and lipid signalling networks [\u03b3-independent mechanisms [\u03b3-dependent (rosiglitazone) and -independent (ciglitazone) mechanisms [Thiazolidinediones (TZDs) are a class of insulin-lowering (insulin-sensitising) drugs which activate the PPAR family of nuclear receptors, with predominant affinity for PPARte cells . Severalte cells . A largete cells  found a te cells . In prosand cMyc  and induand cMyc . Prostatnetworks . In ovarchanisms , 97. In chanisms . Studieschanisms . Taken tThe efficacy of insulin-lowering therapies in reducing risk and progression of cancer is highlighted by the converse, that is, increased risk of cancer in diabetic patients treated with insulin analogues. These include fast-acting analogues such as Aspart and Lispro with similar INSR but reduced IGF1R-binding affinities compared to native insulin , and GlaAt current rates, prostate cancer will affect one man in seven and is the leading cause of cancer deaths in men in western countries . For rapde novo intratumoural androgen synthesis are upregulated in prostate cancer cells [de novo steroid synthesis. While chemotherapies such as docetaxel , 109 ander cells , 127. ThA tranche of new-generation antiandrogens have recently emerged from preliminary clinical trials with promising results; MDV3100 (Medivation Inc.), a small molecule AR antagonist, has recently been FDA approved for secondary hormone treatment for CRPC under the trade name of Enzalutamide. MDV3100 binding the AR blocks ligand binding, impairs nuclear translocation of the receptor, and induces a conformational change that prevents AR transcription and cofactor recruitment . MDV3100\u03b2-hydroxysteroid dehydrogenase (17BHSD) and then to DHT via RDH5. Currently, both ketoconazole . DHEA and androstenedione are then converted to testosterone via 17-in vivo xenograft tumours [Improved, specific CYP17A1 inhibitors such as abiraterone (Janssen) FDA, TAK-700 , and TOK-001  are now in various stages of clinical assessment for adjuvant use with LHRH agonists. abiraterone, unlike previous CYP17 inhibitors, has a 3-pyridyl substitute and 16,17 double bond, which makes it a highly specific, potent, and irreversible inhibitor of both the hydroxylase and lyase activity of CYP17A1 \u2013133. abi tumours . While much progress has been made in the emergence of new drugs suppressing AR activity in prostate cancer, the unfortunate reality is that, even in these early trials, patients have become resistant to these new therapies . Both abMetabolic dysfunction is a well-established side effect of ADT , 139. Th, insulin-signalling pathways) [\u03b2, may also influence prostate cancer cell proliferation [Traditionally, insulin has been considered a hormone-controlling metabolic regulation; however, the pathways activated by insulin, including phosphatidylinositol 3-kinase (PI3K)/Akt and Ras/MAPK pathways, have many well-characterised downstream effects relevant to CRPC progression, including the inhibition of apoptosis  , 153 andathways) , 154. Hyathways)   , a majorathways) , 157. Reathways) \u2013160, andathways) , 162. Noathways) \u2013165. Morathways)  suggestiathways) . Potentiathways) \u2013171 emphathways)  resultinferation \u2013175. Epidemiological evidence, coupled with the upregulation of insulin-signalling components and insulin-mediated upregulation of CRPC pathways in prostate cancer cells, has collectively rationalised a multidisciplinary approach to treating advanced prostate cancer that incorporates antiandrogen therapy with simultaneous treatment of metabolic side effects induced by ADT. de novo steroid synthesis in prostate cancer cells suggests that drugs targeting steroidogenesis in combination with insulin-lowering therapies would be beneficial; trials combining abiraterone and metformin are yet to commence (NCT01677897). Metformin has been the first drug to be explored in this area, with ongoing clinical trials using metformin during active surveillance (NCT01733836) and in combination with ADT (NCT01620593) testing the efficacy of metformin in stabilising/normalising circulating insulin levels. Metformin has a well-characterised safety profile and, while it effectively decreases hyperglycaemia, does not affect blood glucose levels in nondiabetic patients. Metformin may also act directly on tumour cells to reduce cancer cell proliferation via the inhibition of anabolic pathways such as lipogenesis starving the major bioenergetic pathway in prostate cancer cells. However, the ability of the major intracellular target of metformin, AMPK, to potentiate insulin action on cell growth and survival may have more complex regulation in prostate cancer cells via interaction with AR-regulated genes; activated AMPK may potentiate increased prostate cancer cell proliferation and migration when activated downstream of the androgen receptor (AR) , 177 undAtorvastatin (statin) is also currently under examination for treatment in prostate cancer in combination with ADT (NCT01555632). Statins target cholesterol synthesis, the substrate for steroidogenesis and in adrenocortical cells and the ovaries, have been shown to decrease steroidogenic enzymes CYP11A1, HSD3B, and CYP17A1 . StatinsThe dual activity of orlistat, reducing dietary lipid absorption and as an inhibitor of FASN, could also have an adjunct role to play in mitigating the side effects of ADT which may promote cancer progression. orlistat could potentially be used to reduce systemic dyslipidaemia, normalising free fatty acid and cholesterol levels and thereby reducing substrate for tumour metabolism and biosynthesis. However, dietary fats make up only a fraction of the lipid available to prostate cancer cells, which almost universally upregulate FASN . Prostate cancer is the most common cancer in men  and, giv"}
+{"text": "The aim of this study is to systematically review relevant literature. About 218,000 men are estimated to be newly diagnosed with prostate cancer every year in the United States. Approximately 10% of them are still found with metastasis, and in addition to them, about 30% of patients with nonmetastatic prostate cancer recently experience ADT. Population-based studies have shown that dissimilar to other malignancies, type 2 diabetes is associated with a lower incidence of prostate cancer, whereas recent large cohort studies have reported the association of diabetes with advanced high-grade prostate cancer. Although the reason for the lower prevalence of prostate cancer among diabetic men remains unknown, the lower serum testosterone and PSA levels in them can account for the increased risk of advanced disease at diagnosis. Meanwhile, insulin resistance already appears in 25\u201360% of the patients 3 months after the introduction of ADT, and long-term ADT leads to a higher incidence of diabetes (reported hazard ratio of 1.28\u20131.44). Although the possible relevance of cytokines such as Il-6 and TNF- Prostate cancer and the hormonal therapy thereof  have been associated with diabetes in terms of diabetes-associated carcinogenesis  and ADT-PubMed and MEDLINE searches were performed for articles published between January 1991 and November 2011 based on the following key words for diabetes-associated prostate carcinogenesis: prostate cancer AND insulin resistance, hyperglycemia, cancer risk, and diabetes. Literature on ADT-related diabetes was searched using the following keywords: androgen deprivation therapy OR hormone therapy AND diabetes, insulin resistance, hyperglycemia, and metabolic syndrome. Relevant articles on growth hormone (GH)/insulin-like growth factor (IGF)-1 and androgen metabolism were searched with similar strategy. Except for studies concerning statistics, meta-analysis, or reanalysis, review articles were excluded. All full papers based on evidence level 1 and 2 and full papers on level 3 supporting them were downloaded via the library of our institution, provided from other institutions, or purchased, and relevant articles on experimental studies were obtained by similar methods.Prostate cancer is a common malignancy around the world, and in the United States, about 218,000 and 32,000 men are estimated to be newly diagnosed with and to die of prostate cancer every year, respectively . Additio\u03b1) leading to cancer cell survival; they produce a complex network with many-to-many correspondence [P = 0.07) [P = 0.04). It is suggested that the study design and cohort in the study by Moses et al. mainly comprising men with elevated PSA on prostate cancer screening possibly involves different patients' background.Large cohort studies have shown that diabetes is associated with a higher incidence of many malignancies including lung, gastric, colorectal, liver, and pancreatic cancer , 8. Sevepondence , 10. Conpondence , and a spondence . Most repondence . These r = 0.07) . In theiP < 0.001 and 1.56 (1.19\u20132.04) P = 0.0013, respectively [It is known from the results of recent population-based cohort studies that men with type 2 diabetes show lower PSA levels than those without diabetes \u201316. Consectively . HoweverThe relevance of lower PSA levels to the reduced risk of prostate cancer in men with diabetes is thus equivocal, but men with diabetes potentially have more advanced disease at diagnosis where their PSA level reaches a certain cut-off/threshold. Correspondingly, two recent large cohort studies reported the association of diabetes with high/poor-risk disease: more advanced clinical stage and higher Gleason sore . In a coin vivo is involved in high Gleason score [P = 0.001). In men with predominant Gleason pattern 4, interestingly, the diabetes history was noted more frequently . Accordingly, diabetes is involved in the incidence of high-grade/advanced prostate cancer most probably via the acquisition of more malignant potential under low-testosterone environment.Accordingly, diabetes is associated with a lower PSA level in the general population and a higher incidence of poor-risk prostate cancer in the screening-based cohort or regional cancer registration. The latter can be explained by the frequent reduced testosterone levels in men with increased insulin resistance or type 2 diabetes  and is con score \u201325, advaon score , and a pon score , 28. Allon score . They peMeanwhile, the mechanism of lower PSA levels in diabetic men is hard to explain; it is still unclear why diabetes is associated with lower PSA levels. As described elsewhere, serum testosterone levels in men with type 2 diabetes are likely to be lower . Yet, thP = 0.03). In another case-control study by Chen et al. with 174 men in each of the case and control groups, insulin levels had no impact on the risk of incident prostate cancer [P = 0.023), although the study included a small number of prostate cancer patients (n = 44) and hazard ratio for the insulin level was unclear [P = 0.02) [Another interest is whether a higher insulin level is associated with a higher incidence of prostate cancer. Stocks and colleagues prospectively performed conditional logistic regression analyses on 392 prostate cancer patients and 392 matched controls . In theie cancer . In cont unclear . These v = 0.02) . Another = 0.02) .In etiological approaches, the regulation and metabolism of insulin and IGF-1 are correlated, sharing homologous molecular structures , while mde novo steroidogenesis promoted by insulin in prostate cancer; Lubik et al. showed that transcription of androgen-metabolic enzymes such as CYP17A1 and 5-\u03b1-reductase were upregulated by insulin in a dose-dependent manner in prostate cancer cells LNCaP and 22RV1, which express androgen receptor [P < 0.05 in both) with PSA secretion increased significantly. These results suggest that insulin may directly promote proliferation of prostate cancer cells. However, these observations are based on an experimental model for castration-resistant prostate cancer, and studies to examine the effect of insulin on prostate tumorigenesis during its early phase or in hormone-na\u00efve cancer are needed.Most recently, an experimental study reported intracellular receptor . In theiThus, the relationship among insulin resistance, testosterone milieu, PSA level, incidence of prostate cancer, and its malignant potential in men with diabetes has not been fully elucidated, and remains a matter of concern for the regulation of prostate carcinogenesis as well as advances in management of prostate cancer in the general population. Further studies are required in both experimental and clinical approaches.Both benign and malignant prostatic epithelial cells are well known to receive proliferative stimuli from androgens and to have androgen-dependent bioactivities, and ADT has been the therapeutic mainstay for men with metastasis or recurrent disease following definitive local therapy, although the treatment effect is palliative in most of the former . ADT is It is estimated that the 5-year disease-specific survival for men with prostate cancer reaches 98% , 6. In pAs discussed elsewhere, reduced testosterone levels are associated with insulin resistance and type 2 diabetes in the general population . InsulinP < 0.001) in men treated with GnRH agonists. The same authors most recently performed another large population-based study and reported an increased risk of incident diabetes in men undergoing ADT with GnRH agonists  [P < 0.001) [n = 1,231) were diagnosed with diabetes 12 months after ADT, while 6.99% of those without ADT  (P = 0.02) [Keating et al. used Surveillance, Epidemiology, and End Results (SEER) Medicare data; the study cohort comprised 73,196 men with localized prostate cancer . Among t< 0.001) . Another = 0.02) . Thus, tn = 20) had a reduction in abdominal girth (P = 0.05), weight (P < 0.001), and body mass index (P < 0.001) compared to controls (n = 20). Although the study was designed in a small pilot volume, changes in biochemical markers of insulin resistance did not differ between the two arms during the study. Lebret and colleagues examined the utility of an educational tool-kit consisting of information brochure concerning adverse effects of ADT, practical guidance on lifestyle, recipe booklet for ADT-adapted diet, and lifestyle diary to record and evaluate the life style and body measurement [On the other hand, a few trials examined the effect of exercise, diet, and supportive agents/supplements in men during ADT. Nobes et al. reported the efficacy of a low glycemic index diet, exercise program, and metformin (850\u2009mg daily to 850\u2009mg twice daily) in men treated with GnRH agonist (6-month ADT) in a prospective randomized study . The intsurement . They re\u03b1 secreted by macrophages and monocytes in response to infection play a critical role in immunity. Type 2 diabetes has been involved in innate immune system disorder with chronic low-grade inflammation [\u03b1 and IL-6 in patients with elevated fasting blood glucose are independent values predictive of development of diabetes, thereby adipose tissue being the major source of these cytokines [\u03b1 levels to insulin resistance and diabetes has been shown accordingly.The etiology of ADT-related diabetes is poorly understood. As mentioned above, increased fasting insulin levels are observed early after the initiation of ADT, suggesting possible primary responses to altered hormonal milieu. Additionally, recent studies showed that 6-month ADT with combined GnRH agonist and antiandrogens is associated with an about 10% increase of serum IGF-1 \u201361. Althammation , 63, andytokines , 65. Rel\u03b1 in human monocyte-derived macrophages of premenopausal women [in vitro study showed inhibition of IL-6 mRNA transcription and TNF release by dihydrotestosterone [P = 0.0001) and adiponectin levels , its effect on the TNF-\u03b1, IL-6 or CRP level was not significant [Besides, sex steroids such as 17beta-estradiol (estradiol) and testosterone have been suggested to play a role in modulating inflammation, although relevant studies are limited. A previous study showed that estradiol withdrawal brought about greater expressions of proinflammatory cytokines represented by IL-6 and TNF-al women . Concernosterone . Some clnificant ; the smaP = 0.07 and 0.04, resp.). Thereby, TNF-\u03b1 and CRP of the testosterone-treated group declined 30 weeks after treatment compared to those at baseline ; however, IL-6 levels were equivalent between before and after treatment (1.1\u2009ng/l versus 1.1\u2009ng/l). Additionally, subcutaneous abdominal fat has been shown to be an important index reflecting insulin resistance and relevant inflammation. A recent study focused on increased HOMA-IR  and subcutaneous abdominal fat area 240.7 \u00b1 107.5 to 271.3 \u00b1 92.8\u2009cm2, P < 0.01) [Most recently, Kalinchenko and associates studied the effect of testosterone replacement on diabetic and inflammatory markers in 184 men with metabolic syndrome and hypogonadism in a randomized, placebo-controlled, double-blinded setting . In the  < 0.01) , while aP = 0.009) and dihydrotestosterone  concentrations, but not correlated with adrenal androgen or estradiol levels. After ADT, in contrast to the pretreatment relationship, interleukin-6 levels were positively correlated with total-testosterone concentrations , and were positively correlated also with levels of androstenedione  and estradiol , suggesting a coordinated regulation emerging between proinflammatory cytokines and sex steroids during ADT. Although the study focusing on ADT-related body composition change concluded the unchanged IL-6 level despite increased %body fat, the alteration of hormonal milieu produced by ADT can theoretically have an influence on the association of proinflammatory cytokines with metabolic activities including insulin sensitivity. However, it remains unclear whether such altered association between sex steroids and proinflammatory cytokines is the primary action with insulin resistance or secondary reaction to reduced testosterone levels, and further studies are warranted to elucidate the mechanism of ADT-related diabetes and to overcome this important adverse effect brought about by ADT.Regarding the effect of ADT on circulating proinflammatory cytokines, the relevant study has barely been presented. A recent study prospectively examined the relationship between these cytokines and sex steroid levels in the serum in 72 men with localized prostate cancer, who received ADT with GnRH agonists [Diabetes is associated with a lower PSA level in the general population and a higher incidence of advanced prostate cancer in the prostate cancer registration-based cohort. Although the mechanism of the former association is unknown, the latter can be explained by reduced testosterone levels in men with increased insulin resistance or type 2 diabetes. Insulin resistance is frequently observed early after the introduction of ADT, and long-term ADT links to the increased risk of development of diabetes. However, the mechanism of ADT-related diabetes remains unclear; a regulatory relationship between proinflammatory cytokines and sex steroids is possibly involved in ADT-related diabetes."}
+{"text": "DHX9 in the more sensitive SK-N-MC cells, which is targeted to nonsense-mediated decay (NMD), causing its downregulation. DHX9 protein forms a complex with RNA polymerase II (RNAPII) and EWS-FLI1 to enhance transcription. Silencing of DHX9 in ES cells sensitizes them to UV treatment and impairs recruitment of EWS-FLI1 to target genes, whereas DHX9 overexpression protects ES cells from genotoxic stress. Mechanistically, we found that UV light irradiation leads to enhanced phosphorylation and decreased processivity of RNAPII in SK-N-MC cells, which in turn causes inclusion of DHX9 exon 6A. A similar effect on DHX9 splicing was also elicited by treatment with the chemotherapeutic drug etoposide, indicating a more general mechanism of regulation in response to DNA damage. Our data identify a new NMD-linked splicing event in DHX9 with impact on EWS-FLI1 oncogenic activity and ES cell viability.Alternative splicing plays a key role in the DNA damage response and in cancer. Ewing Sarcomas (ES) are aggressive tumors caused by different chromosomal translocations that yield in-frame fusion proteins driving transformation. RNA profiling reveals genes differentially regulated by UV light irradiation in two ES cell lines exhibiting different sensitivity to genotoxic stress. In particular, irradiation induces a new isoform of the RNA helicase  Ewing Sarcomas (ES) are aggressive tumors of bone and soft tissues. They are caused by different chromosomal translocations that yield in-frame fusion proteins comprising the amino terminus of the EWS protein fused to the carboxyl terminus of various ETS transcription factors . These cCHEK2, ABL1 and MDM2  generating the oncogenic fusion protein EWS/FLI-1 type 1 and 2 . LAP-35 s Figure , 1B, alts Figure , 1B. Upod Figure , 1B.2. SK-N-MC cell proliferation was strongly reduced by UV treatment, while the effect on LAP-35 was milder  was hybridized to splicing sensitive microarrays featuring 1804 AS events in 482 genes encoding proteins with functions related to RNA processing and cancer [p value < 0,01; Figure CD82, TRIB3, YWHAH, AFF2) and 3 genes in LAP-35 cells  were upregulated (To investigate whether different changes in gene expression (GE) could account for the different sensitivity of ES cells to UV light, we performed high-throughput analyses. RNA obtained from three biological replicas of SK-N-MC and LAP-35 cells treated with low doses of UV light  identified by microarrays were validated . Furthermore, we identified 18 AS events affected by UV light irradiation independently from the cellular context . Notably, SK-N-MC cells are more responsive to UV light irradiation than other cell lines, at both GE level (102 genes affected versus 46 in LAP-35 and 66 in HEP3B) and AS level , using oligonucleotides covering both exons and exon-exon junctions, of all 8 randomly selected AS changes , which should lead to NMD of this new transcript (NR_033302), thus possibly contributing to the decrease in the pool of , Figure \u20132G, an e1 Figure , a knownDHX9 transcript, which returned to basal levels within 30 minutes from the block of transcription  after treatment. Western blot analyses revealed that full length DHX9 protein is stable in the first 6 hours of cycloheximide treatment, whereas its expression levels are halved by 24 hours of treatment  and S4C. hours afDHX9 exon 6A displays a low score for the 5\u2032splice site  if compared with the constitutive downstream exon , rendering it relatively weak. Thus, we asked whether the differential regulation of DHX9 AS and expression by UV light in ES cells correlated with differential effects on RNAPII phosphorylation. Western blot analysis using an antibody against total RNAPII, which recognizes both RNAPIIO and RNAPIIA, showed that RNAPII is strongly downregulated in SK-N-MC cells after 3\u20136 hours from UV light treatment, whereas this effect was weaker and more transient in LAP-35 cells  in SK-N-MC cells. Although RNAPII binding to DHX9 gene was generally decreased by UV treatment, we observed a peak in occupancy near the alternative exon 6A after 6 hours of treatment  [DHX9 mRNA and protein in these cells  , 33 in ts Figure , 3H.DHX9 gene, contributing to down-regulation of its expression.These experiments argue that modulation of RNAPII processivity upon UV light irradiation in SK-N-MC cells promotes inclusion of exon 6A in the DHX9 downregulation. Cyclin D1 (CCND1), c-MYC, and DNA-binding protein inhibitor ID-2 (ID2) genes encode proteins strictly involved in cell proliferation and cancer development [ID2 expression is upregulated in ES cells as a result of both direct EWS-FLI1 binding to its promoter and increased c-MYC expression [ID2 expression (60% relative to untreated) upon UV irradiation in SK-N-MC cells, whereas the gene was unaffected in LAP-35 cells. Furthermore, c-MYC and CCND1 genes were downregulated at higher extent in SK-N-MC  than in LAP-35 cells  experiments in both SK-N-MC and LAP-35 cells. Recruitment of EWS-FLI1 to d Figure , even thd Figure . Accordid Figure .These results suggest that downregulation of DHX9 expression induced by UV light irradiation in SK-N-MC cells impairs recruitment of EWS-FLI1 on the promoters of its target genes.DHX9 expression in ES cells, we knocked down DHX9 in LAP-35 cells. Reduction of DHX9 expression was confirmed both at the RNA , CCND1 (46%) and c-MYC (40%) mRNA levels , 5-fluorouracile (5FU) and cisplatin (CIS). These drugs are widely used in chemotherapy for their antineoplastic properties . Etoposin Figure , thus den Figure \u20137G similDHX9 alternative splicing, RNAPII phosphorylation and SK-N-MC viability. Accordingly, etoposide treatment displayed a milder effect on LAP35 cells , thus targeting the corresponding transcript to NMD and contributing to DHX9 down-regulation. As a consequence, in response to UV light treatment, the DHX9 protein is diminished in SK-N-MC but not in LAP-35 cells  light and mouse embryonic fibroblasts fos\u2212/\u2212 are defective in the repair of UV-C induced DNA lesions [The functional interaction between EWS-FLI1 and DHX9 was previously shown to support anchorage-independent growth . In thisreatment . Althougreatment  and BRCAreatment , our res lesions .DHX9 splicing isoform induced by UV light treatment that leads to DHX9 down-regulation in ES cells. Since DHX9-EWS-FLI1 functional interaction represents a good opportunity for clinical intervention, our data indicate a novel strategy for targeting EWS-FLI1 oncogene activity through the modulation of DHX9 expression or activity. In this scenario, the development of antisense oligonucleotides recruiting the spliceosomal complex to the alternative exon 6A in DHX9 could be instrumental to drive DHX9 downregulation in ES cells and might provide a valuable additional therapy for the treatment of ES.ES tumors initially respond well to chemotherapy, but 40% of patients later develop recurrent disease and the majority of them die within 5 years, despite high-dose chemotherapy . Down-re2 atmosphere. For treatment, cells were plated at 50%\u201360% confluence 16 h before UV light irradiation (either 10 or 40 J/m2). Fresh medium was immediately added after the treatment and the cells were harvested at different times during the recovery, as indicated. For drug treatment, ES cells were treated 16 hours with DMSO or etoposide, 5-fluorouracile, and cisplatin at different concentration, as indicated.SK-N-MC and LAP-35 Ewing Sarcoma cells were a generous gift from Drs F. Moretti and K. Scotlandi, respectively. Both cell lines were cultured in IMDM medium supplemented with 10% fetal bovine serum, penicillin and streptomycin (Gibco), and maintained at 37\u00b0C in humidified 5% COIn situ hybridization kit plus). After hybridization, arrays were washed, and scanned images analyzed as previously described [RNA from three biological replicates of control or UV irradiated Ewing Sarcoma cells (either SK-N-MC or LAP-35) and HEP3B cells collected 6 hours after the treatment was purified using RNeasy Mini kit (Qiagen) and digested with DNase RNase free (Qiagen). cDNA and Cy5-Cy3 labelled cRNA were generated from the total RNA using the Agilent Low RNA Input Fluorescent Linear Amplification kit. 8 \u03bcg of each cRNA were used for the hybridization with the arrays  for alternative splicing changes. The data were deposited in GEO database with the accession number GSE59889.The cutoff considered was fold change >|1,3| for gene expression changes and fold change >|1,4|;  at final concentration of 100 nM using Lipofectamine RNAiMax reagent (Invitrogen) according to the manufacturer's instructions. The Total RNA was extracted by using TriPure Isolation Reagent (Roche) according to the manufacturer's instructions and subjected to DNase digestion (Roche). First-strand cDNA was obtained from 1 \u03bcg of RNA using random hexamer and M-MLV-Reverse Transcriptase . Synthesized cDNA corresponding to 25 ng total RNA was used for conventional- or quantitative-PCR , according to manufacturer's instructions. Primers used for RT-qPCR are listed in the 2, 30 mM Tris-HCl, pH 7.5, 10% glycerol, 1 mM dithiothreitol, 10 mM \u03b2-glycerophosphate, 0.5 mM Na3VO4, and protease inhibitor cocktail (Sigma-Aldrich) supplemented with 0.5% Triton X-100. The extracts were sonicated (1 sec at 30%), incubated on ice for 10 min. and then centrifuged for 10 min at 12,000 g at 4\u00b0C. Protein quantification was performed by Quick Start Bradford Protein Assay (Bio-Rad). Cell extracts were diluted in SDS sample buffer and boiled for 5 min. Proteins (10\u201350 \u03bcg) were separated on 6% or 10% SDS-PAGE gels and transferred to Hybond-P membranes . Membranes were saturated with 5% non-fat dry milk in phosphate-buffered saline (PBS) containing 0.1% Tween-20 for 1 h at room temperature, and incubated with the following antibodies and dilutions overnight at 4\u00b0C: anti-DHX9 1:200 , anti-FLI-1 1:200 (sc-356 Santa Cruz Biotechnology), anti-GAPDH 1:1000 (sc-32233 Santa Cruz Biotechnology), anti-RNAPII 1:250 , anti-\u03b2\u2013ACTIN 1:1000 , anti-ERK2 1:1000 (Santa Cruz Biotechnology), and phospho-CHK1 1:1000 , anti-UPF1 1:500 (Millipore). Secondary anti-mouse or anti-rabbit IgGs conjugated to horseradish peroxidase (Amersham) were incubated with the membranes for 1 h at room temperature at a 1:10000 dilution in PBS containing 0.1% Tween-20. Immunostained bands were detected by a chemiluminescent method (Santa Cruz Biotechnology). Densitometric analysis was performed by ImageJ software.Total protein extracts were prepared using lysis buffer -5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) method according to the manufacturer's instructions (Promega) by plating 5 \u00d7 108 SK-N-MC and LAP-35 cells were cross-linked with 1% (w/v) formaldehyde (Sigma Aldrich) for 15 min at room temperature, and then formaldehyde was inactivated by the addition of 125 mM glycine (Sigma Aldrich). Cells were washed in cold PBS and lysed to isolate nuclei in a hypotonic buffer containing 5 mM PIPES (pH 8.0), 85 mM KCl, NP40 0.5%, 1 mM dithiothreitol, 10 mM \u03b2-glycerophosphate, 0.5 mM Na3VO4, and protease inhibitor cocktail (Sigma-Aldrich). Isolated nuclei were lysed in a buffer containing 1% SDS, 10 mM EDTA, and 50 mM Tris-HCl (pH 8.0), 1 mM dithiothreitol, 10 mM \u03b2-glycerophosphate, 0.5 mM Na3VO4, and protease inhibitor cocktail (Sigma-Aldrich) and sonicated with Bioruptor (Dyagenode) 2 fold for 6 min (30 sec sonication and 30 sec pause). Chromatin extracts containing DNA fragments (100 \u03bcg/sample) with an average size of 200 bp were pre-cleared overnight and then immunoprecipitated for 3 hours using 2 \u03bcg of anti-FLI1  or anti-RNAPII  or anti RNAPII CTD repeat H14 and H5  antibodies and Protein A/G Agarose/Salmon Sperm DNA (Merck Millipore). Precipitated DNA was extracted and analyzed by qPCR using primers listed in 2 \u00d7 10Percentage of dead cells was determined by staining with propidium iodide (PI 1 \u03bcg/ml eBioscience) and acquisition was performed on flow cytometry . Analysis was performed using FlowJo software. In some experiments GFP positive population of SK-N-MC cells transfected with pEGFP and pEGFP-DHX9 constructs, was isolated using a MoFlo high speed cell sorter (Beckman Coulter).2) and incubated at 37\u00b0C in a humidified atmosphere containing 5% CO2 for 12 day, replacing medium every two days. At the end of the incubation period, cells were washed with PBS, fixed in methanol for 10 min at RT and stained 30 min at room temperature with 0.05% Crystal Violet in distilled water on a rotating shaker. After staining, cells were washed twice with tap water and air-dried overnight. The next day clones were counted.Cell suspensions were plated in 100-mm plates or 35-mm plates at a density of 2000 or 1000 cells/plate, respectively. After one day, cells were treated  and we found that the 5\u2032 Splice-Site Score For DHX9 exon 6A (AAG | GTCAGT) is: 5.9 while the score for the downstream constitutive exon (CAG | GTAAGT) is 12.4. Similar results were obtained using the MaxEntScan::score5ss matrix from the laboratory of Chris Burge (http://genes.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.html).In order to evaluate the strength of the alternative exon we compared the scores of the 5\u2032 splice sites of the alternative exon 6A versus the downstream constitutive exon 7 of"}
+{"text": "Growth in salmon aquaculture over the past two decades has raised concerns regarding the potential impacts of the industry on neighboring ecosystems and wild fish productivity. Despite limited evidence, sea lice have been identified as a major cause for the decline in some wild Pacific salmon populations on the west coast of Canada. We used sea lice count and management data from farmed and wild salmon, collected over 10 years (2007\u20132016) in the Muchalat Inlet region of Canada, to evaluate the association between sea lice recorded on salmon farms with the infestation levels on wild out-migrating Chum salmon. Our analyses indicated a significant positive association between the sea lice abundance on farms and the likelihood that wild fish would be infested. However, increased abundance of lice on farms was not significantly associated with the levels of infestation observed on the wild salmon. Our results suggest that Atlantic salmon farms may be an important source for the introduction of sea lice to wild Pacific salmon populations, but that the absence of a dose response relationship indicates that any estimate of farm impact requires more careful evaluation of causal inference than is typically seen in the extant scientific literature. Farm-based production has been successful in meeting global demands and in generating revenue1; however, it has often been criticized for its potential negative impacts on the ecosystem and the interaction with valuable wild species through disease transmission, interbreeding, and competition7.Increasing global demand for seafood and declining ocean fisheries have led to rapid growth in the aquaculture industry, including salmon farming, over the past few decadesOncorhynchus genera) are key species with strong cultural, socioeconomic, recreational, and symbolic significance to the residents of the Pacific Northwest9. In recent decades, the productivity of some Pacific salmon species has been decreasing13. Several factors are hypothesized to be associated with this decline, such as climate change, infectious diseases, anthropogenic impacts, or poor stock management, as well as the potential interplay among these factors14.Pacific salmon  are natural ectoparasites of salmonids, with a wide distribution in marine waters of the northern hemisphere17. Infestations can disrupt salmon normal behavior and growth, and cause mortalities in severe cases17. However, the effect that sea lice can have on out-migrating juvenile salmon is highly dependent on the size of the smolts19. In addition, it has been demonstrated that the L. salmonis found in the Pacific region differ from those in the North Atlantic and it has been hypothesised that, \u201cnuclear and mitochondrial genetic changes that may help to explain apparent phenotypic differences observed between these forms\u201d20. Sea lice are a major concern in salmon-producing countries, including Canada, with costs to the salmon industry amounting to millions of dollars annually21.The spillover of various pathogens from non-native Atlantic salmon farms to sympatric wild fish has been a contentious issue since the onset of aquaculture in British Columbia (BC) in the 1970s. The transmission of sea lice between farmed and wild juvenile salmon along their migration routes has drawn particular attention, especially through social media, over the past years in BC25. A number of studies, focused on the Broughton Archipelago region, present contradictory evidence for the impact of sea lice infestation at the interface between farmed and wild salmon in BC. For instance, Marty et al. could not find any associations between sea lice abundance on farms and the productivity of wild salmon populations in Broughton Archipelago26; whereas other researchers have demonstrated a negative correlation25. In addition, sea lice abundance in both farmed and wild populations shows prominent temporal and geographic variability28. Hence, in order to adopt the most efficient regional strategies for controlling sea lice, it is necessary to explain the spatiotemporal patterns of the infestation for each specific system, with respect to its unique distribution of wild species, microclimate, and oceanographic characteristics. In the present research, we focus on the Muchalat Inlet, BC, located on the west coast of Vancouver Island , in Muchalat Inlet provided an ideal setting for conducting our study of the host-parasite dynamics within this aquatic ecosystem. Two studies have been conducted previously by our group in collaboration with partners from the Muchalat Inlet on sea lice infestation and its associated determinants on farmed salmon30 and wild juvenile salmon29, but neither of those studies looked at the potential transmission of sea lice between farmed and wild salmon. In addition, our access to high quality data over the last few years is another advantage that motivated us to conduct the current study. The objective of this study was to evaluate the potential association between sea lice  infestation observed on Atlantic salmon farms and those on sympatric wild out-migrating Pacific salmon in the Muchalat Inlet region of BC.A large group of researchers, environmental activists, and indigenous people believe that sea lice originating on Atlantic salmon farms are a key component in the putative decline in some Pacific salmon stocks in BCand Fig.\u00a0. The firL. salmonis and the number of salmon sampled at the study farms are presented in Table\u00a0L. salmonis were attached. The highest and the lowest numbers of fish were sampled in 2011 (n\u2009=\u20093968) and 2016 (n\u2009=\u20091263), respectively. The median abundance of adult female lice on salmon farms in the Muchalat Inlet, during the February-May window, was considerably higher in 2016 (1.30) than in previous years, which did not show marked variability in median abundance, with values ranging between 0.05 and 0.35  from the farm data, the final master data set included 280 analytical units for the modeling procedures. The number of Chum sampled and infested (having at least one louse), during the study period, by sampling site, are presented in Table\u00a0L. salmonis infestation varied between 1.7 and 4.6%, with the exception of 2016 where the proportion was 11.4%. The distribution of prevalence values, for each month at each sampling site, by study year is presented in Fig.\u00a0The Chum salmon data included 365 analytical units, which formed the basis for our master dataset. After removing 85 mismatched values . It was, therefore, standardized  to provide more meaningful interpretations  and the log-odds of the presence of an infestation (Y). To meet the linearity assumption in the final model, a quadratic term for the main predictor of interest  was added to the model. Here is the final model equation:0 is the constant; \u03b2s are regression coefficients  to evaluate the association between the overall output pressure of lice from the farms  in Muchalat Inlet increased, the probability for an infestation to occur on out-migrating Chum (Y) increased , compared with March and June ; therfore, it was not included in the final model.Of the total unexplained variation in Y, 21% was attributed to the variation among the study years. As can be seen in Fig.\u00a0i,t) and the prevalence of infestation with lice (Y). To meet the assumption of normality, a logarithmic transformation was implemented on Y. Here is the final model equation:0 is the constant; \u03b2s are regression coefficients  to evaluate the association between the overall output pressure of lice from the farms  and the prevalence of infestation with L. salmonis on out-migrating Chum (Y) was not statistically significant (P\u2009=\u20090.33). A significant positive association (P\u2009<\u20090.001) was found between the prevalence of L. salmonis on out-migrating Chum and the progress of the out-migration season .Results for the mixed-effects linear model have been summarized in Table\u00a0L. salmonis on wild salmon on the west coast of Vancouver Island, BC, have been studied. The geographical isolation of our study ecosystem and the relative dominance of one wild species (i.e. Chum) provided ideal conditions to investigate this relationship. Elmoslemany et al. investigated a number of site-specific determinants  of the infestation with sea lice on wild salmon at the fish level in Muchalat Inlet, during the period 2004 to 2011. However, that study did not include farms\u2019 effects in the analyses. It has been proposed that L. salmonis is a density-dependent pathogen and that the density of salmonid farms surronding a site can have substantial impact on the sea lice abundance on a given farm32. Therefore, we conducted this population-level study that incorporated the potential lice spread from all of the farms in the study region, and defined an overall output pressure from the farms (i.e. the main predictor of interest), which could presumably drive infestation levels on sympatric out-migrating salmon. To achieve this, we applied a similar methodology to one previously described34, which defines the overall output pressure based on a combination of three influential factors: the farms\u2019 operational sizes, L. salmonis abundance on each farm, and distances from the sampled wild sites.This is the first time that the effects of farm-origin 35. However, based on our linear model, when infestation was present on wild fish, the extent of this infestation  was not associated with the farms\u2019 output pressure. This latter finding may be a statistical artifact related to the limited number of observations that were available in the second model (n\u2009=\u200995), or the presence of two large outliers in the prevalence   over the study period, which indicates the effectiveness of the farm-level control measures in the study region. In BC, during the out-migration season of wild juvenile salmon (March\u2013June), if the regulatory threshold is exceeded, farmers must take appropriate management measures (i.e. harvesting or treatment) in order to reduce the risk of exposure at the interface of farmed and wild fish (www.dfo-mpo.gc.ca/aquaculture/protect-protege/parasites-eng.html). For instance, antiparasitic treatments  were typically carried out during winter  and/or summer (prior to the return of wild adults) (data not shown), in line with perceived best practice and as recommended in other research37.In general, the infestation levels with L. salmonis was the abnormally high temperatures during the winter of in BC38. Bateman et al. studied the abundance of L. salmonis on farmed and wild salmon in the Broughton Archipelago region, on the east coast of Vancouver Island, during 2001\u20132015. They detected outbreaks of this parasite on out-migrating Pink and Chum stocks in 2015 and concluded that the observed outbreaks were also associated with the improper timing of treatments and warmer than usual environmental conditions22. Furthermore, they suggested that the unusually high return of Pink salmon to the Broughton Archipelago region could have been another influential factor in 2015. We, however, did not have access to the wild salmon return data in the study region. In the Broughton Archipelago region of BC, the overall annual proportions of infestation with L. salmonis on juvenile Chum typically ranged between 10% and 17% over a similar period39, once again illustrating the relatively low levels of infestation typically seen in the Muchalat Inlet.The prevalence of infestation with sea lice on out-migrating Chum was also consistently at very low levels, though a significant rise was observed in 2016. This rise corresponded to a marked increase in the lice abundance on the study farms over the same time period. One main reason for the increased levels of infestation in 2016 could be the timing of lice treatments in 2015 and 2016. Three of the study farms were active from September 2015 through 2016 . Based on the first model, the probability of infestation of wild fish increased from March to May, but dropped in June. It has previously been shown that with increasing temperature towards summer months, along with the beginning of the in-migration of adult wild salmonids later in the summer, sea lice infestation levels can rise on both farms and wild fish41. Our contradictory finding of a lower probability of infestation in June compared to the previous months could be attributable to the limited number of samples in this month, which comprised only 13.4% of the total samples in the final data set. While Chum were the dominant species early in the out-migration period, Chinook (O. tshawytscha) and Coho (O. kisutch) were more likely to be observed in Muchalat Inlet29 later in the season. Another explanation for the lower levels of infestation in June could be the expected decline in salinity from June through November, in most years around Vancouver Island, due to the influence of freshwater; i.e. melting snow42.The effects of salinity on the development of 34 considered a maximum travel distance of 30\u2009km for sea lice particles in terms of assessing their effect on neighboring farms or wild fish. We examined a range of biologically plausible distances and did not find any substantive differences in the fit of the models that used a range of bandwidths, from 30 to 60\u2009km. Therefore, we chose the widely adopted distance of 30\u2009km in our final analyses43. In common with those studies which used the overall output pressure, one of the challenges that existed for our study was that we were not able to account for the physical oceanographic features, such as tidal movements, due to the lack of information. In addition, other factors, such as biological behaviour of the larvae, wind, and short-term fluctuations in weather and temperature/salinity profiles, may substantially affect the oceanographic features and lice dispersal patterns and survival44. An additional limitation in our study was the use of Gaussian kernel density weights for seaway distances between the wild sampling sites and farms . In this regard, it was assumed that the weight for any given distance around a site was equal , which may not adequately account for the duration of exposure of wild fish to sea lice particles at a site along their migration path. However, with respect to the fact that juvenile Chum may join at different points (river openings) along the Muchalat Inlet, the actual exposure time for any given group of fish at each sampling site was not known. By and large, Gaussian kernel weights have been deemed to provide reasonable approximations when applied in similar studies34.Previous studies39. We restricted our final analyses to Chum due to the very low proportion of other Pacific salmon species in Muchalat Inlet. On the one hand, this may limit the generalizability of our results to other wild salmon species; but on the other, it may increase the precision of our results . In this regard, the known confounders associated with the species of fish, such as different biological behaviors, susceptibility to L. salmonis45, and migration size29, did not affect our results. Chum begin their out-migration in early March, once they emerged from the gravel. They quickly out-migrate through the river systems draining into Muchalat Inlet, and will usually reach the ocean within a few days29. Therefore, some of potential risk factors for infestation with L. salmonis during out-migration from fresh water to marine environment (e.g. smolt length) are unlikely to affect our analyses or cause substantial bias.In general, Pink and Chum are proportionally the most abundant wild salmon species around Vancouver Island46. However, L. salmonis can be transferred from returning wild adults to other Pacific salmon species such as Coho, which may spend up to a year in the estuaries, and the resident Pacific salmon and trout, such as cutthroat and steelhead, in the vicinity of out-migration routes of juvenile Chum8. Various non-salmonid species, including herring and sticklebacks that overwinter in the coastal area, can also carry L. salmonis, though the significance of these sources is believed to be minor48.In this study, we focused on the role of farms as the main source of infestation for out-migrating juveniles. We should not ignore the prominent role that returning wild adults have in spreading sea lice to farms and other young wild Pacific salmon in the fall. We were not able to assess this association due to the lack of appropriate data on wild returns to Muchalat Inlet. This potential source of sea lice was not expected to directly affect the prevalence of infestation on out-migrating juveniles, as there is allopatric separation between the out-migrating Chum and the returning adults35, there remains controversy around the evidence involving interactions between farmed and wild salmon. Global climate change, anthropological manipulation of the environment, and emerging diseases can all play a role in any such declines. Studies to further elaborate the relative impacts of such factors are definitely needed.Although several studies have pointed a finger at the growing salmon aquaculture industry over the past two decades as a major cause of putative decreases in the productivity of some wild salmon populationsL. salmonis being introduced to sympatric juvenile Chum. However, the levels of sea lice infestation observed on these wild fish did not appear to be influenced by the sea lice abundances recorded on farms. Therefore, continued compliance with the current regulations regarding sea lice control on the farms in BC should be an efficient strategy to avoid outbreaks of this parasite on the valuable wild stocks along their migration routes.Our study found that population-level abundances of sea lice on farmed and wild salmon in Muchalat Inlet were very low. Our analyses suggest that farm-origin sea lice can influence the likelihood of This study has shed some light on the controversy that exists around ecological impacts at the interface of farmed and sympatric wild salmon populations. However, additional observational studies in other BC farming areas over long periods of time (and preferably prospectively followed) are recommended, which could be based upon the general framework presented in the current study. Increased clarity around the nature of these ecological interactions is required to guide the sustainable growth of the salmon industry, while ensuring the successful preservation of valuable wild stocks.Salmo salar) farms in this region, all belonging to one company. Farms in Muchalat Inlet are relatively isolated from other farms on Vancouver Island . The sampling of wild out-migrating salmon for the monitoring of sea lice began in 2004 following the onset of salmon farming in Muchalat Inlet. A total of 16 sites were identified along the inlet and deemed suitable for sampling, based on distances from farms and the need for geographical representation29. Figure\u00a0This study was conducted in Muchalat Inlet, located on the west coast of Vancouver Island, BC Fig.\u00a0. There aL. salmonis counts at different life stages: pre-mobile, mobile , and adult females. In each month, 1 to 11 (mean: 4) cages and 19\u2013101 fish (mean: 21) per farm were sampled. The farms were active at various time periods (production cycles) from 2004 to 2016. Because the farming activity was limited to only one farm between 2004 and 2007, we initiated our study with the 2007 data. More details on sampling and lice counting procedures have been presented elsewhere30. For our statistical analyses, the data were aggregated at the farm level and each analytical unit was defined as a unique combination of farm-year-month.Farm data: provided by the farming company in Muchalat Inlet, from 2004 to 2016. The data set included sea lice counts, environmental , and production (weight and number of fish) variables. Sea lice data were recorded on a monthly basis at the cage level and consisted of 29. Because the majority (84%) of the wild fish sampled in the region between 2007 and 2016 were Chum (Oncorhynchus keta), we further limited our data analyses to this species. Due to scarcity of the weekly data, and to be consistent with the farm-level data, the merging process aggregated the data at the month level; therefore, each analytical unit represented a unique combination of site-year-month.Wild salmon data: extracted from a database prepared by the Mainstream Biological Consulting and the Atlantic Veterinary College, University of Prince Edward Island. This data set included weekly, bi-weekly, or monthly sea lice counts on wild out-migrating (juvenile) salmon sampled from 16 designated sites along Muchalat Inlet using beach seines, during the study period 2007\u20132016). Sampling was carried out during the Pacific salmon out-migration season; i.e. from March through June (4 months per year) at various sites and points in time . The seaway distances were stored in a matrix and later retrieved for further analyses.Seaway distances: seaway distances between each combination of wild sampling sites and farms were calculated with the \u2018gdistance\u2019 packageThe final data set for this research was obtained from three sources, as follows:These three data sets were merged into one table for statistical analyses. To achieve this, the wild data were used as the basis and farm data were combined with those using a unique identification for each time point (i.e. year-month). Therefore, each site-year-month of wild data was matched with up to five farm-year-month data points and thereafter with the relevant seaway distance data (for each site-farm pairing).L. salmonis prevalence on out-migrating Chum in a certain month (t) and sampling site (i) was a function of the sum of the weighted (by seaway distances) load of adult female lice on each of the five farms (output pressure) one month prior; i.e. at (t-1). This 1-month lag time was applied in order to approximate the average time needed for the development from sea lice eggs produced by adult females on farmed fish to the attached stages on wild salmon : the prevalence of infestation with lice (at any life stages) on the sampled out-migrating Chum salmon at time \u2018t\u2019 (per site-year-month of sampling), calculated as the number of Chum with at least one louse at time period \u2018t\u2019 in sampling site \u2018i\u2019 divided by the total Chum sampled at the same time period and site.Yj,t-1: the abundance of adult female L. salmonis on farm \u2018j\u2019 at time \u2018t-1\u2019, calculated as the total number of adult female lice at time \u2018t-1\u2019 on farm \u2018j\u2019 divided by the number of fish sampled at the same time period and farm.Lj,t-1: the average number of fish present on farm \u2018j\u2019 at time \u2018t-1\u2019.Ni,j: seaway distance (km) between each pair of wild site \u2018i\u2019 and farm \u2018j\u2019.di,j: Gaussian kernel density estimated weight for the seaway distance \u2018di,j\u2019.WYear: sampling year (for farmed and wild fish); 2007\u20132016 (n\u2009=\u200910).Month: sampling month; limited to March\u2013June (n\u2009=\u20094).i: wild sampling site; W1\u2013W16 (n\u2009=\u200916).j: farm; F1\u2013F5 (n\u2009=\u20095).To evaluate the association between sea lice infestation levels on farmed and wild (Chum) salmon, it was hypothesised that the .e. at t-. This 1-i,t), the following formula was used:i,t is the overall (at the inlet-level) lice pressure received by a wild site \u2018i\u2019 at time \u2018t\u2019 from the neighboring farm/s \u2018j\u2019; \u2018n\u2019 is the number of farms (n\u2009=\u20095) located within a radius (i.e. bandwidth) of 30\u2009km from a wild sampling site. In the study region, all of the farms were located within the 30\u2009km bandwidth from every wild site  to find the best fit model/s (results not shown). \u2018Lt-1\u2019, \u2018Nt-1\u2019, and di,j were defined earlier, under the variables of interest. W or the Gaussian kernel density weight for \u2018di,j\u2019 was calculated using Equation\u00a0To define our main predictor of interest (X entclass1pt{minimawww.maths.lancs.ac.uk/~rowlings/Splancs), and the kernel density surface with \u2018spatstat\u2019 package (www.spatstat.org) in R50, and the maps were generated with QGIS51.For illustrative purposes only, the kernel densities shown in Fig.\u00a0L. salmonis per sampled fish) per farm during the study period were calculated (Table\u00a0For the farm-level data n\u2009=\u2009410), the annual abundance of adult female sea lice \u2009\u00d7\u2009Lt-1\u2009\u00d7\u2009Nt-1\u2009=\u20090) did not contribute to the Xi,t calculations. If the lice count during the months of interest for a farm (February-May) was missing, the Xi,t including that farm was treated as missing (n\u2009=\u200985) and dropped from the final modeling process to prevent any potential biases.The farms were active at various time periods between 2007 and 2016. The total number of active production cycles for the farms F1\u2013F5, were 4, 5, 3, 3, and 5, respectively. Whenever a farm was inactive , the output pressure from that farm , the number of sampled fish and the number of fish with at least one sea louse attached during the study period were calculated Table\u00a0. The sami,t) and the outcome (Y) for the final dataset (n\u2009=\u2009280) were produced  was built, with Y being either zero  or \u2018one\u2019  at each given wild site-year-month (n\u2009=\u2009280). Second, for the non-zero prevalences (n\u2009=\u200995), a mixed-effects linear regression model (model 2) was built to further examine the association between Xi,t and Y, with Y being the prevalence of infestation (a continuous outcome), if present. The random effects of years and fixed effects of months were included in both models (random intercept models) to account for the potential confounding effects of time. Moreover, the interaction between Xi,t and month, as well as the effect of wild sampling sites on Y, were examined.Due to excessive number of zeros (185 out of 280) in the hum Fig.\u00a0, the effThe datasets used during the current study are not publicly available due to confidentiality considerations, but can be provided by the corresponding author upon reasonable request."}
+{"text": "Oxymycterus nasutus endemic to open areas in the Pampas and Atlantic Forest biomes to assess the tempo and mode of population divergence using an integrative approach, including coalescence theory, ecological niche models, and morphometry. Our results indicated that these O. nasutus populations exhibited high levels of genetic structure. Six major mtDNA clades were found, structuring these biomes into distinct groups. Estimates of their divergence times was indicated to be 0.571 myr. The high degree of genetic structure is reflected in the analyses of geometric morphometric; skull differences between lineages in the two ecoregions were detected. During the last glacial maximum, there was a strong increase in suitable abiotic conditions for O. nasutus. Distinct molecular markers revealed a population expansion over time, with a possible demographic retraction during the post-glacial period. Considering that all clades coalesce with the last interglacial maximum, our results indicated that reduction in suitable conditions during this period may have resulted in a possible vicariance associated with refuge isolation.Pleistocene climatic oscillations favoured the expansion of grassland ecosystems and open vegetation landscapes throughout the Neotropics, and influenced the evolutionary history of species adapted to such environments. In this study, we sampled populations of the rodent  The glaciations occurred in the Pleistocene (2.58\u20130.01 million years ago [myr]), a period of climatic history that is known with near accuracy . TherefoOxymycterus nasutus .In the recent years, some regions in the Neotropics have been systematically studied , as the O. nasutus is an abundant species adapted to wet areas, thriving at sea level in the southernmost Uruguay and Rio Grande do Sul State, Brazil, to higher elevations (up to 900 m) on the Santa Catarina and Parana States, Brazil, where it is restricted by the coastal mountains  were collected (previously) by our research group with the license issued by the Brazil Government authorities.Skull and tissue samples of O. nasutus from 45 localities covering the entire known distribution of this species . Specimens were euthanized via overdoses of isofluorane and cervical dislocation, procedures authorized by The Animal Care and Use Committee of the Institute of Biological Sciences at UFRGS, Brazil, for this study Specimens trapped were deposited both in the mammal collections of UFRGS and MCNU.A total of 135 specimens of  species ; Table 1b (Cytb) gene (801 bp) and the nuclear locus beta-fibrinogen, intron 7 (Fgb-I7) (408 bp) according to the method described by Smith and Patton [Cyt b, MF766110 to MF766188 and Fgb-I7, MF766189 to MF766256.DNA was isolated from 107 specimens using the PureLink Genomic DNA extraction kit , following the manufacturer's instructions. Polymerase chain reaction (PCR) was performed to amplify the mitochondrial DNA (mtDNA) cytochrome d Patton  and Matod Patton . The nucd Patton . PCR proCytb sequences was performed in the Clustal W algorithm using the MEGA 7 software. For the nuclear Fgb-I7, sequences were aligned using MAFFT v.7.245 [Alignment and editing of the mtDNA  v.7.245  with the v.7.245 , 28 as i v.7.245  to recon v.7.245 .The most appropriate substitution model for mtDNA phylogeny from the haplotypic data was the HKY+G that was determined based on the Akaike Information Criterion in the jModelTest v2.1.10 software . The phyhttp://tree.bio.ed.ac.uk/software/figtree/). There were no fossils for Oxymycterus that could be used for a specific estimate of the substitution rate. Hence, we used an evolutionary rate already published [-1) for the genus. Accordingly, the divergence times were estimated in BEAST assuming an uncorrelated relaxed clock model and a normal distribution for the substitution rate, with a mean of 2.37% Myr-1, and a standard deviation of 0.25% Myr-1, to allow some uncertainty in the evolutionary rate. One representative sequence for each haplotype was used. Sequences of Oxymycterus delator (U03525), Oxymycterus dasytrichus (AF454768), Oxymycterus amazonicus (AF454765), and sister lineages of O. nasutus [Fgb-I7 evolutionary tree is shown in The burn-in was determined in Tracer v1.6 based on the trajectory parameters, and 10% of the initial trees were removed and summarized in TreeAnnotator. The consensus tree generated was visualized and edited in Figtree v1.4.3 . For assessing the evolutionary relationships of the Fgb-I7 gene, haplotypes were identified by coalescent-based Bayesian method implemented in PHASE v2.1. Missing/gaps sites were verified and invariant sites were removed from the dataset. Indels were treated as single mutational events.The evolutionary relationships between the haplotypes for each data set (i.e. mtDNA and nDNA) were estimated using the median-joining method implemented in the Network v5.0  (http://Cytb (average distances) using p-distance model with 1000 bootstrap replications using MEGA v7 [Statistical parameters of diversity, such as the number of variable sites (S), number of haplotypes (h), haplotype diversity (Hd), nucleotide diversity (\u03c0), and average number of nucleotide differences (k) were measured using DNASP v5.10 ). We cal MEGA v7 . The defO. nasutus, calculated with the expected frequency based on a population growth-decline model. The sum of squared deviations (SSDs) between the observed and expected mismatch distribution and the raggedness index (r) were calculated to test the null hypothesis of spatial expansion using ARLEQUIN v3.5 [O. nasutus dataset. BEAST v1.8.4 [7 generations  under a HKY+G substitution model (obtained through the jModelTest 2 software), assuming a relaxed molecular clock model. However, we used the substitution rates and dates estimated from previous studies to calibrate a relaxed molecular clock and approximate divergence times for the main phylogroups retrieved in our study. We implemented a lognormal prior distribution based on the substitution rate for the cricetid genus Peromyscus (0.006 \u00b1 0.003 substitution/site/million years) for the Fgb-I7 data set [Historical demographic changes such as signatures of demographic expansion, and equilibrium or decline were examined for the species and for each haplogroup using neutrality tests, such as Tajima\u2019s D  and Fu\u2019sUIN v3.5 . In addiUIN v3.5 . The BSPT v1.8.4  was useddata set . SkylineO. nasutus, we performed a Statistical dispersal\u2013vicariance analysis (S\u2013DIVA) on the maximum clade credibility tree generated from the BEAST analysis using the software RASP 3.02 [O. nasutus were categorized in these areas. We used the output files generated by BEAST  for the analysis.Aiming to reconstruct the ancestral range of ASP 3.02 \u201346. The ASP 3.02  developsO. nasutus , and also between physiognomies or \u201cenvironmental groups\u201d (Pampas versus Atlantic Forest). First, we conducted a principal component analysis (PCA) in the form matrix for each view. The number of PCs necessary to achieve 100% variation in each view  were used as response variables for downstream analyses. We performed multivariate analyses of variance (MANOVA) and discriminant analyses with Jackknife cross validation (DA) to investigate how morphology was structured among the six genetic haplogroups (first predictor) and the two environmental groups (second predictor). MANOVAs and DAs were performed independently for each predictor and for each skull view. All procedures were carried out in the software R ), with tO. nasutus based on climatic variables. Such modelling has been performed favourably compared to other analytical alternatives for presence-only data [2. For modelling settings, the function \u2018Auto features\u2019 was selected, and the distributions were modelled through the \u2018cross-validate\u2019 parameter, applying a maximum number of iterations at 500. We verified model performance using the area under the \u2018Receiver Operating Characteristic (ROC) Curve\u2019 (AUC) calculated by MAXENT. Values between 0.7 and 0.9 indicated good discrimination [Ecological niche modelling (ENM) was carried out in MAXENT v 3.3.3e  to predinly data \u201359. Infonly data , we limimination .http://www.worldclim.org) at 30 arc-sec resolution (~1 km2), with the exception of the layers from the LGM period, which were available in 2.5 arc-min resolution (~5 km2). Climatic variables for the present study represented the average climate changes from 1950 to 2000. Projections for the LGM and mid-Holocene were derived from the CCSM4 [Projections for the past climatic conditions were developed for three periods: LGM c. 21 ka; Last IinterGlacial (LIG) c. 120\u2013140 ka; and mid-Holocene c. 6 ka. Current and past distributions were modelled using 19 bioclimatic data layers available from the WorldClim database (he CCSM4  atmospheFgb-I7 locus resulting in 40 haplotypes (with one 2-bp indel) (Tables We identified 73 variable sites in the mtDNA dataset resulting in 38 haplotypes and 32 variable sites in the ) Tables  and 2. SBayesian consensus tree based on mtDNA dataset depicted six highly supported (BPP > 0.90) haplogroups corresponding to two distinct biomes: Northwest, Central, and Eastern clades are distributed along the Atlantic Forest biome, and Steppes Plain, Taim Wetland, and Southern clades assigned to the Pampas biome. However, the relationship between these groups was not entirely clear, considering that they did not cluster in major clades exclusive to each of the two biomes . The hapFgb-I7 sequences. However, nuclear haplotype H1 was present in almost all mtDNA clades (except Taim Wetland). All mtDNA clades showed the presence of unique alleles, but Taim Wetland group shared the haplotype 31 with Steppes Plain and Southern clades.The majority of haplotypes differed by one substitution site. None of the six major clades in the mitochondrial tree was recovered for the Fgb-I7   , Table 3xpansion .Only Fu\u2019s Fs test showed significant P values for mtDNA (P < 0.01). Considering the mtDNA, only the Central haplogroup depicted significant P values in Tajima\u2019s D test , indicating an undergoing demographic expansion or mutational selection (too many segregating sites/too few pairwise differences). On the other hand, Northwest haplogroup showed positive values for Tajima\u2019s D test , which could be an indicator for a contraction (too few segregating sites/too many pairwise differences). Central, Eastern, and Steppes Plain clades showed significant P values for Fu\u2019s Fs tests performed on nDNA marker, as expected from a recent population expansion. This indicated recent demographic expansion or departure from the null hypothesis of selective neutrality and population equilibrium. Nonetheless, a unique haplotype for nDNA was found in Taim Wetland mtDNA clade, which did not allow neutrality tests to be performed. This clade also showed positive values for the Fu\u2019s Fs test for mtDNA, thereby suggesting recent population bottleneck for this lineage .The results of the mismatch distribution for mtDNA and nDNA analysis was approximately unimodal . Non-sigO. nasutus skull  explained 17.3% of the variation in the dorsal view , 17.9% in the ventral view  , and 15.us skull . Geneticus skull , and 23.us skull . The perRelatively high AUC values showed an excellent predictive power of the ENMs . The ENM results  and the O. nasutus. Dispersal events probably progressed from Pampas domain (A) to areas that are currently translocated into the Atlantic Forest domains (B) and also ranging to other regions of the Pampas. Vicariance signals, detected on node 2 (AB), indicated that vicariance events occurred between the Northwest clade and the other haplogroups that had dispersed between the Pampas and the Atlantic Forest. A new dispersion event was detected on node 3 (A/AB), scattering the haplogroups  along the Pampas and the current Atlantic Forest areas. Finally, on node 4, a new vicariance was verified between the haplogroups that were present on the Atlantic Forest areas  and the Pampas (Steppes Plain).According to S-DIVA analysis , Pampas Cytb haplotypes that was common to Atlantic Forest and Pampas groups was intriguing. However, the scenario was intricate, as a lack of further structuring between the two biomes in the Bayesian and median-joining network analysis was evident. This pattern indicated a possible isolation following the historical scenario of gene flow, as depicted by the Fgb-I7 network. Patterns of skull form were also roughly in agreement with the molecular findings. The differentiation between the physiognomies of O. nasutus populations were evident in the classification after the cross-validation. Subtle differences in the skull shape of O. nasutus populations were also depicted among the environments. Such skull differences might be related to genetic grouping or with environmental factors, exerting some form of local selection and/or guiding phenotypic plasticity in each physiognomy [Deltamys kempi [Scapteromys spp. [The absence of siognomy . Similarys kempi , 64 and mys spp. , 66). weO. nasutus populations is recent  and the divergence process seems incomplete, it can be considered at the population-level and not at species-level yet.A conspicuous geomorphological feature of the connection among the southern Atlantic Forest and Pampas landscapes is the escarpment of Serra Geral , which might have acted as a long-term barrier to gene flow between the Pampas and the current Atlantic Forest open areas at the eastern point of contact of these two biomes. Thus, the altitudinal gradient formed might have influenced certain level of differentiation, thereby rendering a group of lineages dispersing across the highlands of the Meridional Plateau, and others through the sedimentary lowlands of the Paran\u00e1 basin, and later spreading along the coastal plain. Mountain ranges and ridges have been considered as topographic elements associated with speciation processes in akodontine rodents \u201371. SincO. nasutus was quite complex; therefore, it is possible that the recent expansion of forest formations of the South Atlantic Forest, such as the Araucaria Forest and the seasonally dry Forest lato sensu [The population structure of to sensu , along wto sensu .Fgb-I7 variability was conspicuously lower than Cytb variability, as reported in other studies [The phylogenetic tree revealed a more complex evolutionary history in the open areas of Pampas and Atlantic Forest instead of simple reciprocally monophyletic groups. Six major mtDNA clades were observed, which fall within the range of intraspecific divergence described for the Akodontini tribe , 71, 73. studies , 63,74.  studies , 76.The estimates of genetic distances for the mtDNA clades were moderately high (up to 2%). This might be the result of an ongoing process of isolation, and because mtDNA accumulates substitutions 5\u201310 times faster than the single-copy nuclear DNA . The higScapteromys meridionalis [Deltamys araucaria [The Northwest clade was the northernmost lineage; so, the effects of the dynamics of forest formations/open areas might have reached earlier in this group, making it more suitable to environmental pressure. Positive values for the Tajima\u2019s D test  for this clade (from mtDNA) and other negative but non-significant values (for both markers), indicated a possible contraction effect on this lineage. The divergence between the Steppes Plain and Central and Eastern clades dates back to 0.350 myr (0.220\u20130.505 myr). Moreover, some forest formation similar to Seasonal Forest, which at present is adjacent to the escarpment of the Serra Geral might have acted concomitantly. This hypothesis was supported by the results of the ENM that indicated an area of very low suitability between the zone of contact of these two ecoregions. This is consistent with the escarpment of Serra Geral, which might have corroborated mainly due to the vicariance between the Steppes Plain and Central and Eastern clades, as detected by S-DIVA analyses. Similarly, a strong phylogenetic break in this region was evident for other akodonts recently described, such as dionalis  and Deltraucaria . An evidScapteromys tumidus [Deltamys kempi [A remarkable phylogeographic aspect was the genetic divergence of the Taim Wetland clade. The mtDNA dataset revealed a statistically supported phylogenetic break between the Taim Wetland clade and other clades, indicating a possible historical barrier acting in this region. This lineage originated about 0.147 myr (95% HPD = 0.047\u20130.290 myr) and was the first to have dispersed in the S-DIVA analysis. This clade was inserted on the plains of southernmost Brazil (RS), where climatic oscillations occurred during the middle Pleistocene and Holocene, resulting in marine transgressions and regressions of relative sea level that shaped the South Atlantic Coastal Plain (SACP). The formation of the SACP is related to the sedimentary processes associated with the sea transgressive events known as \u2018Barriers\u2019, which occurred in the middle Pleistocene with the formation of Barrier I (~ 0.400 myr), Barrier II (~ 0.325 myr), Barrier III (~ 0.120 myr), and Holocene, when Barrier IV (~0.005 myr) was established . Possibl tumidus  and Deltys kempi . Thus, mOverall, substantial demographic changes associated with Pleistocene climatic oscillations were observed in more than half of the biota investigated in South America. Considering only the taxa to be associated with open vegetation, a total of 68% of the studied species experienced population expansion during the glacial periods [O. nasutus populations estimated by BEAST occurred during the Middle Pleistocene, wherein a minimum of eight glaciations occurred in the Middle\u2013Late Pliocene in the southern Andes of South America [All divergence times within  America . However America ,80. Afte America ).O. nasutus occurred in the earlier periods (ca. 500 kyr), the patterns showed by the present and past niche models depicted expansion of high probability areas during the LGM , favouring its distribution. Probably, a pattern similar to LGM might have occurred during the Great Patagonian Glaciations, where the effects of glaciations might have increased the open areas and retracted the forest formations. The areas of Southern Atlantic Forest were dominated by grasslands between 42,000\u201310,000 years BP; the period comprising the LGM. Forest elements were restricted to sites in deep river valleys and in coastal lowlands, indicating a cold and dry climate [O. nasutus is intrinsically related to open areas and is abundantly found in these habitats [O. nasutus during the interglacial periods.Although the emergence of  climate . Since Ohabitats \u201319, cyclhabitats . The conO. nasutus is known to inhabit the subtropical grassland in wet or flooded seasons [O. nasutus might have followed river routes in search of humid environments. Such habitat specialization might reflect the dispersion ability to more extensive regions during the glacial periods. seasons . Accordi seasons , sandban seasons , and coa seasons . Thus, iO. nasutus. Rivers Uruguay and Paran\u00e1 also might have acted in limiting the dispersion during the glacial periods. The paleoecological niche modelling suggested that at LGM, the River Uruguay limited the dispersion for Steppes Plain and Southern clades in Uruguay and Southern Brazil to reach new areas to the west. Similarly, the River Paran\u00e1 limited the dispersion for Northwest and Central Clade in highlands. Finally, Paran\u00e1, and Paranapanema rivers might have acted as physical barriers in the dispersion to the north, mainly for the Northwest clade, due to their amplitude and water volume. These inferences were based on the ENM results, wherein areas of low suitability were verified in all the prediction models.In this context, we suggest that the two major rivers in Rio Grande do Sul state (the Jacu\u00ed and Ibicu\u00ed) might have acted (and still be acting) as river barrier for the Steppes Plain clade. The haplotypes of this clade are distributed across the western edge of the Patos Lagoon and the interior of the plains of southern Brazil. Therefore, ENM suggested that these areas might be unsuitable for the restriction caused mainly by the river Jacu\u00ed. Others rivers could have affected the limits of dispersion in S1 FigValues above nodes correspond to posterior probabilities > 0.90.(TIF)Click here for additional data file.S2 FigA description of each landmark is presented in (TIF)Click here for additional data file.S3 FigO. nasutus in the lateral view, with groups following the genetic haplogroups  and the physiognomies (C). Changes in the shape for each axis are given. Solid lines indicate positive scores and dashed lines indicate negative ones.Scatter plot of the first Canonical Variate axis for the skull of (TIF)Click here for additional data file.S1 Appendix(DOCX)Click here for additional data file.S2 Appendix(DOCX)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file."}
+{"text": "Compressed sensing (CS) has been applied to accelerate magnetic resonance imaging (MRI) for many years. Due to the lack of translation invariance of the wavelet basis, undersampled MRI reconstruction based on discrete wavelet transform may result in serious artifacts. In this paper, we propose a CS-based reconstruction scheme, which combines complex double-density dual-tree discrete wavelet transform (CDDDT-DWT) with fast iterative shrinkage/soft thresholding algorithm (FISTA) to efficiently reduce such visual artifacts. The CDDDT-DWT has the characteristics of shift invariance, high degree, and a good directional selectivity. In addition, FISTA has an excellent convergence rate, and the design of FISTA is simple. Compared with conventional CS-based reconstruction methods, the experimental results demonstrate that this novel approach achieves higher peak signal-to-noise ratio (PSNR), larger signal-to-noise ratio (SNR), better structural similarity index (SSIM), and lower relative error. MRI prok-space sampling [k-space sampling pattern to shorten the sampling time, increase the imaging speed, and reduce the motion artifacts. However, aliasing artifacts may occur in these sampling methods. The high-frequency part contains less image information than the low-frequency part. Hence, by using undersampling patterns, the information about details is lost in the reconstructed images. Besides, the substantial aliasing artifacts appear incoherent. In case that the sampling ratio is extremely low, it is almost impossible to remove the significant aliasing artifacts from real signals [k-space data. The discrete wavelet transform (DWT) is widely applied in CS-MRI, but it is sensitive to shift, lacks information about phase, and has poor directionality [\u21131-norm regularization. These approaches, such as conjugate gradient [O(1/k2), where k is the number of iterations.In recent years, a variety of techniques have been proposed to enhance the quality of MRI, which can be roughly classified into three categories : incohersampling , spiralssampling , radial sampling , and Gausampling ) takes a signals , 8, 9. Fionality . Waveletionality . The staionality . Similarionality , 19. Thegradient , two-stegradient , 22, andgradient , have begradient  can be eTo enhance the image reconstruction quality and reduce the reconstruction artifacts, in this paper, we propose a novel reconstruction scheme, which combines CDDDT-DWT with FISTA. Although dual-tree complex wavelet transform has also been exploited in the literature , its dirThe remainder of this paper is organized as follows. \u03c6h(t) and \u03c6g(t) and four distinct wavelets \u03c6h,i(t) and \u03c6g,i(t), where \u03c6h,1(t) is an offset from \u03c6h,2(t) by one-half and \u03c6g,1(t) is an offset from \u03c6g,2(t) by one-half. One pair of wavelets \u03c6h,i(t) and \u03c6g,i(t) form an approximation of the Hilbert transform pair [\u03c6g,1(t) \u2248 \u210b{\u03c6h,1(t)}, \u03c6g,2(t) \u2248 \u210b{\u03c6h,2(t)}.The CDDDT-DWT is an overcompleted discrete wavelet transform that combines double-density DWT  with duaorm pair ; namely,L0L0, H0H0) and 16 high-frequency subbands  to describe the details of the recovered image.Two-dimensional (2D) double-density dual-tree DWT includes 2D real double-density dual-tree DWT and 2D complex double-density dual-tree DWT. The former is constructed from two oversampled 2D double-density DWT in parallel, which is redundant by a factor of two. Lp and Hp make up the filter banks of the first-level decomposition, where Lp represents a scale filter and Hp depicts eight wavelet filters, while Lw and Hg denote the filter bank structures of the second-level decomposition. Each level generates four low-frequency subbands  and 32 high-frequency subbands  through 2D CDDDT-DWT transform. Similar to other wavelet transforms, the redundant transform is achieved by recursively applying low-frequency subbands to complete the decomposition of each level. For each pair of subbands, CDDDT-DWT takes their summation and difference to produce the 32 oriented wavelets, describing a total of 16 main directions. Besides, each main direction contains two distinct wavelet representations, which indicate the real part of a complex-valued 2D wavelet function and the imaginary part, respectively [The latter is formed by utilizing four oversampled 2D double-density DWT in parallel to the input image. The filter bank structure of this transform can be obtained by extending the one illustrated in ectively .x denotes the fully sampled image, y is the k-space data acquired from a MR scanner, and \u03be (\u03be > 0) is a parameter appropriately chosen based on the noise level, which controls the difference between the object image and the reconstructed one. Fu is the undersampled Fourier transform in MRI. \u03d5(\u00b7) is called the regularization function in the transform domain, which is generally nonsmooth. This optimization problem can be potentially solved by total variation- (TV-) based approaches [\u03c4 is a positive regularization parameter. To solve (\u21130 \u201cnorm\u201d (\u2016x\u20160 = |{i : \u22600}|) is chosen as the regularization function. \u03d5(x) = \u2016x\u20160 especially provides the simplest way to enforce the sparsity:x can be sparsely represented in this selected domain \u03a6. Here, \u03a6i  is the 16 high-frequency subbands of CDDDT-DWT, which serves as a new sparse basis. However, the solution of  = (1/2)\u2016Fux \u2212 y\u201622 represents the quadratic term, which is a convex function with Lipschitz continuous gradient, and g(x) = \u03c4\u2016\u03a6ix\u20161, i = 1,2,\u2026, 16 is a nonsmooth convex regularizer.Since  convex,  can be c convex,  to effec convex, , f(x) = zk, we can get the gradient of f(x) at zk byFuT(Fuzk \u2212 y) denotes the gradient of f(x) at the given point zk, which is a specific combination of the previous estimate values xk, xk\u22121. The original FISTA based on wavelet transform has been well studied in the literature with a backtracking step size or a constant step size \u03c1, both of which can provide an improved global convergence rate of O(1/k2) [The FISTA algorithm is applied to solve the optimization problem of . For a g O(1/k2) . For simxg, we can getwh is the new wavelet coefficients, which can be adjusted by the proximal forward-backward iterative scheme [\u21131-norm is nonsmooth, it is separable and CDDDT-DWT has the characteristics of tight frame. It is known that the shrinkage thresholding function with threshold T is utilized to obtain the modified wavelet coefficients wh\u2032:Applying the sparsity transform CDDDT-DWT to a local optimal image e scheme  to catchxk is updated byThe recovered image i\u22121, \u2009i = 1,2,\u2026, 16) is applied by the synthesis filter bank structure, constituted by inverse order of the analysis filter bank [\u03b2 is a threshold relaxation factor to adjust T, which optimizes T and reduces the calculation time. When the stop condition T \u2264 \u03f5 is satisfied, we obtain the optimal solution of  for solving  is depick-space data of the axial brain are acquired by a 3T GE MR750 scanner using fast spin echo sequence . The spine MR data are a fully sampled k-space data obtained by a 3T GE MR750 system with FRFSE sequence . For the sake of brevity, the size of all testing images is scaled to 256 \u00d7 256. All experiments are performed using MATLAB 2014b on a desktop computer with a 3.2\u2009GHz Intel core i5-4460 CPU.To evaluate the performance of the proposed reconstruction algorithm, we implement the complex double-density dual-tree wavelet and conventional wavelet using the software in , 29. Thek-space pattern and radial undersampling pattern are used to undersample the fully sampled k-space raw data. For most of MR images, the k-space signal with a large magnitude is generally localized in the central part. k-space and less high-frequency signals in the peripheral region of k-space. The radial undersampling pattern displayed in Gaussian random In this work, FISTA based on three different sparsity transforms is utilized to solve the optimization problem of . These tk-space data. In the axial brain experiment, we set the optimal parameters \u03f5 = 0.001, \u03c1 = 1, \u03b2 = 0.9, and T = 0.0095, while parameters in the spine experiment are set as \u03f5 = 0.0001, \u03c1 = 1, \u03b2 = 0.9, and T = 0.01. For different testing datasets, the tuning parameter \u03c4 is set to different values and the total number of iterations in all the cases is set to 120. Additionally, in both simulation and experiments on in vivo data, we add Gaussian white noise to simulate a realistic environment. For simplicity, the same standard derivation \u03c3 = 0.01 is used.We first conduct the experiment on the Shepp-Logan phantom image shown in x denotes images reconstructed from fully sampled data, M and N are the number of rows and columns in the input image, respectively. MAX means the maximum possible pixel value in the input image data, and The peak signal-to-noise ratio (PSNR), signal-to-noise ratio (SNR), structural similarity (SSIM) index, and relative error (Rel.Err) are used to evaluate the FISTA-CDDDT recovery performance. The PSNR is calculated using the following equation:The SNR is defined asp and q are the various local windows from the same local window in the two different images to be compared. \u03bcp and \u03bcq are the mean of p and q, respectively, while \u03b8p and \u03b8q represent their variance. \u03b8pq is the covariance of p and q. c1, c2, and c3 are three variables used to increase the stability of the results. Both SSIM index and SNR have the same criterion as PSNR; that is, the reconstruction quality is directly proportional to the value of the metrics.The definition of the SSIM index is given byThe Rel.Err is defined asNote that, for all the figures in this part, various approaches are labeled by different colors below the images. The green dotted lines mean FISTA-DWT, the pink dotted lines denote FISTA-CDT, and the blue lines represent the proposed FISTA-CDDDT.\u21131-norm based CS techniques may result in poor performance with substantial artifacts. Consequently, CS methods cannot guarantee the quality of the reconstructed image at low sampling ratios.For further analysis, the PSNRs of the reconstructed images using different methods are plotted at various sampling ratios. It is clear from k-space data. The k-space data from each coil are reconstructed separately, and the final image is generated by the sum-of-square method [Figures e method .Note that the PSNRs of reconstructed axial brain images using radial sampling mask by FISTA-DWT, FISTA-CDT, and FISTA-CDDDT are 33.99\u2009dB, 37.58\u2009dB, and 38.87\u2009dB, respectively. The magnified images are shown in Figures \u03c3 = 0.01. These results further demonstrate that the proposed FISTA-CDDDT is superior to the other two methods, because it exhibits the highest SNR, best SSIM index, and lowest Rel.Err.Figures Considering the superiority of CDDDT-DWT in preserving edges and maintaining higher directional selectivity, the proposed reconstruction approach combines the CDDDT-DWT with FISTA to produce better recovery results with a faster convergence rate. Although the ISTA and TwIST can be integrated with CDDDT-DWT as well, both of them were designed for simple regularization problems. Besides, they have some drawbacks that cannot be ignored. ISTA based on the operator-splitting strategy is a promising method, which has been successfully used in signal recovery. However, it belongs to the first-order algorithm that converges quite slow. As a variant of ISTA, TwIST is also an iterative thresholding algorithm, which is not guaranteed to converge globally. In contrast, FISTA has a faster convergence rate and better reconstruction accuracy, as proved in .l1-norm regularization is studied in this work. Furthermore, FISTA-CDDDT first uses proximal forward-back optimization to approximate the linearized function f(x), then applies shrinkage thresholding function to solve the minimization problem due to the separable characteristics of l1-norm, and finally adopts the specific linear combination of xk and xk\u22121 to smartly select the search points. Besides, the threshold relaxation technique can further reduce the computational cost. Consequently, our method can gain a more accurate solution with a dramatically improved complexity of O(1/k2).It is worth noting that Zhu et al.  designedIn this paper, we develop a new image reconstruction method for CS-MRI based on complex double-density dual-tree wavelet transform. The filter bank structure of the CDDDT-DWT is explored. This novel approach has been applied to Shepp-Logan phantom and axial brain and spine image reconstruction and compared with two popular methods, namely, FISTA-DWT and FISTA-CDT. The reconstructed results demonstrate that our scheme improves the PSNR and SNR as well as SSIM index and reduces the reconstructed artifacts significantly. In both simulation and experiments on in vivo data, we use the FISTA as the reconstruction algorithm. However, it can only solve the unconstrained minimization problems. An algorithm that can solve both unconstrained and constrained convex optimization problems will be studied in the future work."}
+{"text": "IDH1), O-6-methylguanine-DNA methyltransferase (MGMT), and 1p19q. The gliomas were graded according to the intratumoral susceptibility signals (ITSS). We used the Mann-Whitney test to analyze the relationship between ITSS grades and the pathological level and status of these markers. Additionally, the area under the curve (AUC) was used to determine the predictive value of glioma SWI characteristics for the molecular marker status. In these cases, the ITSS grades of low-grade gliomas (LGG) were significantly lower than those of high-grade gliomas (HGG). Similarly, the ITSS grades of gliomas with IDH1 mutations and MGMT methylation were significantly lower than those of gliomas with Wild-type IDH1 and unmethylated MGMT. However, ITSS grades showed no relationship with 1p19q deletion status, while they did show significant predictive ability for glioma grade, IDH1 mutation, and MGMT methylation. These findings indicate an association between some molecular markers and cerebral microbleeds in gliomas, providing a new avenue for non-invasive prediction of molecular genetics in gliomas and an important basis for preoperative personalized surgical treatment based on molecular pathology.Susceptibility-weighted imaging (SWI) can be a useful tool to depict vascular structures in brain tumors as well as micro-bleedings, which represent tumor invasion to blood vessels and could also be representative of tumoral angiogenesis. In this study, we investigated the relationship between SWI features and glioma grades, and the expression of key molecular markers isocitrate dehydrogenase 1 ( According to the 2016 World Health Organization (WHO) Classification of Tumors of the Central Nervous System2, gliomas are further categorized on the basis of both histopathologic features and molecular characteristics, mainly because the importance of molecular types in tracing tumor origin and patient prognosis is being gradually recognized3. Among the numerous molecular characteristics of glioma, IDH gene mutations are the most critical, of which IDH1 mutation is closely associated with a good prognosis and favorable survival in patients4. Furthermore, patients with gliomas carrying the combined 1p19q deletion have a relatively favorable survival prognosis5, while MGMT methylation status is an important predictor of the glioma\u2019s sensitivity to alkylating agent chemotherapy7. However, assessments of these molecular markers are usually performed during pathological examinations after the resection of the tumor, and the molecular characteristics of the tumor are not known before surgery. Thus, the availability of non-invasive methods reflecting these molecular markers associated with the degree of malignancy of the tumor can facilitate individualized surgical treatment.Gliomas, which represent the most common type of primary malignant brain tumor, have an average annual incidence of 3\u20138 per 100,000 population and a survival period of about 10\u201320 months9 is a magnetic resonance imaging (MRI) sequence that is sensitive to paramagnetic substances such as hemosiderin deposition and mineral deposits. SWI exploits the susceptibility differences among tissues and uses the phase image to detect these differences. This image is combined with the magnitude image to create an enhanced contrast magnitude image, which is commonly used for detection of neovascularity (venous blood), microhemorrhage, and calcification inside the glioma10. Thus, the enhanced sensitivity of SWI for gliomas yields a better contrast in the identification of tumor boundaries and tumor hemorrhage, thereby enabling the determination of the tumor status, including the location of microhemorrhages and the degree of hemorrhage in gliomas. Moreover, the extent of microhemorrhage in different gliomas may be related to heterogeneity in their biological properties11. Although SWI has been used to evaluate the microhemorrhage, neovascularization, and preoperative grading of gliomas12, only a few previous studies have attempted to analyze the biological characteristics of gliomas using SWI. In this study, SWI images of gliomas were collected to analyze the correlations between imaging features and key molecular markers such as IDH1, MGMT, and 1p19q in order to reveal the characteristics of molecular markers associated with glioma microbleeds, which can provide a scientific basis for guiding individualized surgery in the future.Susceptibility-weighted imaging (SWI)IDH1 testing and 61 of them showed IDH1 mutations; 101 patients underwent MGMT examinations and 82 showed MGMT methylation; and 88 patients underwent 1p19q testing and 30 showed a combined 1p19q deletion. In addition, ITSS grade was not related to sex or age. The agreement in the assessment of ITSS grades between the two neurosurgeons was 97.5%. In the 2.5% (3/122) of cases where the two raters disagreed, a third senior neurosurgeon made the decision.The clinical, molecular pathological, radiological, and SWI data of 122 patients with gliomas were collected. The results are shown in Tables\u00a0p\u2009<\u20090.001). Similarly, the ITSS grades of IDH1-mutated gliomas were much lower than those of Wild-type gliomas (p\u2009<\u20090.001), and the ITSS grades of MGMT-methylated gliomas were much lower than those of MGMT-unmethylated gliomas (p\u2009<\u20090.001). However, there were no significant differences in 1p19q deletion status in relation to ITSS grade (p\u2009=\u20090.19)  of these patients showed IDH1 mutations; 35 underwent MGMT testing and 19 (54%) showed MGMT methylation; and 24 underwent 1p19q examinations and four (17%) showed 1p19q codeletions. However, among patients with ITSS grade 1, 42 underwent IDH1 testing and 37 (88%) of them showed IDH1 mutations; 46 underwent MGMT testing and 43 (93%) showed MGMT methylation; and 43 underwent 1p19q examinations and 19 (44%) showed 1p19q codeletions. More interestingly, all patients diagnosed with ITSS grade 0 gliomas showed IDH1 mutations and MGMT promoter methylation.The preoperative SWI images and expression status of molecular markers were analyzed, and the results are summarized in Table\u00a0IDH1, MGMT, and 1p19q status in the LGG group and the HGG group, respectively (Table\u00a0IDH1-mutated gliomas were significantly lower than those of Wild-type gliomas (p\u2009<\u20090.01). In addition, ITSS grades of MGMT-methylated gliomas were lower than those of MGMT-unmethylated gliomas (p\u2009=\u20090.041).We analyzed the association between ITSS grades and ly Table\u00a0. In the IDH1, MGMT, and 1p19q. The ITSS grade showed a significant effect in predicting pathological grade and the expression status of IDH1 and MGMT. The receiver operating characteristic (ROC) curve analysis indicated that 1.5 was the best cutoff value  to predict pathological grade, 2.5 was the optimal cutoff value  to predict IDH1 status; and 2.5 was the best cutoff value  to predict MGMT status. However, the ITSS grade showed no significant effect in predicting the expression status of 1p19q (AUC\u2009=\u20090.58) . Statistical comparisons show significant differences in hemorrhage in small blood vessels and microvessels between gliomas of different grades, with higher tumor grades indicating greater presence of small blood vessels and hemorrhage in the tumor. Therefore, the higher the grade of a glioma, the higher its ITSS grade16. The classification of gliomas is not only based on histopathology but also on the molecular characteristics of the tumor, which are crucial for the treatment and prognosis of glioma17. This study used a standard SWI grading method to identify correlations between ITSS imaging features and tumor as well as molecular pathology, and confirmed the findings of previous studies that showed that SWI plays an important role in predicting the status of molecular glioma markers.In previous studies, SWI and SWI-based ITSS grading were widely used in the preoperative diagnosis of brain tumors. In cases of gliomas, this approach plays an especially important role in tumor grading, assessments of calcification, hemorrhage and neovascularization, differential diagnoses between gliomas and other intracranial lesions, and post-treatment monitoring. SWI has significant advantages in the identification of gliomas, lymphomas, metastases, meningiomas, and brain abscesses3. Among the gene markers of gliomas, IDH gene mutations and MGMT methylation are the most critical, and these mutations have an important influence on the prognosis of gliomas. Previous studies have confirmed that IDH1 mutations lead to the activation of the hypoxia-inducible factor (HIF)-1\u03b1 pathway18, which may be one of the carcinogenic mechanisms. The activity of HIF-1\u03b1 plays a central role in maintaining energy metabolism, tumor angiogenesis, and promoting tumor cell proliferation and metastasis. Pol\u00edvka et al.19 found that IDH mutations were associated with lower expression of vascular endothelial growth factor (VEGF). Another recent study found that platelet derived growth factor receptor alpha (PDGFRA) is enriched in MGMT-methylated gliomas20, which plays a role in platelet activation, secretion of agonists from platelet granules, and in thrombin-induced platelet aggregation. The process of angiogenesis is turned on by the presence of hypoxia that results in upregulation of HIF1\u03b1, which subsequently leads to the upregulation of vascular permeability factors such as VEGF21. PDGF was also identified to play an important role in tumor angiogenesis. These findings suggest that IDH1 mutations and MGMT methylation are associated with tumor angiogenesis. ITSS reflects microhemorrhage in gliomas, as described previously. Our study found that IDH1 mutations and MGMT methylation are related to ITSS grading, providing new evidence for the relation between imaging findings and molecular genetic mechanisms associated with angiogenesis resulting from IDH1 mutations and MGMT methylation.The latest research findings show that some specific molecular markers are closely related to the origin and malignant progression of the glioma22. Non-invasive MRI can help provide a more comprehensive perspective on tumor molecular and pathological profiles by providing complementary information on spatial heterogeneity and temporal changes compared to molecular and conventional pathology alone, which often relies on focal surgical sampling. In addition, the non-invasive nature of MRI can facilitate periodic monitoring of the malignant progression of tumors, which has much significance in predicting the prognosis of patients and evaluating therapeutic effects. Research studies have successfully combined imaging with genomics to evaluate clinical prognoses in cases of lung cancer, head and neck cancer, and gliomas24. For example, a recent study found that the apparent diffusion coefficient (ADC) and relative cerebral blood flow (rCBF) are promising imaging biomarkers to predict MGMT methylation in patients with glioma25. Multimodal MRI was also performed for molecular typing in gliomas, and proved to be effective in predicting the expression of IDH1 in glioma26. Although there are numerous studies on SWI, most have focused on glioma grading and few have combined SWI with genetic markers. However, to the best of our knowledge, this is the first study that combines SWI and glioma biomarkers. The advantage of SWI over advanced functional imaging lies in better detection of micro-bleeding and angiogenesis. We found that these imaging characteristics are related to the status of tumor molecular markers. This provides new ideas for the non-invasive prediction of the molecular genetics of gliomas, and also an important basis for preoperative personalized surgical treatment based on molecular pathology.With advancements in imaging technology, simple structural images have evolved to multi-parametric functional images, which can non-invasively and dynamically reflect the microenvironment, blood supply, and metabolism of tissues (cells)Some limitations of our study should also be considered. SWI imaging features are related to the amount of internal bleeding in the tumor. A small amount of bleeding may exaggerate the low signal area, which can obscure other structures in the lesion; moreover, the significantly low signal area caused by extensive hemorrhage may conceal the blood vessels inside the tumor and hinder the correct assessment of the blood vessels. Therefore, it is not easy to use SWI to perform quantitative analyses, but, currently, it is often necessary to use ITSS grading. ITSS scores are generally a reliable and stable basis for classifying SWI findings of gliomas. In our study, the assessment of ITSS grades was highly consistent between the two neurosurgeons. Only in 2.5% of cases, disagreements between the first two neurosurgeons occurred, probably caused by a judgment error of one rater. Besides, improvements in scanning parameters can enhance SWI to achieve an even more detailed depiction of venules and hemorrhages in gliomas, thereby providing more comprehensive information regarding the internal structures of the tumor. Despite these limitations, SWI is an excellent sequence for observing the internal components of tumors. Future research should combine SWI features with genetic features to explore the genetic mechanisms associated with intratumoral hemorrhage.The study protocol was approved by the ethics committee of Beijing Tiantan Hospital and all procedures were in accordance with the institutional guidelines and regulations. The findings for 122 adult patients who were diagnosed with gliomas and underwent surgical therapy at Beijing Tiantan Hospital from December 2013 to August 2017 were retrospectively reviewed. All study participants aged 18 or more provided signed informed consent, and for those under the age of 18, the parents provided informed consent according to the approved guidelines. Cases were included when they met the following criteria: (i) age 16 years or older; (ii) no previous diagnosis of any brain tumor, no history of brain biopsy or brain surgery, and no history of brain radiotherapy and chemotherapy; (iii) preoperative multimodal MRI data available ; (iv) pathologically confirmed glioma based on the 2016 classification of tumors of the central nervous system; and (v) molecular markers assessed for tumor samples. The histopathological diagnosis was evaluated and confirmed by two independent senior neuropathologists.2 and acquisition voxel size of 1.0\u2009\u00d7\u20091.0\u2009\u00d7\u20091.0\u2009mm3; T2-weighted images  with an FOV and matrix size of 240\u2009\u00d7\u2009240 mm2, and acquisition voxel size of 1.0\u2009\u00d7\u20091.0\u2009\u00d7\u20095.0\u2009mm3; gadolinium-DTPA (Gd-DTPA) injection-enhanced (0.1\u2009mmol/kg) axial T1-weighted images  with an FOV and matrix size of 240\u2009\u00d7\u2009240 mm2, and SWI images  with an acquisition voxel size of 0.8\u2009\u00d7\u20090.7\u2009\u00d7\u20091.2\u2009mm3 obtained using a 3-dimensional, high-spatial resolution, fully velocity-compensated gradient echo sequence. Postcontrast images were obtained immediately after injection of the contrast agent. The radiologic parameters in preoperative scans of all patients were maintained consistently.MR imaging was performed using a Siemens Trio 3.0\u2009T scanner . It typically included axial T1-weighted  images with a field of view (FOV) and matrix size of 256\u2009\u00d7\u2009256 mm27 is defined as linear or dot-like areas of low signal gathering or scattering in the tumors, which can be clearly observed on SWI in comparison with conventional MRI . Second, the genomic region spanning the Wild-type R132 of IDH1 was amplified with the primers 5\u2032-GCTTGTGAGTGGATGGGTAAAAC-3\u2032 and 5\u2032-biotin-TTGCCAACATGACTTACTTGATC-3\u2032. Then, the MGMT methylation status was determined by pyrosequencing using a 5\u2032- GGATATGTTGGGATAGT-3\u2032 primer aimed at the MGMT promoter region. A total of seven methylation sites were detected, and a methylation percentage greater than 10% was considered to indicate hypermethylation. Finally, fluorescence in situ hybridization was used to identify 1p19q deletion status.IDHI mutation status, MGMT methylation status, and combined 1p19q deletion status. In addition, AUC values were calculated from the ROC curve that was obtained with GraphPad Prism 7 to analyze the role of ITSS grading in predicting pathological grades and the expression status of IDH1, MGMT, and 1p19q.We used the Mann Whitney test in GraphPad Prism 7 for P-values and drew histograms to compare the ITSS grades of gliomas with pathological grades,"}
+{"text": "We investigated the association of plasma A\u03b21\u201338, A\u03b21\u201340, and A\u03b21\u201342 levels with imaging markers of neurodegeneration and risk of dementia in a prospective population-based study.Plasma amyloid-\u03b2 (A\u03b2) levels are increasingly studied as a potential accessible marker of cognitive impairment and dementia. However, it remains underexplored whether plasma A\u03b2 levels including the novel A\u03b2 peptide 1\u201338 . Dementia and its subtypes were defined on the basis of internationally accepted criteria.1\u201338, A\u03b21\u201340, and A\u03b21\u201342 (in pg/ml) were 19.4\u2009\u00b1\u20094.3, 186.1\u2009\u00b1\u200935.9, and 56.3\u2009\u00b1\u20096.2, respectively, at baseline. Lower plasma A\u03b21\u201342 levels were associated with smaller hippocampal volume . After a mean follow-up of 14.8\u00a0years , 79 persons developed dementia, 64 of whom were diagnosed with Alzheimer\u2019s disease (AD). Lower levels of A\u03b21\u201338 and A\u03b21\u201342 were associated with increased risk of dementia, specifically AD  after adjustment for age, sex, education, cardiovascular risk factors, apolipoprotein E \u03b54 allele carrier status, and other A\u03b2 isoforms.A total of 458 individuals  with baseline MRI scans and incident dementia were included. The mean\u2009\u00b1\u2009SD values of A\u03b21\u201342 levels were related to smaller hippocampal volume. These results suggest that plasma A\u03b21\u201338 and A\u03b21\u201342 maybe useful biomarkers for identification of individuals at risk of dementia.Our results show that lower plasma A\u03b2 levels were associated with risk of dementia and incident AD. Moreover, lower plasma A\u03b2 Amyloid cascade . Accordi vessels . This A\u03b21\u201340 and A\u03b21\u201342 peptides are the two most studied AD biomarkers, which can be measured in plasma through minimally invasive techniques and thus can feasibly be determined in large samples. Several large community-based studies have reported on the association of high plasma A\u03b21\u201340 and A\u03b21\u201342 levels and lower A\u03b21\u201342/A\u03b21\u201340 ratios at baseline with risk of dementia and reduced cognitive measure scores [1\u201342 but not A\u03b21\u201340 with risk of AD [1\u201342 and A\u03b21\u201340 levels and higher A\u03b21\u201342/A\u03b21\u201340 ratio with reduced risk of dementia [1\u201342 concentrations over time. Though most of the study results are inconsistent, they nevertheless do suggest that plasma A\u03b2 levels may be differentially associated with the risk for AD, possibly reflective of the stage of the disease and the complex pattern of production and clearance from the brain [1\u201340 and A\u03b21\u201342 may induce cerebral atrophy, detected on magnetic resonance imaging (MRI) studies as cortical thinning in asymptomatic elderly persons through mechanisms such as synaptic deficits and neuronal loss [A\u03b2e scores \u20137. Two ssk of AD , 9. Convdementia , 11. Londementia  and persdementia  showed snal loss -15 . Mor1\u201340 and A\u03b21\u201342 peptides, which have been investigated extensively, another isoform\u2014A\u03b21\u201338\u2014is of interest because it is reported to be elevated in the cerebrospinal fluid (CSF) of patients with sporadic AD [1\u201338 as an additional biomarker for differential diagnosis of dementia [1\u201338, are associated with preclinical markers of neurodegeneration, such as gray matter, white matter, and hippocampal atrophy, and the risk of dementia in a large population-based setting. We examined the association of plasma A\u03b21\u201338, A\u03b21\u201340, and A\u03b21\u201342 levels with neurodegenerative markers and risk of dementia in a subsample of the Rotterdam Study.Besides A\u03b2radic AD . Moreovedementia , 18. Desn\u2009=\u2009563) during the second visit of the first cohort (1995\u20131996) and were invited to undergo neuroimaging [n\u2009=\u200922), no MRI scans (n\u2009=\u200973), and prevalent dementia (n\u2009=\u200910) were removed, the final sample size consisted of 458 persons [The Rotterdam Study is a population-based prospective cohort study of middle-aged and elderly persons living in the Ommoord district in the city of Rotterdam, the Netherlands. All participants in this study undergo reexamination every 3\u20134\u00a0years and are being followed continuously for events, including occurrence of dementia. This study is embedded within the first cohort, which was initiated in 1990 with 7983 participants at baseline (aged \u2265\u200955\u00a0yr). Persons were randomly selected , plasma samples were stored at \u2212\u200980\u00a0\u00b0C within 60\u00a0minutes of collection. Plasma levels of A\u03b21\u201338, A\u03b21\u201340, and A\u03b21\u201342 were quantified by EUROIMMUN \u03b2-Amyloid 1\u201338, 1\u201342, and 1\u201340 plasma enzyme-linked immunosorbent assays , which have been validated and described in more detail previously [1\u201338, 67.6\u2013161.8\u00a0pg/ml for A\u03b21\u201340, and 46.6\u201355.6\u00a0pg/ml for A\u03b21\u201342. The average coefficients of variation of measurement of A\u03b21\u201338, A\u03b21\u201340, and A\u03b21\u201342 in QC plasma samples during the study were 11.04%, 5.72%, and 8.70%, respectively [Blood samples were drawn into ethylenediaminetetraacetic acid (EDTA) tubes for plasma collection. After centrifugation  to obtain T1-weighted, proton density, T2-weighted, and high-resolution inversion recovery double-contrast three-dimensional half-Fourier-acquired single-shot turbo spin echo (HASTE) sequences . Image ppocampus .Diagnostic and Statistical Manual of Mental Disorders, Third Edition\u2013Revised). The diagnosis of AD was made using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer\u2019s Disease and Related Disorders Association [Participants were screened for dementia at baseline and at follow-up examinations . Screeniociation  and Natiociation . The firData on demographics and medical history were recorded on the same day of dementia screening. Blood pressure was measured in two readings using a random zero sphygmomanometer in a sitting position, and the mean of both measurements was calculated. Mean arterial blood pressure was calculated as two-thirds of the diastolic blood pressure plus one-third of the systolic blood pressure. Serum total cholesterol levels were measured using an automated enzymatic procedure. Diabetes mellitus was defined as fasting blood glucose \u2265\u20097\u00a0mmol/L or receiving treatment for diabetes. Smoking was categorized into ever versus never smokers. Education was treated as the number of years of formal education. Apolipoprotein E (APOE) genotype was determined using PCRs on coded DNA samples. Distribution of APOE genotype and allele frequencies were in Hardy-Weinberg equilibrium. APOE-\u03b54 carrier status was defined by the presence of at least one \u03b54 allele.1\u201340/A\u03b21\u201342 ratio was calculated using raw values of A\u03b21\u201340 and A\u03b21\u201342 levels. We first performed linear regression models to determine the association between A\u03b2 levels and brain tissue volumes . The models were adjusted for age, sex, intracranial volume, mean arterial blood pressure, total cholesterol, diabetes, smoking, and APOE-\u03b54 carrier status. We tested the independent effects of A\u03b2 levels with brain tissue volumes by adding all three isoforms together in the regression models.Plasma A\u03b2 levels and brain tissue volumes were standardized (by subtracting each variable by population mean divided by SD). Plasma A\u03b2 levels were expressed as per-SD decrease. The A\u03b21\u201338, A\u03b21\u201340, A\u03b21\u201342, and A\u03b21\u201340/A\u03b21\u201342 ratio with follow-up time in different models. All Cox proportional hazards models were initially adjusted for age, sex, and education and subsequently for mean arterial blood pressure, total cholesterol, diabetes, smoking, APOE-\u03b54 carrier status, and the other A\u03b2 isoforms using a similar approach to the one described above. We also investigated whether the association between plasma A\u03b2 and dementia was different in carriers and noncarriers of the APOE-\u03b54 allele. The level of significance was set to 5%, and all tests were two-sided. Statistical analyses were performed using IBM SPSS Statistics version 24 software .Using Cox proportional hazards models, we calculated HRs with corresponding 95% CIs for dementia and its subtypes with per-SD decrease in A\u03b2 level. Participants were censored within the follow-up period at date of event diagnosis, death, or loss to follow-up, whichever came first. The proportional hazards assumption was tested by adding the interaction terms of A\u03b2n = 137) persons were APOE-\u03b54 carriers. The mean\u2009\u00b1\u2009SD values of A\u03b21\u201338, A\u03b21\u201340, and A\u03b21\u201342 were 19.4\u2009\u00b1\u20094.3, 186.1\u2009\u00b1\u200935.9, and 56.3\u2009\u00b1\u20096.2, whereas for white matter volume, gray matter volume, and hippocampal volume, the respective values were 354.1\u2009\u00b1\u200985.4, 522.7\u2009\u00b1\u200955.8, and 6.4\u2009\u00b1\u20090.9. The correlation between A\u03b21\u201338 and A\u03b21\u201340 was 0.81 ; between A\u03b21\u201338 and A\u03b21\u201342, R\u2009=\u20090.24, and between A\u03b21\u201340 and A\u03b21\u201342, R\u2009=\u20090.25.Baseline characteristics of the participants are shown in Table\u00a01\u201338, A\u03b21\u201340, and A\u03b21\u201342 levels and lower A\u03b21\u201340/A\u03b21\u201342 ratio were not associated with total brain, gray, and white matter volumes. A significant association was observed between lower plasma A\u03b21\u201342 levels and smaller hippocampal volume .Table\u00a0p value for interaction between A\u03b21\u201338 and time, p\u2009=\u20090.832; between A\u03b21\u201340 and time, p\u2009=\u20090.820; between A\u03b21\u201342 and time, p\u2009=\u20090.998; and between A\u03b21\u201340/A\u03b21\u201342 ratio and time, p\u2009=\u20090.984). In the multivariable analysis, lower levels of A\u03b21\u201338 and A\u03b21\u201342 were associated with increased risk of dementia  . The HRs for AD and vascular dementia were closely similar but insignificant in cases of vascular dementia , whereas for A\u03b21\u201342, this association was observed only among APOE-\u03b54 noncarriers  , 241 individuals died. In the same follow-up, 79 persons developed dementia. Of these 79 individuals with dementia, 64 were diagnosed with AD and 15 with vascular dementia. The interaction terms of A\u03b2 levels with follow-up time in all models were nonsignificant , except for A\u03b21\u201342 levels were associated with thinner temporal cortex in cognitively normal elderly persons [1\u201338 in addition to A\u03b21\u201340 and 1\u201342 on cerebral atrophy and whether it is an important fluid biomarker for neurodegeneration and dementia has not been explored previously. Contrary to what we expected, our findings showed that lower plasma A\u03b2 levels (including A\u03b21\u201338) were not related to brain tissue volumes, except for hippocampal volume, where a significant association was observed between lower A\u03b21\u201342 levels and smaller hippocampal volume in the elderly. The possible reason for the lack of association between A\u03b21\u201338 and brain atrophy could be that plasma A\u03b21\u201338 levels may reflect vascular disease in the brain rather than neurodegeneration. On one hand, this is supported by our previous study in which we showed that A\u03b21\u201338 reflected microvascular damage in the brain and possibly induced adverse changes by inflammation, imbalance of oxygen free radicals, and apoptosis [1\u201342 and the hippocampus in the present study supports the notion that as A\u03b21\u201342 starts to deposit in the brain after the age of 60\u00a0years, lower plasma A\u03b2 levels that follow this deposition relate to hippocampal atrophy. A recent study has shown that accumulation of A\u03b2 and tau pathologies in the brain were related to a decrease in hippocampal volume, including its critical subcompartments  in the earliest stages of AD prodromes [Previous research has shown that higher plasma A\u03b2 levels (1\u201340 and 1\u201342 peptides) at baseline were associated with cognitive dysfunction and faster cognitive decline, regardless of dementia status at follow-up, supporting the notion that plasma A\u03b2 may induce a variety of brain pathologies  earlier in life . A recen persons . Howeverpoptosis . On the rodromes . Moreoverodromes . By controdromes .1\u201342 levels significantly decline in concentration in persons with newly diagnosed AD compared with individuals with prevalent AD and control subjects [1\u201342 levels decline at an average rate of 12% per year among individuals with mild cognitive impairment [1\u201338, in addition to A\u03b21\u201340 and A\u03b21\u201342, were associated with a reduced risk of dementia. The association of A\u03b21\u201338 and A\u03b21\u201342 with dementia persisted when all the isoforms were added together in the model, indicating an independent link with increased dementia risk. These observations further support the findings that A\u03b21\u201338 and A\u03b21\u201342 may be generated independently by \u03b3-secretase and that the production of these peptides is not coordinately regulated [1\u201338 levels were increased upon treatment with sulindac sulfide with no concurrent effect on A\u03b21\u201342 levels, thus arguing against a precursor\u2013product relationship [1\u201338 levels and neurodegenerative markers in this study, a link was still observed between lower levels of A\u03b21\u201338 and increased risk of dementia. As mentioned before, the A\u03b21\u201338 isoform is a marker of vascular pathology, and a higher level may indicate the activation of different inflammatory cascades  [Several lines of evidence suggest that A\u03b2 levels in the CSF and plasma are in dynamic equilibrium with each other and that increased A\u03b2 production in the brain gives rise to raised levels in the plasma . It is fsubjects . It is apairment . Our resegulated . This wationship , 38. Thoactor \u03b1) , which mactor \u03b1) .1\u201338 and A\u03b21\u201342 levels with AD and vascular dementia. Though the significant results were observed only in cases of AD, this finding might be related to the fact that most of the individuals diagnosed with incident dementia had AD (72%). Also, in an elderly population, mixed pathology is commonly observed, which might explain the similar estimates for AD and vascular dementia. Moreover, the association of lower levels of A\u03b21\u201338 with increased risk of dementia was more significant in carriers of the APOE-\u03b54 allele than in noncarriers. Though an opposite link was observed between A\u03b21\u201342 and increased dementia risk in APOE-\u03b54 noncarriers, the similarity in the direction of effect estimates further suggests a role of mixed pathology in the development of dementia, regardless of APOE carrier status.With respect to the subtypes of dementia, similar associations were observed between plasma A\u03b2Strengths of our study include its prospective design, the population-based setting, volumetric quantification of the brain tissues, and virtually complete follow-up for dementia in the older cohort. There are some potential limitations of our study. First, because plasma samples were collected after MRI acquisition with a 3-year time window, the effect estimates calculated in this study may represent over- or underestimations. Second, plasma A\u03b2 levels provide an indirect measure of brain-specific A\u03b2 pathology, and an in vivo analysis of brain-specific A\u03b2 burden (such as with amyloid positron emission tomography) could allow more accurate measures of A\u03b2 burden. Finally, we lacked repeated measurement of plasma A\u03b2 concentrations, which limits its ability to better estimate the trajectory of plasma levels over time in relation to risk of dementia. However, this could be a subject for further studies.1\u201338 and A\u03b21\u201342, are associated with increased risk of dementia, specifically AD. Future studies should examine whether inclusion of novel plasma A\u03b21\u201338 levels as an additional biomarker can provide further information on risk of developing dementia and AD dementia.This study provides evidence that lower plasma A\u03b2 levels, specifically A\u03b2"}
+{"text": "Levels of A\u03b21\u201042 were standardized to certified reference material. Amyloid scans were assessed visually and through automated quantification. We determined the cutoffs of CSF biomarkers that optimized their agreement with 18F\u2010Florbetapir PET and evaluated concordance between markers of the amyloid category.Participants had mild cognitive impairment  and the ratios with A\u03b21\u201042 had good diagnostic agreement with 18F\u2010Florbetapir PET. As a marker of amyloid pathology, the A\u03b21\u201042/A\u03b21\u201040 ratio had higher agreement and better correlation with amyloid PET than A\u03b21\u201042 alone.A\u03b21\u201042 with A\u03b21\u201040 increases the agreement between markers of amyloid pathology.CSF biomarkers measured with the Lumipulse G System show good agreement with amyloid imaging in a clinical setting with heterogeneous presentations of neurological disorders. Combination of A Our aims were to determine for the first time the cutoffs that optimized the agreement between 18F\u2010Florbetapir PET and A\u03b21\u201042, A\u03b21\u201040, tTau, pTau and their ratios measured in CSF on the LUMIPULSE G600II instrument, and to evaluate the concordance between markers of the amyloid category.In recent years, fully automated platforms have been developed for the analysis of CSF biomarkers. Recently, four CSF analytes . All participants gave written consent, and the ethics committee of Hospital Sant Pau approved all procedures included in this study.We included 94 participants from the Sant Pau Initiative on Neurodegeneration (SPIN cohort) recruited between November 2013 and September 2017 who had available CSF samples and g\u00a0\u00d7\u00a010\u00a0min, 4\u00b0C), volumes of 0.5\u00a0mL of CSF were aliquoted into polypropylene tubes  and stored at \u221280\u00b0C until analysis.CSF samples were collected in 10\u00a0mL polypropylene tubes  and transferred to the Sant Pau Memory Unit's laboratory where they were processed within the first 2\u00a0h after acquisition. After centrifugation  and following the manufacturer's instructions. We used an adapter to fit the tubes in the equipment. We used the same batch of reagents for each biomarker throughout the study, and for each sample, we measured all four analytes from the same aliquot and in the same run. The platform was configured to start the analysis with A\u03b21\u201042, followed by A\u03b21\u201040, tTau and pTau. Buffer\u2010based quality control testing was performed at the beginning of each test day to ensure that all measured values of each control level  were within the target ranges.On the day of the analysis, samples were thawed at room temperature and the tubes were vortexed for 5\u201310\u00a0sec. To avoid the effect of multiple freeze\u2010thaw cycles, aliquots used in this study had not been thawed before. A\u03b2\u2010Amyloid 1\u201042 presented in this study have been standardized according to certified reference material developed by the International Federation of Clinical Chemistry and Laboratory Medicine as recommended by their working group for CSF proteins.\u03b21\u201042 to make results comparable across different platforms.The results of the Lumipulse G \u03b21\u201042, A\u03b21\u201040, tTau and pTau levels in CSF from participants of this study had been measured previously using other immunoassays (INNOTEST \u03b2\u2010AMYLOID(1\u201042), INNOTEST hTAU Ag, and INNOTEST PHOSPHO\u2010TAU(181P), Fujirebio Europe; and High Sensitivity Human Amyloid \u03b240, Merck\u2010Millipore), and these results were available in our database for their comparison with the LUMIPULSE analyses.AThe personnel involved in the CSF analyses for this study were blinded to the clinical diagnosis and to previous biomarker determinations.18F\u2010Florbetapir as described elsewhere.18F\u2010Florbetapir. After obtaining the transmission data, brain PET dynamic acquisition was performed (2\u00a0\u00d7\u00a05\u00a0min frames). The reconstruction method was iterative  with a 128\u00a0\u00d7\u00a0128 image size, 2\u00a0mm pixel size and slice thickness.All participants underwent amyloid PET imaging with Three expert readers  blind to clinical diagnosis and to CSF biomarkers visually rated all PET scans. Following manufacturer's protocol, scans were classified as \u201cpositive\u201d when one or more areas showed increased cortical gray matter signal resulting in reduced or absent contrast between gray matter and white matter. Scans were classified as \u201cnegative\u201d when the contrast between gray matter and white matter was clear. Final classification as \u201cpositive\u201d or \u201cnegative\u201d was decided upon agreement of at least two of three readers. Mean inter\u2010reader overall agreement was 88.4% .18F\u2010Florbetapir template using a linear and nonlinear transformation.18F\u2010Florbetapir uptake was measured across frontal, lateral parietal, lateral temporal and anterior/posterior cingulate. Then, the 18F\u2010Florbetapir standardized uptake value ratio (SUVR) map was extracted using the whole cerebellum as reference.18F\u2010Florbetapir quantification and excluded of quantitative analyses.We also quantified amyloid deposition. Each participant's PET scan was spatially normalized to a MNI152 \u03b21\u201042, A\u03b21\u201040, tTau, pTau and the ratios A\u03b21\u201042/A\u03b21\u201040, tTau/A\u03b21\u201042 and pTau/A\u03b21\u201042 to calculate areas under the curve (AUC) with 95% confidence intervals (DeLong). We compared ROC curves by two\u2010sided bootstrapping with 2000 replications. For biomarkers and ratios that showed AUC higher than 0.70, we determined positive percent agreement (PPA or sensitivity) and negative percent agreement (NPA or specificity) and calculated optimal cutoffs maximizing their Youden J index (PPA\u00a0+\u00a0NPA\u00a0\u2212\u00a01). We calculated overall percent agreement (OPA) between CSF biomarker cutoffs and amyloid PET visual interpretation as the sum of participants classified as \u201cpositive\u201d or as \u201cnegative\u201d by both modalities over the total number of participants. We also analyzed the correlation of CSF biomarkers with global amyloid accumulation by fitting quadratic models and calculated the agreement of CSF biomarkers cutoffs with the PET scans quantification status applying a previously described SUVR cutoff of 1.11.\u03b1\u00a0=\u00a00.05. We used Analyse\u2010it\u00ae statistical software for the selection of optimal cutoffs and packages \u201ccar\u201d , \u201cpROC\u201d , \u201cgrid\u201d (R core team 2019) and \u201cggplot2\u201d  as implemented in R statistical software (v 3.6.0) for plots and statistical analyses.We performed receiver operating characteristic (ROC) analysis for AAPOE\u03b54 carriers compared to the amyloid\u2013negative group .We included 94 participants in the study. Table \u03b21\u201042, A\u03b21\u201040, tTau and pTau levels simultaneously on the Lumipulse G System. Their levels in the overall study population ranged from 315 to 2280\u00a0pg/mL for A\u03b21\u201042, 4585 to 25925\u00a0pg/mL for A\u03b21\u201040, 141 to 1902\u00a0pg/mL for tTau, and 18 to 340\u00a0pg/mL for pTau.We measured AThe analyses were divided over three calibration runs on the LUMIPULSE G600II, and the calibration status was valid for all samples. Mean interassay coefficients of variation are displayed in Figure \u03b21\u201042, tTau and pTau showed very high correlation with values previously measured with Fujirebio's INNOTEST ELISA . The Lumipulse G assay for A\u03b21\u201040 showed moderate correlation with values measured with Merck\u2010Millipore's ELISA . On the Lumipulse G system, tTau and pTau were highly correlated .Most CSF samples included in this study had previously been analyzed using other immunoassays, and their results were available in our database. Although these historic results were obtained in the context of routine clinical assessment by using different batches, and therefore a side\u2010to\u2010side precision analysis could not be performed, we explored their correlation with the Lumipulse G quantifications. The Lumipulse G assays for AP\u00a0<\u00a00.001) and 0.84 , respectively. A\u03b21\u201042 had fair accuracy with an AUC of 0.76  and A\u03b21\u201040 alone was not useful for the detection of the visual status of amyloid scans .As displayed in Figure \u03b21\u201042 with a second analyte resulted in significant increases of accuracy. The AUC of A\u03b21\u201042/A\u03b21\u201040 was 0.86 , higher than that of A\u03b21\u201042 alone  or A\u03b21\u201040 alone . tTau/A\u03b21\u201042 had an AUC of 0.87 , higher than that of tTau , and pTau/A\u03b21\u201042 had an AUC of 0.88 , higher than that of pTau alone . There were no significant differences in the AUC of the three ratios, and combining a third biomarker in the ratios did not improve their accuracy (data not shown).Figure \u03b21\u201042, tTau and pTau, the selection was based on clear Youden peaks at 916, 456 and 63\u00a0pg/mL, respectively. For the ratios A\u03b21\u201042/A\u03b21\u201040, tTau/A\u03b21\u201042 and pTau/A\u03b21\u201042, plots showed plateau stages indicating that a wide range of cutoffs yielded similar Youden indices. Best cutoffs for ratios were 0.062 for A\u03b21\u201042/A\u03b21\u201040, 0.62 for tTau/A\u03b21\u201042, and 0.068 for pTau/A\u03b21\u201042.For those biomarkers and ratios that showed AUC higher than 0.70, we used ROC analysis to obtain PPA, NPA and OPA for all possible cutoffs. As displayed in Figure 18F\u2010Florbetapir and CSF biomarker cutoffs. For A\u03b21\u201042, tTau and pTau, the OPA values between visual status and CSF biomarkers status were 79%, 78% and 81%, respectively. The ratio of A\u03b21\u201042 with A\u03b21\u201040, tTau and pTau increased the OPA to 84%, 82% and 88%, respectively.Figure \u03b21\u201042, regardless of the A\u03b21\u201042/A\u03b21\u201040 ratio status, 77% (56 out of 73) had a positive amyloid scan. This proportion increased to 87% (52 out of 60) within this group when the A\u03b21\u201042/A\u03b21\u201040 ratio was also low but decreased to 31% (four out of 13) when the A\u03b21\u201042/A\u03b21\u201040 ratio was high. In the group of participants with high CSF levels of A\u03b21\u201042, the impact of considering the A\u03b21\u201042/A\u03b21\u201040 status had no effect, as in all participants within this group the A\u03b21\u201042/A\u03b21\u201040 ratio was also high. These results highlight the importance of using the A\u03b21\u201042/A\u03b21\u201040 ratio over A\u03b21\u201042 alone in the assessment of brain amyloidosis, especially in patients with low CSF levels of A\u03b21\u201042.Within each CSF biomarker status, the proportion of positive amyloid scans varied when a second biomarker or ratio was taken into account. Figure We next processed amyloid PET scans to obtain quantification values of amyloid deposition. In our study, the previously validated SUVR value of 1.11,2R) were higher for all ratios compared to individual biomarkers. The combination of A\u03b21\u201042 with A\u03b21\u201040 increased the 2R value to 0.44 (P\u00a0<\u00a00.001), indicating that this ratio reflects the amyloid deposition better than A\u03b21\u201042 alone. Stratified analysis by 18F\u2010Florbetapir visual status showed lower 2R values for all biomarkers, which suggests that the correlation observed between CSF biomarkers and amyloid PET quantification is partially mediated by an amyloid\u2010status effect. In this stratified analysis, the highest correlation of SUVR values was found with the A\u03b21\u201042/A\u03b21\u201040 ratio in the amyloid\u2013negative group .As seen in Figure \u03b21\u201042, A\u03b21\u201040, tTau and pTau) and their ratios measured on the fully automated LUMIPULSE G600II platform to optimize their concordance with 18F\u2010Florbetapir PET. We calibrated A\u03b21\u201042 levels to certified reference material, recently developed to harmonize immunoassays across different platforms, and found that the ratios A\u03b21\u201042/A\u03b21\u201040, tTau/A\u03b21\u201042 and pTau/A\u03b21\u201042 had better diagnostic agreement with visual assessment of amyloid scans than single biomarkers. As a marker of amyloid pathology, the A\u03b21\u201042/A\u03b21\u201040 ratio had higher agreement with amyloid PET visual status and showed better correlation with amyloid load quantification compared to A\u03b21\u201042 alone.In our study, we determined cutoffs for four CSF biomarkers for AD  can lead to disparities in the selection of cutoffs. Third, the composition of the populations was not the same across studies. Schindler et al. analyzed data from community\u2013dwelling volunteers,The agreement between amyloid imaging and AD CSF biomarkers has previously been studied by using other automated immunoassays.\u03b21\u201040. In previous studies, and ours, this biomarker alone was not useful for the detection of brain amyloid.\u03b21\u201042 and the A\u03b21\u201042/A\u03b21\u201040 ratio are included in the \u201cA\u201d category of the ATN classification system together with amyloid PET, but in line with other studies,\u03b21\u201042/A\u03b21\u201040 ratio had better agreement with visual amyloid status and higher correlation with brain amyloid quantification. Our results are in line with previous literature that suggests that the use of the A\u03b21\u201042/A\u03b21\u201040 ratio could compensate individual differences in amyloid precursor protein processing that otherwise might lead to false positive or false negative A\u03b21\u201042 CSF levels.\u03b21\u201042/A\u03b21\u201040 ratio has proven to partially mitigate the effect of some preanalytical confounders that have been described to alter the results of amyloid levels.\u03b21\u201042/A\u03b21\u201040 ratio would be more reliable in clinical practice than A\u03b21\u201042 alone as a marker of amyloidosis and that this combination should be used in routine.The LUMIPULSE G600II has incorporated the possibility of measuring CSF levels of A\u03b21\u201042, A\u03b21\u201040, tTau and pTau) measured simultaneously with the automated Lumipulse G System were compared for the first time to 18F\u2010Florbetapir PET to calculate amyloid\u2013based cutoffs. In addition, this is, to our knowledge, the first study to present A\u03b21\u201042 levels that have been standardized to certified reference material, recently developed to harmonize immunoassays across different platforms. Standardized values will make our study more easily comparable to future studies. Moreover, to avoid possible sources of variability, we followed homogeneous CSF preanalytical and analytical procedures and used the same batch of reagents for all measurements. Also, the inclusion of participants with neurodegenerative diseases outside the AD spectrum provides a more realistic application of biomarkers in daily clinical practice.The main strength of our study is that four AD CSF biomarkers , A\u03b21\u201040 (B), tTau (C) and pTau (D).Figure S2. Agreement of visual amyloid PET with the combination of two CSF biomarkers or ratios.Click here for additional data file."}
+{"text": "Data regarding PM10 and benzene daily measured by \u201ctraffic\u201d stations and \u201cbackground\u201d stations in Torino, Perugia, and Lecce during 2014 and 2015 were compared to the limits indicated in the Directive 2008/50/EC. In addition, an inhalation risk analysis for exposure to benzene was performed for adults and children by applying the standard United States Environmental Protection Agency\u2019s (USEPA) methodology. The levels of PM10 detected in Torino exceeded the legal limits in both years with an increased mean concentration >10 \u00b5g/m3 comparing with background station. Benzene concentrations never exceeded the legislative target value. The increased cancer risk (ICR) for children exposed to benzene was greater than 1 \u00d7 10\u22126 only in the city of Torino, while for adults, the ICR was higher than 1 \u00d7 10\u22126 in all the cities. The results suggest the need for emission reduction policies to preserve human health from continuous and long exposure to air pollutants. A revision of legal limits would also be recommended.Air pollution in urban areas is a major concern as it negatively affects the health of a large number of people. The purpose of this study was to assess the inhalation health risk for exposure to PM Outdoor air pollution is one of the most important environmental problem in both industrialized and developing countries, and in 2013, it was classified by the International Agency for Research on Cancer (IARC) as carcinogenic to humans (Group 1) [In particular, traffic-generated urban air pollution is common among all cities and in all seasons and is rich in some of the most dangerous airborne pollutants like particulate matter (PM) and benzene. 10), is a major constituent of outdoor air pollution. It is a highly variable and complex mixture of particles and gases emitted directly from sources or formed in the atmosphere from gaseous emissions. Resuspension of soil tracked onto roads and streets, suspension from disturbed soils, resuspension of industrial dusts, construction, and coal and oil combustion are considered the main sources of PM10 emission in urban areas [PM, particularly components less than 10 \u03bcm   and subs10 and benzene of people living in urban areas affected by vehicular traffic of three Italian cities  and their inhalation health risk.The aim of this research was to assess the level of exposure to PMThis study was included in the \u201cMonitoring Air Pollution Effects on Children for supporting public health policy\u201d (MAPEC_LIFE) project (LIFE12 ENV/IT/000614) , a multi10 and benzene in the years 2014 and 2015. The three towns  (Data on the concentration of PM Puglia) .10 and benzene in each monitoring station were measured continuously respectively by gravimetric method and gas-chromatography as indicated in the Directive 2008/50/EC on ambient air quality and cleaner air for Europe. The validated hourly values of PM10 and benzene in each monitoring station were entered in a Microsoft Excel database and processed in order to obtain the daily averages, which in turn were used to calculate the annual average, standard deviation (SD), and 95% upper confidence limit (UCL) of the mean concentration. The values of both PM10 and benzene were compared to the reference values indicated in Directive 2008/50/EC [p < 0.01) between traffic stations and relative background station. In addition, a linear regression model between benzene and PM10 concentrations was performed, and the correlation coefficient was calculated in each station for whole study time by the MedCalc software, version 14.8.1 .PM08/50/EC  and in t08/50/EC  in order3), the inhalation reference concentration, is the estimate of a continuous inhalation exposure for the human population (including sensitive subgroups) that is likely to be without appreciable risk of deleterious effects during a lifetime. EC (\u03bcg/m3) is the chronic exposure concentration, averaged over the exposure time for non-carcinogenic risk or over a lifetime for carcinogenic risk, calculated according to the following equation:3) is the air pollutant concentration in the exposure point corresponding to UCL of values measured in each monitoring station and in each time lapse, ET (h/day) is the exposure time, EF (days/year) is the exposure frequency, ED (years) is the exposure duration, and AT (years \u00d7 365 days/year \u00d7 24 h/day) is the averaging time of exposure.An inhalation risk analysis based on toxicological approach was performed for exposure to benzene through the use of the procedure described in the USEPA guidelines  and repo3)\u22121) is the Inhalation Unit Risk defined as the \u201cupper-bound excess lifetime cancer risk estimated to result from continuous exposure to an agent at a concentration of 1 \u03bcg/m3 in air\u201d [The increased cancer risk (ICR),  for a receptor exposed via the inhalation pathway to benzene was estimated with the following equation: in air\u201d .\u22122 mg/m3 and IUR equal to 7.80 \u00d7 10\u22126 (\u03bcg/m3)\u22121. The toxicity values were taken from the Integrated Risk Information System\u2019s (IRIS) toxicological database , which fThe values of exposure factors were taken from Exposure Factor Handbook  by takin10 \u00b1 SD measured in 2014 and 2015 at each monitoring station and the number of times in which the daily limit of 50 \u00b5g/m3 indicated by European regulation was exceeded are shown in 10 in urban areas of 14.52 \u00b5g/m3 to 18.78 \u00b5g/m3. These differences appeared to be significant in both years. In Perugia the differences between background and traffic stations ranged from \u22121.44 \u00b5g/m3 to 4.79 \u00b5g/m3, but only Cortonese Park station recorded significant increases in both years, while Fontivegge station showed a significant increase only in 2014. Finally, in Lecce, the increase of PM10 was significant in 2014 (1.55 \u00b5g/m3 to 3.00 \u00b5g/m3) for both traffic stations, while in 2015, the level of PM10 did not show appreciable differences between urban and non-urban areas.The annual average of PMBenzene concentration registered in all cities in 2014 and 2015 is reported in 10 concentrations showed a stronger correlation in Consolata station (Torino), followed by Rubino (Torino), Cortonese (Perugia), and Rebaudengo (Torino) stations, as shown in The linear regression between benzene and PM\u22122 mg/m3).The values for non-carcinogenic (HQ) risk associated with exposure to benzene in the cities of Torino, Perugia, and Lecce are shown in \u22126 in the city of Torino, with the highest value in Rebaudengo station, while in Perugia and Lecce, it was lower. For adults, the carcinogenic risk was greater than 1 \u00d7 10\u22126 in all the cities, with the highest values in Torino.The carcinogenic risk analysis conducted for benzene  showed t10 and benzene in Torino, Perugia and Lecce, detected by the Regional Environmental Protection Agency\u2019s monitoring stations located in each city, were acquired; the level of atmospheric pollution attributable to these contaminants was assessed comparing the data with the limits indicated in the Italian legislation; and the analysis of inhalation risk associated to benzene exposure was performed according to standard USEPA methodology. In this study the data concerning the airborne concentration of PM10 and benzene and confirm the high level of air pollution in this city documented in other studies [Data related to the concentration of airborne contaminants revealed that Torino is the most polluted among the cities involved in this study both for PM studies ,35,36,3710, the target value of the annual average stated in the legislation is equal to 40 \u00b5g/m3. This value was exceeded in Consolata and Rebaudengo stations (Torino) in 2015. In addition, for the same parameter, the legislation indicates a daily limit of 50 \u00b5g/m3, which must not be exceeded more than 35 times in a calendar year. In this case, all the stations located in Torino recorded a number of excesses over the limit both in 2014 and 2015. In Perugia and Lecce, the number of exceedances of the daily limit was lower than the maximum number allowed by the legislation in both years. The situation could be even more alarming if the WHO\u2019s Air Quality Guidelines [3 the limit for annual average of PM10. In our study, all the monitoring station located in urban areas measured annual averages of PM10 above the WHO limit highlighting a potential risk for cardiovascular and respiratory diseases caused by chronic exposure.In particular, with regards to PMidelines  are take3 indicated in the legislation. In this case, WHO guidelines set no safe limit for benzene, as even very low concentrations are considered to be potentially toxic.In contrast, the concentration of benzene measured by all the monitoring stations in both years never exceeded the limit of 5 \u00b5g/m10 could allow us to verify if vehicular traffic contributed to the concentration of these pollutants in urban environments. It is known that the exhaust fumes of motor vehicles contain high concentration of particulate and benzene [10 and benzene indicates a high contribution of vehicular traffic to urban pollution. In our study, this correlation was more evident in the city of Torino than in the other cities and confirmed the high concern about the vehicular traffic in this city highlighted in other studies [10 levels between the \u201ctraffic\u201d and \u201cbackground\u201d stations. It highlighted in Torino a significant contribution of vehicular traffic in PM10 concentration with differences greater than 10 \u00b5g/m3 which, according to other studies [The correlation between benzene and PM benzene ,8 and th benzene ,8. There studies . This fi studies ,40, may 3) rather than inhalation intake of a contaminant in air based on inhalation rate and body weight (mg/kg-day). With regard to the inhalation risk analysis derived from exposure to benzene of population living near the monitoring sites, we followed the USEPA recommendations based on \u201cInhalation Dosimetry Methodology\u201d . This meIn our study, the non-carcinogenic risk for exposure to benzene in the years 2014 and 2015 was lower than the limit of acceptability (HQ = 1) as the chronic exposure concentration in all sites was lower than the safety threshold concentration (RfC) detected by toxicological studies and reported in the IRIS database.\u22126 as the acceptability threshold for the ICR [3 [Regarding the carcinogenic risk, it is important to stress that there is not an exposure threshold to carcinogens below which there is no risk of developing cancer during one\u2019s lifetime. However, many studies and regulations consider 1 \u00d7 10 the ICR ,42,43,44e ICR [3  may leade ICR [3 ,46,47 ane ICR [3 .This work is not without its limitations. In particular, all the assumptions contained in the USEPA methodology are based on a conservative approach in order to protect human health from possible underestimated exposures. This inevitably leads to an overestimation of the actual risks. Factors that may lead to overestimation of risk include use of:(1) 95% UCL on the mean exposure concentrations, (2) default exposure assumptions, such as an exposure time of 24 h per day and exposure frequency of 350 days per year, and (3) conservative toxicity values. The benzene IUR, for example, is based on the high end of a range of maximum likelihood values and includes uncertainty factors to account for limitations in the epidemiological studies for the dose-response and exposure data .There are also some factors that may have led to an underestimation of risk in our study results. This risk assessment was limited by the spatial and temporal series taken into consideration. For the estimated chronic exposure, we used two years of monitoring data to estimate exposures over a 24-year or six-year exposure period (respectively for adults or children) and 2\u20133 monitoring station per city with the risk to exclude periods or areas in which the air benzene concentration is higher than study data. The findings of this study suggest the need for emission reduction policies to preserve human health from exposure to air pollutants in urban areas. These measures should include local and urgent provisions, such as blocking traffic, and global preventive measures that can ensure long-term healthiness of the air, such as stricter land management policies  or encouraging the production and use of low-emission vehicles .The toxicology approach used for health risk assessment could be a strategy useful for the management of air quality in urban areas affected by widespread pollution. In addition, results highlight the importance of revising the criteria used for setting the legal limits concerning air quality in urban areas because the current limits are not always sufficient to protect human health from continuous and long-lasting inhalation exposures to toxic substances."}
+{"text": "Muscle wasting is the key manifestation of cancer-associated cachexia, a lethal metabolic disorder seen in over 50% of cancer patients. Autophagy is activated in cachectic muscle of cancer hosts along with the ubiquitin-proteasome pathway (UPP), contributing to accelerated protein degradation and muscle wasting. However, established signaling mechanism that activates autophagy in response to fasting or denervation does not seem to mediate cancer-provoked autophagy in skeletal myocytes. Here, we show that p38\u03b2 MAPK mediates autophagy activation in cachectic muscle of tumor-bearing mice via novel mechanisms. Complementary genetic and pharmacological manipulations reveal that activation of p38\u03b2 MAPK, but not p38\u03b1 MAPK, is necessary and sufficient for Lewis lung carcinoma (LLC)-induced autophagy activation in skeletal muscle cells. Particularly, muscle-specific knockout of p38\u03b2 MAPK abrogates LLC tumor-induced activation of autophagy and UPP, sparing tumor-bearing mice from muscle wasting. Mechanistically, p38\u03b2 MAPK-mediated activation of transcription factor C/EBP\u03b2 is required for LLC-induced autophagy activation, and upregulation of autophagy-related genes LC3b and Gabarapl1. Surprisingly, ULK1 activation (phosphorylation at S555) by cancer requires p38\u03b2 MAPK, rather than AMPK. Activated ULK1 forms a complex with p38\u03b2 MAPK in myocytes, which is markedly increased by a tumor burden. Overexpression of a constitutively active p38Tbeta; MAPK in HEK293 cells increases phosphorylation at S555 and other amino acid residues of ULK1, but not several of AMPK-mediated sites. Finally, ULK1 activation is abrogated in tumor-bearing mice with muscle-specific knockout of p38\u03b2 MAPK. Thus, p38\u03b2 MAPK appears a key mediator of cancer-provoked autophagy activation, and a therapeutic target of cancer-induced muscle wasting. Cancer has been increasingly recognized as a systemic disorder that stresses multiple organs independent of its location. At least 50% of cancer patients experience cachexia, a systemic wasting syndrome manifested as weight loss, inflammation, insulin resistance, and increased muscle protein breakdown. Progressive loss of muscle mass (muscle wasting) contributes significantly to cancer-associated morbidity and mortality 1There has been a general consensus that accelerated muscle protein degradation is a major cause of cachexia-associated muscle mass loss. It has been well-established that the ubiquitin proteasome pathway (UPP) plays an important role in cancer-induced muscle wasting by degrading myofibrillar proteins 3467810111349The Akt-FoxO signaling pathway inversely mediates the activity of both autophagy and UPP in muscle in response to such catabolic stimuli as fasting or denervation 182011In the present study, we demonstrate that activation of the p38\u03b2 MAPK isoform is necessary and sufficient for autophagy activation in skeletal muscle in a mouse model of cancer cachexia, and that deletion of p38\u03b2 MAPK in skeletal muscle abrogates muscle wasting by attenuating muscle protein degradation mediated by autophagy as well as UPP. Mechanistically, p38Tbeta; MAPK mediates cancer-provoked autophagy activation by upregulating Atg8 orthologues LC3b and Gabarapl1 as well as by activating ULK1. These data support p38\u03b2 MAPK as a key mediator and therapeutic target of cancer-associated muscle wasting.Figure 1A). In addition, systemic administration of SB202190 to LLC tumor-bearing mice inhibited autophagy activation in cachectic muscle . These results suggest that LLC induces autophagy activation in skeletal muscle through the activation of p38\u03b1 and/or p38\u03b2 MAPK.We previously showed that LLC induces an increase in autophagy flux and autophagosome formation in cultured C2C12 myotubes as well as mouse muscle Figure 1C). To examine whether activated p38\u03b2 MAPK actually stimulated autophagy flux, a constitutively active mutant of p38\u03b1 MAPK or p38\u03b2 MAPK Figure 1D). These results indicate that p38\u03b2 MAPK activation stimulated autophagy flux. Similarly, LC3-II was specifically increased by the overexpressed active mutant of p38\u03b2 MAPK in the muscle (TA) of tumor-free mice . Furthermore, co-transfection of GFP-LC3 with active p38\u03b2 MAPK, but not active p38\u03b1 MAPK, in mouse muscle resulted in increased autophagosome formation as indicated by the formation of GFP-LC3-incorporated puncta . These data provided evidence that p38\u03b2 MAPK activation is necessary and sufficient for autophagy activation in skeletal muscle cells by a tumor burden.To identify the isoform of p38 MAPK that mediated LLC induction of autophagy, we utilized siRNA-mediated gene silencing and observed that the loss of p38\u03b2 MAPK, but not p38\u03b1 MAPK, abolished LCM-induced autophagy activation . In addition, p38\u03b2 MKO mice were resistant to LLC-stimulated UPP activity as monitored by the levels of atrogin1, UBR2 and myofibrillar protein myosin heavy chain (MHC) . Consequently, p38\u03b2 MKO mice were spared from LLC-induced muscle wasting without altering tumor growth as measured by tumor weight, body and muscle weight, muscle proteolysis (tyrosine release), muscle strength  and myofiber cross-sectional area . Thus, LLC induces muscle wasting through p38\u03b2 MAPK-mediated activation of both autophagy and UPP.Next, we investigated whether LLC-induced activation of autophagy and muscle wasting are attenuated in the muscle of mice with muscle-specific knockout of p38\u03b2 MAPK (p38\u03b2 MKO) Figure 3A), confirming in vivo that p38\u03b2 MAPK mediates LLC-induced activation of C/EBP\u03b2. To investigate whether C/EBP\u03b2 is critical to LLC-induced autophagy activation, we treated C/EBP\u03b2-deficient C2C12 myotubes with LCM, and observed a dependence of LCM-induced autophagy activation on C/EBP\u03b2 . Further, we observed that LLC-induced autophagy activation was abrogated in the muscle of C/EBP\u03b2 knockout mice . Thus, p38\u03b2 MAPK-mediated activation of C/EBP\u03b2 is critical to LLC-induced autophagy activation.We previously showed that p38\u03b2 MAPK mediates LLC-induced upregulation of atrogin1 http://tfbind.hgc.jpfor potential C/EBP\u03b2-binding sites in the 5\u2019-promoter regions of autophagy-related genes and identified multiple sites within -1 kilo-bases in five important autophagy related genes . By analyzing mRNA levels of these genes in the muscle of LLC tumor-bearing wild type and C/EBP\u03b2 knockout mice, we found that mRNA of LC3b and Gabarapl1, two Atg8 orthologues, were upregulated by LLC in a C/EBP\u03b2-dependent manner . Corroborative data were obtained in C2C12 myotubes where LCM treatment upregulated the two genes in a C/EBP\u03b2-dependent manner . To determine whether LLC stimulates C/EBP\u03b2 binding to the two gene promoters, we performed the chromatin immunoprecipitation (ChIP) assay and observed that LCM treatment of C2C12 myotubes stimulated C/EBP\u03b2 binding to multiple sites in the LC3b and Gabarapl1 promoter . These data suggest that C/EBP\u03b2 upregulates the two Atg8 orthologues in muscle cells in response to a tumor burden.To understand how C/EBP\u03b2 mediates LLC-induced autophagy activation, we searched a data base . Further, upregulation of these genes in skeletal muscle was abrogated in LLC tumor-bearing p38\u03b2 MKO mice . These data confirm that LLC upregulates LC3b and Gabarapl1 through the p38\u03b2 MAPK . Phosphorylation of ULK1 on this serine residue is known to activate ULK1 by AMP-activated protein kinase (AMPK) upon nutrient deprivation 35Figure 6A). These data suggest that p38 MAPK, rather than AMPK, is critical to LCM-induced activation of ULK1. We then investigated whether p38 MAPK interacted with ULK1 by performing immunoprecipitation of p38 MAPK from myotube lysate. We observed co-precipitation of pS555-ULK1 with p38 MAPK in control myotubes, and that the level of co-precipitated pS555-ULK1 dramatically increased in LCM-treated myotubes , suggesting that p38 MAPK does interact with ULK1 resulting in phosphorylation of its Ser-555 residue in myocytes, and this activity is stimulated upon p38 MAPK activation by a tumor burden. To identify the p38 MAPK isoform responsible for LCM-stimulated ULK1 phosphorylation on Ser-555, we performed siRNA-mediated gene silencing in myotubes and observed that p38\u03b2 MAPK, but not p38\u03b1 MAPK, was required for this reaction . To verify that activation of p38\u03b2 MAPK is sufficient to phosphorylate ULK1, FLAG-tagged ULK1 was co-expressed with constitutively active p38\u03b2 MAPK in HEK293T cells. Mass spectrometry analysis of FLAG-ULK1 isolated from cell lysate revealed multiple phosphorylated amino acid residues including Ser-555 (Supplementary Table 1). However, these sites did not include a number of known AMPK-mediated phosphorylation sites in ULK1 such as Ser-317, Ser-467, Ser-637 and Ser-777 36f/f mice but not in that of muscle-specific p38\u03b2 MAPK knockout mice. On the other hand, LLC-induced AMPK activation was not altered in p38\u03b2 MAPK-deficient muscle . Therefore, we conclude that p38\u03b2 MAPK, rather than AMPK, mediates LLC-induced autophagosome formation by activating ULK1 in addition to upregulating LC3b and Gabarapl1.Both LC3b and Gabarapl1 are members of the ATG8 family that are essential for autophagosome formation LC3b and Gabarapl1 genes. Importantly, we were able to abrogate cancer-induced muscle wasting by deleting p38\u03b2 MAPK in skeletal muscle to prevent muscle protein degradation mediated by autophagy as well as UPP. These findings suggest that p38\u03b2 MAPK is a key mediator and a therapeutic target of cancer-induced muscle wasting.The current study identifies p38\u03b2 MAPK as a key mediator of cancer-induced autophagy activation in skeletal muscle, through activating ULK1 as well as upregulating C/EBP\u03b2-controlled LC3b and Gabarapl1 through activating C/EBP\u03b2. The LC3 and Gabarapl family of proteins are mammalian orthologues of ATG8, a yeast autophagy-related protein involved in the formation of autophagosomes 101140We show that p38\u03b2 MAPK upregulates Autophagy is activated by nutritional deprivation through AMPK-mediated phosphorylation of ULK1 on multiple sites including Ser-555 in various cell types 3518in vivo that p38\u03b2 MAPK is essential to UPP activation and muscle wasting induced by cancer. Therefore, developing p38\u03b2 MAPK-specific pharmacological inhibitors would be highly desirable for the intervention of cancer cachexia.It is well-established that in skeletal muscle p38 MAPK is activated by various inflammatory mediators implicated in cancer cachexia including various cytokines 242526274446Our findings on the role of p38\u03b2 MAPK in autophagy activation may have significance beyond skeletal muscle cells. For example, p38 MAPK mediates various stress-induced autophagy activation in a variety of cells 5051525349Taken together, our findings reveal that p38\u03b2 MAPK mediates cancer-induced autophagy in skeletal muscle through novel transcriptional as well as post-translational mechanisms. In addition, our findings suggest that cancer-induced muscle wasting can be ameliorated by targeting a single signaling molecule in skeletal muscle, p38\u03b2 MAPK.2. At 85-90% confluence, myoblast differentiation was induced by incubation for 96 h in differentiation medium (DMEM supplemented with 4% heat-inactivated horse serum) to form myotubes. Preconditioned medium from cultures of Lewis lung carcinoma cells  or non-tumorigenic human lung epithelial cell line NL20 (obtained from American Type Culture Collection) that were cultured for 48 h were centrifuged and the supernatant was used to treat C2C12 myotubes  when indicated. Pretreatment of SB202190 or compound C  for 30 min was carried out when indicated. All cell culture experiments were independently replicated 3 times as indicated (N = 3).Murine C2C12 myoblasts (American Type Culture Collection) were cultured in growth medium  at 37(C with 5% CO6 cells), or an equal volume of vehicle (PBS) was injected subcutaneously into the right flanks of 7-week-old male C57BL/6 mice , C/EBP\u03b2-/- mice in C57BL/6 background that were bred from C/EBP\u03b2-/+ mice  f/f) in C57BL/6 background Experimental protocols were approved in advance by the institutional Animal Welfare Committee at the University of Texas Health Science Center at Houston. For LLC cell xenograft,100  cells  according to the manufacturer\u2019s protocol. In 24 h, myoblasts were differentiated and experiments were started in another 96 h when myotubes were formed. Plasmids encoding constitutively active p38\u03b1 and p38\u03b2 isoforms Total RNA was isolated from myotubes or muscle by using TRIzol reagent . Real-time PCR was performed as described previously Western blot analysis was carried out as described previously ChIP assay was performed as previously described Cross sections of TA were fixed and stained with H&E by the Histology Core at Lester and Sue Smith Breast Center, Baylor College of Medicine. Cross-sectional area of stained muscle sections was quantified by using the ImageJ software (NIH). Five view-fields with ~100 myofibers per field in each section were measured. Frozen sections of mouse TA (5 \u03bcm) that expressed GFP-LC3 and/or p38 MAPK mutant were stained with DAPI and examined with a Nikon A1R Confocal Laser Microscope using 60X objective.Adjustment of brightness, contrast, color balance, and final image size was achieved using Adobe Photoshop CS .HEK293T cells  cultured in 150 mm plates that were ~50% confluent were co-transfected with a plasmid encoding mouse ULK-1 with a FLAG tag (Addgene) and a plasmid encoding constitutively active p38\u03b2 Data are presented as the mean \u00b1 S.D. and were analyzed with one-way ANOVA or Student t test using the SigmaStat software  as indicated. When applicable, control samples from independent experiments were normalized to a value of 1 without showing variations . Chi-square analysis was carried out by using R to compare the distributions of muscle fiber cross-sectional area among various groups. A p value < 0.05 was considered to be statistically significant.Click here for supplemental data file.http://www.cell-stress.com/researcharticles/p38%ce%b2-mapk-mediates-ulk1-dependent-induction-of-autophagy-in-skeletal-muscle-of-tumor-bearing-mice/.All supplemental data for this article are also available online at"}
+{"text": "These results are in line with the literature. Despite this, higher nonsteroidal anti-inflammatory drugs consumption was associated with higher psychological distress, higher HI with severe and moderate intensity, and worse quality of life. Conversely, triptans consumption was correlated with HI of mild intensity, and problem-focused coping strategies. To conclude, the psychological profile, and in particular, the psychological distress and specific coping strategies might influence the self-management of acute medication.Chronic Migraine (CM) is a disabling neurologic condition with a severe impact on functioning and quality of life. Successful therapeutic management of patients with CM is complex, and differences in therapeutic response could be attributable to genetically determined factors, sensitivity to pharmacological treatment, psychosocial and relational factors affecting the patient\u2019s compliance and approach on the therapeutic treatment. The aim of this prospective observational study was to explore self-efficacy, coping strategies, psychological distress and headache-related disability in a cohort of 40 patients with CM  treated with OnabotulinumtoxinA and the relationship between these clinical and psychological aspects and acute medication consumption during OnabotulinumtoxinA prophylactic treatment. Patients presented an overall significant reduction in the Headache Index (HI) ( Chronic Migraine (CM) is a disabling neurologic condition with a severe impact on functioning and quality of life . It accoThe physiopathology of CM is not clearly understood ,3. HowevWith this perspective, migraine is conceptualized as a continuum from episodic to chronic forms, whereby \u201cchronic\u201d indicates severity or patient-specific symptomatic burden, as opposed to the duration of disease . On the Successful management of patients with CM is complex and represents a challenge for primary care as well as for specialist, as in other chronic pain conditions ,6. PartiIt has been well established that the treatment of acute attacks and prophylactic management play a crucial role. However, each subject does not have the same therapeutic response . The reaAs far as prophylactic management, OnabotulinumtoxinA is the only prophylactic treatment specifically approved to reduce the frequency and the severity of migraine attacks ,8,9. In Nevertheless, positive results should rely on the management by the patient of acute medication. For example, the treatment of acute attacks is prescribed by the specialist but self-managed by the patient according to the intensity and the features of each migraine attack. They include the use of different categories of drugs, such as nonsteroidal anti-inflammatory drugs (NSAIDs) and triptans, usually in polytherapy. The prophylactic treatment through OnabotulinumtoxinA reduces the headache symptoms and common comorbidities, including depression and anxiety ,20,21,22Note that psychological factors and pain coping styles might influence acute medication intake in terms of quantity and type  ,23. LiteThe main limitations of these studies are the lack of homogeneity about the prophylactic treatment and, where it was provided, considerable heterogeneity in the OnabotulinumtoxinA injection paradigm (and dose). Moreover, the lack of assessment of acute medication consumption, and the evaluation of mainly depression and anxiety should be outlined.So far, no studies exploring the influence of psychological distress and coping strategies on the OnabotulinumtoxinA treatment effects and the acute medication consumption in patients with CM have been reported. This study aimed to explore self-efficacy, coping strategies, psychological distress and headache-related disability in a cohort of patients with CM treated with OnabotulinumtoxinA and the relationship between these clinical and psychological aspects and acute medication consumption during OnabotulinumtoxinA prophylactic treatment.We expect that the relative contribution of psychological factors would vary among patients undergoing the same prophylactic treatment and would interfere with the acute medication consumption. Improved understanding of the association between these factors might lead us to more effective management for this disabling neurologic condition.Seventy-two patients attending the Neurorehabilitation Unit were screened for eligibility. Eighteen patients were excluded because involved in other research activities. Fifty-four patients were considered eligible. Fourteen patients were excluded because of the lack of consent to perform the psychological assessment and incomplete diary in the 12 weeks before the enrolment. Therefore, 40 patients with CM  were enrolled.The majority of patients was women (92.5%), most of whom were contraceptive consumers (89.2%) and menopausal (59.5%). Most patients were both smoker (85%) and alcohol consumers (87.5%); a large percentage of them was already under pre-study Headache Prophylaxis therapy (60%) and did not respond to acute headache medication (65%). The majority of patients were not taking antidepressants or anxiolytic therapy (65%). Patients\u2019 demographic and clinical features are reported in detail in p < 0.001). Similarly, the HI with severe intensity (p = 0.009), and total analgesic consumption (p = 0.003) decreased significantly over time. Post hoc analysis resulted in a significant reduction in the HI , in the HI with severe intensity at T2 (p = 0.021) and in total analgesic consumption at T2 (p = 0.017). HI with moderate and mild intensity progressively decreased, albeit not significantly.There was an overall significant reduction in the HI  showed an improvement over time, albeit not statistically significant. At T0, the high HIT-6 mean score (above 60 points) demonstrated the severe impact of CM symptoms on quality of life. At T2, the HIT-6 score decreased by \u22122.95 points indicating a meaningful improvement in the quality of life (within-person MCI: \u22122.5 points) and a substantial reduction of symptoms severity. The NSAIDs and Triptans consumption progressively decreased over time, albeit not significantly. Headache Index and Analgesic Daily Consumption are reported in Self-efficacy, Coping Strategies and Disability are reported in s = 0.336, p =0.034), the HI , the HI with severe intensity  and quality of life . There was a positive correlation between the headache-related disability and the total analgesic consumption . However, NSAID consumption was positively correlated with higher HI  and with severe intensity , while triptans consumption was correlated with HI of mild intensity .In general, a higher analgesic consumption was associated with higher HI  and NSAIDs consumption, HI with severe intensity and headache-related disability (HIT-6). Higher positive attitude (COPE-PA) correlated with higher analgesic consumption. Similarly, there was a positive correlation between problem-focused strategies (COPE-PO) and the total analgesic and triptans consumption. Higher perceived social support (COPE-SS) positively correlated with HI with mild intensity .Changes in pharmacological intake showed that higher psychological distress (GSI) correlated with higher triptans consumption at T1 and T2. When considering the GSI cut-off (0.57), patients without psychological dysfunction  reported a reduction in the triptans consumption while patients with psychological disfunction (GSI \u2265 0.57) increased the triptans consumption .Avoidance strategies (COPE-AS) were positively associated with higher total analgesic consumption and higher triptans consumption at T1 and T2. Conversely, higher problem-focused approach (COPE-PO) related to a reduction in the total analgesic and NSAIDs consumption at T2. Turning to religion (COPE-SS) was positively associated with total analgesic consumption .To the best of our knowledge, this study is the first one exploring the pharmacological habitus and the clinical and psychological aspects of CM undergoing the same prophylactic treatment by using OnabotulinumtoxinA. Strengths in the methodology of this study include the fact that all patients underwent the same CM management, consisting of the same specialist giving the diagnosis and pharmacological indication and the same specialist giving the OnabotulinumtoxinA injection according to international guidelines protocol .The main finding of this prospective observational study was that despite the global reduction in the headache symptoms and acute medication intake, higher NSAIDs consumption was associated with higher psychological distress, higher HI with severe intensity, and worse quality of life. Conversely, triptans consumption was correlated with HI of mild intensity, and high problem-focused coping strategies. These two different patterns of medication use suggest that psychological distress and specific coping strategies might influence the self-management of acute medication. Additionally, we explored the relationship between psychological aspects and clinical and medication outcomes at follow up. With progress on the prophylactic treatment, pharmacological treatment remained related to the psychological profile. In particular, the reduction in the triptans consumption was related to lower psychological distress and lower avoidance coping strategies. Conversely, lower problem-focused coping strategies were related to an increase in NSAIDs and analgesic consumption, but only at T2. The overall trend in the reduction of the number of days with migraine was similar to that reported in OnabotulinumtoxinA trails. The OnabotulinumtoxinA was first used in the treatment of movement disorders and focal spasticity in patients with Central Nervous System damage. Early observations in cervical dystonia suggested that besides the anticholinergic effect, OnabotulinumtoxinA may decrease pain before muscle relaxation . A reporThe percentage of reduction in the HI at T1 (\u221216%) and T2 (\u221218.8%) could be considered beyond the responder rate reported in the literature. It might depend on the fact that patients were undergoing prophylactic treatment using OnabotulinumtoxinA since at least three injections, and thus, they were not na\u00efve patients to the treatment. Therefore, treatment effects should be considered as additional effects obtained after prolonged OnabotulinumtoxinA injection. Interestingly, the percentage of reduction in the total number of analgesic consumptions was around 19% at T1 and approaching 42% at T2. It might depend on how the headache diary was compiled: data were self-reported and could be influenced by the patient\u2019s mood, with the risk of overvaluing headache symptoms. Conversely, the number of medication intake should be considered a more objective measure of therapy efficacy.Patients reported severe adverse impact on the quality of life and disability related to CM and, notwithstanding the definite reduction of HIT6 observed over time, the adverse effect was still relevant. Moreover, although examining the prevalence of psychological disorders in the sample was out of the scope of this study, it is noteworthy that approximately a third of patients declared the use of antidepressant or anxiolytic medications and the mean GSI score suggested a high level of psychological distress at enrolment. This result seems in line with the literature, which highlights a high prevalence of psychological disorders, particularly depression and anxiety, and even sub-threshold psychological symptoms in patients with CM ,39,40,41Higher psychological distress resulted associated both with higher headache-related negative impact and HI severity, confirming the findings reported by previous literature on the relationship between comorbid depression and anxiety symptoms with adverse migraine outcomes . AdditioOur sample reported lower perceived self-efficacy than Italian validation study data, according to results reported by D\u2019Amico et al. (2015) . Self-efLooking at previous literature, Wieser et al. (2011) reported that dysfunctional coping, characterized by fear and avoidance, is frequently used by headache patients . Only a To sum up, our findings support the need for patients with CM for a management approach following the bio-psycho-social model. For an appropriate clinical practice during the OnabotulinumtoxinA prophylactic treatment, we recommend an integrated approach, including clinical psychologists working in collaboration with the Neurorehabilitation professionals, to assess psychological needs and profiles. The observed associations between coping strategies, CM disability and pharmacological management highlight the importance of introducing and tailoring psychological interventions considering different psychological factors, including coping strategies. Therefore, the current findings, although being explorative, reinforce the need for using a multidisciplinary approach to implement tailored brief psychological interventions aiming at reducing psychological distress and improving functional coping strategies and self-efficacy in the CM management. As regards the psychological treatment in the neurorehabilitation setting, different approaches, such as cognitive-behavioural, mindfulness, relaxation and biofeedback approaches, have been studied and reviewed resulting valid and safe interventions; and they should be introduced and used in the management of patients with headache . AlthougThe limitations of our study are the lack of i) follow-up assessments about the psychological outcomes, ii) a control group drug na\u00efve for OnabotulinumtoxinA prophylactic treatment, iii) data on the pre-prophylactic psychological profile. Additionally, the sample was small, and results were based mainly on correlations, which allow only a preliminary exploration of data. Further studies on larger samples of patients should consider these limits and introduce the evaluation of all the clinical and psychological data along with different treatment phases. Furthermore, our sample was mainly composed of females, although this is in line with the significant prevalence of CM among women. Finally, both clinical and psychological data were self-reported.Future studies should investigate the impact of the prophylactic treatment  on the overall status of the patient, to repeat psychological assessment after the first three OnabotulinumtoxinA administration treatment cycles and to examine the combined effects of prophylactic treatment and psychological approaches .Our study supports that migraine has a multifaceted pathophysiology and suggests that specific sub-population of patients with CM undergoing OnabotulinumtoxinA prophylaxis might take advantage of specific psychological assessment to evaluate psychological profiles relevant to the management of disease. The applicability of our observations in clinical practice requires a multidisciplinary context with the strict collaboration of specialist in neurology, clinical psychology and neurorehabilitation.A prospective observational cohort study was performed from March 2018 to February 2019. The study is part of to the project \u201cEXploring PsychoLOgical needs of patients with chronic pain attending neuroREhabilitation services\u201d (EXPLORE) involving the Neurorehabilitation Unit and the Clinical Psychology Unit of the Verona University Hospital and the Neurology Unit of the Sacro Cuore Hospital in Negrar (north Verona). Outpatients with a confirmed diagnosis of CM made by a neurologist according to the Classification ICHD-III (beta) and eligible to OnabotulinumtoxinA prophylaxis were recruited . OnabotuInclusion criteria were: age \u2265 18 years, diagnosis of CM according to the Classification ICHD-III (beta) ; ineffecExclusion criteria were contraindications to prophylactic treatment using OnabotulinumtoxinA; the presence of other neurologic disturbances that can cause migraine; incomplete diary compiling in the 12 weeks before the enrolment; lack of consent to perform the psychological assessment.The EXPLORE project was performed according to the latest version of the Declaration of Helsinki and approved by the Ethics Committee of the AOUI of Verona .Patients recorded headache characteristics using consecutive monthly headache diaries referring in the past three months before the recruitment in the study (T0), when the psychological assessment was performed and continued throughout the study period .From the headache diaries the following outcomes were recorded: the Headache Index (HI) calculated as the number of headache/migraine days over one month of observation; the intensity of pain calculated as the number of headache/migraine days with mild, moderate and severe pain over the period of observation; the total analgesic consumption (AC) calculated as the number of total analgesics taken during one-month period; the consumption of NSAIDs (NSAIDs C) and triptans (Triptans C) calculated as the number of NSAID and triptans taken in the reference period, respectively.At every injection session , the headache-related disability was assessed using the Headache Impact Test (HIT-6) ,54,55. TAt T0, the Migraine Disability Assessment (MIDAS) Questionnaire was administered to assess the disability induced by the headache during the previous three months. It is a brief, self-administered questionnaire including five items which examine the disability in three fields of daily-life: either school or work, household work, and either family or social or leisure activities. Two additional questions concern: i) the number of days with headache; ii) the pain of headache attacks  .The psychological assessment in the EXPLORE project was performed at T0 during the same visit to the OnabotulinumtoxinA treatment session and included a battery of questionnaires. The psychological tools considered in this study are: the General Self efficacy (GSE) scale; the Coping Orientation to Problems Experienced (COPE); the Symptom Checklist-90 (SCL-90-R) questionnaire of which the global severity index (GSI) is reported  ,57. The General Self Efficacy Scale (GSE) is a measure of people\u2019s \u201coptimistic self-beliefs to cope with a variety of difficult demands in life\u201d. It consists of 10 items rated on a scale of 1  to 4 (exactly true). The total range between 10 and 40, with higher scores, correspond to greater levels of perceived self-efficacy ,58.The new Italian version of the COPE was used to measure strategies by individuals to cope with problems and stress . It is aAll patients were undergoing OnabotulinumtoxinA prophylaxis according to the international guidelines based on the PREEMPT injection protocol. A total of 195 U was injected every 12 weeks into 39 injection sites (each injection was 5U/0.1 mL) ,10. The So far, literature has investigated mainly mood and anxiety disorders in patients with CM under Onabotulinumtoxin prophylaxis. Due to the explorative nature of the EXPLORE project and to the lack of studies that have evaluated a broader range of psychological aspects, including self-efficacy perception and coping strategies, it was not possible to calculate the sample size. Therefore, we decided to recruit 40 patients based on the recruitment capability over 11 months at the Neurorehabilitation Unit in the Verona University Hospital.p \u2264 0.025. A Spearman\u2019s rank-order correlation was run to determine the relationship between the psychological outcomes and acute medication consumption and HI. For this purpose, the changes of the score (\u0394) between T1-T0 and T2-T0 were computed in the analgesic consumption, NSAIDs consumption and triptans consumption. Higher values corresponded to increased medication consumption at T1 and T2 concerning T0. The level of significance was set p \u2264 0.05. Software statistics SPSS 20.0 .Descriptive statistics included means, standard deviation and percentage calculation. The Shapiro\u2013Wilk test was used to test data distribution. Non-parametric tests were used for inferential statistics. The Friedman test was used to test for repeated measures differences. Post hoc analysis with Wilcoxon signed-rank tests was conducted with a Bonferroni correction applied, resulting in a significance level set at"}
+{"text": "Background: Hypercoagulative conditions play a key role in venous thromboembolism (VTE). Inflammation is currently linked to VTE, but the potential role of circulating microparticles and oxidative stress (OxS) must be elucidated. The aim of this study was to evaluate platelet-derived microparticles and surrogate OxS biomarkers in patients diagnosed with VTE through a case\u2013control study. Methods: Platelet-derived microparticles (MPs), pro-thrombinase-induced clotting time assay (PiCT), phospholipids (PLPs), malondialdehyde (MDA), 4-hydroxynonenale (4-HNE), thiobarbituric acid reactive substances (TBARs), superoxide dismutase (SOD), and galectin-3  were measured in VTE patients and in healthy controls. Results: PLPs, 4-HNE, TBARs, and Gal-3 were higher in VTE patients compared to controls; conversely, SOD was lower. A significant non-linear regression between OxS biomarkers and the markers of platelet degranulation was found. Conclusion: Our results suggest that OxS and platelet degranulation are concomitant pathophysiological mechanisms in VTE. Hypercoagulative conditions play a fundamental role in venous thromboembolism (VTE). Consequently, anticoagulant drugs represent the first-line therapy for treating VTE  to counteract the abnormal cascade of activated coagulative factors . The rolActivated blood cells  are capable of releasing microparticles (MPs) with strong procoagulative functions. The procoagulant capability of these MPs has been attribuited to tissue factor (TF) and phospholipids in the membrane. In this regard, it is interesting to note that the surface of platelet-derived MPs binds coagulation factors, including coagulative cascade factors ,11.Oxidative stress (OxS), defined as the imbalance between the oxidant and antioxidant systems, results from either overproduction of free oxygen radicals or from the insufficiency of antioxidant mechanisms designed to counteract them. The role of OxS in ischemic arterial diseases is well known, but few studies have been performed to elucidate the role of OxS in VTE ,13 or thGalectin-3  contributes to thrombosis through its pro-inflammatory capability, depending on inflammatory mediators such as interleukin-6. Gal-3 is considered a potential marker of endothelial cell dysfunction . AlthougWe carried out a case\u2013control study, enrolling 36 consecutive patients hospitalized in the General Medicine Division  for VTE, paired with a group of control subjects . PatientAll patients and controls provided a venous blood sample in the morning, which was fractionated into serum, citrate, and ethylenediamine tetra acetic acid (EDTA) vacuum tubes. We measured MDA, 4-HNE, and TBARs in order to evaluate OxS status and its severity. SOD was measured as a marker of antioxidant capacity . Gal-3 was also measured as a potential marker of endothelial cell dysfunction. Finally, we also measured platelet-derived MPs and PLPs (\u00b5g/mL) and performed the PiCT (s), which are accepted assays to evaluate platelet degranulation.2+ , 300 \u03bcL of platelet-free plasma was thawed and a thrombin inhibitor and factor Xa inhibitor  were added to the microwells. Then, 100 \u03bcL of platelet-free plasma was incubated for 30 min at 37 \u00b0C (duplicate microwells). After four washes, the anionic phospholipid (PhP) content was determined by a classic pro-thrombinase assay. The results are reported as nanoMoles (nM) phosphatidylserine equivalents (nM PS) according to Pigault et al. [Venous blood samples were centrifuged at 1500 rpm for 15 min with an Eppendorf 5417 C/R centrifuge to obtain platelet-poor plasma. A second cycle of centrifugation was carried out on plasma . Platelet-free plasma samples were stored at \u221280 \u00b0C to ensure sufficient MPs, which were then captured by immobilized annexin V. In brief, biotinylated annexin V  was bound to streptavidin-coated 96-well microtitration plates . After washing the plates three times with TBS-Cat et al. .2 (saturated solution) for 15 min at 37 \u00b0C . Then, 1.5 mM Chromozym TH  was added as a chromogenic substrate for thrombin and the solution was incubated for another 4 min. The chromogenic substrate was cleaved by thrombin. The color change was measured photometrically (405 nm) using a microtitration plate reader  equipped with kinetic software [The immobilized MPs were incubated in a final volume of 150 \u03bcL with factor Va (250 pM), factor Xa (9.3 pM), prothrombin (0.7 \u03bcM), and CaClsoftware . The colThe PLPs were quantified according to a modified Stewart assay (using 100 \u00b5L of platelet-free plasma). The Stewart assay was based on the ability of PLPs to form a complex with ammonium ferrothiocyanate. A solution was prepared by dissolving 13.52 g of ferric chloride hexahydrate and 15.2 g of ammonium thiocyanate (both from Sigma Aldrich) in 0.5 L of water. The solution was stable at room temperature for several months. A PLP (Sigma Aldrich) calibration standard of 0.1 mg/mL was prepared in chloroform and a six-point calibration curve was performed using chloroform as the solvent, bringing the final volume to 2 mL (0\u20131 mL of PLP standard in 2 mL of chloroform). Finally, 2 mL of ferrothiocyanate solution was added to all six standards, prepared in glass tubes. The tubes were vortexed for 20 s and then centrifuged for 5 min at 1000 rpm, the lower layer then being removed using a Pasteur pipette. Test samples were similarly prepared. The optical density (OD) of both of the standards and samples was read at 485 nm using a Shimadzu Recording Spectrophotometer UV-2401PC. Test sample concentrations were found by comparing them with the six-point standard curve built using external standards.2O), 150 mL of HPLC-grade H2O, and 325 mL of phosphoric acid  were added to 100 mL of plasma (in EDTA). The sample was incubated at 90 \u00b0C for 1 h for the MDA derivatization with TBA and at 45 \u00b0C for 1 h for 4-HNE derivatization. After the incubations, duplicate samples were placed in ice, centrifuged at 15,000\u00d7 g for 10 min, and syringe-filtered . Twenty microliters of the sample was then successively analyzed by HPLC (Perkin-Elmer) using a Lichrospher100 RP-18 (250 mm\u20134 mm) column  equipped with a 785A absorbance detector and a LC240 fluorescence detector . The mobile phase contained 200 mL of methanol and 300 mL of phosphate-buffered saline . A standard curve was generated using commercial standards from Cayman Chemical Company for 4-HNE  and 1,1,3,3-tetraethoxypropane  for MDA.The methodology for determining MDA and 4-HNE has been described previously . MDA and\u00ae Plus adjustable single channel micropipettes with disposable tips (5\u2013500 \u03bcL and 200\u20131000 \u03bcL), Eppendorf Research\u00ae Plus adjustable multichannel micropipettes with disposable tips (50\u2013300 \u03bcL), multichannel micropipette reservoirs, multichannel wash bottles, and generic consumables for laboratory analysis. HPLC-grade water was produced in the laboratory using a Milli-Q\u00ae system. All reagents of the kit were prepared according to the ELISA product manual.The pre-coated 96-well plate solid-phase sandwich enzyme-linked immunosorbent assay  was used for the analysis of human Gal-3 in plasma. A target-specific antibody was used to pre-coat the wells of the supplied microplate, and a sandwich was formed by the addition of the second (detector) antibody and a substrate solution that reacted with the enzyme\u2013antibody\u2013target complex to produce a measurable signal. The intensity of this signal was directly proportional to the concentration of the target present in the original specimen and was recorded using an ELISA microplate reader (ThermoFisher Scientific). The limit of detection (LOD) for Gal-3, defined as the concentration resulting in an absorption significantly higher than the absorption of the dilution medium (mean plus two standard deviations), was certified to be 0.29 ng/mL (mean of six independent assays) and the limit of quantification (LOQ) was 0.47 ng/mL. Fresh samples of plasma (citrate) were collected and centrifuged. Samples containing a visible precipitate were clarified prior to use in the assay. Samples were aliquoted and stored at \u221280 \u00b0C  to avoid the loss of bioactive human GAL-3 prior to analysis. Prior to the assay, frozen samples were brought to room temperature slowly and mixed gently using a mechanical laboratory agitator . To carry out the GAL-3 analysis, several materials and consumables were used, including Eppendorf ResearchBriefly, each purified sample (50 \u00b5L), standard, and blank were assayed in duplicate. The microwell strips were washed twice with 400 \u03bcL of wash buffer and 100 \u03bcL of sample diluent was added to all microwells dedicated to the standard curve. A total of 100 \u03bcL of the prepared standard (concentration = 60 ng/mL) was dispensed into wells A1 and A2. The contents of wells A1 and A2 were mixed by repeated aspiration and ejection , and 100 \u03bcL was transferred to wells B1 and B2, respectively. We continued this procedure five times, creating two rows of galectin-3 standard dilutions, ranging from 30 to 0.47 ng/mL. The microplate was then covered and incubated for 1 h at room temperature (18\u201325 \u00b0C) on a microplate shaker.Then, 100 \u03bcL the Horseradish Peroxidase (HRP)-conjugate was added to all microwells and the microplate was covered and incubated for 1 h at room temperature on a microplate shaker. The microplate was emptied and washed four times with wash buffer and 100 \u03bcL of 3,3\u2032,5,5\u2032-Tetramethylbenzidine (TMB)substrate solution was immediately added to all wells. The microplate was incubated for approximately 30 min at room temperature, then 100 \u03bcL of stop solution was added to all wells. Finally, the microplate was read at 450 nm using a Thermo Fisher ELISA microplate reader.According the instructions of the Cayman Chemical Superoxide Dismutase Assay Kit , all reagents and standards provided in the kit were diluted and prepared for the microwell plate. Briefly, serum samples were diluted 1:5 with sample buffer. Then, 200 \u00b5L of diluted radical detector and 10 \u00b5L of seven standard concentrations per well were added . For the sample wells, 200 \u00b5L of diluted radical detector was added. Diluted xanthine oxidase (20 \u00b5L) was added very quickly to all wells, then the plate was shaken for a few minutes and covered with the specific Cayman Chemical film. The plate was incubated for 30 min at room temperature and absorbance was read at 450 nm using a Thermo Fisher ELISA microplate reader.U test. In order to evaluate the effects of MPs and OxS biomarkers on the others , the non-linear regression function was used, graphically represented by regression curves. Only for Gal-3 did we use the linear regression function. Statistical significance was conventionally defined as p < 0.05. Statistical analyses were performed using statistical software SPSS for Windows .Continuous and categorical variables are presented as median (IQR) and relative frequencies (%), respectively. Clinical and hemodynamic variables were compared by the Mann\u2013Whitney The demographic and clinical characteristics of the cases and controls are summarized in MPs were found to be not significantly different between the VTE patients compared to the controls. Interestingly, PLPs were found to be higher in patients with VTE than in controls, whilst PiCT was reduced. Overall, the OxS biomarkers were found to be higher in patients compared to controls. The Gal-3 value was higher in patients with VTE than in controls, while SOD was reduced in VTE patients compared to controls. No differences in the laboratory values were found between patients according to the type of thrombotic disease, with the exception of SOD, which was significantly higher in patients with DVT than in those with PE. In In In In The peak of the parabola b thus hiIt is known that MPs favor clotting because they have a high procoagulant capability via increasing the assembly of procoagulative factors. To explain this procoagulative activity, we must take into account that the surface of MPs contains both clot proteins and phosphatidylserine. In turn, clot proteins greatly increase the activated complex of the activated factors VIII/IX and V/X of the coagulative cascade ,24. FurtThe results from a previous study demonstrated a direct relationship between increased values (quintiles) of Gal-3 and the rate of VTE per 1000 person/years, suggesting that Gal-3 is associated with the incidence of VTE . PlateleGal-3 is mainly found in normal adult tissues, within cell nucleus, in cell surface and in extracellular spaces as fragmented multimers after enzymatic cleavage. This last has consequences; in particular, it enhances the ability of Gal-3 to facilitate cell-to cell interactions. Both cell adhesion and inflammation are known to play a role in promoting the pathophysiologic mechanisms of venous thrombosis. In this regard, it is interesting to note that Gal-3 multimers were found in bloodstream cells, including red blood cells, leukocytes, and platelets, as well as in platelet-derived microparticles. High levels of Gal-3 highlights it as interesting marker of cell-to-cell interaction and of inflammation in venous thromboembolism.We emphasized the role of platelets in VTE, as demonstrated by the high level of PLPs in patients with venous thrombosis. It is known that in platelet activation, antiphospholipid antibodies mark hypercoagulative conditions, characterizing diseases  with a high risk of VTE. To investigate a potential close link between the count and diameter of platelets, their activation was analyzed in patients with the VTE, as the results from previous studies led to us considering this cell to play a role in VTE ,31,32,33The results from the present study show that the OxS process is highly activated in VTE, and was found in patients diagnosed with both DVT and PE. In fact, the biomarkers MDA, 4-HNE, and TBARs as surrogates of the activated OxS process, and Gal-3 as a biomarker of bloodstream cell endorsement, were found to be higher in VTE patients than in controls. The aforementioned pathway confirms the imbalance between the antioxidant and oxidative systems in VTE, and consequently, the balance moved towards the pro-oxidative pathway. The lower levels of SOD found in VTE patients compared to controls confirm the reduced capacity of the redox system. Our results concerning MPs, PiCT, and PLPs may help to highlight two pathophysiologic mechanisms in VTE: We demonstrated a difference in the activation of platelets, and we also demonstrated accelerated thrombin generation. Furthermore, we demonstrated the occurrence of OxS in patients with VTE. Because these mechanisms favor clot formation, we might consider these mechanisms as multifaceted mechanisms in the pathophysiology of VTE. Although previous studies have assessed OxS, platelets, and platelet-derived MPs separately, to the best of our knowledge, this is the first study considering OxS and MPs together in VTE. Our results led us to hypothesize that OxS and degranulation of the platelet membrane are concomitant mechanisms in the pathophysiology of VTE. We hope that the findings of our study will be helpful in improving the knowledge of the pathophysiology of VTE and in promoting further research into the pathways and effective therapeutic options for VTE patients.Our study assessed platelet microparticles, thrombin generation, and OxS, which are not commonly considered to be involved in the pathophysiology of VTE. The limited number of VTE patients affected the study\u2019s sample size, and it could be considered as a limitation of this study. However, we want to draw attention to the low estimated frequency of both venous thromboembolic diseases in patients admitted to a single medical center compared to other vascular diseases. Furthermore, we matched a similar number of VTE patients (cases) with healthy individuals (controls) to assess differences regarding the markers.Our study demonstrated that the enhanced activation of platelets is a prothrombotic event and demonstrated the presence of OxS in VTE. We hope that our findings will encourage further studies to elucidate the mechanisms of VTE."}
+{"text": "Patients who survive critical illness suffer from a significant physical disability. The impact of rehabilitation strategies on health-related quality of life is inconsistent, with population heterogeneity cited as one potential confounder. This secondary analysis aimed to (1) examine trajectories of functional recovery in critically ill patients to delineate sub-phenotypes and (2) to assess differences between these cohorts in both clinical characteristics and clinimetric properties of physical function assessment tools.Two hundred ninety-one adult sepsis survivors were followed-up for 24\u2009months by telephone interviews. Physical function was assessed using the Physical Component Score (PCS) of the Short Form-36 Questionnaire (SF-36) and Activities of Daily Living and the Extra Short Musculoskeletal Function Assessment (XSFMA-F/B). Longitudinal trajectories were clustered by factor analysis. Logistical regression analyses were applied to patient characteristics potentially determining cluster allocation. Responsiveness, floor and ceiling effects and concurrent validity were assessed within clusters.p\u00a0<\u20090.001). Those with complete recovery trajectories demonstrated high levels of ceiling effects in physical function (PF) (15%), role physical (RP) (45%) and body pain (BP) (57%) domains of the SF-36. Those with persistent impairment demonstrated high levels of floor effects in the same domains: PF (21%), RP (71%) and BP (12%). The PF domain demonstrated high responsiveness between ICU discharge and at 6\u2009months and was predictive of a persistent impairment trajectory (AUROC 0.859 (95%CI 0.804\u20130.914), p\u00a0<\u20090.001).One hundred fifty-nine patients completed 24\u2009months of follow-up, presenting overall low PCS scores. Two distinct sub-cohorts were identified, exhibiting complete recovery or persistent impairment. A third sub-cohort could not be classified into either trajectory. Age, education level and number of co-morbidities were independent determinants of poor recovery (AUROC 0.743 ((95%CI 0.659\u20130.826), Within sepsis survivors, two distinct recovery trajectories of physical recovery were demonstrated. Older patients with more co-morbidities and lower educational achievements were more likely to have a persistent physical impairment trajectory.In regard to trajectory prediction, the PF score of the SF-36 was more responsive than the PCS and could be considered for primary outcomes. Future trials should consider adaptive trial designs that can deal with non-responders or sub-cohort specific outcome measures more effectively. Increasing numbers of patients are successfully surviving critical illness. Unfortunately, residual functional and/or mental disabilities affect many critical care survivors after hospital discharge , 2. DespPopulation heterogeneity within the critically ill cohort is one area that may hinder current outcome analysis. Certain specific patient characteristics have already been identified as influential in regard to an individuals\u2019 subsequent HRQoL outcome. To date, these include age , pre-criSeveral re-analyses have demonstrated sub-phenotypes based on recovery trajectories , 15, 22.We performed a secondary analysis of a critical care trial of sepsis survivors using 2-year follow-up data . The aimThe patient cohort comprised of those recruited to a randomised control trial conducted between February 2011 and December 2015 evaluating a primary care-based sepsis aftercare intervention , 24. TwoEducation and family status classifications are shown in Additional Table\u00a0Groups of longitudinal trajectories of Physical Component Scores of the SF-36 (the most commonly reported 6-month HRQoL outcome measure \u201334) weret test or Mann-Whitney U test as appropriate. Normally distributed data were described using the mean  and non-normally distributed data as median (interquartile range). Categorical variables were analysed by \u03c72 testing. Multivariable and univariable logistic regression analyses were applied to variables potentially determining cluster allocation (dependent variable). Unclustered participants were not used in the logistical analysis, and a multinomial regression performed as a sensitivity analysis. Independent variables were determined as characteristics  , 39. FloConcurrent validity is a measure of how well a test compares to a gold standard (such as the PCS)  and its t tests and data represented as mean difference and 95% CI  except for $representing mode (range). P-values represent two-tailed Mann-Whitney U-tests, except for #=Chi-Squared test. ICULOS= Intensive Care length of stay. MV (d)=period of mechanical ventilation (days), CCI=Charlston Co-morbidity Index, RRT (d)=Renal Replacement Therapy (days), PCS=Physical Component Score of the SF-36, MCS=Mental Component Score recall 3 months prior to critical illness. XSFMA F/B= Extra Short Musculoskeletal Function Assessment regarding Physical Function and Disability, 3m recall=recall 3 months prior to critical illness. NA=Not available, *Categories shown in Additional Table 1. 147 patients without MV, 11 patients without available data, 2209 patients without RRT, 5 patients without available data. Additional Table 3.1. Baseline characteristics of the whole cohort split by loss to follow-up and death. Values shown as medians and interquartile range [IQR] except for $representing mode (range). ICULOS= Intensive Care length of stay. MV (d)=period of mechanical ventilation (days), CCI=Charlston Co-morbidity Index, RRT (d)=Renal Replacement Therapy (days), PCS=Physical Component Score of the SF-36, MCS =Mental Component Score recall 3 months prior to critical illness. XSFMA F/B= Extra Short Musculoskeletal Function Assessment regarding Physical Function and Disability, 3m recall=recall 3 months prior to critical illness. NA=Not available, *Categories shown in Table S1.Additional file 4: Additional Table 4. Bivariable and multivariate logistic regression analysis of cohort membership characteristics. Dependent variable: Allocation to persistent impairment cohort vs. complete recovery cohort. ICD=International Classification of Disease; ICULOS= Intensive Care Unit Length of Stay. * represents p<0.05. Additional Table 4.1. Multinomial regression for the persistent impairment group, using the full recovery as the reference group. ICD=International Classification of Disease; ICULOS= Intensive Care Unit Length of Stay; * represents p<0.05. Additional Table 4.2. Multinomial regression for the unclustered group, using the full recovery as the reference group. ICD=International Classification of Disease; ICULOS= Intensive Care Unit Length of Stay; * represents p<0.05.Additional file 5: Additional Table 5. A and B: Ceiling and floor effects. Data are shown as n(%) over time for SF-36 components in patients with a persistent impairment trajectory (n=76) and in patients with a completed recovery trajectory (n=61) (Table 5A: only patients with completed recovery). PF= Physical Function; RP= Role Physical, BP=Bodily Pain, GH= General Health, XSFMA-F= Extra Short Form Musculoskeletal Function Assessment regarding physical function (F). *represents a value of >15% denoting relevant effect. % may not=100 due to rounding effects.Additional file 6: Additional Figure1. Area under receiver operating characteristic curve (AUROC). Logistic regression of predictors of cluster allocation.Additional file 7: Additional Figure2. Trajectories of unclustered patients (n=22). Data points are means of the SF-36 Physical Component Score (PCS) over 24 months after discharge from ICU."}
+{"text": "Stereum genus has been a source of such bioactive compounds. Here we report on the structures and activities of secondary metabolites from Stereum. Their structural types include sesquiterpenoids, polyketides, vibralactones, triterpenoids, sterols, carboxylic acids and saccharides. Most of them showed biological activities including cytotoxic, antibacterial, antifungal, antiviral, radical scavenging activity, autophagy inducing activity, inhibiting pancreatic lipase against malarial parasite, nematocidal and so on. The syntheses of some metabolites have been studied. In this review, 238 secondary metabolites from 10 known species and various unidentified species of Stereum were summarized over the last seven decades.Natural metabolites from microorganisms play significant roles in the discovery of drugs, both for disease treatments in humans, and applications in agriculture. The Basidiomycetes  Natural products deriving from microorganisms are one of the most valuable sources for medicinal and agricultural applications ,2,3. BasStereum belongs to the family of Stereaceae (Basidiomycetes), which is mainly distributed in tropical and subtropical areas, and it often lives in woody debris, rotting trunks and sometimes on buried dead wood [Stereum, according to the Dictionary of Fungi . Stereum spp. are known to be producers of biologically active secondary metabolites. Previous investigations recorded a number of interesting new compounds isolated from Stereum, especially sesquiterpenoids, and about ten types of sesquiterpenoids were obtained from the genus, so it is one of the major sources of structurally diverse sesquiterpenes. Secondary metabolites from Stereum had diversiform biological activities, such as cytotoxic, antimicrobial, inhibit pancreatic lipase, nematocidal and so on. Some of them showed promising activities, for example, vibralactone, isolated from Stereum vibrans, is a lead compound with a novel skeleton structure and strong inhibitory activity (IC50 0.4 \u03bcg/mL) against pancreatic lipase, which is a potential candidate for a new antiobesity therapeutic [Stereum have been investigated for their metabolites. This review presents 238 secondary metabolites isolated from the Stereum spp., including their structures and biological activities reported over the last seven decades.ead wood . There arapeutic ,7. Up toStereum include hirsutane, illudalane, norilludalane, sterpurane, cadinane, drimane, isolactarane, stereumane and other types. Sesquiterpenoids have various structures and abundant bioactivities. Sesquiterpenoids from Stereum hirsutum, which can cause disease in grapevine and also seems to be related to wood deterioration [S. hirsutum, includes hirsutenols A\u2013F (1\u20136) [Escherichia coli by the agar diffusion method (50 \u03bcg/disk) [50 values were 8.78, 1.62 and 0.39 mM, respectively [50 values of 6.93 and 30.52 \u03bcg mL-1, respectively; they also showed cytotoxicity to the HCT116 cell line with IC50 values of 25.43 and 24.17 \u03bcg mL-1, respectively [50 values larger than 200 \u03bcM. Sesquiterpenoid 23 displayed strong NO inhibitory activity in lipopolysaccharide-induced macrophages with an IC50 value of 15.44 \u00b1 1.07 \u03bcM and showed strong cytotoxicity towards HepG2 with an IC50 value of 24.41 \u00b1 1.86 \u03bcM [Most of the hirsutane sesquiterpenoids have been isolated from ioration . The hir\u2013F (1\u20136) ,10, hirs\u2013F (1\u20136) ,12, ster\u2013F (1\u20136) , and ses\u2013F (1\u20136) . Hirsuti\u2013F (1\u20136) . The abs\u03bcg/disk) . Hirsuteectively ,17,18. Iectively . Hirsutiectively . Hirsutiectively . SesquitS. hirsutum, hirsutane sesquiterpenoids also exist in other strains. Chlorostereone (26) and complicatic acid (27) have been isolated from strain IBWF01082 of Stereum, and they probably share the same biosynthetic pathway [50 value of 5 \u03bcg mL\u22121. Complicatic acid (27) was first obtained in 1973 from Stereum complicatum, and it showed broad but moderate biological activities against numbers of microorganisms including bacteria and certain fungi [4 in ethanol to (\u00b1)-hirsutic acid [13C-stable isotope feeding [Apart from  pathway . Chlorosin fungi . Both hiin fungi . The ractic acid ,24. In 1tic acid . In 2006stereone  and comptic acid  have bee feeding . Their sS. ostrea BCC 22955 [Stereum sp. YMF1.1686 [Stereum sp. NN048997 [S. hirsutum FP-91666 [50 values of 7.2, 38, and 5.3 \u03bcg mL\u22121, respectively. This compound also exhibited activity against the malarial parasite Plasmodium falciparum K1 with an IC50 of 2.3 \u03bcg mL\u22121.Three novel dimeric sesquiterpenoids, sterostreins A\u2013C 28\u201330), and twelve illudalanes and norilludalanes, sterostreins D\u2013O 31\u201342), were obtained from cultures of , and twe\u201342, wereNN048997  and S. hFP-91666 . Sterost50 26 \u03bcg mL-1) [Stereum sp. NN048997. Sterostrein P (43) showed weak nematocidal activity against the Caenorhabditis elegans [S. hirsutum FP-91666 and showed antibacterial activity against Salmonella typhimurium, Staphylococcus aureus, and E. coli, with minimum inhibitory concentration (MIC) values of 50.0, 25.0 and 12.5 \u03bcg mL\u22121, respectively [Stereum sp. YMF1.1686 [Stereum sp. YMF1.04734 and S. rugosum ATCC64657, respectively [S. hirsutum FP-91666. The author believed that they are the first example of a naturally occurring quaternary ammonium compound (QAC) of sesquiterpenes combining with \u03b1-amino acids. Stereumamides A (51) and D (54) showed antibacterial activity against Salmonella typhimurium, Staphylococcus aureus, and E. coli, with MIC values between 12.5-25.0 \u03bcg mL\u22121 [Sterostrein D 31) showed weak cytotoxicity towards KB cells (IC\u03bcg mL-1) . Sterost elegans . Sterostectively . Sterost showed wMF1.1686 . Sterostectively ,36. Four \u03bcg mL\u22121 . Their sStereum sp. CCTCC AF 207024 [Ten new sesquiterpenoids, stereumins A\u2013J (55\u201364), containing a new stereumane-type backbone, were obtained from fungus F 207024 ,38,39. TPanagrellus redivivus at 400 mg mL\u22121. Among these five compounds, stereumins C (57) and D (58) killed 84.4% and 94.9% of P. redivivus, respectively, in 48 h [Stereum sp. CCTCC AF 2012007 [ent-strobilols E (76) and G (77), were isolated from the culture of S. cf. sanguinolentum BCC 22926 [Bacillus cereus with a MIC value of 3.97 \u03bcM and cytotoxicity against Vero cell line with an IC50 value of 43.7 \u03bcM. In addition, stereumins A (55), B (56), K (65), L (66), and N (68) were also isolated from this strain [S. gausapatum ATCC60954, among which, strobilol N (78) presented weak nematocidal activity towards C. elegans at a concentration of 200 \u03bcg mL\u22121 with a fatality rate of 75.8% in 36 h [Stereum sp. 8954 [The absolute configuration of stereumin H (62) was established by X-ray analysis and density functional theory (DFT) calculations. Stereumin I (63) is a diastereoisomer of stereumin H (62), and its absolute configuration was assigned as  using DFT calculations . Stereum in 48 h . StereumCC 22926 . The abss strain . Strobil in 36 h . AnotherS. purpureum [The sterpurane is a unique type of sesquiterpenoids possessing an unusual 4/6/5 ring system. These types of compounds, including sterepolide (82), dihydrosterepolide (83), 4,12-dihydroxysterpurene (84), and 5,12-dihydroxysterpurene (85) have been isolated from the fungus urpureum ,45. The urpureum . In 1990urpureum . Richardurpureum . Goverdhurpureum . Harmataurpureum . The cheurpureum .Stereum sp. IBWF01060 [100 values ranged from 1\u201350 \u03bcg mL\u22121 against seven fungi. They also exhibited significant antibacterial and cytotoxic activities. The cytotoxic activity of the four sterelactones was moderate , and sterelactone D (89) exhibited weak nematocidal activity towards C. elegans, at 100 \u03bcg mL\u22121 with a fatality rate of 50% [Four tetracyclic sesquiterpenoids possessing an isolactarane skeleton, sterelactones A\u2013D (86\u201389), have been isolated from BWF01060 . The foue of 50% . Their sS. ostrea [50 values of 50 \u03bcg mL\u22121.Methoxylaricinolic acid (90) and laricinolic acid (91) , two ses. ostrea . The twoS. cf. hirsutum BCC 26597 [Stereyne A (92), a novel acetylenic sesquiterpenoid, and its acetonide derivative, stereyne B (93) , which rCC 26597 . The absStereum sp. YMF1.04183. Stereumene B (95) showed weak nematocidal activity against C. elegans with a fatality rate of 41.1% at 200 \u03bcg mL\u22121 in 24 h [4-mediated Tanabe protocol by employing a series of functionalized benzo- and naphthofurans from cyclohexanone precursors [Stereumenes A-C (94-96) , three n in 24 h . Showkatecursors .S. hirsutum [Staphylococcus aureus and S. aureus with the same MIC values of 25.0 \u03bcg mL\u22121. The two compounds also presented an antibacterial activity against B. subtilis with the MIC values of 25.0 and 50.0 \u03bcg mL\u22121, respectively and showed radicals scavenging activity with EC50 values more than 200 \u03bcM. Compound 98 exhibited strong NO inhibitory activity in LPS-induced macrophages with an IC50 value of 19.17 \u00b1 1.11 \u03bcg mL\u22121 and showed cytotoxicity towards two cell lines, HepG2 and A549. MS-3 (100) had low toxicity on Yoshida rat sarcoma cells in vitro [S. rameale (N\u00b0 2511). MS-3 (100) displayed antibacterial activity against gram-positive bacteria including B. cereus, B. subtilis and S. aureus with MIC values of 50, 10 and 100 \u03bcg mL\u22121, respectively [Stereum sp. 8954, and butyl 2,4-dihydroxy-6-methylbenzoate (101) showed significant nematocidal activity against the nematode P. redivivus [Polyketides are a large group of metabolites that have notable variety in their structure and function . The phehirsutum ,58,59. Cectively . Butyl 2edivivus .Stereum sp. SANK 21205 [S. hirsutum [50 values of 25.10, 12.32 and 3.31 \u00b5M, respectively [Botrytis cinerea at 1000 mg mL\u22121, and 76% inhibition at 2000 mg mL\u22121. Sterenin D (106) also controlled sporogenesis effectively by inhibiting 96% of the sporulation at 500 mg mL\u22121, and assays showed that sterenin D (106) exhibited a minimal fungicidal concentration of 50 mg mL\u22121 and a MIC of 20 mg mL\u22121 [S. hirsutum. Sterenins K\u2013M (113\u2013115) showed inhibitory activities against yeast \u03b1-glucosidase with IC50 values of 7.62, 3.06, 6.03, 22.70, 36.64, 13.09, and 27.52 \u00b5M, respectively. According to the above results, it can be inferred that the activity is closely related to the structure. The relatively strong activity of sterenins E\u2013G (107\u2013109) compared to sterenins H (110) and I (111) indicated that the carbonyl group on B-ring can enhance the inhibitory activity against \u03b1-glucosidase. The fact that sterenin E (107) presented much stronger activity than sterenin J (112) confirmed that the isoprenyl group made a significant contribution to the inhibitory activity. The propane-1,2,3-triol linkage at C-8 and the formation of a furan ring at C-2 and C-3 in sterenin I (111) greatly decreased their inhibitory activity [The novel isoindolinone alkaloids, known as sterenins A\u2013D (103\u2013106), were first found in NK 21205 . Later, hirsutum ,64. Theyectively . Stereni mg mL\u22121 . Nine neactivity . Their sS. subpileatum. 5-Methoxybenzofuran (119) had weak antibacterial activity [H)-one (124), phenostereum A (125), phenostereum B (126), and dihydrobenzofuran (127) were obtained from Stereum sp. 8954 [Stereum sp. YMF1.1684 [Stereum insigne CGMCC5.57, respectively [Benzofuran is deemed as one of the most important heterocyclic rings on account of its diverse biological activities and clinical importance . Nine beactivity . New metsp. 8954 , Stereumectively . Yu et aectively . Their sStereum species, such as 4-(2-hydroxyethyl)phenol (128) from Stereum sp. CCTCC AF 207024 [S. subpileatum [Stereum sp. 8954 [Stereum sp. YMF1.1660 [S. insigne CGMCC5.57 [Stereum sp. 99123 [S. hirsutum FP-91666 [S. vibrans [P. redivivus [Phenol is an important part of a large variety of natural products, and presents high antimicrobial potential . Many phF 207024 ; 2-benzaldehyde (147), 3-(hydroxymethyl)-2,5-bis(3-methylbut-3-en-1- ynyl)benzene-1,4-diol (148), 2,5-dihydroxy-3-iso-prenyl-6-(3-methylbut-3-en-1-ynyl)benzaldehyde (149), 2-hydroxy \u00b1 5-methoxy-6-(3-methylbut-3-en-1-ynyl) benzylalcohol (150), and the known compounds frustulosin (151) and frustulosinol (152) were obtained from hirsutum . Frustultoxicity ,81,82. Ttoxicity ,84. Thretoxicity , and thaS. vibrans (syn. Boreostereum vibrans) and found to inhibit pancreatic lipase with an IC50 of 0.4 \u03bcg mL\u22121. It is a lead compound with a novel skeleton structure and is a potential candidate for a new antiobesity therapeutic [Listeria monocytogenes [S. vibrans [S. rameale and S. hirsutum (Sh134-11) [E. coli was 200 \u03bcg mL\u22121; vibralactone B (154) inhibited the growth of Pseudomonas aeruginosa and E. coli significantly, with MIC values of 100 and 50 \u03bcg mL\u22121, respectively [50 85.7 \u03bcM; mouse IC50 295.2 \u03bcM) and 11\u00df-HSD2 (human IC50 87.1 \u03bcM). Vibralactones E (157) and F (158) showed weak activity against human 11\u00df-HSD1 with suppression rate of 43.6% and 31.2% at 150 mg mL\u22121 and they also against type 1 mouse \u00df-hydroxysteroid dehydrogenase with suppression rates of 37.7% and 24.8% at the same concentration [S. vibrans that converts prenyl-4-hydroxybenzoate into prenylhydroquinone was also characterized. Vibralactones R (170) and S (171) were isolated from an undescribed stereaceous basidiomycete belonging to the family Stereaceae [Vibralactone (153), a distinctive fused lactone-type compound, was isolated from rapeutic ,7. The arapeutic . The \u03b1-lytogenes . In 2008ytogenes . Later, ytogenes . Later,  vibrans ,90,91,92 vibrans . The abs vibrans . The relh134-11) . The twoectively . Vibralantration ,94. It wS. vibrans [Stereum sp. OUPS-124D-1 metabolites [S. ostrea. Ostalactones A (179) and B (180) exhibited strong inhibitory activity against human pancreatic lipase [Vibralactone T (172), vibralactamide A (175), 13-O-lactyl vibralactone 176) and 10-O-acetyl vibralactone G (177) were obtained from the fungus  and 10-Oabolites . Ostalacc lipase . Their sStereum sp. [abeo-lanostane type [50 values of 7.6 and 4.7 \u03bcM, respectively [Stereum sp. Stereinones A\u2013G (194\u2013200) share the carbonyl group at C-12. Stereinones C (196) and D (197) were lanostane-type triterpenoids that contained an unusual 1,2-diketone functional group at C-11 and C-12. The absolute configuration of C-24 in stereinone I (202) was assigned by a Mo2(OAc)4-induced CD experiment for vicinal diols. Stereinone D (197) showed modest cytotoxic activity against tumor cell lines SW480 (IC50 9.8 \u03bcM) and SMMC-7721 (IC50 9.1 \u03bcM) [S. subtomentosum [Sterenoids A\u2013L (182\u2013193), twelve lanostane triterpenoids, have been obtained from fruit bodies of reum sp. , and theane type ,100. Steectively . Sterein 9.1 \u03bcM) . Two trimentosum . Their sSterols have long been regarded as important compounds in drug discovery because of their varied biological activities, such as cytotoxicity, neurite outgrowth-promoting activity, anti-NO production and acetylcholinesterase inhibition . SteroidStereum were obtained from S. hirsutum, including epidioxysterols 1-4 (206-209), ergosterol peroxide (210), -ergosta-5,7,22-trien-3\u03b2-ol (211), 3\u03b2,5\u03b1,6\u03b2-triol-ergosta- 7,22-diene (212), 3\u03b2,5\u03b1-diol-6\u03b2-methoxy-ergosta-7,22-diene (213), 3\u03b2,5\u03b1,9\u03b1-trihydroxy-ergosta- 7,22-dien-6-one (214), steresterones A (215), B (216), 3\u03b2,6\u03b1,14\u03b1-trihydroxy-dankasterone A (217a), 3\u03b1,6\u03b1,14\u03b1-trihydroxy-dankasterone A (217b), dankasterones A (217) and B (218), herbarulide (219), -14-hydroxy-ergosta-4,7,22-triene-3,6-dione (220), ergosta-4,7,22-triene-3,6-dione (221), isocyathisterol (222), -9,14-dihydroxyergosta-4,7,22-triene-3,6-dione (223), and (22E)-ergosta-4,22-diene-3,6-dione (224) [M. tuberculosis H37Rv reference strain with an MIC of 16 \u03bcg mL\u22121, while epidioxysterols 3 (208) and 4 (209) showed the same MIC of 64 \u03bcg mL\u22121 [S. subtomentosum [S. insigne CGMCC5.57 [50 values ranging from 2.3 to 25.7 \u03bcM. Ergosta-4,7,22-triene-3,6-dione (221) showed only weak cytotoxicity against the HL-60 cell line with an IC50 of 34.3 \u03bcM. Dankasterone B (218) showed strong cytotoxicity against five human cancer cell lines , with IC50 values of 2.3, 3.3, 4.4, 3.5, and 2.7 \u03bcM, respectively. -9,14-Hydroxyergosta-4,7,22-triene-3,6-dione (220) also displayed significant cytotoxic activity against the same five cell lines with IC50 values of 3.1, 9.0, 11.0, 13.2 and 12.3 \u03bcM, respectively. Intriguingly, although the compounds dankasterones A (217) and B (218) share similar structures, with the exception of substituents between C-4\u2013C-5, dankasterone B (218) showed stronger cytotoxicity than dankasterone A (217). This result suggests that the presence of C-4\u2013C-5 double bond plays a significant role in mediating the cytotoxic activity against the cancer cell lines tested. Steresterone B (216), containing a hydroperoxyl moiety at C-14, showed no cytotoxicity. However, -14-hydroxyergosta-4,7,22-triene-3,6-dione (220), an analog of steresterone B (216) with a hydroxy at C-14, showed greater cytotoxic activities in these tests. The data revealed that the functional group 14-OH is a key assistant for its cytotoxic effects. Two compounds 3\u03b2, 6\u03b1, 14\u03b1-trihydroxydankasterone A (217a) and 3\u03b1,6\u03b1,14\u03b1-trihydroxydankasterone A (217b) were semi-synthesized from dankasterone A (217) because of its relatively high yield and moderate cytotoxicity, and neither of them showed improved cytotoxicity. The above results indicated that the carbonyl groups on dankasterone A (217) were essential for its cytotoxicity.Most of the sterols from ne (224) ,106,107.mentosum  and S. iGMCC5.57 . It has GMCC5.57 , antiplaGMCC5.57 , immunosGMCC5.57 , antivirGMCC5.57 , and enhGMCC5.57 . RecentlS. hirsutum, sterols have also been isolated from other species of Stereum. For example, dehydroergosterol peroxide (225), and -ergosta-7,22-dien-3\u03b2-ol (226), were obtained from the fruit body of S. subtomentosum [E)-3-hydroxy-5,6-epoxy-7-one-8(14),22-dien-ergosta (228), and - 7,22-diene-3,5,6-triol-ergosta (229) were obtained from the mycelium of S. insigne CGMCC5.57 [Stereum sp. YMF1.1660 [Stereum sp. CCTCC AF 207024 [Apart from mentosum . Stella GMCC5.57 . 5-EpidiMF1.1660 , and (3\u03b2F 207024 . DehydroF 207024 . Their sStereum sp. OUPS-124D-1 and their absolute configurations were determined by the application of the phenylglycine methyl ester (PGME) method [Z,11E)-9,11-hexadecadienoic acid (236) was obtained from S. insigne CGMCC5.57 [Stereum sp. YMF1.1660 [Three carboxylic acids with two primary alcohols, sterepinic acids A\u2013C (233\u2013235), have been isolated from ) method . Methyl GMCC5.57 . In addiMF1.1660 . Their sStereum, nearly half of which were sesquiterpenoids, and some of them were only found in Stereum. The results have shown that the production of secondary metabolites by organisms is not random, but related to their ecological niches [Stereum, especially since the bioactive ones may help Stereum to defend their habitat or to suppress the growth of competitors to maintain its own abundance.Over the past 70 years, 238 compounds have been discovered from the genus of l niches . We specAccording to the studies, we found that some bioactivities of metabolites may be related to critical bonds or groups of structure. For example, sterhirsutins E (15) and G (17) , the immStereum have been a potential drug repository for antiobesity therapeutics, cancer, inflammation, and other diseases, but it is difficult to obtain large quantities of active compounds because only minor amounts can be obtained from natural sources. As a result, we should do more research into the synthesis of such compounds. Recently, SteTC1, a type I cembrane diterpene synthetase from S. histurum, was characterized via genomic data analysis, phylogenetic method, protein sequence alignment and products detection with GC-MS [Stereum, but only 10 known species have been studied for their metabolites, so more new and active compounds are likely to be discovered from Stereum in the future.The discovery of novel and bioactive secondary metabolites is a target of drug and natural product chemists. Microorganisms are dominant sources for such substances. The metabolites of th GC-MS . This is"}
+{"text": "The outcome of well-performed clinical research is essential for evidence-based patient management during pandemics. However, conducting clinical research amidst a pandemic requires researchers to balance clinical and research demands. We seek to understand the values, experiences, and beliefs of physicians working at the onset of the COVID-19 pandemic in order to inform clinical research planning. We aim to understand whether pandemic settings affect physician comfort with research practices, and how physician experiences shape their understanding of research in a pandemic setting.th and 17th, 2020, during a time of local transmission but prior to the surge of cases. We aimed to recruit into the survey physicians in infectious disease and critical care research networks across Canada.A survey tool was adapted to evaluate familiarity and comfort with research during a pandemic. A cross-sectional, online questionnaire was distributed across Canadian research networks early in the COVID-19 outbreak. The survey was administered between March 112 = 8.941, 95% CI: -0.264, -0.085, p = 0.003), using non-identifiable observational data with a waiver of consent with a median score of 97 out of 100 (IQR: 79.25\u2013100) vs median 87 out of 100 (IQR: 63\u201379) . The majority felt that research quality is not compromised during pandemics.Of the 133 physician respondents, 131 (98%) considered it important to conduct clinical research during the COVID-19 pandemic. Respondents were more accepting of adaptations to the research process in during a pandemic compared to in a non-pandemic setting, including conducting research with deferred consent (\u03c7Physicians consider it important to conduct research during a pandemic, highlighting the need to expedite research activities in pandemic settings. Respondents were more accepting of adaptations to the research process for research conducted during a pandemic, compared to that conducted in its absence of a pandemic. One challenge posed by the recent SARS-nCOV-2 (COVID-19) outbreak is how to effectively and efficiently conduct research to better improve clinical care of infected patients.Conducting research during a pandemic is difficult, and associated with a number of pitfalls, including busy staff, scared patients, and concerns for infection control . Yet it At the same time, there is public demonstration of support in participating in randomized trials during a pandemic, perceiving that the benefit obtained outweighs the risks . BalanciPrevious studies, particularly around the H1N1 outbreak, have focused on healthcare worker perceptions and attitudes towards pandemic response measures, as well as perceptions of both public and healthcare providers towards vaccinations \u201312. Few We conducted a cross-sectional, online survey to rapidly assess the views of Canadian physician researchers who were actively working on COVID-19 preparedness planning . We adapThe survey was rapidly adapted for the Canadian and current COVID-19 context. Optimization occurred via clinical sensibility testing and assessing for face and content validity by lay-people and experts . The surWe distributed this survey by email and social media channels across primarily acute and critical care research networks, across jurisdictions, with a focus on dissemination to Canadian infectious disease and critical care physicians, via a convenience sample via snowball sampling of clinicians and investigators. We distributed the survey via a Canadian infectious disease listserv as well as slack channel, as well as via a Canadian ICU clinician listserv and slack channel. Our survey is representative of physicians working in acute and critical care due to the nature of sampling. Due to the nature of the type of COVID-19 research being conducted in Canada at the time of the survey, we focused on physicians treating patients hospitalized or presenting to hospital with COVID-19. No restrictions on the type of patients being cared for were set. We focused on infectious diseases, general internal medicine, or intensive care physicians\u2019 in academic hospitals in Canada, who from our experience represent the primary physicians caring for these patients in hospital and would be most likely to be involved in hospital-based research. We did not restrict our sample to solely clinician-investigators or researchers in order to capture the perspectives of a diverse pool of individuals potentially involved in the implementation of research into practice via a non-biased sample. No specific inclusion or exclusion criteria were set; however, due to the nature of survey distribution, the survey only included physicians belonging to acute and critical care research networks in Canada.The survey was rapidly distributed between March 11th and 17th, 2020, at the onset of COVID-19\u2019s emergence in Canada. The survey was disseminated through email and Slack across infectious diseases and critical care discussion groups amongst Canadian physicians over this time-period. These networks represent trialists as well as clinicians, and reflect some of the diverse group of individuals who are typically involved in clinical research. Study data were collected and managed using REDCap electronic data capture tools at BC Children\u2019s Hospital . At the Our analysis is primarily descriptive, according to the questions asked in the survey. Incomplete surveys were included for the questions to which they contributed. We present descriptive statistics as proportions as well as means (+/- SD) for continuous variables or medians (IQR) for discrete scales. Three-point and five-point Likert scales were used to assess agreement with statements, with three indicating \u2018a large effect,\u2019 and five indicating \u2018strongly agree,\u2019 \u2018very comfortable,\u2019 or \u2018very important.\u2019 A sliding scale (0\u2013100) was used to further elucidate the strength of conviction for certain statements. Our analysis focused primarily on comparing perceptions on research performed during an outbreak, compared with that performed in the absence of an outbreak.We compared categorical responses using chi-square tests  and Kruskal-Wallis tests, and continuous measures using the Student t test and Mann-Whitney U test depending on data distribution. We hypothesized that there should be no difference in comfort with research practices between pandemic and non-pandemic settings, experience recruiting, or by clinical specialty. For comparison of multiple continuous variables, we used a simple linear regression, while one-way ANOVA was used when comparing continuous ordinal responses.We analysed responses from 145 physicians collected in March 2020, with a 92% participation rate (133 physicians answered at least one question of the survey) and 71% survey completion rate. Respondents were infectious diseases and critical care clinicians on email and Slack discussion groups in February and March 2020. Response rate was incalculable due to the nature of social network survey distribution. Respondents clinically worked in critical care (n = 32), infectious diseases (n = 76), general pediatrics and general internal medicine (n = 11), and a mixture of other fields (n = 14) . On averWhile just under half (n = 60) of respondents had been involved in caring for critically ill patients during a prior outbreak, only 22.5% (n = 30) had thus far cared for a suspected or confirmed case of COVID-19 at time of completion, although half (n = 66) noted that such a case did exist thus far in their hospital.Regarding the threat towards ongoing research activities, 14% of respondents (n = 15) indicated that pandemic research would have a large effect, but 38.3% (n = 41) felt it would have no effect at all. With respect to clinical care, 65.7% (n = 71) believed it would have a small effect on clinical care, and only 6.5% (n = 7) believed it would have a large effect. The majority of respondents  felt that the increased clinical workload would have a small effect on their ability to recruit patients into clinical studies. Respondents indicated that conducting pandemic-specific trials in clinical settings will impact other non-pandemic related ongoing research significantly more than it will impact clinical duties in their own clinical environments, rather than affecting them similarly .2 = 8.941, 95% CI: -0.264, -0.085) (p = 0.003)  were comfortable doing so in a non-pandemic setting, while 58.9% (n = 63) were comfortable doing so during a pandemic (\u03c7= 0.003) . When as= 0.003) . When as= 0.003) .Almost 64% (n = 69) felt somewhat or very comfortable randomizing hospitalized COVID-19 patients into a no-treatment arm of a study looking at experimental antiviral therapy. Respondents disagreed that research conducted during pandemics is of lower quality, with 81.2% (n = 108) disagreeing or strongly disagreeing that it is of lower quality.There were few differences between respondents who self-identified more as a clinician than as a researcher. Of note, those who identified more strongly as researchers were more comfortable with the statement that observational data from patients should be collected with a waiver of consent to inform clinical management in both the absence and presence of a pandemic .There were few differences in beliefs amongst those with experience recruiting patients into studies or caring for critically ill patients during previous outbreaks. Those with previous experience recruiting patients believed more strongly that observational data from patients in a pandemic should be collected with a waiver of consent  , while o2 = 9.635, p = 0.022 and, \u03c72 = 8.235, p = 0.041 respectively), no specific between-group differences account for these differences . There were no significant differences in comfort randomizing COVID-19 patients to experimental controls, and no differences in perspectives on how clinical workloads during pandemics might affect ability to recruit patients into trials (or vice versa). There was no difference by specialty regarding whether research in a pandemic is of lesser quality.There were some differences in comfort and beliefs around research by specialty. Critical care physicians believed less strongly than infectious disease physicians that observational data from patients should be collected with a waiver of consent, in both pandemic and non-pandemic scenarios  = 3.375, p = 0.022 and F = 3.176 p = 0.028 respectively) . There wferences . HoweverOur survey of physicians who are involved in clinical care and research on patients affected by outbreaks highlights important insights into the perspectives of conducting research in challenging times. Overall, respondents consider it important to actively participate in randomized control trials as a means to gather evidence during a pandemic. In our study, more than two thirds of respondents noted that the pandemic would affect clinical care and workload speaks to the need for health care worker pandemic preparedness at the clinical unit and hospital level. Our survey evaluated the potential impact of COVID-19 on other research and clinical duties, finding that just under two thirds of respondents felt as though it would have some effect on ongoing research activities. This sentiment was particularly strong amongst critical care physicians.Our study demonstrates a difference regarding conducting research in pandemic settings compared to non-pandemic settings. In two out of three scenarios, respondents felt much more comfortable in the setting of a pandemic using deferred consent for experimental medications, and collecting non-identifiable observational data without consent. As well, our survey demonstrated concern amongst respondents that research conducted in pandemic settings is of lower quality; with the large amount of data emerging on COVID-19, this concern may be valid. Of note, this survey was taken in the weeks leading up to large patient surges in the targeted geographic region.Our findings, that almost two thirds of respondents felt as though COVID-19 impacts ongoing research activities, contrasts to findings from previous studies conducted during the H1N1 outbreak, which indicated that only one third of evaluated research efforts slowed . PerhapsOur findings echo previous work emphasizing the need for research protocols to be present to allow for effective research during pandemics ,17. In tThe ethical standards of research conducted during an outbreak, as stated by the World Health Organization, should be maintained, and the urgency or a public health emergency does not justify lower ethical standards ,20. Our No national guidelines were woven into this survey beyond the standards of human research ethics. As our understanding of the management of COVID-19 develops further, physician perspectives regarding acceptable treatment options is likely to change.Our survey has several strengths. We used pragmatic methods to receive feedback from a sample of respondents likely to be providing clinical care to COVID-19 patients as well as conduct research with this population. We modified a survey tool previously used in other regions, allowing us to accurately compare perspectives in our cohort. As it was conducted relatively early in the COVID-19 outbreak, prior to many physicians directly caring for COVID-19 positive patients and being faced with these potentially difficult scenarios, this survey allowed us to identify their thoughts, feelings and beliefs without them being clouded by their recent and direct actions. However, with the COVID-19 crisis imminently looming, it provided the necessary context for these questions to be asked beyond a hypothetical. Notwithstanding, our survey also had limitations. First, by not collecting demographic data we are not able to accurately assess how representative the population of respondents is compared to care providers, including by country of origin. However, given the nature of distribution of this study through specific physician networks, our findings are likely themselves more reflective of these networks themselves. Indeed, similar networks have been cited as key for conducting research in pandemic settings ,25. TheiOur study demonstrates the need for ongoing work to better understand the perspectives and preferences of patients and the public, who are integral to ongoing research practices, in research participation during pandemics. As well, while our survey represents the views of clinicians and researchers at the outset of a pandemic, ongoing evaluation of the experiences of clinicians and researchers recruiting for clinical trials during COVID-19 will be informative. This includes the need to better understand how clinicians and researchers balance the demands of clinical care and research during these times. Finally, repeating surveys like ours later on in the course of a pandemic, particularly after more respondents have actively cared for patients affected by the illness, may allow for an opportunity to explore shifting perspectives as a result of experience.Amongst a network of physicians likely to be involved in the clinical care and/or research related to COVID-19 patients, there are differences in comfort level conducting research in pandemic situations compared to non-pandemic situations. Conducting high-quality research during a pandemic is perceived as a major priority, and education regarding the challenges of outbreak-specific research is important to better serve the clinical and research community and inform study design.S1 Appendix(PDF)Click here for additional data file.S2 Appendix(DOCX)Click here for additional data file."}
+{"text": "In combating the increasing trend of non-communicable diseases (NCDs) over the last two decades in the country, the Ministry of Health Malaysia developed the Enhanced Primary Health Care (EnPHC) initiative to improve care management across different levels of the public service delivery network. An evaluation research component was embedded to explore the implementation issues in terms of fidelity, feasibility, adaptation and benefit of the initiative\u2019s components which were triage, care coordination, screening, risk management and referral system.A mixed methods study was conducted at 20 participating EnPHC clinics in Johor and Selangor, two months after the intervention was initiated. Data collected from self-reported forms and a structured observation checklist were descriptively analysed. In-depth interviews were also conducted with 20 participants across the clinics selected to clarify any information gaps observed in each clinic, and data were thematically analysed.Evaluation showed that all components of EnPHC intervention had been successfully implemented except for the primary triage counter and visit checklist. The challenges were mainly discovered in terms of human resource and physical structure. Although human resource was a common implementation challenge across all interventions, clinic-specific issues could still be identified. Among the adaptive measures taken were task sharing among staff and workflow modification to match the clinic\u2019s capacity. Despite the challenges, early benefits of implementation were highlighted especially in terms of service outcomes.The evaluation study disclosed issues of human resource and physical infrastructure when a supplementary intervention is implemented. To successfully achieve a scaled-up PHC service delivery model based on comprehensive management of NCDs patient-centred care, the adaptive measures in local clinic context highlight the importance of collaboration between good organisational process and good clinical practice and process. Non-communicable diseases (NCDs) and their multiple risk factors have been affecting the Malaysian population, across wide age range and income level . NCDs haFactors influencing the community\u2019s healthcare utilisation include ease of access to the primary healthcare facilities such as public clinics , distancDue to the alarming rise of NCD burden, Ministry of Health Malaysia (MOH) through the National Strategic Plan for Non-Communicable Disease (NSP-NCD) 2016\u20132025 has proposed a number of initiatives including \u201cStrengthening Chronic Disease Management at Primary Care Level through the Enhanced Primary Health Care (EnPHC) Initiative\u201d . The EnPThe triaging system is commonly associated with a hospital\u2019s Emergency Department ,11. EnPHCare Coordinator is a key component introduced by EnPHC to integrate, facilitate and coordinate NCD care-related activities ,14. A CCThe preconceived notion of \u201ca general health screening is a waste of time unless you have symptoms\u201d was a big challenge ,17. EnPHThis activity was enhanced to empower assistant medical officers and staff nurses, which was previously only performed by doctors. It consisted of cardiovascular disease risk stratification (using the Framingham risk score \u201320) and EnPHC introduced an internal referral system within the clinic named Integrated Specialised Services (ISS) to in-house or visiting allied health professionals such as nutritionist, physiotherapist and dietitian . The extEvaluation research on an intervention is vital to determine feasibility of implementation in the setting and to identify early problems which occur over the implementation course. While the quantitative evaluation method is able to quantify fidelity and utilisation of the components of the intervention, to gain an understanding of how the intervention components could be translated from research into practice, the qualitative approach is taken to explore the reasoning behind its feasibility, as well as to support the quantitative findings ,23. ThisThe EnPHC initiative was piloted in July 2017 in 20 public primary care clinics in two states of Johor and Selangor in Malaysia. Selection of the two states was based on the balance between regional representativeness, intervention budget and implementation capacity which involves manpower and facilities . For theEnPHC-PE was conducted to explore four aspects of implementation issues, namely fidelity, feasibility, adaptation and perceived benefit. The evaluation aspects are as the following:Fidelity is defined as the degree to which an intervention was implemented as it was prescribed in the original protocol or as it was intended by the program developers \u201329. FideFeasibility is defined as the extent to which a new treatment, or an intervention, can be successfully used or carried out within a given agency or setting .Adaptation is described as modifying the changes which have been tested and found to be effective and suited to local setting or condition .Benefit is an advantage or profit gained. The benefits of an intervention targeting on the ultimate outcome are dependent on the effectiveness of other interventions throughout the care cycle .The mixed method study design using structured observation and in-depth interview (IDI) was conducted from September to November 2017, two months after EnPHC was rolled out in the 20 participating public primary health care (PHC) clinics. As the clinic setting, infrastructure and human resource varied across the clinics, the adjustments in implementation were expected to be different. Hence, two months were deemed appropriate and sufficient period for the clinics to make the necessary adjustments.Data was collected using three approaches via self-reported assessment form, structured observation checklist and in-depth interviews.The self-reported assessment form\u2014this data collection tool consisted of three main variables; participants were required to identify the intervention components which have been implemented in their clinic from the list shown in the form, to fill in the implementation date for each intervention as well as an open-ended section to state the reasons if there were any intervention that is yet to be implemented. The form was distributed to all PHC clinics, filled by the clinic\u2019s liaison officer (LO) for EnPHC that was appointed by the program owners and collected before the structured observation activity was conducted. This initial assessment was important to understand the implementation status of each clinic which later on facilitated the development of the checklist for structured observation.The structured observation checklist\u2014this tool was developed to facilitate researchers\u2019 observations on how each of the interventions were implemented and carried out in the clinics. The checklist was pre-tested in one of the participating PHC clinics. Information during pre-testing was captured as field notes which was used to improve the checklist, specifically on the observations for the ISS intervention and document formatting to create more space for researchers to add notes. The revised checklist was later used for the remaining 19 clinics [Refer Appendix for the structured observation checklist]. The structured observation activity was conducted in all 20 PHC clinics, to cover all interventions that were implemented as well as to assess the implementation in the different departments within the clinic. For each clinic, three to five research team members made their observations independently, taking between 45 minutes to two hours for completion. The checklist was also designed with space for the researcher to write the field notes. To follow-up with the observation, the research team members for a particular clinic will gather and discuss among themselves for 10\u201330 minutes on specific issues noted during their observation which needed further exploration during the subsequent IDI sessions.The in-depth interview (IDI)\u2013semi-structured interviews were conducted with 20 HCPs respectively from each intervention clinic. Selection of interviewees was purposive to reflect sharing of implementation issues across clinic settings by the different categories of staff holding different roles and responsibilities. IDI aimed to explore the implementation issues and to clarify information gaps from the self-assessment form and/or the observation.Each participant was briefed on the interview process and guaranteed the confidentiality prior to the session while obtaining informed consent and permission for audio-recording during the interview. The interview was conducted by trained research team members in the participants\u2019 preferred language either English or Malay. It was conducted on the same day as the observation with each session lasting between 30 minutes to two hours.Fidelity information was assessed using self-reported forms followed by a structured observation checklist which was later entered and tabulated in Microsoft Excel. The data were descriptively analysed and presented as the number of availability and utilisation of each intervention component. The qualitative data from IDI were in audio recording and transcribed verbatim. Identifiers for the interviewer and participants remained anonymous and were replaced with researcher-assigned numbers for confidentiality purposes. Thematic analysis approach was used to determine themes and sub-themes from the interview transcripts based on objectives . The results were presented in form of excerpts.The quality control process was carried out by research team members for both quantitative and qualitative data. The data obtained from structured observation was fully cross-checked with the raw data obtained from the checklist. Prior to analysis of qualitative data, research team members who were not involved in the transcribing process cross-checked the transcript with the audio recording for accuracy. Data interpretation was verified by contacting study participants through telephone text messages to ensure the interpreted meaning was as intended. Data validation was achieved through consensus among the multidisciplinary research team members . In addiThe EnPHC-PE study was registered under the National Medical Research Register, Ministry of Health Malaysia (NMRR-17-295-34771). Ethics approval was granted by the Medical Research and Ethical Committee (MREC), Ministry of Health Malaysia (ref: (5) KKM/NIHSEC/P17-350). Confidentiality of participants involved was assured throughout the study\u2019s conduct. Additional permission from the management of the respective state and clinic was obtained. Written informed consent from participants was obtained prior to the interview and confidentiality of participants was assured throughout the study\u2019s conduct.In total, 16 females and four males who were interviewed involved five Medical Officer in Charge (MOICs), 12 LOs and three CCs . The parFidelity assessment was based on the availability of the intervention and its utilisation in accordance to guideline protocols. In general, all intervention components have been implemented according to the protocols in all 20 clinics, except for the following specific components:All clinics deployed the primary triage counter except for one clinic which failed to establish the required counter due to limitation in building infrastructure. Four primary triage counters from the remaining 19 clinics were found unattended and acted as placeholders. The secondary triage counter, however, was successfully set up and utilised in all clinics.One clinic failed to utilise the required format of the visit checklist as they deemed the existing patient appointment card sufficient to capture the required information.The appointment defaulter tracing activity was successfully conducted in all clinics. However, as there was no guideline protocol on how it should be conducted, fidelity assessment could not be made as there was no standard to match. This issue was cited to contribute into feasibility issues during further exploration through IDI.The communication between clinics and hospitals on referral management had been established in all clinics. However, fidelity assessment was unsuccessfully conducted on the communication process as the guideline has no specific criteria to be communicated in the referral as standards to be met.Limitation in physical infrastructure was a common issue encountered by the clinics to deploy the triage counters. Lack of physical space was especially common in clinics with an old building. When these clinics placed the triage counters inside the building, long queues were formed, thereby leading to congestion. In response to this matter, physical renovations were proposed but were deemed unfeasible due to lack of funding.Human resource was another common challenge expressed by the participants. The EnPHC standard operating protocol outlined that the triage counters should be managed by specified categories of staff namely, assistant medical officers and staff nurses. However, they were currently multi-tasking and had existing responsibilities which influenced the intended counter\u2019s function. The primary triage counters were occasionally left unattended in the event of responsibility prioritisation such as attending to emergency cases or covering for other staffs on leave.\"Unfortunately \u2026two issues there. First is space and the second is the person who has to be at the primary triage counter, which is the MA , also limited.\".The assistant medical officer and staff nurse were found competent to manage the NCD cases in accordance with the standard operating procedure, the clinical protocols as well as the EnPHC guideline which was provided for each intervention clinic. An issue raised on the design of NCD care form was the insufficient space to write referral note. The visit checklist underwent several updates, re-training was not conducted for each update. It was left to the clinic staff to adapt and implement the latest version.Patients\u2019 non-adherence to appointments and the implementation of the appointment defaulter system was a common challenge across the clinics. As the implementation guidelines on this activity was not written in detail, the clinics adopted various mechanisms. While all the clinics performed the activity primarily by phone call, the follow-up mechanism differed. If an appointment defaulter was unreachable by phone, the clinic staff would contact his/her next of kin or the patient\u2019s neighbour. Eight of the clinics even took the extra initiative of doing home visits, but it brought in logistical challenges of tracing houses when it came to incomplete addresses.\u201cconducting patient screening is a barrier because we don\u2019t have enough staff\u201d . However, the activity managed to be implemented in all clinics due to the staffs\u2019 dedication, commitment and teamwork in adapting to this new task which they deemed to be valuable.The implementation of NCD screening was perceived as challenging due to inadequate staff, as shared by one participant: \u201cWe conducted  in rotations, with pharmacy, with diabetic foot care, with doctors\u201d .The participants perceived that the use of the mobile applications for the Framingham risk score caused patients to wait longer. As there were frequent application malfunctions and issues in internet access, they tried to overcome the obstacle by performing manual calculations. Participants shared that patients may have a negative impression of staff using the mobile application, perceiving that they were playing with their phones while on duty. The lack of a dedicated room while delivering health education to patients at the open counters raised concerns on patient privacy. Despite the limitations, the clinic staff attempted to conduct opportunistic health education activities, as shared by a participant: The space for referral feedback in the NCD care form was very limited which posed risks for incomplete information. Another issue raised by the staff was the continued use of an existing protocol which stipulated for the existing official referral form to be filled, resulting in repetitive data entry into two separate documents for the same purpose.\u201cPatient\u2019s privacy is more secured and staffs feel more comfortable (working)\u201d .The physical infrastructure was a limitation, the deployment of the triage counters caused patient congestion in most of the clinics. To overcome the problem, modifications of the primary triage counter were carried out in four clinics to also function as a registration counter for new patient visits. The setup for the secondary triage counter also varied, from actual physical counters which were stated in the implementation protocol to dedicated rooms. The rooms were viewed as necessary in eleven clinics for privacy reasons as well as providing a conducive environment for staff to carry the task, as shared by a participant: \u201cNot fixed (staff)\u2026depending on the staff availability on that day\u201d . For the secondary triage, one of the clinics grouped their staff into two teams by the zone catchment area of the clinic. The schedule was modified so that one team would dedicate two days per week for NCD risk management to patients in their assigned zone, while another team took care of the general outpatients, as shared by one of the participants: \u201cMonday and Tuesday would be Zone One appointment patient\u2026Zone Two will help out to see the outpatient, and then we switch (the schedule)\u201d .Due to the human resource constraints, all clinic staff shared the task of managing the primary triage counters instead of assigning dedicated personnel. To overcome the manpower shortage issue, a participant shared: \u201cShe  will write there (in extra paper attached) and attached with NCD care form. For more information, please refer the sheet at the back (attachment)\u201d . For the appointment defaulter tracing activity, three clinics created an appointment defaulter book to facilitate the monitoring, as shared, \u201cwe have an appointment system book, we will count patients that have defaulted from the book\u201d . Meanwhile, clinics which were equipped with an existing partial information technology (IT) system that was originally intended for billing purposes had made modifications to the system in order to meet the EnPHC requirements on visit checklist and appointment defaulter tracing.To cope with the limited space of referral notes in the NCD care form, clinic staffs took the initiative by attaching extra paper to the referred patient information together with NCD care form, as noted by a participant: As a countermeasure to the issues of conducting on-site risk score calculations, clinics traced the necessary laboratory investigation results to calculate the risk score before the patient\u2019s appointment day. This action was perceived as necessary to reduce patients\u2019 waiting time and to avoid any misunderstanding regarding the use of phones in front of patients.A porter system was created in two clinics to improve the referral system. An assistant medical officer or staff nurse was appointed as a porter to bring the NCD care form to the hospitals to get the referral appointment date for the patients and the hospitals\u2019 medical officers would review the referral notes first before assigning the appointment date. This process granted an opportunity for discussion between clinic and hospital. This porter system facilitated the monitoring of hospital appointment defaulters and prevented loss of NCD care forms once the form was given to the patient themselves to get the hospital appointment, as currently practiced.\u201cAfter EnPHC, can see the benefit\u2026 (we) can channel patient (accordingly)\u201d . They also shared that by having the primary triage counter, assistant medical officers and staff nurses were empowered to observe patients\u2019 condition while waiting for their turn to see the doctors, as mentioned by a participant, \u201cWe can observe patients while they\u2019re at the waiting area and take the necessary action when needed\u201d. .Participants informed that the implementation of triage counter facilitated the management of patient traffic within the clinic, as one participant shared; \u201cwe can trace patient by appointment, filter (patient) by date\u201d . Performing the appointment defaulter tracing activity was informed to have reduced the number of defaulted appointments. The activity itself has resulted in a closer interpersonal relationship between clinic staff and patients when the clinic staff contacted them. This opinion was shared by participant: \u201cPatient felt they were being cared more (when) we called them even on Saturday (and) Sunday\u201d .Despite the challenges, the clinic staffs realised that the NCD care form provides more structured and reader-friendly information for patient care management. Suggestions for a booklet design for the NCD care forms were made to minimise repetitive entry of the demographic information and to minimise the risk of missing documents as the form was merely two sheets of carbonless copy paper. The visit checklist was found not only useful for patients\u2019 record management, but it was also a valuable tool to trace appointment defaulters. Care coordinators could detect the appointment defaulters from the list and contact the defaulter to investigate the reason for defaulting and providing new appointment date, as informed by one participant: \u201cOur new (NCD) cases tripled since Enhance (EnPHC). Currently, diabetes 20 cases (detected), hypertension (case detected) increase three times\u2026 after July increase 20 patients (detected) in a month, just hyperlipidaemia.\u201d .The NCD screening activity was shared to have a positive impact on the number of newly detected NCD cases which could reduce the number of undiagnosed and untreated patients within the community. One noted, The clinics shared that the risk stratification criteria were used as a health education guide by clinic staff for general health, exercise, foot care and smoking habits. In addition, this activity empowered the assistant medical officer and staff nurse to deliver health education and it was no longer restricted by doctors only. With the EnPHC initiative, the District health offices were said to have conducted training sessions with the assistant medical officer and staff nurse to improve their knowledge, skills and experience in delivering health education.Enhanced communication was a by-product of this improved referral system. It was found that CC in the clinics and liaison officers from the hospitals had been in close contact with each other in monitoring patient\u2019s adherence to hospital referral appointments, particularly when a patient was reported to have defaulted referral appointment and a new appointment had to be arranged. The communication was performed via various means such as phone call, emails and mobile communication applications.We adopted a mixed-methods approach to assess the implementation of EnPHC intervention packages. Before an intervention is scaled up, fidelity assessment is crucial to address implementation issues before outcome evaluation to ensure the intervention is delivered as intended while feasibility assessment aims to uncover the strengths, challenges and weaknesses. These assessments are important as the context-specific adaptations can be made for improvement. After two months of the implementation of the EnPHC initiative, the interventions were implemented in all participating clinics. Fidelity towards the implementation is high as the interventions mostly enhance the existing activities. However, the extent of implementation for each intervention component and the execution process differs across clinics. This variation is mainly due to the adaptations made to overcome the clinic-specific shortcomings namely, physical structure, human resource and technology uptake.While other studies have shown the importance of three criteria in setting up a triage system namely, tolerable health care resource, brief assessment of medical need by health care provider in charge at the triaging point and an established triage plan or system , this stThe challenge of human resource was prominent in all intervention components, thus appearing as an important factor for the EnPHC initiative\u2019s sustainability and scalability. Our findings reveal that the interventions introduce changes in the clinics\u2019 work procedures and behaviour but with minimal changes in the staffing and on how the tasks are done\u2014most of the interventions were executed manually with minimal technology assistance. If the issue of human resource availability is likely to persist, there should be considerations on making best use of available resources ,35. AlteAlthough the health sector strives to make use of the latest technology, skilled HCPs in clinical care are still required  for careTechnology uptake such as the electronic medical record can reduce the corporeal efforts related to care provision and service quality ,39. In oThe clinics setting is an influencing factor for the adaptive measures taken which has been noted as a domain for implementation . An openExtensive follow-up actions by the HCPs when a patient was unreachable by phone were a testament to the high value placed on defaulter tracing. Studies have also reported defaulter tracing as a favourable method of community engagement and to foster HCP-patient relationship ; this haThe person-centred care concept also stresses the importance of a patient\u2019s care continuity across facilities . Thus, tThis study\u2019s strength lies on its data triangulation efforts. Its mixed methods data collection approach enabled multiple perspectives of the subject being evaluated. The involvement of multidisciplinary research team members , scholarThis study also had its limitations on the data collection process. The structured observation using checklist was conducted in cross-sectional manner which only captured that particular period of observation and might not reflect the whole process. However, the subsequent IDI helped to fill the information gaps. Even though the IDI participants were purposively selected as the representative with the best knowledge on the implementation process in their clinics, \u2018the person with best knowledge\u2019 was perceived from each clinic\u2019s consensus; there were no quantifiable evaluation assessment made to measure the participant\u2019s actual knowledge. Additionally, it might also have limited the sharing of challenges encountered by other sections within the clinics. The scope of evaluation was limited to the organisational  process; the clinical processes were excluded as it was evaluated by another evaluation team. Data collection at two months after the interventions were rolled out was another limitation as some clinics were still in the adjustment period. It led to the research team\u2019s decision to conduct a follow-up evaluation study planned in the tenth month of implementation to explore the implementation feasibility across time in the participating clinics. Focus group discussions with other personnel in the clinic will also be conducted to obtain a more representative feedback from the clinics.The EnPHC initiative is a model of service delivery based on comprehensive patient-centred care particularly on the PHC perspective in managing NCD. The evaluation study has disclosed issues of human resource and physical infrastructure when a supplementary intervention is implemented. It highlighted the need for a good organisational process to address these issues which are equally important as having good clinical practices and processes. The adaptive measures taken to suit each clinic\u2019s local contexts are also important considerations for the program owners to ensure the initiative\u2019s success and sustainability.S1 Checklist(PDF)Click here for additional data file. 16 Jul 2020PONE-D-20-04093Process evaluation of enhancing primary health care for non-communicable disease management: uncovered the fidelity & feasibility elementsPLOS ONEDear Dr. LOW,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please see the comments below.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Aug 30 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Fernando C. WehrmeisterAcademic EditorPLOS ONEAdditional Editor Comments:The manuscript addressed an important research question, especially in a middle income setting. As pointed out by the reviewers, the methods section needs to be improved for a better understanding of the study. Also, improvements in discussion is needed.Journal requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Please provide additional details regarding participant consent.In the ethics statement in the Methods and online submission information, please ensure that you have specified (i) whether consent was informed and (ii) what type you obtained .If your study included minors, state whether you obtained consent from parents or guardians.If the need for consent was waived by the ethics committee, please include this information.\u201d3. Please include additional information regarding the survey or questionnaire used in the study and ensure that you have provided sufficient details that others could replicate the analyses.For instance, if you developed a questionnaire as part of this study and it is not under a copyright more restrictive than CC-BY, please include a copy, in both the original language and English, as Supporting Information.http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.4. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail  and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see We will update your Data Availability statement on your behalf to reflect the information you provide.https://www.youtube.com/watch?v=_xcclfuvtxQ5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to \u2018Update my Information\u2019 (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: 6. Please include a separate caption for each figure in your manuscript.7. Your ethics statement must appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please also ensure that your ethics statement is included in your manuscript, as the ethics section of your online submission will not be published alongside your manuscript.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The manuscript attempts to address an important question by evaluating a primary healthcare initiative to improve NCD care management in Malaysia. The findings are rich and informative, but need to be presented in a more intelligible fashion. The manuscript as it currently stands has potential but lacks rigor and detail, and needs major revisions.Specifically:1. It is unclear how utilization was defined and assessed.2. How were the 20 public primary health care centers sampled/identified? The authors do not describe this.3. The authors mention that data collection was conducted 2 months vs 3-5 months after the program was implemented, but do not mention how these two different data collection time points may have impacted the results. Given that 2 months of implementation is very short, implementation differences may have been observed between clinics that had data collection at 2 months vs 5 months?4. Were the IDIs unstructured? semi-structured? This should be described in the methods. Additionally, authors should include the data collection instrument as an appendix to the manuscript if possible.5. Authors do not explain the rationale for selecting only 1 participant per clinic. Additionally, the participants varied in terms of their role/responsibility in the clinic, therefore the breadth of implementation components evaluated  could have been different from one clinic to another depending on the participant's level of exposure/role. This should be mentioned as a potential limitation, given there was only 1 participant per clinic.6. There is insufficient detail to describe how much the checklist changed between the two iterations.7. Figure 1 is not very informative and does not add to the manuscript. Its findings should be covered in the results section text.8. The results section is somewhat difficult to follow, and authors have combined background/context elements, evidence from other studies (which needs to be moved to the discussion section) and results from this particular study. The results section needs restructuring. It should also clearly summarize the key implementation components being evaluated .9. It would be informative to tell the reader how much is \"some clinics\", \"few clinics\", in the results. Perhaps add a proportion, so that the reader can assess how common some challenges were across the 20 clinics.10. The discussion section needs to be strengthened to clearly summarize the key findings in terms of fidelity, feasibility, adaptation and benefit of the program being evaluated, and to put them into context with other studies/programs, etc.11. Authors should also state key recommendations based on their findings.12. Careful grammar editing is needed throughout the manuscript.Reviewer #2:\u00a0NCDs are relevant and increasing public health issues in low- and middle-income countries, but often neglected as priority for health interventions or health research issues. The paper is interesting and reads well. However, please see below a few comments aiming to improve it.Title:Geographic area to include in the title .Background:Lines 49 to 61 in the background seem more appropriate as methods points, and preferable to move to the methods section, namely the study design and sampling.Methods:Study design and samplingThe description of the study design needs to be developed. You can move in that section a few methods aspects developed in the background as per comment above.The sampling section seems a bit weak and needs to be deeply improved. It was indicated that the intervention was implemented in 40 public health care clinics (20 control clinics and 20 intervention clinics) at two selected states. Do the 20 PHC of the evaluation only include the 20 intervention clinics or both intervention and control clinics? In the event, both type of clinics are included, can you explicit the process for sample size calculation and whether you assessed the precision and power of the sample to be able to detect significant difference between intervention and control clinics? In the event the 20 clinics for the evaluation are intervention clinics only, can you explain the rationale of focusing on the intervention clinics only as you may have missed a good opportunity to shape an interesting and relevant design comparing intervention and control clinics? Additionally whether you focus on the intervention clinics, can you provide an explanation with respect to the choice of the two states for the intervention and try to discuss how they may (or not) be representative of the overall national situation as the assessment aims to end up to evidences that may help for scaling up the intervention?Results:The quality of figures on the PDF format seems poor and needs to be improved. Moreover, the figures need to be numbered properly and well referenced in the text, and figures titles need to be clear and more explicit with respect to the information presented.For statements like \u201cThe current availability of human resource for health in Malaysia is still low when compared to OECD countries\u201d (page 10), it would be good to provide ratios or estimates whether available.Whether feasible and data available, it would be desirable to have more results. For instance, it may be interesting to know to which extent the secondary triage may have helped improving the detection of undiagnosed NCD cases for ensuring care continuity (lines 186-187). From the PHC register, are there collected data with respect to the patients that may be used for diagnosis and patient case classification? In the same vein, when you say that longer patient waiting time was observed in clinics with insufficient personnel to perform tasks at secondary triage counter (lines 190-191), it will be worthwhile trying to quantity the \u2018longer patient waiting time\u2019; or quantitative information in tracing appointment defaulter (line 234) and patients\u2019 adherence to appointments (line 250); or estimating NCD screening activities performed properly according to main reference document for NCD screening ), or to which extent the referral system was improved (line 311), etc.Discussions:It would be desirable to shape the discussions section as per the evaluation-focused four dimensions i.e. fidelity, feasibility, adaptation and benefit.Concerning the design and dimensions of the evaluation, it makes sense and it is relevant as you assessed the \u2018structural quality\u2019 of the intervention , but it may have also been worthwhile trying to address the process quality for such an intervention  as that would have been relevant for such an evaluation with the aim to scale-up the intervention package. You may have made the choice to focus on the \u2018structural quality\u2019, but good to justify more that choice in the discussions as well as the choice why the design did not address the process quality of care.It may also be relevant to discuss the scale-up opportunity and challenges with respect to scaling up such interventions in other regions or nationwide.Format:Review the text and double-check typo issues **********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 15 Oct 2020Editor CommentsAdditional Editor Comments:The manuscript addressed an important research question, especially in a middle income setting. As pointed out by the reviewers, the methods section needs to be improved for a better understanding of the study. Also, improvements in discussion is needed. Journal requirements:When submitting your revision, we need you to address these additional requirements.Thank you, noted & had addressed it1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. Thank you, noted & had addressed it2. Please provide additional details regarding participant consent.In the ethics statement in the Methods and online submission information, please ensure that you have specified (i) whether consent was informed and (ii) what type you obtained .If your study included minors, state whether you obtained consent from parents or guardians.If the need for consent was waived by the ethics committee, please include this information.\u201dThank you, noted & had moved the ethics statement to methods sectionRef: Pg.11, line 140-1473. Please include additional information regarding the survey or questionnaire used in the study and ensure that you have provided sufficient details that others could replicate the analyses.Thank you, noted & had added as [Appendix]Ref: Pg.9, line 95-96http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.4. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see  In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail  and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see  We will update your Data Availability statement on your behalf to reflect the information you provide.We have included the following information in the manuscript:drazahadi@moh.gov.my), the head of sector for Biostatistics & Data Repository, National Institute of Health, Ministry of Health Malaysia and with the permission from the Director General of Health, Malaysia.The dataset which support the findings of this article belongs to the Enhanced Primary Healthcare Evaluation study. Request for data can be obtained from Dr. Mohd Azahadi Omar  2. How were the 20 public primary health care centers sampled/identified? The authors do not describe this.Thank you for highlighted this. We have added this statement.Ref: Pg. 6-7, Line 30-39The initiative was piloted in July 2017 in 20 public primary care clinics in two states of Johor and Selangor in Malaysia. Selection of the two states was based on the balance between regional representativeness, intervention budget and implementation capacity which involves manpower and facilities [22]. For the purpose of evaluation, an addition of 20 control clinics were selected, matched according to urban-rural stratification, clinic setting and type as well as human resource availability in the clinic. Three evaluation studies on the EnPHC initiative were conducted concurrently and independently; two outcome evaluation at the community and facility level , and process evaluation focusing on the implementation process [9]. Since our focus was on the implementation fidelity and feasibility, the control clinics were excluded from the process evaluation. 3. The authors mention that data collection was conducted 2 months vs 3-5 months after the program was implemented, but do not mention how these two different data collection time points may have impacted the results. Given that 2 months of implementation is very short, implementation differences may have been observed between clinics that had data collection at 2 months vs 5 months?Thank you. It was an error on our side and we have made the correction. Ref: Pg.8, line 71-76The mixed method study design using structured observation and in-depth interview (IDI) was conducted from September to November 2017, two months after EnPHC was rolled out in the 20 participating public primary health care (PHC) clinics. As the clinic setting, infrastructure and human resource varied across the clinics, the adjustments in implementation were expected to be different. Hence, two months were deemed appropriate and sufficient period for the clinics for adjustments.4. Were the IDIs unstructured? semi-structured? This should be described in the methods. Additionally, authors should include the data collection instrument as an appendix to the manuscript if possible.Thank you and we have revised. We have included the data collection instrument as an appendix for this manuscript.Ref: Pg.9-Page 10, Line 105-109The in-depth interview (IDI) \u2013 semi-structured interviews were conducted with 20 HCPs respectively from each intervention clinic. Selection of interviewees was purposive to reflect sharing of implementation issues across clinic settings by the different categories of staff holding different roles and responsibilities. IDI aimed to explore the implementation issues and to clarify information gaps from the self-assessment form and/or the observation. Ref: Pg.9, line 95-96Refer Appendix for the structured observation checklist5. Authors do not explain the rationale for selecting only 1 participant per clinic. Additionally, the participants varied in terms of their role/responsibility in the clinic, therefore the breadth of implementation components evaluated  could have been different from one clinic to another depending on the participant's level of exposure/role. This should be mentioned as a potential limitation, given there was only 1 participant per clinic.Thank you. We have addressed the selection in Methods, and also included its limitation under Strengths and limitations.Ref: Pg.9, line 95-96Selection of interviewees was purposive to reflect sharing of implementation issues across clinic settings by the different categories of staff holding different roles and responsibilities. Ref: Pg.22, line 403-407Even though the IDI participants were purposively selected as the representative with the best knowledge on the implementation process in their clinics, \u2018the person with best knowledge\u2019 was perceived from each clinic\u2019s consensus; there were no quantifiable evaluation assessment made to measure the participant\u2019s actual knowledge.6. There is insufficient detail to describe how much the checklist changed between the two iterations.Thank you for this question.Ref: Pg.9, line 92-95Information during pre-testing was captured as field notes which was used to improve the checklist, specifically on the observations for the ISS intervention and document formatting to create more space for researchers to add notes. 7. Figure 1 is not very informative and does not add to the manuscript. Its findings should be covered in the results section text.Thank you for the suggestion. We have replaced this Figure with the following text. Ref: Pg.12-13, line 158-181Fidelity assessment was based on the availability of the intervention and its utilisation in accordance to guideline protocols. In general, all intervention components have been implemented according to the protocols in all 20 clinics, except for the following specific components: Triage Counters (primary triage counter). All clinics deployed the primary triage counter except for one clinic which failed due to limitation in building infrastructure. Four primary triage counters from the remaining 19 clinics were found unattended and acted as placeholders. The secondary triage counter, however, was successfully set up and utilised in all clinics.Triage Counters (primary triage counter). All clinics deployed the primary triage counter except for one clinic which failed due to limitation in building infrastructure. The secondary triage counter, however, was successfully set up in all clinics.Care Coordinator (visit checklist). One clinic failed to utilise the required format of the visit checklist as they deemed the existing patient appointment card sufficient to capture the required information.Care Coordinator (appointment defaulter tracing). The appointment defaulter tracing activity was successfully conducted in all clinics. However, as the there was no guideline protocol on how it should be conducted, fidelity assessment could not be made as there was no standard to match. This issue was cited to contribute into feasibility issues during further exploration through IDI. Referrals . The communication between clinics and hospitals on referral management had been established in all clinics. However, fidelity assessment was unsuccessfully conducted on the communication process as the guideline has no specific criteria to be communicated in the referral as standards to be met.8. The results section is somewhat difficult to follow, and authors have combined background/context elements, evidence from other studies (which needs to be moved to the discussion section) and results from this particular study. The results section needs restructuring. It should also clearly summarize the key implementation components being evaluated .Thank you for the suggestion. We have restructured the entire Results and Discussion section.(Results) Ref: Pg.11-19, line 149-313(Discussion) Ref: Pg.19-23, line 314-4129. It would be informative to tell the reader how much is \"some clinics\", \"few clinics\", in the results. Perhaps add a proportion, so that the reader can assess how common some challenges were across the 20 clinics.Thank you, we have quantified these words, where possible. Ref: Pg.14, line 210Eight of the clinics even took the extra initiative of doing home visits, but it brought in logistical challenges of tracing houses when it came to incomplete addresses. Ref: Pg.15, line 234Triage Counters. To overcome the problem, modifications of the primary triage counter were carried out in four clinics were carried out to also function as a registration counter for new patient visits.Ref: Pg.16, line 256For the appointment defaulter tracing activity, three clinics created an appointment defaulter book to facilitate the monitoring,Ref: Pg.16, line 237The rooms were viewed as necessary in eleven clinics for privacy reasons\u2026 10. The discussion section needs to be strengthened to clearly summarize the key findings in terms of fidelity, feasibility, adaptation and benefit of the program being evaluated, and to put them into context with other studies/programs, etc.Thank you for suggestion. We have restructured the Discussion section.Ref: Pg.19-23, line 314-41211. Authors should also state key recommendations based on their findings.Thank you for suggestion. The recommendations were embedded in each of discussion point. Ref: Pg.20, line 339-341If the issue of human resource availability is likely to persist, there should be considerations on making best use of available resources . Ref: Pg.21, line 360-363Feasibility of technology implementation in Malaysia, however, should also consider the existing infrastructure of the building where it will be implemented, specifically on the electrical wiring, network access, electronic equipment required as well as users\u2019 technology literacy to use any proposed technology to be implemented.Ref: Pg.21, line 370-376Patient norms and behaviour is another component which has to be considered when introducing any new intervention at the primary healthcare setting\u2026This highlighted the importance to explore the service-users\u2019 perspectives on the planned interventions.Ref: Pg.21-22, line 378-385Studies have also reported defaulter tracing as a favourable method of community engagement and to foster HCP-patient relationship [43]; this has been borne out in our study whereby the HCPs perceive that defaulter tracing activity have fostered a closer interpersonal relationship between clinic staff and patients.Ref: Pg.22, line 386-392The person-centred care concept also stresses the importance of a patient\u2019s care continuity across facilities [45]. Thus, the communication established between clinics and hospitals on referral management is significant. The established communication, however, is a foundation of future collaboration efforts between the facilities. Participating EnPHC clinics should also share with each other their experiences and the local adaptations in overcoming challenges in their respective clinics to create a platform of discussion and a knowledge pool in seeking solutions.12. Careful grammar editing is needed throughout the manuscript.Thank you. We have sent the manuscript for editing and proof reading.REVIEWER #2NCDs are relevant and increasing public health issues in low- and middle-income countries, but often neglected as priority for health interventions or health research issues. The paper is interesting and reads well. However, please see below a few comments aiming to improve it.Thank you and had responded to each pointTitle:Geographic area to include in the title .Thank you for suggestion. We have included Malaysia.Process evaluation of enhancing primary health care for non-communicable disease management in Malaysia : uncovering the fidelity & feasibility elements We chose not to include the \u201ctwo states\u201d as consideration for selection has been made accordingly by the program owners. We have also included this information in the manuscript .Background:Lines 49 to 61 in the background seem more appropriate as methods points, and preferable to move to the methods section, namely the study design and sampling.Thank you for suggestion. We have moved to methodsRef: Pg.7-8, line 56-69Methods:Study design and samplingThe description of the study design needs to be developed. You can move in that section a few methods aspects developed in the background as per comment above.Thank you for suggestion. We have created Box 1 to explain the intervention components in details. Ref: Pg.5-6, line 28, Box 1: The EnPHC Intervention ComponentsThe sampling section seems a bit weak and needs to be deeply improved. It was indicated that the intervention was implemented in 40 public health care clinics (20 control clinics and 20 intervention clinics) at two selected states. Do the 20 PHC of the evaluation only include the 20 intervention clinics or both intervention and control clinics? In the event, both type of clinics are included, can you explicit the process for sample size calculation and whether you assessed the precision and power of the sample to be able to detect significant difference between intervention and control clinics? In the event the 20 clinics for the evaluation are intervention clinics only, can you explain the rationale of focusing on the intervention clinics only as you may have missed a good opportunity to shape an interesting and relevant design comparing intervention and control clinics? Additionally whether you focus on the intervention clinics, can you provide an explanation with respect to the choice of the two states for the intervention and try to discuss how they may (or not) be representative of the overall national situation as the assessment aims to end up to evidences that may help for scaling up the intervention?Thank you for highlighted this. We have made the necessary corrections to convey a clearer meaning regarding the sampling.Ref: Pg. 6-7, Line 30-39The initiative was piloted in July 2017 in 20 public primary care clinics in two states of Johor and Selangor in Malaysia. Selection of the two states was based on the balance between regional representativeness, intervention budget and implementation capacity which involves manpower and facilities [22]. For the purpose of evaluation, an addition of 20 control clinics were selected, matched according to urban-rural stratification, clinic setting and type as well as human resource availability in the clinic. Three evaluation studies on the EnPHC initiative were conducted concurrently and independently; two outcome evaluation at the community and facility level , and process evaluation focusing on the implementation process [9]. Since our focus was on the implementation fidelity and feasibility, the control clinics were excluded from the process evaluation. Results:The quality of figures on the PDF format seems poor and needs to be improved. Moreover, the figures need to be numbered properly and well referenced in the text, and figures titles need to be clear and more explicit with respect to the information presented.Thank you for suggestion. As this comment was in line with Reviewer #1\u2019s comments, we have decided to drop this Figure and replace it in text. Ref: Pg.12-13, line 158-181Fidelity assessment was based on the availability of the intervention and its utilisation in accordance to guideline protocols. In general, all intervention components have been implemented according to the protocols in all 20 clinics, except for the following specific components: Triage Counters (primary triage counter). All clinics deployed the primary triage counter except for one clinic which failed due to limitation in building infrastructure. Four primary triage counters from the remaining 19 clinics were found unattended and acted as placeholders. The secondary triage counter, however, was successfully set up and utilised in all clinics.Triage Counters (primary triage counter). All clinics deployed the primary triage counter except for one clinic which failed due to limitation in building infrastructure. The secondary triage counter, however, was successfully set up in all clinics.Care Coordinator (visit checklist). One clinic failed to utilise the required format of the visit checklist as they deemed the existing patient appointment card sufficient to capture the required information.Care Coordinator (appointment defaulter tracing). The appointment defaulter tracing activity was successfully conducted in all clinics. However, as the there was no guideline protocol on how it should be conducted, fidelity assessment could not be made as there was no standard to match. This issue was cited to contribute into feasibility issues during further exploration through IDI. Referrals . The communication between clinics and hospitals on referral management had been established in all clinics. However, fidelity assessment was unsuccessfully conducted on the communication process as the guideline has no specific criteria to be communicated in the referral as standards to be met.For statements like \u201cThe current availability of human resource for health in Malaysia is still low when compared to OECD countries\u201d (page 10), it would be good to provide ratios or estimates whether available.Whether feasible and data available, it would be desirable to have more results. For instance, it may be interesting to know to which extent the secondary triage may have helped improving the detection of undiagnosed NCD cases for ensuring care continuity (lines 186-187). From the PHC register, are there collected data with respect to the patients that may be used for diagnosis and patient case classification? In the same vein, when you say that longer patient waiting time was observed in clinics with insufficient personnel to perform tasks at secondary triage counter (lines 190-191), it will be worthwhile trying to quantity the \u2018longer patient waiting time\u2019; or quantitative information in tracing appointment defaulter (line 234) and patients\u2019 adherence to appointments (line 250); or estimating NCD screening activities performed properly according to main reference document for NCD screening ), or to which extent the referral system was improved (line 311), etc.Thank you for suggestion. As this comment was in line with Reviewer #1\u2019s comments, we have structured the entire Results section according to the four aspects of fidelity, feasibility, adaptation and benefit. However, we are unable to provide the quantifiable information on long waiting time and patient data since this study focused on the structural process of the implementation instead of the clinical processes.Ref: Pg.11-19, line 149-313Discussions:It would be desirable to shape the discussions section as per the evaluation-focused four dimensions i.e. fidelity, feasibility, adaptation and benefit.Thank you for suggestion. As this comment was in line with Reviewer #1\u2019s comments, we have structured the entire Discussion section.Ref: Pg.19-23, line 314-412Concerning the design and dimensions of the evaluation, it makes sense and it is relevant as you assessed the \u2018structural quality\u2019 of the intervention , but it may have also been worthwhile trying to address the process quality for such an intervention  as that would have been relevant for such an evaluation with the aim to scale-up the intervention package. You may have made the choice to focus on the \u2018structural quality\u2019, but good to justify more that choice in the discussions as well as the choice why the design did not address the process quality of care.Thank you. We have included your concern as our study limitation.Ref: Pg.23, line 407-408The scope of evaluation was limited to the organisational  process; the clinical processes were excluded as it was evaluated by another evaluation team.It may also be relevant to discuss the scale-up opportunity and challenges with respect to scaling up such interventions in other regions or nationwide.Thank you. After the restructuring of the Discussion section, we have included your input as embedded recommendations within the Discussion. Some examples of the embedded statements are:Ref: Pg.19-20, line 329-330Pre-assessment on physical location can help to predict the feasibility of its implementation, especially for clinics with old premises [33].Ref: Pg.20, line 332-334By doing the assessment, pre-emptive renovations and refurbishments can be done before the initiative is implemented [33].Ref: Pg.20, line 339-341If the issue of human resource availability is likely to persist, there should be considerations on making best use of available resources .Ref: Pg.20-21, line 353-355The process quality and appropriateness of care delivered through these interventions will have to be addressed should the EnPHC initiative is to be scaled-up.Ref: Pg.21, line 356-357Technology uptake such as the electronic medical record can reduce the corporeal efforts related to care provision and service quality Ref: Pg.21, line 360-363Feasibility of technology implementation in Malaysia, however, should also consider the existing infrastructure of the building where it will be implemented, specifically on the electrical wiring, network access, electronic equipment required as well as users\u2019 technology literacy to use any proposed technology to be implemented .Ref: Pg.21, line 370-376Patient norms and behaviour is another component which has to be considered when introducing any new intervention at the primary healthcare setting\u2026This highlighted the importance to explore the service-users\u2019 perspectives on the planned interventions [42].Ref: Pg.22, line 381-385The manner and appropriateness of how the communication is conveyed also influences patients\u2019 trust which then appears as a key factor for the care-seeking behaviour [44] and the person-centred care concept [45]. This adaptation to the appointment defaulter tracing activity should be considered for future scalability.Format:Review the text and double-check typo issues Thank you. We have sent the manuscript for editing and proof reading.AttachmentLetter respond to reviewers comment_revision 1.docxSubmitted filename: Click here for additional data file. 20 Nov 2020PONE-D-20-04093R1Process evaluation of enhancing primary health care for non-communicable disease management in Malaysia: uncovering the fidelity & feasibility elementsPLOS ONEDear Dr. LOW,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Jan 04 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Fernando C. WehrmeisterAcademic EditorPLOS ONEAdditional Editor Comments (if provided):The manuscript had improved. However, minor details should be addressed. Please see the reviewer comments.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #2:\u00a0(No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2:\u00a0N/A**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #2:\u00a0No**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2:\u00a0Thanks to the authors for addressing the comments.It was a good idea to describe the intervention components using a box (Box 1). However, you provided too much detail, so the box is on two pages. Ideally, we expect an embedded box to be one page as an embedded figure. Therefore, it will be nice to cut down a bit and fit on one page.As per the comments, you tried to describe further the sampling process . However, the place (Background) you inserted this description does not seem appropriate. In the methods, there is a section titled \u201cStudy design and sampling\u201d, but there is no information regarding the sampling in that section. I suggest that you move the description of the sampling process  from the background to the section \u201cStudy design and sampling\u201d.There was also a comment regarding the sample size. Since you have excluded the control clinic, there was no longer a need to address the comment related to the power of the sample to detect significant difference between the intervention and control clinics. However, the comment remains relevant concerning the precision of the sample. It is evident that a sample of 20 clinics and 20 health workers seems small and would not provide a good sample precision. It may therefore be worth addressing that issue  as a limitation of the study.Concerning the discussions, you made considerable efforts to reshape this section and provided valuable additional information.Otherwise, the authors have well addressed the remaining comments.Best wishes.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 18 Dec 2020Editor CommentsAdditional Editor Comments: The manuscript had improved. However, minor details should be addressed. Please see the reviewer commentsThe authors\u2019 response - Thank you, noted and had addressed itReviewer #2: 1. Thanks to the authors for addressing the comments. I t was a good idea to describe the intervention components using a box (Box 1). However, you provided too much detail, so the box is on two pages. Ideally, we expect an embedded box to be one page as an embedded figure. Therefore, it will be nice to cut down a bit and fit on one page.The authors\u2019 response - Thank you for your suggestion. We have further summarised the contents for Box 1 and also formatted the section with single spacing. (Ref: page 5)2. As per the comments, you tried to describe further the sampling process . However, the place (Background) you inserted this description does not seem appropriate. In the methods, there is a section titled \u201cStudy design and sampling\u201d, but there is no information regarding the sampling in that section. I suggest that you move the description of the sampling process  from the background to the section \u201cStudy design and sampling\u201d.The authors\u2019 response - Thank you for highlighting this. We have moved the paragraph on sampling process to the \u201cStudy design and sampling\u201d section. 3. There was also a comment regarding the sample size. Since you have excluded the control clinic, there was no longer a need to address the comment related to the power of the sample to detect significant difference between the intervention and control clinics. However, the comment remains relevant concerning the precision of the sample. It is evident that a sample of 20 clinics and 20 health workers seems small and would not provide a good sample precision. It may therefore be worth addressing that issue  as a limitation of the study.The authors\u2019 response - Thank you for highlighting this. We have added the following information into the section on limitation. (Ref: Pg. 22 Line 410-411 and 416-418) 23 Dec 2020Process evaluation of enhancing primary health care for non-communicable disease management in Malaysia: uncovering the fidelity & feasibility elementsPONE-D-20-04093R2Dear Dr. LOW,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Fernando C. WehrmeisterAcademic EditorPLOS ONEAdditional Editor Comments :The paper had improved since its first version. Congratulations to the authors for the excellent job done.Reviewers' comments: 29 Dec 2020PONE-D-20-04093R2 Process evaluation of enhancing primary health care for non-communicable disease management in Malaysia: uncovering the fidelity & feasibility elements Dear Dr. LOW:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Fernando C. Wehrmeister Academic EditorPLOS ONE"}
+{"text": "Current validation protocols for assessing the accuracy of blood pressure monitors exclude people with atrial fibrillation, except in special circumstances . HyperteOffice blood pressure measurements should be carried out using an auscultatory method with a calibrated analogue sphygmomanometer. Current and forthcoming BIHS/National Institute for Health and Care Excellence guidance regarding cuff size, seating and avoidance of other causes of error in blood pressure measurement should be followed , 4. CuffAuscultatory methods are recommended due to the lack of evidence for accuracy of most oscillometric devices in the presence of atrial fibrillation .Measurements should be repeated at least three times, regardless of absolute blood pressure, since there is increased intra-person variation in blood pressure with atrial fibrillation. Using an average of these multiple measurements is advised on the basis of expert opinion.Due to the absence of evidence for accuracy for most automated monitors designed for home or clinic use, and the increased individual variation in blood pressure with atrial fibrillation, we recommend comparison with multiple auscultatory clinic blood pressure readings for all individuals, when automated devices are used. This may be achieved by taking a sequence of at least three device readings alternating with three auscultatory readings made on the same arm, using a professional analogue device (such as the Accoson Green Light 300).Limited data do exist to suggest that two monitors, designed for professional use, are accurate in measuring systolic, but not diastolic blood pressure: Philips SureSigns VSi and Welch Allyn Vital Signs 300 devices , 6.For home use, data from one other study suggest that the Tensoval duo control device is accurate in measuring systolic and diastolic blood pressure .The Microlife Watch BPA 100 Plus device may be accurate for systolic but not diastolic blood pressure .Given the absence of evidence for accuracy of most ambulatory monitors, and the increased individual variation in blood pressure with atrial fibrillation, we recommend comparison of such devices with multiple auscultatory clinic blood pressure readings for all individuals. This may be achieved by taking a sequence of at least three device readings alternating with three auscultatory readings made on the same arm, using a professional analogue device (such as the Accoson Green Light 300).Limited data obtained by static comparison of oscillometric ambulatory blood pressure monitors with mercury readings suggest accuracy for systolic but not diastolic blood pressures measured by the SpaceLabs 90207 and the A&D TM-2430 devices .Some devices detect pulse irregularity to indicate potentially undiagnosed atrial fibrillation. Such devices are not inherently more accurate in measuring blood pressure with atrial fibrillation, nor can they be assumed to be, in comparison with monitors lacking such technology.Based on published evidence, a number of devices have been shown to be inaccurate for blood pressure measurement with atrial fibrillation, and cannot be recommended Table\u00a0.Table 1SManual measurement should be used where possible for measuring blood pressure with atrial fibrillation. Limited data exist to suggest that some automated devices can accurately measure systolic, but not diastolic, blood pressure in the presence of atrial fibrillation. Further work is needed to evaluate the many commonly used devices lacking such data. Future comparisons should follow internationally recognised protocols to ensure validity and facilitate comparisons."}
+{"text": "Subcutaneous fat thickness and intramuscular fat content are closely related to meat production and quality in the pig industry. Adipogenesis in adipocytes from subcutaneous and intramuscular fat tissues involves different genes and regulatory mechanisms. Analyzing the data of mRNA and miRNA transcriptomes during the differentiation of adipocytes from these two sources will help identify the different mechanisms of subcutaneous and intramuscular fat deposition. In this study, RNA sequencing technology was used to analyze the differential expression of genes and miRNAs in subcutaneous and intramuscular adipocytes at days 0, 2, 4, and 8 of differentiation. We mainly attributed the difference between fat depositions of the two types of adipocytes to variations in the expression patterns of related genes. Through combined weighted gene co-expression network analysis and K-MEANS, we identified 30 and 22 genes that mainly regulated the differentiation of subcutaneous adipocytes and intramuscular adipocytes, respectively. A total of 17 important candidate miRNAs were identified. This study provides valuable reference for the study of different mechanisms of adipogenesis among subcutaneous and intramuscular fat and contributes to improving pig breeding. Adipose tissue is one of the largest and most vigorous organs in humans and animals and plays a major role in the control of energy homeostasis . Many huSLC27A1, ACAA2, ssc-miR-132, ssc-miR-146b, and ssc-miR-221-5p, were screened that had regulative functions on fat deposition [POSTN and FGFR4 that might regulate intramuscular fat depositin were identified from transcriptomic profiles of intramuscular adipocytes in pigs [MicroRNAs (miRNAs) are small non-coding RNAs that regulate the gene expression at the post-transcriptional level and adipogenesis in animals ,15. Tranposition . The gen in pigs . The deslongissimus dorsi (LD) tissues and differentiation was induced in vitro. Adipocytes were collected at four time points  to generate transcriptomic data of mRNAs and miRNAs using RNA-seq. The key functional genes and miRNAs involved in subcutaneous adipocytes or intramuscular adipocytes were identified to understand the regulatory mechanisms of fat deposition in the two tissues of pigs.In this study, porcine preadipocytes were isolated from subcutaneous fat and The animals were reared and handled in accordance with the Guide for the Care and Use of Laboratory Animals in China. All experimental guidelines were approved by the Committee on the Ethics of Animal Experiments of the China Agricultural University (permit number: SKLAB-2012-04-07).2. All culture medium components were obtained from Gibco .Three six-day-old Yorkshire piglets were provided by the Beijing Shunyi Pig Breeding Farm. Intramuscular preadipocytes were isolated from theLD and subcutaneous adipocytes were stripped from the back subcutaneous fat (BF) tissues. First, BF tissues were cut into pieces and digested with 1 mg/mL collagenase type I  at 37 \u00b0C for 60 min and then filtered through 70 and 200 mesh sieve to remove the undigested part. LD tissues were digested for 1.5\u20132 h with 2-mg/mL collagenase type I. Preadipocytes were cultured in Dulbecco\u2019s modified Eagle\u2019s medium/Ham\u2019s F-12 (DMEM-F12) growth medium containing 10% fetal bovine serum (FBS) and 1% penicillin\u2013streptomycin at 37 \u00b0C in an atmosphere of 5% COWhen the cell confluency reached 90%, the standard culture medium was replaced with adipogenic induction medium   for two days. Next, the cells were cultured in maintenance medium (growth medium supplemented with 5-\u03bcg/mL insulin) for an additional two days. The growth medium was then changed every alternate day until adipocyte maturation.For Oil Red O staining, the culture medium was removed, and adipocytes were washed thrice with PBS and fixed in 4% formaldehyde for 30\u2009min. Subsequently, 4% formaldehyde was removed, and cells were washed thrice with PBS and stained with Oil Red O for 20\u2009min. Cells were washed thrice with PBS and photographed under a microscope . After the oil red O dye was extracted with isopropanol for 20 min, the absorbance was measured at a wavelength of 490 nm to quantify the lipid accumulation.Total RNA was isolated from adipocytes after differentiation on days 0, 2, 4, and 8 using the TRIzol reagent . RNA concentration and purity were measured using NanoDrop 2000 . RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system . All RNA samples had RNA integrity number (RIN) values exceeding 8.6. High-throughput sequencing was performed using NovaSeq 6000, and 150 paired-end reads were generated.For small RNA sequencing, first, 3\u2032 SR and 5\u2032 SR adaptors were ligated, and then reverse transcription of the synthetic first chain was performed. Afterward, PCR amplification was performed, and PAGE gel was used for electrophoresis fragment screening. The rubber was cut and recovered as fragments and purified to obtain a small RNA library. Clustering of the index-coded samples was performed on a cBot Cluster Generation System using the TruSeq PE Cluster Kit v4-cBot-HS  according to the manufacturer\u2019s instructions. After cluster generation, the library preparations were sequenced on a NovaSeq 6000, and 50 single-end reads were generated.ftp://ftp.ensembl.org/pub/release-99/fasta/sus_scrofa/dna/Sus_scrofa.Sscrofa11.1.dna.toplevel.fa (4 December 2021) using HISAT2(2.0.4) [Clean reads were filtered by removing adapters, reads containing more than 10% unknown nucleotides (N), and low-quality sequences to obtain clean reads. Clean reads were mapped to the pig reference genome  ,19.2 of the fold change |log2FC| \u2265 1.StringTie (1.3.4 d) was used to assemble the transcript and calculate the fragments per kilobase million mapped read (FPKM) values . DESeq2(Clean reads were mapped to the pig reference genome (scrofa. Sscrofa11.1) with perfect matches using Bowtie software. Annotated tRNA, rRNA, snoRNA, and snRNA sequences were filtered out, and conserved miRNAs were identified using BLAST against miRbase. miRDeep2 software was used to predict new miRNAs based on the characteristics of the miRNA precursor hairpin structure. A differential expression analysis between the two groups was performed using the DESeq2 R package. Differentially expressed miRNAs (DE-miRNAs) were screened with a fold change criterion of \u2009>1.5 and FDR < 0.05 using DESeq2. Target genes of the DE-miRNAs were predicted using miRanda and TargetScan. The miRNA\u2013mRNA signaling pathway interaction network was generated using Cytoscape software .Gene Ontology (GO) enrichment analysis of the DEGs was implemented using the GOseq R packages based on Wallenius noncentral hypergeometric distribution , and KOBAll annotated genes (FPKM > 0.01) were analyzed using the weighted gene co-expression network analysis (WGCNA) package in R studio software. The parameters of the WGCNA program were as follows: minimum module size = 30, minimum height for merging modules = 0.25, and soft threshold = 15. Gene significance (GS) and module membership (MM) refer to the correlation between gene expression and each trait and the correlation between gene expression and each module eigengene, respectively. The correlation between GS and MM was performed using Pearson\u2019s correlation in the WGCNA package. For the genes with eigengene-based connectivity values (|KME|) \u2265 0.7, |MM| \u2265 0.8, and |GS| > 0.3, the pivot gene was selected as the key module.AGT, GK, and CAT) and four miRNAs  were used for qRT-PCR verification. The primers used for quantitative real-time RT-PCR (qRT-PCR) are presented in \u2212\u0394\u0394Ct method.Three genes  in SPSS software . Statistical significance was set at The induced differentiation process is illustrated in Compared to subcutaneous preadipocytes, intramuscular preadipocytes slowly produce lipid droplets. Only a small part of these droplets was formed after two days of differentiation, and their amount on the fourth day was similar to that on the second day. However, on the eighth day, the accumulation of lipid droplet accumulation increased significantly d. In genThe transcriptomes of the 24 samples generated 160.63 Gb of clean data, and the percentage of clean Q30 bases ranged from 90.40% to 96.24%. The clean reads of each sample were aligned with the reference genome (Scrofa 11.1), and the mapping ratio ranged from 90.40% to 96.24% , indicatThe statistics for the number of DEGs and DE-miRNAs are shown in A total of 2365 DEGs and 68 DE-miRNAs were found in subcutaneous adipocytes during differentiation, and 24 DEGs and two DE-miRNAs were shared by all three pairs between stages a,e. DuriUpon comparing all DEGs and miRNAs in the differentiation process of the two adipocytes, 1116 overlapping genes and 22 overlapping miRNAs were identified. During the differentiation of subcutaneous adipocytes, 1249 specific DEGs and 46 specific DE-miRNAs were identified, whereas 1204 DEGs and 23 DE-miRNAs were specific differentially expressed in intramuscular adipocytes c,g. UponWe performed a functional enrichment analysis of the overlapping DEGs and specific DEGs in the differentiation process of the two adipocytes. Overlapping DEGs enriched 278 signaling pathways. Subcutaneous and intramuscular adipocyte-specific DEGs were enriched in 274 and 282 pathways, respectively. The main enriched pathways were glycolysis/gluconeogenesis, rheumatoid arthritis, metabolic pathways, steroid biosynthesis, amino acid biosynthesis, HIF-1 signaling pathway, focal adhesion, interaction of viral proteins with cytokines and cytokine receptors, carbon metabolism, fatty acid metabolism, and other pathways . In totaThe DEGs between the two adipocyte groups may explain the differences between the production mechanisms of the two adipocytes. The KEGG analysis showed that, on day 0 of the differentiation, although the induction of differentiation had not yet begun, the highly expressed genes of intramuscular fat cells were enriched in the cell cycle, DNA replication, carbohydrate digestion and absorption, starch and sucrose metabolism, glycolysis/gluconeogenesis, citrate cycle (TCA cycle), and biosynthesis of the unsaturated fatty acids pathway, while the highly expressed genes in subcutaneous fat participate in the Hippo signaling pathway, multiple species, butanoate metabolism, propanoate metabolism, various amino acid metabolism, fatty acid biosynthesis, and other signaling pathways a.On days 2 and 4 of differentiation, the genes highly expressed in intramuscular adipocytes were mainly involved in DNA replication, synthesis, the degradation of ketone bodies, other glycan degradation, maturity onset diabetes of the young, and other pathways. The highly expressed genes in subcutaneous adipocytes were mainly involved in fatty acid biosynthesis, the adipocytokine signaling pathway, the MAPK signaling pathway, ether lipid metabolism, sphingolipid metabolism, and alpha-linolenic acid metabolism b,c. Aftep < 0.05) and 18 modules for intramuscular fat differentiation  in the four periods may be genes that specifically regulate the differentiation of the two adipocytes. We performed the KEGG analysis on the DEGs between the groups and found 466 genes involved in the lipid metabolism-related pathways . Combining these 466 genes with genes related to the differentiation of BF and IMF analyzed by the WGCNA, we found 40 genes that may specifically regulate subcutaneous fat deposition, 35 genes that specifically regulate intramuscular fat deposition, and 7 genes that coregulate the differentiation of these two adipocytes . PCK1, STAT1, IGF1, CYP26B1, CAT, AGT, SOAT1, ENO2, GK, and FABP4  were predicted, and the negative regulatory relationship between the target genes and DEGs was analyzed. A total of 17 DE-miRNAs targeted 187 DEGs in comparison of the adjacent time groups during the differentiation process of the subcutaneous adipocytes, and 12 DE-miRNAs targeted 255 DEGs in intramuscular adipocytes. For group BF0d vs. IMF0d, we found 19 DE-miRNAs negatively regulated 177 DEGs, BF2d vs. IMF2d group, found that three DE-miRNAs negatively regulated four DEGs, the BF4d vs. IMF4d group, found 17 DE-miRNAs negatively regulated 462 DEGs, and for group BF8d vs. IMF8d, 48 DE-miRNAs were found to target 522 genes .The KOBAS online software was used to perform the GO and KEGG functional enrichment analyses of the target genes. In total, 157 KEGG signaling pathways were enriched in 187 genes targeted by 17 DE-miRNAs during subcutaneous adipocyte differentiation. The main pathways included the pentose phosphate pathway, glucagon signaling pathway, fructose and mannose metabolism, Hippo signaling pathway, and propanoate metabolism . For intThe target gene enrichment analysis of the DE-miRNAs compared between two adipocytes at the same differentiation stage showed that the main enrichment pathways of the target genes of the DE-miRNAs downregulated in intramuscular adipocytes were peroxisome, alanine, aspartate, and glutamate metabolism; fatty acid degradation; valine, leucine, and isoleucine degradation; glycerolipid metabolism; renin secretion; fatty acid metabolism; fluid shear stress and atherosclerosis; and aldosterone synthesis and secretion. The target genes of the DE-miRNAs upregulated in intramuscular adipocytes were mainly enriched for insulin resistance, glycosaminoglycan biosynthesis\u2013keratan sulfate, starch and sucrose metabolism, aldosterone-regulated sodium reabsorption, staphylococcus aureus infection, retinol metabolism, and fructose and mannose metabolism .PRKAG2, CA13, FOS, SFRP1, and FGF1. The novel-miR-126 and novel-miR-667 of DE-miRNAs in intramuscular adipocytes target a large number of genes related to glycerolipid metabolism, carbohydrate metabolism, and insulin signaling pathways, such as ENO2 involved in glycolysis/gluconeogenesis, cholesterol synthesis gene SOAT1, lipogenic gene FAS, glyceride metabolism gene GK, etc. To identify the key miRNAs that regulate lipid metabolism, we constructed a co-expression network diagram of miRNAs, targeted mRNAs, and related signaling pathways involved in targeted mRNA. In the subcutaneous adipocyte group, 32 miRNA\u2013mRNA pairs were constructed from 13 miRNAs and 23 targeted mRNAs a. In theAGT, GK, and CAT) and four miRNAs , were selected for qRT-PCR to validate their expression differences in RNA-Seq. After comparison with the RNA-Seq data, it was found that the expression trend of qRT-PCR was similar to that of RNA-Seq . This is consistent with the phenotype where subcutaneous adipocytes accumulate more lipid droplets than intramuscular adipocytes. This also confirms that fats accumulated by the two adipocytes have different carbon precursors ,23.GK, CAT, FABP4, AGT, PCK1, STAT1, IGF1, PDE3B, APOA1, SOAT1, CYP26B1, ENPP2, and HGF) have been reported to play a role during adipogenesis or in differentiated adipocytes [GGT5, LOC100521789, LPCAT2, PTPR, HHAT, GADD45G, PRKG1, ENSSSCG00000035293, GRIN3A, JAK2, CCDC180, NFATC1, CCBN2, CCBN3, ENO2, PIK3C2B, and ADH1C. When adipocytes are induced to differentiate, preadipocytes re-enter the cell cycle synchronously and undergo mitotic clonal expansion [CCBN2) and cyclin B3 (CCBN3) in subcutaneous adipocytes confirmed this. The expression of these genes changes significantly during the differentiation of subcutaneous adipocytes, and expression levels of most of them exceeded those of intramuscular adipocytes, indicating that these genes may be related to fat deposition in the subcutaneous adipocytes of pigs.The gene expression profile of subcutaneous adipocytes and the intramuscular adipocyte differentiation process provides a lot of information for studying the regulatory mechanism of specific fat depositions in the differentiation of different adipocytes in pigs. We identified 30 genes in subcutaneous adipocytes that may have a specific effect on the differentiation of Yorkshire subcutaneous adipocytes. Half of the genes  is a pleiotropic growth factor that controls cell proliferation, migration, and differentiation [FGF1 gene promoter region combined with the PPAR\u03b3 gene plays a role in regulating adipogenesis. The PPAR\u03b3\u2013FGF1 axis, a key regulator of adipose tissue remodeling and systemic metabolic homeostasis, is functionally conserved in mammals [FGF gene. The ssc-miR-874-, novel-miR-779, and novel-miR-126 genes targeting SFRP1 are endogenous regulators of Wnt/\u03b2-catenin signaling and participate in the paracrine regulation of human adipogenesis [Sfrp1 aggravates weight gain, glucose homeostasis, and inflammation in mice with diet-induced obesity [HHAT and GRIN3A, respectively, which are considered to be important candidates for the regulation of porcine subcutaneous adipocyte differentiation.miRNAs are small non-coding RNAs that mainly target the 3\u2032 untranslated region of mRNAs to reduce the expression of encoded proteins . Certainntiation . The res mammals ,47. In oogenesis . Loss of obesity . In addiARRB1 and ssc-miR-199a-5p-FOXO4 are important miRNA\u2013mRNA pairs that regulate intramuscular fat. The transgene overexpression of ARRB1 inhibited diet-induced obesity and improved glucose tolerance and systemic insulin sensitivity [FOXO) proteins are a family of transcription factors, and FOXO4 is a member of this family. It inhibits the biosynthesis of cholesterol by inhibiting the expression of CYP51, leading to the accumulation of dihydrolanosterol [In intramuscular adipocytes, we identified two new miRNAs (novel-miR-667 and novel-miR-126) through the function of target genes. In addition to the two newly identified miRNAs, ssc-miR-6782-3p-sitivity . Forkheanosterol .In conclusion, our results demonstrated that intramuscular and subcutaneous adipocytes had different ways of generating lipid droplets, i.e., different carbon sources. The DEGs and DE-miRNAs in the differentiation process were not the same. We identified 30 genes that play key roles in the differentiation process of subcutaneous adipocytes. Using the constructed miRNA\u2013mRNA signaling pathway network diagram, 10 miRNAs, novel-miR-1018, novel-miR-326, novel-miR-433, novel-miR-930, ssc-miR-185, ssc-miR-370, ssc-miR-874, ssc-miR-615, novel-miR-779, and ssc-miR-214-3p, were found to regulate the differentiation process of subcutaneous adipocytes. In intramuscular adipocytes, a total of 22 genes that may specifically regulate the differentiation process of intramuscular adipocytes were observed. Using the constructed miRNA\u2013mRNA signaling pathway network diagram, ssc-miR-339-5p, ssc-miR-199a-5p, and novel-miR-667, three miRNAs that may regulate the differentiation process of intramuscular adipocytes, were identified.There is a limitation in the research that needs to be explained. We identified important mRNA\u2013miRNA pairs by predicting the targeting relationship between candidate genes and miRNAs. However, we have not verified their targeting relationship, and future research should focus on the verification of these results."}
+{"text": "Listeria monocytogenes (Lm), a facultative intracellular foodborne pathogen, can exploit the type I IFN response as part of their pathogenic strategy, but the molecular mechanisms involved remain unclear. Here we show that type I IFN suppresses the antibacterial activity of phagocytes to promote systemic Lm infection. Mechanistically, type I IFN suppresses phagosome maturation and proteolysis of Lm virulence factors ActA and LLO, thereby promoting phagosome escape and cell-to-cell spread; the antiviral protein, IFN-induced transmembrane protein 3 (IFITM3), is required for this type I IFN-mediated alteration. Ifitm3\u2212/\u2212 mice are resistant to systemic infection by Lm, displaying decreased bacterial spread in tissues, and increased immune cell recruitment and pro-inflammatory cytokine signaling. Together, our findings show how an antiviral mechanism in phagocytes can be exploited by bacterial pathogens, and implicate IFITM3 as a potential antimicrobial therapeutic target.The type I interferon (IFN) signaling pathway has important functions in resistance to viral infection, with the downstream induction of interferon stimulated genes (ISG) protecting the host from virus entry, replication and spread.  Listeria monocytogenes (Lm) induces type I IFN to suppress the degradation of Lm virulence proteins, ActA and LLO, and promote Lm infection in an IFITM3-dependent manner, thereby hinting at a potential target for antimicrobial therapy.Interferon (IFN) is an important component of antiviral immunity, but can also be exploited by bacteria for immune evasion. Here the authors show that  Listeria monocytogenes (Lm) is a facultative intracellular pathogen that can cause systemic infection in mammalian hosts. After ingestion by immune cells such as macrophages, Lm secretes virulence factors that can lyse the bacteria-containing phagosome and escape into the cytosol2. Once in the cytosol, Lm is able to interact with host actin-related protein (Arp) 2/3 complex using its virulence factor actin assembly-inducing protein (ActA) to polymerize actin and form actin comet tails to propel itself throughout the cell3. Motility is critical for Lm pathogenesis as it allows the bacteria to avoid host cell autophagic machinery and the ubiquitin-proteasome system6. To spread from cell-to-cell, motile Lm initiate formation of cell-surface filopodia  that can be engulfed by neighboring cells and mediate bacterial transfer without exposure to the extracellular space7.10. Lm infection is able to induce a robust type I IFN response during infection. Rupture of the bacteria-containing phagosome leads to the cytosolic delivery of cyclic dinucleotides, DNA and other factors that induce type I IFN production13. Lm is known to benefit from the type I IFN response, as evidenced by the finding that mice deficient in type I IFN receptors and regulatory factors are protected from Lm infection16. However, the molecular mechanisms behind bacterial exploitation of type I IFN signaling remain unclear.Type 1 interferons (IFNs) are a subgroup of interferon proteins that help regulate innate and adaptive immune responses during viral and bacterial infections17. For example, Lm-induced type 1 IFN production negatively regulates chemokine signaling and modulates neutrophil and monocyte recruitment19. We previously showed that type I IFN also promotes Lm cell-to-cell spread20. The early stages of actin-based motility, a process involving Arp2/3-mediated actin polymerization on the bacterial surface, were enhanced by type I IFN by mechanisms that remain unclear. As the type I IFN transcriptional response involves hundreds of genes21, it is also not clear which ISGs promote Lm infection. This led us to examine how type I IFN affects the early stages of bacterial infection in macrophages, an important cellular target of these bacteria during systemic disease.Type I IFN is known to alter many aspects of the immune response to bacteriaLm cell-to-cell spread in macrophages. Cells and mice lacking IFITM3 display an increase in ActA degradation which leads to a decrease in Lm infection. Our study has important implications for understanding the role of type I IFN and IFITM3 in innate immunity during bacterial infections.In this study, we examine the impact of type I IFN on phagosomal maturation and bacterial killing. We identify IFITM3 as a downstream target of type I IFN activation that suppresses proteolytic activity in phagocytes, thereby promoting Lm lacking the pore-forming toxin listeriolysin O . Since listeriolysin O is required for phagosome escape in macrophages, this mutant strain is confined to phagosomes and does not undergo intracellular growth22. As a model of gram-negative bacteria, we also examined Escherichia coli DH10B, a non-pathogenic lab strain. Bone marrow-derived macrophages (BMDMs) from wild-type (WT) C57BL/6 mice were treated with interferon beta (IFN\u03b2) for 20\u2009hours (h) prior to exposure to bacteria. The uptake of bacteria was unaffected by IFN\u03b2 treatment . These findings suggest the type I IFN response suppresses antibacterial activity in phagosomes.To determine if type I IFN affects the antimicrobial activity of macrophages, we examined the fate of two different bacteria confined to phagosomes. We used the gram-positive Next, we examined the impact of type I IFN on phagosome maturation. IFN\u03b2-treated cells showed reduced localization of the lysosome transmembrane protein LAMP1 to phagosomes compared to control cells Fig.\u00a0. This efBy using fluorescence ratiometric imaging of CFSE-conjugated particles to measure the calibrated pH value of phagosomes, we determined that the rate of acidification in IFN\u03b2-treated BMDMs was unaffected  treatment can suppress phagosomal proteolysis to promote antigen presentation26. This phenotype is mediated by the NOX2 NADPH oxidase, a multisubunit complex that generates reactive oxygen species (ROS) within the lumen of the phagosome. ROS-mediated oxidation of critical cysteine residues in phagosome-localized proteases, such as cathepsin B and S, contributes to suppression of phagosomal proteolysis27, along with other potential mechanisms28. Since IFN\u03b3 is known to promote bacterial killing30, ROS-mediated suppression of phagosomal proteolysis may be compensated by the direct antimicrobial activity of ROS31.Phagosomal proteases contribute to killing and digestion of internalized microbes32. IFN\u03b2-treated cells showed a deficiency in phagosomal proteolysis, comparable to the effect seen with IFN\u03b3 treatment  expression under the actA promoter, in a cassette stably integrated in the tRNAARG locus of the bacterial chromosome. This cassette contains all of the known enhancer elements for ActA expression36 and we used the enhanced mutant of GFP for optimal detection of actA transcription  was left intact. Bacteria surface-localized ActA was detected by immunofluorescence using affinity-purified antibodies. The actA:GFP reporter strain was generated in the WT Lm background as well as the \u0394hly mutant and a mutant lacking virulence factors required for phagosomal escape , hereafter referred to as the triple knockout (TKO) Lm strain , and displayed robust transcription of actA, visualized by the expression of actA:GFP and localization of ActA protein on the bacterial cell surface, as expected  and WT and TKO Lm strains . Under these conditions, ActA localized to the bacterial surface in phagosome-trapped bacteria (\u0394hly and TKO Lm)  Fig.\u00a0, suggestLm) Fig.\u00a0. WesternLm) Fig.\u00a0. We also Lm Fig.\u00a0. These fLm lacking other phagosome escape factors  to decrease the efficiency of bacterial entry to the cytosol. Secreted LLO was isolated from the detergent soluble fraction of cell lysates isolated after Lm infection  and SARS-CoV-2 utilizes host\u00a0type II transmembrane serine proteases and cathepsin L to infect cells expressing its ACE2 receptor50. Consistent with this notion, we observed IFITM3 to be the only fusion and trafficking-associated protein strongly localizing to both phagosomes and lysosomes in IFN\u03b2-treated BMDMs  is an antiviral ISG in mice and humans that localizes to cell surface and endocytic compartments in most cell types during type I IFN activationDMs Fig.\u00a0. IFITM3 Ifitm3\u2212/\u2212 mice (hereafter IFITM3 KO) and infected with phagosome-confined bacteria. We observed a reduced bacterial load over time for both \u0394hly Lm and E. coli in untreated BMDMs from WT and IFITM3 KO mice, consistent with antibacterial activity in macrophage phagosomes  was lost in IFITM3 KO BMDMs  were grown in brain-heart infusion (BHI) broth and the following strains were used: 10403S (WT), 10403S (dasherGFP-WT), DP-L2161 (\u0394hly), DH-L1137 (GFP-\u0394hly), DP-L2319 , and DH-1458 (\u0394actA\u0394plcA\u0394plcB). Escherichia coli were grown in lysogeny broth (LB) and the following strains were used: DH10B (WT) and DH10B (RFP). E. coli was cultured overnight, diluted to an OD600 of 1.0 and opsonized with IgG (Meridian) for 30\u2009min at 37\u2009\u00b0C prior to infection.Lm expressing GFP under the actA promoter were used: DH-L1245 (WT), DH-L2011 (\u0394hly) and DH-L2012 . To generate the reporter stains, the reporter construct PactA-actA UTR-gfpmut2 was generated by overlap extension PCR69. Primer 432  and primer 434 (GAAAAGTTCTTCTCCTTTACTCATTTATACTCCCTCCTCGTGATAC) were used to PCR amplify the actA promoter and UTR from the Lm chromosome. Primers 435 (GTATCACGAGGAGGGAGTATAAATGAGTAAAGGAGAAGAACTTTTC) and 221 (AAGTCGACTTATTTGTATAGTTCATCCATGCCATG) were used to PCR amplify the gfpmut2 gene from plasmid pDH-103870. The two PCR products were gel purified using a QIAquick gel extraction kit (Qiagen), and the purified products were then used as templates for splicing by overlap extension PCR69 along with primers 432 and 221. The resulting PactA-actA UTR-gfpmut2 fragment was gel purified, digested with EagI and SalI, and ligated into pPL3 digested with the same restriction enzymes. The ligation was then dialyzed and electroporated into E. coli XL1-Blue to generate strain DH-E1244. The resulting plasmid (pDH-1244) was also electroporated into Lm 10403S to yield DH-L1245, Lm DP-L2161 to yield DH-L2011, and Lm DP-L2319 to yield DH-L2012. Antibiotics were used at the following concentrations: chloramphenicol 20 \u03bcg ml\u22121 for selection of pPL3-derived plasmids in E. coli and chloramphenicol 7.5\u2009\u03bcg ml\u22121 for selection of single-copy pPL3-derived plasmids integrated at the tRNAARG locus in Lm. All primers used are listed in Supplementary Table\u00a0The following reporter strains of Ifnar1\u2212/\u2212  and B6(Cg)-Tyrc-2J-Ifitm3\u2212/\u2212  mice were bred in-house at The Hospital for Sick Children Animal Care Facility. C57BL/6J (stock #000664) and B6(Cg)-Tyrc-2J (stock #000058) mice, originally from The Jackson Laboratory, were also bred in-house and used as controls. All experiments were performed with 6\u201312-week-old sex- and age-matched mice that were maintained on a 12\u2009h light\u2013dark cycle, with food and water available ad libitum. All animals were bred separately and housed in specific pathogen-free barrier rooms kept at 22\u201326\u2009\u00b0C and 45\u201355% humidity. Experiments were not blinded, and mice were not randomized. All experiments described in this study were carried out in accordance with the Guide for the Humane Use and Care of Laboratory Animals and ethical approval was obtained from The Hospital for Sick Children\u2019s Animal Care Committee (AUP #52111).B6.129S2-Lm (#B223021 from BD Biosciences), rabbit-anti-E. coli (#ab20640 from Abcam), rabbit-anti-ActA72 , rabbit-anti-InlB , mouse-anti-p60 (#NBP2-80120 from Novus), rabbit-anti-LLO (#ab200538 from Abcam), rat-anti-F4/80 (#ab16911 from Abcam), biotin-anti-CD3e (#13-0031-85 from ThermoFisher), and rat anti-mouse LAMP1 . Primary antibodies (1:1000) used for western blotting were rabbit-anti-ActA, rabbit-anti-InlB , rabbit-anti-LLO (#ab200538 from Abcam). Alexa Fluor-568/647 Phalloidin and all fluorescent secondary antibodies (Alexa Fluor conjugates) were from Invitrogen. IFN\u03b2  was from R&D Systems and IFN\u03b3  was from PeproTech. 4,6-Diamidino-2-phenylindole (DAPI) (#D1306 from Invitrogen) was used at 1:2,500 dilution to stain the nuclei where indicated. Green DQ-BSA  and Oregon Green Dextran  was from ThermoFisher. Cresyl violet  and FITC-dextran (#FD10S) was from Sigma. Bafilomycin A  was from Cayman Chemical. The following protease inhibitors were from BioShop: Leupeptin , PMSF , Aprotinin , Pepstatin A . E64D  was from Sigma.Primary antibodies (1:100) used for immunofluorescence were rabbit anti-2. All cells used were authenticated and tested negative for mycoplasma by The Hospital for Sick Children Biobank and the Mycoplasma Plus PCR kit (Aligent Technologies #302008). Primary macrophages were obtained from mice housed in The Hospital for Sick Children Animal Care Facility. Mice were euthanized by CO2 inhalation. Mouse BMDMs were obtained from the dissected femurs and tibias of 6\u20138-week-old male C57BL/6 mice. Cells were washed with growth medium and plated on 70\u2009cm2 Petri dishes (ThermoFisher #FB0875712). Medium was replaced every 2-3 days and after 7 days cells were used for experiments. Cells were maintained in high-glucose RPMI-1640 medium (Wisent #350-025-CL) containing 10% heat-inactivated FBS (Wisent), 1% sodium pyruvate (Wisent), 1% non-essential amino acids (Wisent), 0.5% 2-mercaptoethanol (Gibco), 1% penicillin and streptomycin (Invitrogen), and 10% L929-conditioned media while differentiating, and in RPMI and 10% FBS subsequently. L929-conditioned media was generated by growing a confluent layer of L929 cells in 175\u2009cm2 flasks in DMEM supplemented with 10% heat-inactivated FBS. When cells reached confluency, growth medium was replaced with DMEM alone. After 7 days, supernatant was collected, centrifuged, filtered and stored at \u221220\u2009\u00b0C.RAW264.7 and J774 macrophages, AML12 hepatocytes, mouse embryonic fibroblasts (MEFs), and Caco-2 cells were cultured in DMEM (Hyclone) supplemented with 10% heat-inactivated FBS (Wisent) without antibiotics at 37\u2009\u00b0C and 5% CO57. Briefly, cells were fixed with 2.5% paraformaldehyde (PFA) for 10\u2009min at 37\u2009\u00b0C, permeabilized and blocked in PBS+ (Wisent) containing 0.2% saponin  and 10% normal goat serum (SS-PBS) for 30\u2009min. Subsequently, cells were incubated for 1\u2009h with primary antibodies in SS-PBS. Cells were washed three times with PBS+ and incubated with secondary Alexa Fluor conjugated antibodies in SS-PBS for 1\u2009h. Cells were washed three times with PBS+, mounted in fluorescence mounting medium (Dako). Confocal microscopy images were imported into Adobe Photoshop and assembled in Adobe Illustrator for labeling.Immunostaining was conducted as previously describedSamples were normalized to bacterial CFU and subjected to SDS-PAGE using 12% polyacrylamide gels (Invitrogen #XP00125BOX) and transferred onto PVDF membranes (BioRad #1620177). Membranes were blocked using 5% non-fat dried milk diluted in TBS-Tween for 1\u2009h. Primary and HRP-secondary antibodies were diluted at 1:1000 and 1:5000 respectively. Membranes were detected using West Pico PLUS chemiluminescent substrate (ThermoFisher # 34580) on a Bio-Rad ChemiDoc system. Densitometry was performed using ImageJ software. All uncropped and unprocessed scans of blots can be found in the Source Data File.5 cells per well in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with \u0394hly Lm or E. coli at an MOI of 1 or 1:200 respectively in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin (Wisent #400-130-IG) and IFN\u03b2. At 1, 2, 4, 8, 12, and 24\u2009h p.i., cells were lysed with PBS+ containing 1% Triton X-100. Serial dilutions of the lysates were plated on LB- (E. coli) and BHI- (\u0394hly Lm) agar plates and incubated at 37\u2009\u00b0C for 16\u2009h for subsequent quantification of intracellular colony forming units (CFUs).WT, IFNAR1 KO, and IFITM3 KO BMDMs were plated at 3\u2009\u00d7\u2009105 cells per well in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with \u0394hly Lm or E. coli at an MOI of 1 or 1:200 respectively in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin and IFN\u03b2. At 5, 10, 15, 20, 25 and 30\u2009min p.i., cells were fixed with 2.5% PFA. Differential antibody staining was carried out to stain extracellular bacteria before permeabilizing the cells to stain for total bacteria. Cells were imaged on a Quorum spinning disk confocal scan head  equipped with a \u00d763 objective. Phagocytosis was measured by calculating internalized bacteria  over the time course using Volocity 6 software.BMDMs were plated at 3\u2009\u00d7\u2009105 cells per well in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with \u0394hly Lm or E. coli at an MOI of 1 or 1:200 respectively in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin and IFN\u03b2. At 1, 2, 4, 8, 12, 24\u2009h p.i., cells were fixed with 2.5% PFA. Cells were stained with antibodies against Lm, E. coli and LAMP1. Cells were then imaged on a Quorum spinning disk confocal scan head equipped with a \u00d763 objective. LAMP1 recruitment was measured by counting LAMP1-positive bacteria over the time course.BMDMs were plated at 3\u2009\u00d7\u2009105 cells per well in \u00b5-Slide 8 Well IBIDI chambers (#80826) and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with GFP-\u0394hly Lm at an MOI of 5 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, IFN\u03b2 and 50\u2009\u03bcg\u2009ml\u22121 gentamicin. Cells were pulsed with cresyl violet (1\u2009\u03bcM) for 5\u2009min to label acidified compartments73, and washed prior to imaging and replaced with RPMI medium containing 10% FBS and IFN\u03b2. 4\u2009h p.i., cells were imaged live on a Quorum spinning disk confocal scan head  equipped with a \u00d763 objective. Cresyl violet-positive bacteria were quantified using Volocity 6 software.BMDMs were plated at 1\u2009\u00d7\u2009105 cells per well in \u00b5-Slide 8 Well IBIDI chambers and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before treatment. 15\u2009min prior to cresyl violet treatment, cells were pulsed with Oregon Green 10\u2009kDa dextran (40\u2009\u00b5g\u2009ml\u22121) and washed. Cells were pulsed with cresyl violet (1\u2009\u03bcM) for 5\u2009min and washed prior to imaging and replaced with RPMI medium containing 10% FBS and IFN\u03b2. Cells were imaged live using a spinning disk confocal microscope equipped with a \u00d763 objective. Pearson correlation of dextran-positive and cresyl violet-positive compartment colocalization were quantified using Volocity 6 software.BMDMs were plated at 1\u2009\u00d7\u2009105 cells per well in 96 well \u03bcClear plates (Greiner Bio-One) and treated with 100\u2009U ml\u22121 IFN\u03b3 or 2400\u2009IU ml\u22121 IFN\u03b2 20\u2009h prior to assay. Fluorescently labeled, IgG-coupled 3-\u03bcm silica particles were prepared and used for phagosomal lumenal characterization as previously detailed75. Measurements were performed in microplate format with the use of a FLUOstar Optima fluorescent plate reader (BMG Labtech) or Envision 2104 Multilabel Reader (PerkinElmar) at 37\u2009\u00b0C. Immediately prior to the addition of experimental particles, growth medium was removed from cells and replaced with assay medium . Particles were added to BMDMs at an MOI of 2-3 particles per cell.BMDMs were plated at 1.2\u2009\u00d7\u200910BMDMs were prepared as above. To determine the rate of phagosome fusion with lysosomes, a FRET-based assay was used wherein the acceptor fluorophore (Alexa Fluor 594 hydrazide) was pulsed into lysosomes overnight prior to phagocytosis of the particle restricted donor fluorophore (Alexa Fluor 488 SE). The assay was carried out in a microplate format in an Envision plate reader. The FRET signal (emission of the acceptor fluorophore following excitation of the donor fluorophore) was detected over time following phagocytosis and expressed relative to the donor fluorophore fluorescence.76.BMDMs were prepared as above. Phagosomal pH was calculated by recording the ratio of the fluorescent emission at 520\u2009nm of carboxyfluorescein succinimidyl ester (CFSE) conjugated to experimental particles excited at 490\u2009nm and 450\u2009nm followed by polynomial regression to a standard curve as previously detailed77. The hydrolytic capacity of the cells was determined as the rate of substrate liberation of the DQ-Green-BSA from the experimental particles over time, relative to the calibration fluorophore. For comparison of hydrolytic capacities across experiments, the slopes  of the linear portion of the relative substrate fluorescence plotted against time were calculated relative to the internal control indicated.BMDMs were prepared as above. For assessment of the hydrolytic capacity of the phagosome, experimental particles were prepared bearing the proteolytic substrate, green DQ-BSA and the calibration fluorophore (Alexa Fluor 594 SE) as previously described2O2 generated by macrophages stimulated with 50\u2009\u03bcg\u2009ml\u22121 of serum-opsonized zymosan (Sigma Aldrich), supernatant analysis was carried out by measuring the reaction of 20\u2009\u03bcM Amplex Red (Invitrogen #A12222) in the presence of horse radish peroxidase using a FLUOstar Optima fluorescence plate reader (BMG Labtech) as previously described78. Hydrogen peroxide production is presented as relative to unstimulated macrophages.BMDMs were prepared as above. To determine the amount of H7 cells per dish in 70\u2009cm2 Petri dishes and treated with 2400\u2009IU ml\u22121 IFN\u03b2 for 24\u2009h\u00a0prior to and throughout the experiment. 7\u2009\u00d7\u2009107 cells (7 dishes) and 4\u2009\u00d7\u2009107 cells (4 dishes) were used per condition for phagosome and lysosome isolation respectively. For phagosomes, magnetic latex beads  were opsonized with IgG for 60\u2009min at 37\u2009\u00b0C. Beads were diluted in RPMI\u2009+\u200910% FBS and fed to BMDMs at a ratio of 10 beads per cell. Beads were allowed to phagocytose for 30\u2009min before washing cells with PBS+ and replacing with RPMI\u2009+\u200910% FBS for 4\u2009h. For lysosomes, 5\u2009ml media containing 2.5\u2009ml iron dextran  in H2O mixed with 2.5\u2009ml 2X RPMI\u2009+\u200910% FBS, was added to 5\u2009ml regular RPMI\u2009+\u200910% FBS, to make a total volume of 10\u2009ml used per dish. Cells were pulsed for 8\u2009h with the FeDex solution before washing with PBS+ and chased by replacing with RPMI\u2009+\u200910% FBS for 1\u2009h.WT and IFITM3 KO BMDMs were plated at 1\u2009\u00d7\u200910g for 5\u2009min and pellet was resuspended in 10\u2009ml homogenization buffer  and spun down again. Final cell pellets were resuspended in 2.5\u2009ml homogenization buffer and homogenized using a 15\u2009ml Dounce homogenizer with a small clearance pestle for 20\u201330 passes until 90% of cells were broken without nuclear breakage. Homogenate were spun down in 15\u2009ml tube at 135\u2009\u00d7\u2009g for 5\u2009min and supernatant was collected in a 5\u2009ml propylene round bottom tube. To purify phagosomes and lysosomes, tubes with supernatant were placed in an EasySep magnet for 10\u2009min before pouring out to discard unbound solution. Magnetic latex bead-containing phagosomes and FeDex-containing lysosomes attached to the side of the tube were washed and resuspended with 1\u2009ml homogenization buffer and spun down in a 1.5\u2009ml Eppendorf tube at 16,000\u2009\u00d7\u2009g for 15\u2009min. Pellets were resuspended with lysis buffer and stored at \u221280\u2009\u00b0C. Magnetic beads were removed by centrifugation prior to mass spectrometry.Subsequent steps were performed on ice or in 4\u2009\u00b0C. To isolate phagosomes and lysosomes, cells were washed twice with cold PBS+, replaced with 7\u2009ml cold PBS+, scraped, and collected in a 50\u2009ml tube. Cells were spun down at 450\u2009\u00d7\u2009\u22121. Samples were loaded into a 75\u2009\u00b5m\u2009\u00d7\u20092\u2009cm Acclaim PepMap 100 Pre-column followed by a 75\u2009\u00b5m\u2009\u00d7\u200950\u2009cm PepMax RSLC EASY-Spray analytical column filled with 2\u2009\u00b5M C18 beads (Thermo Fisher Scientific). MS1 acquisition resolution was set to 120,000 with an automatic gain control (AGC) target value of 4\u2009\u00d7\u2009105 and maximum ion injection time (IT) of 50\u2009ms for a scan range of m/z 375\u20131500. Monoisotopic precursor selection (MIPS) was determined at the peptide level with a global intensity threshold of 10,000 and only peptides with charge states of 2\u20137 were accepted, with dynamic exclusion set to 10\u2009s. Isolation for MS2 scans was performed in the quadrupole with an isolation window of m/z 0.7. MS2 scans were performed in the ion trap with maximum ion IT of 10\u2009ms, AGC target value of 1\u2009\u00d7\u2009104, and higher-energy collisional dissociation (HCD) activation with an NCE of 30. MS raw files were analyzed using Proteome Discoverer (version 2.2.0.388) and fragment lists and GO annotation searched against the mouse UniProt Reference database . For both search algorithms, the parent and fragment mass tolerances were set to 10\u2009ppm and 0.6\u2009Da, respectively, and only complete tryptic peptides with a maximum of two missed cleavages were accepted. Protein abundance was compared between UT and IFN\u03b2-treated phagosomes and lysosomes. Complete proteomic datasets were deposited in the MassIVE repository, accession # MSV000087014 [10.25345/C5V51C].All sample preparation, LC-MS/MS data collection, and MS data searches were carried out at the SPARC BioCentre at The Hospital for Sick Children . Samples were reduced with DTT , alkylated with iodoacetamide , and digested overnight at 37\u2009\u00b0C with trypsin . Peptides were dried by vacuum centrifugation, desalted on C18 ziptips (Millipore) using a DigestPro MSi , and dried again by vacuum centrifugation before resuspension in Buffer A (0.1% formic acid). Samples were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using an EASY-nanoLC 1200 system with a 1\u2009h analysis and an Orbitrap Fusion Lumos Tribrid Mass Spectrometer (Thermo Fisher Scientific). The LC portion of the analysis consisted of an 18\u2009min linear gradient running 3\u201320% of Buffer A to Buffer B , followed by a 31\u2009min linear gradient running 20\u201335% of Buffer A to Buffer B, a 2\u2009min ramp to 100% Buffer B and 9\u2009min hold at 100% Buffer B, all at a flow rate of 250\u2009nL min5 cells per well in 12-well tissue culture plates with glass coverslips and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before treatment. Cells were pulsed with 10\u2009kDa FITC-dextran, washed and chased for 1\u2009h in RPMI medium containing 10% FBS and IFN\u03b2. Glass coverslips were transferred to an imaging chamber containing HEPES-buffered RPMI. The cells were visualized with a Leica DM IRB microscope. Once a cell was found that had bound fluorophore-labeled dextran, pH measurements were performed by fluorescence ratiometric imaging using a filter wheel (Sutter Instruments) to rapidly alternate between excitation filters. The FITC-dextran was excited by light from an EXFO X-cite 120 lamp (ExFo Life Sciences) transmitted through the appropriate excitation filters and directed to the sample using a dichroic mirror. The emitted light was captured by a CCD camera  after passing through an emission filter. MetaFluor  software was used to control the filter wheel and camera. An in situ calibration was performed for each lysosome after measurement. Samples were bathed in K+-rich buffers ranging from pH 4.5\u20139.6 containing 10\u2009\u03bcg\u2009ml\u22121 nigericin. Images were taken 5\u2009min after the addition of each calibration solution to ensure equilibration to the desired pH. The resulting fluorescence intensity ratio was plotted as a function of pH and fitted to a Boltzmann sigmoid that was used to interpolate ratios measured of lysosome acidification.BMDMs were plated at 6\u2009\u00d7\u2009105 cells per well in \u00b5-Slide 8 Well IBIDI chambers and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. 4\u2009h prior to infection, cells were pulsed with green DQ-BSA (10\u2009\u03bcg\u2009ml\u22121) for 1\u2009h and chased with RPMI medium containing 10% FBS and IFN\u03b2 for 3\u2009h. Cells were infected with 1:200 RFP-E. coli in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, IFN\u03b2 and 50\u2009\u03bcg\u2009ml\u22121 gentamicin. 4\u2009h p.i., cells were imaged live using a spinning disk confocal microscope equipped with a \u00d763 objective. DQ-BSA-positive bacteria were quantified using Volocity 6 software.BMDMs were plated at 1\u2009\u00d7\u2009106 cells per well in 6-well tissue culture plates overnight in DMEM. Cells were infected with mid-log bacterial cultures resuspended 1:20 in 100 \u03bcl DMEM for 10\u2009min. Infected cells were washed with PBS+ after 60\u2009min and replaced with DMEM containing 50\u2009\u03bcg ml\u22121 gentamicin. At each time point, cells were lysed with 0.1% Triton X-100\u00a0in PBS+, bacterial titers in the lysates were determined by plating dilutions for CFU of bacteria recovered via centrifugation. Bacteria were normalized to CFU and whole-cell lysates were generated by 3\u2009mg\u2009ml\u22121 lysozyme treatment in Tris-EDTA for 60\u2009min at 37\u2009\u00b0C and subjected to western blot analysis.J774 murine macrophage-like cells were plated at 2\u2009\u00d7\u2009106 cells per well in 6-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with WT, TKO or \u0394actAplcAplcB Lm at an MOI of 10 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin IFN\u03b2. Cells were lysed with 1% Triton X-100 in 1\u2009ml PBS+ at 1, 2, and 4\u2009h p.i. 100\u2009\u00b5l of lysate was used for serial dilution and plated on BHI agar plate to obtain bacterial CFU. Remaining lysates were spun down to recover soluble fraction for LLO and bacteria pellet for ActA and InlB. Samples were diluted and resuspended in sample buffer, boiled for 5\u2009min, and subjected to western blot analysis.WT and IFITM3 KO BMDMs were plated at 2.5\u2009\u00d7\u2009105 cells per well in 24-well tissue culture plates. Where indicated, cells were treated with 2400\u2009IU ml\u22121 IFN\u03b2, 100\u2009nM bafilomycin A, or protease inhibitors 24\u2009h, 4\u2009h and 30\u2009min respectively before infection. Cells were infected with actA:GFP reporter strains; WT, \u0394hly Lm and TKO Lm at an MOI of 10 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, IFN\u03b2 and 50\u2009\u03bcg\u2009ml\u22121 gentamicin. At 4\u2009h p.i., cells were fixed with 2.5% PFA for 10\u2009min. To visualize bacteria surface protein degradation\u00a0in phagosomes, cells were stained with antibodies to ActA and LAMP1. Cells were imaged using a spinning disk confocal microscope equipped with a \u00d763 objective. ActA- and LAMP1-positive actA:GFP reporter-positive bacteria were quantified using Volocity 6 software.RAW264.7 macrophages, WT and IFITM3 KO BMDMs were plated at 3\u2009\u00d7\u2009105 cells per well in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with WT Lm at an MOI of 20 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin IFN\u03b2. At 1, 1.25, 1.5, 1.75, 2 and 4\u2009h p.i., cells were fixed with 2.5% PFA. Differential antibody staining was carried out to stain extracellular bacteria before permeabilizing the cells to stain for total bacteria. BMDMs were also stained for actin using phalloidin. Cells were imaged on a Quorum spinning disk confocal scan head equipped with a \u00d763 objective. Actin recruitment was quantified as phalloidin-positive internalized bacteria  over the time course, and motile Lm (actin comet tail-positive bacteria) were quantified 4\u2009h p.i., using Volocity 6 software.WT and IFITM3 KO BMDMs were plated at 3\u2009\u00d7\u20091057. Briefly, WT and IFITM3 KO BMDMs were plated at 1.5\u2009\u00d7\u2009106 cells per well in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. AML12, MEF and Caco-2 cells were plated at 2, 4, and 2.5\u2009\u00d7\u2009105 cells per well, respectively, in 24-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with WT Lm at an MOI of 0.001 (BMDM), 1 (AML12), 0.5 (MEFs) or 0.1 (Caco-2) in RPMI (BMDM) or DMEM . At 18\u2009h p.i., cells were fixed and counterstained with Lm and DAPI, and imaged on a Quorum spinning disk confocal scan head equipped with a \u00d710 objective. The number of infected cells per focus of infection was quantified using Volocity 6 software.Assay was conducted as previously described5 cells per well (sub-confluence density) in 24-well tissue culture plates and treated with 2400\u2009IU ml-1 IFN\u03b2 24\u2009h before infection. Cells were infected with WT or \u0394actA Lm at an MOI of 1 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS, 50\u2009\u03bcg\u2009ml\u22121 gentamicin IFN\u03b2. At 2, 4, 8 and 12\u2009h p.i., cells were lysed with PBS+ containing 1% Triton X-100. Serial dilutions of the lysates were plated on BHI agar plates and incubated at 37\u2009\u00b0C for 16\u2009h for subsequent quantification of bacterial CFU.WT and IFITM3 KO BMDMs were plated at 3\u2009\u00d7\u200910Lm infection. Mice were restrained using Mouse Tail Illuminator Restrainer (Braintree Scientific), tail was swabbed with 70% EtOH and warmed to dilate lateral tail vein. Mice were infected with 5\u2009\u00d7\u2009104 bacteria diluted in 200\u2009\u00b5l of PBS+ via intravenous injection using 30\u2009G x \u00bd needles (BD). Mice were monitored and weighed 3 times a day at 9 am, 3\u2009pm and 9\u2009pm. Survival rate was plotted using Kaplen\u2013Meier function after 10 days p.i. Organs used to determine bacterial load were harvested from a separate group of mice 72\u2009h p.i. Mice were euthanized by CO2, and liver, spleen and brain were obtained and homogenized in 1\u2009ml PBS+, and serial dilutions of the tissue were plated on BHI agar plates and incubated at 37\u2009\u00b0C for 16\u2009h for subsequent quantification of CFU. Final bacterial load was calculated after normalization to tissue weight.8\u201312-week-old sex- and age-matched WT, IFITM3 KO, and IFNAR1 KO mice were used for WT Lm or GFP-Lm for 72\u2009h was embedded in OCT medium (Tissue-Tek #4583) and snap-frozen in liquid nitrogen. 5\u2009\u00b5m sections collected in 4 series were obtained using a Cryostat (Leica CM 1850) and mounted on charged slides (VWR #CA48311-703). Tissue was fixed in ice-cold methanol for 10\u2009min at \u221220\u2009\u00b0C. For hematoxylin and eosin staining, slides were rehydrated and stained according to the following: Hematoxylin (3\u2009min), H2O (1\u2009min), Clarifier (1\u2009min), H2O (1\u2009min), Bluing Reagent (3\u2009min), H2O (1\u2009min), 95% EtOH (rinse), Eosin (30\u2009s), 75% EtOH (rinse), 95% EtOH (rinse), 100% EtOH (1\u2009min \u00d73), Xylene (1\u2009min \u00d73). Tissue was sealed with mounting media (Sigma #107960) and liver infection foci were imaged using Leica DM1000LED with a \u00d720 objective. Number of foci were calculated per square mm of tissue. For immunofluorescence staining, slides were blocked with 5% BSA, 10% goat serum and 0.1% Triton X-100 diluted in PBS+ for 30\u2009min at RT. Tissue were stained with antibody to Lm, ActA, CD3e and F4/80 overnight at 4\u2009\u00b0C, washed with PBS+ and counterstained with secondary antibody and DAPI. Tissue was imaged on a Quorum spinning disk confocal scan head equipped with a \u00d710 and \u00d760 objective. ActA and immune cell recruitment, and the number of infected cells per focus of infection were quantified using Volocity 6 software.Liver obtained from WT and IFITM3 KO mice infected with WT 6 cells per well in 6-well tissue culture plates and treated with 2400\u2009IU ml\u22121 IFN\u03b2 24\u2009h before infection. Cells were infected with WT Lm at an MOI of 0.001 in RPMI. At 60\u2009min p.i., all cells were washed three times with PBS+ and cultured in RPMI medium containing 10% FBS and 50\u2009\u03bcg\u2009ml\u22121 gentamicin. Cell culture supernatant was collected 4, 8, 12 and 24\u2009h p.i. IFN\u03b2 levels were measured using ELISA kit (PBL Assay Science #4200-1).WT and IFITM3 KO BMDMs were plated at 4\u2009\u00d7\u200910Lm was obtained and RNA was isolated using the RNeasy kit (QIAGEN #74104). cDNA was synthesized using iScript Reverse Transcription Supermix for reverse transcription. 10\u2009ng of cDNA per reaction was used for quantitative PCR using SsoFast EvaGreen Supermix (Bio-Rad #1708840) with Hprt as the housekeeping gene. The following primers were obtained from Sigma: Ifnb (F-CCCTATGGAGATGACGGAGA R-CTGTCTGCTGGTGGAGTTCA), Ifngr1 (F-GTAGCCTCACCGCCTATCAC R-GGGCCTCTCCTGTGAGTCTA), Tnfa (F-CCCATGGATGTCCCATTTAG R-CAATCAGGAGGGTGTGTGTG), Il4 (F-GCCTGCTTTTCACATGAGGT R-AAATATGCGAAGCACCTTGG), Il10 (F-CCAAGCCTTATCGGAAATGA R-TTTTCACAGGGGAGAAATCG), Il12 (F-AGCATAAGAGACGCCCTCAA R-GGTGTTACAGGCCCAAAGAA). All primers used are listed in Supplementary Table\u00a0Liver tissue from WT and IFITM3 KO mice infected with WT P values were calculated as described in figure legends. P\u2009<\u20090.05 was considered statistically significant. Unless stated otherwise, *P\u2009<\u20090.05, **P\u2009<\u20090.01, ***P\u2009<\u20090.001, ****P\u2009<\u20090.0001, not significant (ns) P\u2009>\u20090.05.Statistical analyses and graph plotting were conducted using GraphPad Prism v.8.4.1. The mean\u2009\u00b1\u2009s.d. is shown in figures, and Further information on research design is available in the\u00a0Supplementary InformationReporting Summary"}
+{"text": "AimHip fracture fixation surgeries are one of the most common surgeries that every trauma unit does regularly. Surgical training and expertise to fix these fractures properly are quite crucial for every orthopaedic surgeon. Therefore, orthopaedic training programmes all over the world consider significant focus on this and teach trainee surgeons expectantly to manage these fractures independently. Surgical fixation of hip fractures often requires fluoroscopy assistance in the operating theatre with associated hazards from ionising radiation. Moreover, hip fractures can be sometimes quite complex and may require relatively more fluoroscopy usage even with the higher grade of the operating surgeons. Therefore, training need for hip fracture fixation surgery is imperative and there is also a need for intraoperative radiation safety. This study has tried to find a balance between intraoperative fluoroscopic radiation exposure, surgical training requirement, and hip fracture complexity.Methodology2), and grade of the operating surgeon in order to find any relation between these factors.This single centre study has collected retrospective peri-operative data over a period of two years including hip fractures that required fluoroscopy-guided surgical fixation. Femoral head fractures, subtrochanteric fractures, diaphyseal fractures, and trochanteric fractures with associated pelvic fractures were excluded from the study. We collected data on demographic parameters, fracture complexity and grading (Arbeitsgemeinschaft f\u00fcr Osteosynthesefragen/Orthopaedic Trauma Association [AO/OTA] Classification), intraoperative ionising radiation exposure  comprising of 83 (31%) male patients and 185 (69%) female patients. The study population was further stratified into three groups depending upon the operating grade of the surgeon: \u2018Junior Trainee\u2019 ; \u2018Senior Trainee\u2019 ; and \u2018Consultant\u2019 . There was no statistically significant difference among these three sub-groups with regards to the age (p = 0.79), gender (p = 0.73), body mass index (p = 0.46), and fracture pattern (p = 0.96) of the patients. However, consultants tend to operate more on the higher American Society of Anesthesiologists (ASA) grade patients (p = 0.049) with more comorbidities. There was statistically significant higher fluoroscopic radiation exposure while junior trainee surgeons (p = 0.005) were operating and during the higher complex grade of hip fracture (p = <0.001) fixation.ConclusionIn conclusion, the quantity of intra-operative radiation dose utilised in the surgical fixation of hip fractures is significantly associated with the grade and level of training of the operating surgeon and fracture complexity type. The results of this study emphasise and support the importance of comprehensive, supervised, and structured orthopaedic training for in-theatre radiation safety. It is recommended to have a safe balance between teaching, learning, and prevention of ionising radiation hazards in order to optimally achieve trainee\u2019s professional development with successful patient outcomes. Modern orthopaedic practice heavily relies on the appropriate use of fluoroscopic imaging. During the surgical fixation of hip fractures, intra-operative imaging provides a valuable guide to assess the quality of fracture reduction, while also ensuring that the final implant position is of a reasonable standard. However, exposure to prolonged ionising radiation has proven associations to various harmful effects. There is evidence suggesting that orthopaedic surgeons are at greater risk of the development of malignancy, a possible consequence of increased occupational exposure to ionising radiation ,2. An asAround 70,000-75,000 hip fractures occur annually in the United Kingdom . As suchFew available studies have explored the association between the surgeon grade, modality of fixation, and the intra-operative radiation dose used in the surgical fixation of hip fractures. However, there is limited evidence correlating the surgeon grade, fracture severity, and radiation exposure altogether. The primary aim of this study was to explore whether there is any relationship between these variables. The secondary aim was to identify any associated factors that have contributed to increased radiation used during surgery. Our ambition was for our results to act as a guide in order to suggest measures to reduce intra-operative radiation exposure for surgeons and patients alike.Study designThis study was performed at a large district general hospital in the West Midlands, United Kingdom, covering a catchment area of over 500,000 people. Data were collected over a two-year period, from January 2018 to December 2019. All the hip fractures fixed during this time using intraoperative fluoroscope were included in the study. Electronic patient records, operative notes, anaesthetic checklists, and radiographs were used to collate and analyse data. Data regarding the radiation dosage was provided from records made immediately post-operatively by the radiographer present in the operating theatre. The study provided level III evidence.During the specified period, 268 patients with extracapsular hip fractures required surgical fixation. The fractures were classified according to the Arbeitsgemeinschaft f\u00fcr Osteosynthesefragen/Orthopaedic Trauma Association (AO/OTA) classification model . The cla2 (cG/cm2).All patients who had a surgical fixation for the neck of femur fracture and the recording of the radiation dosage availability from the radiographers were included. Fractures requiring open reduction were excluded because of the complexity, and hence the additional radiation involved. The grade of the operating surgeon was subdivided into a \u2018Consultant\u2019 , \u2018Senior Trainee\u2019 (>five years of experience in trauma and orthopaedics), and \u2018Junior Trainee\u2019 (<five years of experience). Radiation dosage was measured by centi-Gray/cmStatistical analysisStatistical analysis was performed using SPSS Statistics\u00a0version 22.0 . A two-way analysis of variance was applied to determine the significance of surgeon grade and fracture type to the dose of radiation. Tukey\u2019s post hoc tests were performed to perform sub-group analysis. A p-value of <0.05 was considered statistically significant.Cohort characteristicsFrom January 2018 to December 2019, 305 patients had surgical fixation of neck of femur fracture, of which 268 met inclusion criteria. A summary of the baseline patient demographics and fracture complexity can be found in Table When analysed by the American Society of Anesthesiologists' (ASA)\u00a0classification, there was a significant difference between the three groups (p = 0.049), with consultants tending to operate on patients with a higher ASA grade and higher comorbidities. However, there was no statistically significant difference in the grade of the operating surgeon and the fracture complexity (p > 0.05). This could have given relatively unbiased values of radiation exposure due to the skill mix while fixing different grades of hip fracture.Correlation of radiation dosage as per surgeon gradeTable A sub-group analysis Table  demonstrCorrelation of radiation dosage as per fracture typeWhen categorised according to AO/OTA  classifiTable Our study demonstrates that the amount of intra-operative radiation dose used in the fixation of hip fractures is highest when patients are operated upon by the junior trainees. The data analysis showed that the junior trainees used nearly 50% higher radiation dose when compared to the more senior trainees. As with the progression of the learning curve, the radiation exposure during hip fracture fixation gradually reduced. Botchu et al.  performeOn the contrary, Quah et al.  found thInterestingly, in a series of 137 hip fracture patients, Kelly et al.  studied Rashid et al.  studied Buxbaum et al.  conducteRiaz et al.  have triOur results support the belief that the additional experience and confidence associated with seniority aids the decreased use of potentially harmful ionising radiation. It would be appropriate to suggest that this is associated with increased experience and skill during reduction manoeuvres, correct guidewire positioning with minimum attempts, experience with the judgement of screw size, and metalwork positioning. Indeed, surgical expertise is a learned skill and every trainee has to climb the learning curve. The findings from this study emphasise the importance of comprehensive and structured orthopaedic training. Furthermore, teaching and training in a \u2018radiation safe environment\u2019 remain the responsibility of the trainer and the trainee both. It is very difficult to draw a line when a junior trainee becomes a senior trainee, and the learning curve resolves. However, the national training structure has been designed to it best to support the learning in a safe environment.It is, however, mandatory\u00a0that the fixation quality should not be compromised, even when making a concerted effort to reduce intra-operative radiation dosage. For that reason, it is recommended that a consultant always scrubs/supervise the surgery on patients with complex hip fractures, so as to provide experienced support to the trainee, helping achieve high-quality fixation, while reducing the amount of radiation administered to the patients and also to the operating room personnel.We acknowledge the limitations of a single centre, retrospective study with limited sample size. Nevertheless, this paper provides important information for the relationship between the seniority of a surgeon, the complexity of the hip fracture surgery, and the radiation exposure from the use of intra-operative fluoroscopic imaging. It is acknowledged that there will be some variation amongst individual surgeons, even if they are fully trained, as they will have different skills and steps that require the use of intra-operative imaging. However, this difference could be minimum because of the standard training structure. A larger multi-centre study involving even greater numbers of surgeons of varying experience will help reduce the effect of this confounding factor. Importantly, the experience of the radiographer is also crucial, with the assumption made those radiographers of experience will orient\u00a0themselves quicker and require fewer initial radiographs to find the anatomical landmarks.In conclusion, the quantity of intra-operative radiation dose utilised for surgical fixation of hip fractures is significantly associated with the grade and level of training of the operating surgeon and fracture severity type. The results of this study emphasise and support the importance of comprehensive, supervised, and structured orthopaedic training for in-theatre fluoroscopic radiation safety. It is recommended to have a safe balance between teaching, learning, and prevention of ionising radiation hazards in order to optimally achieve trainee\u2019s professional development with successful patient outcomes."}
+{"text": "Microbial keratitis is a leading cause of blindness worldwide and results in unilateral vision loss in an estimated 2 million people per year. Bacteria and fungus are two main etiological agents that cause corneal ulcers. Although antibiotics and antifungals are commonly used to treat corneal infections, a clear trend with increasing resistance to these antimicrobials is emerging at rapid pace. Extensive research has been carried out to determine alternative therapeutic interventions, and antimicrobial peptides (AMPs) are increasingly recognized for their clinical potential in treating infections. Small molecules targeted against virulence factors of the pathogens and natural compounds are also explored to meet the challenges and growing demand for therapeutic agents. Here we review the potential of AMPs, small molecules, and natural compounds as alternative therapeutic interventions for the treatment of corneal infections to combat antimicrobial resistance. Additionally, we have also discussed about the different formats of drug delivery systems for optimal administration of drugs to treat microbial keratitis. Pseudomonas aeruginosa and Streptococcus spp. along with Staphylococcus aureus, S. epidermidis, Serratia marcescens, and Haemophilus influenza , corneal infections are likely to cause 1.5\u20132\u00a0million new cases of blindness per year . The risnfluenza . In contupervene . Studiestoplasty .A. flavus , natural compounds, and small molecules in combating corneal infections. Additionally, we have explored the importance of drug delivery systems in delivering the therapeutics for the treatment of microbial keratitis.We used online literature databases like PubMed and Scopus for searching relevant research articles based on the specific keywords. The keywords used for search included \u201ckeratitis\u201d, \u201cantimicrobial resistance\u201d, \u201cantimicrobial peptides\u201d, \u201csmall molecules\u201d, \u201cdrug delivery systems for delivering antimicrobial drugs,\u201d and \u201cwound healing\u201d. The results were narrowed down by selecting articles relevant to the current review. The Food and Drug Administration (FDA) website was searched for the list of approved antimicrobial peptides in clinical use.S. aureus strains, including methicillin-resistant S. aureus (MRSA), are resistant to moxifloxacin  resistance  for clinical trials are listed in Antimicrobial peptides are a diverse group of small proteins that acts as the first line of defense and mounts an attack against invading pathogens. They are found to be evolutionarily conserved in the genome and synthesized by all forms of life . In natuynthesis . In mammynthesis . Due to ynthesis . AMPs arin vitro, but rarely in vivo. hBD-9 is expressed by corneal and limbal epithelia and corneal stroma at modest levels, whereas conjunctival epithelium shows the presence of high levels of hBD-9 protein (2+ and Zn2+) sequestration in the ocular surface inhibits fungal germination and growth, which requires these essential metals. These constitutively expressed AMPs have a major role to play in the prevention of infections and aids in host defense. Murine \u03b2-defensin 3  contributes to the clearance of P. aeruginosa in vivo and additionally limits P. aeruginosa adhesion to the corneal epithelial surface, thus suggesting that AMPs are also involved in maintaining normal resistance to infection in the healthy tissues (in vitro through mitogen-activated protein (MAP) kinase and NF-\u03baB pathways. Differential expression of several AMPs was identified in patients with P. aeruginosa and S. pneumoniae corneal infections  signaling in the infected corneas  and decreased fungus-mediated corneal disruptions in a mice model of keratitis . Pam-3 is also highly effective against A. baumannii resistant to the last-resort antibiotics, colistin and tigecycline. Additionally, Pam-3 was able to eradicate established biofilms formed by S. aureus and P. aeruginosa in vitro  protein, a cationic protein derivative has broad spectrum activity against many fungi, including Candida spp., C. neoformans, and A. fumigatus. Shorter synthetic peptides  which are derivatives of BPI protein domain III analogs act against Candida spp. When these peptides were used in combination with flucanozole, the minimum inhibitory concentration (MIC) of the antibiotic reduced up to 8-fold. The peptide XMP 391 was effective against murine-disseminated aspergillosis and enhanced the effectiveness of amphotericin B. The peptides ToAP2 (derived from venom of scorpion Tityus obscurus) and NDNP-5.7 also showed antifungal properties against C. albicans infection in which ToAP2 exhibited a broad spectrum of activity. These peptides show fungicidal nature by permeabilizing the cell membrane and invoked changes in cell morphology such as cell disruption 24-h posttreatment  and Cryptococcus neoformans 3K have recently been shown to cause cell wall thinning, loss of cytoplasm structure, formation of mesosome-derived multimembrane structures, and \"decorated fibers\" derived from DNA chains in . aureus  instead of fungi . As fungcharides . Anidulaergillus . Apart fergillus  are alsoergillus ; some liergillus  causes dergillus . Apart fergillus .During corneal infections, pro-inflammatory cytokines like IL-1\u03b2, IL-6, and tumor necrosis factor (TNF)-\u03b1 are released that triggers different signaling pathways leading to collagen degradation in the stroma as well as necrotic death of keratocytes. These inflammatory damages result in the thinning of corneal stroma followed by scar formation . StudiesS. aureus\u2013induced inflammatory damage by downregulating the expression of TLR2 and IL-8 in an ex vivo model of infection. Tempol , a membrane permeable molecule known to exhibit antioxidant activity, reduces the reactive oxygen and nitrogen species and enhances the catalytic activity of catalase /TSLP receptor (TSLPR) pathway  showed reduced corneal opacity caused by infectious keratitis  often protects corneas from microbial infections by killing the microbes; however, excess production of ROS induces corneal inflammation and results in irreversible corneal opacification and loss of vision . Antioxicatalase . Crupi ecatalase  used thicatalase . Quercetcatalase . Previoucatalase  and alsocatalase . Yin et catalase  reportedl stroma . Baicaleications . Zhu et ications  have rep pathway . Epigall pathway . Topicaleratitis . Vincamieratitis . AntioxiS. simulans, against S. aureus\u2013induced corneal keratitis. In vivo studies (rabbit models) displayed that lysostaphin treatment significantly killed more methicillin resistant S. aureus (MRSA) or methicillin sensitive S. aureus on the corneal surface and the corneal tissues than in vancomycin-treated or untreated eyes (P. aeruginosa and type 3 secretory system (T3SS) in Yersinia spp. \u2013induced corneal inflammatory damage. RvE1 treatment significantly reduced the production of chemokines and pro-inflammatory cytokines in HCEC, human neutrophils , murine cornea (CXCL1), and macrophages . Additionally, RvE1 treatment also reduced the neutrophil infiltrations into the corneal stroma and minimized corneal thickness and haze. RvD1 prevented the corneal inflammatory damage by reducing corneal infiltrates, edema, and production of inflammatory cytokines (IL-6 and CXCL1) along with inhibition of neutrophil recruitment (The omega-3 fatty acids like docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) exhibits anti-inflammatory activity by inhibiting the oxidation of arachidonic acid (AA), which prevents the production of pro-inflammatory molecules like leukotriene Bandin E2 . Resolviandin E2  to evaluruitment .Corticosteroids having anti-inflammatory activity are known to suppress inflammatory pathways in a wide variety of cells by downregulating the inflammatory genes . Cortico2+ influx that helped in proliferation of keratinocytes in a skin wound model  and poly-HEMA contact lenses for treating fungal keratitis. Econazole released from the contact lens efficiently inhibited the growth of C. albicans and displayed antifungal activity for up to three weeks. P. aeruginosa\u2013induced microbial keratitis in rabbit models  are transparent, concave-shaped devices directly placed on the ocular surface for correcting the refractive errors. Additionally, they are used as bandage for protecting the corneal epithelial layer, helping in healing, and sealing wound leaks . CLs arefied CLs . Kakisu fied CLs  reportedfied CLs . LbL coapidermis . Ciolinot models . In a hut models . Mel4, amaterial  and prevmaterial .in situ gels  for ocular application. In vitro studies showed the MXF released from the in situ gels inhibited bacterial growth of E. coli and S. aureus, whereas in vivo studies displayed that the gels were transparent and non-irritating with no ocular damage  to treat bacteria keratitis in rabbit models -block-poly(glycidyl methacrylate) (PEG-b-PGMA) to deliver natamycin for treating fungal keratitis  are new generation formulations of solid lipid nanoparticles, which are used as an alternative for conventional drug delivery. Candida albicans growth in the rabbit model and KT gels minimized the corneal inflammation caused by fungus (Aspergillus spp. .Nanotechnology bridges a barrier between the biology and physical sciences by developing nanostructure using synthetic or natural polymers to address various problems in the field of sciences . Nanocarye drops . Sayed eye drops  enhancederatitis . Drug-loget site . Ahsan en models . Lecithiulations . Shivam ulations  reportedy fungus . In anoty fungus  reportedCurrently, there is an alarming increase in antibiotic resistance and is considered as a global concern that requires more focused research to develop alternative therapeutic interventions to battle the growing trend. The AMR is increasing among ocular pathogens as well and impacting patient care to a large extent. The studies present in this review highlight the significant role of alternative therapeutics to combat increasing antimicrobial resistance and AMPs are explored widely and considered as the most potent new age therapeutics. The challenge has given us an opportunity to explore new antimicrobial molecules, repurpose existing molecules, explore alternative nonantibiotic therapies, and the drug delivery system that ensure concentration effective against drug-resistant pathogens. AMPs are one of the most potent alternatives that can be considered to fight antibiotic resistance as in addition to direct microbial killing activity, and it also plays an integral role in innate immune system. The small molecules targeting the virulence factors of the pathogens are also emerging as promising alternatives as they are not inhibiting microbial growth and generating selective pressure. These alternative interventions provide hope and feasible option for developing AMPs, small molecules, and natural compound analogues as future generation antimicrobials to combat antibiotic resistance."}
+{"text": "In \u201cPredicting Age Groups of Reddit Users Based on Posting Behavior and Metadata: Classification Model Development and Validation\u201d :e25807) the authors noted one error.In the originally published manuscript, one sentence under the \u201cPrincipal Findings\u201d section was incorrect. The following sentence appeared in the second paragraph of this section:The adult age group tended to have shorter comments than the adult age group.In the corrected version of the manuscript, this sentence has been changed to:The adolescent age group tended to have shorter comments than the adult age group.The correction will appear in the online version of the paper on the JMIR Publications website on April 30, 2021, together with the publication of this correction notice. Because this was made after submission to PubMed, PubMed Central, and other full-text repositories, the corrected article has also been resubmitted to those repositories."}
+{"text": "Left atrial dissection is a rare complication of cardiac surgery, most commonly associated with mitral valve surgery. Herein, we report on the successful conservative treatment of left atrial dissection while avoiding anticoagulation therapy.A 64-year-old man developed left atrial dissection during operation for acute type A aortic dissection, most likely due to retrograde cardioplegia cannulation. As there was no connection between the left atrial dissection cavity and the left atrium on enhanced computed tomography, we did not administer anticoagulants to prevent expansion of the left atrial dissection cavity. However, the patient developed atrial fibrillation, which was successfully managed by beta-blocker and amiodarone administration. Follow-up imaging showed gradual left atrial dissection reduction, and the patient was started on anticoagulation therapy.We were able to resolve left atrial dissection by preventing the use of anticoagulation therapy in the acute stage by managing the atrial fibrillation with antiarrhythmic drugs. Left atrial dissection (LAD) is a rare complication of cardiac surgery. Its clinical presentation and course vary widely, from asymptomatic to severe, the latter being fatal due to hemodynamic collapse. Herein, we report on successful conservative treatment while avoiding anticoagulation therapy in a case of LAD, most likely related to retrograde cardioplegia cannulation, during operation for acute type A aortic dissection (ATAAD).\u00ae 14Fr, Edwards Lifesciences Corp, Irvine, CA, USA). Cannula insertion for retrograde cardioplegia was smooth. The total cardioplegia dose was 20\u00a0ml/kg. The patient\u2019s body weight was 70\u00a0kg; accordingly, the total cardioplegia dose was 1400\u00a0ml. The retrograde cardioplegia dose was one-third of the total dose. Upon infusion, the injection pressure rose to approximately 70\u00a0mm\u00a0Hg, but it was momentary. We continued infusion after the pressure dropped to approximately 30\u00a0mm\u00a0Hg and cardiac arrest was induced. During cardiac arrest, there were no signs of LAD, and the presence of retrograde cardioplegia solution was confirmed in the coronary orifices. At CPB weaning (after aortic cross de-clamping), transesophageal echocardiography (TEE) showed a multivesicular space on the back of the left atrium that had no significant fistula with the left atrium  was established with bicaval drainage and left subclavian artery perfusion. We performed antegrade infusion for cardioplegia from the ascending aorta and retrograde infusion from the coronary sinus, inserting the cannula from the right atrial appendage. We always use a self-inflating retrograde cannula (RC014TThe patient was extubated on postoperative day (POD) 5. Amiodarone administration was discontinued on POD 29, and he was started on anticoagulation therapy with a direct oral anticoagulant. We used warfarin potassium, with the dose adjusted so that the INR was approximately 2. There was residual paroxysmal AF rhythm, but the patient was hemodynamically stable. Follow-up enhanced CT performed on POD 37 showed LAD reduction (Fig.\u00a0LAD is a rare complication of cardiac surgery, associated with mitral valve surgery in 0.16\u20130.84% of cases . Tsukui In conclusion, it is important to correctly diagnose LAD and detect any connection with another cavity. In cases where no connection is detected, conservative treatment can be considered. In addition, preventing the use of anticoagulation drugs might help resolve LAD; in cases of postoperative AF, it is useful to administer antiarrhythmic drugs."}
+{"text": "Live weight is an important indicator of livestock productivity and serves as an informative measure for the health, feeding, breeding, and selection of livestock. In this paper, the live weight of pig was estimated using six morphometric measurements, breed, weight at birth, weight at weaning, and age at weaning. In the present paper, we propose a comparative analysis of various machine learning methods using outlier detection, normalisation, hyperparameter optimisation, and stack generalisation to increase the accuracy of the predictions of the live weight of pigs. The StackingRegressor algorithm yielded a prediction quality of the live weight of Duroc, Landrace, and Yorkshire pigs that was higher than that of the state-of-the art algorithms.Live weight is an important indicator of livestock productivity and serves as an informative measure for the health, feeding, breeding, and selection of livestock. In this paper, the live weight of pig was estimated using six morphometric measurements, weight at birth, weight at weaning, and age at weaning. This study utilised a dataset including 340 pigs of the Duroc, Landrace, and Yorkshire breeds. In the present paper, we propose a comparative analysis of various machine learning methods using outlier detection, normalisation, hyperparameter optimisation, and stack generalisation to increase the accuracy of the predictions of the live weight of pigs. The performance of live weight prediction was assessed based on the evaluation criteria: the coefficient of determination, the root-mean-squared error, the mean absolute error, and the mean absolute percentage error. The performance measures in our experiments were also validated through 10-fold cross-validation to provide a robust model for predicting the pig live weight. The StackingRegressor model was found to provide the best results with an MAE of 4.331 and a MAPE of 4.296 on the test dataset. Live weight is an important indicator of livestock productivity and serves as an informative feature for the health, feeding, breeding , and selAlthough the direct weighing method provides the most accurate  results,In past studies, linear regression analysis was usually used to predict the live weight of pigs ,24,25; hThe objective of this paper is to study various machine learning methods ,28 for pWe show that machine learning methods can provide better results than traditional linear regression algorithms for predicting the live weight of pigs.By using outlier detection, normalisation, hyperparameter optimisation, stack generalisation, and cross-validation, pig live weight prediction was improved.The dataset and model for live weight prediction of Duroc, Landrace, and Yorkshire pigs can be downloaded for use by the livestock research community freely by following the link .The main contributions of this article are as follows:The animal experimental and data collection were approved by the Animal Care and Use Committee of the South Ural State Agrarian University and Federal Research Centre of Biological Systems and Agro-technologies of the Russian Academy of Sciences (01-14/758). All procedures and data collection in this study were conducted according to the Guidelines for Experimental Animals (Russia).This study used data from 340 Duroc, Landrace, and Yorkshire pigs kept on a private farm in the Chelyabinsk region of Russia. Traits associated with reduced live weight of pigs included weight at birth (kg), weight at weaning (kg), age at weaning (days), body length (cm), chest girth (cm), withers height (cm), chest depth (cm), chest width (cm), and metacarpus girth (cm). The weight of these pigs was measured with a scale and ranged from 86 to 113 kg. The distribution of pigs by breed was as follows: 231 Yorkshire, 72 Duroc, 37 Landrace. The age of the pigs was 6 months. They were all females at finishing stages. A histogram illustrating the distribution of the live weight by breed is shown in The six body measurements shown in Body length was measured at the middle of the occipital ridge along the upper straight line of the neck, withers, back, loin, and sacrum to the root of the tail using tailor tape.Chest girth was measured behind the shoulder blades by girdling the animal in a vertical plane tangent to the posterior angles of the shoulder blades using tailor tape.Withers height was measured at the highest point of the withers using a measuring stick.Chest depth was measured from the withers to the sternum vertically, tangent to the posterior angle of the scapula, using a measuring stick.Chest width was measured at the widest point of the vertical tangent to the posterior angle of the scapula using a measuring stick.Metacarpus girth was measured at the lower end of the upper third of the metacarpus using tailor tape.The estimated body measurements were as follows:z-score, InterQuartileRange, IsolationForest, LocalOutlierFactor, OneClassSVM, EllipticEnvelope. After extensive experimentation with normalisation algorithms, the z-score normalisation algorithm was chosen because it exhibited the best performance. The z-score normalisation algorithm calculates the z-score for each sample of data. The z-score is defined asx is the current sample value and u and s are the mean and standard deviation of all samples, respectively.Outlier detection as a preprocessing step was used to identify anomalies of rare samples that were suspicious because they differed significantly from most data points. The SciKit-Learn library (SKlearn)  providesThe features have different units and scales. To reduce this impact on the prediction results, the data should be normalised before training the model to make sure that each feature has the same order of magnitude.x represents the sample value, y is the normalised value of the feature.The following normalisation algorithms from the SKlearn library  were useWe studied all the machine learning algorithms from the SKlearn library . HoweverThe data were initially partitioned randomly into two parts: the training dataset (70%) and the test dataset (30%). Additionally, 20% of the training dataset were used for validation.Our experiments with the models involved testing various combinations of hyperparameters to find the optimal response. We used the GridSearchCV algorithm from the SKlearn library  to automEnsemble methods have greatly helped obtain a more powerful prediction based on combinations of many different machine learning models. There are various ensemble methods: averaging methods based on different weighted averaging algorithms, bagging, boosting, stack generalisation, and the special network StackNet. StackNet is a scalable meta-modelling methodology that utilises stacking to combine multiple models in a neural network architecture with multiple levels in parallel.Stacked generalisation or stacking is an ensemble machine learning algorithm . The advStacked generalisation uses a meta-learning algorithm to fit a combination of the prediction models. Stacked generalisation can combine the predictions from some models on the same dataset, such as boosting and bagging. In contrast to boosting, the stacking model uses a single model to fit a combination of the predictions from the models. In contrast to bagging, the stacking model is typically different and fits the same dataset. The stacking model consists of some base models and a meta-model that integrates the predictions of the base models. The outputs from the base models are used as the input to the meta-model. In the meta-model, the training dataset can be prepared using k-fold cross-validation from the base models and can also use the training dataset as the inputs to the base models, which can provide additional data to the meta-model to fit the best combination of the predictions from the meta-model. The base models are trained on the entire original training dataset, and the meta-model is trained on the prepared training dataset. Base models should be diverse and complex.Some evaluation criteria were used to estimate the performance of the models used in this study for predicting the pig live weight.n is the number of samples in the dataset, In this study, we examined various commonly used evaluation measures. We used the coefficient of determination (After preprocessing, 311 out of 340 samples remained after excluding outliers. We obtained the results of various evaluation measures used to evaluate model performance on the training and test datasets shown in We investigated different ensemble methods to achieve better predictions based on combinations of many different machine learning models Show in : the aveThe RidgeCV base model with two estimators yielded the optimal response for the BaggingRegressor model. The KNeighborsRegressor, LassoCV, and RidgeCV base models yielded the optimal response for the VotingRegressor model. The StackingRegressor model yielded the optimal response using LassoCV, KNeighborsRegressor, and LGBMRegressor base models and the CatBoostRegressor meta-model. We obtained the following results shown in The performance measures in our experiments were also validated by 10-fold cross-validation. The 10-fold cross-validation results for the StackingRegressor model using various evaluation measures are shown in It is of interest to note that the StackingRegressor algorithm yielded a prediction quality of the live weight of Duroc, Landrace, and Yorkshire pigs that was higher than that of the state-of-the art algorithms ,24,25,26This study employed various machine learning algorithms to predict the live weight of Duroc, Landrace, and Yorkshire pigs using body length, chest girth, withers height, chest depth, chest width, metacarpus girth, weight at birth, weight at weaning, and age at weaning. We found strong evidence of better performance for machine learning algorithms compared with the traditional linear model using various evaluation measures. The StackingRegressor model was found to provide more accurate pig live weight prediction, outperforming the traditional linear model. The results of the present study demonstrate that the StackingRegressor model can be used to predict pig live weight. Moreover, outlier detection, normalisation, hyperparameter optimisation, and stack generalisation algorithms can be used to increase the accuracy of predicting pig live weight. The findings of this study may help researchers and practitioners adopt machine learning algorithms for accurate live weight prediction using various morphological traits and other features. Since we used data from pigs with the weight ranging from 86 to 113 kg, the proposed model will be guaranteed to predict the weight of pigs in this range. We think that an indirect automated estimation of the live weight should be a non-invasive measurement of morphometric measurements based on computer vision, followed by live weight prediction using a machine leaning."}
+{"text": "During an infectious disease progression, it is crucial to understand the cellular heterogeneity underlying the differential immune response landscape that will augment the precise information of the disease severity modulators, leading to differential clinical outcome. Patients with COVID-19 display a complex yet regulated immune profile with a heterogeneous array of clinical manifestation that delineates disease severity sub-phenotypes and worst clinical outcomes. Therefore, it is necessary to elucidate/understand/enumerate the role of cellular heterogeneity during COVID-19 disease to understand the underlying immunological mechanisms regulating the disease severity. This article aims to comprehend the current findings regarding dysregulation and impairment of immune response in COVID-19 disease severity sub-phenotypes and relate them to a wide array of heterogeneous populations of immune cells. On the basis of the findings, it suggests a possible functional correlation between cellular heterogeneity and the COVID-19 disease severity. It highlights the plausible modulators of age, gender, comorbidities, and hosts\u2019 genetics that may be considered relevant in regulating the host response and subsequently the COVID-19 disease severity. Finally, it aims to highlight challenges in COVID-19 disease that can be achieved by the application of single-cell genomics, which may aid in delineating the heterogeneity with more granular understanding. This will augment our future pandemic preparedness with possibility to identify the subset of patients with increased diseased severity. Therefore, understanding the diversity of disease severity and clinical outcomes, requires uncovering the functional diversity of cells. The outcome modulation by this cellular heterogeneity can imply distinct functionality necessary during a diseased state for survival conditions  platforms have been critical toward this as they generate huge amounts of data . With buogeneity . During ogeneity .This article aims at highlighting the role of cellular heterogeneity across infectious disease, particularly the COVID-19. This includes the different levels of immune response defining the host\u2019s response with disease phenotype and correlation of the heterogeneous population of immune cells with COVID-19 disease severity and clinical outcome. It provides a compendium of insights on the possible clinical outcome of a disease from the cellular heterogeneity perspective, based on the clinical phenotypes.While understanding the infectious diseases, COVID-19 pandemic has surpassed the previous known global infectivity and is one of the major infectious diseases of the era. The single-stranded RNA virus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), causes COVID-19, which is a heterogeneous disease with a variable range of severity symptoms. The clinical presentation of COVID-19 varies from predominantly asymptomatic and mild-to-moderate episodes to more severe and critical, where 10%\u201320% of patients develop acute respiratory distress syndrome (ARDS) and pneumonia . AlthougThe COVID-19 disease severity sub-phenotype is categorized by World Health Organization (WHO) into asymptomatic, mild, moderate, severe, and critical, where there is a clear distinction based on clinical symptoms that they exhibit Table\u00a01 Although there is an increasing amount of knowledge on the host immune response to SARS-CoV-2 infection and the pathogenesis of COVID-19, it is still not apparent why some patients progress to severe illness, whereas others present\u00a0mild symptoms or are asymptomatic. Therefore, it is crucial to define the immunological and inflammatory components of SARS-CoV-2 infection in great detail. The rationale behind different clinical outcomes based on immune profiles of patients infected with similar viral strain could be possibly due to cellular heterogeneity Figure\u00a01The role of cellular heterogeneity is essential to understand the mechanism by which a complex network of billions of specialized immune cells functions in harmony and produces a coordinated host response against COVID-19. During a viral infection, there are two different layers of the immune system, i.e., innate and adaptive, which functions one after the other to restrict the entry of virus or prevent it from bypassing the host\u2019s immune system , 21. TheInnate immune cells carry pathogen recognition receptors (PRRs) on their surface that, upon viral entry, trigger inflammatory signals through recognition and binding of harmful viral particles that behave as pathogen-associated molecular patterns. On the other hand, intrinsic compounds, such as heat shock proteins, are released from viral-infected or damaged cells that act as damage-associated molecular patterns and activate innate immune and inflammatory responses by interacting with PRRs. Nucleotide-binding oligomerization domain, Toll-like receptors (TLRs),\u00a0C-type lectin receptors, a retinoic acid\u2013inducible gene I\u2013like receptors (RLRs),\u00a0and absent in melanoma 2\u2013like receptors are the most prevalent PRRs in the host . Among tThe innate immune cells are the primary target for successful SARS-CoV-2 infection . MacrophbrightCD16neg NK-cell subset majorly produces cytokines, and the CD56dimCD16pos NK-cell subset is characterized by strong cytotoxicity and high expression of inhibitory receptors such as killer cell immunoglobulin-like receptors.  composition between patients with severe and mild COVID-19. This was supported by an increased CD14+ monocyte population and decreased CD16+ non-classical monocyte, CD14+CD16+ monocytes, and DC2 in severe patients compared with mild patients and healthy individuals . Whereasceptors. . Among tseverity . In contseverity , which iseverity . Zheng eseverity . It can In contrast to the innate mechanism of host defense, the adaptive immune system exhibits specificity for its target antigen. Humoral and cellular immunity forms the adaptive or acquired immune response, where B and T lymphocytes, respectively, provide antigen-specific responses . The abiSu et\u00a0al. reported that, during COVID-19, several B-cell subsets, including naive B cells and antibody secreting cells, were elevated in severe patients, whereas memory B cells were increased in mild patients, suggesting a heterogeneous B-cell population across COVID-19 disease sub-phenotypes . Patientvia effector CD8+ T cells provides evidence of elevated cytotoxicity induced in severe patients  is present on the 3p21.31 locus and encodes the sodium\u2013imino acid (proline) transporter 1 (SIT1), which is known to interact with the ACE2 receptor  are one of the major players involved in antigen presentation to the lymphocytes, further activating the host immune response  of TMPRSS2 polymorphisms may serve as predictive model for COVID-19 severity  is of paramount importance in providing relevant information at single-cell resolution with the highest granularity that can aid in a comprehensive understanding of cellular immune response during COVID-19. Rather than using composites or averages from multiple cells, single-cell approaches offer a high-resolution perspective into these subsets and individual cells. Furthermore, multi-omics profiling of concurrent readouts from the same cell, including gene expression, cell surface proteins, and receptor sequences, enables more accurate and reliable characterization of these heterogeneous cell populations. From evidence within patients with COVID-19, where T-cell population is immensely variable, the single-cell profiling of T-cell subsets can be performed on a clinical cohort to understand insights of T-cell\u2013mediated response and T-cell receptor repertoire dynamics. Detailed characterization of both CD4+ T cells and CD8+ memory T cells using single-cell omics can be helpful in patient categorization and plausible future protection. Understanding from the perspective of genes involved in defining the particular cell states during severe COVID-19 can also help us to elucidate the role of cellular heterogeneity in disease severity. Single-cell omics approach will help address the unresolved query concerning cellular heterogeneity that may assist us in preparing for the future as the SARS-CoV-2 is continuously evolving with acquired immune escape capabilities.Understanding cellular heterogeneity in COVID-19 can be a cumbersome task as it comes with many challenges Figure\u00a04Author contribution KK has read the relevant literature, synthesized the findings, wrote the manuscript and made the figures. RP planned the study, wrote the manuscript, coordinated the manuscript outline, figures, conclusions and future challenges/opportunities. Both the authors contributed to the article, have read and approved the final submission.The study was supported by Bill and Melinda Gates Foundation (BMGF), INV-033578, Foundation for Innovative New Diagnostics (FIND), project code \u2013 GAP-0249, and AIDS Healthcare Foundation (AHF), project code CLP0043.KK acknowledges the fellowship from CSIR toward her salary support.The authors declare that the article was written in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Gastric volvulus\u00a0is a distinct and uncommon pathology that usually presents with vomiting secondary to gastric outlet obstruction and gastrointestinal bleeding with an association with hiatal hernia. We present a case of a 71-year-old female who presented to the emergency department (ED) with a three-day history of coffee ground emesis. Of note, the patient was recently in the hospital under medical observation two weeks prior, with similar complaints of hematemesis. Chest X-ray revealed a left basilar opacity representing bowel gas suggestive of a hiatal hernia. Intravenous proton pump inhibitors were initiated but due to persistent recurrence of symptoms and progressive discomfort, a computed tomography (CT) of the chest and abdomen was ordered. This revealed a partial gastric volvulus with signs suggestive of vascular compromise of the herniated part of the stomach. She subsequently underwent emergent laparotomy, repair of the hiatal hernia, and partial gastrectomy and gastropexy. Post-surgical biopsy findings showed focal mucosal necrosis and ulceration, focal foveolar hyperplasia, edematous changes, and overall congestion in the submucosal tissue. She was discharged five days later with no complications or recurrence of symptoms. Gastric volvulus is the twisting of all or a portion of the stomach by at least 180 degrees, resulting in a closed-loop obstruction that can result in complications, including but not limited to gastrointestinal (GI) bleeding .In an organoaxial gastric volvulus, the esophagogastric junction (EGJ) and the pylorus form an axis around which the stomach spins. The antrum revolves in the opposite direction from the stomach's fundus. In around 59% of instances , this kiHiatal hernias, a type of hernia in which abdominal organs (most often the stomach) migrate through the diaphragm into the middle compartment of the thoracic cavity, are an issue whose incidence increases with age. Approximately 60% of individuals aged 50 or older have a hiatal hernia [This article was previously presented as a meeting abstract at the 2021 ACG Annual Scientific Meeting on October\u00a027, 2021 [We present a case of a 71-year-old female with a history of hypertension, chronic alcohol abuse (about three beers every other day) with associated gastritis, and a recent upper GI\u00a0bleed who presented to the emergency department with a three-day history of coffee ground emesis. She reported taking non-steroidal\u00a0anti-inflammatory\u00a0drugs (NSAIDs) occasionally for aches and pains about once or twice per week. She denied any difficulty breathing, abdominal pain, weight loss, melena, altered consciousness, or a history of liver disease.The patient was recently in the hospital under medical observation two weeks prior with similar complaints of hematemesis. At the time, she had remained hemodynamically stable with no concerns over hypovolemia and her hemoglobin remained greater than 13, which was at her baseline. She ultimately would undergo an endoscopy that revealed a medium hiatal hernia without obstruction in the distal esophagus, acute moderate diffuse superficial gastritis of the antrum, and mild diffuse superficial duodenitis. The patient was discharged with instructions to continue taking pantoprazole daily and to follow up as an outpatient in two weeks as well as at that time obtaining a CT\u00a0of her abdomen. She admits she was non-compliant with any of these requests.While in the emergency department during this current presentation, her blood pressure was 175/89 mmHg, heart rate at 64 beats per minute, respirations unlabored at 18 breaths per minute while saturating 95% on room air, and afebrile at 98.0 F. On physical exam, she was found to be in mild distress but fully oriented, with no mucosal pallor, no cardiac murmurs, and no significant abdominal tenderness nor rebound as well as no abdominal. In addition, there was no palmar erythema, Dupuytren's contracture, or spider nevi. Laboratory findings showed hemoglobin of 16 g/dl, platelets of 233 k/uL, prothrombin time (PT) of 13.1s, international normalized ratio (INR) of 0.95, blood urea nitrogen (BUN) of 13, creatinine of 0.80, albumin of 5.1 g/dL, alanine aminotransferase (ALT) 24 Unit/L, aspartate aminotransferase (AST) of 30 Unit/L, alkaline phosphatase (ALP) of 116 Unit/L, Lactic acid 1.6 mmol/L, bicarbonate 34 mmol/L, and serum sodium 146 mmol/L.Chest X-ray, as seen in Figure Subsequently, intravenous proton pump inhibitors were initiated. Ultimately, due to her recurrent presenting symptoms and level of progressive discomfort, CT\u00a0of the chest and abdomen were ordered, illuminating partial volvulus with signs suggestive of vascular compromise of the herniated part of the stomach as seen in Figure She underwent emergent laparotomy, repair of the hiatal hernia, and partial gastrectomy and gastropexy. Post-surgical histopathological findings would show focal mucosal necrosis/ulceration, focal foveolar hyperplasia, edematous changes, and overall congestion in the submucosal tissue. Eventually, she was discharged five days later with no complications or recurrence of symptoms.Acute gastric volvulus is a distinct and uncommon pathology that usually presents with vomiting secondary to gastric outlet obstruction and GI bleeding related to mucosal vascular compromise and sloughing. It is imperative\u00a0to recall the association of a para-esophageal hiatal hernia with gastric volvulus during GI bleed evaluation, as it can ultimately lead to incarceration and potentially fatal strangulation of vital organs.Gastric volvulus in particular is characterized by rotation of the stomach along its long or short axis leading to variable degrees of gastric outlet obstruction, which may present acutely or chronically. Especially in chronic rotation of the stomach, decreased venous return can occur, which leads to increased capillary pressure owing to gastric bleeding as seen in this case. Mortality related to acute gastric volvulus\u00a0is high if unrecognized, underscoring the need for early diagnosis and treatment . The comThe initial diagnostic test to evaluate for volvulus of the stomach is typically plain radiography, which illustrates a single, large, spherical gas bubble located in the upper abdomen or chest with an air-fluid level . SometimAs held true in this case, the initial plain film of the patient\u2019s chest alluded to the diagnosis, but the extent of its consequence would need further elucidation with additional imaging modalities. Both types of images can show abnormal positioning of the stomach, but a CT scan offers additional visual insight into the relationship of the stomach to its surrounding structures. This can offer the added benefit of delineating anatomic abnormalities associated with secondary gastric volvulus. As evidence, in a study of 36 patients with acute gastric volvulus, barium swallow was diagnostic in only two of four patients, whereas CT scan diagnosed all 26 patients in which it was utilized .Management and treatment may differ slightly whether primary or secondary gastric volvulus is present but tend to both result in the need for gastric fixation or gastropexy after gastric reduction and de-rotation. If anatomical defects are present, it has been found to be prudent to repair these at the same time so as to avoid future recurrent volvulus. If tissue during this process is deemed to be nonviable then gastrectomy becomes warranted as well. Of note, poor surgical candidates have the alternative option of attempts at endoscopic de-rotation and gastric fixation with subsequent percutaneous endoscopic gastrostomy tube placement .Acute gastric volvulus is a distinct and uncommon pathology that usually presents with vomiting secondary to gastric outlet obstruction and gastrointestinal bleeding related to mucosal vascular compromise and sloughing. It is imperative for gastroenterologists to recall the association of para-esophageal hiatal hernia with gastric volvulus during gastrointestinal bleed evaluation, as it leads to incarceration and potentially fatal strangulation."}
+{"text": "Meanwhile, elevated alpha diversity, higher abundance of Flavonifractor, Ruminococcus, and Alloprevotella, as well as imbalanced functional pathways, were observed in the gut of SD mice. Moreover, the global patterns for the plasma metabolome were altered, e.g., the decreased butanoate metabolism intermediates in SD mice. In addition, disrupted metabolic homeostasis in the SD atrium, such as fatty acid metabolism, was analyzed by the transcriptome. These results demonstrated that the crosstalk between GM and atrial metabolism might be a promising target for SD-mediated AF susceptibility.This study examined the effect of sleep disturbance on gut microbiota (GM), atrial substrate, and atrial fibrillation (AF) inducibility. C57BL/6 mice were subjected to six weeks of sleep deprivation (SD) using the method of modified multiple-platform. Transesophageal burst pacing was performed to evaluate AF inducibility. Feces, plasma, and an atrium were collected and analyzed by 16s rRNA sequencing, liquid chromatography\u2013mass spectrometry (LC-MS)-based metabolome, histological studies, and transcriptome. Higher AF inducibility (2/30 of control vs. 15/30 of SD,  With the intensification of social production pressure, sleep disturbance has gradually become a common global issue. Sleep disturbance may lead to learning disabilities in children, memory impairment in people of all ages, and personality changes and depression ,2,3. It Recent studies found that sleep restriction can alter the gut microbiome and affect the gut barrier integrity, which leads to systemic, low-grade inflammation . MoreoveIn this study, we examined the effect of sleep disturbance on GM, atrial substrate, and AF inducibility in mice. A multi-omics approach was employed to evaluate the potential interaction among GM composition by 16s rRNA sequencing, features of GM-derived metabolites by untargeted LC-MS based metabolomics of plasma, and atrial transcriptomic profiles by transcriptome. In addition, AF inducibility was evaluated by burst pacing and histological examinations in mice following sleep deprivation (SD). We assumed that every 12 h of SD for 6 weeks might alter the GM composition, plasma metabolome, and atrial transcriptome of C57BL/6 mice, ultimately contributing to the altered atrial substrate and enhanced AF susceptibility.All animal studies (including the mice euthanasia procedure) were approved by the Animal Research Ethics Committee of Capital Medical University and conducted according to the ARRIVE guidelines and the EU Directive 2010/63/EU for animal experiments.Six- to eight-week-old male C57BL/6 mice were purchased from the Vital River Laboratory Animal Technology Company . All the animals were housed in an SPF environment with a temperature of 22 \u00b1 2 \u2103, relative humidity of 55 \u00b1 5%, and had free access to rodent chow and water. After seven days of adaption, mice were randomly assigned to the control and SD groups.SD was performed using the modified multiple-platform method ,26,27. TMeanwhile, the mice in the control group remained in their home cages in the SPF room. The mouse metabolism cage was used to collect the accumulated feces over a 24 h period on days 41 and 42; samples were then stored at \u221280 \u2103.Transesophageal burst pacing was performed after 6 weeks of SD intervention. Mice underwent anesthesia with 1.5\u20132% isoflurane, and electrodes were fixed on limbs to yield a surface II-lead echocardiogram (ECG). AF was induced via transesophageal burst rapid pacing with a 1.1-Fr octapolar catheter  . Each moUsing standard histological procedures, isolated atrial tissue samples were fixed in 4% paraformaldehyde and embedded in paraffin. Tissues were cut into 5 \u03bcm sections and subsequently stained with Masson\u2019s trichrome staining and Sirius Red to evaluate left atrial (LA) fibrosis and collagen, respectively. To detect lipid deposition in the atrium, the atrial section was prepared from the frozen atrium and stained with Oil Red O staining. Micrographs were captured by a Pixera Pro600EX camera on a VANOX-S microscope  and were analyzed using the ImageJ software (Version 1.8.0).The microbiota profile of collected fecal specimens was detected using 16s rRNA gene amplicons. Firstly, total DNA was extracted through the CTAB/SDS method, and then the purity and concentration of the extracted DNA were detected by agarose gel electrophoresis. The V4 region of gut microbial 16S rRNA was characterized by the Illumina NovaSeq platform (250 bp). Quality filtering on the raw tags was performed using the fastp (Version 0.20.0) software to obtain high-quality clean tags. The clean tags were compared with the Silva database using Vsearch (Version 2.15.0) to detect the chimera sequences, and the chimera sequences were removed to obtain effective tags. Then, amplicon sequencing variants (ASVs) were obtained according to QIIME2 or DADA2 analysis process, and ASVs with an abundance < 5 were filtered out. The Silva database was utilized for taxonomic annotation.\u00ae HSS T3 . The quality control (QC) sample was the equivalent mixture of all samples and was tested before, during, and after the sample injection based on LC-MS analysis. The chromatographic separation conditions included acetonitrile, 0.05% formic acid, and H2O as mobile phases, a column temperature of 40 \u00b0C, a flow rate of 0.3 mL/min, an injection volume of 5 \u03bcL, and an automatic injector temperature of 4 \u00b0C. The electrospray ionization (ESI) positive mode was operated using the following conditions: heater temperature was 300 \u00b0C, sheath gas flow rate of 45 arb, Aux gas flow rate of 15 arb, sweep gas flow rate of 1 arb, spray voltage of 3.0 kV, capillary temperature 350 \u00b0C, and S-Lens RF level set constant at 30%. However, in ESI negative mode, spray voltage and S-Lens RF levels were set at 3.2 kV and 60%, while other conditions remained the same as in the ESI positive mode. The metabolic data were achieved by a full scan form m/z 70-1050, and the data dependent-MS/MS (TopN = 10), with a resolution of 70,000 for MS and 17,500 for MS2, utilized high-energy collisions. All metabolomic data were prepared for feature extraction and preprocessed with Compound Discoverer 2.0 software (Thermo Fisher Scientific). Data were normalized and were then edited into a 2D data matrix by Excel 2010 software, using retention time (RT), compound molecular weight (compMW), observations (samples), and peak areas. A multivariate analysis was performed using SIMCA-P software . Compounds were significantly distinguished between groups, identified by a variable influence on projection (VIP) > 1 and p < 0.05 based on the peak areas. The exact molecular mass and ms/ms value of these compounds were used to identify the metabolites related to the featured peak in the Metlin, HMDB, and KEGG databases. Using the KEGG database, we annotated and evaluated differential metabolite-related metabolic pathways.A plasma sample of 60 \u03bcL was placed in a 1.5 mL EP tube, mixed with 180 \u03bcL methanol, vortexed for 30 s, and ultrasonicated for 30 min at 4 \u00b0C. Samples were then kept at \u221220 \u00b0C for 1 h and centrifugated at 12,000 rpm at 4 \u00b0C for 15 min. Then, 100 \u00b5L supernatant was collected and mixed with 2.5 \u03bcL DL-o-chlorophenylalanine (1 mg/mL). Finally, samples were analyzed using a liquid chromatography\u2013mass spectrometry (LC-MS)  equipped with an ACQUITY UPLCp-values were adjusted using Benjamini and Hochberg\u2019s approach for controlling the false discovery rate. A p-value < 0.05 and |log2(FoldChange)| \u2265 1 were set as the threshold for significantly differential expression. Then, clusterProfiler R package (3.8.1) was used to perform Gene Set Enrichment Analysis (GSEA) of KEGG based on differential expression genes. In addition, PPI analysis of differentially expressed genes was based on the STRING database. For the species that exist in the database, we built a network of the species in the database by extracting the list of target genes from the database. Otherwise, the Diamond software (0.9.14) was used to compare the target gene sequence with the selected reference protein sequence, after which the network was established according to the known interaction of the selected reference species. Meanwhile, KEGG pathways were obtained using String (https://string-db.org/), accessed on 1 March 2022, to identify signaling pathways enriched by overlapping genes.The RNA extraction, sequence, and library construction were completed at Novogene Biotech Co., Ltd. . Samples were sequenced by the Illumina NovaSeq 6000. The method was shown in Atrial tissue proteins were collected after lysis with RIPA buffer containing protease and phosphatase inhibitors and centrifugation at 13,000 rpm for 15 min at 4 \u00b0C. BCA assay kit was used to quantify the protein concentration following the manufacturer\u2019s instructions. Then, the proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted onto nitrocellulose membranes. Next, the membranes were blocked in 5% skim milk for 1 h and incubated overnight at 4 \u00b0C with primary antibodies against collagen I (Proteintech) and \u03b1-SMA (Proteintech). After incubation with secondary antibodies for 1 h, the membranes were detected using the Odyssey infrared imaging system  and analyzed by ImageJ software. GAPDH was used as an endogenous control.t-test was used to compare variable differences between the control and SD groups. Pielou evenness, Shannon index, and Chao1 richness were calculated with R software . Principal coordinate analysis (PCoA) was performed by the vegan and ape packages; all plots were visualized by the package ggplot2 in R software (version 3.3.3). Differential abundance of taxa and EC were determined using the t-test. Correlations among microbiota, plasma metabolites, and atrial transcriptomic features were tested using the Spearman test. All statistical tests were 2-sided, and p < 0.05 was considered statistically significant.The Student\u2019s n = 6) and control (n = 6) mice. Compared to control mice, SD mice were more susceptible to atrial arrhythmia (AF was seen 3/6 (50.00%) in SD mice vs. 0/6 (0.00%) in the control mice; p = 0.128) (p = 0.251) or diastolic (p = 0.178) blood pressure  A\u2013D. Meanpressure  and six-p < 0.001), and the collagen content assessed by Sirius Red exhibited a similar tendency (p < 0.001), which was accompanied by the increased expression of collagen I and \u03b1-SMA . The amplicon sequence variants (ASVs) accumulation curve was near saturation, which suggested that the sequencing data and the sample size were sufficient  phyla in the gut of AF patients [On the phylum level,  with SD F. Similapatients , an incrFlavonifractor, Ruminococcus, and Alloprevotella were higher, while the abundance of Erysipelatoclostridiaceae, Bifidobacterium, and Mucispirillum were lower in the SD group compared to the control group.On the genus level , the abut-test, p < 0.05), and the results indicated that processes associated with pyruvate fermentation to isobutanol, glycolysis, and fatty acid elongation were over-represented in the bacteria of the SD group, while the function related to purine, pyrimidine and guanosine was over-represented in the control group . The orthogonal partial least squares\u2013discriminant analysis (OPLS-DA) score plots showed a distinct separation in ES+ and ES\u2212 modes  were performed. The atrium transcriptome of SD mice was different from the controls. A distinct separation was acquired from principal coordinate analysis (PCoA) A, which Next, the GSEA analyses based on DEGs were performed to evaluate the responded functional pathway under the intervention of SD. Thirty-three KEGG pathways were annotated in SD ; 16 pathAcox1 , Acsf3 , Hadha , Ehhadh , Mmut , Abat , Bckdha , Pcca , Aldh1b1 , and Acat2   G, might Meanwhile, the GSEA analyses about the Gene Ontology (GO) based on DEGs were carried out to explore the impact of SD on the atrial biological process (BP). Overall, 222 GO-BP were acquired , and 12 Ank2, Ctnna3, Dsc2, Dsg2, Dsp, Gja5, Hcn4, Ryr2, Scn5a, and Kcnq1, were annotated in multiple GO-BPs  was performed . OverallThe present study demonstrated that SD exposure for 6 weeks increases AF susceptibility in mice. It also aggravates fibrosis, collagen, and lipid accumulation in the atrium, alters GM, leads to microbial function imbalance, alters various primary metabolomic pathways in plasma, and disrupts metabolic homeostasis in the atrium. These results demonstrated that the crosstalk between GM and atrial metabolism might be the potential promising target for SD-mediated AF susceptibility.Ruminococcaceae UCG-002 and Ruminococcaceae UCG-003 are the main genera mediating the positive association between chronic insomnia and cardiometabolic diseases [Ruminococcus was identified in the current SD mice, and the potential mechanism mediating the impact of gut microbes on the atrial substrate should be further investigated.AF, as the most common arrhythmia in clinical practice, has been associated with increased morbidity, mortality, and healthcare burden . Recent diseases . NotablyOther studies found that disrupted adaptability to sympathetic nerve excitement and excessive norepinephrine secretion during sleep restriction enhance myocardial contractility and increase conduction speed and oxygen consumption, thus further aggravating the load on the heart ,42. FurtIn this study, we further examined the effect of SD on atrial histological changes, gut flora composition, plasma metabolic spectrum, as well atrial transcriptomic deciphered in a mouse model. The association between chronotype and GM has been recently recognized. Triplett et al. examined temporal and region-specific effects of sleep fragmentation on GM and intestinal morphology in Sprague Dawley rats, finding that both acute (6 days) and chronic (6 weeks) sleep fragmentation (SF) in rats, induces GM dysbiosis, accompanied by increased crypt depth in the distal ileum and an increase in the number of villi lining. In addition, chronic SF induces decreased microbial adhesion and penetration in the distal ileum and cecum . EmerginBesides the direct effect of GM-mediated sleep disturbance-induced disease progression, newly emerging data demonstrate that microbiota has circadian rhythmicity, which is tightly interrelated to the host circadian rhythm . AlteredSCFA was detected in the current multi-omics analyses in the aspects of metabolic pathways such as butanoate metabolism, propanoate metabolism, as well as acetate-included pyruvate metabolism, and glycolysis /gluconeogenesis. SCFA, the metabolite derived from gut microbial fermentation, is an important factor in the microbiota\u2013gut\u2013brain axis and circadian rhythms, acting on multiple mechanisms, including modulating the host metabolism . SpecifiEhhadh, Acox3, and Acox1, were found to be at the crossroads of multiple pathways which might act as a coordinator. For example, Ehhadh, Enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase, regulated and mediated by PPAR\u03b1, encodes a bifunctional enzyme protein essential for the peroxisomal \u03b2-oxidation pathway for the breakdown of very long chain fatty acids and indispensable for the production of medium-chain dicarboxylic acids [Ehhadh in the SD group\u2019s atrium might be associated with altered fatty acid metabolism and pathologic remodeling [Acox3 (acyl-Coenzyme A oxidase 3) and Acox1 (acyl-Coenzyme A oxidase 1) are essential genes related to \u03b2-oxidation; therefore, the decreased profiling promotes the disturbed metabolism of the myocardium, which is consistent with the findings from diabetic cardiac microvascular endothelial cells [Notably, lipid accumulation in the atrium was identified in the current study. The heart is an energy-demanding organ relying on fatty acid (FA) and glucose oxidation. A failing heart usually shows impaired transcription of key enzymes involved in FA metabolism and impaired mitochondrial oxidative function ,61,62. Cic acids . Thus, tmodeling . Furtheral cells .The present study still has some limitations. First, the current study confirms correlation but not causation. Thus, further studies with fecal transplantation might provide a stronger conclusion explaining AF-induced GM dysbiosis and the progression of AF. Furthermore, quantifying plasma and myocardial triglycerides and free fatty acids levels, as well as myocardial lipidomic, might provide more information about altered lipid profiles in the SD atrium. Moreover, further experiments on optical and electrical mapping, atrial refractoriness, and patch clamp-based ion channel studies are needed to assess the impact of SD on the electrophysiological features of the atrium and atrial myocardial cells. In addition, further studies are required to explore whether supplementation of SCFA to SD mice could alleviate the concomitant atrial remodeling and protect from AF. To sum up, our data suggest that SD leads to enhanced AF inducibility and atrial injury, especially lipid accumulation, accompanied by alterations in GM structure, circulating metabolomics, and atrial transcriptomic patterns. These results provide preliminary evidence that the crosstalk between GM and atrial metabolism might be the potential promising target for sleep disturbance-mediated AF susceptibility. Yet, more research is needed to further confirm these findings."}
+{"text": "VHL syndrome is an autosomal dominant hereditary cancer syndrome and one of the leading causes of death is ccRCC. Current target therapies may lead to stable disease or partial remission, as best response and scant evidence supports the therapeutic decision-making in metastatic ccRCC. Therefore, new genetic and epigenetics insights are needed, to guide the development of more effective target therapies and to promptly predict the presence and prognosis of ccRCC. Our review highlights all the new molecular perspectives based on research of genetic alterations, biological pathways and promising biomarkers in the VHL-associated hereditary ccRCC.Von Hippel-Lindau (VHL) disease is an autosomal dominant inherited cancer syndrome caused by germline mutations in the VHL tumor suppressor gene, characterized by the susceptibility to a wide array of benign and malign neoplasms, including clear-cell renal cell carcinoma. Moreover, VHL somatic inactivation is a crucial molecular event also in sporadic ccRCCs tumorigenesis. While systemic biomarkers in the VHL syndrome do not currently play a role in clinical practice, a new promising class of predictive biomarkers, microRNAs, has been increasingly studied. Lots of pan-genomic studies have deeply investigated the possible biological role of microRNAs in the development and progression of sporadic ccRCC; however, few studies have investigated the miRNA profile in VHL patients. Our review summarize all the new insights related to clinical and molecular features in VHL renal cancers, with a particular focus on the overlap with sporadic ccRCC. VHL disease is a rare inherited cancer syndrome, with a birth incidence between 1/27,300 and 1/45,500 live births, and a prevalence rate ranging between 1/39,000 and 1/91,000 individuals [Von Hippel in 1904 and Lindau in 1927 were among the first to describe some features of VHL disease  ,6. VHL dVHL disease has diverse genotype and phenotype correlations, and variable intra- and inter-familial expressivity ,11,12.VHL disease can be classically divided into various types and subtypes according to the presence or absence of Pheo and ccRCC susceptibility: type 1 is the most common, it often displays deletions or truncating mutations and does not predispose to the development of Pheo; on the contrary, type 2 disease (7\u201320% of families) exhibits missense mutations and Pheo susceptibility ,14,15. TSince affected families can shift between subtypes over time, the clinical utility of this classification is limited . Liu et First diagnostic criteria\u20141964: patients with no family history of VHL disease and two related tumors , or with family history and at least one VHL-related tumor .Careful family history and screening for other VHL-related tumors, in all patients who undergo hemangioblastoma genetic testing for VHL disease, is recommended .Genetic testing on peripheral blood samples should be offered to all clinically suspected cases. Southern blotting (SB) is usually used to detect whole gene deletion and gene rearrangements, and fluorescence in situ hybridization has a consequent confirmatory role, but multiplex ligation-dependent probe amplification can be alternatively used instead of SB. In patients with a negative result on peripheral blood, genetic testing can be repeated by sampling other tissues .In established cases, a comprehensive screening program is recommended, while with regard to ccRCC, an annual abdominal MRI starting from the ages of 10\u201316 years of age is of paramount importance. An annual abdominal ultrasound is a complementary technique, while abdominal CT is reserved for clinical scenarios in which MRI is contraindicated ,22,23. SIn VHL disease, tumor susceptibility is underlain by genetic abnormalities behaving as tumor suppressor genes, causing a dysfunctional VHL-Hypoxia Inducible Factor (HIF) pathway, according to the 2-hit hypothesis for the development of cancer and Knudson\u2019s theory of human carcinogenesis ,25. The However, in about 20% of affected families, no VHL deletion or mutation is detectable . VHL disNotably, VHL loss of function is not sufficient for ccRCCs to develop, ,33 sinceA disrupted VHL pathway leads to dysfunctional ubiquitination of the VCB-Cullin 2-RBX1 (VCB-CR) complex and consequently to the constitutional activation of the HIF pathway and, finally, to subsequent alterations in downstream processes, mediated by abnormally expressed carcinogenic factors ,36,37. AThe VHL locus was first cloned and mapped between the late 80s and early 90s, while the VHL gene was identified in 1993 ,40. The pVHL binds elongin C and elongin B to form the VCB complex , stabiliIn VHL-wild type patients in normoxic conditions, the VCB-CR complex is able to bind to prolyl hydroxylated hypoxia-induced factor 1\u03b1 (HIF1\u03b1), while with hypoxia, this binding is prevented by the lack of hydroxylation of HIF1\u03b1 by prolyl hydroxylase 1, 2 and 3, inactivated by the lack of their co-substrate: oxygen ,48.In VHL disease, the loss of function in the VCB-CR complex prevents its binding to the ubiquitous unstable subunit HIF1\u03b1, which subsequently heterodimerizes with the stable HIF1\u03b2 to form HIF1, which translocates to the nucleus and acts as a transcription factor binding the hypoxia-response elements, leading to the constitutive activation of expressed downstream effectors that would physiologically be activated only in hypoxic conditions. HIF is a key driver of ccRCC progression and might be a tumor suppressor, directly contributing to tumorigenesis ,49,50.Some of the most relevant downstream effectors are TGF\u03b1, EGFR , PDGFB , the chemokine receptor CXCR4 and MMP2/9/14 and lysyl oxidase, UPAR, MMP2 , dysregulation of TWIST and activation of HGFR , VEGFA (angiogenesis) ,51.HIF2\u03b1 is a subunit isoform peculiarly expressed only in the endothelium, lung, liver, and kidney cells, activated in hypoxia, that can heterodimerize with a \u03b2-subunit (HIF1\u03b2) to form HIF2, which displays a slightly different spectrum of downstream effects compared to HIF1, preferentially driving growth and angiogenetic processes . HIF2, mpVHL also has HIF-independent functions  that could, theoretically, influence tumorigenesis, however, its contribution is currently unknown ,61,62,63The genetic abnormalities in sporadic ccRCC are similar to those observed in VHL disease, i.e., loss of 3p25, and VHL mutations are present in 60\u201390% of patients .VHL mutations are typically frameshift or nonsense mutations, but missense mutations may be observed . EpigeneSporadic ccRCCs display mutation heterogeneity, with different subclones harboring different anomalies. In progressively smaller subclones, genetic abnormalities are named ubiquitous , shared, and private .VHL mutational status does not predict oncologic outcomes in sporadic ccRCCs since mixed results have been reported. Masahiro et al. reported a strong association between VHL alterations in sporadic ccRCC and better cancer-free survival and cancer-specific survival in non-metastatic disease treated with radical nephrectomy (RN), particularly in stage III patients . On the Gordan et al. reported an alternative classification of sporadic ccRCC based on the VHL allele, HIF1a, HIF2a, and MYC expression, recognizing three different molecular subgroups: VHL WT , H1H2  and H2 tumors  .The prognosis could be improved by performing a genetic diagnosis and careful follow-up . Before Especially in advanced diseases, the prognosis remains poor. The incomplete understanding of VHL tumorigenesis slowed down the development of a rich target-therapy arsenal . HoweverA poor prognosis is associated with advanced-stage disease, which implies a limited response to chemotherapy and radiotherapy, but a better response to immunotherapy, biologics, or target therapy .Early-onset disease, a positive family history, and truncating VHL mutations are associated with reduced overall survival and disease-specific survival , and femRisk factors for overall survival in VHL disease also include truncating mutations, type 1 disease, presence of CNB or RHB rather than abdominal lesions  .Several molecular pathways are involved in tumorigenesis and, consequently were investigated as possible therapeutic targets in this population, especially multiple tyrosine kinase inhibitors (TKis) linked to key downstream effectors. However, it was only recently that another class of drugs proved to be active and well tolerated in VHL patients, leading to FDA approval of the HIF-2a inhibitor Belzutifan .ccRCC is acknowledged as a Renal Cell Tumor by 2016 WHO Classification of kidney tumors , represeVHL syndrome is the oldest and most common hereditary RCC syndrome, among at least twelve known entities .Hereditary cancer syndrome of the kidney represents 5\u20138% of cases . In a stVHL disease predisposes to the development of renal cysts and ccRCCs, and a single individual can present with multiple lesions . A natioccRCC will develop in 30\u201370% of patients with VHL-disease ,23,87. TIn VHL patients with ccRCC, the 10-year disease-specific survival rate is 95% . The oveHereditary VHL-related ccRCCs display earlier onset and multifocal and bilateral tumors : NeumannThe metastatic rate is around 11%, lower than for sporadic ccRCCs , and it VHL disease displays a high rate of recurrence ; PloussaDiagnosis is often delayed due to the asymptomatic nature of the tumors, thus typical signs and symptoms of RCC, such as visible hematuria, flank pain, and palpable flank mass or masses are indicative of more advanced disease .Unlike in the screening setting, the first-line diagnostic technique in a suspected case of RCC is contrast-enhanced abdominal CT to characterize the location, number, size, and appearance of solid lesions .The predominant histotype in VHL disease is ccRCC. A series on renal pathology in VHL disease showed that 91% of solid neoplasms in surgical specimens were ccRCCs, with different cytological features . The architectural pattern was typically trabecular, with a minority of cases displaying a microcystic pattern. The renal masses were all well-circumscribed, and a pseudocapsule (PSC) frequently surrounded the neoplasm. In this series, PSC microscopic invasion was present in 76% of cases, with no invasion of the surrounding parenchyma . The neoUS is not a sensitive enough technique to characterize RCCs and, when used alone, is outperformed by MRI and CT .The Bosniak system classification is useful for describing cystic lesions in VHL disease, but since small foci of dysplasia or RCC can harbor in these lesions, it should not be used to guide management in this population of patients, unlike in sporadic ccRCCs .A national audit of VHL disease showed that MRI was the most common detection modality, followed by CT and ultrasonography, especially for bigger lesions . MRI is VHL has a saltatory growth pattern, with quiescent phases, that complicates the interpretation of imaging findings as treatment-response or natural quiescence . A summaVHL mutations are ubiquitous, early, truncal events in ccRCCs .Jonasch et al. found an association between the molecular abnormalities underlying ccRCCs and their timing and subdivided them into those that drive tumor initiation events , tumor progression  and those that confer lethality  .ccRCCs are hypervascular tumors, and the main driving factor in tumor progression is represented by HIF overexpression and upregulated downstream effectors, above all VEGF . The endccRCCs typically display large neoplastic cells, featuring an abundant, clear cytoplasm rich in glycogen and lipids, derived from a high glucose metabolism that, in VHL-null ccRCCs, can possibly be linked to the increased expression of an HIF downstream effector (the adipose differentiation-related peptide) acting as a lipid transporter . A schemIn the last decades, the implementation of genetic testing and the improvements in screening protocols have led to better clinical outcomes. The aim is to detect RCCs before the development of metastatic disease and to approach renal masses with nephron-sparing surgery so as to maximally preserve renal function. In view of the multifocal and bilateral disease presentation, the high recurrence rate, and the limited number of possible nephron-sparing surgical interventions because of their effects on renal function, tailored and careful surgical planning is of paramount importance.Regarding target therapy, a recent phase II study of HIF-2a inhibitors in ccRCCs documented objective partial responses in 30 of the 61 enrolled patients, stable disease in 30 patients, and only one case of disease progression after a median follow-up time of 21.8 months . The invLesions with a maximum diameter of less than 3 cm are usually treated with a surveillance protocol. The VHL alliance recommends repeating abdominal MRI every 3 to 6 months to assess tumor growth. In case of disease stability over 3 consecutive MRIs, the interval between scans can be extended to 2 years. On the contrary, if a lesion is greater than 3 cm, a urologic referral is mandatory Walther et al. investigated the 3 cm threshold as an indication for surgery; smaller tumors (group 1) underwent imaging surveillance and eventual surgery when the threshold was reached, while larger tumors (group 2) were immediately resected. After 60 months, no group 1 patients developed metastatic disease and only one required surgery, while after a 66-month follow-up, 12 of 44 group 2 patients required nephrectomy, and 11 of 44 progressed to the metastatic stage .Surgery is the standard of care when dealing with >3 cm lesions, although the recent approval of Belzutifan in this setting has enriched the therapeutic arsenal and can be offered as an alternative choice. Belzutifan approval is based on the NCT03401788 trial, which included individuals with renal masses ranging from 10 to 61mm with no evidence of metastatic disease . It is nA maximum renal mass diameter greater than 3 cm is associated with an increased risk of metastatic disease, although VHL-related ccRCCs tend to have limited local invasiveness and histologic grade ,105. RadSteinbach et al. reported similar 5- and 10-year disease-specific survival rates for RN  and NSS . Moreover, the NSS group had 5- and 10-year recurrence-free survival rates of 71% and 15%, 51% displayed postoperative local recurrence, and only 2 of 49 patients progressed to metastatic disease. Finally, 23% developed ESKD, 6 of 15 were managed with renal transplantation, and 9 with dialysis . BratslaSome investigators suggested adopting a 4 cm threshold to guide the treatment of renal masses in VHL disease, in an effort to maximally preserve the quality of life, renal survival, and overall survival .A nationwide Japanese survey found that 203 VHL disease patients were affected by RCC (50.3%). Partial nephrectomy was performed in 46% of cases, radical nephrectomy in 31%, radiofrequency ablation (RFA) in 14%, and in 44% of cases two or more interventions were necessary. An increased number of surgeries correlated with a decrease in eGFR. The 10-year cancer-specific survival rate was higher than in non-VHL disease patients, reaching 95% . In a UKWhen NSS is not feasible or does not prevent ESKD, renal replacement therapy is usually needed. Goldfarb et al. specifically investigated the clinical outcomes in VHL patients who underwent RN, developed ESKD, and received a renal transplantation, and compared the data with a control group of non-VHL transplanted patients. They reported that graft survival, patient survival, and renal function were similar between the two groups, supporting the safety of RT in VHL disease .Surgery is usually not necessary for smaller than 3cm lesions due to the low grade and low metastatic rates , while lAlthough smaller lesions are usually managed by close surveillance or Belzutifan, ablative techniques such as percutaneous RFA are increasingly being investigated for the treatment of <3 cm lesions, because of their efficacy and low complication rates . CryoablPloussard et al. investigated clinical outcomes in VHL patients treated with NSS. At 5- and 10-year intervals, the respective local recurrence rates were 45.6% and 83.7%, while the respective overall repeat surgery rates were 23.1% and 63.4%. The mean time to local recurrence was 53 months. The 10-year disease-specific survival rate was 93.8% and none of the NSS-treated patients progressed to CKD or developed metastatic disease .Currently, only scarce to moderate evidence guides therapeutic decision-making in the setting of metastatic VHL-related ccRCCs, and data are mostly extrapolated from the treatment approach to its sporadic counterpart. Metastatic RCCs are treated with target-therapy agents, mostly tyrosine-kinase inhibitors targeting VHL disease pathways, particularly the VEGF, PDGFR, and FGFR pathways. These agents include Semaxanib, Sunitinib, Pazopanib.Complete radiologic and metabolic response of a metastatic RCC was reported after 11 administrations of Semaxanib, a tyrosine-kinase inhibitor that selectively targets VEGF .Sunitinib is the most studied drug in VHL-related advanced RCC, and the main application is for palliative purposes, although complete remissions have been reported.Several trials have demonstrated disease stability, partial response, and even complete regression  in metasPazopanib is a 1st generation inhibitor of multiple tyrosine kinases , approved for the palliative treatment of advanced RCC, seemingly with greater efficacy than sunitinib, albeit its use is supported by fewer and more inconsistent data ,123.Dovitinib is a multiple TKi; it is currently being studied for use in metastatic carcinoma, and the best response was found to be a stable disease for CNS hemangioblastomas .Sorafenib is a multiple TKi; partial response in two patients was documented in patients with multiple small RCCs .Although HIF2a inhibition has a strong biological rationale for the inhibition of an upstream abnormal target rather than one or more downstream effectors , to dateEven though the diagnosis of VHL syndrome is related to a well-known list of clinical and genetic features, as mentioned in the previous paragraph, the need for new molecular biomarkers able to predict the development and the aggressiveness of renal neoplasms in the VHL syndrome remains crucial in the oncological and nephrological panorama. In fact, one of the main problems related to VHL patients is represented by the multiple growths of ccRCC inside both kidneys, leading to multiple and consecutive surgical and radiological operations, when it is feasible . As a reSo, miRNA expression levels can distinguish VHL-associated tumors from sporadic ccRCC even though most differentially expressed miRNAs were similar between the two tumor groups . FurtherUnlike research studies on the genetic bases of VHL disease, research studies on the transcriptome and non-coding RNA profiles on both liquid and solid biopsies are very scarce or absent in the context of VHL-associated hereditary ccRCC. The discovery of new biomarkers able to guide diagnosis, local or systemic therapy, and follow-up of VHL patients affected by ccRCC are urgent clinical needs. Given that non-coding RNA are emerging new molecular biomarkers for a plethora of diseases, including ccRCC, and could be promising therapeutic targets, preclinical and clinical research on the topic must be encouraged to improve the management of VHL patients."}
+{"text": "Wolbachia (wMel-strain) into the Aedes aegypti mosquito population. We analysed 318 serotyped and geolocated dengue cases (and 5921 test-negative controls) from a randomized controlled trial in Yogyakarta, Indonesia of wMel deployments. We find evidence of spatial clustering up to 300\u00a0m among the 265 dengue cases (3083 controls) in the untreated trial arm. Participant pairs enrolled within 30\u00a0days and 50\u00a0m had a 4.7-fold increase  in the odds of being homotypic  as compared to pairs occurring at any distance. In contrast, we find no evidence of spatiotemporal clustering among the 53 dengue cases (2838 controls) resident in the wMel-treated arm. Introgression of wMel Wolbachia into Aedes aegypti mosquito populations interrupts focal dengue virus transmission leading to reduced case incidence; the true intervention effect may be greater than the 77% efficacy measured in the primary analysis of the Yogyakarta trial.Dengue exhibits focal clustering in households and neighborhoods, driven by local mosquito population dynamics, human population immunity, and fine scale human and mosquito movement. We tested the hypothesis that spatiotemporal clustering of homotypic dengue cases is disrupted by introduction of the arbovirus-blocking bacterium  The four serotypes of dengue virus (DENV) are transmitted between humans primarily by the Aedes aegypti mosquito, a species that thrives in urban settings where breeding sites and human blood sources co-exist in close proximity. These bionomic factors make households a primary location for DENV transmission risk and the focal nature of DENV transmission has been well observed6.Dengue places seasonal pressure on healthcare systems and public health resources throughout the tropical and subtropical world, with an estimated 100 million cases globally each year. The disease burden is growing in both case load and countries affected2 demonstrated highly focal DENV transmission among children residing within 100\u00a0m and 15\u00a0days of an index case. A retrospective analysis of serotyped dengue cases in Bangkok5 showed spatial dependence in both homotypic (same serotype) and heterotypic (different serotype) dengue cases at different time scales, reflecting complex interactions between local population immune profiles and dengue transmission. Local mosquito population dynamics, and human population density, immunity and mobility9 are understood to be key determinants of these patterns. Peridomestic space spraying of insecticide is a mainstay of dengue control efforts in endemic settings, and the observed focal clustering of dengue cases provides a rationale for the common approach of targeted reactive insecticide spraying around the immediate neighbourhood of one or more notified dengue cases. The temporal scale of focal dengue transmission is important here, however, with some studies finding serological evidence for clustering of recent DENV infections but no excess of acute, prospectively-detected DENV infections10, suggesting limited opportunity for reactive efforts to interrupt chains of transmission after detection of an index case. A lack of evidence for the efficacy and optimal implementation of conventional approaches to Aedes control12 together with the challenge of sustaining these activities at scale and over the long term13, helps explain the ongoing occurrence of dengue outbreaks worldwide in spite of the efforts of vector control programs.The temporal and spatial scale at which dengue case clustering occurs is informative about both the underlying transmission dynamics and the opportunity to intervene and interrupt transmission. A prospective index-cluster study in rural ThailandWolbachia, a naturally occurring bacterium that is common in insect species but absent from Ae. aegypti. Wolbachia (wMel-strain) infection of Ae. aegypti has been shown in the laboratory to reduce their transmission potential for dengue, chikungunya, Zika and Yellow fever viruses18 and releases of wMel-Ae. aegypti have resulted in successful introgression of wMel into Ae. aegypti populations in the field19. Accumulating field evidence from randomized and non-randomized wMel deployments demonstrates a significant reduction in the incidence of dengue and other Aedes-borne diseases in communities where wMel has been established at a high level23. In a recent randomized controlled trial in Yogyakarta, Indonesia, , the incidence of virologically-confirmed dengue cases was 77% lower in neighbourhoods where wMel was successfully introgressed into local Ae. aegypti compared to areas that did not receive wMel deployments23. The cluster randomized design of the AWED trial, with wMel deployment into 12 of 24 contiguous clusters  were resident in one of the 12 wMel-treated clusters and the remaining 318 (83%) were resident in untreated clusters  enrolled in the AWED cluster randomized trial of wMel-treated clusters and 3083 (52%) in untreated clusters. The map in Fig.\u00a0Among the 5921 participants with test-negative illness, 2838 (48%) were resident in For a more granular view of the spatial distribution of dengue cases and test-negative controls, kernel smoothing was used to visualize the spatially-varying test-positive fraction Fig.\u00a0C. ConsiswMel is of primary interest, but directly inferring chains of transmission is difficult. We instead assume that pairs of homotypic (same serotype) dengue cases enrolled in the AWED study with illness onset within 30\u00a0days of each other are potentially transmission-related, whereas pairs of heterotypic (different serotype) dengue cases or test-negative controls within the same space-time window are assumed not to be transmission-related. We compare the spatial distributions of these two populations of participant pairs as an indicator of spatiotemporal dependence in DENV transmission.Understanding the dynamics of DENV transmission in the absence and presence of 27. This measure captures the overall tendency of homotypic dengue cases to occur within specified space-time windows above and beyond that observed in the enrolled study population due to secular factors such as healthcare-seeking behaviour and environmental conditions  observed within 30\u00a0days of each other in cluster 10. In contrast, five of 11 untreated clusters returned point estimates of spatiotemporal dependence within 50\u00a0m of an index residence that appear inconsistent with the null hypothesis of no spatiotemporal dependence. For the untreated arm overall, spatiotemporal dependence was estimated to exceed what would be expected under the null hypothesis up to a distance of 300\u00a0m, with the greatest relative odds of a homotypic case occurring for enrolled individuals with residences within 50\u00a0m of an index case , there is evidence of spatial dependence up to 200\u00a0m in the untreated arm. There remains no evidence of small-scale spatiotemporal clustering of dengue cases in the intervention arm under any of these sensitivity settings.We additionally performed sensitivity analyses to account for potential contamination effects for residences near cluster boundaries and to examine the effects of applying differing temporal clustering windows. The results are presented in Fig.\u00a0wMel into the local Ae. aegypti mosquito population disrupts the focal transmission of dengue virus. The intention-to-treat analysis of a cluster randomised controlled trial of wMel deployments in Yogyakarta, Indonesia previously reported a 77% reduction in dengue incidence in wMel-treated areas23. However, the inability to account fully in the primary analysis for human and mosquito movement between treated and untreated clusters may have biased the efficacy estimate towards the null, making the reported protective efficacy of Wolbachia an underestimate25. The findings reported here from a secondary analysis of the trial data demonstrate an absence of spatiotemporal clustering among the 53 serotyped dengue cases detected in wMel-treated areas. These results are consistent with the hypothesis of an even larger wMel intervention effect than measured in the primary analysis of the AWED trial, and raise expectations that area-wide coverage of Yogyakarta with wMel could result in near elimination of local DENV transmission.We show here that successful introgression of wMel deployments occurred, no homotypic dengue case pairs occurred in any 30-day window throughout the 27\u00a0months following wMel releases. Among the remaining six wMel-treated clusters where the spatial dependence of homotypic dengue case pairs was estimable, only one cluster on the northeast border of the trial site had any homotypic dengue case pairs that could plausibly have been transmission-related. In contrast, in untreated areas we found evidence of clustering in dengue incidence within space-time windows of 30\u00a0days and 300\u00a0m, with increasing spatiotemporal dependence within decreasing intervals of space (up to 50\u00a0m) and time (up to 7\u00a0days). The lack of spatiotemporal clustering among the dengue cases resident in wMel-treated areas of Yogyakarta does not preclude the possibility that infection occurred in the cluster of residence, and that other transmission-related infections went undetected or were asymptomatic. However, since the sensitivity of dengue case detection can be expected to be equivalent, on average, between treated and untreated arms of the AWED trial, these findings strongly suggest that the dengue cases in the intervention clusters may have acquired their infection outside of their cluster of residence. Information collected in the AWED trial on the travel history of participants during the 10\u00a0days prior to illness onset, together with planned genomic analysis of DENV detected in trial participants, will support a more direct assessment of the potential transmission-relatedness between dengue cases detected in intervention clusters and those resident elsewhere in the trial area.In six of the twelve clusters where wMel of spatial patterns in dengue case occurrence is evident in the visualizations of the dengue case time series aggregate over 27\u00a0months, even before considering the two key components in potential transmission-relatedness: serotype and case onset date. At an aggregate area level, despite being completely intermixed with the untreated clusters, the cluster-specific test-positive fraction estimates for wMel-treated clusters are all considerably lower than the test-positive fractions in the untreated clusters, with the exception of intervention cluster 10. The results of the kernel estimator, which does not differentiate between serotype or take artificial study boundaries into consideration, suggest that the areas where dengue test-positive febrile illness is highest are located in untreated clusters and tend to extend across borders with other untreated areas rather than borders with intervention clusters. When serotype and case onset date are accounted for via the spatial-temporal clustering The distortion by 6, Thailand6, Australia3, Peru9, and Taiwan28 despite differences in analysis methods, ecological setting and human population characteristics. We observed strongest clustering of dengue cases within 50\u00a0m and 7\u00a0days, declining with increasing spatial and temporal distance, which is supportive of focal DENV transmission within households and the immediate neighbourhood in the absence of Wolbachia. Similar focal clustering has been reported from Thailand, where the authors found strongest evidence of clustering at a 15\u201317\u00a0day interval and distances less than 200\u00a0m4. These spatiotemporal patterns provide the rationale for the common approach of applying conventional vector control interventions, primarily insecticide spraying, in a reactive manner around the households of notified cases that cluster in space and time. In Yogyakarta, notification of hospitalised dengue cases to the District Health Office with evidence of local transmission  will usually trigger perifocal insecticide fogging, with malathion most commonly used in recent years, and application of a larvicide such as pyriproxyfen to water containers. Insecticide resistance and insecticide penetration to indoor resting places is a challenge, and the limited ability of these approaches to meaningfully impact dengue virus transmission is evidenced by the high baseline dengue burden and paediatric seroprevalence in Yogyakarta29, and recurring dengue outbreaks in other locations where large efforts are expended on Aedes vector control30.The fine scale spatial clustering of dengue cases in untreated areas of Yogyakarta closely mirrors findings reported by others from VietnamwMel method for dengue control is its efficacy against the four DENV serotypes23. However, this results in very little case data for the estimation of spatiotemporal clustering. Only 67 virologically confirmed dengue cases were enrolled in the intervention clusters throughout the 27-month AWED study, of which, only 53 had identifiable DENV serotypes. When examining the spatiotemporal dynamics of transmission, the lack of potentially transmission-related dengue is itself a critical finding, despite being difficult to represent statistically. The completion of wMel deployments throughout the AWED untreated clusters in January 2021 is expected to result in an even greater impact on dengue in Yogyakarta in coming years, and even raises the prospect of local elimination. Monitoring progress towards dengue elimination in Yogyakarta will require the development of an appropriate surveillance framework and statistical methods for demonstrating absence of disease, which differ from those used when disease is present31.One of the strengths of the A considerable hurdle in spatiotemporal analyses is the identification and geolocation of the underlying population at risk. Cross-sectional surveys are of limited utility for examining spatiotemporal patterns in the occurrence of self-limiting acute infections like dengue, as virological markers of acute infection are short-lived and detection of antibody is not informative about the timing of infection. Prospective cohort studies with clinical or serological endpoints are expensive, time-consuming and logistically complicated to carry out, and their sensitivity for detection of case clustering may be limited unless very large. As such, many studies rely on passively collected case data and compare these counts against \u201ctotal population\u201d census estimates, introducing room for bias when the total population is not the true population at risk because it includes individuals with immunity as well as those whose healthcare-seeking behaviour may preclude their detection in facility-based data sources. The test-negative design provides a new framework for simultaneously sampling cases and controls from the underlying at-risk, healthcare-seeking population. Methodological research is in progress to further explore the benefits of this design for spatiotemporal analyses of infectious disease.32. In this work, we have attempted to follow the recommended best practices when applying 33. In the context of the test-negative design specifically, 27. The controls in the AWED study may not be a random sample from the underlying spatial distribution of the population. If there are other processes driving spatial dependence in the test-negatives other than the spatial distribution of the underlying population , then this would affect the calculation and interpretation of the over and above any spatial patterns in the underlying health-care seeking population that gave rise to the dengue cases. However, as demonstrated in Fig.\u00a0Further research and development of the small-scale spatial dependence estimator 34. The performance of the blocked bootstrap has yet to be explored in the context of the 27. Further methodological development in estimation and inference for the Dengue was a relatively rare outcome in the AWED study sample, present in only 6% of individuals in the analysis set. As such, using bootstrap resampling as the basis for statistical inference resulted in two complications. First, previous work has demonstrated that blocked bootstrap resampling of spatial data is generally a more appropriate approach to inference of spatial estimators as it retains a level of spatial correlation among observed case locations that is lost when resampling individualswMel in the monitored mosquito populations was strikingly homogeneous within the intervention areas, but, by the second year of the trial, was also detected at the edges of the untreated cluster borders23. Additionally, human movement could affect an individual\u2019s risk of infection and transmission9. AWED participants\u2019 geolocated movements over the 10\u00a0days prior to illness onset were recorded at enrolment, providing a unique opportunity to gain further insight into the extent of human mobility and its role in transmission. Incorporating such fine-scale spatial and temporal data will allow for the investigation of DENV transmission beyond the proxies of geolocated residence and intervention assignment.The current work examines DENV transmission under a binary intervention status based on household residence. This serves as only a proxy of an individual\u2019s true intervention experience. The presence of wMel, replicating others\u2019 reports from multiple endemic settings. Importantly, it shows that in areas randomly allocated to wMel deployments, the sustained introgression of wMel into the local Ae. aegypti population successfully disrupts the focal transmission of dengue virus, consistent with a protective efficacy of Wolbachia that may be greater than previously reported.This work provides the first report of spatiotemporal clustering of dengue in Yogyakarta in the absence of Wolbachia to Eliminate Dengue (AWED) trial (NCT03055585)-a parallel, two-arm, cluster-randomized test-negative design study carried out in Yogyakarta, Indonesia from January 2018 to March 2020. The trial design and results have been described elsewhere26. Written informed consent for participation in the clinical component of the trial was obtained from all the participants or from a guardian if the participant was a minor. In addition, participants 13\u201317\u00a0years of age gave written informed assent. The trial was conducted in accordance with the International Council for Harmonisation guidelines for Good Clinical Practice and was approved by the human research ethics committees at Universitas Gadjah Mada and Monash University26. Yogyakarta has a population of nearly 420,000 in an area 32.5\u00a0km29. The AWED trial site was 26\u00a0kmwMel-infected Ae. aegypti releases. Where possible, geographic borders were used in order to slow mosquito dispersal between clusters23. Routine vector control activities continued throughout the study area. Individuals 3\u201345\u00a0years old presenting to government primary care clinics with acute febrile illness who were resident in the study area, had no localising symptoms suggestive of a non-dengue diagnosis, and had not been enrolled within the previous 4\u00a0weeks were invited to enrol and their residence and places visited during 10\u00a0days prior to illness onset were geolocated. A positive result in either dengue PCR or NS1 antigen ELISA distinguished virologically-confirmed dengue cases from test-negative controls  and a subset of participants excluded from analysis . The infecting serotype was determined for PCR-positive dengue cases.Data was collected during the Applying 35. This measure captures the overall tendency of homotypic dengue cases to occur within specified space-time windows above and beyond that observed in the enrolled study population due to secular factors . This method compares the odds that an enrolled pair of individuals within a given time and distance, i and j are considered to be potentially transmission-related (To characterize the small-scale spatiotemporal dependence of homotypic dengue cases, we employ a global measure, the mentclass2pt{minimBased on the observed spatial dependence in dengue cases reported previously in other settings, we examine the 36.Permutation-based null distributions from 1000 reshuffles of the location data provided the basis of hypothesis testing used to evaluate statistical significance of the estimated Supplementary Information."}
+{"text": "In May 2021, the SARS-CoV-2 Delta variant led to the first local outbreak in China in Guangzhou City. We explored the epidemiological characteristics and spatial-temporal clustering of this outbreak.Based on the 153 cases in the SARS-CoV-2 Delta variant outbreak, the Knox test was used to analyze the spatial-temporal clustering of the outbreak. We further explored the spatial-temporal clustering by gender and age groups, as well as compared the changes of clustering strength (S) value between the two outbreaks in Guangzhou.The result of the Knox analysis showed that the areas at short distances and brief periods presented a relatively high risk. The strength of clustering of male-male pairs was higher. Age groups showed that clustering was concentrated in cases aged \u2264 18 years matched to 18\u201359 years and cases aged 60+ years. The strength of clustering of the outbreak declined after the implementation of public health measures. The change of strength of clustering at time intervals of 1\u20135 days decreased greater in 2021  than that in 2020 .The outbreak of SARS-CoV-2 Delta VOC in Guangzhou has obvious spatial-temporal clustering. The timely intervention measures are essential role to contain this outbreak of high transmission. Coronavirus disease 2019 (COVID-19), associated with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection outbroke in December 2019. Since the outbreak of the pandemic, several prevalent SARS-CoV-2 mutant strains have been encountered globally, resulting in a considerable socioeconomic burden . The emeThe transmission of COVID-19 has obvious characteristics of spatial-temporal clustering. Some studies have found that appropriate public intervention measures can be effective in reducing the transmission of COVID-19 \u201310. SeveChina maintains a strict policy of public health interventions in response to the COVID-19 outbreak. On 21 May 2021, the first local outbreak in China from the highly transmissible Delta variant was identified in Guangzhou, Guangdong Province . GuangzhData on COVID-19 cases reported in Guangzhou from April 2 to May 4, 2020, and from May 18 to June 18, 2021, were obtained from the Guangdong Center for Disease Control and Prevention (Guangdong CDC). COVID-19 cases were individuals with a positive result in a PCR for SARS-CoV-2 in respiratory specimens, referring to guidelines issued by Chinese National Health Commission  and WHO http://wjw.gz.gov.cn/).Data and timelines for relevant public health interventions for the Delta VOC outbreak were obtained from the emergency response working group of Guangdong CDC and the website of Guangzhou Municipal Health Commission (http://www.resdc.cn/), and demographic information of each street in Guangzhou was obtained from the Statistical Yearbook of Guangdong Province (http://stats.gd.gov.cn).The map data of the administrative interface of each street in Guangzhou were obtained from the Data Center of Resource and Environmental Science  under various spatial-temporal interval combinations was set as the total strength of spatial-temporal clustering.The most commonly used method, Monte Carlo hypothesis testing, was proposed by Mantel . If the ustering . For knoustering , 20, 23.ustering . The spahttp://api.map.baidu.com/lbsapi/getpoint/index.html), subsequently, the projection coordinate system of all the coordinates were converted to WGS84 projection Coordinate System (World Geodetic System 1984).In the Knox analysis, we Geo-coded for each case in the Delta outbreak first. We converted the residential address of each infection case into latitude and longitude coordinates by the Baidu map coordinate picker , female-female, and male-female. All case pairs were divided into six groups based on age, including aged \u2264 18 years, aged 18\u201359 years, aged 60+ years; and aged \u2264 18 years\u2013aged 18\u201359 years, aged \u2264 18 years\u2013aged 60+ years, and aged 18\u201359 years\u2013aged 60+ years.To further address the effectiveness of public health interventions in the Delta outbreak, we divided the timing of this outbreak into two the stages. The first stage is from 18 May to 31 May 2021, and the second stage is from 1 June to 18 June 2021. Most public health interventions were implemented in the first phase. In addition, we included another COVID-19 epidemic which has a similar scale to the epidemic in Guangzhou as the comparative case. We included 215 cases of local outbreaks in Guangzhou from April to May 2020 , and comhttp://CRAN.R-project.org, R Foundation, Vienna, Austria), and the \u201csurveillance\u201d package  are shown in S values were statistically significant (P < 0.05). The highest levels of strength of the spatial-temporal clustering occurred at intervals of 0 and 1 day and within 100 meters . With the distance between the two cases increased, the S values decreased. The S values also gradually decreased as the onset interval between the two cases was prolonged.The 0 meters . The areS) with increasing time thresholds and spatial distance. The strength of spatial-temporal clustering of male-male pairs was higher at time thresholds of 1\u20137 days and spatial distances < 600 m. The strength of the spatial-temporal clustering showed that male-male > male-female > female-female . Three peaks of clustering were observed for the case pairs aged \u2264 18 years\u2013aged 18\u201359 years, at 1, 3, and 6 days, respectively. In addition, the pattern of spatial-temporal clustering characteristics in the case pairs aged 18\u201359 years was similar to that in the genders.S value was 26, and the sum of S values was 541, and after the peak of the epidemic , the maximum S value was 9, and the sum of S values was 304  than in 2020  at time intervals of 1\u20135 days, while at 6\u201310 days and 11\u201314 days, the changes in S value were greater in 2020.In this study, we characterized the spatial-temporal clustering of the COVID-19 outbreak in Guangzhou from May 21, 2021, to June 18, 2021, based on detailed individual information on each case. This outbreak is the first community-transmitted outbreak of the Delta VOC in China. Our study found that the outbreak of the Delta variant in Guangzhou has obvious spatial-temporal clustering, and effective interventions can reduce the spatial-temporal clustering, which may provide references for the response to the COVID-19 outbreak. We observed that the effect of spatial-temporal interaction was obvious and exhibited interval heterogeneity. The areas with the highest level of elevated risk were all within a distance of 1 kilometer. The highest risk value occurred at intervals of 0 and 1 day and gradually decreased as the onset interval was prolonged. This result indicated that COVID-19 infection from one case to the other individuals tends to occur in nearby persons. On the one hand, the Delta VOC B.1.617.2 grew faster and was more transmissible. Campbell et al. reported a 97% increase in the effective reproductive number of B.1.617.2 by 3 June 2021 . This maS-value) for case pairs showed a male-male > male-female > female-female pattern. It may be related to the higher infection rate for males  has decreased greater in 2021 than that in 2020. The reason may be that more stringent interventions were adopted in the early stage of the outbreak in 2021. It was reported that the incubation period of Delta is shorter (about 4 days) , 39, whiOur study is based on the coordinate information of each case, which can accurately address the spatial-temporal clustering of a COVID-19 outbreak at a small scale and it may serve as a template for responding to small-scale outbreaks. Several limitations should be noted within our study. First, in the spatial-temporal analysis, the distance between the cases was computed by their usual living address. The actual site where the case contracted the virus may be a working location or a public place, such as mass transit and restaurants. The risk areas of the distance interval may be biased. Second, the study sample size which includes 153 cases is not very great, while all the cases had very clear transmission chains based on the detailed epidemiology survey. Third, about 20% of the population was fully vaccinated, and the vaccine may influenced the spread of the virus to some extent.Our study revealed differences in spatial-temporal clustering in different stages of the epidemic and among populations with different characteristics. Adolescents and seniors are the key groups we need to focus on. The results give strong evidence that timely public health interventions including rapid tracing, quarantine, keeping social distance, and nucleic acid screening are crucial to contain the outbreak of emergent high transmissible variants. Overall, our study provides a template for the clustering analysis of the ongoing COVID-19 epidemic and is informative for response to the next SARS-CoV-2 variant outbreak.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.QZ and JX wrote the manuscript. YL and JX conceived and designed the study and reviewed and revised the manuscript. XC, YLZ, MZ, QZ, and JX contributed to data collection and statistical analysis. JH, GH, YZ, ZR, LY, JZ, YQ, ZH,WZ, XL, ZZ, YT, YHL, LZ, and DF contributed to data visualization. All authors contributed to the article and approved the submitted version."}
+{"text": "Alzheimer\u2019s disease (AD), the most prevalent form of dementia, is a neurodegenerative disorder characterized by different pathological symptomatology, including disrupted circadian rhythm. The regulation of circadian rhythm depends on the light information that is projected from the retina to the suprachiasmatic nucleus in the hypothalamus. Studies of AD patients and AD transgenic mice have revealed AD retinal pathology, including amyloid-\u03b2 (A\u03b2) accumulation that can directly interfere with the regulation of the circadian cycle. Although the cause of AD pathology is poorly understood, one of the main risk factors for AD is female gender. Here, we found that female APP/PS1 mice at 6- and 12-months old display severe circadian rhythm disturbances and retinal pathological hallmarks, including A\u03b2 deposits in retinal layers. Since brain A\u03b2 transport is facilitated by aquaporin (AQP)4, the expression of AQPs were also explored in APP/PS1 retina to investigate a potential correlation between retinal A\u03b2 deposits and AQPs expression. Important reductions in AQP1, AQP4, and AQP5 were detected in the retinal tissue of these transgenic mice, mainly at 6-months of age. Taken together, our findings suggest that abnormal transport of A\u03b2, mediated by impaired AQPs expression, contributes to the retinal degeneration in the early stages of AD. APOE)-4 genotype, epidemiologic and clinical studies have shown that female gender is a major risk factor for developing AD [Alzheimer Disease (AD), the most common form of dementia, is a progressive and multifactorial disorder leading to progressive memory loss, cognitive deficits, and behavioral changes ,2,3,4. Toping AD ,7. HowevIn addition to cognitive decline, AD patients show circadian dysfunction ,9. In paPer2, Per3, and Arnt1, occur significantly earlier in women than in men [Circadian rhythm is associated with sex differences . It has n in men . Sex difn in men .Per1, Per2, Cry1, and Cry2 compared with wild-type control mice in the medulla/pons [However, there is a paucity of research on the sex differences associated with AD-related changes in the circadian rhythms and pathogenic mechanisms. For example, it has been shown that 2-month-old APP/PS1 mice exhibit altered expression of the clock genes lla/pons . Sleep dlla/pons .Sex differences in the pathological characteristics of transgenic AD mice have been demonstrated in numerous studies. For instance, immunohistochemical analysis revealed that female APP/PS1 mice carry a higher A\u03b2 burden compared with male APP/PS1 mice ,19,20. CTaken together, it is still necessary to further clarify the severity of circadian dysfunction and retinal amyloidosis in a female-experimental AD model, such as APP/PS1 mice. Our current study, together with our previous results on retinal neurodegeneration in male APP/PS1 mice , suggestClock, Arntl, Cry1, Cry2, Per1, Per2, and Per3 at ZT 1, 7, 13, and 19. We analyzed the rhythmic expression pattern of clock genes in the 6- and 12-month-old female APP/PS1 mice compared with female control mice . The whoClock mRNA expression exhibited a circadian rhythmicity in 6-month-old wt mice with acrophase in the daytime period, but at 12 months, these control mice lost rhythmicity  compared with age-matched wt mice  compared with age-matched wt mice  compared with age-matched wt mice  E. When tAqp1 mRNA in the retina of APP/PS1 than of wt mice at 6 and 12 months of age , where it is involved in compensating for altered water transport in this retinal region ,59. In aAqp5 gene expression [Aqp5 mRNA expression decreased in aged mice compared to young mice, suggesting the involvement of AQP5 in the pathogenesis of age-related retinal diseases, including AD. AQP5 was widely expressed in various retinal layers, from GCL to RPE, suggesting different functions. However, few studies have described the role and distribution of AQP5 in healthy and injured retina beyond its involvement in retinal fluid regulation ,72. Intepression . Downregpression ,75. NotaAqp4 mRNA and protein were significantly inhibited in the presence of A\u03b2, suggesting that A\u03b2-induced cell damage is due to astrocyte dysfunction through the inhibition of AQP4 [It has been speculated that A\u03b2 may impair retinal homeostasis by altering AQPs expressed by the retinal cells . A\u03b2 indu of AQP4 . We cannPer2 decreases the expression of \u03b1-dystrobrevin, a component of the dystrophin-associated complex known to regulate the polarization of AQP4, supporting a link between the perturbation of clock gene expression in the circadian rhythm and AQP4 expression [Although the link between the regulation of circadian rhythms and AQPs may not be obvious because it has not been sufficiently studied, some studies have shown this link. A very recent study proposes a relationship between the loss of normal rhythmic expression of circadian proteins, including BMAL1, CLOCK, PER1, PER2, and CRY2, and the polarized expression of AQP4 in perivascular astrocytes . Moreovepression . Furtherpression .Aqp5 expression [Aqp5 expression in the mouse submandibular gland has been shown to be controlled by the central clock in the hypothalamic SCN [The association between circadian regulation and AQPs is not restricted only to the hypothalamic region but has also been described in other peripheral tissues, such as salivary glands, where circadian rhythmic expression of clock genes has been linked to pression . In addiamic SCN . This stTherefore, in this study, we examined the expression of circadian rhythm clock genes in the brain and the expression of AQPs in the retina, suggesting that both processes may be involved in A\u03b2 accumulation in the retina with neurodegenerative consequences. In conclusion, our findings propose a novel retinal mechanism involved in the clearance of A\u03b2 produced in the RGC mediated by AQP regulation, a mechanism that would be common to both males and females. We speculate that abnormal transport of A\u03b2, mediated by impaired AQPs expression, contributes to a toxic A\u03b2 accumulation in the retina in the early stages of AD pathology. This allows for impaired transport of retinal signals to the hippocampus, leading to a downregulation of the circadian rhythm mediated by changes in clock gene expression. ad libitum access to food and water and were sacrificed at ZT 1 (08:00), 7 (14:00), 13 (20:00), and 19 (02:00). For molecular and immunohistochemical analysis, animals were sacrificed during light period (~ZT 7) by deep anesthesia and their eyes were immediately dissected and fixed for 24 h in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB) at pH 7.4.Female and male double-transgenic APP/PS1 mice (6- and 12-month-old), which overexpressed the human genes APP (amyloid beta precursor protein) with the Swedish mutation and exon-9-deleted PSEN1  were used. Age-matched mice not expressing the transgene were used as wild-type controls (wt). All animals were handled and cared for according to Spanish legislation and guidelines and the Council Directive 2010/63/UE of 22 September 2010, and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and ARRIVE guidelines (2020). Mice were maintained in a 12:12 light/dark cycle (Zeitgeber time (ZT)) with 2 inhalation at ZT 1, 7, 13, and 19. Brains and eyes were immediately removed and the cerebral cortexes, hippocampuses, hypothalamuses, and retina were extracted and stored at \u221280 \u00b0C. Retinal RNA was obtained by eye dissection from APP/PS1 and wt eys and brain tissues  using NZYol  following the manufacturer\u2019s protocol. RNA concentration was measured in a NanoDrop\u2122 One Spectrophotometer  and 1\u00b5g of each sample was retrotranscribed to cDNA using an iScript\u2122 cDNA Synthesis Kit . Quantitative real-time PCR (qRT-PCR) was performed in a LightCycler\u00ae 480 Instrument  using NZYSpeedy qPCR Green Master Mix . The primers were predesigned and used in the qRT-PCR to determine the expression levels of Clock, Per, Cry, Arntl, Aqp, Gs, Glast, and the housekeeping gene (Hprt) (Hprt data to obtain \u0394Cp data (\u0394Cp = mean CpHprt \u2212 CpGOI). \u0394\u0394Cp was calculated between the normalized \u0394Cp values from each time point.At 6 and 12 months of age, mice were euthanized via COe (Hprt) . RelativPreviously, the fixed eyes were paraffin-embedded, and 4 \u00b5m thick sections were collected on microscopy slides using a microtome .After deparaffinization, treatment with 88% formic acid for 20 min at room temperature was performed in eye sections before peroxidase-based immunostaining for A\u03b2.2O2 for 10 min, and the Vectastain Elite ABC HRP kit  protocol was used according to the manufacturer\u2019s instructions. As the primary antibody we used rabbit anti-\u03b2-amyloid  which was diluted in phosphate-buffered saline (PBS) 0.1 M containing 5% normal goat serum and 0.5% Triton X-100, and incubated overnight with the tissues at 4 \u00b0C. After overnight incubation, primary antibody staining was revealed using one complementary secondary anti-rabbit antibody (HRP conjugated) and 3,3\u2032-diaminobenzidine DAB substrate from the Vectastain Elite ABC HRP kit . Counterstaining with Vector hematoxylin  was performed followed by mounting with DPX . Images were captured using a light microscope .Prior to peroxidase-based immunostaining, the tissues were treated with 3% HFor immunofluorescence, one series of 4 \u00b5m thick eye sections was used for double-labelling experiments. Previously, and after deparaffinization, eye sections were pre-incubated for 20 min with 88% formic acid at room temperature. Eye sections were then incubated overnight with primary antibodies at 4 \u00b0C and diluted in PBS 0.1 M containing 10% normal horse serum and 0.03% Triton X-100. The following primary antibodies were used: rabbit anti-\u03b2-amyloid , rabbit-anti AQP1 , rabbit-anti AQP3 , rabbit-anti AQP4 , and mouse-anti AQP5 . These antibodies were revealed using fluorescence-conjugated secondary antibodies from Life Technologies: Alexa Donkey anti-mouse 488  and Alexa Goat anti-rabbit 555 . DyLight\u2122488 labeled tomato lectin , was used as an effective marker of blood vessels. Finally, the slides were mounted with Immunoselect Antifading Mounting Medium with DAPI . Fluorescent images were obtained using a Stellaris Laser Scanning confocal microscope or a Thunder imager wide-field microscope  and analyzed using the Image J 1.54f software . Quantitative analysis of the immunostaining was performed using images of the cross-sectional samples of each retinal cell layer until the whole retina had been evaluated. A fluorescence threshold greater than the background was established and the signal above that threshold was measured, obtaining the mean fluorescence parameter.p < 0.05. For the analysis of circadian rhythmicity, we used CircaCompare in RStudio software (version 1.1.419), as previously described [Data analysis was conducted using GraphPad Prism 6.01  software. All data are expressed as mean \u00b1 standard error of the mean (SEM). Multiple comparisons were calculated using two-way ANOVA followed by Bonferroni\u2019s correction. In all cases, statistical significance was set at escribed ."}
+{"text": "This prognostic study/decision analytical model investigated the use of methodologies that improve expected prognostic accuracy and thus cost-effectiveness in selecting patients with melanoma for sentinel lymph node biopsy. Can systematically refining eligibility guidelines identify more appropriate patients to undergo useful medical procedures using sentinel lymph node biopsy (SLNB) for melanoma as an illustrative example?In this prognostic study/decision analytical model that included 7331 patients with melanoma, a methodology that significantly improved the prognostic accuracy of probabilities of SLNB outcomes was used in 2 distinct populations. Adopting a range of minimally acceptable probabilities made patient selection for SLNB more cost-effective, often with fewer procedures performed and more patients with node-positive melanoma identified.This study found that improved accuracy in predicting SLNB-positivity could enhance cost-effectiveness in selecting patients for SLNB, suggesting that melanoma guidelines for undergoing SLNB should be refined accordingly. Refining eligibility guidelines may identify more appropriate patients to undergo useful medical procedures.To improve cost-effectiveness in selecting patients with melanoma for sentinel lymph node biopsy (SLNB).This hybrid prognostic study/decision analytical model was conducted among patients with melanoma who were eligible for SLNB at 2 melanoma centers from Australia and the US from 2000 to 2014. Participants consisted of 2 cohorts of patients with melanoma undergoing SLNB and a cohort of eligible patients without SLNB. Individualized probabilities of SLNB positivity generated by a patient-centered methodology (PCM) were compared with those generated by conventional multiple logistic regression analysis investigating 12 prognostic factors. Prognostic accuracy was assessed by the area under the receiver operating characteristic curve (AUROC) for each methodology and by matched-pair analyses.Triaging appropriate patients to undergo SLNB.Total number of SLNBs performed  vs number of SLNB-positive outcomes (a measure of effectiveness) was evaluated. Improved cost-effectiveness through judicious patient selection was interpreted as increased numbers of SLNB-positive outcomes achieved, decreased numbers of SLNBs performed, or both outcomes simultaneously.Among 7331 patients with melanoma, SLNB outcomes were assessed in 3640 Australian patients  and 1342 US patients ; 2349 patients eligible for SLNB who did not undergo the procedure were included in the simulation. PCM-generated probabilities achieved an AUROC of 0.803 in predicting SLNB positivity in the Australian cohort and 0.826 in the US cohort, higher than corresponding AUROCs generated by conventional logistic regression analysis. In simulation, adopting many SLNB-positive probabilities as minimally acceptable patient-selection criteria resulted in fewer procedures performed or increased the expected numbers of positive SLNBs. A minimally acceptable PCM-generated probability of 8.7% elicited the same number of SLNBs as historically performed (3640 SLNBs), with 1066 positive SLNBs (29.3%), constituting an improvement of 287 additional positive SLNBs compared with 779 actual positive SLNBs (36.8% improvement). In contrast, adopting a 23.7% PCM-generated minimum cutoff probability resulted in performing 1825 SLNBs, or 1815 fewer SLNBs than the actual experience (49.9%). It resulted in the same expected number of positive results (779 SLNBs), for a 42.7% positivity rate.This prognostic study/decision analytical model found that the PCM approach outperformed conventional multiple logistic regression analysis in predicting which patients would have positive results on SLNB. These findings suggest that systematically producing and exploiting more accurate SLNB-positivity probabilities could improve the selection of patients with melanoma for SLNB compared with using established guidelines, thus improving the cost-effectiveness of the selection process. Eligibility guidelines to undergo SLNB should include a context-tailored minimum cutoff probability. They often fail to consider individual patient characteristics and differences among participating institutions. Strict reliance on established guidelines may therefore overlook patients who may benefit from a procedure while selecting some who are unlikely to benefit. Systematically refining guidelines to reflect relevant contextual factors concerning individual patients and institutions could substantially improve the chances of selecting the most appropriate patients.The substantial cost of health care delivery constitutes a substantial burden on the economies of industrialized nations. Ample evidence points to the magnitude of waste when patients unnecessarily undergo costly medical procedures.2 and the fifth most common in the US.3 Major advances in melanoma management have resulted from early diagnosis,4 identification of regional lymph node micrometastases,5 and development of effective systemic therapies.9 Identification of lymph node metastases was revolutionized by the sentinel lymph node biopsy (SLNB) technique. SLNB is an important and reliable staging tool, with SLN status emerging as the most powerful prognostic factor for clinically localized primary melanoma10 and an important criterion for selecting patients with high-risk, SLNB-positive (stage III) and -negative (stage II) melanoma for adjuvant systemic therapy.14 While the procedure is generally well tolerated, it can be associated with complications, such as seroma, infection, and lymphedema.Melanoma is the third most common malignant neoplasm in Australia5 These patients derive most of the procedure\u2019s benefit (beyond the knowledge of node-negative status) given that patients with SLNB-negative melanoma are often treated in the same manner as if they had not undergone SLNB. This suggests that more accurate prediction of SLNB positivity could reduce the number of procedures performed and increase the number of patients with SLNB-positive melanoma identified, thus improving the cost-effectiveness of the selection procedure. Various nomograms have been developed to reflect risk of SLNB positivity.16 However, whether more accurate probabilistic algorithms could improve cost-effectiveness in selecting patients to undergo SLNB and the extent of this improvement have not been investigated previously, to our knowledge.SLNB is typically recommended to patients based on eligibility criteria, including a primary tumor greater than 1.0-mm thick or thinner melanomas with high-risk features, such as ulceration or increased mitotic rate. The procedure identifies approximately 15% to 20% of patients as having node-positive melanoma.17 PCM has been shown to enable more accurate prediction of (1) survival outcomes in melanoma and breast cancer17 and (2) the performance of mitotic rate in predicting prognoses in melanoma.18 This study investigated PCM predictions of individualized SLNB positivity compared with other methods and the resulting cost-effectiveness in selection of patients to undergo SLNB.We developed several novel statistical procedures, termed patient-centered methodology (PCM), that generate individually tailored probabilities assignable to specific clinical outcomes .TRIPOD) and Consolidated Health Economic Evaluation Reporting Standards (CHEERS) reporting guidelines for observational studies . Criteria used to define eligibility and recommend SLNB included melanomas greater than 1.0 mm thick or 1.0 mm or less in thickness with ulceration or a mitotic rate of 1 per mmInformation available on 12 prognostic factors was used for subsequent analyses. These factors were patient age, patient sex, tumor site, tumor thickness, ulceration, mitotic rate, presence of microsatellites, presence of regression, tumor-infiltrating lymphocyte (TIL) grade, presence of lymphatic invasion, tumor type, and Clark level.We defined effectiveness as the appropriateness of patients selected to undergo SLNB, a staging procedure aiming to identify patients with node-positive melanoma. Thus, effectiveness was increased when whichever biopsies were performed detected more patients with node-positive melanoma. We defined cost as medical resources (including but not restricted to monetary expenditures) used in performing SLNBs. Thus, cost was reduced when fewer procedures were performed to identify patients with node-positive melanoma. We defined cost-effectiveness in terms of 2 outcomes from adopting minimum cutoff probabilities used to select patients to undergo SLNBs, assessed by comparing these outcome measures: actual or expected number of positive SLNBs achieved and required number of procedures performed to achieve that many positive SLNBs.18 generated a probabilistic algorithm to predict SLNB positivity by stratifying each cohort  into 3 risk-defined subgroups based on T category and patient age that provided significant discrimination in each cohort. The composition of each risk subgroup is provided in eMethods in P values are 2-sided; statistical significance was defined as P\u2009\u2264\u2009.05.PCMR2 values were calculated. Data were analyzed using SPSS statistical software version 27 (IBM) from October 2000 to April 2021.Probabilistic algorithms generated by 3 different methodologies were applied to the 5989-patient Australian cohort: the PCM-generated algorithm, an algorithm derived from conventional multiple logistic regression analysis, and an algorithm combining useful features of both methodologies  underwent SLNB . We also2 ranged from 3.88 (P\u2009=\u2009.05) for mitotic rate to 65.14 (P\u2009<\u2009.001) for melanoma subtype  . PCM produced a more accurate prognosis 69.4% more frequently than when using conventional logistic regression analysis.We then fitted by separate logistic regression analysis an algorithm that best predicted SLNB positivity from the same 12 prognostic factors to each patient subgroup. Distinct subsets of factors were identified as independent covariates in each subgroup (eTables 3-5 in 2 test (P\u2009<\u2009.001) eTable 2 in P\u2009<\u2009.001 for signed rank and binomial tests). PCM produced a more accurate prognosis 100.9% more frequently than conventional analysis.Separately, we examined US patients who had undergone SLNB. There were statistically significant differences in the composition of the 2 cohorts , with thWe then assessed the cost-effectiveness of selecting patients to undergo SLNB by virtue of equaling or exceeding a minimum cutoff probability. Separate SLNB-positivity probabilities were generated by 3 separate algorithms. To the 3640 patients in the Australian cohort, we added 2349 patients  but with 1066 expected positive outcomes, for a positivity rate of 29.3%. This constituted an improvement of 287 SLNBs compared with 779 actual positive SLNBs (36.8% improvement). In contrast, adopting a 23.7% minimum cutoff resulted in performing 1825 simulated SLNBs, with the same expected number of positive outcomes (779 SLNBs), for a positivity rate of 42.7%, and requiring 1815 fewer simulated procedures (49.9%). Each minimum cutoff probability that produced curve 1 of In addition, we assessed results when applying 4 PCM-generated minimum-cutoff SLNB\u2013positivity reference probabilities that may be applied in practice . Melanoma centers typically recommend SLNB to an individual patient when the probability of a positive outcome ranges between 5% and 10%. Adopting 10%, 15%, or 20% PCM-generated minimum cutoffs improved both outcome measures simultaneously (given that they were within the cost-effective dominance range of 8.7% and 23.7%) . For exaWe next assessed the cost-effectiveness of judicious patient selection when cutoff probabilities were generated from conventional multiple logistic regression analysis of the same 12 prognostic factors in the MIA cohort. Use of these probabilities in simulation also resulted in improved cost-effectiveness compared with actual experience, although with smaller differences than found when using probabilities generated by PCM A. The raDespite significant differences in composition of the 2 cohorts, we sought to investigate whether a probability-estimating algorithm derived from 1 cohort could improve the cost-effectiveness of selecting patients in the other cohort. A prognostic algorithm was produced from the US cohort by combining PCM and conventional logistic regression analysis. Application of this algorithm to the 5989-patient MIA cohort also improved the cost-effectiveness of selecting patients to undergo SLNB compared with actual experience A, albeitR2 values were 0.993 for PCM  was realized by using PCM to estimate a separate, individually and institutionally tailored probability of SLNB positivity based on 12 established and routinely available clinical and histopathological prognostic factors. Several features of PCM enabled its increased capability in our models,18 including stratifying the population into more homogeneous risk subgroups, developing indices for each prognostic factor reflecting the shape of its impact on the outcome measure of interest, and special handling of missing observations.This hybrid prognostic study/decision analytical model found improved discrimination in predicting SLNB positivity. These results extend prior such attempts. Investigators at the Memorial Sloan Kettering Cancer Center developed a nomogram using 5 prognostic factors that achieved an AUROC of 0.694.23The improved prognostic capability of PCM was exploited to enable improvements in the cost-effectiveness of selecting patients to undergo SLNB. Patients were selected by comparing their estimated SLNB-positive probability with a minimum cutoff probability. The PCM-based selection procedure produced an expanded range of cost-effectiveness dominance compared with that obtained using conventional logistic regression analysis. Both methodologies improved cost-effectiveness compared with the actual experience in the Australian cohort. Intriguingly, using a 5% cutoff probability (which is used by many melanoma centers) resulted in outcomes that were outside the PCM cost-effective dominance range, whereas using a 10% value produced outcomes within the range. This suggests that appropriate minimum cutoff probabilities recommended by various guidelines may usefully be revisited.Our results suggest substantial room for improvement in the cost-effectiveness of the process by which patients with melanoma are currently selected to undergo SLNB. To achieve this improvement, each health system may need to choose its preferred minimum cutoff probability, with the goal of reducing the total number of patients undergoing SLNB  or increasing the number of patients with node-positive melanoma detected (by up to 36.8% in this cohort) or some balance between these goals. Minimum cutoff probabilities and resulting pairs of SLNB outcomes indicated the consequences of applying the chosen cutoff probability using each algorithm, while outcomes found using cutoff probabilities and cost-effectiveness curves indicated whether that probability was within each algorithm\u2019s cost-effective dominance range.An important possibility is that with a sufficiently large sample of patients required to generate stable probabilistic estimates, each health system may develop an algorithm tailored to the composition of its own patient population and reflecting the distinct ways various prognostic factors are recorded. Any such locally tailored  algorithm may be incorporated into an interactive electronic  tool whose inputs are specific prognostic factors and whose outputs are calculated SLNB-positive probabilities for local individual patients. We recommend that the National Comprehensive Cancer Network and other national melanoma guideline committees consider these issues in discussing minimum cutoff probabilities. At the individual patient level, this may have important implications for the decision-making process. For example, the conversation with a male patient aged 34 years with a 0.7-mm acral melanoma without TILs (harboring >10% risk) would be markedly different than that with a female patient aged 87 years with a 1.8-mm desmoplastic melanoma on the upper arm (harboring <5% risk).This study has several limitations, including compositional differences between cohorts and the difficulty in applying an algorithm from 1 institution to another when relevant prognostic factors were not similarly coded. This analysis constitutes a retrospective simulation demonstrating the potentially improved cost-effectiveness achievable by selecting various cutoff probabilities. However, a prospective clinical trial would be required to confirm improvements realized by adopting a chosen minimum cutoff probability to select patients for SLNB using PCM or any other appropriate prognostic methodology.Beyond SLNB for melanoma, results of this hybrid prognostic study/decision analytical model study may have important implications for how guidelines are developed for selecting patients to undergo other useful medical procedures. These results suggest the consequences that choosing different minimum cutoff probabilities may have for the cost-effectiveness of the selection process and the unambiguous advantages that may be gained by selecting patients within the cost-effective dominance range when one is identified. Importantly, this approach reflects a conceptual advance beyond a strictly categorical approach  to a comparative approach  in contexts in which differing degrees of eligibility are sensible and ascertainable."}
+{"text": "Plasmodium falciparum, uses the PfATP4 cation pump to maintain Na+ and H+ homeostasis in parasite cytosol. PfATP4 is the target of advanced antimalarial leads, which produce many poorly understood metabolic disturbances within infected erythrocytes. Here, we expressed the mammalian ligand-gated TRPV1 ion channel at the parasite plasma membrane to study ion regulation and examine the effects of cation leak. TRPV1 expression was well-tolerated, consistent with negligible ion flux through the nonactivated channel. TRPV1 ligands produced rapid parasite death in the transfectant line at their activating concentrations, but were harmless to the wild-type parent. Activation triggered cholesterol redistribution at the parasite plasma membrane, reproducing effects of PfATP4 inhibitors and directly implicating cation dysregulation in this process. In contrast to predictions, TRPV1 activation in low Na+ media accentuated parasite killing but a PfATP4 inhibitor had unchanged efficacy. Selection of a ligand-resistant mutant revealed a previously uncharacterized G683V mutation in TRPV1 that occludes the lower channel gate, implicating reduced permeability as a mechanism for parasite resistance to antimalarials targeting ion homeostasis. Our findings provide key insights into malaria parasite ion regulation and will guide mechanism-of-action studies for advanced antimalarial leads that act at the host-pathogen interface.The intracellular human malaria parasite,  Plasmodium parasites in humans, remains a public health priority, with P. falciparum and P. vivax the predominant causes of morbidity and mortality Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The authors present an elegant an innovative approach to studying the role of malaria ATP4 and the mechanism of action of ATP4 inhibitors. Plasmodium ATP4 has emerged as a key target of pipeline antimalarials, with several distinct classes. The precise mechanism or parasite killing is unclear but ATP inhibitors are known to cause key changes in cellular pH, Na+ levels and plasma membrane composition. This work uses expression of a ligand gated cation channel as a tool to dissect these changes. The resultant transgenic parasites demonstrate selective sensitivity to TRPV1 agonists which result in parasite killing and changes in saponin sensitivity analogous to that seen for ATP4 inhibitors. The work is well written and I have only minor suggestions, mostly surrounding additional discussion of rationale and findings.Minor commentsTechnical approach - I am not sure why the authors opted for random integration using the piggyBac system \u2013 random integration and potential for variable copy number are big disadvantages, which could be avoided using various Cas9 or even AttB integrase type approaches. These disadvantages are well mitigated by the follow up work, including appropriate genotyping and phenotypic controls. The fact that the integration site is unknown will make these specific lines less attractive for others to use. That said, this does not affect the success of this work in validating the fundamental approach and of course similar lines could be readily remade targeting a known locus. I think the parasite lines will be of broader interest and the methodological development itself provides significant impact, so some discussion of these tool parasites, for example for steps to characterise their integration site/generate separate lines and some additional use case examples would be a good addition.Genotyping - The combined genotypic data of PCRs Southerns, and IFA is convincing. If available the Southern blots should include a positive control probe for the DD2 wild type to confirm even DNA loading.Localisation - The EM and IFA images are consistent with membrane localisation, but further IFA images from other parasite stages (particularly rings and late trophozoites) would be informative. It might be easier to discern clear parasite membrane localisation in earlier stages.Saponin source - The fact that clear differences in saponin reactivity were seen between different preparation, could the authors comment on that in the discussion. Is there a difference in source/purity etc which could account for this?Biochemical characterisation \u2013 Although authors discuss the draw backs of some of approaches to measure changes in pH/cation flux in live parasites, it would clearly be an important next step to compare findings with these tool parasites. I don\u2019t think it is necessary to add such experimental data here, but it would be appropriate to lay out next steps for biochemical analysis of the TRPV1 lines in the discussion.All the best,Rob MoonReviewer #2:\u00a0The manuscript \u201cConditional permeabilization of the P. falciparum plasma membrane in infected cells links cation influx to reduced membrane integrity\u201d by Sylla et al. is a pleasure to read. It describes a very original approach to control sodium permeability of the blood stage malaria parasite plasma membrane by introduction of the TRPV1 channel. This will be a great tool for the research community to explore processes related to the ion homeostasis of the parasite. In the present work the authors used the engineered parasite to test a previously proposed model connecting the function of a PfATP4, a sodium and proton exchange pump, directly with lipid homeostasis. The study is very elegant and every alternative hypothesis that I was able to think of was addressed in the discussion. In my opinion the manuscript can be published as is.********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0Robert W. MoonReviewer #1:\u00a0Reviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 3 Mar 2023See attached Response to Reviewers fileAttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 16 Mar 2023Conditional permeabilization of the P. falciparum plasma membrane in infected cells links cation influx to reduced membrane integrityPONE-D-22-32957R1Dear Dr. Desai,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Jude M PrzyborskiAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 27 Mar 2023PONE-D-22-32957R1 P. falciparum plasma membrane in infected cells links cation influx to reduced membrane integrity Conditional permeabilization of the Dear Dr. Desai:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr Jude M Przyborski Academic EditorPLOS ONE"}
+{"text": "This study was undertaken to compare direct composite resin restorations (DCRR) and indirect composite resin restorations (ICRR) for treating permanent first molars affected by MIH in terms of clinical performance.This was a controlled, randomized, clinical split-mouth study. The studied sample consisted of 40 asymptomatic first permanent hypomineralised mandibular molars in 20 children aged between 7\u201311 years, these cases were divided randomly into two groups: Group 1 : 20 first permanent mandibular molars were restored with ICRR, and Group 2 (control): 20 first permanent mandibular molars that were restored with DCRR. The cavity was prepared using a diamond bur on a high-speed handpiece, and the prepared cavity was wiped with cotton moistened with sodium hypochlorite. The composite was applied directly with a total-etch bonding system. In the ICRR group, an impression for the prepared cavity was taken using a silicon-based material, and the restoration was adhesive with self-adhesive resin cement. The child\u2019s satisfaction with each of the two application techniques was assessed through the scale FACES. Restorations were evaluated during follow-up periods  according to Modified USHPH criteria.P\u2009=\u20090.218). Children were significantly more satisfied (P\u2009=\u20090.0351) with ICRR than DCRR.The clinical success rate was 90% in the ICRR group versus 85% in the DCRR group after 12 months of follow-up without statistically significant differences (Both DCRR and ICRR can be considered effective restorations with acceptable clinical performance in the restoration of hypomineralised first permanent molars with an advantage of ICRR in terms of child acceptance of the restoration application technique. Molar incisor Hypomineralisation (MIH) is defined as a developmental defect in teeth that primarily affects enamel in the first permanent molars with varying degrees of severity ranging mainly from mild enamel opacity to severe enamel break down, especially in occlusal regions and can involve the incisors . This coPrevalence of MIH is considered one of the highest enamel defects, ranging from 3 to 40% .Etiology for MIH is currently unknown, many factors and conditions may work together and increase the risk of its occurrence as some systemic and genetic factors work synergistically , prenataAccording to Garot et al., prenatal factors , perinatal factors  and postnatal factors  were shown to be significantly associated with MIH .The evidence for management of MIH affected molars overall is weak. In mild cases, preventive approach is very important including oral hygiene instruction, dietary advice to both children and their careers, placement of topical fluoride varnish, and resin-based fissure sealants. In severe cases, the treatment is more complex, including restoration with composite resin, preformed metal crowns, laboratory manufactured indirect restorations, pulp therapy, and scheduled extractions , 11.In the case of using full crowns, the need to preserve the remaining tooth structure can not be achieved when treating these teeth in children with relatively short clinical crowns, wide pulp chambers, greatly extended pulp horns and unstable contact points .In dental restorations with the need for both durability and a conservative preparation, ICRR may be a possible solution for the treatment of hypomineralised permanent first molars and is midway between DCRR and full crowns . On the ICRRs are an esthetic alternative to cast metal restorations and preformed metal crowns with minimal microleakage . there iWith the lack of clinical trials that compare the use of ICRR in severe degrees of MIH and other materials such as direct resin composite restorations, it is important to investigate the clinical outcome of ICRR when compared to direct restorations. The first null hypothesis was that DCRR and ICRR had no effect on the clinical performance of restored permanent first molars affected by MIH, and the second null hypothesis was that DCRR and ICRR had no effect on the child\u2019s satisfaction with each of the two application techniques.The study protocol was approved by the Scientific Research and Postgraduate Board of Damascus University, Ethics Committee, Damascus University, Syria (IRB No. UDDS-3116-07092020/SRC-621). The trial was also registered on clinicaltrials.gov (NCT05299489). A detailed information sheet written in plain, non-technical language was provided in advance and the parent/guardian was asked to sign an informed consent form.d) for secondary caries was considered for the calculation of the sample size, based on a previous study the effect size (d) for secondary caries was 0.9 [The sample size was determined using the PS Power and Sample Size Calculation Program, version 3.0.43. Effect size  .Children who were included to be part of this study were healthy and cooperative children according to Frankel\u2019s scale .The\u00a0children\u00a0were\u00a0aged\u00a0between\u00a07 and 10 years.Children who had two severe hypomineralised first permanent mandibular molars according to EAPD classification  that could be restored.No past dental treatment for the hypomineralised first permanent mandibular molars.Caries lesions that include the occlusal surface and do not exceed more than two-thirds of the dentin thickness in the periapical radiographic examination,Areas of hypomineralisation that include one-third of the affected tooth surface but less than two-thirds.No past dental treatment for the hypomineralised first permanent mandibular molars.Vital pulp according to chloroethyl test with no fistula or abscess, no story of spontaneous or continuous pain, and absence of clinical and radiographic signs of pulp necrosis .A total of 40 hypomineralised first permanent molars of 20 patients were evaluated for the study and invited to participate in the study according to the following inclusion criteria:The presence of systemic disease.Children who had two mild hypomineralised first permanent mandibular molars according to EAPD classification .Any potential confounding enamel defects i.e., amelogenesis imperfecta.Uncooperative children according to Frankel\u2019s scale .A history of allergic reactions to local anesthetics or some components of restorative materials.While Exclusion criteria were related to:All patient were assessed by 3 Pedodontists to ensure EAPD Diagnostic criteria of MIH, and all teeth were treated by one Pedodontist.www.randomization.com, where the patients were randomly distributed into two random permuted blocks containing 20 patients with an allocation ratio of 1:1; Group  represents the group in which the right side was treated with indirect resin composite as experimental restorations) and Group  represents the group in which the right side was treated with direct resin composite as control restorations. A single-blinded study was also adopted so the examiners were masked about the applied materials.This trial has been designed according to CONSORT statement guidelines Fig.\u00a0 and the All dental treatments were provided at the Department of Pediatric Dentistry, Faculty of Dentistry, Damascus University. The cavity was prepared after rubber dam isolation Fig.\u00a0 and applAll prepared walls were wiped with cotton moistened in sodium hypochlorite 5.25% before applying the acid etch and bond. Sodium hypochlorite enabled the removal of proteins from the infected MIH molars, which in turn can promote the inclusion of resin tags, which enhance the micro-mechanical bonding .For ICRR, the preparation was made as the cavity walls were vertical to the longitudinal axis. The lingual and gingival margins of the proximal part were extended outside the contact areas by 0.5\u2009mm, the functional cusps were reduced by 2\u2009mm and then the non-functional cusps were reduced by 1.5\u2009mm. The intervention was completed according to the application methods (direct or indirect):The DCRR group: the phosphoric acid 37%  was applied to the enamel for 15\u2009s, then to the enamel and dentin for 15\u2009s, followed by thoroughly rinsing under running water for 10\u2009s and dried with a gentle air. The single bond (3\u2009M/ESPE) was placed on the enamel and was light cured for 20\u2009s with a light-emitting diode light-curing unit . The resin composite  was applied in a layering technique, as the thickness of one layer does not exceed 2\u2009mm, then each layer was light cured separately for 20\u2009s. The finishing and polishing process was done using Fine (2135\u2009F) and extra fine (2135FF) diamond burs (KG Sorensen), and then rubber points  were applied until a smooth and polished surface was obtainedThe ICRR group: teeth were cleaned after completing the preparation, and then the impressions were taken for both jaws using an additional silicone rubber impression material . The impression was cast using yellow gypsum to obtain gypsum samples. Resin composite resin was applied to the gypsum samples in layering technique after they were isolated using silica, as the thickness of one layer does not exceed 2\u2009mm, then each layer was light cured separately for 20\u2009s. The finishing and polishing process was performed using Fine (2135F) and extra fine (2135FF) diamond burs (KG Sorensen), and then rubber points  were applied until a smooth and polished surface was obtained.The inner surfaces of the restoration were sandblasted using air abrasion with 50\u2009\u03bcm aluminum oxide, then silane  was applied to the inner surface of the restoration with gentle air. A self-adhesive dual-cure resin cement  was applied using light-cured for 40\u2009s from all sides to ensure that the light reached the full thickness of the resin cement.All children were given oral hygiene instruction and topical fluoride varnish application during the follow-up sessions.Restorations were evaluated during 3, 6, and 12 months Figs.\u00a0 and\u00a03 byThe FACES scale comprises a row of five faces numbered from 1 to 5 and aims to assess state anxiety, the scores were recorded as follows: score 1 = Strongly agree (no anxious), score 2 = Agree (mild anxious), score 3 = Undecided (moderate anxious), score 4 = disagree (severe anxious), and score 5 = Strongly disagree (panic level anxiety) . The chi\u03b1\u2009=\u20090.05.Statistical analysis was performed by using the SPSS 21.0 software . The data were analyzed with Mann Whitney U, paired t-test, and Chi-square test. The testing was performed at N\u2009=\u200937) of cases showed extreme sensitivity to cold, 82.5% (N\u2009=\u200933) post-eruptive breakdown, 85% (N\u2009=\u200934) atypical extensive caries (Table\u00a0This study included 20 children aged 7\u201310 years (mean age = 8.3\u2009\u00b1\u20090.9) with MIH of which 11 were males (55%) and nine were females (45%)  respectively. The survival rate of the two types of DCRR and ICRR was evaluated using Kaplan\u2013Meier survival analysis, the survival rate was 90% in the ICRR group versus 85% in the DCRR group after 12 months of follow-up without statistically significant differences (P\u2009=\u20090.218) as seen in Table\u00a0Mann Whitney-U or Chi-Square tests were applied to pairwise comparison. After 12 months of follow-up, both DCRR and ICRR demonstrated acceptable anatomical form, marginal adaptation, surface texture, marginal discoloration, retention, secondary caries, and post-operative hypersensitivity with no statically significant differences (t-tests were applied to pairwise child satisfaction. Table\u00a0P\u2009=\u20090.0351) with ICRR (50% agree and 45% strongly agree), than DCRR (60% agree and 20% strongly agree).Paired The management of teeth with MIH lesions is a clinical problem due to its high prevalence, multiple clinical manifestations, young age of patients, severe dental sensitivity, and post-eruptive breakdown . AlthougScheduled extractions are also indicated for teeth with significant breakdown, or for those that are pulpally involved or associated with a dental abscess or facial cellulitis. In severe cases, consideration should also be given to the long-term prognosis of the tooth, the likelihood of repeated dental interventions and the psychological impact on the child . ExtractClinical studies on the evaluation of the clinical performance of direct resin composite restorations are few and limited, hence this study was conducted to evaluate the clinical performance of indirect resin composite in the restoration of MIH first permanent molars during a 12-month follow-up period.Resin composite was selected to restore MIH first permanent molars because it requires conservative preparation and is the first choice in restoring molars affected by MIH, especially if the lesion includes one or two surfaces . ICRRs wIn the ICRR, the restorations were made by the dentist on the gypsum samples, and the adhesion was performed using self-adhesive resin cement, but selective enamel etching was undertaken for 30\u2009s, where both Goracci et al., and de Goes et al., showed an increase in the bond strength after selective enamel etching , 26.A self-adhesive resin cement was used to shorten the etching, washing, and drying stages as it has good mechanical properties, including its low solubility in oral fluids. It also has good flowability due to its low viscosity, and thus it achieves the lowest possible cement thickness between the restoration and the tooth surface . This ceThe resin composite was applied in both application methods (direct and indirect) with a layering technique so that the thickness of the layer does not exceed 2\u2009mm to harden the entire layer of the resin composite . The innSilane was applied after sandblasting the inner surface of ICRR to increase the bond strength as an additional covalent interaction occurs between the methacrylate group in the resin cement and the silane particles during the hardening process . An addiThe results of this study supported the first null hypothesis, as there were no significant differences in terms of the clinical performance of DCRR and ICRR in the restoration of MIH first permanent molars. It is possible to apply the indirect resin composite in the restoration according to the results recorded in this study, which may help to overcome the problems associated with the application of direct restorations in children such as polymerization shrinkage and post-operative sensitivity .Despite the need for an additional session in ICRR, the shortness in the duration of the treatment session compared to the DCRR in one was more desirable for the child, as the second null hypothesis was rejected. The results of the assessment of the child\u2019s satisfaction with the ICRR technique were (50% agree and 45% strongly agree) higher than DCRR (60% agree and 20% strongly agree) and this plays a role in gaining the child\u2019s cooperation for dental procedures . Statistn\u2009=\u200921)., and Lygidakis et al. study evaluated direct resin composite in the restoration of molars affected with MIH in children aged 8\u201310 years old [No loss of restorative material was observed during follow-up periods in both techniques, this indicates that the resin restorations have good retention and stability towards masticatory forces, and this is consistent with the Dhareula et al. study which evaluated metal and indirect resin onlays in the rehabilitation of first permanent molars affected with MIH in children aged 8\u201313 years old, the study was performed on 30 children. 42 teeth were equally divided into two groups (ears old , 34.The presence of secondary caries was examined using the probe, and the results of this study showed there were no secondary caries in 90% of DCRR and 95% of ICRR after 12 months of follow-up without significant differences between these two types of restorations. This could be attributed to the removal of all affected enamel and the placing of the restoration margins on sound enamel. This is consistent with the study of de Souza et al.  which evComparing the anatomical form changes in the DCRR and ICRR, the results showed no change in the anatomical form of 85% and 95% in both DCRR and ICRR, respectively. This is consistent with the study of Dhareula et al. and S\u00f6nmez and Saat studies , 17. OurAs for the surface texture, the DCRR showed an enamel-like surface in 60% of cases compared to 85% for the ICRR without statistically significant differences. This can be explained by the fact that the ICRR contains a larger percentage of filler particles, which makes it less susceptible to surface changes , 36.In this study, it was observed that there was no marginal discoloration and closely marginal adaptation in 75 and 80% of cases respectively, while in the ICRR group, the closely marginal adaptation and no marginal discoloration reached 80% with no statistically significant difference between the two groups. This could be attributed to the application of both resin composite restorations with a layering technique to overcome the polymerization shrinkage by reducing the C-factor .Through the results of this study, it was observed that there was no post-operative sensitivity in the DCRR group 70%, 80%, and 85% during 3, 6, and 12 months respectively, compared to 80%, 90%, and 95% for the ICRR group. These results may be attributed to the strict adherence to rubber dam isolation and adhesive ICRR by dual-cure resin cement, which achieves better sealing of the dentin canals and bypasses the two stages of etching and drying of the dentin. The results of this study are consistent with Lygidakis et al., study regarding post-operative sensitivity , while tThis is the first study that evaluated ICRR in the first permanent molars affected with MIH. It has included good sample size and good follow-up periods, but we recommend in the future to conduct further studies with longer follow-up periods to confirm these results. Treatment decisions were made on a subjected criteria based on defect size, cooperation, patient needs, and this is the major limitation of the study. This is because there is not a standardized protocol.The results indicated that using DCRR and ICRR in the restoration of MIH first permanent molars is effective with the advantage of ICRR which resulted in child satisfaction due to shorter treatment sessions. Future studies are still required to confirm our findings with a larger sample size and further follow-up."}
+{"text": "Frontiers documents the multiple challenges associated with COVID-19 and efforts to ameliorate them among diverse populations that reside in the US Mexico border region and beyond.COVID-19 exacerbated existing health inequities and led to unique ones in vulnerable and historically underserved populations. This edition of Mu\u00f1iz-Salazar et al. describes how the pandemic interrupted ongoing efforts to detect TB and provide treatment for tuberculosis in the state of Baja California. It also documented how the pandemic limited existing TB services and required service providers to develop and adapt new strategies to detection and treatment such as relying on telemedicine. In another study, Wagler et al. reveals the impact of the pandemic on specific social determinants of health that lead to high-risk behaviors such as unhealthy diets.The border between Mexico and the United States is a complex space where the unique social and economic context of the region impacts the health, economy and other social determinants which contribute to significant health inequities among the diverse populations that inhabit the region. One consequence of the COVID-19 pandemic was to further aggravate these existing health inequities. For example, Moreno Ram\u00edrez et al.. It also reminds us of the centrality of essential workers to the functioning of society and the importance of integrating the workplace into the public health response. Studies in Miami-Dade County and Arizona also highlight that social determinate of health, such as migration, that are commonly found on the border are not limited to the geographical region. Bastida et al. and Nu\u00f1o T. et al. provide evidence of the causes of vaccine hesitancy and acceptance allowing public policymakers to consider the impact of health messages and intervention programs anchored by scientific evidence and the authenticity of the messenger. Finally, Harvey-Vera et al. centers the experience of people who inject drugs and how social stigma and discrimination that they experience along with the limited access to health services complicates COVID-19 vaccination efforts. It reminds us of the importance of accounting for the heterogeneity within populations and the need to tailor interventions to a variety of life circumstances.The COVID-19 pandemic not only aggravated existing health inequities but also led to unique ones as well. Several of the articles in this Research Topic remind us that technical solutions, such as vaccines, need to account for the social context within which they are implemented to ensure their widespread adoption. A case study in Tucson, Arizona of workers at beauty salons and auto shops provides solid information in addressing this topic in the article by Rangel G\u00f3mez, Varela, et al.. Cruz Pi\u00f1eiro and Ibarra report results from interviews of Central American and Caribbean immigrants stranded in four border cities in Mexico. The experience of these immigrants speaks to the impact of over-crowded shelters and lack of access to services affected the mental, social, and economic health of this population from a diverse cultural and economic perspective. Also deported Mexican migrants faced an increased risk of COVID-19 infections due to a lack of vaccines and unhealthy conditions in detention settings in the US as is described by Mart\u00ednez-Donate et al..Migration is another social determinate of health that plays a prominent role in public health efforts in the border region and beyond. The intense mobility that is a trait at the border posed the challenge of detecting COVID-19 infection among migrant populations as lack of transparency in information and lack of institutional coordination are evidenced by Morales Chain\u00e9 et al. addresses the mental health symptoms that impacted the population suffering from COVID-19 and the need to target specific populations such as women with psychological care. Furthermore, Jaramillo et al. attests to the centrality of mental health issues to the pandemic. The article not only contributes evidence from the 794 screenings but also documents a unique strategy of bi-directional monitoring among non-specialized health personnel at the Health Windows and Mobile Health Units for the immigrant population that will allow the promotion and early care for mental health beyond the COVID pandemic. The impact of COVID-19 on the healthy development of adolescents is still an interrogation mark, evidence is key to understanding how long COVID-19 plays a role in depression and anxiety, and other acute and long-term illnesses. Nu\u00f1o V. L. et al. describes the procedure to gather evidence that in the future may inform policy in a multifaceted study of adolescents 12 to 17 years through intersectionality theory.Several articles in this Research Topic address the unique mental health impacts of the COVID-19 pandemic.  Rangel G\u00f3mez, Cruz-Pi\u00f1eiro, et al. concludes. Lower health insurance rates limited English proficiency, and fear of deportation and discrimination, among others, require public health organizations to adopt non-traditional engagement and outreach approaches such as Ventanillas de Salud (VDS) and Mobile Health Units (MHU) to engage effectively with these populations. Several articles in this Research Topic highlight factors, such as availability and health regulations, that negatively impacted the health of those populations with comorbid conditions such as diabetes, hypertension, and obesity. Infante et al. calls for an inclusive policy that, together with the assistance of civil society organizations, helped migrants to overcome barriers to service and make public health institutions more accessible.The articles in this Research Topic not only highlight the impact of the COVID-19 pandemic on the health of different populations in the border region and beyond but also highlight the challenges and limitations of public health efforts to ensure access to effective messages, services, and interventions. Migrant communities are fluid and require cultural humility from service provides and public health officials to create credible and culturally sensitive information as Improving Clinical and Public Health Outcomes through National Partnerships to Prevent and Control Emerging and Re-Emerging Infectious Disease Threats\u201d fostered a partnership among the Mexican Section of the USMBHC, the Latino Commission on AIDS (LCOA) and Alianza Americas (AA) to integrate their existing infrastructure and relationships with these communities into the COVID-19 response efforts. Rosales et al. describes the efforts of the Mobile Health Units (MHU) that formed and essential part of this cooperative agreement. Their work was guided by three strategies: disseminate and adopt; inform and adapt; and target and train; with the aim of improve health promotion and development of healthcare strategies as a direct response to health emergencies such as the COVID-19 pandemic.To address some of these limitations, the Centers for Disease Control and Prevention (CDC) funded several multi-year cooperative agreements with existing national networks serving immigrant communities across the United States with the goal of improving health promotion and response activities with limited English proficiency (LEP) Latino essential workers, their families, and the communities where they live. One such cooperative agreement, entitled \u201cJim\u00e9nez and Kozo. New collaborative models such as Ventanillas de Salud and Mobile Health Units reveal the importance of networks that allow putting forward preventive health activities for historically underserved populations as Rangel G\u00f3mez, Salazar, et al. describes.Collaborative approaches to support transborder communities during the COVID-19 pandemic were put in place all along the border region to address the health needs with proper communication, coordination, and collaboration as described by Fingesi et al. examines the need to analyze policy interventions to inform and evaluate the impacts of perceptions and experiences of COVID-19.Mobile Outreach Vaccination and Education for Underserved Populations (MOVE UP) as well as Mobile Health Units institutionalized a network of collaboration to bridge the health equity gap for disadvantaged populations such as American Indians, Hispanics, and Blacks as is the case in Arizona. Frontiers not only identifies health impacts of COVID-19 but helps to build an evidence-base for diverse strategies to improve access to culturally competent health services for historically underserved populations. If translated into practice, the collaborative efforts and models discussed in this Research Topic will serve to build a more inclusive Public Health infrastructure to address endemic health inequities as well as better prepare society for the next pandemic.Latinx populations and immigrant communities experienced higher rates of infection, were overrepresented in essential jobs and were often excluded from government assistance programs such as unemployment benefits and health insurance subsidies or coverage. Furthermore, limitations of public health institutions to effectively address factors such as limited English proficiency, rural locations, and other structural barriers to health complicated access health information, interventions, and care during the COVID-19 pandemic. This issue of All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication."
\ No newline at end of file