diff --git "a/deduped/dedup_0274.jsonl" "b/deduped/dedup_0274.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0274.jsonl"
@@ -0,0 +1,35 @@
+{"text": "As there are a number of ways to divide up the anatomical structure of an organism, each may be represented by more than one valid partonomic (part-of) hierarchy. This raises the issue of how to represent and integrate multiple such hierarchies.Anatomy ontologies play an increasingly important role in developing integrated bioinformatics applications. One of the primary relationships between anatomical tissues represented in such ontologies is In this paper we describe a solution that is based on our work on an anatomy ontology for mouse embryo development, which is part of the Edinburgh Mouse Atlas Project (EMAP). The paper describes the basic conceptual aspects of our approach and discusses strengths and limitations of the proposed solution. A prototype was implemented in Prolog for evaluation purposes.With the proposed name set approach, rather than having to standardise hierarchies, it is sufficient to agree on a suitable set of basic tissue terms and their meaning in order to facilitate the integration of multiple partonomic hierarchies. Drosophila, zebrafish and C elegans, can be found on the Open Biological Ontologies web site ; hasPart.TID1 TID2;\u2022 TID2 is an immediate part of TID1, i.e. For the evaluation of the name set representation, we use an extended version of the tissue predicate (view handling is ommitted from the protoype description to keep our examples simple) :ext_tissue.\u2022 S, T, FN: as above;\u2022 NSp: positive name set of tissue represented by a list ;\u2022 NSpL: length of NSp;\u2022 NSn: negative name set of tissue represented by a list ;\u2022 NSnL: length of NSn;For example, the embryo mesenchyme tissue of Figure ext_tissue.Tp Tc is true:The following Prolog clause is used to determine whether subPart :-ext_tissue,ext_tissue,NSpLc > NSpLp,ord_subset,ord_disjoint.proper subset relationships.Predicates ord_subset and ord_disjoint from the Prolog library were used to implement the set theoretic aspects of the representation. Although these predicates support ordered sets, this is not required for our representation (but there were no unordered set predicates in the library). NSpLc > NSpLp is required to enforce Tp Tc is true:The following two Prolog clauses are used to determine whether not_immediate_subPart :-subPart,subPart.immediate_subPart :-subPart,not not_immediate_subPart.The Prolog implementation given is not particularly efficient and there are a number of optimisations that could be put in place. However, as the purpose of the prototype was not to deliver a robust application for end-users, but a reference implementation of the proposed approach for evaluation purposes, it proved entirely sufficient.The paper makes no claims over the relative merits of different implementation strategies for the proposed approach. Alternatives to Prolog include using a relational database system or an ontology language, such as OWL (more details of OWL available from W3C ). The laFor evaluation purposes, a number of tests were carried out on the name set representation of the Mouse Atlas anatomy. These are discussed here, together with some general observations about the proposed approach.The first assumption that must hold is that no two tissues (at any given stage) have the same name set representation. This was tested usingtest1 :-ext_tissue,ext_tissue,T1 not = T2.test1 returns no, i.e. no two different tissues with the same name sets were found, as required.To test whether all part-of relationships can be reconstructed from the name set representation, we usedtest2 :- immediate_subpart, not hasPart.test3 :- hasPart, not immediate_subPart.Both, test2 and test3 return no, i.e. the name set representation does not lead to any part-of relationships that are not intended (test2), and all existing part-of relationships are found through the name sets (test3), as required.group in EMAP. A recently identified need for a group has been for all  tissues at Theiler stage 17. Using predicateThe smallest form of part-of hierarchy integration is the addition of a new tissue node, which is equivalent to adding a immediate_subPart_ns.\u2022 S: stage ID;\u2022 NSp: positive name set of new tissue node (group);\u2022 NSn: negative name set of new tissue node (group);\u2022 T: tissue ID of immediate sub-part of tissue identified by name sets and stage;we can write a \"query\" in the form:immediate_subPart_ns, tissue,writeName(FN), nl, fail.and obtain the following result:  ...Similarly, using predicate immediate_superPart_ns, we obtain:immediate_superPart_ns is analogous, and its Prolog implementation very similar, to immediate_subPart_ns. Details are, therefore, omitted.The correctness of these results was confirmed by one of the biologists who created EMAP. Other, similar tests, worked equally well. A constraint put on all of these cases, however, is that the name set of the new group tissue must only contain names that are already used in the existing hierarchy.This raises the question of how to deal with the introduction of new component names. For example, the addition of a group  cannot automatically be carried out, since the existing hierarchy does not use head in its name sets. For the integration to work, it is first necessary to add head to the appropriate name sets in the existing hierarchy. This can be done at the highest appropriate levels, since sub-parts inherit all name set elements from their super-parts, and may therefore not require as much effort as one initially expects.For the head example, however, we did identify two additional problems which are likely to be typical in this context. Firstly, some agreement needs to be reached as to what in fact is considered to be part of the newly introduced tissue. In our example: how much of the neck is anatomically considered to be part of the head? The second problem deals with the fact that an existing tissue may need to be divided further in order to obtain the appropriate subparts for the newly introduced tissue. For example, the carotid artery runs from the head into the body of the mouse embryo, i.e. only a part of carotid artery is actually part of the head. Hence, the carotid artery needed to be divided into two subparts, one for the head section of it, one for the rest. In our name set approach, the former contains head in its positive name set, while the latter contains head in its negative name set. Of course, only the head section part becomes part of the head. Neither of these two problems presents any direct consequences for our approach.O1 includes midbrain as one of the parts of the brain, but no further detail, and O2 is a brain anatomy ontology that divides the midbrain into cerebral aqueduct, floor plate, lateral wall, etc., then we would find {brain, central nervous system, embryo, midbrain, mouse, nervous system, organ system} as the positive name set for midbrain in O1, and {brain, cerebral aqueduct, midbrain} as the positive name set in O2, resulting in {brain, central nervous system, cerebral aqueduct, embryo, midbrain, mouse, nervous system, organ system} \u2013 the union of these previous two name sets \u2013 as the representation of midbrain in the merged ontology. The meaning of the component names in the intersection of the two original names sets, {brain, midbrain} must have been used in a consistent manner for the merger to work, though many of the component names will differ across the ontologies, because of the different levels of granularity, e.g. the terms nervous system and organ system are unlikely to be found in the brain specific ontology. When merging ontologies of different granularity, the same principle as before applies: shared component names must be used in a consistent manner. Assuming ontology component names thus far, shows that some of them have additional structural complexity and if one wishes to take advantage of the semantics of these complexities, the proposed name set representation would need to be extended. For example, at Theiler stage 18 the tissue  has two subparts, called  and . The naming, hence, reflects lineage relationships between tissues, and the identity of a tissue is partially established by that relationship. Although extensions to the name set representation could be developed to allow the inclusion and subsequent reasoning over such information, it would lead to a semantic overloading of the name sets and for simplicity are, therefore, not considered further \u2013 the (component) name is treated as an atomic string describing a tissue, while the lineage relationship is modelled externally to the name sets.Taking a closer look at these \"basic tissue terms\", called Theoretically, merging two part-of hierarchies can be accomplished by systematically (top-down) adding each tissue from one hierarchy into another, i.e. conceptually the problem can be reduced to iteratively adding \"group nodes\" as discussed above.part-of relationships specified. Instead, a much more flexible solution is offered without having to sacrifice the interoperability across multiple data sets annotated with these anatomical concepts.The approach discussed in this paper will not work where there has been no agreement on the basic component terms, and as such is different from already existing work on merging autonomous ontologies. This raises two questions: what is the basis on which these terms should be agreed and what benefits are to be obtained from the proposed solution if such agreement has to be reached before these partonomic hierarchies can be merged. With respect to the first question, if a basic term, for example skin, exists, then it must be possible to dissect the mouse to a level that separates all the corresponding tissue from the rest of the mouse tissues, e.g. separate all skin tissue from the rest of the mouse. Other examples of basic terms are, therefore, head, skeleton, limb and forelimb. At this point scientists are then free to use combinations of these terms (for the positive and negative name sets) to describe the anatomical concepts they are interested in, e.g. {head, skin} to refer to the skin of the head. The different anatomy hierarchies created by different scientists can then be automatically merged using the approach proposed in this paper. Hence, to answer the second question from above, the benefit of our solution lies in the removal of the need for multiple scientists to agree on a single anatomy partonomy where all tissue concepts are defined and their Essentially, the solution is based on the transitivity property of the structural part-of relationship. As such, one could imagine implementations other than the one based on name sets to achieve the same result. The basic idea, however, would be the same. Using the name set concept makes the solution more directly accessible to biologists, who are more familiar with naming anatomical concepts than using computer generated IDs. We believe that the same approach may be applicable in other ontology areas, which have similarly transitive relationships, but since we have not tested this idea, we shall not elaborate on it in this paper.part-of relationships. Some preliminary studies suggest that where there are different types and these types are organised in an is-a hierarchy, the proposed integration mechanism will still work at the level of the common part-of type. For example, let H1 be a part-of hierarchy based on part-of-type-1, and let H2 be a part-of hierarchy based on part-of-type-2. If both, part-of-type-1 and part-of-type-2, are specialised versions of the more general part-of-type-0, i.e. part-of-type-1 is-a part-of-type-0 and part-of-type-2 is-a part-of-type-0, then we can use the proposed approach to integrate H1 and H2. The integrated hierarchy, however, would only support part-of-type-0 semantics. Our work in this area is still in its early phase and beyond the scope of this paper. Further details will be reported elsewhere.Also, the work described here only deals with the integration of hierarchies that are based on the same type of The work presented in this paper has focused on the issue of integrating different partonomic hierarchies in one species, mouse. We note that a similar approach may be useful when trying to integrate partonomic hierarchies across different organisms. This is subject of current research work, however, and will be reported on separately.part-of. For any given organism, however, there is more than one way to divide it into parts and subparts, thus leading to more than one valid partonomic hierarchy. To be able to interoperate between bioinformatics resources that make use of these anatomy ontologies, the corresponding hierarchies must be reconciled in some way. The paper addresses the problem that unique identifying names for tissues often reflect the partonomic hierarchies in which they are used. Although these names are in fact ordered sets (the order implying a particular hierarchy) of \"component names\", the order in these sets is not necessary to uniquely identify any tissue. Also, the sets of components in names can be used to derive all part-of relationships in the hierarchy. Based on these observations, we have developed a name set representation which facilitates integration of different partonomic hierarchies. Although this does not eliminate the requirement to agree on a set of suitable basic tissue terms and their meaning, it does remove the need to standardise the partonomic hierarchies. The proposed approach has been tested for the anatomy ontology of the Edinburgh Mouse Atlas. A Prolog prototype was implemented for evaluation purposes.Anatomy ontologies play an important role in bio-medical informatics. One of the key relationships modelled in such ontologies is that of 1Tj is a direct subpart of Ti, if Tj is part of Ti and there is no other tissue Tk such that Tj is part of Tk and Tk is part of Ti. If such a tissue Tk exists, Tj is an indirect subpart of Ti.AB developed the name set representation, implemented the prototype and carried out parts of the evaluation. YY provided input with respect to the current implementation of EMAP and EMAGE in relation to the proposed name set representation. DD carried out part of the evaluation process. RB contributed to the development of the name set representation. DD and RB are overall project leaders of EMAP and EMAGE. All authors have contributed to the writing and/or revision of the paper."}
+{"text": "The Adult Mouse Anatomical Dictionary was developed to provide an ontology for standardized nomenclature for anatomical terms in the postnatal mouse. The ontology will be used to annotate and integrate different types of data pertinent to anatomy. We have developed an ontology to provide standardized nomenclature for anatomical terms in the postnatal mouse. The Adult Mouse Anatomical Dictionary is structured as a directed acyclic graph, and is organized hierarchically both spatially and functionally. The ontology will be used to annotate and integrate different types of data pertinent to anatomy, such as gene expression patterns and phenotype information, which will contribute to an integrated description of biological phenomena in the mouse. An important role for biological databases is the integration of different types of data. Ontologies aim to overcome the semantic differences encountered in data collection and representation, providing common terminology in order to facilitate this integration. An anatomy ontology is a structured vocabulary of anatomical entities in which the terms have unique identities and relate to each other in meaningful ways. For many biological applications, anatomy ontologies are essential for standardized description of data directly related to anatomy, such as gene expression patterns and phenotype information.The Gene Expression Database (GXD) is a resource for gene expression information from the mouse . GXD hasCritical to this effort was the realization that existing sources of controlled vocabularies for anatomy were not sufficient for use with the adult mouse, for several reasons. First, none conforms well to the structure of the embryonic mouse anatomy ontology created by our Edinburgh collaborators, an important factor in enabling planned integration between these ontologies (see below). Human-oriented anatomical ontologies have been developed  , OpenGalis-a and part-of relationships. The ontology is organized hierarchically in both spatial and functional ways, and contains more than 2,400 unique anatomical terms for the postnatal mouse. As GXD is part of the larger Mouse Genome Informatics (MGI) system, the ontology will also be used to annotate other types of data pertinent to adult mouse anatomy in order to provide an integrated description of a wide array of biological phenomena in the mouse.Another major consideration involved determination of the hierarchical structure and format of the ontology. Our experience using the developmental ontology made it clear that a mechanism to provide alternative hierarchies would be a critical factor. Consequently, the Adult Mouse Anatomical Dictionary is structured as a directed acyclic graph (DAG) in which an anatomical term can be represented as a child of more than one hierarchical parent term using both GXD has extensive experience with the Mouse Embryo Anatomy Nomenclature Database, available through Theiler Stage (TS) 26, which is used by GXD and EMAGE to describe developmental gene expression patterns. Based on our annotation work, we continue to contribute to this ontology in the form of extensions and revisions, and by adding synonyms. Consequently, an early objective was to ensure that the anatomy ontology for the postnatal (TS 28) mouse corresponds as much as possible, both in content and in structure, with the developmental ontology. This was done for consistency of nomenclature, because we were familiar with and confident of the utility of this format, and to facilitate the future integration of these ontologies. Eventually, the goal is to combine and integrate the ontologies to generate an anatomy ontology covering the entire lifespan of the laboratory mouse.With the developmental ontology as its framework, the effort was then focused on compiling an extensive list of anatomical terms for the postnatal mouse. The list was based on a number of major sources, including mouse atlases as well as anatomy and histology text resources -22. For Once the basic list of terms had been generated, we confirmed that each term on the initial list represented actual mouse structures. These determinations were usually clear but at times ambiguous. For example, for numerous structures described in anatomy and histology textbooks, no clear documented evidence was found for their existence in the mouse. Consequently, these have not been included in the ontology. Further work is ongoing to ensure accuracy. Careful attention was paid to validating each term, with the requirement for two or more reliable sources whenever possible. Concurrent with the textbook-based identification of terms was the continuing effort to expand the vocabulary using a research data-driven approach. This method included extensive evaluation of published biomedical research literature, as well as data with anatomical attributes that have been collected in scientific databases. For example, several mouse-specific datasets -26 were epithelium and mesenchyme, as well as defined cell type structures such as purkinje cell layer. In addition, we have also elected to include the term unfertilized egg and its synonyms.An additional consideration in determining the content of the vocabulary had to do with whether to include cell types. While cell type information is an important component in anatomical descriptions, this also introduces a level of complexity that is difficult to address adequately. We felt that it would be unfeasible to extend the representation to the cellular level owing to the large number of required hierarchical levels and leaf nodes. Therefore, it was concluded that the adult mouse anatomy ontology would not contain cell types, but that cell type terms would eventually be provided by the orthogonal controlled vocabulary for cell types currently being developed as part of the Open Biological Ontologies (OBO) effort . Howeverfemur is placed in the hierarchy according to this limb bone's spatial location, as a substructure of the upper leg, rather than as a part of the skeleton. In contrast, the brain is described as being part of the central nervous system, rather than as a part of the head. Based on our experience with the developmental ontology and anticipating planned revisions for it, we decided to represent the adult mouse anatomy ontology as a DAG, in which a given anatomical term is able to have more than one hierarchical parent. This allowed us flexibility in organizing the hierarchies, and provided a mechanism to create a more comprehensive view of the relationships between the anatomical terms.The anatomy ontology for mouse development is currently structured as a straight hierarchy. In this format, an anatomical term can have only one parent and, thus, one place in the hierarchy. For example, the term body, body cavity/lining, head/neck, limb and tail. Accordingly, terms defined by these superstructures are primarily organized according to spatial localization. In contrast, another branch of the hierarchy is indicated by the superstructure organ system, where the anatomical terms are organized, as much as possible, according to their respective contribution to a specified functional system.For each of the anatomical terms being evaluated, any one of a number of pathways to that term could be conceptualized. However, it also soon became apparent that two fundamental characteristics could be determined for most of the terms: its spatial location within the animal and its functional contribution as part of a particular organ system. Consequently, we decided to use the distinction between spatial versus organ system representation as an organizational principle. Since 'spatial part' does not itself represent a unique anatomical entity, it was not included as an independent node in the ontology. However, the initial division of the hierarchy into spatial and organ system components is immediately apparent in the first level of substructures below the root node, TS28. As shown in Figure Currently, the distinction between spatial and functional relationships is represented only implicitly. However, based on the parentage of anatomical structures, biologists will be able to intuitively discern both types of relationships. Furthermore, they should be able to perform most of the queries related to expression and phenotype data that are currently envisioned. Explicit representation of both relationship types might be a desirable feature for advanced knowledge representation and computational analysis. On the other hand, it might also introduce unnecessary complexities to a biologist because, for example, many anatomical structures would have both spatial and functional relationships between them. Shielding the user from those complexities would require additional software development. A careful evaluation of the advantages and disadvantages of both approaches will direct our future work in this area.blood vessel, bone, connective tissue, muscle, nerve, organ and skin, which are represented as terms in the organ system part of the hierarchy. To accommodate the need to represent these tissues in specific body regions, we devised modules  rather than as an adjective  whenever possible.During the construction of the adult mouse anatomy DAG, we had to take into account the fact that terms representing some tissues would logically be spatially located in numerous parts of the ontology. Groups of tissues which meet this criteria include: heart  so that it becomes easy to interpret and use the term unambiguously.Our experience with the mouse developmental ontology, as well as extensive literature review, provided the primary basis for the naming conventions that were employed. Early in building the ontology, we realized that consistent nomenclature, not only for a given term itself but for related terms and groups of terms, would be a critical requirement. Consequently, whenever possible, the same name was used for a given anatomical structure or concept throughout the ontology. For instance, we have used the term Other factors that were considered were the requirements of the DAG-Edit software (see below), as well as features promoting unambiguous identification of terms. Additional conventions employed for the naming of anatomical terms included: structure names are preceded by superstructure names, in noun form; terms are used in singular form, whenever possible; all term names at the same level in the hierarchy are ordered alpha-numerically; and all characters are in lower case. Nomenclature consistency will also facilitate querying for specific anatomical terms within the ontology.An ontology should contain a level of detail appropriate to the data being classified and the level at which queries are likely to be performed, while simultaneously providing sufficient flexibility to enable regular updating without needing to significantly modify the hierarchies. Therefore, we recognized that the adult mouse anatomy ontology would require a format that was both robust and flexible, as well as the tools to accommodate the need for maintenance and updating. The DAG-Edit tool developed by the Gene Ontology (GO) Consortium provides a graphical interface to handle any vocabulary that has a DAG data structure, and has been used by other groups to build ontologies for a wide range of biological subjects, including the GO  and MammWe have developed an ontology containing more than 2,400 unique terms to provide standardized nomenclature for anatomical structures in the postnatal mouse. The Adult Mouse Anatomical Dictionary can be accessed at the MGI web site . The MGIlimb in Figure derived-from types of relationships linking anatomical structures at subsequent developmental stages. Such relationships will allow querying for progenitor and derivative tissues. These associations will also enable analysis of differentiation pathways, thus enhancing the ability to explore biological phenomena occurring in the mouse.We will continue to expand and refine the Adult Mouse Anatomical Dictionary in response to additional sources of information, as well as the needs of the scientific community. As part of the ontology's ongoing development, we plan to: expand the list of terms, based on additional resources as they become available; further edit the hierarchies when necessary; and provide alternative names for terms as synonyms. A limited number of synonyms have already been included  incorporates or associates relevant terms from the adult anatomy ontology into the Mammalian Phenotype Ontology, which is being developed to provide standard terms for annotating mouse phenotype data. Eventually, the standardized anatomy terms will be used to directly link gene expression and phenotype annotations within MGI via the anatomy. The mouse anatomy ontology is also being used to annotate phenotype data for the Eumorphia project . In PathAnatomy is an important biological integrator. Like expression data, many biological processes and phenotypic observations relate to specific anatomical structures. We have successfully promoted the idea that such data should be described using the same anatomical descriptors. Specifically, we have shown that this can be achieved by describing more complex types of biological information in a modular fashion by combining terms from orthogonal vocabularies . The com"}
+{"text": "Prior research has shown a higher prevalence of substance use and mental disorders among sexual minorities, however, the influence of sexual orientation on treatment seeking has not been widely studied. We use a model of help-seeking for vulnerable populations to investigate factors related to treatment for alcohol or drug use disorders and mental health disorders, focusing on the contributions of gender, sexual orientation, and need.N = 2,074).Survey data were obtained from a population-based probability sample of California residents that oversampled for sexual minorities. Logistic regression was used to model the enabling, predisposing, and need-related factors associated with past-year mental health or substance abuse treatment utilization among adults aged 18\u201364 (Compared with individuals without a diagnosed disorder, those with any disorder were more likely to receive treatment. After controlling for both presence of disorder and other factors, lesbians and bisexual women were most likely to receive treatment and heterosexual men were the least likely. Moreover, a considerable proportion of sexual orientation minorities without any diagnosable disorder, particularly lesbians and bisexual women, also reported receiving treatment.The study highlights the need to better understand the factors beyond meeting diagnostic criteria that underlie treatment utilization among sexual minorities. Future research should also aim to ascertain the effects of treatment provided to sexual minorities with and without diagnosable disorders, including the possibility that the provision of such treatment may reduce the likelihood of their progression to greater severity of distress, disorders, or impairments in functioning. It is generally understood that the great majority of individuals with psychiatric disorders, including both mental and substance use disorders, do not receive treatment for them -3. Many Prior epidemiological surveys, both population-based and respondent-driven, have shown that minority sexual orientation populations report higher rates of drug use and related problems than do others ,10. FindAdditional evidence comes from a population-based survey of women aged 18 to 29 in low-income neighborhoods in Northern California; women who reported having both male and female sexual partners had significantly higher rates of injection drug use compared with others . SimilarElevated rates of some common mental disorders among sexual orientation minorities have also been demonstrated . Using tSeveral explanations have been posited for the generally higher prevalence of both substance use and mental health disorders among sexual minority populations. One study using national survey data showed that women who reported same-sex sexual partners spent more time in bars and party settings, and that these women consumed more alcohol in these settings, compared with exclusively heterosexual women . AlthougOthers studies have documented a link between having a sexual orientation minority status and exposure to life stressors, often stemming from experiences of discrimination and stigma , antigayFindings suggest that patterns of mental health and substance misuse treatment utilization among sexual minority groups differ from those of heterosexuals. For example, in a study using the 2000 National Alcohol Survey, Drabble and colleagues found that although lesbian and bisexual women had lower abstention rates overall, they were also more likely to report alcohol-related problems  and to have sought help for an alcohol problem . Hughes In contrast, studies of mental health services utilization have shown that lesbians tend to utilize mental health services at higher rates and for longer duration as compared with heterosexual women . One stuTaken collectively, these findings suggest that help seeking for mental health and substance abuse problems may be differentially influenced by sexual orientation status and gender. However, much of this work has been hampered by small sample sizes and limited assessment of clinical disorders. Further, sexual minorities who are also ethnic minorities face additional barriers to seeking health services and are less likely to receive care .The goal of the present paper is to examine the relationship of gender and sexual orientation with treatment utilization for psychiatric problems, including both mental health (MH) and alcohol and drug (AOD) disorders. We apply the Gelberg-Andersen Behavioral Model for Vulnerable Populations . This moCalifornia Quality of Life Survey , which is a follow-back to the 2003 California Health Interview Survey (CHIS). The parent CHIS is a stratified multistage random-digit telephone health surveillance interview of more than 42,000 adults aged 18 years and older that has been conducted every other year since 2001. Information collected covers a wide range of topics, including health status, health conditions, health-related behaviors, health insurance coverage, access to and use of health care services, and the health and development of children and adolescents.Data for this study come from the The CalQOL follow-back survey used a subsample of the original CHIS survey sample to obtain more detailed information about specific topics . The overall CHIS response rate was 34% (using the American Association for Public Opinion Research Response Rate 4 method), which is consistent with other recent random-digit telephone interviews. In the CHIS, all adult respondents aged 18 to 70 years were asked about the genders of their sexual partners during the past year, and those aged 18 and older (with no age limit) were asked about their sexual orientation identity. Seventy-six percent of respondents were willing to participate in additional health surveys. From the CHIS sample, 4165 individuals were selected by probability methods. Eligibility was determined by having completed either a CHIS interview in either English or Spanish; a willingness to be recontacted; and an over-selection for sexual orientation minority status. Of these, 2322 individuals were successfully interviewed between October 2004 and February 2005 (56% response rate using the American Association for Public Opinion Research Response Rate 1 method).The current study used data from 2074 individuals who were aged 18 to 64 years at the time of the CalQOL interview. Individuals aged 65 and older were excluded due to the nature of the study question  because insurance coverage in the United States is nearly universal after age 65 and may thereby mitigate other factors related to treatment utilization. Overall, the weighted sample was approximately half male (48.5%) and half female (51.5%). The ethnic/racial distribution was 55.6% White, 29.8% Hispanic, 5.9% African American, 7.8% Asian/Pacific Islander, and less than 1% Native American. About half of the sample was between the ages of 30 and 50, with a mean age of 40.7 [SD = 12.4] years. There were no significant differences between men and women in mean age or race/ethnicity classification. A majority (72.4%) were currently employed, although a smaller proportion of women than men were employed . Most of the sample (81.2%) had health insurance (includes both public and private insurers). Nearly two thirds of the sample (64%) had at least some college education, with a slightly higher proportion of men than women having completed a college degree or more . A majority of the sample (64.3%) were currently married or living with a partner, with no significant difference observed between men and women.Treatment received was assessed by a question asking whether the respondent had \"received any treatment for emotional, mental health, alcohol or other drug problems\" in the past 12 months. Overall, 29.3% of the sample reported having received treatment for these problems in the past year. Among those receiving any treatment, 2% reported an inpatient hospitalization for either AOD or MH problems, 37% reported outpatient MH treatment, 68% used a prescription medicine for MH problems, 5% had outpatient AOD treatment, 5% attended 12-step meetings for AOD problems, less than 1% were treated in residential rehabilitation programs for AOD problems, 27% received treatment for MH or AOD problems from a primary care provider, and 20% reported use of alternative therapies  .DSM-IV criteria  = 131.6, p < .0001). Similarly, there is a main effect of gender, with about one third of women (33.8%) and one quarter of men (24.5%) reporting receiving treatment in the past year . As would be expected, the rate of treatment received varied by disorder status, with 18.4% of those with no disorder, 37.2% of those with an AOD disorder only, 58.1% of those with a MH disorder only, and 73.4% of those with both types of disorders reporting having received some form of treatment in the past year .Overall, there is a main effect of sexual orientation on treatment received; 48.5% of lesbian/gay/bisexual individuals reported receiving treatment in the past year as compared to 22.5% of heterosexuals . Similarly, among women with a MH disorder only, a greater proportion of lesbian/bisexual women than heterosexual women had received treatment (71.6% vs. 55.1%). There were no significant differences in treatment received by sexual orientation among women with an AOD disorder only or with both an AOD and MH disorder.Among men without a disorder, a greater proportion of gay/bisexual men than heterosexual men reported receiving treatment in the past year (30.7% vs. 9.5%). The same pattern was observed among men with a MH disorder only, with 70% of gay/bisexual men and 41.9% of heterosexual men having received treatment. There were no significant differences in treatment received by sexual orientation for men who had an AOD disorder only or had both an AOD and MH disorder.2 = 0.279). Among the predisposing variables, older age increased the likelihood of receiving treatment (adjusted OR = 1.01). As compared with Whites, Hispanics (adjusted OR = 0.46), African Americans (adjusted OR = 0.34), and Asian/Pacific Islanders (adjusted OR = 0.29) were all less likely to have received treatment. Considering enabling characteristics, we observed no independent significant differences in treatment received by employment, insurance, education, level of social support, or marital/partner status.We next developed a logistic regression model testing the independent contributions of predisposing, enabling, and need-related factors on past-year treatment utilization in which we contrasted the reference group for gender/sexual orientation status. In Table p < .0001). However, given the small cell size of two of these categories (AOD only and combined AOD and MH disorders), these estimates are less stable.The presence of a MH and/or AOD disorder significantly increased the odds of receiving treatment (adjusted OR = 6.2). In another set of models (data not shown), when the separate categories for MH and/or AOD disorders were entered (with the referent group set to \"no disorder\"), there was a graded relationship between type of disorder and treatment received. Individuals with only an AOD disorder evidenced a greater odds  of receiving treatment, as did those with only a MH disorder  and those with both an AOD and MH disorder  as compared to those with no disorder , when heterosexual women are treated as the referent group, both lesbians and bisexual women (adjusted OR = 2.08) and gay and bisexual men (adjusted OR = 1.57) had greater odds of receiving treatment, but heterosexual men had about half the odds of heterosexual women (adjusted OR = 0.57). As shown in Model 2, in which lesbians and bisexual women were treated as the referent group, both heterosexual women (adjusted OR = 0.48) and heterosexual men (adjusted OR = 0.27) were less likely to report having received treatment. But there was no significant difference in the odds of treatment received between lesbians/bisexual women and gay/bisexual men. In Model 3, when heterosexual men were classified as the referent group, all other groups were significantly more likely to receive treatment .This study builds upon previous epidemiological studies that have shown higher prevalences of AOD and MH disorders among sexual minority populations ,11,13,15The greater propensity for treatment use among those possessing a minority sexual orientation may be related to several factors. These include differential norms that promote help-seeking among sexual minorities in general, particularly among lesbians and bisexual women, as well as higher exposure to discrimination, violence, and other stressful life events ,31,49-52As anticipated, rates of receiving treatment varied by severity of the disorders that occurred during the period of interest. It is reassuring, for example, that nearly three quarters of individuals meeting criteria for both substance use and mental health disorders indicated that they had received at least some services in the past year. At the same time, nearly 20% of individuals who did not have a diagnosable disorder in the past year reported having received some form of mental health and/or substance abuse-related services. This finding is consistent with national surveys showing that many individuals who receive mental health treatment do not have a diagnosable disorder , but mayNone of the enabling characteristics that have been associated with treatment seeking in other studies  were significantly related to treatment use in the multivariate models. It is possible that the effects of disorder and sexual orientation cancelled out any effects associated with these factors. However, we observed that ethnic/racial minorities were less likely to utilize mental health or substance use related services. This effect was found after controlling for differences in morbidity and other predisposing and enabling characteristics, including health insurance, which have been associated with underutilization of these services among ethnic minorities in prior research -66. AfriThis study encountered several limitations typical of telephone-based follow-back surveys. The California Quality of Life Survey sample was recruited by recontacting those 2003 CHIS respondents who had agreed to be recontacted, using the telephone number associated with the original interview. Loss to follow-up was most often due to mobility from the original residence and was associated with younger age. Thus our estimates of the relationship between age and treatment received may be imprecise; other factors associated with lack of contact for the follow-up survey may also have influenced the estimates derived from the study sample. Although the follow-back survey oversampled for sexual minorities, the cell sizes for groups defined by sexual orientation and type of disorder (particularly among those with an AOD disorder only or with both MH and AOD disorders) were small (approximately 78 cases). Hence, statistical power was somewhat limited and may have failed to detect some relationships among sexual orientation, type of disorder, and treatment received. Lastly, although the study findings may be generalized to the general population in California, the dependent variable of interest, treatment seeking, may be particularly influenced by the cultural context of California, in which therapeutic interventions are consistent with an overall \"therapy culture\" , thus liThe study provides important evidence of the differential effects of gender and sexual orientation minority status on the receipt of mental health and substance abuse treatment, beyond the influence of the presence of a diagnosable disorder and other factors that predispose individuals to seek treatment. The findings showed that minority sexual orientation predisposes individuals to seek out services, despite pervasive barriers that exist within the service delivery system that might even discourage their use by this population . The stuThe authors declare that they have no competing interests.CEG conceived the idea for the paper, directed the data analyses, and drafted the paper; LG conducted the statistical analyses and contributed to the interpretation of findings and writing of the paper; VMM collaborated on the design of the original survey study and contributed to the interpretation of findings and writing of the paper; SDC conceived and directed the original survey study and contributed to the interpretation of findings and writing of the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The extracellular ligand-induced extrinsic pathway of apoptosis is executed via caspase protease cascades that activate downstream effectors by means of site-directed proteolysis. Here we identify proteome changes upon the induction of apoptosis by the cytokine tumor necrosis factor\u2013related apoptosis-inducing ligand (TRAIL) in a Jurkat T cell line. We detected caspase-dependent cleavage substrates by quantifying protein intensities before and after TRAIL induction in SDS gel slices. Apoptotic protein cleavage events are identified by a characteristic stable isotope labeling with amino acids in cell culture (SILAC) ratio pattern across gel slices that results from differential migration of the cleaved and uncleaved proteins. We applied a statistical test to define apoptotic substrates in the proteome. Our approach identified more than 650 of these cleaved proteins in response to TRAIL-induced apoptosis, including many previously unknown substrates and cleavage sites. Inhibitor treatment combined with triple SILAC demonstrated that the detected cleavage events were caspase dependent. Proteins located in the lumina of organelles such as mitochondria and endoplasmic reticulum were significantly underrepresented in the substrate population. Interestingly, caspase cleavage is generally observed in not only one but several members of stable complexes, but often with lower stoichiometry. For instance, all five proteins of the condensin I complex were cleaved upon TRAIL treatment. The apoptotic substrate proteome data can be accessed and visualized in the MaxQB database and might prove useful for basic and clinical research into TRAIL-induced apoptosis. The technology described here is extensible to a wide range of other proteolytic cleavage events. Apoptosis is an essential cellular mechanism regulating normal physiological processes, for instance, in development , 2. As a3In vitro approaches such as the incubation of peptides or protein libraries with the active protease of interest have led to the identification of substrate motifs but do not necessarily represent in vivo events in the context of an intact cell intrinsic stimuli. Despite its importance for the development of cancer therapeutics, no global proteome study has characterized cleavage events induced by the extrinsic stimulus tumor necrosis factor\u2013related apoptosis-inducing ligand (TRAIL), apart from one targeted study focusing on cleavage kinetics  were treated with 50 ng/ml, 100 ng/ml, 200 ng/ml, or 500 ng/ml human TRAIL Apo-II ligand  or mock and incubated at 37 \u00b0C in 5% CO2 for 24 h. Cell growth was regularly examined, and cell morphology was checked using 5-h light microscopy and a cell counter . Based on these experiments, a concentration of 100 ng/ml was selected for further analyses.Jurkat T cells ; R&D Systems, Minneapolis, MN; 1 mg) 10 min prior to 5 h of incubation with 100 ng/ml of either TRAIL or mock. Cells were washed twice with ice-cold PBS, and cell pellets were frozen at \u221280 \u00b0C until further analysis using Western blotting.Jurkat T cells were treated with varying concentrations of the pan-caspase inhibitor z-VAD-FMK  was used. Cells were washed and resuspend in ice-cold water. An antibody mix for propidium iodide/Annexin V-FITC (1:20 propidium iodide and 1:100 Annexin-V FITC) was prepared and added to the cells in Binding Buffer. Cells were kept on ice until flow cytometric analysis. Cells were analyzed after 0, 1, 2, 4, and 5 h of TRAIL induction.TM devoid of arginine and lysine; Invitrogen) supplemented with 10% dialyzed fetal bovine serum (FBS) (Invitrogen) (10 kDa cut-off) and 1X penicillin/streptomycin. For SILAC labeling, arginine and lysine were added in either light  or heavy  forms to a final concentration of 33.6 \u03bcg/ml for arginine and 73 \u03bcg/ml for lysine. For triple labeling, cells were additionally cultured in medium containing Arg6 and LysD4 using the same concentrations. l-arginine (Arg0), l-lysine (Lys0), l-13C6-arginine (Arg6), l-D4-lysine (LysD4), l-13C615N4-arginine (Arg10), and l-13C615N2-lysine (Lys8) were purchased from Sigma-Aldrich. Prior to treatment, Jurkat T cells were grown for 8 to 10 passages in SILAC medium and tested for full incorporation.Jurkat T cells were cultured in RPMI medium (high-glucose GlutaMAX6 cells/ml) were treated for 5 h with 100 ng/ml TRAIL or mock in heavy and light medium. For the inhibition study, medium labeled cells were additionally pre-treated for 10 min with 50 \u03bcm z-VAD-FMK. TRAIL treatment was stopped by the addition of ice-cold PBS to the cells. Cell suspensions were centrifuged , and the supernatant was discarded. Cell pellets from the corresponding heavy and light cultures  were resuspended in a small aliquot of ice-cold PBS and combined in one tube. Cells were once more washed with ice-cold PBS and centrifuged. Cell pellets were shock-frozen in liquid nitrogen and stored at \u221280 \u00b0C.Equal numbers of Jurkat T cells . Protein concentrations were measured using a tryptophan-fluorescence assay. 150 \u03bcg of the samples were used for further analyses. Proteins were reduced with DTT (10 mm) for 45 min at room temperature, and reduction was followed by alkylation for 30 min in the dark (55 mm iodoacetamide).Proteins were extracted and digested following the first steps of the filter-aided sample preparation protocol . Cells wProteins were mixed with LDS sample buffer  and samples were boiled at 70 \u00b0C for 10 min. 50 \u03bcg of protein per sample were loaded on a polyacrylamide gel  in each of three adjacent lanes . Proteins were separated with 180 V for 45 min. Proteins were fixed and stained in the gel using standard protocols .18 StageTips  were used. For CASP8 detection, 12% NuPAGE Bis-Tris Gels (Invitrogen) were used. For PARP1 analysis, 4%\u201312% Bis-Tris gels were used. All gels were run with MOPS buffer. Proteins were transferred onto a nitrocellulose membrane using a vertical blotting system for 1 h at 100 V. Primary antibodies in 1% BSA or nonfat dry milk were added to the membrane for 1 h at room temperature or were left overnight at 4 \u00b0C. The second antibody  was added for 30 min to 1 h at room temperature. Antibodies were used as follows: PARP (46D11) rabbit mAb (Invitrogen), 1:1,000 in milk; caspase-8 (1C12) mouse mAb (Invitrogen), 1:1,000 in BSA; GAPDH rabbit, 1:1,000 in milk or 5% BSA (Invitrogen), 1:3,000 2nd Ab rabbit ; 1:10,000 2nd Ab mouse .Peptide mixtures were analyzed using nanoflow liquid chromatography (LC-MS/MS) on an EASY-nLC system ) on-line coupled to an LTQ Orbitrap XL or LTQ Orbitrap Velos instrument  thrm/z 300\u20131,650) were acquired in the Orbitrap analyzer after accumulation to a target value of 106 in the linear ion trap. Spectra were acquired with a resolution of 60,000 at 400 m/z. The 5 (LTQ Orbitrap XL) and 15 (LTQ Orbitrap Velos) most intense ions with charge states \u2265 +2 were sequentially isolated with a target value of 5,000 and fragmented using collision-induced dissociation in the linear ion trap with a normalized collision energy of 35%. The activation q was set at 0.25, and the activation time was set at 30 ms and 10 ms for the LTQ Orbitrap and LTQ Orbitrap Velos, respectively. The ion selection threshold was set at 500 counts for collision-induced dissociation MS/MS. Maximum ion accumulation times of 1,000 ms and 500 ms for full scans and 150 ms and 25 ms for collision-induced dissociation MS/MS scans were set for the LTQ Orbitrap XL and the LTQ Orbitrap Velos, respectively. The dynamic exclusion was 90 s with early expiration enabled . Standard MS parameters were set for all experiments as follows: 2.2 kV spray voltage; no sheath and auxiliary gas; 200 \u00b0C heated capillary temperature; predicted and normal automatic gain control enabled for Velos analyses ; 110 V tube lens voltage (LTQ Orbitrap) and 50% to 60% S-lens radio frequency level (LTQ Orbitrap Velos); if used, a lock mass of m/z 445.120024 was applied , light cultures were treated with mock, heavy cultures were treated with TRAIL, and medium cultures were treated with both z-VAD-FMK inhibitor and TRAIL.Raw files of each double- and triple-labeling Jurkat T cell experiment were analyzed together using the in-house-built software MaxQuant . Ea0 containing the uncleaved protein. The t test statistics were calculated between the ratios of peptides in slice s0 and ratios of peptides in slices s < s0, for which the average ratio was larger than 1.5. The statistical test was repeated 1,000 times with randomly permutated slices to evaluate the FDR. Finally, this value was corrected for multiple-hypotheses testing via the Benjamini\u2013Hochberg method . All ratios were converted into log2 values. Ratios of reverse labeling experiments were inverted beforehand. A protein was determined to be an apoptosis substrate if the peptides in the slices representing molecular weights smaller than that of the full-length protein were more abundant in apoptotic cells than in untreated cells. A statistical non-parametric test was applied to determine the confidence of the identification of cleaved proteins. In brief, for each identified protein group, the slice with the most peptides that had SILAC ratios smaller than 1 between TRAIL treated cells and untreated controls was selected as slice sg method .x-axis of the map represented the position of the peptide with respect to the protein sequence. The y-axis represented the slice in which the peptide was detected. The boxes were color-coded according to the ratio between TRAIL-treated and untreated cells. If peptides cleaved at the C-terminus of aspartic acid were identified, the corresponding cleavage site was marked by a solid line if the SILAC ratio of the cleaved peptide was greater than 1.5, and by a dotted line otherwise. Similarly, potential cleavage positions that matched the sequence motif x[ET]xD and known cleavage positions were marked in the plots as additional information for the reader. Protein sequences and domains were obtained from Uniprot web services.For each protein group, a plot presenting the identified peptides as boxes in a two-dimensional map was generated. The y-axis in the plots represented the estimated molecular weight. The mapping of slices to molecular weights was done via linear regression. For each protein group, the intensity-weighted average of slices, k = 1, \u2026, K enumerate the slices and ikI is the extracted ion current of protein i in slice k. The linear function ln(m) = a + bs with the parameters a and b was then fitted to the data ), where im is the molecular weight of protein i.The second http://maxqb.biochem.mpg.de. Instructions on how to use MaxQB for visualizing and extracting cleavage information are provided as supplemental information. In addition, all .m files for the MATLAB script are provided on the MaxQB web page to allow researchers to analyze their data with regard to proteolytic cleavage events (http://maxqb.biochem.mpg.de/mxdb/project/show/9213156110000).The MaxQuant results, the results of the filtered substrates including statistical information, and the list of known cleavage sites were uploaded to the publicly available database MaxQB . AdditioData were depicted using GraphPad Prism (version 5.04) and the free software environment R.Cleavage events are more likely to be detected in highly abundant proteins. In order to remove this effect of abundance as a confounding variable, we first generated a background distribution of the whole proteome data with an intensity distribution identical to that of the cleaved proteins. To this end, the intensity range was binned and each protein group from the whole dataset was randomly drawn with a probability equal to the proportion of cleaved proteins in the corresponding bin out of the total number of cleaved proteins. Fisher's exact test was then used to identify gene ontology categories that were significantly enriched or depleted (Benjamini\u2013Hochberg FDR = 0.02) in the cleaved population relative to the background population.A). We also included label-swap experiments as an additional check of the method .When proteolytically cleaved proteins change their molecular weight relative to their uncleaved counterparts, it can be detected in an SDS gel as a shift of the cleaved protein to a lower-molecular-weight region. We took advantage of this fact to extract information about cleaved proteins from complete proteome datasets. For direct comparison, we combined treated and untreated states in one quantitative SILAC experiment. As both samples were merged at the cell level, this eliminated errors arising from a lack of reproducibility and differences in sample processing. In our SILAC experiments, untreated cells were labeled with light RPMI medium  and cells used for treatment were labeled with heavy medium  before the induction of apoptosis A. We alsB). Peptides from the uncleaved protein are expected to be located in higher molecular weight regions and to cover the protein sequence without bias to sequence location. In contrast, cleaved apoptotic fragments of the same protein should migrate to a lower molecular weight region, and the identifying peptides should span only a certain part of the protein sequence in accordance with the cleavage position. The quantitative information obtained via SILAC labeling then provides a third dimension. These SILAC peptide ratios encode information about the extent to which the protein or fragment comes from the treated or untreated state. Peptides from the uncleaved protein are mainly derived from the untreated cells (negative treated/untreated ratio after log transformation) when they are from a high mass region, whereas peptides derived from corresponding cleaved fragments are mainly derived from the apoptotic state (positive treated/untreated ratio) if they are from the relatively lower gel position. The slice with the highest sequence coverage combined with a median log ratio around zero corresponds to the uncleaved protein. Slices at lower molecular weights with median positive ratios correspond to the cleaved fragments. The third dimension is represented in our plots as a heat map value . Importantly, the above-mentioned criteria should be fulfilled concurrently; that is, the uncleaved protein and its SILAC and sequence values should be consistent with the cleaved product or products and their location, SILAC ratios, and distributions of peptides in the protein sequence.We applied the SILAC-based approach to investigate cleavages induced by treatment with TRAIL. Populations of SILAC-labeled Jurkat T cells that had been treated with TRAIL or mock control for 5 h were merged, and their lysates were separated on one-dimensional SDS gels. To achieve high molecular weight resolution, we cut the gel into between 28 and 36 horizontal slices and followed this with standard in-gel digestion and LC-MS/MS analysis on ion trap Orbitrap instruments. Data were analyzed with the MaxQuant software as in our standard workflows; however, the output data were further processed in order to identify cleaved caspase substrates  by means of sophisticated filtering. For this processing step, we developed a statistical algorithm that specifically extracts proteins with a distinct peptide distribution pattern as a function of gel slice position. In-gel digestion of a particular gel slice creates peptides from the embedded proteins that represent a certain mass range (the apparent molecular weight of that gel position). The software provides the localization of all detected peptides from each protein in two dimensions: within the gel according to the apparent molecular weight region, and along the protein sequence according to the location of the identified peptide B. Peptidp values and an FDR for the significance of being a cleavage product . Only proteins with an FDR value below 5% were considered as significant candidates, and only for these were graphs created. We marked theoretically detectable peptides to give an impression of the highest possible sequence coverage of the protein. In addition to the experimental data, we also included data from the literature in the graphs. For instance, known cleavage sites of proteins in the substrate database that we created (see below), as well as possible cleavage sites following the x[ET]xD caspase cleavage motif, are indicated as red lines. Known domains of the protein derived from Uniprot are depicted as small blue boxes. In addition, we marked the specific protein position with a red line where peptides showed cleavage according to enzymatic digestion with Asp C. This is because caspase cleavage followed by tryptic digestion creates semitryptic peptides in shotgun proteomics experiments that, if detected, can mark the exact site of caspase cleavage. For these peptides, we distinguished cleavages with high confidence (ratio [log2] > 1.5) and intermediate confidence (ratio [log2] < 1.5); these values were chosen based on the distribution of known caspase cleavage products. For high-confidence cleavages, the explicit cleavage site is denoted in the output table, as well as the sequence window of \u00b13 amino acids surrounding the cleavage site. In addition, we calculated molecular weight distributions that relate the position on the one-dimensional SDS gel to the molecular weight of the proteins detected in the entire proteome dataset of this experiment. This relationship is depicted in Bsupplemental Fig. S1 and is used to provide a molecular weight scale on the right-hand y-axis of each plot. We further manually inspected the automatically filtered candidates for consistency across all six experiments (see below) and verified them for inclusion in the final substrate list.To statistically formalize these criteria, the software defines these cleaved and uncleaved regions of a protein and calculates A\u20132C) showed that this time point optimally covers both upstream and downstream apoptotic events , which should allow us to cover a broad spectrum of apoptotic cleavage events. In addition, the results of our H2O2 treatment\u2014an unspecific cytotoxic agent\u2014show that we clearly separated apoptosis from uncontrolled necrotic cell death (A and 2C).Because no global whole proteome studies had been reported on the specific proteolytic substrate spectrum of TRAIL-induced apoptosis, we treated Jurkat T cells with different concentrations of TRAIL and monitored their state over time via light microscopy . Based on the results, we chose a TRAIL concentration of 100 ng/ml and stimulation for 5 h. Microscopic, flow cytometric, and immunoblotting results A\u20132C showll death A and 2C.Next, we applied the above-mentioned conditions in a SILAC experiment treating Jurkat T cells for 5 h with TRAIL (100 ng/ml) and mock. We performed three biological double-labeling experiments and three biological triple-labeling experiments comparing TRAIL-treated and mock-treated states. In the triple-labeling experiments, we used only the light and heavy channels; the medium condition was additionally inhibitor treated, as mentioned below.supplemental Table S1).For substrate identification, we combined all six experiments. When we identified a candidate as significant in one of the experiments (FDR < 5%), the software created a three-dimensional cleavage plot for the other experiments (even if they were not significant) to allow better comparison among the different experiments. We derived significances for each plot from the FDR columns of the output of our script and counted how often each protein had been identified as statistically significant in the six experiments. In the final manual validation, only candidates with an appropriate peptide distribution pattern that were found to be significant at least three times were designated as TRAIL-induced apoptosis substrates and considered for further analyses . BID mediates the crosstalk between the extrinsic and intrinsic form of cell death via accumulation of its 15-kDa fragment tBid at mitochondria, initiating mitochondrial outer membrane permeabilization . To generate a list of known substrates for comparison, we accessed the caspase substrate database CASBAH . Cleavage substrates were distributed toward the higher abundant area of the complete proteome. This is not surprising as verification, as a substrate requires substantially more information than mere identification in the proteome. Interestingly, although our data are biased toward the more abundant part of the proteome, the substrates are relatively flatly distributed across the accessible abundance range. This shows that the tendency to be a caspase substrate is not strongly correlated with protein abundance, at least in the abundance range covered by this study.We next plotted the intensity distribution spanned by the complete proteome experiment in comparison with the intensity fraction covered by the statistically significant cleaved substrates C. CleavaB, S2Csupplemental Figs. S2).Detected substrates span a broad molecular weight range and encompass proteins ranging from about 20 kDa to up to 200 kDa. Nevertheless, very small proteins are underrepresented within the substrate population, which might be the result of limitations of the gel-based MS approach (A). Based on these results, we utilized a triple-SILAC approach treating SILAC-labeled cells with mock (light SILAC condition), TRAIL , or TRAIL (5 h) and z-VAD-FMK at 50 \u03bcm (medium SILAC condition). We performed three biological replicate experiments and analyzed the samples as described under \u201cExperimental Procedures.\u201d TRAIL-treated samples (heavy/light ratio) showed clear cleavage patterns , whereas inhibitor-treated samples showed no peptide ratio difference relative to the mock-treated population  (medium/light ratio). Note that peptides of caspase-dependent substrates such as PARP1 could also be found in molecular weight regions of the cleavage fragments; however, these have one-to-one SILAC ratios (0 in log2) between inhibitor-treated and control conditions, showing that they originate from background (TRAIL-independent) cleavage. Because all significant cleavage events were abolished by the inhibitor, we conclude that they all were caspase dependent.Proteolytic substrates are not necessarily the result of caspase cleavage; they also can be cleaved by other proteases, which could be either activated by or independent of upstream caspase cleavage. To verify that the cleaved substrates were truly caspase dependent, we incubated Jurkat T cells with the pan-caspase inhibitor z-VAD-FMK before treatment with TRAIL. We determined the best inhibitor conditions by using different concentrations of z-VAD-FMK and the known caspase substrate PARP1 A. Based supplemental Table S3. Several novel potential substrates such as the cell-growth-regulating nucleolar protein LYAR also were found in this way (A). For this protein, we mapped the cleavage site to the position D281 overlapping with the hypothetical cleavage motif x[ET]xD. A sequence logo analysis (B) supported earlier findings on intrinsically induced apoptosis that characterized cleavage motifs as diverse . Using this approach, we were indeed able to identify 93 explicit cleavage events in 86 proteins, including known ones that served as positive controls and novel ones. These sites, including the sequence windows of \u00b13 amino acids, are listed in this way A. For thanalysis B support diverse . We concC; supplemental Table S3). In 50 of these cases, the cleavage area overlapped with only one x[ET]xD motif (implicit sites). In 85 proteins, there was more than one motif in the cleavage area (area). In the remaining cases, a different cleavage motif was presumably used by the responsible protease.In cases when the caspase-cleaved peptide was not confidently identified, the cleavage event was often still mappable to a particular region of the protein. In 159 proteins, the cleavage was mapped to a region of about 100 amino acids . We found, for instance, two cleavage events in the DNA replication licensing factor MCM6, one of which was already known and could be mapped directly as an explicit site (D274). For the second cleavage, two possible motifs matched within the C-terminal region close to position 770. From the positions of the fragments in the gel, we determined that either or both cleavages can occur, indicating that there appears to be no preference for one of them as an initiator site (D). As either cleavage presumably inactivates the protein, such a cleavage pattern is functionally sensible for substrate inactivation.In several cases, we determined multiple cleavage events within the same protein D. We foutor site D. As eitAs these results show, our whole protein approach is not necessarily limited to the identification of cleaved proteins and in many cases might yield detailed information about the cleavage site or region. Even the identification of cleavage regions can already be of great importance for tracking the effect of the cleavage by providing information about cleaved domains or motifs, for instance.supplemental Table S4). In particular, many substrates belong to RNA-dependent pathways, endocytosis, spliceosomal, and cell-cycle-related processes. We next extracted protein populations enriched or depleted in our substrate population relative to the complete detected proteome using Fisher's exact test (Benjamini\u2013Hochberg FDR = 0.02). Because the substrate population is biased toward higher protein expression, as determined earlier (C), we first created a background protein population spanning the same intensity region as the cleaved substrates (A) to serve as a reference population. Interestingly, the substrates showed an asymmetric distribution between depleted and enriched categories . TRAIL-induced apoptosis appears to target a broad range of functions without strong preferences, whereas a small number of pathways and compartments were clearly selected against. The latter encompassed the endoplasmic reticulum, mitochondria, and inner membrane proteins in general, as discussed below.Bioinformatic analysis of our substrate proteome revealed that it covered a broad range of different pathways with known and novel substrates showing similar trends . In contrast, proteins intrinsic to membrane were significantly underrepresented, and proteins in mitochondria and endoplasmic reticulum were underrepresented by more than 200% within the cleaved substrate fraction . Proteins in endoplasmic reticulum and mitochondria might not be accessible to caspases, or they might not contain as many cleavage sites (cleavage motifs) because they have to fulfill important tasks in controlled cell death. In any case, this is an interesting observation given that mitochondria dynamics and fission are known apoptotic effects  , were siFig. 6 effects . RegardlC). Classical upstream (e.g. caspases) and downstream substrates  were observed with strong negative ratios, indicating that a large percentage of these substrates had been cleaved at this time point (5 h). In contrast, proteins in the right-hand peak had ratios around zero, indicating that most of these proteins remained uncleaved, even though fragments with clear positive ratios marked them as apoptotic substrates. Splitting the population into novel and known substrates showed a clear tendency of novel substrates toward the right-hand distribution . This might reflect the sensitivity of our approach, as proteins cleaved with lower stoichiometry are more difficult to detect. Bioinformatic analysis of the enrichment of protein classes within the two different peaks with a Fisher's exact test (Benjamini\u2013Hochberg FDR = 0.02) revealed that proteins in complexes were highly enriched in the right-hand peak . Thus complex members often appear to be cleaved with less efficiency than proteins not involved in complexes.The preceding analysis was focused on the identity of the substrate proteins only. In a next step, by evaluating the SILAC ratios of the apoptotic substrates at the gel positions of the full-length proteins (uncleaved ratios), we noticed that they displayed in all experiments a bimodal distribution C. Classisupplemental Fig. S4). The center of the interaction network was formed by Caspase-3 surrounded by many known substrates such as CASP6, BID, LMNB1, PAK2, and ROCK1. Novel substrates created additional links between known cleavage substrates but also spanned further networks at the periphery of the graph. Protein clusters highlighted interactions of ribosomal and nuclear pore proteins, as well as of proteins involved in protein biosynthesis, DNA replication, transcription, vesicle transport, and endocytosis, defined by both known and novel substrates. We also noticed entire macromolecular complexes, among which proteasomal proteins and the condensin I complex were prominent. The latter is of special interest because it plays a crucial role in the formation of structurally stable mitotic chromosomes and their segregation, as well as in gene regulation and DNA repair ) and visualized and analyzed results in Cytoscape (version 2.8.2). We grouped the substrates into known and novel proteins . To better understand the process of condensin I complex cleavage, we extracted the three-dimensional cleavage plots of all of its members. The known substrate NCAPH was strongly cleaved in the middle of the protein, as already described in the literature. However, our detected cleavage site (D380), which matches with a potential cleavage motif, does not overlap with the known cleavage site at D366. The novel substrates of this complex SMC2, SMC4, NCAPD2, and NCAPG showed cleavage at the N- or C-termini, resulting in a slight shift of the uncleaved protein. These substrates were cleaved with less efficiency than the known substrate NCAPH. Both structural maintenance of chromosome ATPase subunits (SMC2 and SMC4) have nucleotide-binding domains at their N- and C-terminus, termed Walker A and B motifs. Within each protein, these domains interact with each other and form so-called head domains. We detected cleavages in both proteins at their N- and C-termini. Interestingly, for SMC2 we could even map an explicit cleavage site at the C-terminal part of the protein located exactly within the Walker B motif at D1116. This is remarkable because ATP-binding pockets should be difficult to access. For NCAPD2 and NCAPG, we also detected cleavage at the N- and C-terminus, respectively. These cleavage sites appear to overlap with important intra- and intermolecular interaction sites of the other proteins of the complex. Interestingly, NCAPD3 from the related condensin II complex was cleaved as well. However, in this case we located this cleavage site at position D529 in the middle part of the sequence, rather than the termini. This might indicate different modes of association of NCAPD2 and NCAPD3 with their corresponding kleisin subunits.Interestingly, we identified not only NCAPH but also all other components of the complex as cleaved substrates after TRAIL induction  . Interessupplemental Fig. S6). As with the condensin complex, stoichiometries of substrate cleavages were relatively low. From the regulatory particles, we found the previously known substrate subunits Rpn2, Rpn3, Rpn10, Rpt1, Rpt5, Rpt6, and Rpt4, as well as the novel substrates Rpn5 and Rpt2  and PSMD4 (Rpn10) most probably recognize the polyubiquitinated proteins, whereas PSMD1 (Rpn2) most likely holds together the lid and the base of the 19S regulator particle . Their cThe SILAC ratios observed in our data are relatively low, suggesting sub-stoichiometric cleavage at different sites for each member protein of a complex. In order to compensate for this lower cleavage efficiency, caspases appear to cleave several members of the same protein complex, such as the proteasome, perhaps with a more robust inactivation effect as the cleavage of one specific protein.in silico derived site D169 and in an experimental follow-up defined it as the cleavage site of CASP8 leading to the inactivation of the autophagic process after TNF or TRAIL induction. Here, we also detected ATG3 cleavage after TRAIL induction in our Jurkat T cell system, and we identified a cleavage region including two possible sites, D169 being one of them . Furthermore, we mapped an explicit cleavage site of ATG3 at D104. That site had also been found in another study (The link between apoptosis and autophagy is also of special interest (see, for instance, Ref. er study , supportHere we have described a quantitative SILAC-based approach for the identification of proteolytically cleaved substrates and used it to investigate the events of apoptosis induced by the extrinsic stimulus TRAIL. Our approach uncovered nearly 700 cleavage substrates, a dataset that can serve as a resource for studying TRAIL-induced cleavage events for the community of cell death researchers. It also might be clinically relevant, because TRAIL is of great importance for cancer therapy research aiming to preferentially inducing apoptosis in tumor cells but not in normal cells , 53. In After this study was finished, Cravatt and co-workers incorporated SILAC into their PROTOMAP approach  and eleg"}
+{"text": "Increased fertilizer application, coinciding with high mowing frequency, reduced bryophyte species richness significantly. Accordingly, productivity estimates such as plant biomass and nitrogen concentration were strongly negatively related to bryophyte species richness, although productivity decreased only pleurocarpous species. Ellenberg indicator values for nutrients proved to be useful indicators of species richness and productivity. In conclusion, bryophyte composition was strongly dependent on productivity, with smaller bryophytes that were likely negatively affected by greater competition for light. Intensive land-use, however, can also indirectly decrease bryophyte species richness by promoting grassland productivity. Thus, increasing productivity is likely to cause a loss of bryophyte species and a decrease in species diversity.While bryophytes greatly contribute to plant diversity of semi-natural grasslands, little is known about the relationships between land-use intensity, productivity, and bryophyte diversity in these habitats. We recorded vascular plant and bryophyte vegetation in 85 agricultural used grasslands in two regions in northern and central Germany and gathered information on land-use intensity. To assess grassland productivity, we harvested aboveground vascular plant biomass and analyzed nutrient concentrations of N, P, K, Ca and Mg. Further we calculated mean Ellenberg indicator values of vascular plant vegetation. We tested for effects of land-use intensity and productivity on total bryophyte species richness and on the species richness of acrocarpous  and pleurocarpous  growth forms separately. Bryophyte species were found in almost all studied grasslands, but species richness differed considerably between study regions in northern Germany (2.8 species per 16 m Conservation of biodiversity is one of major ecological challenges nowadays In semi-natural grassland ecosystems, investigations on relationships between land use and plant species diversity have only seldom considered bryophyte diversity We investigated the diversity of bryophytes in 85 agricultural grasslands in two different regions in Germany. On these grasslands we assessed relationships between bryophytes, land-use intensity, and grassland productivity. We included aboveground vascular plant biomass, nutrient concentrations therein and mean Ellenberg indicator values for vascular plants to assess environmental and productivity-related impacts on bryophyte diversity Specifically, we addressed the following questions: i) Which major gradients of land-use intensity  affect occurrence and composition of bryophyte vegetation in agricultural grasslands? and ii) Which measures of productivity \u2013 biomass production, biomass nutrient concentrations, or Ellenberg indicator values \u2013 are most strongly related to bryophyte species richness? And third, as the most important question we ask: iii) How is the relationship between bryophyte vegetation and productivity in agricultural grasslands?Poa pratensis, Dactylis glomerata and Bromus hordeaceus. Among the herbs Taraxacum officinale, Cerastium holosteoides and Trifolium repens belong to the most frequent species. Plots were selected in a randomly stratified manner from a larger pool of 500 study plots per region to represent a wide gradient of land use typical for central European agricultural grasslands. Information on land use was inferred from standardized interviews with farmers containing detailed information on management practices of the last three years 2006\u20132008. For each plot we calculated mean intensities of grazing (number of livestock units \u00d7 days grazing \u00d7 ha\u22121), fertilizer application (kg N \u00d7 year\u22121 \u00d7 ha\u22121) and mowing (number of cuts \u00d7 ha\u22121 \u00d7 year\u22121) as given in Bl\u00fcthgen et al. (2012).The study involved 85 grassland plots of 50\u00d750 m size within two regions belonging to the setup of the long-term and interdisciplinary project of the Biodiversity Exploratories n\u200a=\u200a43; Schorfheide-Chorin: n\u200a=\u200a42) in April 2009, the season when bryophytes are most easily recognized. Bryophyte species richness was further separated into acrocarpous and pleurocarpous species (including liverworts) according to Hill et al. Following the nomenclature of Koperski et al. 2 as mixed samples of four randomly placed quadrates of 0.25 m2. Occasionally occurring shrubs and litter were excluded from the biomass sampling. Temporary fences prevented our plots from mowing and grazing before sampling took place. Biomass samples were dried for 48 h at 80\u00b0C, weighed, and ground to pass a 0.5-mm screen. Total nitrogen (N) concentrations were determined with an elemental auto analyzer . For the analyses of phosphorus (P), potassium (K), calcium (Ca) and magnesium (Mg) samples were digested in a microwave oven system  with concentrated nitric acid (65%) and hydrogen peroxide (30%) and analyzed by ICP-OES . All analyses were run in duplicates and repeated if results differed by more than 10%.From mid-May to mid-June, vascular plants were recorded at the same plots. Based on these vegetation relev\u00e9s, we calculated mean Ellenberg indicator values for nutrients, reaction, light, and moisture per plot without cover weighting Canonical correspondence analysis (CCA) based on presence-absence data was used to assess patterns and gradients in the composition of bryophyte vegetation and to relate those to significant environmental factors . Ordination was carried out with 83 relev\u00e9s including all bryophyte species that occurred more than once in the dataset (30 species) and additional down-weighting of rare species. Furthermore, we used bi-plot scaling to optimize ordination for species data. All involved environmental variables  were standardized prior analysis (z-transformation) and forward selection with Monte Carlo permutation test (499 runs) was performed to assess the significance of environmental factors (p<0.05). Further, inflation factors of significant variables were checked for co-linearity. Ordination was performed using Canocoo 4.5 Afterwards, we calculated Spearman rank correlations between axes scores and environmental variables.Because of partly correlated proxy variables for land-use intensity and productivity , we calculated three separate multiple regression analyses as linear models to test for their effects on bryophyte diversity. Prior to linear model calculations, species richness data were square-root transformed to achieve normal distribution. All statistical tests were carried out with JMP .Brachythecium rutabulum , Eurhynchium hians (57%), Amblystegium serpens (22%), and the acrocarpous Phascum cuspidatum (53%), Barbula unguiculata (28%), Bryum rubens (16%), and - only on drained fen soils - Physcomitrium pyriforme (16%). Generally, pleurocarpous species were more frequent than acrocarpous species  but also along the second axis  but also in nutrient supply as revealed by Ellenberg N indicator values  and N  and K concentrations  in vascular plant biomass . These emoisture . The secBryophyte vegetation was negatively affected by certain land-use measures . While tSr\u200a=\u200a\u22120.38; p<0.05) and a positive in Schorfheide-Chorin . As further implied by ordination analysis Click here for additional data file."}
+{"text": "Prostate tumor overexpressed 1 (PTOV1) was demonstrated to play an important role in cancer progression and was correlated with unfavorable clinical outcome. However, the clinical role of PTOV1 in cancer remains largely unknown. This study aimed to investigate the expression and clinicopathological significance of PTOV1 in breast cancer.The mRNA and protein expression levels of PTOV1 were analyzed in 12 breast cancer cell lines and eight paired breast cancer tumors by semi-quantitative real time-PCR and western blotting, respectively. Immunohistochemistry was performed to assess PTOV1 protein expression in 169 paraffin-embedded, archived breast cancer samples. Survival analysis and Cox regression analysis were performed to investigate the clinicopathological significance of PTOV1 expression.P\u2009=\u20090.003). Breast cancer patients with higher PTOV1 expression had substantially shorter survival times than patients with lower PTOV1 expression (P\u2009<\u20090.001). Univariate and multivariate analysis revealed that PTOV1 might be an independent prognostic factor for breast cancer patients (P\u2009=\u20090.005).Our data revealed that PTOV1 was frequently overexpressed in breast cancer cell lines compared to normal human breast epithelial cells and in primary breast cancer samples compared to adjacent noncancerous breast tissues, at both the mRNA and protein levels. Moreover, high expression of PTOV1 in breast cancer is strongly associated with clinicopathological characteristics and estrogen receptor expression status (Our study showed that PTOV1 is upregulated in breast cancer cell lines and clinical samples, and its expression was positively associated with progression and aggressiveness of breast cancer, suggesting that PTOV1 could serve as an independent prognostic marker. Human breast cancer is the most common carcinoma in females, and the second leading cause of cancer related mortality in women, accounting for approximately 29%  of all new cancer cases among women and 14%  cancer related mortality, representing a serious health threat to women worldwide [Prostate tumor overexpressed 1 (PTOV1), a 46\u00a0kDa protein with two repeated PTOV homology blocks, was first identified during a screen for genes overexpressed in prostate cancer . The PTOIn the present study, e aimed to investigate the expression of PTOV1 in breast cancer and its relationship with clinical parameters and prognosis in breast cancer patients. The results showed that PTOV1 is significantly upregulated in breast cancer, and overexpression of PTOV1 is closely associated with the clinical stage, T, N and M classification, and estrogen receptor (ER) expression levels in breast cancer. Cox regression analysis revealed that PTOV1 might be considered as an independent biomarker for breast cancer prognosis. Collectively, our findings strongly suggested that PTOV1 plays an important role in the development and progression of human breast cancer, and might be a useful predictive marker of prognosis in breast cancer patients.Primary normal breast epithelial cells (NBEC) were established according to a previous report . ImmortaA total of 169 breast cancer paraffin-embedded specimens from female patients, which had been histopathologically and clinically diagnosed as breast cancer at the Cancer Center, Sun Yat-sen University from 2003 to 2007, were used in the present study. Tumor grade and stage were defined according to the 6th edition of the TNM classification of the Union for International Cancer Control . For the use of these clinical materials for research purposes, prior patients\u2019 consents and approval from Sun Yat-sen University Cancer Center Institutional Review Board were obtained. Clinical information on the samples is summarized in Table\u00a0-\u25b3\u25b3Ct method described by the previous report [Total RNA from cells and fresh surgically obtained tumor tissues and their adjacent noncancerous tissues was extracted using the Trizol reagent  according to the manufacturer\u2019s instruction. The extracted RNA was pretreated with RNase-free DNase, and 2\u00a0\u03bcg of RNA from each sample was used for cDNA synthesis primed with random hexamers. For PCR amplification of PTOV1 cDNA, an initial amplification using PTOV1 specific primers was done with a denaturation step at 95\u00b0C for 10\u00a0min, followed by 28\u00a0cycles of denaturation at 95\u00b0C for 60\u00a0s, primer annealing at 58\u00b0C for 30\u00a0s, and primer extension at 72\u00b0C for 30\u00a0s. Upon completion of the cycling steps, a final extension at 72\u00b0C for 5\u00a0minutes was done before the reaction was stored at 4\u00b0C. Real-time PCR was applied to measure the fold of increase of PTOV1 mRNA in each of the primary breast tumors relative to the paired normal breast tissue obtained from the same patient. Real-time PCR primers were designed using the Primer Express v 2.0 software (Applied Biosystems). The sequences of real-time PCR primers were: PTOV1 Forward: CGAGTACAGGAGCATGAGCA and Reverse: CTTCACCAACAGAGACTGCG; GAPDH Forward: GACTCATGACCACGTCCATGC and Reverse: AGAGGCAGGGATGATGTTCTG. Expression data were normalized to the geometric mean of housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to control the variability in expression levels and analyzed using the 2s report , and allCells were washed twice with ice-cold phosphate-buffered saline (PBS), then lysed on ice in radioimmune-precipitation assay  buffer containing complete protease inhibitor cocktail  and heated for 5\u00a0min at 100\u00b0C. Fresh tissue samples were ground to powder in liquid nitrogen and lysed with SDS-PAGE sample buffer. Equal protein samples (30\u00a0\u03bcg) were separated on 10.5% SDS polyacrylamide gels and transferred to PVDF membranes . Membranes were blocked with 5% fat-free milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1\u00a0h at room temperature. Membranes were incubated with anti-PTOV1 antibody  overnight at 4\u00b0C, and then with horseradish peroxidase-conjugated goat anti-rabbit IgG . To evaluate PTOV1 expression, enhanced chemiluminescence system (ECL) prime Western blotting detection reagent (Amersham) were used according to the manufacturer\u2019s instructions. \u03b1-Tubulin  was used as a loading control.Immunohistochemical analysis was done to measure PTOV1 protein expression in 169 human breast cancer tissues. Briefly, paraffin embedded specimens were cut into 4\u00a0\u03bcm sections and baked at 60\u00b0C for 2\u00a0hours, followed by deparaffinized with xylenes and rehydrated. Antigenic retrieval was done by submerging the Sections into EDTA antigenic retrieval buffer and microwaving. The sections were then treated with 3% hydrogen peroxide in methanol to quench the endogenous peroxidase activity, followed by incubation with 1% bovine serum albumin to block the nonspecific binding. Sections were then incubated with anti-PTOV1 rabbit polyclonal antibody  overnight at 4\u00b0C. For negative controls, the primary antibody was replaced by normal goat serum. After washing, the tissue sections were treated with biotinylated anti-rabbit secondary antibody (Abcam), followed by a further incubation with streptavidin-horseradish peroxidase complex (Abcam). The tissue sections were immersed in 3-amino-9-ethyl carbazole and counterstained with 10% Mayer\u2019s hematoxylin, dehydrated and mounted in Crystal Mount.The degree of immunostaining of the sections was viewed and scored separately by two independent investigators, who were blinded to the histopathologic features and patient data of the samples. The scores were determined by combining the proportion of positively stained tumor cells and the intensity of staining. Scores given by the two independent investigators were averaged for further comparative evaluation of the PTOV1 expression. The proportion of positively stained tumor cells was graded as follows: 1 (<\u200910% positive tumor cells), 2 (10-50% positive tumor cells), 3 (50-75% positive tumor cells), and 4 (>\u200975% positive tumor cells). The intensity of staining was recorded as following: 0 (no staining), 1 , 2 , and 3 . The staining index was calculated as the product of the proportion of positive cells and the staining intensity score. Cutoff values to define the high and low expression of PTOV1 were chosen based on a measure of heterogeneity with the log-rank test statistics with respect to overall survival (OS). An optimal cut-off value was identified: a staining index score of greater or equal to 6 was used to define tumors with high PTOV1 expression and a score less than or equal to 4 indicated low PTOV1 expression.P-values are two-sided. A P-value of less than 0.05 was considered statistically significant in all cases.All statistical analyzes were carried out using the SPSS 16.0 statistical software packages. The chi-square test and Fisher\u2019s exact test were used to analyze the correlation between PTOV1 expression and the clinicopathologic characteristics. Bivariate correlations between study variables were calculated by Spearman\u2019s rank correlation coefficients. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. The significance of various variables for survival was analyzed by univariate and multivariate Cox regression analyzes. All reported To explore the potential role of PTOV1 in the tumorigenesis of breast cancer, the expression of the PTOV1 protein and mRNA were determined by western blotting and real time-PCR. Higher PTOV1 protein expression was observed in all 12 breast cancer cell lines compared with that in two primary cultured normal human mammary epithelial cells (NMEC), in which it was weakly detected  . The archived tissue came from 30 patients with stage I cancer, 81 patients at stage II, 53 patients at stage III, and five patients at stage IV. As shown in Table\u00a0P\u2009=\u20090.005), T classification (P\u2009=\u20090.048), N classification (P\u2009=\u20090.035), M classification (P\u2009=\u20090.021) and estrogen receptor (ER) expression levels (P\u2009=\u20090.003), but not significantly associated with age, progesterone receptor (PR) expression levels and c-erbB2 expression levels. Moreover, Spearman correlation analysis suggested that the PTOV1 expression level was markedly associated with clinical stage , T classification , N classification , M classification  and ER expression levels    and clinicopathological characteristics: pT status (P\u2009=\u20090.006), pN status (P\u2009=\u20090.001) and PR expression (P\u2009=\u20090.017), which showed significant effects on overall survival by univariate analysis, were included in multivariate analysis (Table\u00a0P\u2009=\u20090.005).Univariate and multivariate Cox proportional hazard regression analysis were performed to identify the independent prognostic value of each variable for predicting overall survival in patients. PTOV1 expression (is Table\u00a0. As expeP\u2009=\u20090.026) and III\u2013IV , indicating that PTOV1 could be considered as a valuable prognostic marker for breast cancer in all disease stages     Figure\u00a0D, lymph ) Figure\u00a0E and pM0) Figure\u00a0F. HoweveP\u2009<\u20090.001), indicating that PTOV1 plays an important role in breast cancer progression. Furthermore, Cox regression analysis showed that higher PTOV1 expression was an independent prognostic indicator of shorter survival in breast cancer patients. These findings strongly suggested that lower expression of PTOV1 would provide a selective advantage in prognosis for breast cancer patients.In the present study, we provided the first evidence that overexpression of PTOV1 protein is associated with poor prognosis of breast cancer patients with both early- and late-stage disease. Our data showed that PTOV1 is upregulated in breast cancer cell lines and in clinical tumor specimens, at both the mRNA and protein levels, compared with normal breast epithelial cells and normal breast tissues, respectively. Moreover, the analysis of 169 archived breast cancer samples revealed that PTOV1 expression is significantly associated with progression of breast cancer; a high level of PTOV1 might correlate with a shorter survival time  suggested that the expression level of PTOV1 might be a useful supplement to breast cancer hormone therapy decision-making. Thus, PTOV1 may be a useful marker for determining prognosis and guiding the follow-up schedule of breast cancer patients.Breast cancer patients with the same clinical stage, which is routinely classified by TNM stage system, often have distinct outcomes. This large difference indicates that the TNM stage system alone is not sufficient to fully predict the clinical outcome of breast cancer patients with regard to the heterogenetic biological characteristic of this malignancy. The ER is overexpressed in about 50% breast cancer patients and could be a prognostic indicator for breast cancer patients . HoweverOur study indicated that PTOV1 might positively regulate breast cancer development and progression, and is a useful indicator of poor prognosis and a prognostic marker for patient survival. However, the modulation of PTOV1 expression in this malignant tumor and its molecular mechanisms in breast cancer development and progression still require further investigation.In this study, we found that PTOV1 overexpression is correlated with breast cancer progression and progressive phenotype. Moreover, our data indicated that PTOV1 might be an independent prognostic marker on the whole group and subgroup analysis as well. Thus, PTOV1 protein expression might be a useful marker for stratifying breast cancer patientsprognosis as well as an effective novel criteria for selection of therapeutic options.The authors declare that they have no competing interests.FYLei carried out the Western blotting, and drafted the manuscript. LJZ collected the tissue specimens and patient information, and editing of the manuscript. XHL collected patient information and carried out the statistical analyses. XL carried out Immunohistochemical (IHC) analysis. SW carried out RNA extraction and real-time PCR. FYLi participated in designing the study and guiding editing the manuscript. JLL conceived the study and guided editing manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/14/457/prepubSubtype classification and ER, PR, HER2 and P53 status in breast cancer cell lines.doc.Click here for file"}
+{"text": "Breast cancer is the most frequently diagnosed cancer and the leading cause of mortality in females worldwide. Despite the great improvement in survival rates the last two decades, relapsed disease with metastasis still remains the most poorly understood aspect of cancer pathogenesis . ConsequIn vitro experiments showed that overexpression of LMTK3 accelerates the dispersion and invasion of breast cancer cells towards the matrigel and collagen, while it increases actin protrusions and focal adhesion formations on the edge of migrating cells. To address the underlying molecular mechanisms, a stable isotope labeling by amino acids in cell culture (SILAC)-based proteomics analysis was implemented to investigate the downstream components of LMTK3-regulated cascade. Interestingly, integrin subunits \u03b15 (ITGA5) and \u03b21 (ITGB1), central receptors in metastatic signal relay, were positively regulated by LMTK3, while high LMTK3 levels were also correlated with increased ITGB1 expression in breast cancer patient samples. In support of the role of LMTK3 in metastatic progression, a proof-of-concept in vivo metastatic mouse model was generated, after injecting parental T47D breast cancer cells and T47D cells overexpressing LMTK3 into the mammary fat pads of female NOD/SCID mice. Our preliminary results revealed that only the T47D-LMTK3 mice developed metastasis in the mammary fat pad after 7 weeks, suggesting the contribution of LMTK3 in metastatic potential (unpublished data).Cell migration and invasion are the early steps of the metastatic process controlled by cellular signals that stimulate changes in cell adhesion and cytoskeleton formation . We haveITGA5 and ITGB1 gene transcription. A set of gain- and loss-of-function experiments showed that LMTK3 could stimulate SRF indirectly through its action on cell division control protein 42 homolog (CDC42). However, other alternative mechanisms merit investigation, including the possibility that LMTK3 might activate SRF through direct phosphorylation. In support of this hypothesis, in silico analysis revealed potential phosphorylation sites of SRF targeted by LMTK3 that are currently under examination. Moreover, the topology of LMTK3 , implies that LMTK3 may be capable of shuttling between subcellular compartments upon specific stimuli  and other cellular conditions. Therefore, understanding the exact role(s) of LMTK3 in different cellular compartments is imperative. In order to characterize substrates phosphorylated by LMTK3, a high-throughput in vitro kinase assay screen is in progress that will further help us uncover the signaling pathways that LMTK3 is implicated in and decipher its contribution in disease.Similar to other RTKs, LMTK3 can directly interact with the adaptor protein GRB2, activate RAS-GTPase family members subsequently leading to upregulated serum response factor (SRF) activity, resulting in increased Furthermore, elucidating the upstream mechanisms of LMTK3-regulation is also essential. Till now, there have been no studies regarding the existence of any LMTK3-specific ligand(s) or other proteins  that can directly activate/inactivate the catalytic activity of LMTK3. Unraveling the upstream signaling and cross-talk pathways of LMTK3 would greatly improve our understanding of the underlying mechanisms that contribute to the regulation of LMTK3 and its involvement in invasion and metastasis Fig .In aggregate, based on our results so far, LMTK3 appears to be a promising new target against breast cancer progression and metastasis. Additional work is required to broaden our knowledge of LMTK3 functions at molecular and cellular levels. In parallel, a drug screening program will facilitate the identification of specific LMTK3 inhibitors, which could eventually aid to tackle breast cancer metastasis and endocrine resistance."}
+{"text": "AQP3 gene. The upregulation of AQP3 can influence the expression of molecules related to epithelial-mesenchymal transition and the reorganization of actin-cytoskeleton, resulting in enhancement of cell migration and invasion in ER-positive breast cancer cells.Accumulating evidence suggests that aquaporins (AQPs) may facilitate tumor development. The molecular pathways connecting the pathological functions of AQPs are unclear and need to be better defined. This study aimed to investigate whether AQP3, one of the AQPs expressed highly in breast cancer, had any clinical implication in estrogen-receptor (ER) positive breast cancer, and explore the regulatory mechanisms of AQP3 in estrogen-related breast cancer progression. Here we show that AQP3 is an important enforcer of migration and invasion in breast cancer. We, for the first time, reported that ER-positive breast cancer tissues obtained from premenopausal patients had higher AQP3 expression when compared to those obtained from postmenopausal patients. Estrogen directly upregulates AQP3 by activating ERE in the promoter of the  Breast cancer is the most common cancer in women worldwide. The majority of breast cancers are estrogen-dependent for tumor progressionAquaporins (AQPs) are a class of small integral membrane proteins distributed widely in organisms24710AQP3 gene, which might mediate estrogen-induced AQP3 expression, cell migration and invasion in ER-positive breast cancer.Recent studies showed that several kinds of tumors including breast cancer overexpressed AQP31213141516171Using immunohistochemistry (IHC) and immunoreactivity scoring system (IRS), we examined the expression level of AQP3 protein in breast invasive ductal carcinoma samples obtained from 56 patients. Before the IHC experiments, the AQP3 antibody had been proofed appropriately validated for IHC . Fig. 1 2), and found that treatment with 10\u22128 M and 10\u22127 M E2 for 48\u2009h significantly upregulated the expression level of AQP3 mRNA in ER-positive breast cancer cells , and, obtained six high-score putative EREs (AQP3 could be pulled down by ER\u03b1 antibody (2 (2 (2 had no effect on pGL3-AQP3-S5 and the mutated pGL3-AQP3-S6(m) (ACATGGCTaggCCTAG)  . This re2-induced migration, invasion and proliferation of ER-positive breast cancer cells, we transfected siRNA targeting AQP3 gene into T47D and MCF7 cells. Compared with the cells transfected with scrambled siRNA, treating T47D cells with AQP3 siRNA for 36\u2009h significantly reduced the expression level of AQP3 protein by 84.9% (2 (10\u22127 M) significantly promoted cell migration (2.14\u2009\u00b1\u20090.23-flod), invasion (2.12\u2009\u00b1\u20090.23-flod) and proliferation (1.21\u2009\u00b1\u20090.07-flod) in T47D cells transfected with scrambled siRNA (2 group (vs. scrambled siRNA\u2009+\u2009E2 group). As shown in 2 group (vs. scrambled siRNA\u2009+\u2009E2 group). However, knockdown of AQP3 had no effect on cell proliferation (2 (10\u22127 M) significantly promoted cell migration (2 group (vs. scrambled siRNA\u2009+\u2009E2 group). As shown in 2 group (vs. scrambled siRNA\u2009+\u2009E2 group).In order to determine the role of AQP3 in Eby 84.9% . E2 , and 66.8% in CuSO4\u2009+\u2009E2 group (vs. E2 group). As shown in 4 significantly reduced 40.6% of the invaded cells in CuSO4 group (vs. control group), and 65.1% in CuSO4\u2009+\u2009E2 group (vs. E2 group).Pretreatment of CuSO7D cells . As showTo confirm that high AQP3 expression might play an important role in breast cancer progression, we overexpressed AQP3 in T47D cells. After AQP3 overexpression vector transfection for 48\u2009h, AQP3 protein level was significantly increased (161.9%), compared with control . As show2 induced a marked reorganization of actin cytoskeleton characterized by formation of filopodia and rearrangement of stress fibers , CTNNB1 (\u03b2-catenin) and TJP1 (ZO-1), and, the mesenchymal markers CDH2 (N-cadherin), VIM (Vimentin), FN1 (Fibronectin 1), SNAI1 (Snail) and SNAI2 (Slug), between control and AQP3-overexpressed T47D cells by qPCR. As shown in CTNNB1) was decreased and two (CDH2 and SNAI1) were increased significantly (P\u2009<\u20090.05) in AQP3-overexpression group. The results were further verified by Western blotting analysis  or ER-negative breast cancer cell line (MDA-MB-231). Our data showed that E2 could upregulate AQP3 expression in ER-positive cells only, and the ER antagonist inhibited its enhanced effects. Estrogen exerts its effects by directly binding to ER, which homodimerizes and interacts with ERE in genes to stimulate the transcription of target genes. We, for the first time, found a functional ERE in the promoter region of the AQP3 gene. Although this sequence is exactly same as the canonical ERE (GGTCAcagTGACC), the 13-nucleotide (TGGCTaggTGACC) can form an inverted repeat just like the classical ERE. We are now fully persuaded the expression of AQP3 is under the direct control of estrogen.The mechanisms underlying the regulation of AQP3 expression are complex and unclear. It was reported that natriuretic peptides could upregulate AQP3 in human colonic epithelial cells11162-induced migration and invasion of ER-positive (T47D) breast cancer cells. Knockdown of AQP3 expression significantly attenuated migration and invasion of T47D cells, while overexpression of AQP3 promoted cell migration and invasion.On the other hand, we found that higher AQP3 levels were associated with poorer cell differentiation and more lymph node metastasis in ER-positive breast cancer patients, suggesting that AQP3 may be an enhancer in breast cancer progression. It has been shown that AQP3 might mediate FGF-2-induced cell migration in two representative breast cancer cell lines (MDA-MB-231 and Bcap-37)For metastasis to occur, tumor cells firstly detach from their tissue of origin, and then migrate and invade to another organ24293031in vitro cellular systems to show that AQP3 plays an important role in cell migration and invasion of ER-positive breast cancer. Our clinical data indicated that higher AQP3 expression in ER-positive breast cancer was associated with poorer cell differentiation, more lymph node metastasis and premenopausal status. We, for the first time, identified an ERE in the promoter of AQP3 gene, and found that estrogen might promote breast cancer development through activating ERE in the promoter of AQP3 gene and upregulating AQP3 expression in ER-positive breast cancer. Upregulation of AQP3 by E2 increases the cell migration and invasion through regulating the expression of EMT-related factors and influencing the reorganization of actin cytoskeleton. Hence, in our view, AQP3 might be a potential target for anti-breast cancer treatment. However, the precise molecular mechanisms of AQP3-induced cell migration and invasion are still incompletely understood. Further studies are encouraged to investigate the mechanisms.In conclusion, we used a combination of clinical patient samples and This study included Fifty-six patients  with breast invasive ductal carcinoma (IDC) confirmed by histopathological analysis after breast surgery at Women\u2019s Hospital, School of Medicine, Zhejiang University, China, between January 2011 and June 2012. Histopathological grade was determined by modified Bloom-Richardson-Elston grading system. These patients did not receive hormone treatment in the previous three months. The study was approved by the Ethics Committee of Women\u2019s Hospital, School of Medicine, Zhejiang University, and all patients provided the written informed consent for this study. All experiments were performed in accordance with relevant guidelines and regulations.2O2/PBS solution for 10\u2009min at room temperature in the dark to quench endogenous peroxidase. Then, sections were incubated with AQP3 primary antibody  at a 1:500 dilution overnight at 4\u2009\u00b0C. After several washes, 50\u2009\u03bcl of secondary antibodies  were added to tissues and incubated for 30\u2009min. After washing again, the sections were reacted with DAB, and, counterstained with hematoxylin. Immunostained sections were reviewed and scored semiquantitatively by expert pathologists on the basis of a well-established immunoreactivity scoring system (IRS)Breast samples were sectioned at 4 \u03bcm intervals. Sections were heated in citrate buffer for 20\u2009min for antigen retrieval, and, bathed in a 3% HIn order to validate the IHC results, the pellets of control, AQP3 knockdown and AQP3 overexpression T47D cells were embedded in the same paraffin block, and IHC was performed on the same panel. Cells were trypsinised and fixed for 3\u2009h in 10% formalin, centrifuged at 2000\u2009g for 10\u2009minutes, then washed twice with PBS and stained with eosin, and finally re-suspended in 3% agarose. The cell pellets were processed through gradient concentrations of alcohols before being cleared in xylene and washed in molten paraffin. These cell pellets were embedded in paraffin and IHC was carried out on 4\u20135 \u03bcm sections.2 treatment, cells were cultured in phenol red-free medium supplemented with 10% charcoal/dextran-treated FBS.Breast cancer cell lines, T47D and MDA-231 cells were obtained from the Key Laboratory of Cancer Prevention and Intervention, Ministry of Education, China, and, were cultured in RPMI-1640 and L-15, respectively, supplemented with 10% fetal bovine serum (FBS) and antibiotics. Before and during the E2O, 1.0\u2009\u03bcl cDNA. The thermal cycling conditions were: 95\u2009\u00b0C for 10\u2009s, 95\u2009\u00b0C for 5\u2009s, 60\u2009\u00b0C for 34\u2009s, and for 40 cycles. Every sample was repeated at least three times. Data were analyzed by the comparative threshold cycle (CT) method.Total RNA was extracted from breast cancer cells using RNAiso Plus  according to the manufacturer\u2019s instructions. The cDNA was prepared by reverse transcription, using RT reagent Kit (Takara). qPCR was carried out with SYBR-Green premix Ex Taq (Takara) in an Applied Biosystems 7900 Fast , using GAPDH as internal controls. Primer sequences used for qPCR are shown in Protein extracts from breast cancer cell lines were made in RIPA buffer containing protease inhibitors (1\u2009\u03bcg/mL leupeptin and 1\u2009\u03bcg/mL phenylmethylsulfonyl fluoride). The polyvinylidene fluoride transfer membranes containing separated samples were incubated with blocking buffer for 30\u2009min. The membranes were then incubated with primary antibody  overnight at 4\u2009\u00b0C, followed by horseradish peroxidase-linked secondary antibody (1:5000) for 1\u2009h at room temperature, and visualized with ECL detection reagent. The grayscale of bands was measured with Quantity One software.AQP3 gene to find high-score putative EREs. T47D cells were treated with 10\u22127 M E2 for 6\u2009h and cross-linked with 1% formaldehyde and processed. The ChIP analyses were performed according to the ChIP Kit Instruction Manual . Condition for sonication was 15\u2009sec pulse followed by 30\u2009sec rest, and power setting at 30%. ER\u03b1 antibody (Millipore) is functionally validated in the precipitation of ER\u03b1 associated chromatin. Purified immunoprecipitated DNA were used for RT- PCR and the PCR products were confirmed by sequencing. Primer sequences used for ChIP PCR are shown in The Regulatory Sequence Analysis Tools (RSAT) web server was used to analyze the promoter sequence of AQP3 promoter fragments containing an ERE-like sequence were gained from ChIP analyses. They were digested with XhoI and KpnI, and ligated into promoter-less luciferase reporter plasmid pGL3-basic  to construct the AQP3 promoter-luciferase reporter systems. Luciferase reporter systems  were transfected into T47D cells in 24-well plate. After transfection for 36\u2009h, cells were treated with or without E2 (10\u22127 M). Cell lysates were prepared, and, luciferase activities were measured using the dual-luciferase reporter assay system (Promega) according to the manufacturer\u2019s instructions. Luciferase values were normalized to the Renilla luciferase activity.AQP3 gene (100\u2009pmol/well) and siRNA negative control were purchased from RiboBio . For overexpression experiments, AQP3 overexpression vector (2\u2009\u03bcg/well) was purchased from OriGene . Cell transfection was conducted using Lipofectamine 2000  according to the manufacturer\u2019s guideline.T47D cells were seeded in 6-well plates. For knockdown experiments, siRNA targeting the 5/well) were seeded in 12-well plates pre-coated with 0.5% gelatin overnight at 4 \u00b0C. After pretreatment (knockdown or overexpression of AQP3), cells were cultured to confluence overnight. The monolayer cells were then scratched with a standard 200\u2009\u03bcl pipette tip, and washed twice with PBS to remove floating cells. After scratching the lines, cells were cultured in medium supplemented with or without E2 (10\u22127 M) for 24\u2009h. Mitocycin C (10\u2009mg/ml) was included in the medium to prevent cell proliferation. Wound healing was quantified by measuring the migratory distance of cells.T47D cells (1\u2009\u00d7\u2009105/well) were loaded in the upper chamber in culture medium with 0.2% BSA, and with or without E2 (10\u22127 M). Cell migration to the other side of the membrane was induced by 30% FBS-containing medium in the lower chamber for 24\u2009h. Cells were fixed in methanol for 30\u2009min, and stained with 0.5% crystal violet for 15\u2009min. After gently removing the cells on the up side of the top chamber, migrated cells were photographed and counted with Image-J software .A permeable filter of transwell system  was used to study the invasion ability of cells. The inside compartment of the transwell inserts was coated with Matrigel  at 4\u2009\u00b0C overnight, and then blocked by 1% BSA/PBS solution for 30\u2009min at room temperature. After pretreatment (knockdown or overexpression of AQP3), T47D cells (1\u2009\u00d7\u2009104/well) were plated in 96-well plates. After pretreatment (knockdown or overexpression of AQP3), cells were cultured for 24\u2009h in culture medium supplemented with or without E2 (10\u22127\u2009M). The MTT assay was applied to quantify cell proliferation, and, the absorbance of samples was measured at 490\u2009nm.T47D cells (1\u2009\u00d7\u2009104/well) were grown on coverslips and exposed to treatments. The fixed cells were blocked in 1% BSA and then incubated with a 1:300 dilution of primary AQP3 antibody at 4 \u00b0C overnight. They were then incubated with a 1:200 dilution of Alexa Fluor488 goat anti-rabbit IgG  for 1\u2009h. Actin-cytoskeleton was detected using rhodamine-conjugated phalloidin  diluted in phosphate buffer (50\u2009\u03bcg/mL). Confocal images were taken by Olympus microscope (BX61W1-FV1000).T47D cells ."}
+{"text": "The aim of the present Salmonella typhimurium was used to evaluate mutagenicity of experimental materials with and without S9 mix fraction. The materials tested in this study consisted of MTA, MTA/disodium hydrogen phosphate and MTA/silver nanoparticles at 0.1, 0.01, 0.001 and 0.0001 concentrations. Negative and positive control groups consisted of 1% dimethyl sulfoxide and sodium azide with 2-aminoanthracene, respectively. The number of colonies per plate was determined. If the ratio of the number of histidine-revertant colonies to spontaneous revertants of the negative control colonies was \u22652, the material was regarded a mutagenic agent. TA100 strain of  In all the concentrations of the three tested materials, the Ames test failed to detect mutations. Under the limitations of the present study, MTA/disodium hydrogen phosphate and MTA/silver nanoparticles were biocompatible in relation to mutagenicity. Enterococcus faecalis . Also, due to the results reported by Li et al. [17], the Ames was negative regarding the genotoxicity of silver nanoparticles and suggested that this result can be due to the inability of these nanoparticles to penetrate the bacterial cell wall.When ingredients are incorporated into a biomaterial to improve its properties, important factors that should be taken into account are the cytotoxicity and genotoxicity of the final product . StudiesSalmonella typhimurium assay or Ames test is a bacterial test widely used to determine the potency of substances that can produce genetic damage and gene mutations . In the present study, this test was used and none of the materials was shown to be mutagenic. In many studies, the biocompatibility of silver nanoparticles and disodium hydrogen phosphate was evaluated by placing their implants in the subcutaneous tissues of rats or in exposure with cells in the cultures media; the histological cross-sections showed the safety of these materials -15, 25. in vitro study, MTA/silver nanoparticles and MTA/disodium hydrogen phosphate had no genotoxicity at the concentrations used.Based on the results of the present"}
+{"text": "The promise of cell therapies is beginning to be recognized internationally. Cell therapy products (CTPs) are different from other drug products because many aim to be curative, and they are less comprehensively characterizable and more variable, sometimes being manufactured one lot at a time. They have complex mechanisms of action that remain incompletely understood. These unique features have led some regulators to take different approaches to cell therapy regulation in the form of special guidance for navigating regulatory frameworks that were originally intended for pharmaceutical drugs.A consideration for CTP developers is where to manufacture them, and under what circumstances. With few regulators developing manufacturing requirements specifically for CTPs, highly harmonized regulatory principles of Good Manufacturing Practice (GMP) for pharmaceuticals and biologics apply. However, what people mean when they say they make \u201cGMP grade\u201d CTPs remains ambiguous, and this confusion is exacerbated because most CTPs in early stage development are processed in whole or in part in academic hospital-based settings instead of industrial facilities.Since GMP guidelines were not originally written with CTPs in mind, the regulatory landscape has been influenced by \u201cmulti-level model of practice-driven institutional change\u201d . That isTo inject some clarity, stating that GMP is a grade of material is overly simplistic. Instead, GMP should be considered a product-specific assertion based on what is known about a product\u2019s relevant characteristics and a system of ensuring its quality and must be determined on a case-by-case, product-specific basis. This assertion can be substantiated, which may or may not include direct or indirect evidence of third party  review.Others have identified the need for CTP GMP and noted jurisdictional and study phase differences \u20135. From Canada states that CTPs are drugs that must be manufactured according to GMP requirements aside from specific sample testing and retention requirements, and that \u201cCell therapies will be held to increasingly stringent manufacturing controls as they are developed from early to late stage clinical trials\u201d .Division 5\u2014Clinical Trial Application of the Food and Drug Regulations. Regulator assessment of cell therapy clinical trial products against GMP principles is performed by Clinical Trial Application reviewers for all stages of clinical trial development. This is done by the Biologics and Genetic Therapies Directorate pre-market review group, who have the authority and specific training to conduct on-site inspections as required, and it does not typically involve Health Canada\u2019s establishment licensing group. As can be seen below, this is different from what is done by the US FDA and European Medicines Agency (EMA), who have compliance experts assess GMP for phase 2 and 3 clinical trial products, and for all clinical trial products, respectively.Health Canada\u2019s regulation surrounding cell therapy clinical trial manufacturing requirements is the most flexible and simplest to follow, but it lacks detail. Health Canada\u2019s approach stands out because the regulator does not require manufacturing establishments to register or obtain a license for their manufacturing establishment when they only produce products under Division 2\u2014GMPs that apply to fabricating material for use under Division 5\u2014Clinical Trial Applications; however, these establishments will only have evidence of regulatory approval of GMP in the form of a No Objection Letter for a specific clinical trial product manufactured in their facility.Any authorized clinical trial sponsor in Canada claiming to manufacture under GMP is accurately stating what they must do\u2014they must meet all principles of The US FDA relies on pre-market regulatory professionals to assess against GMP as part of a product-specific Investigational New Drug (IND) application for phase 1 studies (2)(B) of the Food, Drug, and Cosmetic Act). However, these studies are explicitly exempted from GMP regulations described in 21 CFR 211 unless and until they are used (or have previously been used) in phase 2 clinical trials or later, at which time they must Register the site with the US FDA . This reThe US FDA review of phase 1 studies is like what is done by Health Canada\u2014both are done in the context of an IND application context and rely primarily upon the available data that supports the safety, purity, identification, and strength of the new CTP . The US Phase 1 IND trial authorization is implicit evidence of meeting US FDA GMP standards, while later phase IND trial evidence of meeting US FDA GMP standards is explicitly found in the form of a site license, which can be searched on a US FDA database.lex specialis legislation specifically for advanced therapy medicinal products (ATMP). Together with legislation for Medicinal Products for Human Use and Investigational Medicinal Products (IMP), the ATMP regulations stipulate that an IMP \u201cshall be manufactured by applying manufacturing practice which ensures the quality of such medicinal products in order to safeguard the safety of the subject and the reliability and robustness of clinical data generated in the clinical trial (\u2018good manufacturing practice\u2019)\u201d (In the European Union (EU), the EMA, has developed ctice\u2019)\u201d . All IMPctice\u2019)\u201d . The Guictice\u2019)\u201d . Informactice\u2019)\u201d , 12.European Medicines Agency manufacturing authorization is issued by a competent authority of a Member State for all investigational products, regardless of the phase of study. This is dependent upon successful completion of an inspection, where the manufacturer demonstrates compliance with GMP principles and guidelines , 13 as wAs evidence of meeting GMP, anyone manufacturing an ATMP for clinical trials in an EU member state will be able to point to their site license in the EudraCT database.Despite differences in international regulatory approaches to requiring evidence of GMP compliance throughout product development, all manufacturers of CTP clinical trial materials must strive to meet GMP principles. While CTP manufacturing move through academic facilities into industrial facilities they need to meet the same performance-based GMP principles, using the same interpretive flexibility. This is because the safety of clinical trial participants is paramount, and any data developed in clinical trials is inherently more robust when one can be reasonably assured by evidence of the quality of a product that is manufactured consistently. Nevertheless, administratively different ways to assess GMP of CTPs at different phases of clinical study exist internationally and are relevant.While academic and industry manufacturing facilities are not (and should not be) inspected against different GMP standards or criteria, it makes sense that manufacturing facilities in Canada, the US, and the EU may be inspected differently at each phase of clinical development by different groups of professionals who have a variety of perspectives, expertise, training, and experience. Because of the contextual differences in centralized and country-wide control of GMP regulation, it seems sensible that the stringency for early phase clinical trials is higher for a centralized authority such as the EMA. The risk for different interpretations or standards of the GMP requirements between European member states needs to be managed when different authorities may be looking at clinical trial submissions; this early regulatory requirement can add confidence in product manufacturing. Without the need to address multiple regulatory bodies reviewing manufacturing materials, North American regulators can ease the regulatory burden of obtaining manufacturing site licenses.Regional differences in regulatory methods in Canada, the US, and the EU shape different approaches, making it possible that each review group will interpret GMP requirements for CTPs from their own unique perspectives. Since one can predict which group of professionals will assess against GMP principles , one can consider the implications of manufacturing in Canada, the US, or the EU. Assuming results from clinical trials in any ICH member country are equally supportive of later regulatory submissions, we suggest that having premarket cell therapy reviewers assess against GMP for phase 1 or 2 trials is preferable to having facility GMP experts assess cell therapy manufacturing facilities. The former is more likely to consider unique characteristics of CTPs  or a CTP (in particular) than the latter. Without mitigating circumstances, there are practical reasons to choose to manufacture early stage CTPs in Canada (phase 1 or 2) or the US (phase 1), where manufacturing is reviewed against GMP principles by pre-market review groups who are more likely to take a more tailored risk-based approach.PB planned, coordinated, and drafted this document. SK researched and drafted the FDA section. JJ researched and drafted the EMA section. LC revised the document and contributed to the FDA, EMA and Opinion sections.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Cannabis sativa has a complex history reflected in both selection on naturally occurring compounds and historical trade routes among humans. Iran is a rich resource of natural populationswhich hold the promise to characterize historical patterns of population structure and genetic diversity within Cannabis. Recent advances in high-throughput DNA sequencing technologies have dramatically increased our ability to produce information to the point that it is now feasible to inexpensively obtain population level genotype information at a large scale. In the present investigation, we have explored the use of Genotyping-By-Sequencing (GBS) in Iranian cannabis. We genotyped 98 cannabis samples 36 from Iranian locations and 26 accessions from two germplasm collections. In total, 24,710 high-quality Single Nucleotide Polymorphisms (SNP) were identified. Clustering analysis by Principal Component Analysis (PCA) identified two genetic clusters among Iranian populations and fineSTRUCTURE analysis identified 19 populations with some geographic partitioning. We defined Iranian cannabis in two main groups using the results of the PCA and discovered some strong signal to define some locations as population according to fineSTRUCTURE analyses. However, single nucleotide variant analysis uncovered a relatively moderate level of variation among Iranian cannabis. Cannabis sativa L. is a dioecious species in the Cannabaceae family1 with a broad global distribution which is likely the result of human cultivation. Humans have cultivated the plant as a source of fiber, food, medicines, intoxicants and oils for thousands of years2. This use and breeding has led to the selection of two distinct types of C. sativa, one for fibre and seed (hemp) and one for medicinal use (marijuana). While these types are morphologically similar, they are distinguished by the type and level of cannabinoids produced. Levels of two types of cannabinoids in particular are used to distinguish marijuana and hemp C. sativa. First, D-9-tetrahydrocannabinol (THC) is a psychoactive compound3 found in leaves and inflorescences (but not seeds) of juvenile and mature plants. The second compound, cannabidiol (CBD), is an isomer of THC found in all plant tissues, however, this cannabinoid does not activate cannabinoid receptors5. Marijuana varieties used for drug consumption are characterized by a high THC content, whereas fibre varieties (hemp) produce CBD as the predominant cannabinoid7.Cannabis since the Neolithic period with subsequent secondary domestication events in geographical regions outside of the accepted native range15. For instance, archaeological evidence for the pharmaceutical or shamanistic use of Cannabis has been found in cave artifacts that include a large cache of Cannabis dating to ca. 700 BCE16. This long history of use has resulted in a complex biogeographical history for this species. Based on polymorphism in RAPD markers, the Eurasian Steppe region of Central Asia has been recognized as a putative center of origin for Cannabis, spreading from there to the Mediterranean as well as Eastern and Central European countries, in particular, Afghanistan and Pakistan17. However, the genus has also been described has having two centers of diversity, Hindustani and European\u2013Siberian18. As with other cultivated plants it is difficult to pinpoint the exact place of origin for C.\u00a0sativa. It is likely that Cannabis spread to ancient Persia very early, assisted by Aryan and Scythian tribes expanding westward from central Asia. Evidence for this early spread comes from archeological studies of the Scythians, who occupied an area encompassing large swathes of what is now northwest Iran from the 7th century BCE to the 4th century CE, this culture was known to use Cannabis for entertainment and spiritual purposes. While all Iranian cannabis has been described as a complex of landraces of C. sativa, it is one of the countries with a high level of genetic diversity among cannabis populations19.Archaeological and palaeobotanical evidence supports the cultivation and use of C. sativa genomics and transcriptomics are, (1) Identification of sex determining regions23, (2) forensic investigations25, (3) selection of the chemotype and identification of hemp and marijuana types26, (4) DNA typing and genetic relatedness analyses27, and (5) the development of molecular markers for distinguishing hemp and marijuana genotypes as well as determining genetic structure and diversification through domestication30.Currently, the most important topics in C. sativa were published in 201131 and a large scale study of the genetic structure of marijuana and hemp types was published in 201530. Nevertheless, the phylogeography and domestication history of Cannabis remains poorly understood, in part due to limited access to genetic material from natural populations. Given that Cannabis is a native plant with a long history of cultural use in Iran, it is surprising that no studies of Cannabis diversity using molecular markers exist. Here we present an initial description of population structure and genetic diversity, between Iranian and global collections of Cannabis as well as within the Iranian collection. Specifically, we leverage genotyping-by-sequencing (GBS)32 to generate single nucleotide polymorphisms (SNPs) across a large collection of Iranian cannabis. GBS provides a robust, cost-effective alternative to other approaches and provide greater power to detect genome wide patterns associated with population structure and demographics than other molecular markers34.A draft genome and accompanying transcriptome of C. sativa Purple Krush and Finola reference genomes, respectively. These uniquely mapped sequence reads covered approximately 0.43% to 1.08% of Purple Kush genome (estimated size ~786.6\u2009Mb). Because the Finola genome assembly is incomplete (~221.4\u2009Mb), the percentage of genome representation was higher, from 1.26% to 3.08%.In total 98 cannabis samples were digested, sequenced, and genotyped these included, 70 samples representing 35 locations in Iran Fig.\u00a0, 2 sampl35. The number of markers ranged from 2.7 to 8.5 million with average distance of 5089\u2009bp and 2.4 to 6.8 million with distance of 780\u2009bp on Purple Kush and Finola genome, respectively.Sample level variation in the percentage of reads mapped to the reference Table\u00a0 revealed39. Tajima\u2019s D was calculated for the filtered SNPs with a mean of \u22120.18  across all samples  has been identified as a fiber cultivar41. CAN37 was previously described as hemp type and originating in France, however, Sawler et al.30 found that it was a distinct outlier and was more closely associated with marijuana and speculated that it could be a mislabeled sample. We also estimated genetic differentiation among marijuana and hemp accessions and Iranian samples and found a larger FST across hemp 0.086 than marijuana 0.039.Population differentiation resulting from genetic structure was estimated using F\u2009km Fig.\u00a0. Low val42 was evaluated on 13,325 SNPs that were identified across 209 samples  as another metric of genetic relationships among types and collections. Nei\u2019s genetic distance values ranged from 0.00496 to 0.01932 and largely reflected the DAPC analysis. Similar to Sawler et al.30, hemp showed the least genetic distance followed by germplasm collections from CGN and IPK. Marijuana and Iranian cannabis clustered together with genetic distances of 0.00496 and 0.00921, respectively, while the genetic distance between Iranian collections and hemp was estimated at 0.01469 , and C. sativa GBS data from Sawler et al.30  that failed to group with the two main clusters. Previous outliers from Sawler et al.30 were suggested to be sample error or misclassification (hemp vs. marijuana), our data suggests that CAN individuals 30 are more genetically similar to marijuana type accessions. To further elucidate genetic clustering identified by PCA, we performed a Discriminant Analysis of Principal Components (DAPC)44. Consistent with fineSTRUCTURE analysis . PCA using data from Iranian collections, CGN sis Fig.\u00a0, DAPC idsis Fig.\u00a0. Visualisis Fig.\u00a0.Figure 446, indicates an asymmetric sharing of alleles  compared to between population estimates  that marijuana and hemp are differentiated and identify Iranian collections as genetically more similar, yet distinct from, marijuana. This evidence provides support for the hypothesis that Iranian cannabis harbors unique genetic diversity and may represent a distinct genetic lineage of marijuana. Heterozygosity indicates levels of genetic diversity within populations, and has also been used to estimate genetic distance between populations50. Consistent with genetic diversity levels in the present study, previous estimates of heterozygosity across diverse marker types  typically identify higher levels of heterozygosity in hemp compared to marijuana53. However, it should be noted that one study found lower levels of heterozygosity in hemp varieties across 195 samples and 2894 SNPs29. It has been suggested that this may result from limited hemp sample representation in the collection29. Heterozygosity estimates within our Iranian collection were similar to those found by Sawler et al.30 for marijuana type accessions. If, as we surmise, Iranian cannabis are marijuana accessions, then these accessions likely represent remnants of cultivated germplasm from the other regions, possibly through migration of Cannabis from neighboring countries like Afghanistan and Pakistan into Iran. These results demonstrate that Iran is a public repository of marijuana genetic diversity; however, the loss of this unique germplasm is of great concern as there are no breeding programs and growing Cannabis is associated with strict legal penalties.Population analyses among all accessions sampled defined 4 distinct genetic clusters Figs\u00a0,4 and 5.Cannabis are wind-pollinated and highly heterozygous . We were able, however, to identify marijuana and fibre type specific markers through reanalysis of previously published data.In plants, the sex determination system is important for two reasons; first, understanding the role of sex determination in shaping plant evolution, and second, diversity in the mechanisms through which sex is determined. There have been many studies on gender in 30. Comparative analysis of Purple Kush (marijuana) and Finola (fibre) genomes revealed highly discriminative SNPs that are distributed across the genome and are not restricted to particular loci 31. While previous work focused on THC:CBD ratios and the associated B locus 41, recent work has identified SNPs in THCA and CBDA synthases associated with chemotype variation58. Thus, associating SNPs with active and inactive forms of THC and CBD synthases will continue to be a powerful tool for distinguishing Cannabis types. In this study, we identified SNPs that appear to be tightly linked to type, and are outside of cannabinoid genes, which should prove useful for future research. More immediately, these markers can be validated for early and rapid identification of marijuana and fibre type plants for current breeding programs.Our conclusions, consistent with previous studies, show that genetic differences between hemp and marijuana accessions are widely distributed across the genomeCannabis in Iran were identified and seeds were collected for growing in the field in university of Tehran. Sex identities were verified using taxonomic keys. A set of different accessions provided by CGN and IPK and one population from Afghanistan were used for analysis in this study as well (Table\u00a0https://cran.r-project.org/web/packages/raster/index.html) and Ggplot2 version 2.2.1 (http://ggplot2.tidyverse.org/reference/)59. Additionally Dplyr version 0.5.0 was used to manipulate the dataframes (https://cran.r-project.org/web/packages/dplyr/index.html).Natural populations of ll Table\u00a0, Fig.\u00a01.in silico digestion of the Cannabis genome sequence with PstI and ApekI to select the best restriction enzyme library preparation. Libraries were prepared using the GBS protocol published by Sonah et al. (2013). A 150 ng genomic DNA template was used to prepare the library using the ApekI enzyme. High-throughput was performed on an Illumina Hiseq. 2500, Rapid-run mode, single-end 100 base reads, at Duke Center for Genomics and Computational Biology.DNA was extracted using a Qiagen DNeasy plant mini-kit, from leaf tissue of one female and one male plant from each location. The isolation procedure was carried out according to the manufacturer\u2019s\u2019 guidelines. We performed 60 was used for demultiplexing of reads. Reads were organized into new files with adapter sequences removed, reads were discarded that were, shorter than 50 bases, and trim leading and trailing low quality regions (<Q30) by fastq-mcf, a widely available open source software61. To elucidate the relationship of Iranian cannabis with marijuana and fibre type accessions, we merged our data with marijuana and hemp data prepared by Sawler et al.30 (downloaded from NCBI SRA BioProject: PRJNA285813).After unzipping fastq.gz files to fastq files by gunzip command, the GBSX package62 was used to map reads of the individual genotypes to the reference genome with the default parameters. Reads mapped to Purple Kush  and Finola  C. sativa reference genome assembly separately which are known as high and low-THCA producing varieties respectively. The mapping outputs were used for removing unmapped reads to produce BAM files using Samtools63 and only reads mapping to a unique location in the genome were retained. Merging all BAM files into one stream by bamaddrg utility (https://github.com/ekg/bamaddrg), sorting and indexing BAM files by Samtools package63 were primary stages for use of FreeBayes64 to detect variants. Before running FreeBayes, we estimated the number of markers for each individual by \u201cbedtools genomecov\u201d65 and percentage of coverage by dividing marker number times read length by genome size. FreeBayes was run using default parameters. This was performed for or males and females and drug and non-drug types separately to find positions linked to gender and type. Bi-allelic, missingness, quality, and depth were filtered. The aim of the QC on SNPs was to define high quality set of individuals for analysis. Bi-allelic markers were identified by a command-line written in our lab. Then got vcflib freely available (https://github.com/vcflib/vcflib.git) packages to filter down the SNPs that had mapping quality <30 and read depth <5. This package can filter each position for each individual. Filtering was initially performed using VCFtools package66, VarFilter from BCFtools is freely available (https://github.com/samtools/BCFtools) packages. After screening a few markers we found that read depth and quality were not being appropriately filtered for our data set and therefore we opted to use vcflib. To filter missing data we used \u201c\u2013max-missing 1.0\u201d option in VCFtools package6. Finally, summary statistics were collected using vcf-stats before and after data filtering.In a high-throughput genotyping workflow, alignment of short reads to a reference genome is the first step after read processing and filtering. BWA64. After filtering variants for read depth (>5), read mapping quality (>30) and minor allele frequency (>2.5%), we generated allele frequency estimates and compared frequencies at the same position across the genome.Identification of DNA markers associated with gender and type was carried out based on comparison of SNP allele frequency differences between each group . To do this, we called SNPs for sample pairs female and male, marijuana and fibre, separately using FreeBayesST) using VCFtools66 among all wise locations in the Iranian collection and also between marijuana and hemp types. Estimation of heterozygosity for each individual was conducted with custom command-line scripts by dividing the number of heterozygous sites by the number of non-missing genotypes. The number of heterozygous sites was counted by vcflib tools. We pursued principal components analysis (PCA) to investigate genetic relationships using a distance matrix obtained by TASSEL version 567. Plotting PCA results was completed via the ggplot259 package in Rstudio version 0.99.902. We also applied discriminant analysis (DA) of principal components44 using the adegenet package68. Discriminant analysis can ascribe relationships for pre-defined groups without relying on a particular population genetics mode44. Files were read using the function read.vcf and converted into geneid objects with the vcfR2geneid function69. In DAPC, data is first transformed using a principal components analysis (PCA) and subsequently the number of genetic clusters was assessed using the find.clusters function. The Bayesian Information Criterion (BIC) was calculated for K\u2009=\u20091\u201310. For k-means clustering, all of the principal components were retained. The K value with the lowest BIC was selected as the optimal number of clusters. DAPC was implemented using the optimized number of principal components as determined by the optim.a.score function. Nei\u2019s genetic distance42 among populations was calculated using the StAPP package for R70 and the resultant dendrogram was drawn using the standard R function plot.hclust. To determine the most probable number of genetic clusters, fastSTRUCTURE71 was run at K\u2009=\u20091 and K\u2009=\u200910, with an average of 22600 iterations, using default parameters for the Iranian samples. The analysis at K\u2009=\u20092 was performed to test the extent to which the samples reflect two distinct groups. Other values of K were tested (not shown), but did not provide further optimization or descriptive value. Additionally, the cannabis population structure was investigated using fineSTRUCTURE72. To visualize populations, we plotted the output data via the fineSTRUCTURE graphical user interface.We computed the fixation index . MIGRATE-N was implemented with following parameters: the Bayesian inference strategy, 1000 for number of recorded steps in chain, a burn-in of 1000 for each chain and a full migration model with two population sizes and two migration rates. The starting values for \u03b8 and M were generated initially from Fst, Migrate-n was subsequently run using the resulting \u03b8 and M values of the previous run. The runs were conducted on 5\u2009K of markers. Hierarchical analysis of molecular variance (AMOVA) was performed using the Arlequin software package (v. 3.1)47. Significance levels for variance components and F-statistics were estimated using 1000 permutations.The genetic clusters from fastSTRUCTURE and fineSTRUCTURE were used to estimate gene flow and population size via MIGRATE-N (v. 3.6.11)Supplementary InformationSupplementary Table S1Supplementary Table S2Supplementary Table S3"}
+{"text": "Frequent somatic mutations of BRAF and CTNNB1 were identified in both histological subtypes of craniopharyngioma (adamantinomatous and papillary) which shed light on target therapy to cure this oncogenic disease. The aim of this study was to investigate the noninvasive MRI-based radiomics diagnosis to detect BRAF and CTNNB1 mutations in craniopharyngioma patients.Forty-four patients pathologically diagnosed as adamantinomatous craniopharyngioma (ACP) or papillary craniopharyngioma (PCP) were retrospectively studied. High-throughput features were extracted from manually segmented tumors in MR images of each case. The modifications-robustness in region of interests and Random Forest-based feature selection methods were adopted to select the most significant features. Random forest classifier with 10-fold cross-validation was applied to build our radiomics model.Four features were selected to make pathological diagnosis between ACP and PCP with area under the receiver operating characteristic curve (AUC) of 0.89, accurancy (ACC) of 0.86, sensitivity (SENS) of 0.89 and specificity (SPEC) of 0.85. The other two features were applied to estimate BRAF V600E mutation with AUC of 0.91, ACC of 0.93, SENS of 0.83 and SPEC of 0.97. Accurate predication of CTNNB1 mutation by three selected features was realized with AUC of 0.93, ACC of 0.86, SENS of 0.86 and SPEC of 0.86.We developed a reliable MRI-based radiomics approach to perform pathological and molecular diagnosis in craniopharyngioma patients with considerably accurate prediction, which could offer potential guidance for clinical decision-making.The online version of this article (10.1186/s12883-018-1216-z) contains supplementary material, which is available to authorized users. Craniopharyngioma (CP) is a rare central nervous system tumor with incidence of 0.19/100, 000 every year in America and accounting for 0.8% of brain tumor . Due to Recently, thanks to high throughput sequencing technology, 2 activating oncogenic driver BRAF and CTNNB1 were revealed to show highly frequent somatic mutations in CPs \u20138. FurthHowever, \u201cNeo-adjuvant Therapy\u201d means molecular diagnosis should be confirmed before operation. At present, the only way to realize pre-operative molecular diagnosis is doing genetic sequencing in peripheral blood test, and this method is technically inconvenience and expensive , 15. RadThe study was approved by the local ethics committee of Huashan Hospital. We retrospectively reviewed medical records of patients who underwent surgery for craniopharyngioma in single neurosurgical institution  from 2015 to 2017. Forty-four patients diagnosed of craniopharyngioma pathologically were enrolled with complete pre-operation MRI data. Central review and histological subtyping were performed by two individual neuropathologists. In our cohort, there were 29 male and 15 female patients, with 9 pediatric patients  and 35 adult patients . Among all patients, 32 cases were primary craniopharyngiomas, and 12 cases were recurrent tumors or with ventriculoperitoneal shunt history.Adamantinomatous craniopharyngiomas or papillary craniopharyngiomas of 44 cases were diagnosed independently by two individual neuropathologists based on H&E review. Immunostaining for BRAF V600E  and \u03b2-Catenin  was performed by Ventana NexES Staining System in a proportion of patients. BRAF V600E on exon 15 and CTNNB1 mutation on exon 3 were detected and analyzed by sanger sequencing as previously reported .High resolution preoperative T1-MPRAGE MR images were acquired using a Magnetom Trio 3\u2009T (Siemens) scanner. The size of MR images was 512\u2009\u00d7\u2009448, and MR images were stored as 16-bit unsigned integer. All images were acquired by using following parameters: pixel spacing\u2009=\u20090.488\u2009mm, slice thickness\u2009=\u20091\u2009mm, repetition time\u2009=\u20091900\u2009ms, echo time\u2009=\u20092.93\u2009ms, inversion time\u2009=\u2009900\u2009ms, flip angle\u2009=\u20099\u00b0. Two experienced radiologists blinded to patients\u2019 clinical characteristics first segmented tumor lesions in MR images independently and then culminated in consensus on their discrepancies. High-throughput features extraction, feature selection and classification were sequentially performed to build the radiomics model. The details of each process are present below.The location of craniopharyngioma was considered highly correlating with its genotype . InsteadIn addition to 464 location features, another 555 high-throughput features measuring intensity, shape, texture and wavelet are generated from the segmented volumes. The dimensions of features in each category are 21, 15, 39 and 480 respectively. Intensity features are applied to describe the intensities distribution of pixels within the tumor volumes. Shape features typify the morphological structure of the tumor. Texture features reflect the properties of tumor arrangement spatially. Wavelet features quantify the intensity and texture of each MR image in different eight frequency sub-bands and various feature orientations. All of 555 features have generally been used in previous radiomics studies . The totAmong the 1021 features, a large quantity of them was highly redundant, which brought difficulties in the classification and increased the computational complexity . To idenIn the first stage, we modified the manual segmented regions of tumor lesions by eight scenarios as follows: (a) horizontal translation by 2 pixels; (b) horizontal and vertical translation by 2 pixels; (c) 1\u00b0 rotation; (d) 5\u00b0 rotation; (e) combining modifications a, b and c; (f) combining modifications a, b and d; (g) enlarging by 1 pixel along radial lines; and (h) shrinking by 1 pixel along radial lines. Then we assessed modifications-robustness in region of interests of high-throughput texture features using the intraclass correlation coefficient (ICC) . High-thIn the second stage, we enrolled robust texture features, location features and clinical features, and adopted a Random Forest classification model using the 10-fold cross validation . In everIn the third stage, a sequential forward selection strategy was applied to carefully select a small group of significant features in compliance with the contribution ranking. We still adopted a Random Forest classification model to evaluate the predictive accuracy for candidate subset of features using the 10-fold cross validation. The sequential forward selection strategy is a feature selection strategy that sequentially adds one feature from top to bottom according to the contribution ranking. The classification accuracy was recorded for each subset of features and the selection process stopped when all features were added. The subset of features with the highest classification accuracy was finally selected.In this paper, the selected features were fed into an outer Random Forest to build the ultimate prediction model of pathological subtypes, BRAF and CTNNB1 mutational status. The performance of classification model was evaluated and validated by employing the 10-fold cross validation model. Several indexes, containing accuracy(ACC), sensitivity(SENS), specificity(SPEC), positive predictive value(PPV), negative predictive value(NPV), Matthew\u2019s correlation coefficient (MCC), out-of-bag (OOB) score and the area under the receiver operating characteristic curve (AUC), were obtained as metrics to assess quantitative discrimination performance of the radiomics model in the classification of pathological subtypes and genetic mutational status.In 10-fold cross-validation, the original dataset was randomly partitioned into ten equal sized subsets. Of the ten subsamples, nine subsamples were used as training data for model construction and the remaining one subsample was retained as the validation data for testing the model. The cross-validation process was then repeated ten times, with each of the ten subsets used exactly once as the validation data. Therefore, classification results of cases in every validation fold could be obtained for the all trees in the relevant random forest model. Then we calculated the proportion of positive prediction results size to the number of trees as scores for every validation sample and the positive result was defined by ACP, BRAF mutation or CTNNB1 mutation. Finally, we performed this technique in the all folds and acquired the scores of all cases. The ROC curve could be plot based on the score variables. The threshold of score variables was set to 0.5, which means that the category with the most votes of trees is specified as the final classification result in the random forest. The patients with score variable above 0.5 were classified as positive cases. Hence, the prediction results of all patients were acquired. For the pathological subtypes model, sensitivity is defined for ACP and specificity is defined for PCP. For the genetic mutational status models, sensitivity and specificity are defined to estimate the mutation and wild type, respectively. The measurement indexes could be calculated based on the ROC curve and prediction results ultimately. Using all cases rather than 10-fold cross validation to construct the prediction models, we can acquire the generalization accuracy (OOB score).In addition, radiomics-based prognostic nomograms were developed based on selected features, and the discriminative ability of prognostic models could be measured using Harrell\u2019s C-index. The value of the C-index ranges from 0.5, which indicates no discriminative ability, to 1.0, which indicates perfect ability to distinguish pathological subtypes and genetic mutational status.p\u2009<\u20090.05. All statistical analyses were performed by using SPSS software version 22.0 (IBM Corp.) and R software.Mann\u2013Whitney U test and Fisher exact test were used to evaluate whether age, gender and pathological types had statistical differences between different gene statuses. The rms package was used for nomograms, and the Hmisc package was used for calculation of C-index in R software. Statistical significance was set as p\u2009=\u20090.002). Six (60.0%) of ten cases with not detected status was observed in pediatric patients while nineteen (86.4%) of twenty-two CTNNB1 mutant cases struck adult patients and all twelve (100%) BRAF mutant cases were adults. This result was also in accordance with the previous study [p\u2009<\u20090.001), and all twelve (100%) tumors were classified as papillary craniopharyngiomas in the BRAF mutation group while eighteen (81.8%) of twenty-two tumors were classified as adamantinomatous craniopharyngiomas in the CTNNB1 mutation group. For not detected cases, eight (80.0%) of ten tumors belonged to adamantinomatous craniopharyngiomas. BRAF V600E mutation and CTNNB1 mutation were mutual exclusive in all cases. Mutational profile was not changed between primary and paired recurrent craniopharyngiomas (p\u2009=\u20091.000) in Table Including forty-four patients in our study, we stratified all the cases into three categories based on mutational status included BRAF mutation group, CTNNB1 mutation group and not detected (BRAF and CTNNB1 gene status are both wild types.) group. Distribution of gender, age, pathological subtypes and mutational profile was summarized in Table\u00a0eteen 86.% of twenThe tumor segmentation results were shown in Fig.\u00a0Thirty-two primary craniopharyngiomas patients were used as the main cross validation dataset. We selected the most significant features of the main dataset for prediction models. The main radiomics models were constructed based on the main dataset. Another 12 recurrent or treated cases were added into the main database as extensional database.As the main radiomics models were used for pathological subtypes and gene status prediction of primary craniopharyngiomas, using the 12 recurrent or treated patients as a test database could not accurately assess model performance. Besides, the number of additional patients is not enough for recurrent model construction. The additional cases are also imbalanced such as only three BRAF mutation patients Additional file 2:Figure S1. The histopathological findings in different groups. (PDF 540 kb)Additional file 3:Figure S2. The examples of DNA electrophorograms for BRAF and CTNNB1 mutation. (PDF 257 kb)Additional file 4:Table S2. High-throughput texture features which have an ICC greater than 0.8. (PDF 334 kb)"}
+{"text": "A recently developed dynamic model of FeNO uses flow\u2010concentration data from the entire exhalation maneuver rather than plateau means, permitting estimation of CawNO and CANO from a wide variety of protocols. In this paper, we use a simulation study to compare CawNO and CANO estimation from a variety of fixed flow protocols, including: single maneuvers  and three established multiple maneuver protocols. We quantify the improved precision with multiple maneuvers and the importance of low flow maneuvers in estimating CawNO. We conclude by applying the dynamic model to FeNO data from 100 participants of the Southern California Children's Health Study, establishing the feasibility of using the dynamic method to reanalyze archived online FeNO data and extract new information on CawNO and CANO in situations where these estimates would have been impossible to obtain using traditional steady\u2010state two compartment model estimation methods.Exhaled nitric oxide (FeNO) is an established respiratory biomarker with clinical applications in the diagnosis and management of asthma. Because FeNO depends strongly on the flow  rate, early protocols specified that measurements should be taken when subjects exhaled at a fixed rate of 50\u00a0ml/s. Subsequently, multiple flow (or \u201cextended\u201d) protocols were introduced which measure FeNO across a range of fixed flow rates, allowing estimation of parameters including C A recently developed Bayesian dynamic two\u2010compartment model of FeNO uses flow\u2010concentration data from the entire exhalation, which permits estimation of CawNO and CANO from a wide variety of protocols. We compare estimation under single and multiple fixed expiratory flow protocols to demonstrate the gains in precision of multiple flow protocols and the feasibility of estimation with multiple 50\u00a0ml/s maneuvers informing, respectively, future study designs and the re\u2010analysis of archived online FeNO data. A multiple fixed flow rate FeNO sampling protocol was employed in later years of the study; however, in earlier years only repeated FeNO1.11.1.1r and l are the airway radius and length (respectively), in cm.z0, zmouth, and zalv are the locations of the sensor, mouth, and alveolar boundary, in cm from z0.c is a solution of Equation z and time t, in ppb.ic: \u00a0=\u00a0c  is the model solution at the sensor z0, c^i is a numerical approximation of ic, and c~i is the measured concentration, all in ppb and at time it.v (t) is the linear flow rate, in cm/s.d is the diffusivity of NO in air, in cm2/s.p is the permeability of airway wall tissue to NO, in cm/s.wc is the concentration of NO in the airway wall tissue in ppb.awNO\u00a0=\u00a0wc, the \u201cairway wall concentration\u201d, and CANO\u00a0=\u00a0c, the \u201calveolar concentration\u201d corresponding to the concentration at the alveolar boundary zalv.Using the notation of  time scales. As described in , which is the only term that varies with time and in a sense \u201cdrives\u201d the solution. The fundamental difference between dynamic and steady\u2010state modeling approaches is that the latter assumes this as constant, while the former (which we employ) uses measured flow data to empirically estimate this function.The dimensions of the alveolar compartment may vary, unlike the airway compartment. However, at any moment it is \u201cperfectly mixed\u201d; that is, the NO concentration is assumed to be constant throughout and is denoted by C22.1f(\u03b8|x) for parameters \u03b8 and data x) in terms of the likelihood f(x|\u03b8) and a prior distribution f(\u03b8). In our application the parameters of interest consist of the vector \u03b8\u00a0=\u00a0, while x is the FeNO data collected for each subject. This consists of a collection of measurements denoted c~ij, where c~ij is the measured concentration at time it during maneuver j\u00a0\u03f5\u00a01, 2,\u2026. As is often the case, it is sufficient to work with the unnormalized posterior, which simplifies the relationship between the posterior, likelihood, and prior into the proportionality f(\u03b8|x)\u221df(x|\u03b8)f\u03b8.We consider the problem of parameter estimation in a Bayesian paradigm =\u220fi\u220fjf(c~ij|cij), where \u03b8 appears implicitly on the right via the model solution ijc. Here we assume that c~ij\u223cNcij,\u03c3. To efficiently explore the posterior distribution we employ a Metropolis\u2010Hastings style Markov chain Monte Carlo (MCMC) algorithm .Select an initial value \u03b8\u2032 using a transition kernel q\u03b8\u2192\u03b8\u2032 and calculate the likelihood f(\u03b8\u2032|x).Propose a new value min1,f(x|\u03b8\u2032)f\u03b8\u2032q\u03b8\u2032\u2192\u03b8f(x|\u03b8)f\u03b8q\u03b8\u2192\u03b8\u2032.Accept the proposed value with probability \u03b8\u00a0=\u00a0\u03b8\u2032, f(\u03b8|x)\u00a0=\u00a0f(\u03b8\u2032|x) then return to 1; otherwise, return to 1.If the proposal is accepted set We assume that with q. Although manually finding an optimal q may be very difficult, a number of recent MCMC algorithms incorporate an \u201cadaptive\u201d transition distribution  estimators, that is, the estimator that maximizes the posterior probability. We use uniform priors for all parameters, hence in this framework the MAP estimator is equivalent to the maximum likelihood estimator (MLE) on a bounded domain. To quantify uncertainty in the reported MAP estimates the empirical standard deviation of accepted sample points is reported, with the first half of points discarded to account for the \u201cburn\u2010in\u201d sampling period.Running the MCMC algorithm described above yields a collection of points {awNO and CANO.Calculating the MAP/MLE values is an optimization problem, and the MCMC routine can be viewed as a way of approximating the solution. One advantage of the Bayesian approach over deterministic optimization methods is that the posterior sample provides an empirical measure of uncertainty around the estimated values. Probabilistic methods like MCMC may also be less likely than deterministic methods to get stuck at locally optimal solutions, a problem we have encountered when experimenting with deterministic methods for simultaneous estimation of CawNO and CANO respectively. To assess the convergence of the chains we employ the Gelman\u2010Rubin , , and  for C2.2Online multiple flow FeNO data were collected at two study visits (2010 and 2011\u20132012) from more than 1,600 children who participated in the population\u2010based cohort of the CHS recruited in 2002\u20132003 from southern California classrooms  based on observed flow data from both study visits and to observed FeNO data from only the 2011\u20132012 study visit under various study protocol scenarios. The distribution of FeNO50 in these 100 participants at the 2011\u20132012 visit is displayed in Figure https://doi.org/10.6084/m9.figshare.8968313). The original CHS data collection protocol and this reanalysis of archived data was approved by the University of Southern California Health Sciences campus institutional review board.For this study, we randomly selected 100 CHS participants who performed nine maneuvers at the 2011\u20132012 visit (as specified in the study protocol) when they were ages 14\u201316 and had performed at least 2 50\u00a0ml/s maneuvers at the previous study visit. To validate use of the Bayesian dynamic two\u2010compartment model on data arising from various study protocol, we applied it to simulated FeNO data ; one scenario consisted of three samples with one each at 30, 100, and 300\u00a0ml/s (HMA); and the final scenario consisted of all nine samples specified in the CHS protocol, which includes two samples at 30, 100, and 300\u00a0ml/s along with three at 50\u00a0ml/s (9F). The single and 9F scenarios were chosen as they represent either the minimal or maximal amount of data available. The HMA scenario was selected as it includes low, medium, and high flow rates, which corresponds to the protocol described in  random variable into random variables representative of current estimates for the corresponding population distributions. These population estimates were taken from the percentiles for individuals under 20\u00a0years of age reported in Table awNO and CANO were  and  respectively. The airway length was assumed to be 25\u00a0cm and the airway volume 100\u00a0ml, which is downscaled roughly 40% for children based on values of 39.93\u00a0cm and 142\u00a0ml used in  and (d) illustrate the standard deviation of the MCMC samples generated during estimation of the respective parameters.The accuracy and precision of the estimates for CawNO appears to be a function of flow rate for the single flow samples, with error variability increasing monotonically as the flow rate increases. The error in estimation arises from the fact that there are many combinations of values for CawNO and CANO which produce model solutions very similar to what is observed. One reason we employ a probabilistic estimation method is because deterministic methods often locate these locally optimal solutions, which can be quite far from the global optima.In Figure awNO based on multiple samples provide more accuracy and precision, and as expected using the full complement of nine maneuvers as in scenario 9F yields the best results. However, differences between the 9F, HMA, and 5@50 scenarios are small. After 9F, HMA provides the next best accuracy and precision, followed by 5@50.For the single flow samples the standard deviation of the posterior samples also increases monotonically as a function of flow rate, as shown in Figure ANO parameter. For this parameter there is much less variation in the accuracy and precision of the single flow rate estimates as compared to CawNO. However, there do appear to be differences as the number of maneuvers increases, with small decreases in error variability and larger decreases in posterior sample standard deviation moving from scenarios with a single flow to 5@50, HMA, and 9F.Figure 3.2SD) age of: 15.3 (0.6) years, mean (SD) height of: 168.5 (8.8) cm, and mean (SD) weight of: 63.2 (13.0) kg. Figure awNO and CANO are unknown for these samples the estimation error cannot be calculated. Panels (a) and (c) of Figure The 100 CHS participants were 57% male, primarily Hispanic (55%) or non\u2010Hispanic White (31%), 22% reported a doctor's diagnosis of asthma, and had a mean , which is consistent with the similarity exhibited by the sample distributions in Figure In Figure ANO parameter estimates, which appear to be somewhat more variable across methods than for CawNO. The correlation between CANO estimates .To further illustrate the range of estimates within and between individuals, the results for three randomly selected subjects are shown in Table 3.3awNO and CANO for the later years. Here, we have estimated both CawNO and CANO using multiple samples at a single rate (3@50) and a range of rates (9F). We can use these to investigate the relationship between the two scenarios for each parameter and estimate a regression relating the estimates under each scenario.In the context of the CHS, the relationship between the 3@50 and 9F protocols is of interest. Earlier study years collected multiple FeNO samples at only one rate, while later years collected FeNO at a range of rates; therefore, currently it is only possible to estimate CawNO have a positive skew, and similarly for CANO in Figure https://doi.org/10.6084/m9.figshare.8198831). To account for the skew, we first log\u2010transform the data after adding one (log1p), and scatterplots of the resulting values are illustrated in Figure 2 values are also reported in Figure awNO and CANO estimates when only repeated samples at 50\u00a0ml/s are available.The boxplots in Figure 44.1awNO and CANO under a variety of fixed flow rate sampling protocols using the Bayesian dynamic two\u2010compartment model. We found that both parameters can be reasonably estimated using three or five repeated measures of FeNO at 50\u00a0ml/s. As expected, estimation is markedly improved by using multiple flow rates and more modestly improved by including replicates across multiple flow rates. We provide quantification of the improvement, which could inform future fixed flow sampling designs. Our findings suggest that the dynamic model can be applied to repeated online measurements of FeNO50, providing new opportunities for re\u2010analysis of existing archived online FeNO50 data.In this article, we used simulated data and real multiple flow FeNO measurements from the CHS to evaluate the estimation of C4.2awNO and CANO using data from a single target flow rate (by exploiting information on within\u2010maneuver variation in flow), a scenario where parameter estimation is impossible for steady\u2010state methods. Hence the dynamic method parameter estimates reported here are, by design, not meant to be directly comparable with steady\u2010state results. However, previous results on sampling protocols with steady\u2010state methods can contextualize our results. In . Moreover, they find that including some combination of low (below 50\u00a0ml/s), medium (between 50 and 200\u00a0ml/s), and high (above 200\u00a0ml/s) flow rate samples yields optimal results across all criteria for a strategy based on sampling at four different rates. These results are consistent with our results illustrated in Figure awNO at low flow rates, while for CANO estimates at higher flow rates tend to be in closer agreement.The dynamic method applied here is a strict generalization of the steady\u2010state approach, as proved mathematically in  flow rates  we reduced the number of parameters estimated from three as reported in  we recreate Figure R^\u00a0>\u00a01.1, and they are nearly identical. Finally, we used synthetic versions of the various sampling protocols by considering subsets of archived maneuvers conducted as part of a nine flow protocol. It is conceivable that participants might perform maneuvers differently when independently conducting each sampling protocol, and our analyses do not capture these differences. However, our approach efficiently used archived data.This study has several limitations. First, the data collected in the CHS had a digital signal filter automatically applied by the device manufacturer's software (intended to reduce noise in the biofeedback which assists participants in attaining and maintaining target flow rates), so the raw data are not available and cannot be recovered. The signal filtering induces a dependence between consecutive measurements, which is inconsistent with the independence assumption underlying the likelihood. This does not affect the unbiasedness of the point estimates, but it may lead to an underestimate of the associated posterior variance (Gelman et al.,  Gelman, . This ap4.4awNO and CANO in situations where these estimates would have been impossible to obtain using traditional steady\u2010state two compartment model estimation methods. Given the strong correlation of estimates from the 9F and 3@50 scenarios, these estimates should be useful in population\u2010level research studies. In future work, we will apply the dynamic method to archived online FeNO50 data in the CHS from two study visits. Researchers collecting new online FeNO data for estimating CawNO and CANO, especially for clinical purposes, should collect FeNO at different flow rates. We should also note that the dynamic estimation method is best suited to data from dynamically varying flow exhalation profiles rather than fixed flow rate maneuvers. In future work, we will evaluate the dynamic method applied to data from tidal or other variable flow rate maneuvers. This will require collecting original data from newly recruited subjects, without the various signal processing techniques typically applied by default. A key requirement of new data collection for this purpose is rapid, synchronized sampling of both flow rate and NO concentration; however, limited accuracy is expected and explicitly accounted for in the model description. It has long been recognized that there is potential benefit in optimizing the configuration of existing hardware (Condorelli, Shin, & George, In this article, we have demonstrated the feasibility of applying the dynamic method to archived online target flow FeNO data to extract new information on CNone declared.\u00a0Click here for additional data file.\u00a0Click here for additional data file.\u00a0Click here for additional data file."}
+{"text": "Neonatal seizures are a major challenge for clinicians because of inconspicuous clinical presentation, variable electro-clinical correlation, and poor response to antiseizure drugs. It is well recognized that fever and infection can trigger seizures in young children and that this risk is enhanced in children with epilepsy. As immunization may cause a fever, vaccination can be a non-specific trigger for seizures in children 1.1.1The reported prevalence and incidence of neonatal seizures vary considerably due to differences in study methodology, especially in the identification of neonatal seizures, and geographic setting Incidence. The reported incidence of neonatal seizures worldwide varies from 1.0\u20134.4 per 1000 livebirths in high-income countries (USA) 1.1.2The etiology of neonatal seizures is heterogeneous, and sometimes unknown, although the majority are due to hypoxia-ischemia, stroke or infections in term infants. In preterm infants, intraventricular hemorrhage is the commonest cause of seizure The heterogeneity in the etiologic profile of neonatal seizures across geographies and economic strata is due to two main factors: differences in obstetric/perinatal care and access to electrodiagnostic techniques leading to differing rates of detection and diagnosis .1.1.3The onset of neonatal seizures depends on etiology and is most common within the first week of life, with 25\u201355% occurring in the first 24\u202fh 1.1.4Maternal risk factors for neonatal seizures include maternal age >40\u202fyears, nulliparous, diabetes mellitus, chorioamnionitis, traumatic delivery, prolonged second stage of labor, fetal distress, placental abruption, cord prolapse, and uterine ruptureNeonatal risk factors for seizures include the etiologies for seizure listed in 1.1.5While a normal neurological outcome after neonatal seizures is reported in 25\u201340% of infants 1.1.6Developmental age-specific mechanisms influence the generation and phenotype of seizures. While there are some limitations in the use of animal models to study neonatal seizures, conclusions can be reached with consideration of the species-specific maturation rates in the system of interest The neonatal period is a time of intense brain development. While cortical lamination is fully developed in the term infant, neurite outgrowth and synaptogenesis are continuing and are in their elementary stages. Brain myelination is immature. These factors limit the rapid propagation of neonatal seizures and their clinical presentation  + channel super-family and important for maintenance of resting membrane potential and dendritic excitability, are also developmentally regulated. The immature brain has relatively low expression of the HCN1 isoform, which serves to reduce dendritic excitability in the adult brain In the neonatal brain, the balance between excitatory versus inhibitory synapses is tipped in favor of excitation to permit robust activity-dependent synaptic formation, plasticity, and remodeling. Glutamate is the major excitatory neurotransmitter in the CNS with the involvement of AMPA and NMDA receptors and more expression and function than in the adult brain. For example, while, in the adult brain, \u03b3-amino-butyric acid (GABA) usually induces membrane hyperpolarization, early in the developing brain it induces membrane depolarization by causing Cl\u00af efflux rather than influx. The HCN channels, which are members of the KGenetic epilepsies with onset in the neonatal period reflect the structural and physiologic factors that can lead to neonatal seizures. These include ion channel function (e.g. KCNQ2), excitation-inhibition balance (e.g. pyridoxine-dependent epilepsy), brain development (e.g. ARX) and synaptic function (e.g. STXBP1) 1.1.7The clinical diagnosis of neonatal seizures is challenging because many neonatal seizures either manifest with subtle clinical signs or remain entirely subclinical despite the presence of clear electrographic seizure activity on EEG.Clinical manifestations of neonatal seizures may include focal motor movements or non-motor signs The diagnosis of neonatal seizures may be made by cEEG, amplitude-integrated EEG (aEEG) or by clinical signs alone. Gold-standard is capturing a seizure on cEEG  because it provides the most direct and comprehensive assessment of neuronal activity. In comparison, aEEG is less accurate because it employs fewer electrodes over a smaller spatial area and the aEEG display is filtered and time-compressed making it harder to identify brief seizures. When aEEG is used together with a real-time EEG channel, the median sensitivity for seizure identification is 76% (range: 71\u201385%), and the median specificity is 85% (range: 39\u201396%). When aEEG was used without a real-time EEG channel, the median sensitivity is 39% (range: 25\u201380), and specificity is 95% (range 50\u2013100) Among neonates who present with clinically apparent seizures, antiseizure drugs commonly suppress clinical activity, but ongoing electrographic seizures persist, a phenomenon termed uncoupling 1.1.8Early recognition and accurate diagnosis of seizures in the neonatal period is essential for optimal management. However, the clinical diagnosis of seizures in neonates is also challenging because infants may present with abnormal movements that are non-epileptic but are mistaken for seizures leading to inappropriate treatment and unwarranted prognostic concern 1.1.9Maternal vaccination. A literature search conducted by the authors did not identify any reports of seizures among newborns born to women who received tetanus-diphtheria-acellular pertussis (Tdap), tetanus toxoid, tetanus-diphtheria (Td), seasonal or pandemic influenza vaccines, or in randomized controlled trials of investigational Group B Streptococcus or respiratory syncytial virus vaccines. A retrospective cohort study of pertussis among infants <63\u202fdays of age reported no seizures among 34 infants (median age 45\u202fdays) whose mothers received Tdap during pregnancy, while 14/336 (4%) infants of unvaccinated mothers developed seizures with pertussis infection  Neonatal vaccination. In a study of claims in the United States National Vaccine Injury Compensation Program of seizures and/or encephalopathy allegedly caused by an immunization among children younger than two years during 1995\u20132005, a total of 90 claims (60%) concerned babies between 0 and 6\u202fmonths of age but the number of neonates was not reported 1.1.10Several definitions of neonatal seizures exist . Neonata1.1.11Neonatal seizures are focal, often subclinical 1.1.12There is no uniformly accepted definition of neonatal seizures. This provides the opportunity to offer a definition that is practical and useful in the context of neonatal seizures following maternal and neonatal immunization, as data comparability across trials or surveillance systems will facilitate data interpretation and the assessment of vaccine safety, as well as promote the scientific understanding of neonatal seizures.1.2http://www.brightoncollaboration.org/internet/en/index/process.html, the Brighton Collaboration Neonatal Seizures Working Group was formed in 2018 and included members with clinical, academic, public health, industry backgrounds.Following the process described in the overview papers To guide the decision-making for the case definition and guidelines, we conducted a literature search using Medline, Embase and the Cochrane Central Register for English language articles reporting on seizures among neonates born to women vaccinated during pregnancy. In addition, we searched for clinical trials, passive and active surveillance reports, cohort and case-control studies of specific vaccines evaluated in pregnancy to capture additional reports of neonatal seizures and confirm the findings of our primary literature review. Only English language articles and articles referring to humans were selected for review. The primary search identified 82 articles excluding duplications of which 80 were excluded based on review of the title of abstract. The remaining two articles were excluded after review of the full text as they did not provide information regarding neonatal seizures and vaccines. A search for adverse events after maternal Tdap vaccination identified one relevant article that mentioned neonatal seizures.We extended the search to include reports of neonates with seizure after immunization at birth, following the same methods described above. A total of 194 articles excluding duplications were identified. Based on abstract content we selected 12 articles for complete reading. Articles were excluded mainly because they presented no detailed information about the age of the vaccinated infants (e.g. \u201cinfants 0\u20136\u202fmonths\u201d) or the specific vaccination schedule. Finally, only one original article was selected for inclusion in our systematic review 1.3The working group agreed that electrographically documented seizures with or without clinical manifestations represent the most accurate concept of neonatal seizures. There are several operational definitions for electrographic seizures in the newborn. According to the American Clinical Neurophysiology Society (ACNS), an electrographic seizure in a newborn is defined as a sudden, abnormal EEG event characterized by a rhythmic and evolving pattern with a minimum 2\u202f\u00b5V peak-to-peak voltage and duration of at least 10\u202fs. \u201cEvolving\u201d is defined as an unequivocal evolution in frequency, voltage, morphology, or location Amplitude-integrated EEG (aEEG) can be a useful instrument but less accurate : is a clinical term that applies to the estimated age of the fetus during pregnancy, generally given in weeks and days from the first day of the last menstrual period. According to the International Statistical Classification of Diseases and Related Health Problems (ICD-10) Neonatal seizures: relate to epileptic seizures in the neonatal period. It includes terms such as neonatal convulsions, neonatal fits, neonatal epilepsy and neonatal convulsive disorder . The preferred term is neonatal seizure.Epilepsy refers to a disorder with at least two unprovoked (or reflex) seizures occurring greater than 24\u202fh apart or one unprovoked (or reflex) seizure and a probability of further seizures similar to the general recurrence risk (at least 60%) after two unprovoked seizures, occurring over the next 10\u202fyears 1.3.2The focus of the working group was to agree on a harmonized definition of neonatal seizures and the criteria to identify them, with different levels of diagnostic certainty. This will be useful also for the identification of neonatal seizures in the context of vaccination of mothers during pregnancy or neonatal vaccination.1.3.3It needs to be emphasized that the grading of definition levels is entirely about diagnostic certainty, not the clinical severity of an event. Thus, a very severe clinical event may appropriately be classified as possible (level 3) or probable (level 2), rather than definite (level 1), if it could reasonably be of a non-epileptic etiology. Detailed information about the severity of the event should additionally always be recorded, as specified by the data collection guidelines.The number of symptoms and/or signs that will be documented for each case may vary considerably. The case definition has been formulated such that the level 1 definition is highly specific for the condition. As maximum specificity normally implies a loss of sensitivity, two additional diagnostic levels have been included in the definition, offering a stepwise increase of sensitivity from level 1 down to level 3, while retaining an acceptable level of specificity at all levels. In this way, it is hoped that all possible cases of neonatal seizures can be captured.1.3.4The working group agreed to a definition of neonatal seizures (see below) and to give different levels of certainty in the diagnosis  in order to be effective and applicable in high-, middle- and low-income countries.Pathology, radiology and laboratory findings are not included in the case definition, although they can provide important information regarding the causes of neonatal seizure.1.3.5The working group decided against using \u201ctreatment\u201d or \u201ctreatment response\u201d towards the fulfillment of the case definition of neonatal seizures.A treatment response or failure is not in itself diagnostic, as less than 50% of neonatal seizures respond to the first line treatment  1.3.6Specific time-frames for the onset of symptoms of neonatal seizures following maternal immunization are not included. No information is available regarding the potential relevance of the timing of maternal immunization and the occurrence of neonatal seizures.We postulate that a definition designed to be a suitable tool for testing causal relationships requires ascertainment of the outcome  independent from the exposure . Therefore, to avoid selection bias, a restrictive time interval from maternal immunization to onset of neonatal seizures should not be an integral part of such a definition. Instead, where feasible, details of this interval should be assessed and reported as described in the data collection guidelines.Furthermore, neonatal seizures often occur outside the controlled setting of a clinical trial or hospital. In some settings, it may be impossible to obtain a clear timeline of the event, particularly in low resource and rural settings. To avoid exclusion of such cases, this Brighton Collaboration case definition avoids setting arbitrary time-frames between maternal immunization and occurrence of the defined event.1.4As mentioned in the overview, the case definition is accompanied by guidelines which are structured according to the steps of conducting a clinical trial, i.e. data collection, analysis and presentation. Neither case definition nor guidelines are intended to guide or establish criteria for management of ill infants, children, or adults. Both were developed to improve data comparability.1.5Similar to all Brighton Collaboration case definitions and guidelines, review of the definition with its guidelines is planned on a regular basis (i.e. every three to five years) or more often if needed.2Case definitionneonatal seizure is defined as a transient electrographic change in the brain due to an abnormal, excessive or synchronous neuronal activity either with the occurrence of clinical signs  or without them (electrographic-only), in the first 28\u202fdays of life in full-term infants. In the preterm infants (born <37\u202fweeks of gestation), this definition applies up to 44\u202fweeks of post menstrual age (PMA), considering the pattern of brain maturation.A Seizures confirmed by conventional EEG (cEEG) with or without clinical manifestations represent the most accurate concept of neonatal seizures; cEEG is considered the gold standard for neonatal seizure diagnosis (Level 1 \u2013 \u201cdefinite\u201d diagnosis). Ictal EEG refers to the epileptiform activity seen during a seizure in contrast to interictal discharges seen between seizures which are not diagnostic in neonates. Concomitant video recording is helpful although not a necessity and may be replaced by clinical observation during the EEG to determine a clinical-electrographic correlation.Amplitude-integrated EEG (aEEG) or cerebral function monitoring can be a useful instrument but is less accurate than cEEG see . The ideAs mentioned above, the clinical diagnosis of neonatal seizures is challenging and without EEG it is difficult to differentiate seizure from physiological or abnormal, but non-epileptic, movements see . HoweverAs discussed in https://www.epilepsydiagnosis.org/index.html.For further information on clinical manifestations and definitions of seizure types and epilepsy syndromes see LEVELS OF CERTAINTYFor All Levels of Diagnostic CertaintyAge 0\u201328\u202fdays in a full-term infantORPostmenstrual age of <44 weeks in a preterm infant (born <37\u202fweeks of gestation)Level 1 of diagnostic certaintyLevel 2 of diagnostic certaintyLevel 3 of diagnostic certaintyLevel 4Level 5Notes for Levels of Certainty2sudden, abnormal EEG event characterized by repetitive and evolving pattern 3seizure confirmed with EEG and with clear clinical manifestation4seizure confirmed with EEG without clear clinical manifestation5regularly rhythmic jerking, that involves the same muscle groups and not influenced by manual restraint6focal sustained stiffening/sustained increase in muscle contraction lasting a few seconds to minutes and not influenced by manual restraint7someone who routinely cares for neonates and is familiar with the clinical presentation of neonatal seizures through training or clinical practice. Ideally this is a physician , but in different settings also other professionals  could diagnose \u201cprobable or possible seizures\u201d, depending of their specific training in neonatal care8such as myoclonic, epileptic spasm, automatism, autonomic changes, behavioral arrest, but non-seizure events cannot be excluded without EEG [79]3Neonatal Seizures Working Group to recommend the following guidelines to enable meaningful and standardized collection, analysis, and presentation of information about neonatal seizures. However, the implementation of all guidelines might not be possible in all settings. The availability of information may vary depending upon resources, geographical region, and whether the source of information is a prospective clinical trial, a post-marketing surveillance or epidemiological study, or an individual sporadic report of neonatal seizures. Also, these guidelines have been developed by this working group for guidance only and are not to be considered a mandatory requirement for data collection, analysis, or presentation.It was the consensus of the Brighton Collaboration 3.1These guidelines represent a desirable standard for the collection of data on neonatal seizures following maternal immunization to allow for comparability of data and are recommended as an addition to data collected for the specific study question and setting. The guidelines are not specifically intended to guide the primary reporting of neonatal seizures to a surveillance system or study monitor, but they could potentially be adapted for these purposes. Investigators developing a data collection tool based on these data collection guidelines also need to refer to the criteria in the case definition, which are not repeated in these guidelines.Guidelines numbered below have been developed to address data elements for the collection of adverse event information as specified in general drug safety guidelines by the International Conference on Harmonization of Technical Requirements for Registration of Pharmaceuticals for Human Use, and the form for reporting of drug adverse events by the Council for International Organizations of Medical Sciences. These data elements include an identifiable reporter and patient, one or more prior maternal immunization, and a detailed description of the adverse event, in this case, of neonatal seizures following maternal immunization. The additional guidelines have been developed as guidance for the collection of additional information to allow for a more comprehensive understanding of neonatal seizures following maternal immunization.3.1.1(1)Date of report.(2)10 and/or diagnosing the neonatal seizures as specified by country-specific data protection law.Name and contact information of person reporting(3)Name and contact information of the investigator responsible for the subject, as applicable.(4)Relation to the patient .For all cases and/or all study participants , the following information should be recorded:3.1.23.1.2.1(5)Case/study participant identifiers  or code (or in accordance with country-specific data protection laws).(6)Date of birth, age, and sex.(7)For neonates: gestational age and birth weight, twin status.For all cases and/or all study participants (including mothers and infants as appropriate), the following information should be recorded:3.1.2.2(8)Past and current gynecological/obstetric history, medical history, including hospitalizations, underlying diseases/disorders, pre- immunization signs and symptoms including identification of indicators for, or the absence of, a history of allergy or other reactions to vaccines, vaccine components or medications; food allergy; allergic rhinitis; eczema; asthma. Any family history of seizure, neonatal/infant death (sibling), or congenital/genetic conditions should be recorded.(9)Any medication history (other than treatment for the event described) prior to, during, and after maternal immunization during pregnancy including prescription and non-prescription medication as well as medication or treatment with long half-life or long-term effect. .(10)Maternal and infant immunization history (i.e. previous immunizations and any adverse event following immunization (AEFI), in particular occurrence of neonatal seizures after a previous immunization).For all cases and/or all study participants (including mothers and infants as appropriate), the following information should be recorded:3.1.3(11)Date and time of maternal and infant immunization(s).(12)Description of vaccine(s)  and number of dose if part of a series of immunization s against the same disease).(13)The anatomical sites (including left or right side) of all immunizations .(14)Route and method of administration .(15)Needle length and gauge.For all cases and/or all study participants (including mothers and infants as appropriate), the following information should be recorded:3.1.4(16)For all cases at any level of diagnostic certainty and for reported events with insufficient evidence, the criteria fulfilled to meet the case definition should be recorded.(17)7, and/or testing performed).Clinical description of signs and symptoms of neonatal seizures, seizure type (18)11, first observation12 and diagnosis13, duration and frequency of seizures (seizures/hour or seizures/day), last seizure14 and final outcome15.Date/time of onset(19)\u2022Measurement/testing \u2022Minimum EEG standards for cEEG are described in the American Clinical Neurophysiology Society (ACNS) guidelines \u2022https://doi.org/10.1136/adc.2004.062745) https://www.acns.org/UserFiles/file/Guideline5-MinimumTechnicalStandardsforPediatricEEG_v1.pdf) Minimum aEEG standards are described by de Vries and Hellstr\u00f6m-Westas \u2022Results of electrolytes, blood gas, and serum glucose, calcium, magnesium, bilirubin as well as complete blood count and blood culture.\u2022Other investigations depend on clinical presentation, history and availability and may include lumbar puncture, urine culture and toxicology , screen for relevant congenital infections, metabolic screen, and genetic testing.\u2022Ultrasound and neuroimaging (MRI or CT scan) if available.Concurrent signs, symptoms, and diseases.(20)Treatment given for neonatal seizures, especially specify drug(s) and dosing.(21)15 at last observation. Persistence beyond the neonatal period should be noted, ideally as late as 12\u201318\u202fmonths.Outcome(22)16.Objective clinical evidence supporting classification of the event as \u201cserious\u201d according to regulatory standards(23)Maternal and infant exposures other than the maternal immunization, including those 24\u202fh before and after immunization, and until delivery  considered potentially relevant to the reported event.Specifically document:3.1.5The duration of surveillance for neonatal seizures should be predefined based on the neonatal period (see case definition \u2013 up to 28\u202fdays in term and up to 44 PMA in preterm infants). Events with onset of seizures after this time are not considered neonatal seizures although it is recognized that seizures may persist (onset of epilepsy).(24)The duration of follow-up reported during the surveillance period should be predefined likewise. It should aim to continue to resolution of the event.(25)Methods of data collection should be consistent within and between study groups, if applicable.(26)Follow-up of cases should attempt to verify and complete the information collected as outlined in data collection guidelines 1\u201323.(27)Investigators of patients with neonatal seizures should provide guidance to reporters to optimize the quality and completeness of the information provided.(28)Reports of neonatal seizures should be collected throughout the study period regardless of the time elapsed between maternal or infant immunization and the adverse event. If this is not feasible due to the study design, the study periods during which safety data are being collected should be clearly defined.Biologic characteristics of the vaccine (e.g. live attenuated versus inactivated component vaccines), biologic characteristics of the vaccine-targeted disease, biologic characteristics of the vaccinee  are not considered relevant for the choice of the duration of the surveillance for neonatal seizures.3.2(29)Reported events should be classified in one of the following five categories including the three levels of diagnostic certainty. Events that meet the case definition should be classified according to the levels of diagnostic certainty as specified in the case definition. Events that do not meet the case definition should be classified in the additional categories for analysis.Event classification in 5 categories17Event meets case definitionLevel 1: Criteria as specified in the neonatal seizures case definitionLevel 2: Criteria as specified in the neonatal seizures case definitionLevel 3: Criteria as specified in the neonatal seizures case definitionEvent does not meet case definitionAdditional categories for analysis18Level 4: Reported neonatal seizures with insufficient evidence to meet the case definition19Level 5: Not a case of neonatal seizures(30)11 of the first symptoms and/or signs consistent with the definition. Additionally, the occurrence of neonatal seizures in relation to the infant\u2019s date of birth should be reported. If few cases are reported, the specific time course could be analyzed for each; for a large number of cases, data can be analyzed in the increments based on trimester of maternal immunization 14 and/or final outcome15. If seizures persist beyond the neonatal period, this has to be noted. Whatever start and end are used, they should be used consistently within and across study groups.The period of occurrence is defined as the interval between the date of onset of the first seizure consistent with the definition and the last seizure(32)If more than one measurement of a particular criterion is taken and recorded, the value corresponding to the greatest magnitude of the adverse experience could be used as the basis for analysis. Analysis may also include other characteristics like qualitative patterns of criteria defining the event.(33)The distribution of data (as numerator and denominator data) could be analyzed in predefined increments , where applicable. Increments specified above should be used. When only a small number of cases are presented, the respective values or time course can be presented individually.(34)Data on neonatal seizures obtained from subjects born to mothers receiving a vaccine should be compared with those obtained from an appropriately selected and documented control group(s) to assess background rates of neonatal seizures in non-exposed populations and should be analyzed by study arm and dose where possible, e.g. in prospective clinical trials.Furthermore, it is useful to analyze time of onset of seizure because some etiologies have a definite time of onset. For preterm infants the age of onset is recorded as the corrected age and chronological age b.(31)The3.3(35)All reported events of neonatal seizures should be presented according to the categories listed in guideline 29 or other classification that is considered appropriate.(36)Data on possible neonatal seizures events should be presented in accordance with data collection guidelines 1\u201323 and data analysis guidelines 29\u201334.(37)Terms to describe neonatal seizures such as \u201clow-grade\u201d, \u201cmild\u201d, \u201cmoderate\u201d, \u201chigh\u201d, \u201csevere\u201d or \u201csignificant\u201d are highly subjective, prone to wide interpretation, and should be avoided, unless clearly defined.(38)Data should be presented with numerator and denominator (n/N) (and not only in percentages), if available.(39)Although denominator data are usually not readily available for immunization safety surveillance, attempts should be made to identify approximate denominators. The source of the denominator data should be reported, and calculations of estimates be described . The incidence of cases in the study population should be presented and clearly identified as such in the text.(40)If the distribution of data is skewed, median and range are usually the more appropriate statistical descriptors than a mean. However, the mean and standard deviation should also be provided.(41)\u2022The study design;\u2022The method, frequency and duration of monitoring for neonatal seizures;\u2022The trial profile, indicating participant flow during a study including drop-outs and withdrawals to indicate the size and nature of the respective groups under investigation;\u2022The type of surveillance (e.g. passive or active surveillance);\u2022The characteristics of the surveillance system ;\u2022The search strategy in surveillance databases;\u2022Comparison group(s), if used for analysis;\u2022The instrument of data collection ;\u2022Whether the day of maternal immunization was considered \u201cday one\u201d or \u201cday zero\u201d in the analysis;\u20222 and/or the date of first observation3 and/or the date of diagnosis4 was used for analysis; andWhether the date of onset\u202220.Use of this case definition for neonatal seizures, in the abstract or methods section of a publicationAny publication of data on neonatal seizures after maternal immunization should include a detailed description of the methods used for data collection and analysis as possible. It is essential to specify:These guidelines represent a desirable standard for the presentation and publication of data on neonatal seizures following maternal immunization to allow for comparability of data and are recommended as an addition to data presented for the specific study question and setting. Additionally, it is recommended to refer to existing general guidelines for the presentation and publication of randomized controlled trials, systematic reviews, and meta-analyses of observational studies in epidemiology  Notes for guidelines10If the reporting center is different from the vaccinating center, appropriate and timely communication of the adverse event should occur.11The date and/or time of onset is defined as the time within the neonatal period when the first sign or symptom indicative of neonatal seizures occurred. This may only be possible to determine in retrospect.12The date and/or time of first observation of the first sign or symptom indicative for neonatal seizures can be used if date/time of onset is not known.13The date of diagnosis of an episode is the day within the neonatal period when the event met the case definition at any level.14The end of the occurrence of neonatal seizures is defined as the time the subject no longer meets the case definition at the lowest level of the definition.15E.g. recovery to pre-event immunization health status, spontaneous resolution, therapeutic intervention, persistence of the event, sequelae, death.16An adverse event after immunization (AEFI) is defined as serious by international standards 17To determine the appropriate category, the user should first establish, whether a reported event meets the criteria for the lowest applicable level of diagnostic certainty, e.g. Level three. If the lowest applicable level of diagnostic certainty of the definition is met, and there is evidence that the criteria of the next higher level of diagnostic certainty are met, the event should be classified in the next category. This approach should be continued until the highest level of diagnostic certainty for a given event could be determined. If the lowest level of the case definition is not met, it should be ruled out that any of the higher levels of diagnostic certainty are met and the event should be classified in categories four or five. The highest possible level of classification should be recorded for each event.18If the evidence available for an event is insufficient because information is missing, such an event should be categorized as \u201cReported neonatal seizures with insufficient evidence to meet the case definition\u201d.19An event does not meet the case definition if investigation reveals a negative finding of a necessary criterion (necessary condition) for diagnosis. Such an event should be rejected and classified as \u201cNot a case of neonatal seizures\u201d.20Use of this document should preferably be referenced by referring to the respective link on the Brighton Collaboration website (http://www.brightoncollaboration.org).4The findings, opinions and assertions contained in this consensus document are those of the individual scientific professional members of the working group. They do not necessarily represent the official positions of each participant\u2019s organization . Specifically, the findings and conclusions in this paper are those of the authors and do not necessarily represent the views of their respective institutions.The authors declared that there is no conflict of interest."}
+{"text": "Despite many guidelines for the management of gestational diabetes available internationally, little work has been done to summarize and assess the content of existing guidelines. A paucity of analysis guidelines within in a unified system may be one explanatory factor. So this study aims to analyze and evaluate the contents of all available guidelines for the management of gestational diabetes.Relevant clinical guidelines were collected through a search of relevant guideline websites and databases . Fourteen guidelines were identified, and each guideline was assessed for quality using the Appraisal of Guidelines for Research & Evaluation (AGREE) II instrument. Two independent reviewers extracted guideline recommendations using a \u201crecommendation matrix\u201d through which basic guideline information and consistency between search strategy and selection of evidence, between selected evidence and interpretation, and between interpretation and resulting recommendations were analyzed.Fourteen documents were analyzed, and a total of 361 original recommendations for gestational diabetes mellitus (GDM) management were assessed. In all guidelines included, the recommendations were developed in five domains, namely, diagnosis of GDM, prenatal care, intrapartum care, neonatal care and postpartum care. Different guidelines appeared to have significant discrepancy in consistency of guideline content, but overall, there was consistency between search strategy and selection of evidence, between selected evidence and interpretation, and between interpretation and resulting recommendations .Although commonality in most recommendations existed, there were still some discrepancies between guidelines. Consistency of guidelines on the management of GDM in pregnancy is highly variable and needs to be improved.The online version of this article (10.1186/s12884-019-2343-2) contains supplementary material, which is available to authorized users. Gestational diabetes mellitus (GDM) is a special form of diabetes in women of child-bearing age and is a common gestational endocrine disease . Due to Clinical practice guidelines (CPGs) are statements that include recommendations intended to assist providers and recipients of healthcare and other stakeholders to make informed decisions, and they are effective tools for disseminating medical knowledge . With reHowever, methodological quality of guideline is not the only way to evaluate a guideline. Whether guidelines provide valid recommendations is an aspect of particular importance to practitioners. It is noted that there may be conflict between methodological quality and the validity of recommendations, and current guidelines differ substantially in their management recommendations . WhetherA search was conducted in CPGs for GDM management. The search strategy used the keywords \u201cpregnancy\u201d, \u201cgravida*\u201d, \u201cconception\u201d, \u201cmaternity\u201d, \u201cdiabetes\u201d, \u201chyperglycemia\u201d, \u201cinsulin resistance\u201d, \u201cglucose intolerance\u201d, \u201cguideline\u201d, \u201ccriteria\u201d, \u201crecommendation\u201d and \u201cstandard\u201d. Information sources were identified from the National Institute for Health and Care Excellence (NICE), New Zealand Guidelines Group (NZGG), Scottish Intercollegiate Guidelines Network (SIGN), China Medlive, American Diabetes Association (ADA), Canadian Diabetes Association (CDA), International Diabetes Federation (IDF), PubMed, Web of Science, Embase, China National Knowledge Infrastructure (CNKI), Wanfang Chinese Periodical Database and VIP Chinese Periodical Database. The eligibility criteria included: \u2460full guideline that were available in English or Chinese; \u2461guidelines which contained recommendations regarding GDM interventions; \u2462guidelines that were issued between 2009 and 2018. Two independent reviewers selected documents for inclusion and appraised the methodological quality with the Appraisal of Guidelines for Research & Evaluation (AGREE) II instrument.Based on the quality evaluations, the reviewers summarized recommendations in guidelines and assessed the content of guidelines by establishing a \u201crecommendation matrix\u201d  independently analyzed one guideline with the recommendation matrix in order to identify the validation and feasibility of the tool before determine the final result. Then the final form was used to extract recommendations content from the other guidelines. Frequent communication occurred between two researchers throughout the process so as to maximize inter-rater reliability. Any disagreements were settled through consultation with the study groups.Descriptive statistics were conducted in order to characterize the recommendation content. For quantitative data, the statistical analysis was performed using Microsoft Office 2013 and SPSS Version 25.0. The total number, percentages, and mean, and standard deviation were calculated to describe the consistency of recommendations. In addition, a radar chart was also used to identify features of recommendation consistency in different aspects.http://www.guidelines-registry.cn), Registration number: IPGRP-2016CN015.This article is part of a guideline adaptation project. The Guideline Adaptation Project has been registered in the International Guideline Register Center , NCC-WCH , IDF , FIGO , CMA , DDG (German Diabetes Association), A.N.D. (Academy of Nutrition and Dietetics), API (The Association of Physicians of India), CDA (Canadian Diabetes Association), HKCOG (The Hong Kong College of Obstetricians and Gynecologists), American Endocrine Society, NZGG , SIGN (Scottish Intercollegiate Guidelines Network), and Queensland Department of Health. See Fig. According to systematically evaluation with AGREE II instrument, the methodological quality of guidelines included varied. But generally, they scored well. Scores for six AGREE II domains (Mean\u2009\u00b1\u2009SD) were:88%\u2009\u00b1\u20090.15 (Scope and Purpose), 73%\u2009\u00b1\u20090.30 (Stakeholder Involvement), 60%\u2009\u00b1\u20090.29 (Rigor of Development), 89%\u2009\u00b1\u20090.19 (Clarity of Presentation), 70%\u2009\u00b1\u20090.34 (Applicability), 70%\u2009\u00b1\u20090.41 .Using the recommendation matrix, all relevant guideline information and recommendations included were extracted, and all health questions of each guideline were placed in the recommendation matrixes Additional file 2:Recommendations Extraction of NZGG guideline. The NZGG guideline development team followed a structured process for guideline development, and there were 38 relevant recommendations being extracted, which were displayed and appraised in Additional file 2. (XLSX 19 kb)Additional file 3:Recommendations Extraction of SIGN guideline. The SIGN guideline was developed using a standard methodology according to SIGN guideline manual. There were 18 relevant recommendations being extracted, which were displayed and appraised in Additional file 3. (XLSX 16 kb)Additional file 4:Recommendations Extraction of ADA guideline. The ADA guideline was developed using a standard methodology by the ADA\u2019s Professional Practice Committee. The guideline included general recommendations about all kinds of diabetes, and there were only 17 relevant recommendations being extracted, which were displayed and appraised in Additional file 4. (XLSX 15 kb)Additional file 5:Recommendations Extraction of FIGO guideline. The FIGO brought together international experts to develop the guideline, and suggestions are provided for a variety of different regional and resource settings. There were 40 relevant recommendations being extracted, which were displayed and appraised in Additional file 5. (XLSX 19 kb)Additional File 6:Recommendations Extraction of Endocrine Society guideline. The Endocrine Society guideline was searched on the NGC website, which provided recommendations for the management of the pregnant woman with diabetes. Twenty-five relevant recommendations were extracted and appraised, which were displayed in Additional file 6. (XLSX 16 kb)Additional file 7:Recommendations Extraction of CDA guideline. The CDA guideline was developed following the process used to develop previous Canadian Diabetes Association clinical practice guidelines, and AGREE II were incorporated into the guideline development process. There were 17 relevant recommendations being extracted, which were displayed and appraised in Additional file 7. (XLSX 15 kb)Additional file 8:Recommendations Extraction of API guideline. To develop API guideline, existing guidelines, meta-analyses, cross sectional studies, systematic reviews and key cited articles were reviewed, and the recommendations were discussed at the national insulin summit. There were 22 relevant recommendations being extracted, which were displayed and appraised in Additional file 8. (XLSX 17 kb)Additional file 9:Recommendations Extraction of IDF guideline. The guideline was developed through a non-formal evidence review and discussed by a small Writing Group. There were 13 relevant recommendations being extracted, which were displayed and appraised in Additional file 9. (XLSX 14 kb)Additional file 10:Recommendations Extraction of Queensland guideline. The Queensland guideline was developed based on evidence, and there were 8 relevant recommendations being extracted, which were displayed and appraised in Additional file 10. (XLSX 14 kb)Additional file 11:Recommendations Extraction of HKCOG guideline. The HKCOG guideline was an expert consensus. It was updated taking reference to the recent evidence, WHO, NICE guideline and recommendations of other international bodies. There were 13 relevant recommendations being extracted, which were displayed and appraised in Additional file 11. (XLSX 14 kb)Additional file 12:Recommendations Extraction of A.N.D. guideline. The guideline focused on nutrition practiece during the treatment of women with GDM. There were 15 relevant recommendations being extracted, which were displayed and appraised in Additional file 12. (XLSX 15 kb)Additional file 13:Recommendations Extraction of DDG guideline. The recommendations of DDG guideline were based on the evidence from the literature, which was selected through a systematic external literature search. There were 21 relevant recommendations being extracted, which were displayed and appraised in Additional file 13. (XLSX 15 kb)Additional file 14:Recommendations Extraction of CMA guideline. The CMA guideline was an expert consensus. There were 40 relevant recommendations being extracted, which were displayed and appraised in Additional file 14. (XLSX 19 kb)"}
+{"text": "Based on its water solubility and high reactivity when phosphorylated, it is a suitable co-factor for many biochemical processes. Furthermore the vitamin is a potent antioxidant, rivaling carotenoids or tocopherols in its ability to quench reactive oxygen species. It is therefore not surprising that the vitamin is essential and unquestionably important for the cellular metabolism and well-being of all living organisms. The review briefly summarizes the biosynthetic pathways of vitamin B6 in pro- and eukaryotes and its diverse roles in enzymatic reactions. Finally, because in recent years the vitamin has often been considered beneficial for human health, the review will also sum up and critically reflect on current knowledge how human health can profit from vitamin B6.Vitamin B Furthermore, the current Recommended Dietary Allowance per day by the National Institute of Health (NIH) of the USA is around 2 mg with an upward tolerance of 100 mg per day for adults. A recent U.S. study, which tested the blood PLP levels in around 8,000 patients, demonstrated a widespread deficiency of the vitamin among all tested subgroups, and the authors suggested an increase of the daily allowance from around 2 mg to 3 to 4.9 mg per day [6 vitamers and some derivatives can generate toxic photoproducts as a result of UV irradiation [6 induced impacts will be observed. Because of the great interest in vitB6 as a therapeutic and pharmaceutical compound, its reactive capability, and its potent antioxidative characteristics, we summarize in the following paragraphs some of the relevant topics related to these issues.Since its discovery in 1932 by the Japanese scientist S. Ohdake, vitBh issues . In thesersupply ,28,29. A per day . It has  per day ,32. Thesadiation ,34,35. HPLP-dependent enzymes are highly diverse and the reactions they facilitate are estimated to represent 4% of all known catalytic activities; hence, many of them are being explored as targets for therapeutic agents (for an excellent overview see ). We chohttp://www.unicef.org/health/ index_malaria.html). Several approaches are currently underway in an effort to affect the life cycle or metabolism of the pathogen Plasmodium falciparum, the cause of malaria. One such approach is to impair biosynthesis of xanthurenic acid (14), which is essential for gametogenesis and fertility of the pathogen [15) degradation pathway from L-kynurenine (16) via 3-hydroxykynurenine (17) by the activity of the PLP-dependent kynurenine aminotransferase (EC 2.6.1.7) [One of the most threatening human diseases is malaria, with more than 300-500 million infected people worldwide and an annual death toll of up to one million people   (Scheme 17) in P. falciparum infected mosquitoes potentially reducing or even preventing malaria transmission to humans. A similar direction was recently proposed by channeling synthetic pyridoxyl-amino acid adducts into the pathogen, which can phosphorylate these compounds mediated by PDXK kinase [P. falciparum opening up the possibility for a novel malaria treatment in the future [P. falciparum expresses PDX1/PDX2 proteins, which humans lack, a potential approach can also be to target these de novo pathway proteins by specific drugs [A possible strategy involves developing specific drugs that reduce activity of the aminotransferase. This might lower the levels of 3-hydroxykynurenine (K kinase . After be future . Becauseic drugs . Howeverhttp://www.sbri.org/diseases/african.asp). It is caused by the protist Trypanosoma brucei and transmitted by flies of the Genus Glossina. A target to treat sleeping sickness in affected patients is the PLP-dependent enzyme ornithine decarboxylase . It catalyzes the step from L-ornithine (18) to the diamine putrescine (19), an initial step in the production of polyamines  to tetrahydrofolate (22) to form glycine (23) and 5,10-methylenetetrahydrofolate (24) (24), which serves as a methyl donor in many reactions, SHMT activity is critical for one-carbon metabolism, the biosynthesis of methionine, lipids, formyl-tRNA and pyrimidine. The latter is of special interest as apparently SHMT activity is coupled to some extent with increased demand for DNA biosynthesis. For example there is evidence in tumors with highly proliferating, mitotically active cells, that serine is preferentially channeled for DNA biosynthesis [Targeting PLP-dependent enzymes is also discussed in context with cancer. Here an interesting candidate is, for example, serine hydroxymethyltransferase , which catalyzes the reversible transfer of the C\u03b2 of serine (ate (24) C. Becausynthesis ,49. Consynthesis ,51.6 is directly discussed to play an important role are cardiovascular disease and high blood pressure. Coronary heart disease (CHD) is one the major reasons for death worldwide. It is caused by atheromata, which are swollen artery walls due to the accumulation of cell debris containing e.g., fatty acids and cholesterols that negatively affect blood flow. Though the impact of vitB6 is controversially discussed , among middle-aged (40\u201359 years) non-multivitamin supplement users [6 intake from 1.3 to 1.6 mg already significantly reduced the number of affected patients with reported CHDs and MIs [6 intake and reduced risk of CHD [6 are unclear. One suggested reason is that vitB6, like folates and cobalamins, can lower homocysteine (26) levels in the blood by converting the amino acid to cysteine (25) or methionine, respectively. VitB6 is required as a cofactor for cystathionine-\u03b2-synthase (EC 4.2.1.22), a PLP-dependent enzyme that converts homocysteine (26) to cysteine (25) via a cystathionine (27) intermediate  stability [5) is needed for the biosynthesis of cysteine (25), it is suggested that the mechanism of PLP (5) on the blood pressure is either a direct one, by buffering the detrimental activity of aldehydes, or occurs indirectly, by influencing the rate of cysteine (25) biosynthesis [5) with lowered blood pressure is curious as it is required for dopamine biosynthesis (see PDXH/Pnpo gene expression was found in hypertensive Dahl-S rats [5) levels are needed for coping with salt uptake and argue that the vitamin is beneficial for preventing high blood pressure [VitBpressure ,62,63,64pressure . Consequpressure . Treatmea2+ flux . In additability . Becauseynthesis ,63. Stilesis see  below, al-S rats . Okuda adiabetes mellitus focus on the impact of vitB6 on blood sugar levels and arteriosclerosis [6 in children with type 1 diabetes [diabetes mellitus patients. Endothelial function can be assessed as flow-mediated dilation of the brachial artery with high-resolution ultrasound. MacKenzie and co-workers treated patients over eight weeks with vitB6 or folate, which resulted in improved flow-mediated dilation from an average 3.5% to 8.3% and 2.6% to 9.7%, respectively, and with a combination of both to over 10% [A variety of articles about clerosis ,71,72. F6 on endothelial cells, indicating that the vitamin is indeed affecting the status of this tissue [6 seems to have a positive role against progressive kidney disease, which is frequently associated with diabetic nephropathy [6 on mammalian tissues is discussed to be the vitamin\u2019s ability to react with reducing sugar and lipids in the blood to prevent formation of advanced glycation or lipoxygenation endproducts    [39,72,728) or fructose or polyunsaturated fatty acids are highly abundant in the blood or in cells. This can be the case under stress conditions (e.g. oxidative stress) or for patients that suffer from diabetes or arteriosclerosis, respectively. The accumulation of AGEs and ALEs are on the long run detrimental and can lead to severe tissue damage in the body. Here, vitB6 might effectively prevent AGE and ALE formation making it a good candidate as a therapeutic agent in treating side effects in diabetes and arteriosclerosis patients [Such products can accumulate when reducing sugars like glucose , dopamine (35), and \u03b3-aminobutyric acid (GABA) (36). Serotonin (34), or 5-hydroxytryptamine, is synthesized from L-tryptophan (15) and requires the activities of tryptophan hydroxylase (EC 1.14.16.4) and the PLP-dependent enzyme DOPA  decarboxylase , which catalyzes the step from 5-hydroxy-L-tryptophan (37) to serotonin (34). The enzyme also catalyzes the biosynthesis of dopamine (35) from L-DOPA (38). Here the initial precursor is L-tyrosine (37), which is converted to L-DOPA (38) by the activity of L-tyrosine hydroxylase (EC 1.14.16.2) (36) in turn is synthesized by a decarboxylation reaction from L-glutamate (40) based on the activity of L-glutamate decarboxylase (VitB14.16.2) A, B. GABboxylase C (EC 4.134) acts on the central nervous system where it affects a diverse range of conditions including appetite, sleep, or cognitive functions, and it is also well known for its ability to improve the overall mood [35) affects the sympathetic nervous system where it is involved in the regulation of blood pressure and heart rate, while GABA (36) is a major inhibitory neurotransmitter in mammals that widely controls the excitability of neurons [6 have been associated with depression and also dysfunction of the brain , and it is even considered by some authors as an \u2018anti-stress\u2019 agent [Ginkgo biloba, synthesize derivatives of vitB6 that are suggested to inhibit the salvage pathway enzyme PDXK and thereby to impair neurotransmitter biosynthesis in the brain [Serotonin  with no major side effects reported [6 as deficiencies cause \u2018atrophy of lymphoid organs, marked reduction in lymphocyte numbers, impaired antibody responses, and decreased IL-2 production\u2019 [6 levels appear to be critical for patients with asthma or carpal tunnel syndrome [6 levels [While much of this work has been done in cell cultures, experiments in mice demonstrated significant tumor reduction at the minimum recommended levels of vitBreported . The immduction\u2019 . Likewissyndrome ,102; and6 levels ,104.6 and its function as a co-factor have been well resolved in the last years, leaving currently open what drives the activities of the different participating enzymes in the cell. Overall the latest studies indicate that vitB6 can be beneficial as a nutritional supplement, but can also be used as a pharmacological agent for disease treatment. Similarly, the diversity of PLP-dependent enzymes and the reactions they catalyze yield a wide range of targets for therapeutic approaches. However, the precise mechanisms of how vitB6 is beneficial are often still elusive, and to solidly define them is probably one of the most challenging tasks in the near future.The biosynthesis of vitB"}
+{"text": "Pneumonia is the leading cause of mortality and morbidity in under-five children. Regardless of this fact, efforts to identify determinants of pneumonia have been limited in the study area. The aim of this study was to identify determinants of community-acquired pneumonia among 2\u201359 months of age children in Northeast Ethiopia.Facility-based unmatched case-control study was conducted from February to April, 2019 among 444 (148 cases and 296 controls) 2\u201359 months of age children in Northeast Ethiopia. Cases were children with pneumonia, while controls were non-pneumonia children. Data were collected using a structured and pre-tested questionnaire by integrated management of neonatal and childhood illness trained nurses. The data were entered into Epi Data and then transferred to SPSS version 23 for analysis. Binary logistic regression analysis was used to test associations between the independent and the dependent variables. Variables with P-value\u2009\u2264\u20090.05 in the multivariable logistic regression model were declared as significant variables.Children having older age mother , having mothers who are housewife , not having separate kitchen , having a history of diarrhea in the last 2 weeks , having a history of acute lower respiratory infection in the last 2 weeks  and having a history of parental asthma in the family  were found to be determinants of community-acquired pneumonia.Children having older age mother, having mothers who are housewife, not having separate kitchen, having a history of diarrhea in the last 2 weeks, having a history of acute lower respiratory infection in the last 2 weeks and having a history of parental asthma in the family were found to be determinants of community-acquired pneumonia. Therefore, all health institutions should promote early treatments and prevention of diarrhea and acute lower respiratory infections of under-five children at the health facility and household level. Community-acquired pneumonia (CAP) is an infection that begins outside the hospital or is diagnosed within 48 hours after admission to the hospital in a person who has not resided in a long-term care facility for 14 days or more before admission. Community-acquired pneumonia (CAP) is an infective inflammation of lung parenchyma due to bacterial or viral pathogens [The incidence of pneumonia in children under the age of five years is 0.29 episodes per child-year, which equates 151.8\u00a0million cases annually in developing countries . The morIn sub-Saharan Africa, the estimated proportion of death in children aged below 5\u00a0years attributed to pneumonia is 17\u201326% [The determinants of pneumonia are numerous; educational status of parents, smoking habits of any member of the household, nutritional status, age and sex of the child and widely varies across the regions of the world . MortaliThe rate of all-cause mortality in the under-five age group has been cut by more than half worldwide since 1990, from 91 deaths per 1000 live births to 43 in 2015. Although this is an enormous achievement, pneumonia and diarrhea\u2019s contribution to under-five children death remains stubbornly high. In 2015, these two diseases together were responsible for nearly one of every four deaths that occurred in children under five \u201330.The under-five pneumonia morbidity burden also costs the health services program as health services are passed on to cure high pneumonia morbidity cases. Pneumonia is not only the problem of individuals, but it is also equally the problem of policymakers, planners and communities at large. Controlling the continued threat of pneumonia is one of the major health priorities of the government of Ethiopia for which this study would contribute its part. The result would be used to ensure the continuity of continuum of care so that healthy preschool children will be transformed into healthy adolescents. More importantly, there were no previous scientific studies to find out the determinants of CAP among 2\u201359 months of age children in this study area though the recent service report from the study area found pneumonia to be one of the ten top diagnoses in children. Therefore, this study was intended to fill this information gap by identifying the determinants of CAP among 2 to 59 months of age children and to update the previous knowledge on the same problem.A facility-based unmatched case-control study was conducted from February 4 to April 15, 2019 among 2\u201359 months of age children in Northeast Ethiopia. The study was conducted in Dessie City, Northeast Ethiopia. It is located 401 KMs from Addis Ababa, the capital city of Ethiopia. It was conducted from February 4 to April 15, 2019.The study population was children aged two months to five years who were attending Dessie city health institutions for different reasons within the data collection period and who lived in Dessie city administration kebeles for a minimum of six months. The cases were children aged two months to five years positive for pneumonia as defined by the World Health Organization (WHO) Integrated Management of Childhood Illness (IMNCI) guideline adopted by the Ethiopian Government since 2001 . The conThe dependent variable was community acquired pneumonia. The independent variables were socio-demographic variables , home based variables , nutritional variables , common childhood illnesses and related care practices .The sample size was determined based on sample size calculation for two population proportions formula using EPI info version 7 software by calculating the minimum number of cases and controls required by taking assumptions of a 95 percent confidence level, 80 percent power, and 14.3 percent controls the history of current parental smoking giving odds ratio (OR) of 2.0 . FinallyIn Dessie city administration, there are 8 health Centers; all of them were included in the study. Based on the number of clients/patients who visited each health center during the previous year, the total sample size was proportionally allocated to each selected health center. Screening for pneumonia in under-five outpatient department (OPD) and the maternal health department was performed based on the Integrated Management of Newborn and Child Illness (IMNCI) guideline. Controls were selected from growth monitoring and expanded program of immunization (EPI) units. The number of study participants was assigned to each selected health facility proportional to their average client size attended per month by referring to their monthly reports.The total yearly cases and controls were reported monthly through HMIS. Each health center\u2019s report was divided by 12 to get the average monthly flow. To determine the sample size, required from each health center, the average monthly flow of cases and controls is multiplied by the duration of the study period (2\u00a0months and 1 week). Finally, the study subjects were drawn from each selected health facility using consecutive sampling. The youngest child at the time of the interview was included for mothers/caretakers who have more than one under-five children. All cases were considered in all health centers during the study period and for each case, two consecutive controls were used to select controls  were enrolled in the study making a 100% response rate for both study groups. Of these enrolled, 105 (70.9%) cases and 235 (79.4%) controls were permanent urban residents. Female children account for 70 (47.3%) of cases and 155 (52.4%) of controls. The mean (\u00b1\u2009SD) age of the children was 24.16 (\u00b1\u200914.10) months and 23.94 (\u00b1\u200915.30) months for cases and controls, respectively. The mean (\u00b1\u2009SD) age of mothers was 29.19 (\u00b1\u20094.18) years and 25.77 (\u00b1\u20095.06) years for cases and controls, respectively. In relation to the household monthly income of the respondents, a large proportion of mothers of cases reported a household monthly income 103 (69.59%) while mothers of controls reported 213 (72.0%) per month. The number of children greater than three was 113 (76.4%) of the cases and 207 (69.9%) controls were lived in the households  cases and 149 (50.3%) controls had an earthen floor and their wall was made of wood with mud. One hundred forty-three (96.6%) of cases and 294 (99.3%) of controls houses had windows. About 54.3% of children\u2019s households used wood and dung as fuel for cooking. About 73 (49.3%) of cases and 169 (57.1%) of controls children were carried on the back during cooking. One hundred fifteen (77.7%) of cases and 210 (70.9%) of controls were cared for by their parents. Regarding the sleeping room, less than three persons in the family share bed during sleeping for cases 136 (91.9%) and controls 285 (96.3%)  of cases and 274 (92.6%) of controls had never been supplemented with zinc during diarrhea. About 99.5% of under-five children had been exclusively breastfed. One hundred thirty-four (90.5%) of cases and 278 93.9%) of controls started complementary feeding at six months. About 3.7% of cases and 3.7% of controls were stunted and 2% of cases and 3.4 percent of controls were wasted (Table\u00a0.9% of coThirty-six 24.3%) of cases and 24.3% of controls had current diarrhea illness and two cases had a history of measles illness. About 118 (79.7%) of cases and 233 (78.7%) of controls received a full dose of pentavalent vaccine. One hundred twenty-two cases and 241 controls received measles vaccines. One hundred forty-five cases (98%) and 277 controls (93.6%) received one full dose of the pneumococcal conjugate vaccine  compared to a child born to a mother whose age was 35\u00a0years or above. Children born from mothers who were government employees were 81% less likely to develop childhood community-acquired pneumonia  compared to children born from mothers who worked as a housewife. Children from those households who had no separate kitchen for cooking were 5.4 times more likely to develop childhood community-acquired pneumonia  compared to children from households who had separation of kitchen from the main house.Children who had a history of diarrhea in the past fifteen days prior to the study were ten times  more likely to develop pneumonia compared to their counterparts. Children from households with a history of acute lower respiratory infection within the past fifteen days prior to the study were 8.3 times  more likely to develop pneumonia compared to their counterparts. Likewise, children from households with a history of asthma were 4.9 times more likely  to develop pneumonia compared to their counterparts (Table\u00a0The study was aimed at identifying determinants of community-acquired pneumonia among under-five children in Northeast Ethiopia. Children having older age mother, having mothers who are housewife, not having separate kitchen, having a history of diarrhea in the last 2 weeks, having a history of acute lower respiratory infection in the last 2 weeks and having a history of parental asthma in the family were found to be determinants of community-acquired pneumonia.Children born from the younger mother were less likely to develop community-acquired pneumonia. A case-control study done in Kersa district, Southwest Ethiopia supports this study . The posChildren born from mothers who were government employees were less likely to develop childhood community-acquired pneumonia. This finding agreed with the studies done in India, Baghdad/Iraq , 12. ThiChildren from those households who had no separate kitchen for cooking were more likely to develop childhood community-acquired pneumonia. This finding is similar to a study conducted in Este town, Northwest Ethiopia, Nigeria, Zdola, Zambia, and Kenya \u201321, 26. Children who had a positive history of diarrhea in the past fifteen days prior to the study were more likely to develop community-acquired pneumonia. Similar studies conducted in urban areas of Oromia Zone, Amhara Region, Tigray, Ethiopia and Iraq, Zimbabwe , 25, 26 Children from households with a positive history of acute lower respiratory infection within the past fifteen days prior to the study were more likely to develop community-acquired pneumonia. It is consistent with a study conducted at Kemissie, Ethiopia . The posChildren from households with a positive history of asthma were more likely to develop community-acquired pneumonia. This result is supported by a case-control study carried out in India . AnotherOverall, the study findings imply that in Ethiopia, educating women to recognize upper respiratory tract infections earlier to prevent the development of pneumonia and creating awareness about the effect of indoor air pollution to limit the progression of respiratory tract infections to pneumonia would be very important.The unmatched case control nature of the study did not enable us to control several confounding factors at the same time and during performing logistic regression we might end up with empty strata i.e.; no cases or no control in some strata. The other limitation related to the case control study would be recall bias. Diagnosis of pneumonia was based on clinical WHO IMNCI classification guideline, which could introduce misclassification bias. In addition, the institution-based nature of the study could limit the generalizability of the findings.Children having older age mother, having mothers who are housewife, not having separate kitchen, having history of diarrhea in the last 2 weeks, having history of acute lower respiratory infection in the last 2 weeks and having history of parental asthma in the family were found to be determinants of community acquired pneumonia among 2\u201359 months of age children. Therefore, all health institutions should promote early treatments and prevention of diarrhea and acute lower respiratory infections of children in the health facility and at household level."}
+{"text": "TERT promoter (TERTp) are a common mechanism of TERT reactivation in many solid cancers, particularly those originating from slow-replicating tissues. They are associated with increased TERT levels, telomere stabilization, and cell immortalization and proliferation. Much effort has been invested in recent years in characterizing their prevalence in different cancers and their potential as biomarkers for tumor stratification, as well as assessing their molecular mechanism of action, but much remains to be understood. Notably, they appear late in cell transformation and are mutually exclusive with each other as well as with other telomere maintenance mechanisms, indicative of overlapping selective advantages and of a strict regulation of TERT expression levels. In this review, we summarized the latest literature on the role and prevalence of TERTp mutations across different cancer types, highlighting their biased distribution. We then discussed the need to maintain TERT levels at sufficient levels to immortalize cells and promote proliferation while remaining within cell sustainability levels. A better understanding of TERT regulation is crucial when considering its use as a possible target in antitumor strategies.The reactivation of telomerase reverse transcriptase (TERT) protein is the principal mechanism of telomere maintenance in cancer cells. Mutations in the  Telomeres and their associated shelterin complex are located at chromosomal ends. Telomeres are tandem repeats of TTAGGG up to 15 kb long in humans. Together, telomeres and the shelterin complex protect chromosomal ends and preserve genomic DNA integrity ,3,4. TelTERT promoter (TERTp) contains binding sites for numerous transcriptional activators including Sp-1, c-Myc, Hypoxia Induced Factor (HIF), AP-2, \u03b2-catenin, NF-\u03baB, E-twenty-six (Ets)/ternary complex factors (TCF) family members, and transcriptional repressors (Wilms\u2019 tumor (WT1), TP53, Nuclear Transcription Factor, X-Box Binding (NFX-1), Mad-1 and CCCTC binding factor (CTCF)) [TERT expression can be reactivated by copy number variants (CNV), TERT or TERTp structural variants, chromosomal rearrangements juxtaposing TERTp to enhancer elements, cellular and viral oncogenes such as Hepatitis B virus (HBV) X protein (HBx) or high-risk Human papillomavirus (HPV)16 and HPV18 E6 oncoprotein, and, last but not least, mutations within TERTp (31% of TERT-expressing cancers) , encompassing the core promoter, enables binding of c-Myc and Sp-1, thus reactivating transcription. In contrast, the region spanning exon 1 (positions +1 to \u00b1100 from the TSS) contains a binding site for the DNA insulator CTCF. Hypermethylation of this region disrupts binding of CTCF and therefore allows TERT transcription [TERT has been comprehensively reviewed recently [TERTp mutations.Although TERT activity is regulated principally at the transcriptional level ) ,20,21,29cancers) A [10,30,ll lines ,45,46,47cription ,42,43,44cription ,42,43,44recently  and, as TERTp mutations were first described in congenital and sporadic melanoma in 2013 [TERTp mutation prevalence in many other forms of cancer and characterized their mode of action. in 2013 ,50. SubsTERTp mutations are located at positions 1,295,228 and 1,295,250 on Chromosome 5, and generate C to T transitions. They are located 124 and 146 base pairs upstream from the TERTp TSS  create novel Ets/TCF transcription factor binding sites. The Ets/TCF transcription factors bind to GGAA motifs (or TTCC on the opposite strand). The 30 members of the Ets/TCF-family transcription factors are important contributors to oncogenesis and include Ets-1, Ets-2, and GA binding protein (GABP) [n helical turns away from each other [TERTp mutations are associated with epigenetically active chromatin [TERT promoter is associated with TERT expression [TERTp mutations are associated with decreased TERTp methylation [All of these n (GABP) . So far,n (GABP) ,70,71. Un (GABP) ,72,73,74ch other , or brouhromatin ,69,75,76pression ,43,44, Thylation .TERTp mutations have been recorded in a wide range of solid cancers. They are present in primary gliomas and glioblastoma multiforme (GBM), oligodendrogliomas and astrocytomas [TERTp mutations often arise in tissues with low rates of self-renewal  [TERTp mutations neutral [ocytomas ,84,85,86ocytomas ,89,90,91ocytomas , urothelocytomas ,92,93,94ocytomas ,95,96,97ocytomas ,105,106,ocytomas ,37,57  , where t neutral ,109.TERTp mutations is cancer-dependent. It is a consideration for fine tumor stratification and orientation of patients towards personalized treatments, and provides insight into the process of cellular transformation.The clinicopathological association of IDH)-1/2 mutations (a biomarker for secondary GBM), and the presence of the 1p/19q codeletion (a marker for oligodendroglioma) [TERTp mutations are relatively rare in diffuse  and anaplastic astrocytomas , as well as in IDH-mutated gliomas and secondary GBM (~28%). Their prevalence is highest  in oligodendrogliomas (where they coexist with the 1p/19q full deletion [EGFR) amplification, an early feature of primary GBM, [ATRX) and Death Domain Associated Protein (DAXX) [GBM are WHO Grade IV tumors of the central nervous system (CNS). Primary GBM evolve rapidly without prior low-grade lesions, while secondary GBM progress slowly from diffuse or anaplastic astrocytoma and oligodendroglioma (WHO Grade II and III). Primary and secondary GBM differ genetically more than histologically. The 2016 WHO classification of CNS tumors is based on \u201cintegrated diagnosis\u201d including histology and isocitrate dehydrogenase (oglioma) . TERTp mdeletion ) and in deletion ,85,111. ary GBM, ,111. Conn (DAXX) ,111,112,TERTp mutations are independently associated with older age, late clinical stage, poor prognosis, and shorter overall survival (OS) in GBM/glioma and IDH-wt astrocytoma patients. The presence of TERTp mutations alone is associated with a worse prognosis than TERTp mutations together with IDH-mutations [TERTp mutations have longer OS than patients with TERTp mutations only [IDH-wt CNS tumors generally respond to adjuvant radiation and chemotherapy with temozolomide (TMZ). However, the presence of TERTp mutations decreases sensitivity to genotoxic therapies. It has therefore been proposed to use TERTp mutations to further stratify IDH-wt Grade II and III gliomas into subgroups to orient treatment [utations ,85,112. ons only ,112,113.reatment ,81,114.TERTp mutations have been reported in 39.2% (range 22\u201371%) of tumors. They arise progressively in sun-exposed sites and have been attributed to UV radiation. They are associated with increased patient age, distal metastases, poor outcome, and compromised OS and disease-free survival (DFS) [BRAF/NRAS [mutTERTp+BRAF/mutNRAS<mutTERTp~BRAF/mutNRAS<TERTp-wt+BRAF/NRAS-wt [In patients with primary melanoma, al (DFS) ,89,115. RAF/NRAS ,116, inf/NRAS-wt .TERTp mutations are also highly prevalent at sun-exposed sites in non-melanoma squamous cell (50%) and basal cell carcinomas , the most common skin tumor [TERTp mutations display unique features in melanoma and non-melanoma cancers. First, \u2212146 C>T and \u2212124 C>T occur with similar frequencies in contrast to all other cancers, where \u2212124 C>T is by far the most prevalent mutation  of urothelial bladder and upper urinary tract cancers. They are the most common somatic lesions in this cancer type [cer type ,118,119.cer type ,118,119,cer type ,94.TERTp mutations have been reported mainly in follicular-cell-derived thyroid malignancies (papillary thyroid carcinoma (PTC): 13.4%, range 4.1\u201337.7%; follicular thyroid carcinoma (FTC): 13.9%, range 5.9\u201366.7%; poorly differentiated thyroid carcinoma (PDTC): 43.7%, range 21\u201351.7%; and anaplastic thyroid carcinomas (ATC): 39.7%, range 13\u201350%). The presence of TERTp mutations is significantly associated with increased age, tumor size and stage, distal metastases, tumor recurrence, and shorter OS and DFS in PTC and FTC. Their prevalence increases from differentiated PTC and FTC to the more aggressive poorly differentiated ATC  in preneoplastic cirrhotic lesions [CTNNB1 mutation, TERTp mutations are considered critical effectors of malignant transformation. As such, they have been proposed as early biomarkers for hepatocellular transformation [igenesis ,62,77,95ormation ,120,121.TERTp mutations appear to be more frequent in HCV-associated HCC [TERTp is a recurrent mechanism of TERT transcriptional reactivation in HBV-associated HCC [TERT in HCC found TERTp mutations to be mutually exclusive with HBV integration, TERT CNVs, and ATRX mutations [ated HCC ,96,122 aated HCC ,122, altated HCC ,77,95. Hated HCC ,123,124,utations .TERTp mutations were detected in cervical SCC  and HNSCC  [TERT [TERTp mutations have a notably higher prevalence in HPV-negative cervical and oral SCC. This gives distinct patterns of TERT reactivation through mutually exclusive mechanisms [7\u201331.7%) ,37. Thes7\u201331.7%) ,126,127.%) [TERT ,128,129.chanisms ,37. In cchanisms ,37. BroaTERT polymorphisms, a common polymorphism (rs2853669 A>G) which disrupts a pre-existing Ets/TCF binding site located 245 bp upstream of the TERT TSS has been reported to modify the effect of TERTp mutations. It decreases TERT transcription in vitro and reverses TERT upregulation by TERTp mutations [TERTp-mutated urothelial bladder cancer, renal clear cell carcinoma, melanoma, and GBM [TERTp mutations has been associated with decreased OS and DSF, and increased TERTp methylation and expression [TERTp mutations. Further studies are needed to assess the relevance of screening for this polymorphism for prognostic and treatment purposes.Among utations ,85,130.  and GBM ,131, to  and GBM ,102,103.pression . PossiblTERTp mutations have been recorded in individuals of Caucasian, African, and Asian descent, with no race-related bias. The \u2212124 C>T mutation has an overwhelmingly higher prevalence than the \u2212146 C>T mutation in all cancers, with the exception of skin cancers, where both hotspots are mutated with comparable frequencies  CA and PIK3 Receptor 1 (PIK3R1) mutations are recorded in 50% of GBM with wt arcinoma ,86,132. arcinoma , as wellarcinoma ,26,27,28lization ,137, c-mlization ,139, andlization ,141, thelization ,142. It lization ,143 and lization ,145, andlization ,150,151.TERTp mutations are associated with late-stage disease in GBM, melanoma, urothelial, and thyroid carcinoma [TERTp mutations coexist with EGFR amplification [FGFR3 (Fibroblast Growth Factor Receptor 3) mutations [TERTp mutations coexist with the common BRAF-V600E mutation [TERTp mutations [CTNNB1) neatly precede TERTp mutations during the process of malignant transformation [TERTp mutations with shortened telomeres and with age as in PTC, melanoma, and GBM/glioma, since cells from younger patients or with sufficiently long telomeres do not need to rely on telomerase reactivation to overcome telomeric crisis [Hints for a model come from the observation that overall, arcinoma ,112,118 arcinoma ,95. Theyfication ,77,111, utations ,94. In ~mutation ,116,152.mutation . Mutatioutations ,77,112. ormation ,95,120. ormation ,112,115.ormation . This inc crisis ,101,115.TERTp mutations. Alternatively, the decrease in GABPA expression may follow rather than precede TERTp mutations. In this case, it would be a cellular adaptation which confers a selective advantage to TERTp-mutated (and GFR/BRAF/RAS-mutated) cells by containing TERT reactivation within sustainable limits. Decreased GABPA could also be an adaptation to the TERT-induced proliferation, stemness, and invasion to avoid contradictory signals. Further studies establishing the order of emergence of these mutations would be needed to shed light on this matter.Intriguingly, it was recently reported that GABPA controls the cell cycle and induces cell differentiation, thus acting as a tumor suppressor regulating cell proliferation, stemness, and adhesion. It decreased tumor invasiveness and distal metastases in PTC, HCC, and bladder carcinoma ,155,156.Taken together, these observations point to a fine tuning of TERT homeostasis and suggest that there is a narrow kinetic and quantitative window for TERT expression. Below that window, cells succumb to telomere crisis and DNA damage. Above that window, cells succumb to overwhelming genetic alterations or metabolic needs. This frailty could be exploited through strategies aiming to push cells either way beyond the threshold of TERT tolerability.TERTp mutations have only been described recently; however, they have prompted an impressive number of studies which draw a comprehensive picture of their prevalence across cancers, as well as providing clues on their mechanisms of action and their associated constraints. They have been proposed as potential biomarkers with predictive and treatment-orienting value. However, more structured studies are needed to validate their clinical potential, particularly since they appear at different stages in different malignancies, ranging from preneoplastic cirrhotic lesions to late stage GBM or melanoma with distal metastases. Cancer cells only require one mechanism of telomere maintenance. This underscores the key role of telomere stabilization in the process of transformation, as well as the necessity of maintaining an exquisitely balanced TERT homeostasis to achieve tumor cell selection, adaptation, and sustainability. TERT is a target of choice in antitumor strategies due to its reactivation in numerous cancers. A better understanding of TERT regulation, homeostasis, and functions could help to overcome the shortcomings of prior genetic and immunotherapy-based approaches targeting TERT."}
+{"text": "TP53 mutations. Recently, six p53 immunohistochemical (IHC) patterns have been defined, which have shown strong correlation with TP53 mutation status. However, few studies have applied this new six-pattern framework and none of them exhaustively compared p53 IHC positivity and patterns between invasive VSCC and adjacent skin lesion. We performed p53 IHC in a series of 779 HPV-independent VSCC with adjacent skin and evaluated the IHC slides following the newly described classification. Some 74.1% invasive VSCC showed abnormal p53 IHC staining. A skin lesion was identified in 450 cases (57.8%), including 254 intraepithelial precursors and 196 inflammatory/reactive lesions. Two hundred and ten of 450 (47%) VSCC with associated skin lesions showed an abnormal p53 IHC stain, with an identical staining pattern between the VSCC and the adjacent skin lesion in 80% of the cases. A total of 144/450 (32%) VSCC showed wild-type p53 IHC both in the invasive VSCC and adjacent skin lesion. Finally, 96/450 (21%) VSCC showed p53 IHC abnormal staining in the invasive VSCC but a wild-type p53 staining in the skin lesion. Most of the discordant cases  showed adjacent inflammatory lesions. In conclusion, the p53 IHC staining and pattern are usually identical in the VSCC and the intraepithelial precursor.Human papillomavirus (HPV)-independent vulvar squamous cell carcinomas (VSCC) and its precursors frequently harbour  Vulvar squamous cell carcinomas (VSCC) may arise via human papillomavirus (HPV)-associated and -independent pathways ,2. InvasTP53 mutations are a common finding in HPV-independent VSCC and its classical precursor lesion, dVIN [TP53 mutations [TP53 abnormalities [TP53 mutated or wild-type status in VSCC [TP53 mutational status [TP53 mutation status within HPV-independent VSCC and its precursor intraepithelial lesions.on, dVIN . Indeed,utations ,5,6,7,8. in VSCC . p53 IHC in VSCC . However in VSCC ,19, whicl status  and highOnly two studies have applied this new six-pattern classification in VSCC and premalignant lesions ,20, but p < 0.001).Overall, 577/779 invasive VSCC (74.1%) showed an abnormal p53 IHC staining, and 202/779 (25.9%) showed wild-type p53 expression. Parabasal/diffuse , followed by basal overexpression  were the most frequent abnormal patterns observed. Null pattern was observed in 66 cases (11.4%), whereas cytoplasmic staining was identified only in eight VSCC (1.4%). The percentage of invasive VSCC with abnormal patterns of p53 IHC was significantly higher in cases arising in normal skin compared with VSCC with adjacent skin lesion  and VAAD/DEVIL . LS was identified in 36 cases (4.6%). Finally, other inflammatory/reactive lesions were recognized in 160 cases (20.5%). LS was identified as an accompanying lesion in 64 cases (25.2%) with intraepithelial lesions. An abnormal p53 IHC staining was identified in 129/186 (69.3%) of the dVIN, 34/46 (73.9%) of the HSIL-like lesions, 9/22 (40.9%) of VAAD/DEVIL, 9/36 (25.0%) LS, and 29/160 (18.1%) of inflammatory/reactive lesions.Four hundred and fifty out of 779 cases (57.8%) showed at least one adjacent skin abnormality, and in 329 cases (42.2%) no skin lesions were identified. Intraepithelial precursors were identified in 254 cases (32.6%). dVIN was the most frequent intraepithelial precursor identified , followed by HSIL-like lesions  was reviewed. The series, which has been described in detail elsewhere , includeAll VSCC fulfilling the following inclusion criteria were included in the study: (1) Negative result for HPV detection by polymerase chain reaction (PCR); (2) negative result for p16 IHC in the invasive tumor; and (3) presence of at least 1 cm of skin surrounding or overlying the invasive tumor.From 1709 VSCC included in the VVAP study, 1060 were HPV negative and p16 negative. Of them, 281 cases were excluded because no skin, or less than 1 cm of adjacent skin was available for revision. Overall, 779 cases fulfilled the inclusion criteria and were included in the analysis. The study algorithm is shown in DNA extraction was performed on whole sections of formalin-fixed paraffin-embedded tissue from surgical specimens or vulvar biopsies as previously described . No micrHPV DNA detection and typing were performed using SPF10 PCR, DEIA and the LiPA25 system  as previously described . BrieflyA single histological slide of each tumor was available for review. The squamous epithelium adjacent to the neoplasms was carefully evaluated in search of associated precursor lesions or inflammatory/reactive skin abnormalities. In order to establish the diagnosis of intraepithelial lesion, the lesion had the peripheral extension for at least 1 cm away from the invasive carcinoma to rule out possible peripheral intraepithelial extension of the invasive tumor ,36.Intraepithelial precursors included (1) dVIN, (2) HSIL-like lesions, and 3) VAAD/DEVIL. As inflammatory skin lesions we included LS as a separate category, but any other inflammatory/reactive skin conditions, including lichen simplex chronicus, lichen planus, and other non-specific inflammatory and/or reactive abnormalities, were grouped as a single category. The diagnosis of dVIN was based on the presence of atypical keratinocytes limited to the basal and parabasal layers in the context of a fully differentiated epithelium . HSIL-liAll 779 cases included in the VVAP study were evaluated by two pathologists (N.R. and J.O.). This evaluation was blind to the HPV detection and IHC results. The morphological evaluation included tumor subtype and characteristics of the adjacent skin with identification of inflammatory and/or intraepithelial precursors (if present). All discrepant results were reviewed in an adjudication meeting and a final diagnosis was established by consensus between the reviewers.IHC stainings were performed with the automated system TechMate 500 , using the EnVision system (Dako). p53 was detected with the monoclonal antibody . Briefly, 4 \u03bcm sections were deparaffinized and hydrated through graded alcohols and water. Peroxidase was blocked for 7.5 min in ChemMate peroxidase-blocking solution (Dako). Then, the slides were incubated with the primary antibodies for 30 min and washed in ChemMate buffer solution (Dako). Then, the peroxidase-labeled polymer was applied for 30 min. After washing in ChemMate buffer solution, the glass slides were incubated with the diaminobenzidine substrate chromogen solution, washed in water, counterstained with hematoxylin, washed, dehydrated, and mounted. A positive control consisting of an ovarian serous papillary carcinoma was included in each section.The staining was evaluated separately in the invasive tumor and in the adjacent skin."}
+{"text": "The presence of an unpaired electron in paramagnetic molecules generates significant effects in NMR spectra, which can be exploited to provide restraints complementary to those used in standard structure-calculation protocols. NMR already occupies a central position in drug discovery for its use in fragment screening, structural biology and validation of ligand\u2013target interactions. Paramagnetic restraints provide unique opportunities, for example, for more sensitive screening to identify weaker-binding fragments. A key application of paramagnetic NMR in drug discovery, however, is to provide new structural restraints in cases where crystallography proves intractable. This is particularly important at early stages in drug-discovery programs where crystal structures of weakly-binding fragments are difficult to obtain and crystallization artefacts are probable, but structural information about ligand poses is crucial to guide medicinal chemistry. Numerous applications show the value of paramagnetic restraints to filter computational docking poses and to generate interaction models. Paramagnetic relaxation enhancements (PREs) generate a distance-dependent effect, while pseudo-contact shift (PCS) restraints provide both distance and angular information. Here, we review strategies for introducing paramagnetic centers and discuss examples that illustrate the utility of paramagnetic restraints in drug discovery. Combined with standard approaches, such as chemical shift perturbation and NOE-derived distance information, paramagnetic NMR promises a valuable source of information for many challenging drug-discovery programs. The theory and use of paramagnetic NMR has been reviewed elsewhere  effect leads to changes in chemical shift positions. Nuclei sense the sum of the external magnetic field and of a field caused by the electron static magnetic moment. Therefore, the dipolar interaction between the total magnetic field and nuclei is not completely averaged by molecular rotation (in contrast to dipole\u2013dipole interactions between nuclear spins). The anisotropy of the static magnetic moment yields average residual dipolar interactions, which cause the PCS effect. As a result, PCS depends on both the distance  arises in the case of anisotropic magnetic susceptibility of the paramagnetic center, which induces partial self-alignment of the molecules relative to the magnetic field. When a molecule tumbles freely and isotropically, dipole\u2013dipole interactions are averaged to zero; in the case of partial alignment, an RDC remains, providing orientation information about scalar-coupled pairs of spins, relative to the alignment tensor. The RDC for two spins, 1 and 2 is defined in Eq.\u00a0Residual dipolar couplings have been extensively reviewed elsewhere  to lanthanide metals  can be identified by intermolecular PREs, as long as the exchange rate is larger than the PRE enhancement and the chemical shift difference between two states, i.e. in fast exchange on the chemical shift and relaxation timescales . However, due to the strength of the PRE effect, even weakly-interacting molecules can be easily detected by line broadening of their signals upon addition of paramagnetic protein, compared to a diamagnetic reference, and furthermore, the protein requirements are very low Fig.\u00a0. These en Jahnke . The metIn a second paper, the use of PREs for primary screening was also demonstrated in a method known as SLAPSTIC (spin labels attached to protein side chains as a tool to identify interacting compounds) , enhancing the Solomon PRE according to Eq.\u00a0In addition to screening, PRE effects can also be used as a source of distance restraints to provide information on ligand pose in a binding site Figs. , 6. To dmentclass2pt{minimmentclass2pt{minimt}\u03c4c Eq.\u00a0.2+ chelated  have a greater population in the bound state leading to larger shifts on the protein, resulting in a larger effective tensor. A greater effective Kd was observed by ITC for DOTA-tagged sevoflurane as for untagged sevoflurane, a concern is that the addition of such a large tag to a ligand could substantially alter its binding mode. It is also notable that in this case the Kd was not included in the calculations, which led to differences between the effective tensors in the two cases. The magnitude of these tensors are therefore not transferable to other systems with different Kd values, for example for screening applications. For such a purpose, the tensors must be calculated by either considering the Kd values or by calculating the tensor using the shifts seen on the signals of the tagged ligand. For the latter, as with all tensor calculations, a minimum of eight signals would be required.The shifts can be used in a similar manner to chemical shift perturbations (CSP) in order to validate a hypothesized binding position. As the PCS are purely distance and orientation dependent and are not affected by  changes in chemical environment, they directly report on the true binding site, in contrast to CSP analysis, which can be affected by allosteric changes. An example of this approach is DOTA-tagged sevoflurane, which binds to calmodulin N- and C-lobes. The binding position was identified by calculating an effective bound) for use in structure calculations or filtering of docking poses. Different strategies have been employed in different exchange regimes, which are discussed below.While tagging the ligand enables detection of the binding region on the protein, tagging the protein allows PCS for the ligand signals to be detected, potentially allowing determination of the binding pose. The key challenge is then to determine the bound-state shifts for the ligand signals  and long mentclasspt{minimaon Table . The add1H and 13C spectra of the ligand were measured in order to maximize the available restraints . Accuracy of the 19F placement approaches 0.8\u00a0\u00c5 in some cases, compared to X-ray structures   at the intersection point. This gave a readout of orthogonality that could then be used to directly compare data calculated with a variety of sets of three tensors. The authors found that for three iso-surfaces with an angle score below 30\u00b0, the calculated position closely matches the four-tensor calculation, but with an angle score above 40\u00b0, this could lead to a deviation of up to\u00a010\u00a0\u00c5.However, to directly calculate one single position, rather than eliminating artificially the false results, multiple data sets with different tensors must be used, either using multiple tag positions  is unavailable, or if the binding kinetics is in intermediate to slow exchange where ligand signals are challenging to detect. Methods to overcome these difficulties have been proposed, but likely remain beyond the scope of many projects. PRE restraints are less powerful for structural analysis of protein\u2013ligand complexes since they only provide distance and no orientation restraints, and the accuracy of the distance information depends on the ability to extract In recent years various applications of paramagnetic NMR in drug discovery have been reported. PRE-based screening allows more sensitive detection of weak binding with reduced protein concentration, while PCS restraints have been used in multiple applications to allow localization of ligands in different exchange regimes. This appears especially useful in early stages of drug discovery involving weakly binding fragments, which are often difficult to crystallize. Paramagnetic restraints can be used for structure calculations of protein\u2013ligand complexes, using e.g. Xplor-NIH or HADDOCK, or to filter docking poses derived from computational analyses Fig.\u00a0. Given t"}
+{"text": "Short chain fatty acids (SCFAs) are produced and absorbed in the distal intestine. We explore whether SCFAs affect ClC-2, re-examine a possible direct effect of lubiprostone on ClC-2, and use mice deficient in ClC-2 to stringently address the hypothesis that the epithelial effect of lubiprostone targets this anion channel. Patch-clamp whole cell recordings of ClC-2 expressed in mammalian cells are used to assay SCFA and lubiprostone effects. Using chamber measurements of ion current in mice deficient in ClC-2 or CFTR channels served to analyze the target of lubiprostone in the distal intestinal epithelium. Intracellular SCFAs had a dual action on ClC-2, partially inhibiting conduction but, importantly, facilitating the voltage activation of ClC-2. Intra- or extracellular lubiprostone had no effect on ClC-2 currents. Lubiprostone elicited a secretory current across colonic epithelia that was increased in mice deficient in ClC-2, consistent with the channel\u2019s proposed proabsorptive function, but absent from those deficient in CFTR. Whilst SCFAs might exert a physiological effect on ClC-2 as part of their known proabsorptive effect, ClC-2 plays no part in the lubiprostone intestinal effect that appears mediated by CFTR activation.Lubiprostone, a 20-carbon synthetic fatty acid used for the treatment of constipation, is thought to act through an action on Cl The search for drugs that target specific defects in the CFTR Cl\u2212 channel protein has resulted in the discovery of modulators useful in the treatment of the disease [\u2212 channel ClC-2 [Knowledge of how to manipulate pharmacologically intestinal transport processes is important for the rational design of drugs to combat the intestine\u2019s disorders that can result in diarrheal disease or constipation. An example is cystic fibrosis (CF), an inherited disease caused by mutations that impair the function of CFTR, a Cl disease ,2. Lubip disease . Lubiproel ClC-2 , but thiel ClC-2 .\u2212 channels belonging to the CLC family [\u2212 secretion in the mouse small intestine was based on a purported apical location of the channel [ClC-2 is one of four mammalian plasma membrane ClC family . ClC-2 c channel . There i channel ,9,10,11. channel . The abs\u2212/\u2212Clnc2 mouse, also support a basolateral localization for this channel [\u2212/\u2212Clcn2 mouse model led to an increase in cAMP-dependent Cl\u2212 secretion, and double mutants lacking ClC-2 and expressing the CF mutant CFTR-\u0394F08 had a markedly decreased early lethality [Functional data implicating ClC-2 in an absorptive ion transport function in the colon, obtained using a  channel ,13. The ethality , presuma4 receptors, increasing intracellular cAMPs promoting secretion through CFTR activation [4 prostanoid receptor to induce an increase in cAMP.In view of the results described above, it is difficult to envisage that the activation of intestinal ClC-2 channels by lubiprostone could be the mechanism for its action as a drug to antagonize constipation, but the reality is quite the contrary. An alternative mechanism of action for lubiprostone has been proposed and supported by strong experimental evidence. In this scenario, lubiprostone would act as an agonist of EPtivation ,16,17,18tivation . Lubiprotivation  also dem4 receptor. The high expression of ClC-2 in the colon, a site of absorption of short chain fatty acids (SCFAs) from very high luminal concentrations, led us to explore the possible regulation of the channel by these compounds. In addition, we have probed the possible role of ClC-2 in the intestinal effect of lubiprostone, taking advantage of the availability of ClC-2 null mice. Our results show that ClC-2 can be both activated and blocked by SCFAs but not by lubiprostone. Our experiments using genetically modified mice show that the secretory effect of lubiprostone in the colonic epithelium is independent of the presence of ClC-2 but consistent with an activation of CFTR.All this evidence notwithstanding, the idea that lubiprostone might act directly through ClC-2 activation has persisted. Indeed, in a recent paper, Cuppoletti et al.  propose 2, 1 MgCl2, 22 sucrose, and 10 Hepes, pH 7.4 adjusted with Tris. The pipette solution (35 mM chloride) contained the following (mM): 100 sodium gluconate, 33 CsCl, 1 MgCl2, 2 EGTA, and 10 Hepes, pH 7.4 adjusted with Tris. Different concentrations of butyrate, acetate, propionate, and lactate were achieved by the equimolar replacement of sodium gluconate in the solutions. Changes in liquid junction potential were calculated [Heterologous expression and electrophysiology. HEK-293 cells were grown and transiently transfected with the ClC-2 cDNA for ClC-2\u220677-86 from Cavia porcellus , GenBankStandard whole-cell patch-clamp recordings were performed as described elsewhere . The volTo extrapolate tail currents, double exponentials plus a constant term equation were fitted to the current deactivation time course and the tail current value calculated as the sum of the size of the exponential terms and the constant value. The tail current as a function of the voltage curve was analyzed by adjusting a Boltzmann distribution, as described .Clcn2\u2212/\u2212 [tm1EurCftr [Animals. All animal procedures were reviewed and approved by the local Institutional Animal Care and Use Committee (protocol 2016-01). The mouse facility at the Centro de Estudios Cient\u00edficos (CECs) is AAALAC accredited and adheres to the guidelines in the Guide for the Care and Use of Laboratory Animals . Mice were bred at the Animal Facility of CECs from Clcn2\u2212/\u2212  or Cftrttrtm1Eur  foundersTissue isolation and Ussing chamber experiments. All procedures were carried out by trained personnel within approved premises. Mice (C57BL/6J background) were euthanized by cervical dislocation. The colon was excised and opened lengthwise through the mesenteric border; the mucosal surface of the distal colon was scraped with a glass microscope slide to obtain a partially stripped mucosal sheet. This type of preparation yields a largely mucosa-containing tissue suitable for the measurement of transepithelial electrical parameters .2) and inserted as a dividing membrane in a modified Ussing chamber . The bath solution bathing either side of the epithelial layer contained the following (in mM): 120 NaCl, 25 NaHCO3, 3.3 KH2PO4, 0.8 K2HPO4, 1.2 MgCl2, 1.2 CaCl2, and 10 D-glucose. Both hemichambers were continuously gassed with 5% CO2 and 95% O2.The sheet was mounted on a tissue-holding slider  and Acquire & Analyse v. 2.3 software through a DI-720 data acquisition system  were used to continuously measure the transepithelial potential difference , clamp current at zero, and deliver 1 s, 10 \u03bcA pulses at 0.2 s intervals. The difference in current and voltage was used to calculate the tissue resistance and equivalent short-circuit currents according to Ohm\u2019s law.+ current through the epithelial sodium channels (ENaC). Apical lubiprostone  was used at 0.1 \u03bcM. Increase in intracellular cAMP was achieved with 1 \u03bcM forskolin  and 100 \u03bcM isobutylmethylxanthine . The KCNQ1/KCNE3 K+ channel was inhibited using 10 \u03bcM chromanol 293B . Carbachol 100 \u03bcM  was used to activate muscarinic cholinergic receptors.Apical 10 \u03bcM amiloride  was added to block Na\u2212 and 100 mM gluconate (panels A and A1) or the same Cl\u2212 concentration but 100 mM intracellular butyrate (panels B and B1). The values for the traces indicate the magnitude of the main activating voltage pulses, which are followed by steps to 30 mV, thus allowing the measurement of tail currents and therefore the degree of activation reached. Comparison of the traces obtained with intracellular butyrate and those with gluconate, that we presumed to be inert and impermeant, suggest that less hyperpolarization is needed to activate ClC-2 when the SCFA is present. This impression is confirmed by examining the tail currents at 30 mV as a function of the magnitude of the main activating pulse  from \u2212107 \u00b1 3.3 mV (n = 7), the V0.5 measured when 100 mM gluconate was the main intracellular anion . 50 at 22 mM and nH value of 2.5. The valence derived from the slope factor is given in panel D1. Similar effects on V0.5 can be seen with other SCFAs, and those for 100 mM acetate, propionate, and lactate are also shown in High intracellular SCFA concentrations are likely attained in the transporting colonocytes during their absorptive process in the large intestine. Given the presence of ClC-2 in these cells , we haveng pulse C. The ac50 of 25 mM.Examination of the traces in To gain an idea about the possible voltage dependence of butyrate\u2019s blocking effect, we have examined the development of the tail currents at 30 mV after activating pulses of different voltages. \u2212 and 100 mM gluconate, with a bathing solution of 146 mM Cl\u2212. The reversal potential of \u221237.7 \u00b1 0.6 mV (mean and SEM of four separate experiments) is close to ECl. Replacement of all but 16 mM Cl\u2212 with the foreign anions butyrate or acetate displaced the reversal potential in the depolarized direction, consistent with PX/PCl ratios of 0.08 \u00b1 0.03 (n = 4) and 0.07 \u00b1 0.02 (n = 4) for butyrate and acetate, respectively, similar to that of the impermeant anion gluconate .Concerning SCFA permeability, butyrate and acetate are largely impermeant, as shown in panel F of Clcn2 null mouse [SC recording of the distal colon epithelium from a wild type (WT) mouse mounted in an Ussing chamber. After blocking ENaC-mediated Na+ absorptive current with 10 \u00b5M mucosal amiloride, addition of 0.1 \u00b5M lubiprostone elicited a negative current, consistent with anion secretion. This can be inhibited by the addition of 10 \u00b5M of chromanol 293B to block the KCNQ1/KCNE3 K+ channel. Further addition of carbachol  to the serosal solution to increase intracellular Ca2+ and activate KCa3.1 resulted in an anion secretory current known to be mediated by CFTR [SC) across the colon epithelium under the different conditions is given in the right-hand panel of Clcn2\u2212/\u2212 mouse can be seen in SC. None of these differ significantly from those measured in the WT tissues, save the \u2206ISC in response to lubiprostone, that was significantly larger in the colon from Clcn2\u2212/\u2212 than in that from WT mice . We also probed the effect of the drug in the colonic tissue of mice carrying the \u2206F508 mutant of CFTR, the most common defect causing CF in humans. The lubiprostone effect was absent from the epithelia of these animals, in which increasing cAMP or addition of Cch also failed to evoke any anion secretory response, this last compound eliciting a K+ secretory current, as described previously [Given that lubiprostone is a fatty acid, it is conceivable that a mechanism involved in its proposed role in the amelioration of constipation could be of that of a ClC-2 blockade, as seen here with SCFAs, and a consequent diminution in ion absorption. We have now used a ll mouse  to explo by CFTR , presumaeviously .n = 7) under control conditions and \u22122.10 \u00b1 0.29 nA (n = 5) for cells with intracellular lubiprostone. In 0.5 values of \u2212100 \u00b1 1.8 and \u2212101 \u00b1 2.0 mV  in this segment of the intestine. Intraluminal concentrations of SCFAs in the colon can reach combined levels of the order of 150 mM, compared to <0.5 mM in the portal circulation ,30. Moreproposed ,33,34. Isorption . As SCFAsorption ,36, our cdc2/cyclin B [Although our results indicate that SCFAs regulate ClC-2 activity directly, an SCFA-dependent mechanism involving G-coupled receptors cannot be ruled out. Indeed, SCFAs not only act as energy sources  and histcyclin B , and procyclin B . It is nIt has also been proposed that lubiprostone promotes a functional switching from absorptive-to-secretory phenotype in jejunal villous and surface colonic epithelial cells by a mechanism that facilitates the internalization of key absorptive proteins such as NHE-3, DRA, and ClC-2, while stimulating the insertion at the plasma membrane of CFTR, NBCe1, and NKCC1, key proteins involved in intestinal solute secretion ,48. Lubi\u2212, and extracellular H+. Activation by H+ has been linked to the neutralization of the so-called gating glutamate identified in ClC protein structures [\u2212 was proposed to favor this neutralization allosterically by interacting with the most intracellular of three putative anion binding sites of the channel\u2019s selectivity filter (SF) [\u2212 into the permeation pathway to displace the gating glutamate through an electrostatic effect, and this accounts for the voltage-dependent gating of ClC-2 [\u2212 [\u2212 influx rather than a direct voltage-dependent removal of the SCFA. An alternative interpretation, of activation taking place by partial voltage-dependent ingress of the SCFA into the pore without completely traversing it [Concerning the mechanism of the direct effects of SCFAs on ClC-2, we have not investigated further the possible location of the site(s) of their action on the channel. The activation of ClC-2 is known to be dependent on voltage, intracellular Clructures , which iructures . Intraceter (SF) . More reof ClC-2 ,55. The ClC-2 [\u2212 , in whic\u2212 channel ClC-2 [\u2212 secretion is increased in \u2212/\u2212Clcn2 mice and early lethality of the tm1EurCftr mouse, that carries the CFTR-\u2206F08 CF mutant, is markedly ameliorated upon additional inactivation of Clcn2 [Lubiprostone is a pharmacological agent used in the treatment of constipation  that hasel ClC-2 , a mechael ClC-2 ,56. Indeel ClC-2 . Consistof Clcn2 . Lubiproof Clcn2 , which stm1EurCftr mice confirm a previous report [4-type prostanoid receptors.Despite the protracted dispute about the mechanism of lubiprostone action, it is surprising that its effect on intestinal ClC-2 had not been tested through the use of genetic inactivation in animals. Our results fill this gap and reveal that the presence of ClC-2 is not necessary for lubiprostone action in intestinal transport. Lubiprostone is capable of eliciting an anion secretory response in the mouse colon, and this effect is not only not curtailed in the absence of ClC-2 but enhanced. This is consistent with ClC-2 exerting a proabsorptive effect as it has been deduced from experiments with double mutants lacking both CFTR and ClC-2  or direcs report  that anyThe concept of lubiprostone as a specific activator of ClC-2 originates from work with T84 colonic carcinoma cells that express the channel but also on recombinant ClC-2 expressed in HEK-293 cells  that rep\u2212 channel as a possible explanation for a prosecretory intestinal effect. Clear effects of short chain fatty acids on the ClC-2 channel revealed here, on the other hand, might be of relevance to transport processes in the distal intestine. Our results using ClC-2 null mice point to a CFTR-mediated effect of lubiprostone, most likely mediated by prostanoid receptor activation [In conclusion, our results are inconsistent with an action of lubiprostone on the activity of the ClC-2 Cltivation , to unde"}
+{"text": "Resistive random access memory (RRAM) devices are receiving increasing extensive attention due to their enhanced properties such as fast operation speed, simple device structure, low power consumption, good scalability potential and so on, and are currently considered to be one of the next-generation alternatives to traditional memory. In this review, an overview of RRAM devices is demonstrated in terms of thin film materials investigation on electrode and function layer, switching mechanisms and artificial intelligence applications. Compared with the well-developed application of inorganic thin film materials  materials) in RRAM devices, organic thin film materials  application is considered to be the candidate with significant potential. The performance of RRAM devices is closely related to the investigation of switching mechanisms in this review, including thermal-chemical mechanism (TCM), valance change mechanism (VCM) and electrochemical metallization (ECM). Finally, the bionic synaptic application of RRAM devices is under intensive consideration, its main characteristics such as potentiation/depression response, short-/long-term plasticity (STP/LTP), transition from short-term memory to long-term memory (STM to LTM) and spike-time-dependent plasticity (STDP) reveal the great potential of RRAM devices in the field of neuromorphic application. Most ofa et al. . The bipn et al. , Pt/sputg et al. , Pt/Ni/Ek et al. .4+ ions [2O3/ITO device exhibited 80% transmittance at 550 nm wavelength due to the good light transmittance of the ITO electrode. The excellent electrical conductivity of graphene and ITO made the devices operate under low CC (<100 \u03bcA) with low voltage (<1 V) and low power consumption (<100 \u03bcW). The device also demonstrated a resistance ratio between HRS and LRS higher than 104 during 200 successful switching cycles and retention longer than 104 s. Apart from elementary substance metals mentioned, carbon-based materials such as graphene and carbon nanotubes ,131,135,4+ ions . Zhao etThe significance of selecting electrode materials is to optimize the performance of RRAM devices. Electrode materials like inert metals (Pt and Pd) are always investigated as carrier transportation paths, which have a slight and limited influence on RS performance. Then, electrodes of an RRAM device should have a positive impact on the formation process of CFs, which resulted from the migration of anion, which is always observed in oxygen-vacancy-based RRAM devices ,9,32. FiWith the rapid development of information technology, the neuromorphic computing applications in terms of hardware and software have stepped into the new era. For now, the neuron complexity simulation has been achieved with conventional computing technology based on animal brains of cats and rats ,137. How2 device area and can also switch with the energy of ~pJ-level, which enables significant improvements in high-density integration and low power operation compared to conventional CMOS-based synapse devices [Compared with a conventional computer system based on Von Neumann architecture, artificial neural networks (ANNs) have received extensive attention due to their lower power consumption and higher operation efficiency ,139. How devices ,137,138.10 synapses/cm2) [2+, which has a temporary influence on synaptic transmission. The transmitting process of the neurotransmitter through a synapse represents the information delivery among neurons. The gap between presynaptic and postsynaptic membranes is the synaptic cleft, which is around 15~30-nm thick [In the analog circuit of ANNs, RRAM devices act as substitution to synapses in order to provide connection function between neurons and information storage cells ,141. Theses/cm2) ,142. As ses/cm2) . Presynanm thick ,145. In Massive neurons form neural circuits through synapses in neural networks of the human brain ,3,4,5,6.x:Ag/TiOx/p++-Si RRAM device with bilayer dielectric in terms of STP such as potentiation, depression and PPF [x:Ag/TiOx/p++-Si samples, the next post-synaptic response became higher than that of the previous one, which indicated that the interval time of spike was less than the recovery time. Berdan et al. also reported the STP of TiO2-based RRAM devices through the transient conductance response [x/IGZO (InGaZnO) bilayers [x/IGZO-based RRAM device could enhance the trans-conductance with the effect of high-frequency stimuli and further improve the PPF phenomenon. In general, two types of RS behaviors observed in RRAM devices, abrupt and gradual RS behaviors, were considered corresponding to digital and analog switching, respectively. The abrupt performance for resistance change was believed to be consistent with a digital signal while the gradual one with continuous conductance changes showed similar characteristics like a biological synapse . Ilyas e and PPF . The con and PPF ,157. Durresponse . As illuresponse ,160,161.response . As demobilayers . Firstly0.5Zr0.5O2 (HZO) dielectric layer, as illustrated in Compared with the investigation of STP, current research on LTP mainly focuses on long-term potentiation/depression and transition from STP to LTP ,163,164.2+ ions drifting into the RS layer with a few stimulations, and then CF based on Cu atoms spontaneously decayed back to the initial state. However, with more repeated stimulations onto TE Cu, more Cu2+ ions migrated to the RS layer, which showed similar performance like training operation in the neural network. Ilyas researched the transition from STP to LTP of Ag/SiOx:Ag/TiOx/p++-Si device through modulating pulse strength [Except for the research on long-term potentiation and depression behaviors of RRAM devices, the transition from STP to LTP also attracted significant interests ,155,165,Currently, many research achievements have proved that long- and short-term plasticity functions of biological neural synapse could by mimicked by RRAM devices with modulation of applied pulses (including amplitude and number modulations). On the other hand, as one of the determining factors in synapse plasticity, STDP also has received extensive attention. STPD can be defined as a function relationship between change of synaptic weight (\u0394W) and time interval (\u0394t) resulting from activity variation of the pre- and post-neurons ,163. Whex:Ag/TiOx/p++-Si samples, which can be observed in 2/Al2O3/ITO) [3/RGO/FTO [Ilyas et al. emulated the STDP rule of Ag/SiO2O3/ITO) . As illu2O3/ITO) . After t/RGO/FTO ; a similx and HfOx functional layers [x/HfOx functional layers with stack structure were investigated [x resistive layers with the multi-level structure was verified [In this work, we have provided an overview of RRAM devices with advances including various thin film materials applied in RS layer and electrode, classification of RS mechanisms and investigation on artificial synapse. Many research reports indicate that RRAM devices fabricated with inorganic materials, such as oxides, solid electrolyte and two-dimensional 2D) materials, have demonstrated relatively mature performance. There is great potential for the application of organic materials  in RRAM devices accordingly. The performance of the devices depends largely on the RS mechanisms, which also has a strong connection with choice and processing techniques of the thin film materials. Based on the fundamental performance of RRAM devices, some outstanding enterprise or research institutions such as Samsung Electronics, Intel Corporation and Institute of Microelectronics of the Chinese Academy of Sciences (IMECAS) have put effort into promoting the development of large-scale manufacture and mature product commercialization of RRAM devices for many years. As early in 2004, Samsung Electronics reported the highly scalable TMO  RRAM devices with CMOS technology in IEDM  and NiO was used as a functional layer . In 2007D material layers . One yeastigated . In 2016verified . In 2019verified . All the"}
+{"text": "Quercus species. In initial experiments, a five-factor Plackett-Burman design including 12 experimental runs was tested against the total polyphenolic content (TP). Amongst, XA: extraction temperature, XC: solvent concentration and XE: sample-to-solvent ratio had shown significant influence on yield. These influential factors were further subject to a three-factor-three-level Box-Wilson Central Composite Design; including 20 experimental runs and 3D response surface methodology plots were used to determine optimum conditions .This optimized condition was further used in other Quercus species of western Himalaya, India. The High-Performance Liquid Chromatography (HPLC) revealed occurrence of 12 polyphenols in six screened Quercus species with the highest concentration of catechin followed by gallic acid. Amongest, Q. franchetii and Q. serrata shared maximum numbers of polyphenolic antioxidants (8 in each). This optimized extraction condition of Quercus species can be utilized for precise quantification of polyphenols and their use in pharmaceutical industries as a potential substitute of synthetic polyphenols.In this study heat-assisted extraction conditions were optimized to enhance extraction yield of antioxidant polyphenols from leaves of Himalayan  The health benefits of polyphenols to human beings have been attracted attention to them worldwide and these beneficial properties of polyphenols are generally accredited to their antioxidant nature . PolypheNaturally, in plants, PAs are among the most abundant secondary metabolites with approximately 8,000 known structures \u201310. ThesQuercus genus (family: Fagaceae) consists 500 species of trees and shrubs distributed mainly in Central America and Southeast Asia  Plackett-Burman statistical design (PBD) involving 12 experimental runs considering only one dependent variable [Total Phenolic Content] was performed to select the influential factors (1: Extraction temperature (\u00b0C), X2: Solvent concentration (%) and X3: Sample-to-solvent ratio ; linking 20 experiments considering five dependent variables  ] . Table 3TP was calculated by following Folin-Ciocaltue\u2019s method described by Singleton and Rossi  and the 3) method [Quercus leaf samples and quantified as miligram quercetin equivalent per of gram dry leaf sample (mg QE/g dw).The Aluminium chloride (AlCl) method  was usedThe Folin-Denis colorimetric method was used to measure total tannin content (TT) by following Ram and Mehrotra , and resQuercus leaf samples was analyzed through ABTS and DPPH assays by following Pandey et al. [The antioxidant activity in y et al.  and resuQuercus species and expressed as milligram per gram dry weight of leaf samples (mg/g dw).The phenolic profiles of extracts were analyzed through high performance liquid chromatography (HPLC)  coupled with diode array detector (DAD-MZOA) and two LC-10AT HPLC pumps . Phenoli\u00ae version 12 software  and multiple regression analysis opted to analyze experimental data [All analytical experiments were repeated three times, except RSM analysis, and obtained results were analyzed through analysis of variance (ANOVA) using SPSS statistical package for Windows . The individual and interrelated influence of significant factors on the extraction yield were studied by plotting three dimensional (3D) response surface plots through Design-Experttal data .Quercus leaves. Among all tested solvents (80% v/v), significantly (p<0.05) higher yield of TP (66.43 mgGAE/g dw) was obtained in methanol followed by ethanol (53.51 mgGAE/g dw), isopropanol (40.02 mgGAE/g dw) and distilled water (33.30 mgGAE/g dw)  . Thus meA: extraction temperature (\u00b0C), XB: extraction time (min), XC: solvent concentration (%), XD: solvent pH, XE: sample-to-solvent ratio (g/ml) on TP concentration response. The analysis of variance (ANOVA) of the response data showed a significant effect of extraction temperature, solvent concentration, and sample-to-solvent ratio on TP response ((p<0.01) with F-value of 19.79 and showed good determination coefficient value (0.94). All the significant factors showed positive regression coefficient value which revealed that the TP response increased with increase in extraction temperature, solvent concentration and sample-to-solvent ratio. Among these, the influence of extraction temperature on TP response was the maximum followed by solvent concentration and sample-to-solvent ratio (Plackett\u2013Burman Design (PBD) was applied using five possible factors, namely, Xresponse . Overallnt ratio . The remF-value, which indicates the significant role of factor\u2019s level in deterring the model variations. The coefficient of determination value was also found satisfactory for TP response, while for others it showed good R2 value ((p<0.001) positive, while the solvent concentration showed significant (p<0.05) negative effect on TP. For TT response, a highly significant positive linear influence of extraction temperature (p<0.05) as well as sample-to-solvent ratio (p<0.001) was recorded. Moreover, a positive interactive effect between these factors has also affected TT response significantly (p<0.05). Similarly, in case of TF, a highly significant (p<0.001) positive linear effect of solvent concentration and sample-to-solvent ratio was recorded. Also, solvent concentration was found to produce a highly significant (p<0.001) positive quadratic effect on TF. A significantly (p<0.05) negative effect of sample-to-solvent ratio and an interactive effect between extraction temperature and solvent concentration was recorded for TF.Box-Wilson central composite design (BW-CCD) model was applied on significant factors over 3 levels to determine the linear, interactive and quadratic effect of factors on polyphenolic contents and antioxidant activity. To best fit the model in determining the optimized condition, model fitness analysis was conducted. All response models showed model fitness with the significant R2 value . The insin vitro assay. Both the assays were highly influenced by sample-to-solvent ratio and shown a significant (p<0.001) positive linear effect ((p<0.001) positive dependence on the extraction temperature. Also, a positive interactive effect of extraction temperature and solvent concentration was recorded for ABTS activity. However, significantly (p<0.01) negative linear and quadratic effects of solvent concentration on ABTS activity were observed.The antioxidant activity was analyzed using DPPH and ABTS r effect . IndividAll the significant linear, quadratic and interactive term fitted to the second order polynomial equation as-A\u201411.65XC2YTP = 55.42 + 15.19XA + 19.71XE + 3.27XAXCYTT = 66.32 + 2.59XC + 5.51XE + 9.38XC2\u20135.09XE2\u20132.74XAXCYTF = 28.86 + 9.65XEYDPPH = 27.04 + 9.91XA\u20140.092XC + 0.2617XE\u20140.1841XC2 + 0.2587XAXEYABTS = 1.72 + 0.315X(p<0.001) linear increase of TP content was recorded ((p<0.05) increase in TT content was recorded with increasing temperature. However, the effect of extraction temperature was more on TP response compared to TT response ((p<0.001) linear increase in ABTS activity was seen with increasing extraction temperature and sample-to-solvent ratio ((p<0.001) increase in ABTS activity was seen when both sample-to-solvent ratio and extraction temperature were raised simultaneously. Also, TT increased significantly (p<0.05) with the increase in extraction temperature along with sample-to-solvent ratio ((p<0.05) negative effect on TF. Further, with decreasing extraction temperature and increase in solvent concentration, TF increased significantly  increase in TF concentration was recorded ((p<0.001) positive quadratic effect. However, ABTS activity was observed decreasing with increasing solvent concentration ((p<0.05) decreased. Also, with increase in extraction temperature the positive influence of solvent concentration on TF was found to be decreased and revealed a negative interactive effect  positive linear effect of sample-to-solvent ratio was found on all responses except TP (A highly significant xcept TP . IncreasQ. semecarpifolia was determined as: temperature (80\u00b0C), solvent concentration (87% methanol), sample-to-solvent ratio (1: 40), solvent pH (2), and extraction time (45 min). The optimized condition was further tested on five Quercus species i.e. Q. floribunda, Q. franchetii, Q. glauca, Q. oblongata, and Q. serrata. The TP was recorded maximum (77.34 mg GAE/g dw) in Q. semecarpifolia and minimum (63.01 mg GAE/g dw) in Q. serrata. However, TT (94.19 mg TAE/g dw) and TF (87.05 mg QE/g dw) content were observed maximum in Q. serrata and minimum TT (80.10 mg TAE/g dw) in Q. franchetii and TF (27.24 mg QE/g dw) in Q. glauca respectively , the optimized heat assisted extraction (HAE) condition for ectively . All valm-coumaric acid, p-coumaric acid, 3-hydroxybenzoic acid and vanillic acid) in the leaf extracts of total screened (six) Quercus species, described in section 3.5 (Q. franchetii and Q. serrata were among the highest (8 in each) polyphenolic compound containing species followed by Q. glauca, Q. oblongata, Q. semecarpifolia (6 each) and Q. floribunda (3). Among the detected compounds, catechin was found in highest concentrations in Q. floribunda (37.60 mg/g leaf dw), Q. semecarpifolia (28.31 mg/g leaf dw) and Q. serrata (19.53 mg/g leaf dw) respectively. Followed by gallic acid, and it was detected maximum in Q. oblongata (28.276 mg/g leaf dw), Q. glauca (23.45mg/g leaf dw), and Q. franchetii (21.55 mg/g leaf dw) respectively , solvent concentration of , sample-to-solvent ratio (1: 40), solvent pH (2), and extraction time (45 min). Gallic acid was observed in all the tested Quercus species however, highest catechin concentration was observed for Q. floribunda. Quercus glauca and Q. franchetii had significantly stronger DPPH radical scavenging activity or reducing power compared with that of the other tested species. No significant difference was observed in ABTS radical scavenging activity of tested six Quercus species. This study indicates that all the tested Quercus species of central Himalaya have a high utilization potential because of their high phenolic and flavonoid contents as well as strong antioxidant nature. Further, presence of significant catechin concentration in leaves of these species indicates use of Quercus species especially Q. floribunda, Q. semecarpifolia and Q. serrata in nutraceutical interventions and the extract after evaporating the solvent can be used in many nutrient formulations like beverages, dietary products etc. Use of Quercus species in pharmaceuticals and nutraceuticals may be helpful in reducing the extraction pressure from the threatened medicinal plants of Himalaya.Among six S1 File(DOCX)Click here for additional data file."}
+{"text": "Total hip arthroplasty (THA) is traditionally associated with a low complication rate, with complications such as infection, fracture and dislocation requiring readmission or reoperation. We seek to identify the complication rate among the anterior, direct lateral and posterior surgical approaches.We reviewed all THAs performed at the Epworth Healthcare from 1 July 2014 to 30 June 2016. There were 2437 THAs performed by a variety of approaches. No hips were excluded from this study.We surveyed the hospital database and the Australian Orthopaedic Association National Joint Replacement Registry (AOANJRR) to identify those patients who had been readmitted and/or reoperated on. Details collected included age, gender, laterality of the surgery , surgical approach utilised, complications which occurred.There were 29 peri-prosthetic fractures detected  and 10 underwent revision of implant, 19 were fixed. The increased rate of revision in the anterior group was statistically significant.There were 14 dislocations  of which 8 prostheses were revised.Three cases operated\u00a0via the anterior approach and 1 by the lateral had early subsidence without fracture, necessitating revision of the femoral prostheses.Operative site infection occurred in 12 cases  with 6 requiring revision of implants.The complication rates between the 3 main approaches are similar, but individual surgeons should be vigilant for complications unique to their surgical approaches, such as femoral fractures in the anterior approach and dislocations in the posterior approach. Total Hip Arthroplasty (THA) is generally associated with a low complication rate, ranging from 1 to 3%. Infection, peri-prosthetic fracture (PPF) and dislocation are early complications that may require re-admission to hospital for management. The surgical approach may also influence early outcomes. There are 3 commonly used approaches for the hip joint, the posterior, direct lateral and anterior. The latter approach has been used increasingly over the past few years with reported benefits including shortened hospital stay , 3. HoweThe posterior approach to the hip is the most common surgical approach used internationally for THAs . This apThe primary aim of this study was to determine if different surgical approaches to THA are associated with an increased complication rate requiring either re-admission or re-operation. The secondary aim was to see if complications were associated with an increased rate of revision.Epworth HealthCare is a private healthcare group in Victoria, Australia comprising a combined total of 1200 beds. Approximately 1200 THAs are performed annually. This study was approved by the Research Development & Governance committee of Epworth HealthCare. We reviewed the records of all primary THAs performed at Epworth HealthCare from 1 July 2014 to 30 June 2016. All surgeries were performed by experienced surgeons in private practice utilising three approaches, i.e.,\u00a0the posterior, direct lateral and anterior hip approaches.Demographic details collected included age, gender, laterality of the surgery , surgical approach utilised, complications, number of and time to reoperations and details of readmissions.The Epworth HealthCare data were then linked to the Australian Orthopaedic Association National Joint Replacement Registry (AOANJRR) to identify those patients who had been revised for complications related to the index procedure that may have occurred outside Epworth HealthCare. The AOANJRR has collected data on almost 100% of hip arthroplasties performed in Australia and the data are externally validated against patient-level data provided by all Australian state and territory health departments. A sequential matching process is used to identify any missing data and this is subsequently retrieved by contacting the relevant hospital. Each month, in conjunction with internal validation and data quality checks, all primary procedures are linked to any subsequent revision involving the same patient, same joint, and same side. Data are also matched bi-annually with the Australian Government\u2019s National Death Index to obtain information on the date of death. Linking revision and death to the primary procedure enables revision rates to be determined.The primary end point was the frequency of complications defined as return to theatre as inpatient or re-admission within 30\u2009days. The secondary end point was revision surgery. Complication rate was defined as the number of complications per total number of operations conducted using each surgical approach. Revisions were defined as reoperations of previous hip replacements where one or more of the prosthetic components were replaced, removed, or one or more components are added. Revision rate was defined as the number of revisions performed for each complication, per total number of operations conducted using each surgical approach.Percentages for the presence of each complication and indications for revision were statistically compared using Fisher\u2019s exact test extended to r by c  tables . All statistical analyses were conducted using Stata version 15 .A total of 2437 THAs were performed during the study time period and were matched to records in the AOANJRR. Of these, 949 (38.9%) were performed via the anterior approach, 618 (25.4%) via the lateral approach, and 870 (35.7%) via the posterior approach. The average age of patients in this study was 66.6\u2009years (range 19\u201397\u2009years). There were 1074 male and 1363 female patients.p\u2009=\u20090.99).There were 72 (3%) patients who had complications requiring re-admission or re-operation. Peri-prosthetic fracture, dislocations and surgical site infection (SSI) were the most common complications leading to re-admission and / or re-operation Table\u00a0. The prep\u2009=\u20090.17).Of the cases with complications detected, 28  required revision due to the complications of fracture, early subsidence, dislocation and surgical site infection within the first 30\u2009days of the index surgery. These are presented in Table\u00a0p\u2009=\u20090.48). When including age and gender, the overall effect of approach is not statistically significant (p\u2009=\u20090.052), and age is not significantly related. However, the effect of gender approaches statistical significance (p\u2009=\u20090.073), with females more likely to have revisions  than males.Logistic regression by surgical approach alone shows that overall difference in revision between approaches is not significant (2 in 8 (27.6%) of the 29 cases, with a mean of 27.9\u2009kg/m2 and a standard deviation of 8.5\u2009kg/m2 (range: 16.4\u201350.7\u2009kg/m2).There were 29 cases of PPFs and 21 occurred in female patients. The overall mean age was 69.6\u2009years, (range: 51\u201391\u2009years). The body mass index (BMI) was greater than 30\u2009kg/mOf the 29 cases, 19 (65.5%) underwent fixation of the fracture. These fractures were detected intra-operatively and the fixations were performed at the time of the index surgery. None of these patients went on to require subsequent revision.p\u2009=\u20090.003). Seven of those revised in the anterior group were readmitted.There was a significantly higher rate of revision for PPF for patients undergoing the anterior approach. Nine patients (0.9% of 949 Anterior approaches) were revised for PPF, compared with none of the lateral group and 1 (0.1% of 870 patients) in the posterior group. . These 19 prostheses consisted of various models from different companies. Six patients had cemented prostheses and 3 patients had modular prostheses.2 (range: 25.5\u201332\u2009kg/m2). Only 1 patient had a BMI more than 30\u2009kg/m2.There were 4 cases of early stem subsidence without fracture, which occurred within 30\u2009days of index surgery; 3 occurred in female patients. The mean age was 65.6, standard deviation 6.8\u2009years (range: 58\u201374\u2009years). The mean BMI was 28.6, with a standard deviation of 2.7\u2009kg/mThese patients presented with limb length discrepancy or instability. All 4 cases required revision of the femoral implant. Three of the patients were in the anterior group and 1 in the lateral group. In 2 of the patients in the anterior group, the subsequent stems utilised in the revision were 4 sizes larger than that of the stems used in the index surgeries. In the single patient in the lateral group, the stem was revised to cemented femur prosthesis.2 in 5 of the patients, with an average of 28.6\u2009kg/m2, standard deviation of 7.5\u2009kg/m2 (range: 17.2\u201343.6\u2009kg/m2).There were 14 cases of hip dislocation requiring readmission or reoperation and 11 occurred in female patients. The average age was 66.5\u2009years, standard deviation 10.7\u2009years (range: 47\u201380\u2009years). The BMI was >\u200930\u2009kg/mThe rates of dislocation in our study for anterior, lateral and posterior approaches were 0.5, 0.2 and 0.9% respectively. These dislocation rates were not statistically significant. Eight out of 14 of the patients who had an early dislocation required revision. The revision rates for dislocation across the three approaches were not statistically significant as well. The remaining 6 patients who had dislocations which did not require revision had relocations performed in the emergency department or under anaesthesia in the operating theatre, with no subsequent sequelae.2 in 4 of the patients, and the average BMI was 29.1\u2009kg/m2, with a standard deviation of 5.2\u2009kg/m2 (range: 20.3\u201339.5\u2009kg/m2).There were 12 cases of SSIs. There were 7 female patients and 5 male patients, with an average age of 68.3\u2009years and standard deviation of 14.6\u2009years\u00a0(range: 35\u201393\u2009years). The BMI was greater than 30\u2009kg/mNine patients had deep SSIs requiring reoperation, whilst the remaining 3 had superficial SSIs which resolved with conservative management with antibiotics.Six patients with SSI required removal and revision of the implant. The revision rate for SSIs across the 3 approaches was not statistically significant. Three patients had washouts without revision of implant.One\u00a0patient who had index surgery via the anterior approach was readmitted for post-operative haematoma causing sciatic nerve compression, presenting with foot drop. The patient underwent surgery for an evacuation of the haematoma and neurolysis of the sciatic nerve via the posterolateral approach.There was 1 case of iatrogenic injury to the sciatic nerve in a patient operated on through the posterior approach. The patient was noted to have post-operative foot drop and went on to have an exploration and repair of the sciatic nerve, which was noted to have a 30% division.In regard to the primary endpoint, this study has demonstrated that, whilst the prevalence of complications following THA was not statistically different amongst the three approaches, there was a higher overall rate of revision for the anterior approach, and this was due to early revisions for PPF.The benefits and drawbacks of the different surgical approaches for THA continue to be a source of some debate and controversy. Studies supporting the use of the anterior approach have reported shorter lengths of inpatient stay, improved clinical and functional outcomes, improved gait dynamics and a lower dislocation rate , 12, 13.The commonest complications following THA in our study were fractures. There were a significantly higher proportion of fractures that went on to receive\u00a0revision in the anterior approach group. If the fractures were detected and fixed intra-operatively, there were no revisions but if they occurred intra-operatively and were not recognised, then there was a higher revision rate. This was the case\u00a0despite the use of fluoroscopy for the anterior approach in almost all the cases.The fractures in the anterior group occurred in the calcar, and involved cement-less tapered wedge femoral prostheses, which were most commonly used in the anterior approach. The study by De Geest\u2019s group et al.  showed tIt is not known if the increased risk of fractures in the anterior approach can be attributed more to the approach itself, or the limitations of the implants or instrumentation. It has been theorised that the supine positioning, with the usage of traction tables and manipulation of the lower limb for surgical exposure, may result in higher forces during elevation of the femur and broaching . These cIt is probable that factors such as the positioning of the patient and femur, amount of exposure and instrumentation, while individually not causal factors of statistical significance, combine to elevate the risk of iatrogenic fractures above that of the posterior and lateral approach. Meneghini et al. found thaSeven of the fractures in the anterior group (53.8% of the fractures in the anterior group) were not detected on intra-operative imaging. This did not occur in the lateral or posterior approaches. This is again similar to the findings of De Geest et al., where peri-prosthetic fractures were only detected post-operatively on checking radiographs or being readmitted from rehabilitation. Malek et al.  also encThe two patients with early subsidence without fractures required revision with stems which were significantly larger than those initially inserted. In absence of fractures, this appears to indicate that the limitations of current instrumentation and surgical exposure may cause issues during broaching in this approach. It is postulated that the surgeons had difficulty inserting the broach directly down the intramedullary canal, causing an inadequate filling of the canal and thus incorrect sizing of the femoral components.The posterior approach is known to have a slightly higher risk of dislocations, whilst the anterior and lateral approaches allow for preservation of the posterior soft tissue envelope. Dislocation rates reported in literature for the posterior approach range from 1 to 5% , whilst The rate of dislocation in our study parallels that in literature, with the rates for anterior, lateral and posterior approaches being 0.5, 0.2 and 0.9% respectively. Revision rates due to dislocations did not differ significantly across the 3 approaches. Again, whilst the numbers are small, the heterogeneity of the study population does indicate that in the real world setting, the risk of dislocation is not completely removed by the anterior approach, and attention on the surgeon\u2019s part with respect to acetabular cup and femoral stem positioning is still paramount, regardless of approach. As with fracture complications, neither gender nor BMI appeared to be risk factors for instability.The anterior approach has been linked to an increased re-operation rate due to wound complications, such as haematomas with or without infection, delayed wound healing or prosthetic joint infections . This ha2 and diabetes placed patients at greater risk for wound complications and re-operation. This may serve as a guide to surgeons when considering the suitability of patients for the anterior approach.A study by Jahng  has look2 but the low numbers did not allow us to analyse if BMI was a risk factor for wound complications. Among the patients in which re-operation was required for SSI, there did not appear to be any approach associated with an increased risk of SSI. In addition, whilst half of the patients with SSIs went on to require revision of implants, there was no significant difference in revision rate for infection among approaches.In our patients, only 4 out of 12 patients had BMI >\u200930\u2009kg/m2 for 4 patients out of 7, with an average of 31.6\u2009kg/m2. However, the numbers are too low to allow analysis if gender or BMI are significant risk factors. Thus the incidence of VTE in patients undergoing THA in our institution appears to be a function of known risk factors as established in literature as opposed to being approach specific.There has been no recent literature comparing the rates of venous thromboembolic events (VTE) among the approaches and in our patients, VTE occur in the different approaches. Five out of 7 of the patients who had VTE were female. In our patients, whist BMI was more than 30\u2009kg/mThere are several strengths to this study. It examines the overall complications of all THA performed at a large tertiary hospital group and includes the results of all the surgeons performing arthroplasty, and not just from a specialized joint arthroplasty centre. All procedures were linked to the AOA NJRR to capture all revisions including those that may not have occurred at the hospital. A case record review was performed of all complications as distinct from relying on information from an administrative dataset review. There are also limitations to this study. Although data are\u00a0collected on length of time of surgery the setup for the anterior hip approach with a traction table and fluoroscopy is recorded within the whole theatre time. Therefore this may have lengthened the time of the operation recorded for the anterior approach compared to that for patients receiving the lateral or posterior approaches. Because of this we were unable to directly examine whether length of surgery is\u00a0correlated with complications. We also did not analyse the data by surgeon experience and are aware of the effect of the learning curve on the rate of revision for the anterior approach to the hip . HoweverThe complication rates do not differ across the 3 surgical approaches for THA. However, at our institution, revision rate for PPF, in the first 30\u2009days after the index surgery are significantly higher in the anterior approach compared with the posterior and lateral approaches. Surgeons utilising this approach should be vigilant for femoral fractures, and pay careful attention to the surgical exposure and to intra-operative imaging."}
+{"text": "Patients undergoing intensive care are exposed to risk factors for hearing impairment. This study assessed the worse changes in pure tone average (PTA) thresholds after intensive care and identified the factors associated with worse hearing function.We conducted a single-centre retrospective study, and included adult patients admitted to the intensive care unit (ICU) of Kurashiki Central Hospital between January 2014 and September 2019, who had regular pure tone audiometry performed before and after ICU admission. Correlations between changes in PTA threshold and patient characteristics, were evaluated. The included ears were classified as those with worse hearing (>10\u00a0dB increase in the PTA threshold) and those without worse hearing, and the baseline characteristics were compared.9/L vs. 206\u00a0\u00b1\u00a085\u00a0\u00d7\u00a0109/L, respectively; P\u00a0=\u00a00.010), and the rate of planned ICU admission (elective surgery) was higher in the worse hearing group .During the study period, 125 ears of 71 patients  met the eligibility criteria. Age, sex, and the use of furosemide were not correlated with changes in PTA threshold. Univariate analysis showed that ears with worse hearing were associated with a lower serum platelet count than ears without worse hearing (153\u00a0\u00b1\u00a085\u00a0\u00d7\u00a010Age, sex, and the use of furosemide did not have adversely affect hearing function. Low serum platelet count and planned admission appear to be risk factors for worse hearing. Loop diAdmission to the ICU is generally unexpected, and it is difficult to obtain a pre-ICU admission hearing function test; in turn, this makes it difficult to assess whether hearing dysfunction after discharge from the ICU is new. Hamill-Ruth et\u00a0al. conducted a screening protocol in patients admitted to the surgical ICU, and reported that 58.4% of the patients had auditory impairment based on distortion product otoacoustic emission (DPOAE) . HoweverPatients in the ENT department regularly undergo audiometry for disease monitoring. Some of our patients were admitted to the ICU, and the adverse effects of intensive care on hearing function could be evaluated based on changes in audiometry between pre- and post-ICU admission. Therefore, we conducted a retrospective pilot study to assess the adverse effects of intensive care on hearing function using the data from these patients.2This single-centre retrospective observational study assessed changes in hearing function in patients undergoing intensive care. We hypothesized that intensive care would have negative effects on hearing function. We also evaluated the patient characteristics associated with worse hearing.2.1This study was conducted at Kurashiki Central Hospital, an urban tertiary hospital that serves 800,000 people in the western area of Okayama Prefecture, Japan. There are approximately 70,000 visits to the hospital emergency department annually. Kurashiki Central Hospital has five ICU units . To avoid effects of intracranial disease, we included all ICUs except the SCU. Patients were included if they were \u226520 years old, were admitted to the ICU between January 2014 and September 2019, and had audiometry within 5 years before and after ICU admission. Hearing impairment is usually classified as conductive or sensorineural. Conductive hearing loss is treated medically or surgically , and about 40% of patients in the ICU setting have transient middle ear effusion , 2003. W2.2Pure tone averages (PTAs) were obtained via pure tone audiometry before and after ICU admission. Audiometry was performed in a soundproof room according to the standard protocol of the Japan Audiological Society and related international standards . AccordiWe collected data on patient age at ICU admission, as well as ex, body mass index, comorbidities (hypertension and diabetes), length of ICU stay, Sequential Organ Failure Assessment (SOFA) score-related variables , and type of admission (unplanned [emergency] or planned [elective surgery]). The SOFA score assesses the function six organ systems, i.e. the respiratory, cardiovascular, hepatic, coagulation, renal and neurological systems, and the worst value in a 24-h period were collected.2.3Baseline variables with normal distributions are reported as the mean and standard deviation (SD), and those with a skewed distribution are reported as the median and interquartile range (IQR). To assess the correlations between the changes in PTA thresholds and patient characteristics, we used Pearson\u2019s correlation test for age and the dose of furosemide, and Student\u2019s t-test for sex. To identify factors with adverse effects on hearing function, we classified ears as ears with worse hearing (>10\u00a0dB increase in the PTA threshold) or ears without worse hearing. The two groups were compared using Student\u2019s t-test and the chi-square test. The institutional review board of Kurashiki Central Hospital approved this study (No 3433).33.1During the study period, 17,863 adult patients were admitted to the included ICUs, and 79 patients met the eligibility criteria. Of these 79 patients, 125 ears of 71 patients  met the inclusion criteria; The details of the changes in PTA threshold were as follows: 45 ears had a \u2265\u00a0\u221210\u00a0dB and \u22640\u00a0dB change in the PTA, 59 ears had a >0\u00a0dB and <10\u00a0dB change in the PTA, 17 ears had a >10\u00a0dB and \u226420\u00a0dB change in the PTA, and four ears had a >20\u00a0dB change in the PTA .Fig.\u00a02Nu3.2The mean change in PTA threshold was 4.14\u00a0\u00b1\u00a05.93 in women and 4.03\u00a0\u00b1\u00a08.60 in men. The mean difference was 0.11 (95% CI\u00a0\u22122.55 to 2.77), which was not statistically significant (p\u00a0=\u00a00.934). Changes in PTA threshold tended to be larger in older patients, but there was no significant correlation with age  .Fig.\u00a03Th3.3The total dose of furosemide during the ICU stay and changes in PTA threshold are shown in 3.4The modal value of the change in PTA threshold was 0\u00a0dB, and changes were mostly in the range of\u00a0\u221210 to 10\u00a0dB. Therefore, we defined worse hearing as a >10\u00a0dB increase in the PTA threshold after ICU admission. We compared the ears with worse hearing and those without worse hearing . Of the The rate of planned admission was higher in the ears with worse hearing, and the incidence of worse hearing was about threefold higher in ears with planned admission compared to emergency admission . The reasons for planned admission were thoracic surgery (33 ears) and others (9 ears), which had respective changes in PTA threshold of 4.51\u00a0\u00b1\u00a08.33 and 3.33\u00a0\u00b1\u00a08.17. The association of the change in PTAs, serum platelet, and type of admission are shown in 4The results in this study indicated that hearing function was not damaged by intensive care in most cases, although 16.8% of the ears had worse hearing (>10\u00a0dB increase in the PTA threshold after discharge from the ICU). Low platelet count and planned admission (elective surgery) were associated with worse hearing outcomes.It has long been known that intensive care can have adverse effects on hearing function, but this was not considered important because of the low survival rate of ICU patients. Improvement in the survival rates of ICU patients has shifted the focus of outcomes in critical care medicine from short-term mortality to long-term health status . Audiological hearing dysfunction is associated with cognitive impairment, depression, and reduced well-being , and so Hamill-Ruth et\u00a0al. conducted an audiological screening program in a surgical ICU, and found that about 58.4% of ears of ICU patients had hearing loss, defined based on DPOAE . AlthougThere are a number of uncertainties regarding the mechanisms of hearing loss in the ICU, although several mechanisms have been proposed, including microemboli, perfusion abnormalities, hypercoagulability, and ototoxic drugs . The sigThis study had some limitations. Firstly, we only included patients who underwent routine audiometry pre- and post-ICU admission, so there may have been some selection bias. However, it should be noted that no study has reported an association between routine audiometry and poorer hearing function. Nevertheless, it is unclear whether the results can be extrapolated to the general population. Secondly, we did not record the noise levels in the ICUs. A survey in Japan reported that noise levels in an ICU room exceeded 80\u00a0dB , which c5In conclusion, age, sex, and use of furosemide did not have adverse effects on hearing function after discharge from the ICU. Of the 125 included ears, 21 (16.8%) showed adverse changes in the PTA threshold, and low serum platelet count and planned admission were risk factors for worse hearing after discharge from the ICU.All authors have no potential conflict of interest .Ohara HealthCare Foundation).This study was funded by Kurashiki Research Institute . The funding is used for correction of English writing. This study was not funded by third parties."}
+{"text": "We investigated whether there was a difference in peripheral muscle SvO2 (pSvO2) and peripheral fractional oxygen extraction (pFOE) in preterm neonates with early inflammation/infection compared to healthy subjects during the first 72 h after birth.Adequate oxygen supply for preterm neonates may be defined through non-invasive measurement of venous oxygen saturation .We retrospectively analyzed secondary outcome parameters of prospective observational studies, including preterm neonates at risk of infection in whom peripheral NIRS measurements were performed in combination with venous occlusions. Early neonatal inflammation/infection was diagnosed by clinical signs and laboratory parameters. Peripheral muscle tissue oxygenation index (pTOI) was measured using either NIRO 300 or NIRO 200-NX  on the patients' lower legs. Using 20-s venous occlusions, pSvO2  and pTOI  were lower in those neonates with inflammation/infection, while there was no such difference for measurements between 24\u201348 and 48\u201372 h.We analyzed measurements from 226 preterm neonates , 64 (28.3%) of whom were diagnosed with early neonatal inflammation/infection. During the first 24 h after birth, pSvO2 and pFOE is feasible and may be utilized for early detection of impaired peripheral oxygen delivery. As pTOI was also significantly lower, this parameter may serve as substitute for diminished regional oxygen supply.NIRS measurement of pSvO Venous equation . While i2 in preterm neonates by using NIRS. Adequacy implies a sufficient quantity of oxygen to satisfy tissue needs, thus in preterm neonates we assessed the amount of excess oxygen left over after all the processes of cellular respiration were completed as a proof of concept (2 and oxygen delivery (DO2) due to impaired microcirculation in early neonatal inflammation/infection. With impairment of oxygen delivery likely being a dynamic process, we took changes over time into account and, thus, divided the observation period of 72 h after birth into three 24-h intervals.Following the publications of Andersen et al. , 4 we ap concept . We hypoth, 2005, and June 28th, 2015, at the Division of Neonatology, Medical University of Graz, Austria. We included preterm neonates at risk of infection in whom NIRS measurements of peripheral muscle tissue had been performed in combination with venous occlusions during the first 72 h after birth. Risk factors for early neonatal inflammation/infection included premature rupture of membranes, chorioamnionitis, and vaginal colonization with group B streptococcus, among others. Exclusion criteria were congenital cardiovascular malformations and perinatal asphyxia. All studies had been approved by our university's ethics committee  and written parental consent had been secured prior to study inclusion.For this study, we retrospectively analyzed secondary outcome parameters of prospective observational studies that were performed between November 30We obtained demographic and clinical data, including gestational age, birth weight, sex, umbilical artery pH, and Apgar scores from clinical records. Neonates were differentiated by the development of early neonatal inflammation/infection. For this purpose, a blood culture was taken on the first day of life ; according to previously published criteria , early i2 [%] and heart rate (HR [beats/min]) were measured with a pulse oximeter on the ipsilateral foot . Occlusions were repeated until at least one measurement passed the quality criteria as defined by Pichler et al.  [%], peripheral fractional oxygen extraction (pFOE) [%], DO2 [\u03bcmol/l/min], and VO2 [\u03bcmol/l/min] were calculated from the abovementioned parameters through integration of SpO2 data , while peripheral venous oxygen saturation . Metrically scaled data were tested for normal distribution using the Kolmogorov-Smirnov-test. Normally distributed data are presented as mean \u00b1 one standard deviation, while skewed data are presented as median and interquartile range  and pTOI , while pSvO2, pFOE, pTOI, DO2, VO2, and HR were similar between the groups.Between 24 and 48 h after birth (n = 22 measurements), we did not find any differences in pSvO2, pFOE, pTOI, DO2, VO2, SpO2, and HR between neonates in the inflammation/infection group and those without inflammation/infection.Between 48 and 72 h after birth , anemic hypoxia (from low hemoglobin) or hypoxic hypoxia (from low inspired oxygen tension)  . We stro2, while Mrozek et al. , which may potentially cause different cardiovascular effects. Still, our findings may be used as a hypothesis generating starting point for a prospective study with predefined clinical outcome parameters and an adequately sized patient cohort, investigating the additional benefit of pSvO2 it has to be taken into account that NIRS derived data is influenced by several demographic  and clinical parameters  (When interpreting non-invasively measured pSvOlactate) . Being flactate)  to decre2 was significantly reduced during the first 24 h after birth in preterm neonates of the inflammation/infection group, while SpO2 was similar between groups during this period. As pTOI was reduced at the same time, this parameter may be used as a proxy for these changes in clinical settings.pSvO2 in preterm neonates and to investigate the safety and clinical potential of pSvO2 guided therapies. Yet, our preliminary findings suggest that NIRS measured pSvO2 and pTOI may be a promising non-invasive tool to detect neonates \u201cat risk\u201d early and to define oxygen sufficiency in preterm neonates.More research is certainly required to determine reference values for pSvOThe raw data supporting the conclusions of this article will be made available by the authors upon reasonable request.The studies involving human participants were reviewed and approved by the Ethics Committee, Medical University of Graz, Austria . Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.LM and BU conceptualized the study, analyzed data, drafted the initial manuscript, and revised the manuscript. JB designed the data collection instruments, collected data, carried out the initial analyses, and critically reviewed the manuscript for important intellectual content. NB-S, BS, NH, and GP collected data, coordinated and supervised data collection, and critically reviewed the manuscript for important intellectual content. CA and MS conceptualized the study, analyzed data, and critically reviewed the manuscript for important intellectual content. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Ozone is widely used in the agri-food and food processing industries mainly as a sanitizing agent. However, it has recently become clear that ozone exposition leads to another important benefit: in living tissues, the induced-oxidative stress triggers the antioxidant response, and, therefore, it enhances the production of antioxidant and stress-related secondary metabolites. As such, ozone can be considered an abiotic elicitor. The goal of the present review was to critically summarize knowledge about the possibility of improving bioactive compounds and, consequently, the health-related properties of grapes and wine, by using ozone. The greatest interest has been given not only to the pre- and post-harvest treatment of table and wine grapes, but also to the explanation of the mechanisms involved in the ozone-related response and the main secondary metabolites biosynthetic pathways. From the literature available, it is clear that the effect of ozone treatment on health-related properties and secondary metabolites accumulation depends on many factors, such as the cultivar, but also the form (water or gaseous), doses, and application method of ozone. Most of the published papers report an increase in antioxidant compounds  and stress-related volatiles, confirming the hypothesis that ozone could be used to improve berry and wine compositional and sensory quality.  Food and Drug Administration (FDA), and it has, therefore, been widely used in the food industry [Ozone  within the processing and packaging rooms [\u00ae, involves the use of O3 with the goal to decontaminate grapes and winery facilities during winemaking, by reducing the employ of sulphur dioxide. Many patents have been developed for OCantelli , who devng rooms . The pat3 exposure of plants and harvested fruits and vegetables has been demonstrated to induce important metabolic shifts. Hence, it can promote the biosynthesis of secondary metabolites, such as polyphenols and volatile organic compounds (VOCs), in plants and in plants products. The resulted metabolic shifts are strictly related to different factors, such as concentration and length of exposure, and are cultivar-dependent [In addition, Oependent ,12,13,143 as an abiotic stressor to trigger the content of bioactive compounds in plants and plant products [3 exposition, focusing on those metabolites important for grapes and wine quality, as well as on their health-promoting properties. The most relevant papers selected and discussed in the present review are summarized in Therefore, in the recent years, many studies have focused on the possibility to use Oproducts ,16,17,18The bibliographic identification was conducted between December 2020 and August 2021 using relevant electronic bibliographic databases  to ensure the highest coverage for significant papers. The primary keywords  were combined using the set operator AND with secondary keywords . To find and select documents, recently published reviews were firstly analysed. Then, starting from pre-selected papers, literature older than the mentioned time period was included if considered helpful to improve topic description. Authors independently evaluated the available literature using predefined eligibility criteria, resolving disagreement by discussion. To restrict and focus the aim of the research, only papers sections dealing with polyphenols and volatiles following ozone treatments were selected . A total of 88 papers were selected in the end. 3 penetrates the cells, it is immediately converted in reactive oxygen species (ROS), and, therefore, an endogenous ROS production, known as oxidative burst, contributes to the overall oxidizing potential of O3 [Once Oal of O3 . ROS proal of O3 . The oxial of O3 . The scaal of O3 ,38.3 for the agri-food preservation and in inducing secondary metabolism shifts, recently, O3 has been suggested as a pre-and post-harvest elicitor [Secondary metabolites are biologically active compounds produced under specific condition in plants tissues, and are generally involved in plants adaptation as a response to changes in external condition. Several secondary metabolites  have been demonstrated to have important functional effects on human health, and, therefore, techniques aimed at increasing their content in plants and plant products are becoming popular ,40. Elicelicitor ,19,43,44Grape and wine polyphenols have considerable importance not only for their contribution to wine quality parameters, such as color, flavor, astringency, bitterness, and ageing behavior , but als3, playing as stressor, induces the defence mechanism to protect plants and fruits tissue against oxidative stress-related damages. Given the antioxidant role that polyphenols play in the cells, most of them are biosynthesized in both vines and grapes as a response to biotic and abiotic stresses thanks to the activation of the phenylpropanoid pathway . Researc3 in terms of polyphenols accumulation [However, the effect on polyphenol content after ozonisation is not always clear ,40: somemulation ,15,29, wmulation ,50,51. 3 in inducing the biosynthesis of polyphenols mainly depends on the concentration and method, as well as the length of exposure. Generally, high ozone doses lead to an over oxidation which will induce a phenol decrease [3 results in a controlled oxidative stress which may stimulate the biosynthesis of these compounds [The effect of Odecrease ,51. Neveompounds .3 in gaseous form is much more stable and effective in potentially inducing the oxidation. On the contrary, ozonated water is less stable and less oxidative, and, therefore, a negative impact on phenol accumulation is unlikely to occur [3 at 1.5 g/L increases phenol and anthocyanin content, whereas longer and continues exposition decreases phenolics [Apart from the doses utilized, the method of application is another crucial aspect which can influence the effects and the consequences of the ozonisation process. Oto occur . Lastly,henolics .Volatiles are important secondary metabolites which are often involved in defence mechanisms. VOCs are indeed produced in, and released from, leaves, flowers, and fruits with the main functions of: (i) attracting pollinators and beneficial insects; (ii) protecting plants against pathogen infection and herbivore attack; (iii) creating molecules signal for plant\u2013plant communication . Because3 is applied, especially if accurately managed, and stress-related VOCs biosynthesis generally is induced [In living tissue, such as vine leaves and grapes, stress responses occur when O induced ,58. Rema induced . 3 exposition, belongs to the terpenoid family, i.e., isoprene, monoterpenes, and sesquiterpenes [3 stressed plants tissues, the inhibition of terpenes biosynthesis results in higher oxidative damage [Another class of VOCs known to play a key role in the antioxidant response, and, therefore, also produced after Oterpenes . The stiterpenes , which aterpenes ,61,62,63terpenes ,38,57,64terpenes . In addie damage . Lastly, another defence mechanism induced by oxidative stress is the stimulation of the activity of different enzymes, including uridine5\u2032-diphospho-gluconosyltransferases (UGTs), which play an indirect role in ROS-detoxification . GlycosyVitis vinifera L.) are affected in postharvest life by evident quality depletion mainly caused by loss of water, berry softening, browning, and microbiological contamination, the latter mainly due to grey mold action [3 treatment ranging from 0.1 mg/L/day or higher allows to prolong table grape shelf-life, inhibiting the growth of grey mold [3 was reported to boost the phenolic and aromatic compound biosynthesis, since O3 induces in living tissues different defense mechanisms at the genetic, transcriptional, and biochemical level [Table grapes  on the quality of Autumn Seedless grapes both after protracted storage at low temperature , and after one week at retail conditions (15 \u00b0C). Either continuous or discontinuous treatments, at low temperature, determined an increase of total flavan-3-ol. Furthermore, continuous treatment also retained the initial content of hydroxycinnamates. After the retail period, a significant increase of total polyphenols was observed for both treatments [A similar study  tested deatments .3 flows (2 mg/L) during storage . The shelf-life of O3-treated grapes, regardless of the method of application, was significantly prolonged in comparison with the control grapes stored in air [3 blocked the resveratrol biosynthesis, whereas a discontinuous action could trigger its biosynthesis [3 for 30 min, every 2.5 h) boosted the resveratrol content in Napol\u00e9on grapes. However, some discrepancies in the results have been evidenced in the literature, probably as a consequence of a cultivar [3 treatments: continuous highly concentrated (2 mg/L) treatment could deplete antioxidant compounds as a defensive mechanism toward oxidative stress [Cayuela et al.,  treated d in air . Additioynthesis . This waynthesis ,48, whercultivar ,48 or doe stress , wherease stress . 3 pre-treatments at three different concentrations  (2% O2 and 5% CO2), monitoring the quality decay trend, sensory traits, and antioxidant compounds profile during 45 days at 0 \u00b1 0.5 \u00b0C, followed by 7 days at higher temperature (15 \u00b1 1.0 \u00b0C). The results showed a higher level of polyphenols and antioxidant capacity for all samples O3-treated, confirming the O3 activity as an elicitor of phenolic compounds biosynthesis. Moreover, the content of anthocyanins in the berry skins of O3-treated grapes was significantly higher than in the control ones [Admane et al.  evaluaterol ones . The incrol ones . 3 treatments determined a doubling of the antioxidant capacity in Thompson samples, whereas only the treatment with 6 and 8 mg/L increased antioxidant activity in Black Seedless grapes [Silveira et al.  observeds grapes .3 exposure can cause modifications in grape secondary metabolism, improving the synthesis of phenolics such as stilbenes and anthocyanins [As previously described, Oocyanins ,77. 3 treatments for 24 and 72 h affected the initial phases of skin maceration in red vinification for both Barbera and Nebbiolo grapes, favoring the extraction of di-substituted anthocyanins in Nebbiolo grapes. Namely, O3 treatment did not affect the final individual anthocyanin extractability, thus, the varietal anthocyanin fingerprint was maintained. O3 also influenced the flavanol extraction, which was slowed down in both varieties. In another study, Bellincontro et al. [3 treatment of Petit Verdot grapes. Paissoni et al.  observedo et al.  reported3 treatment did not activate the stilbene synthesis in Maturano white grapes, even if the leafy chlorogenic acid content was increased; thus, they proposed chlorogenic acid as a biochemical marker of O3-induced stress in the V. vinifera plant. Valetta et al.  observed3 on fresh grapes have proven effective in determining changes in flavanol fraction, with a significant increase in catechins, and a slightly decreased epicatechin [3-induced oxidative stress. Short-term treatments with Ocatechin . As suggcatechin , the tri3 could play a protective role against the oxidation of flavanols since, during post-harvest partial grape dehydration, O3 exposure both promotes antioxidant enzymes, and inhibits the oxidant activity of polyphenol oxidase and lipoxygenase enzymes [3 fumigation at 1.5 g/h for 18 h in continuous flow (shock treatment) could preserve the polyphenol and anthocyanin content. On the other hand, a long-term O3 treatment  determined a significant oxidation of the polyphenol content. At the same time, O enzymes . Botondi enzymes  showed t3 effects are cultivar-dependent. As reported by R\u00eco Segade et al. [3 treatment [Both dehydration and Oe et al. , in Barbreatment . Vitis vinifera L.) showed that short-term O3 exposure (60 \u03bcL/L for 48 h) on fresh grapes did not determine an immediate resveratrol accumulation, but it induced an elicitor effect on total stilbenes (+36%) in dehydrated grapes (20% of weight loss), with a considerable overproduction of trans-resveratrol and trans-piceatannol.Another study  carried 3 treatments during grapes post-harvest seem to stimulate the berry skin cell wall degradation, affecting the extractability of oligomeric flavanols and proanthocyanidins [3 shock treatment on Pignola grapes did not affect the pectin methylesterase and polygalacturonase activities, which, in turn, affect cell wall composition and porosity, and are responsible for different anthocyanin and flavonol extractability [3 exposure (30 \u03bcL/L) for 24 h, evidencing a role of O3 treatment on the berry skin mechanical features. The use of O3 for the treatment of wine grapes in post-harvest is currently being explored to improve polyphenol extractability, which is mainly affected by the cultivar and, to a lesser extent, by the time of the O3 exposure [Furthermore, Oyanidins . As obseyanidins , O3 shoctability . Moreovetability . Recentltability  observedexposure ,30,77.3 exposition (30 mg/L continuously supplied) on the aromatic composition of Moscato Bianco grapes during the dehydration process was investigated by Segade et al. [3 significantly increased not only the amount of total VOCs, but also the amount of terpenoids, which are the major aromatic markers of the Moscato scent. Accordingly, the biosynthetic pathways involved in terpenoids and C6 biosynthesis  were up-regulated following the O3 exposition. On the contrary, higher doses (60 mg/L) supplied for a shorter time significantly reduce total VOCs, due to terpenoids oxidation [3 on VOCs profile strongly depend on the concentration and exposure time.Lastly, the effect of Oe et al. . O3 signxidation . These f3 has become popular, and its employment is increasing in a significant number of wineries. As already discussed, O3 has been widely used not only as sanitizing agent and for increasing the shelf-life of harvested grapes, but also as an exogenous elicitor to enrich grapes of secondary metabolites, significant factors for grape quality and human health. Hence, at berry level, the oxidative stress modifies the accumulation of different compounds to defend the cells from possible oxidative damages [3 in increasing the bioactive compound presence. However, when dealing with wine grapes, it is decisive to understand if the changes induced in grapes are transferred in the resulting wine, considering that the accumulation of those metabolites can increase wine health-promoting attributes thanks to their antioxidant activity [With respect to wine production, the use of O damages . Most ofactivity .As is obvious, the accumulation of secondary metabolites in grapes have a great influence on wine quality. For instance, modifications of the polyphenol profile in grapes will result in changes in color, astringency, bitterness, and body of the resulting wines. Furthermore, the accumulation of antioxidant volatiles, such as terpenoids and C6 compounds, induced by the oxidative stress ,31,61 ca3 has been proposed for pest management in viticulture as a possible alternative to traditional pesticides, considering its environmental and human health friendliness. Studies related to the in-field O3 application on grapes, and associated to the wine quality and composition, are very limited. It is well established that viticulture practices  can strongly influence grape development and metabolism [3 has always been considered as an environmental pollutant, associated with yield reduction, and the development of physiological disorders in plants  and fruits [3 is applied under controlled conditions. Additionally, the controlled oxidative stress induces antioxidant responses which could enrich fruit and wine of secondary metabolites, exactly as they occur in post-harvest applications [Recently, Otabolism , and, cod fruits . Howeverications ,72,81. Vitis vinifera L. cv. Bobal) was studied by Campayo et al. [trans-caftaric, and trans-p-coutaric acids were in higher amount after vines ozonation, regardless of the dose and type of application. Furthermore, among the different stilbenes identified by the authors, trans-resveratrol and glucoside piceid-trans-resveratrol increased in wine made starting from ozonated vines [Recently, ozonated water was applied to control grapevine diseases, and the effect on grapes and wine quality  and the peonidin and malvidin 3-O-glucosides acetylated increased in the wine made starting from ozonated vines. However, when the ozonated water treatments were repeated three times, the amounts of all the non-acylated anthocyanins decreased. The authors reported that these antioxidant compounds produced in grapes against oxidative stress would be oxidized and depleted under long exposure to ozone.The amount of non-acylated anthocyanins . Based on the only one study available, it seems clear that the application of O3 is still very debated, its use for post-harvest management of wine grapes is widely used. Hence, in the context of new technologies for grapes preservation and wine making, O3 is currently a common tool not only to control spoilage microorganisms, but also to increase the nutritional value of grapes and wine. As already discussed in 3 treatment on grape composition and metabolic responses, whereas the effect of ozonation on wine quality is less studied. Many winemakers considered the use of O3 as a potential risk of oxidation of important compounds for the sensory and quality attributes of wine . However, it is currently known that, if used under controlled conditions, it can represent a good option to increase the amount of these compounds. Hence, growing attention has been paid to O3, related to its stress action, which enhances the biosynthesis of bioactive compounds (such as phenolic substances) in table and wine grapes [Though the pre-harvest use of Oe grapes ,28,85.3 according to the Purovino\u00ae method . The authors explain that the increase of these compounds  is obtained thanks to two different, but linked, mechanisms [3 for the right amount of time promotes biosynthesis of metabolites [3-treated grapes. Bellincontro et al. [3-treated harvested grapes. The increase in anthocyanins is probably due to the berries\u2019 reaction to a moderate stress, which induces polyphenols biosynthesis, which are then transferred in the resulting wine. Mencarelli and Catelli  showed, chanisms . On one abolites ,14,86, a3-treated grapes, and, therefore, O3 treatment not only induces the biosynthesis of phenolic substances, but also affects the cell wall structure and cell membrane composition [Furthermore, after ozonation, the extractability index increased in Oposition , facilitposition  thus rep3 exposition was also pointed out by Carbone and Mencarelli [3 has been used at the beginning of controlled dehydration of Pignola and Romanesco grapes for \u201cpassito\u201d wine production [3 treatments used to reduce the smoke taint in wine, which means wine made from grapes exposed to bushfires with undesirable sensory characters , lead to higher polyphenol content as well [The increase of polyphenols in wine grapes after post-harvest Oncarelli , Paissonncarelli , and Segncarelli , who repncarelli , and higncarelli ,77. The oduction ,29. Last as well ,88. Unfo3 treatments operated on table and wine grapes reveal many important advantages, especially related to the phenolic and aromatic fractions. However, the effect of O3 treatment strongly depends on the treated cultivar, O3 form , and method used for the treatment . Both gaseous and water ozone treatment exert an elicitor effect on grape bioactive compounds , although most of the studies refer to gaseous treatments. Moreover, it is often reported that high doses and long exposition could result in an excessive oxidative stress which potentially decreases grape quality parameters, as bioactive compounds may be oxidized. On the other hand, when O3 is applied under studied and controlled conditions, an increase of bioactive compounds, such as polyphenols and antioxidant volatiles, is often reported. The literature suggests that in most of the cases, the best results are obtained with a low concentration and short treatment. Moreover, continuous ozone treatment during post-harvest dehydration increases the total VOCs. However, it is also suggested that the internal composition of the berries (cultivar-dependent) strongly influences the final result of O3 exposition. For example, in cultivars with higher flavanol and anthocyanins content, the result of O3 treatment is a greater extraction of polyphenols. Furthermore, in cultivars characterized by the prevalence of anthocyanins di-substituted, the result is a lower anthocyanin extractability, whereas in cultivars with tri-substituted anthocyanins, the extractability after O3 exposition is higher. Overall, the O3 to stimulate the biosynthesis of bioactive compounds is clear, and, considering that O3 treatment is very practical, it can be easily incorporated into the wine production chain not only as sanitizing agent, but also to promote the health-related compounds of wines, inducing an improvement of their general quality. Moreover, post-harvest grape exposure could significantly reduce the use of sulphur dioxide in winemaking due to its bactericidal and fungicidal properties. However, in a large-scale application, especially in the case of winemaking goals, an adaptation of O3 treatment depending on the cultivar and on the target wine would also be highly desirable.In the light of all the above considerations, the factors affecting the bioactive compounds content in grapes, and, as a consequence, in wine, are many, and a unique strategy is, therefore, difficult to identify. Nevertheless, all considered, the potential role of O"}
+{"text": "Mir146b as a microRNA whose expression progressively and unidirectionally declined with age in thioglycollate-elicited murine macrophages. Mir146b deficiency led to altered macrophage cytokine expression and reduced mitochondrial metabolic activity, two hallmarks of cellular aging. Single-cell RNA-seq identified patterns of altered inflammation and interferon gamma signaling in Mir146b-deficient macrophages. Identification of Mir146b as a potential regulator of macrophage aging provides novel insights into immune dysfunction associated with aging.Macrophages undergo programmatic changes with age, leading to altered cytokine polarization and immune dysfunction, shifting these critical immune cells from protective sentinels to disease promoters. The molecular mechanisms underlying macrophage inflammaging are poorly understood. Using an unbiased RNA sequencing (RNA-seq) approach, we identified  Macrophages are innate immune cells that perform critical surveillance functions and phagocytose pathogens and cellular debris . ThroughMir146b-5p) that inversely correlates with thioglycollate-elicited macrophage (TGEM) host age. Here we demonstrate that expression of Mir146b progressively declines in the aging TGEM and is associated with significant mitochondrial dysfunction\u00a0and abnormal macrophage activation and polarization, recapitulating the inflammaging phenotype.Altered macrophage polarization and activation are associated with aging and drive molecular inflammation. Although this age-induced macrophage-mediated phenotype has been partially characterized, the current paradigm relies on an incomplete cytokine signature to determine whether macrophages mitigate or promote disease with little information about the altered regulatory networks that inform downstream effector function of aging macrophages . Over thAlthough miRNAs have been implicated in regulating age-associated gene expression, their role in directing gene expression patterns and function in aging macrophages is unclear. We hypothesized that altered transcriptional regulation by miRNAs contributed to age-associated programmatic alterations in macrophages and sought to examine these changes in non-coding RNA expression on a genome-wide scale. Thioglycollate injection induces a sterile inflammatory response in the mouse peritoneum, which elicits infiltration of monocytes from the blood. Lavage of the peritoneum several days post-injection allows for the collection of the activated TGEM population, consisting of both resident and recruited macrophages\u00a0, with thMir15a, Mir29a, Mir423, Mir146a, or Mir18a with age. Mir362 (data not shown) was also evaluated but was undetected for approximately half of all samples tested, independent of age, and was therefore excluded from analysis. Two miRNAs, Mir146b and Mir22, displayed significant decreases from 3 to 20 months  spanning the normal lifespan of C57Bl/6 mice to identify miRNAs whose expression changed with aging. Peritoneal exudates from 10 female thioglycollate-elicited mice were pooled to obtain one TGEM sample per time point. As miRNAs generally function to repress their targets, we were most interested in miRNAs whose expression decreased with organismal age, which would in turn lead to the accumulation of the miRNA\u2019s downstream target genes that may contribute to age-associated inflammation and cellular dysfunction. Unsurprisingly, we found many miRNAs whose overall expression was altered with age . We next0 months . Previouleukemia\u00a0. Mir22 cn hearts . For Mirividuals\u00a0. The effof Mir22 , indicatMir146b expression decreased in TGEMs from 3 to 20 months, we next asked whether this decrease continued through 30 months\u00a0of\u00a0age (in accordance with our RNA-seq time points) and whether this trend also occurs in other macrophages, such as bone marrow-derived macrophages (BMDMs), which represent a more naive state compared to elicited TGEMs. We indeed observed a decrease of more than twofold in Mir146b gene expression in TGEMs isolated from 3-month-old vs 30-month-old female mice  with transient Mir146b knockdown through fast-forward transfection with Mir146b-specific antagomir inhibitors at a final concentration of 25 nM. We measured the\u00a0transfection efficiency (in separate wells) using a fluorescently tagged sham inhibitor of similar nucleotide length and noted a transfection efficiency of approximately 80%, with less than 2% cell death assessed by terminal deoxynucleotidyl transferase dUTP nick end labeling\u00a0(TUNEL)  of protein coding genes to initiate a process of post-transcriptional degradation . Age cau by qPCR . Knockdosed Il10  when comted Il10 .Mir146b expression, we generated a novel Mir146b knockout mouse strain (Mir146bflox/flox) . Mir146bflox/flox littermates (hereafter referred to as Control) were used as controls. Mir146b loss was confirmed by qPCR using independent biological replicates from 3-month-old females (Mir146 family member Mir146a (To assess the in vivo effect of the\u00a0loss of macrophage ox/flox)  and cros females , and we  Mir146a , whose mMir146b knockdown in TGEMs  partial knockdown in culture. Taken together, however, even without added activating stimulation  such as IFNy + LPS or IL4, these results suggest that deficiencies in Mir146b lead to abnormal cytokine gene expression. Similar patterns have previously been reported with tumor-associated macrophages and macrophages in models of age-related macular degeneration\u00a0(AMD), a blinding eye disease (TGEMs harvested from young (6\u201312 weeks old) female cKO mice displayed altered polarization on gene expression analysis  similar in TGEMs . Compare disease .Mir146b-deficient TGEMs on a subcellular level, we examined electron micrographs of cells isolated from cKO female mice and littermate Controls. Analysis revealed a decreased number of mitochondria in TGEMs lacking Mir146b compared to littermate Controls  is reduced into formazan crystals by oxioreductases, primarily (though not exclusively) in the mitochondria and provides an estimation of cell metabolism  rates and ECAR were increased compared to scramble-transfected controls  mice using four biological replicates from each group. Although genes upregulated in Mir146b-deficient macrophages are of interest as this pattern may indicate that Mir146b directly targets this/these gene(s) through canonical or non-canonical miRNA seed binding, we wanted to examine gene expression in a more global and unbiased manner so as to capture any significant changes in expression that may be related to mitochondrial dysfunction. We found several genes significantly downregulated in Mir146b cKO TGEMs, which have critical roles in both mitochondrial morphology and respiration  .We next sought to elucidate the molecular mechanism by which Gtpbp10) . These fth aging . InteresMir146b-deficient macrophages, without a single obvious candidate to directly explain mitochondria structural and functional disparities between cKO and Control cells, we hypothesized that the heterogeneity of our samples may be masking critical differences between the two genotypes. We also asked whether increasing age may amplify these transcriptional differences. To address these questions, we performed single-cell RNA sequencing (scRNA-seq) using TGEMs isolated from young (<4 months) and old (>17\u00a0months) cKO female mice and age-matched littermate Controls. Analysis revealed three transcriptionally distinct clusters . Its expression increased in cKO macrophages across all clusters compared to the Control counterparts; however, this increase was not recapitulated by natural aging (young Control vs old Control). As discussed above, we were unable to modulate Lyz1 expression using overexpression models. Taken together, these may suggest that Mir146b\u2019s role in Lyz1 regulation is indirect. Alternatively, this discrepancy may be caused by amplifying or divergent effects due to the dramatic loss of Mir146b associated with our knockout model compared to the slow decline that occurs with natural aging, estimated to be approximately 25% (reduction) at this time point based upon our initial RNA-seq data  and identified five (a\u2013e) hierarchically defined expression patterns amongst our four groups (Mir146b. Genes within these patterns were enriched for cellular functions such as cholesterol transport and biosynthesis (pattern b), scavenging/phagocytosis and migration (pattern c), negative regulation of inflammation (pattern d), and calcium homeostasis and endocytosis (pattern e).Since the majority of cells belonged to Cluster 1 , we hypor groups . As withIsg15), C-C motif chemokine ligand 5 (Ccl5), interferon-induced transmembrane 3 (Ifitm3), interferon regulatory factor 7 (Irf7), interleukin-18 binding protein (Il18bp), and secretory leukocyte protease inhibitor (Slpi). These findings are especially informative as IFNy treatment has been demonstrated to significantly reduce the respiratory capacity of macrophages in culture  signaling pathway, including interferon-stimulated gene 15  mice compared to Mir22. While future studies examining the loss of Mir22 with aging in TGEMs are certainly warranted, here we chose to pursue the effects of Mir146b loss, as its initial high expression in TGEMs from young mice and gradual decline with age may represent a biologically relevant pattern consistent with the slow onset of age-related pathologies. One caveat of this study is that our original sequencing data, which identified Mir146b and Mir22 as miRNAs of interest in aging TGEMs, were aligned to the mm9 version of the mouse genome. While re-alignment and re-analysis of our data using the updated mm10 genome build may reveal other interesting patterns of miRNA expression or identify new miRNAs of interest in aging macrophages, this is technically challenging due to the legacy format of the raw data, and as such, we have not been able to integrate the data into the newer build. Regardless, our subsequent qPCR data confirm that Mir146b expression significantly decreases from 3 to 30 months in not only TGEMs but also BMDMs. We did note that Mir146b is expressed at much higher levels in\u00a0TGEMs, owing, perhaps, to the naive state of cultured BMDMs compared to elicited macrophages. Loss of Mir146b in TGEMs, established by both the\u00a0transient knockdown ex vivo and a novel conditional macrophage/monocyte knockout mouse, resulted in altered cytokine expression and polarization that parallels low-grade chronic inflammation associated with aging  with age precedes the\u00a0downstream effects on macrophage proteome and function. miRNAs, which are major components of the non-coding transcriptome, alter expression by either transcript degradation or translational repression . Here weth aging .Mir146b deletion in TGEMs results in an\u00a0abnormal mitochondrial structure and dysfunctional mitochondrial metabolism, characterized by a\u00a0decreased OCR and ECAR. Interestingly, this phenotype was reversed with Mir146b overexpression. Further examination of the effects of Mir146b overexpression in TGEMs as well as other murine macrophages such as BMDMs is warranted in future studies.We demonstrated that Mir146b utilizing RNA-seq. Age-related reductions in oxidative phosphorylation have been noted not only in macrophages  embryonic\u00a0stem\u00a0(ES) cells and clones were screened for G418 resistance and homologous recombination via long range PCR and Southern hybridization. Positive karyotypically normal ES clones were subsequently injected into mouse blastocysts. The resulting chimeric male mouse served as the colony founder and was bred to C57Bl/6J female mice . Mice positive for the Mir146b insert were bred to B6.Cg-Tg(Pgk1-flpo)10Sykr/J hemizygous Flp deleter strain (Jackson Laboratory Stock No. 011065) to remove the Universal Neo cassette. Offspring positive for the Mir146b knock-in construct and negative for Frt/Universal Neo were further crossed to C57Bl/6J for subsequent generations to establish the line at >99% in the C57Bl/6J background. Genetic background analysis was performed by IDEXX BioAnalytics  using C57Bl/6J as the reference background. To create mice in which Mir146b was conditionally knocked out in macrophages, we crossed this line with Lyz2Cre mice (Jackson Laboratory stock No. 04781) to produce LyzCreMir146bflox/flox (cKO) and MiR146bflox/flox littermate controls (Controls). The final breeding scheme of LyzCreMir146bflox/flox X MiR146bflox/flox resulted in viable fertile litters with approximately half of the pups being Mir146b macrophage cKOs and half, Cre-negative (non-excised) Mir146b-construct-positive Controls. Genotyping primers and parameters can be found in All animal use and experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Washington University in Saint Louis and performed according to the Washington University Animal Care and Use Guidelines. Data presented within this manuscript were obtained using female mice. C57Bl/6 mice, ranging in age from 3 to 30 months, were obtained from the National Institute on Aging  Aged Rodent Colony. To create mice lacking  methods . The fir2 asphyxiation and macrophages were collected by peritoneal lavage in 10 ml DPBS . Cells were pelleted at 1000 xg for 10 min, DPBS was decanted, and cells were resuspended and plated in Dulbecco's modified Eagle medium\u00a0(DMEM) (Gibco) containing 10% FBS (Gibco), 100 U/ml\u00a0penicillin/streptomycin antibiotic cocktail (Gibco), and 2 mM L-glutamine (Gibco). Following overnight cell adherence, plates were washed two to three times with DPBS to remove non-adherent cells and complete DMEM medium was replaced for approximately 24 hr, at which time they were directly assayed or harvested for further analysis. Cells were maintained in an incubator at 37\u00b0C with 5% CO2.Adult mice were injected interperitoneally with 1.5\u20132 ml of sterile 4% thioglycollate  as previously described . At day 2 asphyxiation, and the femurs and tibia were harvested. Each bone was flushed with 5 ml DMEM using a 25 g needle and syringe to collect the bone marrow. The cell suspension was passed through a 100 \u03bcM strainer to remove clumps. Cells were plated in a\u00a0differentiation medium consisting of DMEM with 10% FBS, 1% L-glutamine, 1% pen/strep, 1% sodium pyruvate, and 20% conditioned medium from L929 cell culture. Cultures were washed in DPBS every 3 days and the\u00a0differentiation medium replaced\u00a0through d7, after which time they were switched to a\u00a0medium without the addition of L929-conditioned media and prepared for assay.For BMDMs, mice were euthanized via COCells were harvested by peritoneal lavage of thioglycollate-elicited\u00a0female mice, aged 3 or 20 months, cultured overnight in complete DMEM to allow macrophage/monocyte cells to attach, washed with DPBS to remove non-adherent cells, and returned to culture to rest overnight as described above. To collect the adherent cells for analysis, plates were washed twice with DPBS to remove the\u00a0residual culture medium and fresh ice-cold FACS buffer  was added to the plate. Cells were gently removed using a cell lifter. The resulting cell suspension was pipetted up and down to achieve single cells and then passed through a 50-\u00b5M filter. Cells were stained with CD11b eFluor450 and F4/80 APC (eBiosciences) and 30,000 cells per sample were analyzed using a BD FACSCanto Flow Cytometry system.For small RNA-seq to examine miRNA expression, TGEMs were harvested, as described above, from C57Bl/6 female mice of ages 3, 6, 12, 18, 24, and 30 months . Peritoneal exudates containing TGEMs were pooled from 10 mice per age group and plated and washed as described above. RNA (>10\u00b5g) was isolated from macrophage samples using the mirVana RNA isolation kit (ThermoFisher Scientific) as\u00a0per manufacturer\u2019s instructions. RNA was randomly fragmented and converted to complementary\u00a0DNA\u00a0(cDNA) for sequencing using the Illumina GAII  platform. The resulting sequencing reads were analyzed by Cofactor Genomics , in consultation with the Washington University Genome Center, using the\u00a0Cofactor Genomics EXP software package. Sequences were first aligned against the mouse genome (July 2007 [NCBI37/mm9]). Overlapping reads were then clustered together to assemble expressed loci and provide respective read counts and coverage for each locus. All counts and expression levels were normalized down to the sample with the fewest reads in order to allow cross sample comparative expression between loci. A x6 coverage multiplier was used as a cutoff for including reads to compensate for stochastic deep sequencing. A pair-wise comparison was performed between samples and log2 ratios were computed for each expressed small\u00a0RNA. Sequences aligning to the\u00a0annotated regions of the mouse genome that have been previously identified as 572 individual microRNAs were used for further analysis. We next identified microRNAs whose expression either consistently increased or decreased  across time in the progressively aging macrophage, allowing for +/- 10% error in the expression ratios between any two consecutive time points, such that if the (n + 1) time point compared to (n) was 0.9 < (Exp(n+1))/Exp(n) < 1.1, then it was considered to be no change and not contributing to either direction. A heatmap of the top 100 expressed miRNAs was constructed using Phantasus build 1.9.2 .U6 expression. Ct values greater than 36 were excluded from analysis. Relative miRNA expression was calculated using the average values obtained from the appropriate control group for each experiment . The following primer sets were utilized: hsa-Mir146b-5p , hsa-Mir22-5p , hsa-Mir15a-5p , hsa-Mir-29a-5p , hsa-Mir423-5p , hsa-Mir146a-5p , hsa-Mir18a-5p , hsa-Mir362-5p , and U6 snRNA  .For qPCR analysis of miRNA expression, we isolated RNA from TGEMs using the miRvana RNA isolation kit and prepared cDNA using the miRCURY LNA Universal RT microRNA PCR, Polyadenylation and cDNA synthesis kit II (Qiagen) with 65 ng of starting RNA per reaction. We performed qPCR using ExiLENT SYBR Green master mix (Qiagen) and miRCURY LNA miPCR primer sets (Qiagen). To analyze the data, we used the \u0394\u0394Ct method, normalizing to Mir146b-5p probe set, positive control (#SM-10013\u201301), and U6 (#SR-19005\u201301). Briefly, diluted probe sets, samples, and controls were added to wells of the 96-well capture plate, sealed, and incubated overnight at 46\u00b0C. The following morning, plates were washed 3x with Wash Buffer, and Pre-Amp solution was applied to all wells for 60 min at 46\u00b0C. After washing, 2.0 Amplifier solution was applied to each well for\u00a060 min at 46\u00b0C, followed by additional washes and application of the Label Probe for an additional 60 min at 46\u00b0C. After a final set of washes, luminescent 2.0 Substrate was added to each replicate well and luminescence was measured on a TopCount NTX counter.TGEMs were isolated and cultured as described above. RNA was extracted using mirVana RNA isolation kit. QuantiGene 2.0 miRNA Assay  was performed according to\u00a0the\u00a0manufacturer\u2019s instructions using 250 ng of RNA per reaction using mmu-Mir146b, 5\u00a0x\u00a0105 cells in 600 ul media were plated in each well of a six-well plate and allowed to adhere. Lipofectamine RNAi MAX (ThermoFisher) was diluted 1:100 in a\u00a0serum-free medium and combined 1:1 with a\u00a0medium containing mirVana Mir146b inhibitor or negative control . This mixture was incubated at room temperature (RT)\u00a0for approximately 15 min to allow for lipofectamine/oligo complexes to form, per manufacturer\u2019s instructions. 400 ul of each solution was then added to cells for a final concentration of 2 ul lipofectamine and 25 nM inhibitor or negative control\u00a0per well in 1 ml total volume. To assess transfection efficiency, additional cells were transfected using BLOCK-iT Alexa Fluor Red Fluorescent Oligo (ThermoFisher) using the same protocol. After 24\u201372 hr, cells transfected with BLOCK-iT were processed for TUNEL staining as described below, and cells transfected with Mir146b inhibitor or control sequence were harvested and processed for RNA/miRNA isolation using mirVANA microRNA isolation kit according to the\u00a0manufacturer\u2019s instructions (ThermoFisher).TGEMs were harvested from 3-month-old C57/Bl6 female mice. For inhibition of Chemicon ApopTag Fluorescein In Situ TUNEL labeling kit  was used according to the\u00a0manufacturer\u2019s instructions to detect apoptotic cells in cultured primary macrophage samples. Briefly, TGEMs were washed in DPBS and fixed in 1% paraformaldehyde for 10 min at RT and post-fixed in precooled ethanol:acetic acid (2:1) for 5 min at \u221220\u00b0C, with phosphate-buffered saline\u00a0(PBS) washes before and after this step. Next, equilibration buffer was applied at RT followed by incubation with TdT enzyme at 37\u00b0C for 1 hr,\u00a0and\u00a0then a\u00a010-min wash in Stop/Wash buffer. After washing in PBS, anti-digoxigenin conjugate was applied for 30 min, followed by PBS washes, counterstaining with 4 \u2032, 6-diamidino-2-phenylindole\u00a0(DAPI), and fluorescent imaging.Actinb and Gapdh housekeeping genes. The following TaqMan Gene Expression probes were utilized: Actinb (Mm00607939_s1), Gapdh (Mm99999915_g1), Nos2 (Mm00440502_m1), Mmp9 (Mm00442991_m1), Il6 (Mm00446191_m1), Il1b (Mm01336189_m1), Ccl2 (Mm00478593_m1), Cd163 (Mm00474091_m1), Arg1 (Mm00475988_m1), and\u00a0Il10 (Mm99999062). Each experiment was conducted three\u00a0to\u00a0five times using independent samples.For mRNA expression analysis, TGEMs were pooled from two to three female mice for each sample. We isolated RNA by using the RNeasy Plus Mini Kit (Qiagen) as\u00a0per manufacturer\u2019s instructions. We prepared cDNA using the High Capacity Reverse Transcription kit (Thermo Fisher Scientific) and performed qPCR using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) with n\u00a0=\u00a02 technical replicates per sample. We used the \u0394\u0394Ct methods and normalized to the geometric mean of 20) prior to en bloc staining with 1% aqueous uranyl acetate  for 1 hr. Following several rinses in\u00a0dH20, samples were dehydrated in a graded series of ethanol and embedded in Eponate 12 resin (Ted Pella Inc). Sections of 95 nm were cut with a Leica Ultracut UCT ultramicrotome , stained with uranyl acetate and lead citrate, and viewed on a JEOL 1200 EX transmission electron microscope  equipped with an AMT 8.0 megapixel digital camera and AMT Image Capture Engine V602 software .For ultrastructural analyses, TGEMs from female cKO or Control mice were fixed in 2% paraformaldehyde/2.5% glutaraldehyde  in 100 mM sodium cacodylate buffer, pH 7.2, for 1 hr at RT. Samples were washed in sodium cacodylate buffer and post-fixed in 1% osmium tetroxide (Polysciences Inc) for 1 hr. Samples were then rinsed extensively in distilled\u00a0water\u00a0.TGEMs from female mice were plated at 100,000 cells per well in 96-well plates in complete DMEM medium as described above. At the time of the experiment, cells were washed with DPBS and DMEM medium containing 0.5 mg/ml MTT (Millipore-Sigma) was applied to the cells for 3 hr at 37\u00b0C in a 5% CO2 incubator at 37\u00b0C for 1 hr, we measured the\u00a0OCR at baseline and after sequential treatment with the following chemicals from the Mito Stress Test kit (Seahorse Bioscience): 3 \u03bcM oligomycin, 5 \u03bcM FCCP, and 1 \u03bcM rotenone/antimycin A (rot/AA). Each cycle consisted of 2 min of mixing and a 1 min pause, followed by a 5-min measurement period; we repeated each cycle three times. We normalized the background of all measurements by subtracting the average OCR of each sample after treatment with rot/AA. Values from n\u00a0=\u00a06 technical replicates were averaged for each biological replicate sample.For metabolic characterization of macrophages, we used the Seahorse XF Cell Mito Stress test on an XF96 Extracellular Flux Analyzer  to measure the OCR as a surrogate marker for oxidative respiration. Macrophages were plated in Seahorse XF96 cell culture microplates (Seahorse Bioscience) at 100,000 cells per well. On the morning of the experiment, we washed the cells and replaced the medium with Seahorse assay medium (Agilent Technologies) supplemented with 10% FBS, 25 mM glucose , and 1 mM sodium pyruvate (Thermo Fisher Scientific) and the\u00a0pH\u00a0adjusted to 7.4. After incubation in a non-COMir146b in TGEMs was achieved by fast-forward transfection of cells harvested from C57Bl/6J (Jackson) female mice using fluorescein amidite-labeled (FAM-labeled) hsa-146b-5p miRCURY locked nucleic acid (LNA) miRNA Mimic  or negative control A LNA . Briefly, after harvest, macrophages were seeded at 1\u00a0x\u00a0106 cells/well in 96-well plates and allowed to adhere for 2 hr. Following DPBS washes to remove non-adherent cells, transfection complexes were prepared containing 50 nM of mimic (or negative control LNA) and 0.75% HiPerFect transfection reagent (Qiagen) and incubated for 15 min at RT before adding to the cells in DMEM supplemented with 10% FBS, 1% pen/strep, and 1% L-glutamine. FAM-labeled LNA allowed us to visualize the transfection efficiency by observing with a fluorescent microscope. Cells were assessed by Seahorse XF MitoStress Assay (as described above) 48 hr post-transfection.Transient overexpression of For bulk RNA-seq, TGEMs were harvested from 3-month-old female cKO and littermate Controls. Each mouse served as an independent biological replicate. Cells were plated and harvested as described above. RNA was isolated using RNeasy mini kit . mRNA was extracted with oligodT beads (Life Technologies), and cDNA and libraries were constructed as previously described . LibrariFor scRNA-seq, TGEMs were harvested from female cKO and littermate Control mice at 3 (15\u00a0weeks) or 17 months of age and plated as described above. Cells were profiled using the 10XGenomic platform using the 3\u2019V3 chemistry and libraries sequenced on the Illumina NovaSeq S4 at the Genome Technology Access Center (GTAC) at Washington University.Emr1, Mertk, Csf1r, and Cd68) that were removed from further analyses. tSNE-dimension reduction was performed on the top principal components learned from the 317 genes with the highest variance across the cells that passed quality filters (>5000 mRNA counts), and the Louvain method was used to define clusters. The Monocle3 fit_models function was used to assess\u00a0differential gene expression\u00a0with the following parameter: model_formula_str = \u2018~library + 1\u2019.Data were analyzed first using Cellranger 3.1.0 and mapped to the mouse mm10 genome with default parameters. Expression matrices were reanalyzed using Monocle3 (v0.2.1) . InitialAll sequencing data discussed herein have been deposited in NCBI\u2019s Gene Expression Omnibus  under rehttps://github.com/alexdobin/STAR . One-way mixed analysis of variance (ANOVA) with Bonferroni post-test or non-parametric Mann-Whitney U-test was used for comparison between groups. The accepted level of significance for all tests was p<0.05. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:Age-related inflammation, also known as inflammaging, is a leading driver of multiple aging-related diseases. However, the molecular mechanisms underpinning why immune cells become dysfunctional during aging remain poorly understood. This study is a timely investigation demonstrating that aging leads to differential expression of micro RNAs in elicited peritoneal macrophages, which in turn promotes altered macrophage gene expression, polarization, and mitochondrial dysfunction. A key strength of this manuscript is the discovery of a role for miR-146b in macrophage biology, and the role of its decreased expression with age in driving aspects of macrophage functional decline with aging.Decision letter after peer review:eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Matt Kaeberlein as the Senior Editor. The reviewers have opted to remain anonymous.Thank you for submitting your article \"Loss of macrophage miR-146b with aging contributes to inflammation and mitochondrial dysfunction\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1) The authors use a type of \"elicited\" macrophages, Thioglycollate-elicited macrophages (TGEMs), which do not represent a naive state, but an activated/recruited state. However, this information is only included in the material and methods, and not discussed in the rest of the manuscript. Since this could have a great impact on the results, the three reviewers agreed that it is essential that authors explicitly address the use of TGEMs, , including in the title, abstract and main text, to make sure that the narrower scope of findings is clear to readers without needing to read the material and methods. If possible (maybe for future studies), similar analyses of other macrophage types would help understand the general relevance of the finding on the impact of miR-146b on inflamm-aging.2) Since the authors opted for an adherence-only method of purification for the TGEMs, it is crucial that some measurement of the purity of the macrophage population be provided to make sure that the purity of TGEMs by adherence is not affected by aging. An F4/80 and Cd11b flow cytometry staining on cells purified similarly from the same ages and sexes would be the ideal method for this.3) The authors need to carefully edit the manuscript to include all relevant and necessary methodological details . The authors also should refer to the individual reviewer comments for the points needed clarification in the revised manuscript on this point.4) Generally, the authors need to improve and amend their statistical analyses. This includes (i) providing more information on the analysis leading to only miR-146b , (ii) removal of all t-tests since there is no power to test for data normality, removal of statistical tests when the authors only have n = 2, etc.5) Finally, potentially contradictory findings between figures need to be reconciled or explicitly discussed by the authors. (e.g. Reviewer #2 point 4)Reviewer #1:In this manuscript, Santeford et al. study the regulation and impact of a microRNA, miR-146b, on macrophage aging phenotypes in mice. They first identify miR-146b as the only significantly and monotonously age-regulated miRNA in thioglycolate-elicited peritoneal macrophages (TGEMs) using a small RNA-seq approach. They then proceed to perform short-term manipulation of miR-146b expression in culture, as well as using a myeloid KO in vivo, and observe consistent remodeling of gene expression of cytokine genes in TGEMs. They also observe that miR-146b deficiency impacts TGEM metabolic function, including mitochondrial respiration. Transcriptome-wide analysis (both bulk and single-cell level) of the impact of miR-146b deficiency in TGEMs from the myeloid miR-146b KO model reveals decreased expression of metabolic genes and increases in interferon-signaling genes, similar to what is reported with aging.This article identifies an interesting new regulator [miR-146b] of macrophage phenotypes with potential relationship with aging, thus providing an interesting mechanistic insight into remodeling of macrophage function with aging. Consequently, this study is of interest to the fields of macrophage biology, immunometabolism and aging biology. While the strength of this manuscript is the discovery of a role for miR-146b inn macrophage biology, and potential link with functional decline with aging, a number of points need to be addressed before the study is presented with its full context (i.e. choice of use of TGEMs) and some technical questions are answered.A major caveat that will need to be discussed and addressed by the authors is the use of TGEMs vs. na\u00efve/resident peritoneal macrophages with aging. Indeed, thioglycolate elicitation recruits new non-resident macrophages to the peritoneum, and will also drive them to a more activated state in response to the foreign signal. TGEMs contain a lot more \"small\" peritoneal macrophages (bone-marrow derived) than steady state peritoneal macrophages . Although the study of TGEMs is interesting (and provides insights into populations recruited upon infection) they do not represent the steady state. This point should be very clearly stated in the text rather than just in the material and methods, at least the first time the macrophages are mentioned rather than just refer to these as \"peritoneal macrophages\" which is incorrect and somewhat misleading.1) Peritoneal Macrophages used from these experiments are from thioglycolate-elicited peritoneal macrophages (majorly bone-marrow derived and recruited upon acute irritation), which are very different from the steady state population . Since thioglycolate is a way to mimic a chronic infection, some of the described biology (including the difference between TGEMs and BMDMs) could be due to a difference in response to the chronic infection instead of the difference between microRNA expression of aged animals. Thus:a. This caveat needs to be explicitly addressed in the text the first time the authors mention the macrophages . This term should be systematically replaced with \"TGEM\" for accuracy throughout the manuscript.b. The authors should discuss the caveat that effects may differ if unstimulated resident peritoneal macrophages had been evaluated instead.c. Another point that should be discussed would be that the difference in age-regulated expression between TGEMs and BMDMs may be due to the effect of thioglycolate induction on the studied macrophages.2) A number of studies are done with N = 2 samples . This is problematic for several reasons: (i) statistics cannot be reliably applied to such small sample numbers and are thus meaningless and (ii) the use of the student t-test is for sure unwarranted, since a goodness of fit test is impossible to perform to confirm normality of data. If these pieces of data are retained as is, I recommend commenting on fold changes and nothing else. If the authors want to discuss statistics, additional samples need to be included and non-parametric tests should be used. In generally, the authors should revise analyses to use non-parametric tests instead of the Student t-test.3) Aging is a very sex-dimorphic process, and thus a variable of interest in any study including aging as its topic. However, the sex of used animals is not given in the manuscript. Please update the manuscript to include this information. If only one sex was used, please discuss how results may be different in the other sex in the Discussion section. If both sexes were mixed, please make sure to color-code data points to differentiate females and males on the graphs.4) Methodological details need to be included or revised for consistency reproducibility.a. Please include a table with the sequences of all used qPCR and genotyping primers.b. Some analyses are performed on the mm9 mouse genome build  and some on the mm10 genome build (e.g. RNA-seq of KO TGEMs line 591). Since this could lead to differences in results, please harmonize analyses so they are all performed on the same genomic build.c. Please include all code/scripts used for the analysis in a supplementary document or deposit them to a Github repository as per the journal policy.Reviewer #2:Santeford et al. investigated age-dependent molecular changes in macrophages that could contribute to inflammaging. Using RNA-seq analysis on peritoneal macrophages from mice of various ages, they identified miR-146b as a microRNA that progressively and unidirectionally declined with age. Using miR-146b antagomirs (inhibitors) and conditional knockout mice, they show that the loss of miR-146b function alters the expression of several inflammatory cytokines. Microscopic analysis revealed abnormal mitochondrial morphology in thioglycolate-induced peritoneal macrophages that lack miR-146b, which was coupled with reduced maximum respiratory capacity and glycolytic rate. Single cell RNA-seq on peritoneal macrophages revealed distinct clusters and a subset with altered interferon \u03b3 signaling.The study demonstrates an interesting role for miR-146b as a regulator of macrophage function. It provides a strong correlation between microRNAs and inflammaging, but a causal relation is yet to be established. The study surveys the expression of macrophage miR-146 from mice of various age groups, uses a unique mouse model capable of conditionally knocking out miR-46b, and scRNA-seq to dissect the complex population of peritoneal macrophages in a peritonitis model. Some limitations of the study lie on the lack of mechanistic connection between miR-146b and mitochondrial/metabolic alternations, the incomplete understanding whether aging macrophages lose the adaptive capacity to induce miR-146b upon stimulation or the ability to maintain baseline expression, and the unclear role of resident vs recruited macrophages in inflammaging.1. The authors state that miR-146b is the only microRNA that progressively and unidirectionally declined with age . This is confusing as Supplementary Figure 1 shows other miRNAs that decline with age, such as miR15a. Please clarify and/or rephrase.2. The thioglycolate-induced peritonitis model provides activated macrophages (both resident and recruited monocyte-derived macrophages). In contrast, bone marrow-derived macrophages that were differentiated in vitro are naive. This difference may underly the inconsistent in age-dependent miR-146 expression pattern in Figure 1. Thus, it is possible that what is lost during aging in macrophages is the adaptive capacity to induce miR-146b rather baseline expression. Would miR-146b levels decline with age also in bone marrow-derived macrophages if they were to be stimulated (i.e. loss of adaptive capacity to induce miR-14b)?3. The manuscript should clearly discuss that data on thioglycolate-induced peritoneal macrophages reflect induced responses rather than naive conditions.4. The cytokine panel in Figure 2C (miR-146b knockdown) does not include some cytokines in 2F (miR-146b knockout) \u2013 were they measured? Also, please comment on the Mmp9 expression, which is decreased in 2C but increased in 2F.5. It would strengthen the paper if the levels of secreted cytokines (proteins) upon loss of miR-146b were measured.6. In figure 3, the authors overexpress miR-146b and show increased mitochondrial respiration. Does this also alter the expression of cytokines measured in Figure 2?7. The loss of miR-146b reduces OCR/ECAR and, conversely, its overexpression increases OCR/ECAR. Further, the authors show that the loss of miR-146b affects the expression of mitochondria-associated genes. On that line, does miR-146b overexpression affect similar genes (which would revert the metabolic phenotype)?8. The miR-146b-dependent metabolic shift may result from alterations of multiple metabolic pathways that consequently affect OCR/ECAR, such as glucose metabolism. Were there metabolic genes that changed in the RNA-seq? If so, is/were there a coherent metabolic pathway(s) that is/are highlighted? If possible, quantifying metabolites that are highly relevant to macrophage function would provide further insight.9. Are the cytokines measured in Figure 2 reflected in the scRNA-seq of Lyz2; miR-146bM-/M- mice?10. As the authors state, peritoneal macrophages consist of a heterogeneous population of resident and recruited (monocyte-derived) macrophages. Further, monocyte-derived macrophages may not display age-dependent loss of miR-146b . The authors may want to add some discussion on the potentially differential role of resident vs recruited macrophages in inflammaging. Further, have the authors tried to compare resident vs recruited macrophages in the scRNA-seq on peritoneal macrophages in addition to the 3 clusters (it is not clear whether the largest cluster 1 is a mix of both populations)?Reviewer #3:The manuscript by Santeford et al., investigates whether micro RNAs regulate macrophage function during the aging process. The authors approached this question by using an unbiased non-coding RNA transcriptomic profiling of mouse peritoneal macrophages spanning the whole lifespan of mice from 3-30 months. This analysis revealed an aged-dependent decrease in the expression of the micro RNA miR-146B. The authors further revealed that transient knock-down or knock-out of miR-146B expression in peritoneal macrophages leads to altered cytokine gene expression, indicative of skewed macrophage polarization seen in aging tissues. Additionally, miR-146B KO macrophages also had altered mitochondrial morphology and dysfunctional mitochondrial metabolism. Lastly, to further investigate peritoneal macrophage populations that are most affected by loss of miR-146B, the authors performed single-cell RNA sequencing of peritoneal macrophages from old and young WT and miR-146B KO mice. This analysis largely showed that gene expression in recruited monocyte derived (non-resident) macrophages is most affected by loss of miR-146B. The authors conclude that gradual loss of miR-146B may lead to macrophage dysfunction and inflammation phenotypes during aging.Strengths:\u2013 The authors use of unbiased non-coding RNA transcriptomic profiling of mouse peritoneal macrophages (spanning the whole lifespan of mice from 3-30 months) provides a thorough analysis of the expression profiles of multiple micro RNAs in an age-dependent manner. This approach allowed the authors to identify the age-dependent down-regulation in miR-146B expression. Furthermore, the authors data set also revealed age-dependent changes to other micro RNAs, which will be areas of future investigation and a great resource to the aging field.\u2013 The authors utilized multiple genetics approaches to target miR-146B for transient knockdown and knockout in primary peritoneal macrophages and characterized the functional consequences. This approach led to the major findings in the paper that loss of miR-146B in macrophages leads to altered gene expression of inflammatory cytokines, metabolism genes, and mitochondrial dysfunction.\u2013 In addition to in vitro based experiments, the authors developed a miR-146B KO mouse model and aged the mice to investigate how loss of miR-146B affected the aging phenotype of aging peritoneal macrophages. This analysis was largely done in an unbiased manner utilizing single-cell RNA sequencing.Weakness:\u2013 The authors claim that the unbiased non-coding RNA transcriptomic profiling revealed miR-146B as the only micro RNA with consistent progressive changes with age. However, careful analysis of Supplemental Figure 1A shows many other micro RNAs that appear to be both positively and negatively correlated with age, including miR-15a which has a nearly identical gene expression pattern to miR-146B.\u2013 In Figure 1B, the authors attempt to validate the RNA-seq gene expression of miR-146B via qPCR in young and old peritoneal macrophages, to demonstrate that this micro RNA is down-regulated during aging. However, the authors do not attempt to look at other micro RNAs as controls to test their hypothesis that miR-146B is the only micro RNA whose expression is regulated during aging.\u2013 Figure 1, the experimental details are not very clear as described in the main text or figure legends. For example, in all the experiments it is unclear whether the data represents individual mice or biological/technical replicates from an individual mouse, the sex of the mice used in the study is unclear, and many experiments have a small sample size, especially for being in vivo mouse experiments.\u2013 The paper attempts to look at mechanisms of macrophage aging-related inflammation by solely focusing on thioglycolate induced peritoneal macrophages (a transient and non-resident monocyte derived subpopulation of macrophages) responding to acute inflammation. However, emerging evidence suggest that aging is characterized low-grade chronic inflammation. Thus, it's unclear whether miR-146B is relevant in aging-related inflammation since macrophages from naturally low-grade chronically inflamed aged tissues were not analyzed in this paper.Furthermore, it is also unclear if miR-146B is differentially expressed in non-resident vs tissue resident macrophages as no attempt to measure this was done in the manuscript or in the single-cell data presented in Figure 4. This is especially relevant since the authors showed in Figure 1D that bone marrow derived macrophages do not express significant amounts of miR-146B, compared to peritoneal macrophages, suggesting that different population of macrophages may or may not express miR-146B, particularly those that drive inflammaging. Perhaps the authors could investigate macrophage phenotypes from other tissues (known to undergo inflammaging) such as fat tissue from young and old, WT and miR-146B KO mice.\u2013 In Figure 2, the authors mention that loss of miR-146B affects macrophage polarization, skewing macrophages to a phenotype that resembles inflammaging. However, the authors only looked at a very narrow panel of cytokines. The data (both in vitro and in vivo) shows that loss of miR-146B leads to many pro-inflammatory cytokines being significantly down-regulated such as IL-1b and IL-6, while seeing an upregulation of the anti-inflammatory cytokine IL-10 suggesting miR-146B promotes an anti-inflammatory skewing (opposite of what the authors claim). Furthermore, this gene expression was performed under basal conditions which leads to less reliable gene expression. The authors did not attempt to measure how loss of miR-146B affects proper macrophage polarization via the treatment of macrophages with the type II cytokine IL-4 (M2) and LPS to skew to the classical M1 state.\u2013 The data showing miR-146B regulates macrophage gene expression and mitochondrial function is descriptive and the authors do not provide any mechanistic insight in to how miR-146B promotes these changes.-In Figure 4, the authors suggest the gene Lyz1 may be involved in the phenotype observed in miR-146B KO macrophages, but once again no attempt to demonstrate that miR-146B regulates mitochondrial function or gene expression via regulation of Lyz1 was performed. In fact, this conclusion is weakened by Figure 4E, showing that despite downregulation of miR-146B in old WT macrophages, Lyz1 expression does not increase as expected, making it an unlikely regulator of the altered gene expression seen in the WT old macrophages.Overall, the authors of this study provided strong evidence that aging leads to the down-regulation of miR-146B expression in aging peritoneal monocyte derived macrophages. The authors have also provided strong evidence that miR-146B regulates cytokine expression and mitochondrial function in peritoneal macrophages. However, the paper suffers from being descriptive and lacking mechanistic insight in how miR-146B regulates macrophage cytokine expression and mitochondrial function. Lastly, for the reasons listed above the paper does not fully support the hypothesis that miR-146B may be a major driver of aging-related macrophage dysfunction and inflammaging.1) Figure 1A, please clarify the units on the Y axis.2) Typo pg 5, line 86, add space between number and months.3) Figure 4D, clearly label what are resident vs non-resident markers.4) Figure 4A and 4E, please list the genes in the same order and provide the same genes in each experiment.5) Figure 4F, please label on graph what each Pattern represents, clearly state genes in each Pattern and if possible, show data for each gene in supplemental space.eLife. Your revised article has been evaluated by Matt Kaeberlein (Senior Editor) and a Reviewing Editor.Thank you for resubmitting your work entitled \"Loss of Mir146b with aging contributes to inflammation and mitochondrial dysfunction in thioglycollate-elicited peritoneal macrophages\" for further consideration by The reviewers have discussed your revised submission, and found that crucial issues had not been addressed, as outlined below:1. The purity panel needs to be more than n = 1 per age, and should be included in the manuscript, not just in the rebuttal letter. All reviewers were disappointed that this major point was not satisfactorily addressed.2. In general, the authors should address all previous concerns raised in the first round of reviews that were not addressed, including:\u2013 a number of the methodological points we raised (for instance the mix and match approach on genome reference usage mm9/mm10) are not at all addressed, not even textually in the revised manuscript.\u2013 regarding the uniqueness of the miR-146B pattern, reviewers are not convinced. For instance, the authors do not attempt to look at other micro RNAs as controls to test their hypothesis that miR-146B is the only micro RNA whose expression is regulated during aging.\u2013 information about biological vs. technical replication is still lacking in the revised manuscript. Essential revisions:1) The authors use a type of \"elicited\" macrophages, Thioglycollate-elicited macrophages (TGEMs), which do not represent a naive state, but an activated/recruited state. However, this information is only included in the material and methods, and not discussed in the rest of the manuscript. Since this could have a great impact on the results, the three reviewers agreed that it is essential that authors explicitly address the use of TGEMs, , including in the title, abstract and main text, to make sure that the narrower scope of findings is clear to readers without needing to read the material and methods. If possible (maybe for future studies), similar analyses of other macrophage types would help understand the general relevance of the finding on the impact of miR-146b on inflamm-aging.Use of Thioglycollate-elicited macrophages (TGEMs) has been has been explicitly highlighted throughout the manuscript, and we have included this detail in the revised manuscript title.2) Since the authors opted for an adherence-only method of purification for the TGEMs, it is crucial that some measurement of the purity of the macrophage population be provided to make sure that the purity of TGEMs by adherence is not affected by aging. An F4/80 and Cd11b flow cytometry staining on cells purified similarly from the same ages and sexes would be the ideal method for this.EBioMedicine. 2018;32:9-20. doi:10.1016/j.ebiom.2018.05.035). Using a flow cytometry approach, as was also suggested by reviewers here, we harvested TGEMs from female C57Bl/6 mice at approximately 3 and 18 months of age and stained for macrophage markers F4/80 (clone BM8) and CD64 (clone x54-5/7.1). We acquired data on a BD LSR II flow cytometer and used FlowJo v10 software to visualize and analyze data. No difference in the macrophage population was noted with either marker, and the overall percentages of cells positive for both macrophage markers (and therefore identified as macrophages) was consistently 94-96% in both old and young. In our previous studies, we have established that aging does not affect the purity of the TGEM population selected by adherence  The authors need to carefully edit the manuscript to include all relevant and necessary methodological details . The authors also should refer to the individual reviewer comments for the points needed clarification in the revised manuscript on this point.Methodological details, including clarification of mouse sexes and ages and use of biological vs. technical replicates, have been extensively added throughout the manuscript for each experiment. This includes the Methods section as well as main text and figure legends.4) Generally, the authors need to improve and amend their statistical analyses. This includes (i) providing more information on the analysis leading to only miR-146b , (ii) removal of all t-tests since there is no power to test for data normality, removal of statistical tests when the authors only have n = 2, etc.miR-146b, and acknowledged that other miRs were identified whose expression may change with mouse age and possibly warrant future investigation. In particular, reviewers noted that miR-15a levels represented in heatmap format in Supplemental Figure 1A look similar to those of miR-146b. Indeed, in this graphical representation pattern coloring does appear similar, particularly in small format. However, when we look directly at the numerical expression data, we can see that the decrease in expression from 3 months to 30 months in not unidirectional, as was seen with miR-146b and that may be expected as a result of the natural aging process. In fact, miR-15a expression actually increases by more than 10% between two separate consecutive time points , thereby failing our criterion threshold.We have added additional rationale regarding our identification of and focus on We have also presented experiments throughout the manuscript that include a greater number of replicates, when possible, and amended our statistical analyses of all experiments in accordance with the recommendation to remove all t-test. For instances when comparison between two groups is necessary, we have utilized the non-parametric Mann-Whitney U-test. In addition, for discussion of cytokine gene expression in Figures 2C and F, we removed statistical analysis and referred only to trends in the data, while also providing additional data points from independent experiments.5) Finally, potentially contradictory findings between figures need to be reconciled or explicitly discussed by the authors. (e.g. Reviewer #2 point 4)miR-146b in regards to cytokine gene expression levels. One potential explain of the differential patterns that we observed may be caused by the dramatic long-term (life-long) absence of miR-146b in conditional knockout macrophages vs. the short-term, partial reduction achieved through in vitro transfection.We have amended the text to address the contradictory findings noted by the reviewers. Namely, we have addressed the discrepancy between in vitro knockdown and in vivo knockout of Lyz1 data obtained through bulk RNA-seq and scRNA-seq. Lyz1 was found to be the only gene significantly increasing as a result of miR-146b deletion in TGEMs in our bulk RNAseq analysis. Deeper analysis using scRNA-seq also found this target to be increased across all clusters between miR-146b and littermate controls at both young (3 months old) and old (17 months old) time points. However, as noted by Reviewer #2, we did not observe an increase in Lyz1 when comparing old control TGEMs to young controls. As we have established that miR-146b expression is decreased with age in TGEMs, one may anticipate that expression of Lyz1 should thereby increase. An important consideration is that the natural aging process leads to a slow and steady decline of miR-146b, though not a full obliteration of expression, whereas TGEMs from our conditional knockout mouse model show a persistent, near complete miR-146b loss. The continued expression of miR-146b, though lesser with age, in control/wildtype TGEMs may either be enough to continue regulating Lyz1 and/or the slow decline in miR146b with aging may allow for additional, indirect compensatory regulation through other targets. These data illustrate in our opinion an important point about macrophage aging.We have also expanded our discussion of Reviewer #1:1) Methodological details need to be included or revised for consistency reproducibility.a. Please include a table with the sequences of all used qPCR and genotyping primers.The list of qPCR probe sets and manufacturer ID/catalogue number has been presented in lieu of specific sequences. Each of the products used within this manuscript are commercially available. The manufacturers from which we obtained Taqman probes (Life Technologies) or LNA primers (Qiagen) do not disclose specific product sequences. However, utilizing the provided manufacturer assay IDs will allow other investigators to easily find these products should they choose to replicate these studies in their own hands.All genotyping PCR sequences are presented in Supplemental Table 2 and the Key Resources table.b. Some analyses are performed on the mm9 mouse genome build  and some on the mm10 genome build (e.g. RNA-seq of KO TGEMs line 591). Since this could lead to differences in results, please harmonize analyses so they are all performed on the same genomic build.c. Please include all code/scripts used for the analysis in a supplementary document or deposit them to a Github repository as per the journal policy.References to GitHub depository have been moved to the Data Availability section for greater visibility and included in the Key Resources table.Reviewer #2:1. The cytokine panel in Figure 2C (miR-146b knockdown) does not include some cytokines in 2F (miR-146b knockout) \u2013 were they measured? Also, please comment on the Mmp9 expression, which is decreased in 2C but increased in 2F.In adding additional samples to our analyses, we have amended the list of cytokines to include targets measured for both knockdown and knockout, including some targets that may not be significantly changed. We have discussed any discrepancies within the text and noted possible rationale for differences noted in transgenic knockout vs. in vitro knockdown scenarios.2. It would strengthen the paper if the levels of secreted cytokines (proteins) upon loss of miR-146b were measured.INF\u03b3 + LPS or IL4, the greater sensitivity of qPCR over protein assays like ELISAs is capable of more accurately measuring differences here at baseline that may be otherwise less-reliably detectable due to the experimental limits of protein measuring.We agree that protein levels often provide interesting insight to a cell\u2019s biology. Our previous studies have shown that gene expression data provides a strong picture of the cell\u2019s status. As our experiments did not utilize additional activators, such as 3. In figure 3, the authors overexpress miR-146b and show increased mitochondrial respiration. Does this also alter the expression of cytokines measured in Figure 2?miR-146b overexpression on TGEM cytokine or mitochondria-related gene expression have not yet been examined. These are interesting questions which certainly warrant follow-up studies, with both in vitro and possibly mouse models.The effects of 4. The miR-146b-dependent metabolic shift may result from alterations of multiple metabolic pathways that consequently affect OCR/ECAR, such as glucose metabolism. Were there metabolic genes that changed in the RNA-seq? If so, is/were there a coherent metabolic pathway(s) that is/are highlighted? If possible, quantifying metabolites that are highly relevant to macrophage function would provide further insight.RNA-seq revealed statistically significant decreases in several genes involved in mitochondrial morphology and respiration, as noted in lines 342-3. However, no one pathway in particular seems to be targeted, though pathway analysis without a large number of genes can be limiting. Metabolomics analysis is great idea for future follow up studies, but is beyond the scope of the current project.5. Are the cytokines measured in Figure 2 reflected in the scRNA-seq of Lyz2; miR-146bM-/M- mice?Most of the cytokines measured in Figure 2 do appear in the scRNA-seq data set, as shown in 6. As the authors state, peritoneal macrophages consist of a heterogeneous population of resident and recruited (monocyte-derived) macrophages. Further, monocyte-derived macrophages may not display age-dependent loss of miR-146b . The authors may want to add some discussion on the potentially differential role of resident vs recruited macrophages in inflammaging. Further, have the authors tried to compare resident vs recruited macrophages in the scRNA-seq on peritoneal macrophages in addition to the 3 clusters (it is not clear whether the largest cluster 1 is a mix of both populations)?miR-146b, though perhaps not as dramatically as noted in TGEMs. The levels of miR-146b even in BMDMs from young mice however is only ~30% that of TGEMs from age-matched mice. In the scRNA-seq, the majority of cells expressing markers or resident peritoneal macs map to cluster 2. However, the vast majority of cells map to cluster 1, as noted in Supplemental B, and as such would be anticipated to contribute most to the phenotypes we observed.BMDMs indeed exhibit age-related loss of Reviewer #3:1) Figure 1A, please clarify the units on the Y axis.Y axis units of Figure 1A have been amended to \u201cNormalized Expression (RPM)\u201d. Units represent the normalized expression value of reads per million mapped to the mouse genome.2) Typo pg 5, line 86, add space between number and months.Spacing between number and months has been added to p5 line 86.3) Figure 4D, clearly label what are resident vs non-resident markers.Labels have been added to Figure 4D indicating resident vs recruited markers.4) Figure 4A and 4E, please list the genes in the same order and provide the same genes in each experiment.Gene listings for Figures 4A and 4E have been harmonized to list genes in the same order.5) Figure 4F, please label on graph what each Pattern represents, clearly state genes in each Pattern and if possible show data for each gene in supplemental space.For Figure 4F, the main text and figure legend has been expanded to more clearly explain that each row represents the mean z score for that hierarchically defined cluster of genes from the heatmap in Supplemental Figure 3. This was used to convey the various expression patterns across our four samples, and to interpret the GO categories and functions of the groups of genes with these patterns. All genes from Patterns a-e are noted in Supplemental Figure 3, along with their individual expression patterns across each sample, as well as listed Supplemental Table 1 for additional clarity.The reviewers have discussed your revised submission, and found that crucial issues had not been addressed, as outlined below:1. The purity panel needs to be more than n = 1 per age, and should be included in the manuscript, not just in the rebuttal letter. All reviewers were disappointed that this major point was not satisfactorily addressed.2. In general, the authors should address all previous concerns raised in the first round of reviews that were not addressed, including:\u2013 a number of the methodological points we raised (for instance the mix and match approach on genome reference usage mm9/mm10) are not at all addressed, not even textually in the revised manuscript.\u2013 regarding the uniqueness of the miR-146B pattern, reviewers are not convinced. For instance, the authors do not attempt to look at other micro RNAs as controls to test their hypothesis that miR-146B is the only micro RNA whose expression is regulated during aging.\u2013 information about biological vs. technical replication is still lacking in the revised manuscript.1. We have included flow cytometry analysis of both young  and old  TGEMs using the macrophage markers CD11b and F4/80 to validate the purity of the macrophage population utilizing the adherence selection method employed throughout this study. Approximately 95% of all cells, in both young and old samples, were double positive for both markers, indicating not only a high level of macrophage purity, but also demonstrating that there is no purity difference due to age. This data has been included as Figure 1\u2014figure supplement 1 and Figure 1\u2014figure supplement 1 source data. Dr. Lynn Hassman contributed to this effort and has been included as an author on the revised manuscript.Mir146b. Based on values from our original small RNA-seq, we have evaluated the expression of Mir15a, Mir22, Mir423, Mir29a, Mir146a, and Mir18a along with Mir146b. We also attempted to analyze Mir362, but found its expression below the limit of detection for nearly half of our samples, regardless of age, and therefore did not include it in this manuscript. While our original experiment was able to utilize mice as old as 30 months of age, 20 month old mice is the oldest time point that we are able to presently acquire. We have noted this caveat within the manuscript. This new validation using mice using 7-9 individual mice at 3, 12, and 20 months of age again demonstrated decline in Mir146b from 3 to 20 months. In addition, Mir22 was observed to decline between these time points as well. Our RNA-seq data indicates that while there may be decreases in expression between 3 and 18-24 months, expression may actually increase again from 24-30 months. We have included the graph of normalized expression values for Mir22 obtained from our small RNA-seq data, but we cannot presently validate this potential increase in TGEMs from 30 month mice, and as such, do not comment on this pattern within the manuscript. We do however note that the level of reads for Mir146b is more than 3 fold higher than that of Mir22, keeping Mir146b an attractive target for our study, but also note the need for future studies of Mir22 in the aging macrophage.2. We have evaluated the miRNA expression patterns for a number of additional miRNAs in TGEMs. Here we further investigated microRNAs identified in our original dataset to have overall decreased expression with age, but which were not noted to decline in quite the linear fashion with each age point, we observed Mir146b as a microRNA of interest, was aligned to the mm9 version of the mouse genome. We understand that re-analysis of the data using a newer version may reveal different patterns of expression for some miRNAs, revealing additional miRNAs of interesting in aging. However, due to the changes in raw data file types and programs that have occurred in the time period since this data was originally procured, conversion has been technically challenging at this point, and as such we are currently unable to realign these files. Importantly though, our qPCR of miRNA expression and additional experiments validates our initial findings from this RNAseq data set\u2014Mir146b progressively declines with aging in murine TGEMs.3. We have explicitly highlighted and discussed that our original small RNA-seq data, which helped us to identify 4. We have reviewed details in both the manuscript body as well as figure legends to ensure that we have explicitly indicated the use of biological vs technical replicates of each experiment and added additional methodological details within both the results and Materials and methods sections as well as in the figure legends.5. Use of Thioglycollate-elicited macrophages (TGEMs) has been has been explicitly highlighted throughout the manuscript, and we have included this detail in the revised manuscript title.6. We have presented experiments throughout the manuscript that include a greater number of replicates, when possible, and amended our statistical analyses of all experiments in accordance with the recommendation to remove all t-test. For instances when comparison between two groups is necessary, we have utilized the non-parametric Mann-Whitney U-test. In addition, for discussion of cytokine gene expression in Figures 2C and F, we removed statistical analysis and referred only to trends in the data, while also providing additional data points from independent experiments.miR-146b in regards to cytokine gene expression levels. One potential explain of the differential patterns that we observed may be caused by the dramatic long-term (life-long) absence of miR-146b in conditional knockout macrophages vs. the short-term, partial reduction achieved through in vitro transfection.7. We have amended the text to address the contradictory findings noted by the reviewers. Namely, we have addressed the discrepancy between in vitro knockdown and in vivo knockout of Lyz1 data obtained through bulk RNA-seq and scRNA-seq. Lyz1 was found to be the only gene significantly increasing as a result of miR-146b deletion in TGEMs in our bulk RNAseq analysis. Deeper analysis using scRNA-seq also found this target to be increased across all clusters between miR-146b and littermate controls at both young (3 months old) and old (17 months old) time points. However, as noted by Reviewer #2, we did not observe an increase in Lyz1 when comparing old control TGEMs to young controls. As we have established that miR-146b expression is decreased with age in TGEMs, one may anticipate that expression of Lyz1 should thereby increase. An important consideration is that the natural aging process leads to a slow and steady decline of miR-146b, though not a full obliteration of expression, whereas TGEMs from our conditional knockout mouse model show a persistent, near complete miR-146b loss. The continued expression of miR-146b, though lesser with age, in control/wildtype TGEMs may either be enough to continue regulating Lyz1 and/or the slow decline in miR146b with aging may allow for additional, indirect compensatory regulation through other targets. These data illustrate in our opinion an important point about macrophage aging.We have also expanded our discussion of"}
+{"text": "Background: Posterior capsule opacification (PCO) is the most common complication after cataract surgery, in which increased levels of transforming growth factor-beta 2 (TGF-\u03b22) accelerate PCO formation; however, the pathological mechanisms are not fully understood. This study aims to explore the regulation mechanism of TGF-\u03b22 in PCO formation via its autophagic functions. Methods: The autophagic effect of TGF-\u03b22 was detected by transmission electron microscopy (TEM), Western blotting, and immunofluorescence analysis. The association between autophagy and the epithelial\u2013mesenchymal transition (EMT) was evaluated by qPCR and Western blotting. The transcriptome analysis was used to uncover the molecular mechanism of TGF-\u03b22-induced PCO formation. Results: TGF-\u03b22 specifically promotes autophagy flux in human lens epithelial cells. The activation of autophagy by rapamycin can promote EMT marker synthesis and improve cell migration. However, the inhibition of autophagy by 3-MA attenuates EMT. To uncover the molecular mechanisms, we performed RNA sequencing and found that TGF-\u03b22 elevated tumor protein p53-inducible nuclear protein2 (TP53INP2) expression, which was accompanied by a nuclear-to-cytoplasm translocation. Moreover, the knockdown of TP53INP2 blocked the TGF-\u03b22-induced autophagy and EMT processes, revealing that TP53INP2 plays an important role in TGF-\u03b22-induced autophagy during EMT. Conclusions: Taken together, the results of this study suggested that TP53INP2 was a novel regulator of PCO development by TGF-\u03b22, and notably, TP53INP2, may be a potential target for the pharmacological treatment of PCO. Posterior capsule opacification (PCO) is the most common complication after cataract surgery, causing decreased vision in 20\u201340% of elderly patients  and 100%\u2212/\u2212 zebrafish  \u00d7 100.The cells were harvested with cold PBS and lysed in buffer A  containing 1% PMSF on ice for 20 min. The cells were added to buffer B and then centrifuged at 13,000 rpm for 5 min. The resultant supernatant was transferred to a new Eppendorf tube and used as cytosolic fractions. The sediment was then homogenized with the buffer of nuclear protein extraction reagent with 1% PMSF. After 30 min of vortexing, the cells were centrifuged for 10 min at 16,000 rpm and the resultant supernatants were used as nuclear fractions.t-tests were performed to compare the statistical difference between two groups and one-way ANOVA was conducted to compare the data of multiple groups. A value of p < 0.05 was considered significant.The data were analyzed using GraphPad Prism 8.0 software and are presented as means \u00b1 SD. Student\u2019s p-value < 0.05). The gene ontology (GO) term and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway were conducted based on up-related DEGs. The top sixteen KEGG pathways are presented in To reveal the molecular mechanisms of autophagy in TGF-\u03b22-exposed HLE cells, we performed transcriptome profiling to compare the genes involved in PCO development in TGF-\u03b22-treated or -untreated HLE cells. A total of 998 differentially expressed genes (DEGs) were found in the two groups A,B, of wPrevious studies and RNA sequencing have indicated that TGF-\u03b22 has the ability to regulate autophagy. To determine the influence of TGF-\u03b22 on autophagy flux in HLE cells, we observed the autophagic vacuoles (AVs) in TGF-\u03b22 treated or untreated cells by transmission electron microscopy (TEM), which is an intuitively morphological examination. Under the stimulation of TGF-\u03b22, the number of AVs markedly increased A, which According to the RNA sequencing, the high expression of TP53INP2 was first found in TGF-\u03b22-treated HLE cells. To validate our hypothesis, we treated the cells with different doses of TGF-\u03b22, ranging from 1 ng/mL to 20 ng/mL for 24 h. Western blot testing revealed that the autophagy-related protein levels of LC3-II, Atg5, and Beclin1 were increased. P62(SQSTM1), meanwhile, gradually degraded, which suggests enhanced autophagy. EMT markers, such as fibronectin (FN) and vimentin expression levels were also increased, indicating the formation of the EMT process. It is worth noting that the TP53INP2 expression level was also obviously elevated A,B.We consistently observed an increased number of LC3 puncta and a reduced number of P62 puncta in TGF-\u03b22-treated HLE cells via immunofluorescence, which verified the active autophagic response C,D. HoweGiven the dual regulatory role of autophagy on EMT in other types of cells, we examined the functional connection between autophagy and the EMT process in HLE cells. Two pharmacological agents, rapamycin (rapa) and 3-methyladenine (3-MA), were used. We co-treated the HLE cells with TGF-\u03b22 and rapa, an activator of autophagy, which primarily blocked the MTORC1 signal pathway. As shown in To further investigate the functions of TP53INP2 in HLE cells, we transfected TP53INP2-specific siRNA to HLE cells and observed that the effect of RNA interference was nearly 91% A. The TPIn this study, we observed the essential role of TP53INP2 in regulating TGF-\u03b22-induced autophagy during the EMT process in HLE cells. TP53INP2, at the crossroad of autophagy and EMT in PCO pathogenesis, is likely a novel medical target for PCO therapy.\u2212/\u2212 mice and Pik3c3/Vps34\u2212/\u2212 mice have discovered that impaired autophagy in lenses generates cataracts [Autophagy is one of the main intracellular degradation systems for maintaining lens homeostasis ,16. Studataracts . HoweverFurther evidence has suggested that autophagy plays a fundamental role in the EMT in cancer . Given tTP53INP2, a nuclear protein, is highly expressed in actively metabolizing tissues and is involved in cellular processes including obesity, transcription, autophagy, and apoptosis ,22. UndeIn this study, we found that TGF-\u03b22 could directly promote the entry of TP53INP2 into the cytoplasm and elevate TP53INP2 expression to activate autophagy and the EMT. Interestingly, the subcellular location of TP53INP2 acts as a switch to determine its biological behavior . We alsoGiven that no effective drug treatment is available, patients are still suffering from the threat of vision loss caused by PCO. Therefore, it is of great significance to find the potential drug targets. In this respect, our study provided novel insights into the interplay between autophagy and EMT induced by TGF-\u03b22 in HLE cells and suggested that TP53INP2 could work as a molecular switch to modulate autophagy induction to fine-tune the EMT process. Of note, the role of TP53INP2 in PCO formation has not been fully clarified yet. Thus, further investigations are needed to explore the underlying mechanism of autophagy regulation by TP53INP2, and there may exist some unknown post-translational modifications and protein\u2013protein interactions in vivo. Besides, the function of TP53INP2 may be a new target for PCO treatment.In conclusion, this study focused on the role of TP53INP2 in the modulation of TGF-\u03b22-induced autophagy and the EMT in HLE cells. During this physiological process, active autophagy is pivotal in regulating the EMT process to affect PCO development. Our findings provide new clues for understanding the pathogenesis of PCO and suggest that TP53INP2 inhibitors may be potential targets for the pharmacological treatment of PCO."}
+{"text": "The complex geographic and temporal origins of chicken domestication have attracted wide interest in molecular phylogeny and phylogeographic studies as they continue to be debated up to this day. In particular, the population dynamics and lineage-specific divergence time estimates of chickens in Southeast Asia (SEA) and the Pacific region are not well studied. Here, we analyzed 519 complete mitochondrial DNA control region sequences and identified 133 haplotypes with 70 variable sites. We documented 82.7% geographically unique haplotypes distributed across major haplogroups except for haplogroup C, suggesting high polymorphism among studied individuals. Mainland SEA (MSEA) chickens have higher overall genetic diversity than island SEA (ISEA) chickens. Phylogenetic trees and median-joining network revealed evidence of a new divergent matrilineage  as a sister-clade of haplogroup C. The maximum clade credibility tree estimated the earlier coalescence age of ancestral D-lineage  of continental chickens  while island populations diverged later at 2.1 kya (95% HPD 1467\u20132815\u00a0years). This evidence of earlier coalescence age of haplogroup D ancestral matriline exemplified dispersal patterns to the ISEA, and thereafter the island clade diversified as a distinct group. Gallus gallus domesticus) is one of the world\u2019s most widely distributed domestic animal species. It plays a key role in human societies as the largest source of animal protein2 and as a significant factor in socio-cultural development3. Since domestication, chickens have been distributed throughout various countries and continents, resulting in a wide range of chicken breeds today5. Despite their global distribution, studies on the chicken domestication process and translocation history remain obscure. Modern biological and zooarchaeological approaches suggest that chicken domestication probably occurred across southwest China and Southeast Asia, involving one or more wild progenitors across their native geographical range12. Subsequently, domestic chickens have been translocated out of their domestication centers to every inhabited region by human migration and trade expansion. This led to the evolution of subpopulations of chickens in response to natural selection pressure and selective breeding for adaptation to the variety of agro-ecological conditions13.The domestication of animals has led to important shifts in human demographics that helped shape early human societies. Domestic chicken , being the most geographically complex tropical region on Earth, has given rise to a diverse and highly endemic avifauna27. However, from the early twenty-first century, numerous mtDNA analyses suggested multiple domestication events28 and the possibility of different Gallus species contributing to the genetic makeup of domestic chickens30. Moreover, recent genome-wide data linked domestic chickens most closely to the Southeast Asian subspecies G. g. spadiceus, which locally interbred with other subspecies across South and Southeast Asia11. Mitochondrial DNA D-loop variation has been extensively used to gain a better understanding of chicken populations, types, evolutionary relationships, and domestication history. Chickens have been classified into eight highly divergent maternal haplogroups  and six rare haplogroups 31. Major haplogroups A and B were ubiquitously distributed in Asian regions, whereas haplogroup E was widely distributed in Europe, the Middle East, Africa, and South America33. Haplogroup C was spread over East Asia, whereas haplogroup F was restricted to Yunnan, China and Myanmar34. Haplogroup D was mostly found in SEA and Pacific populations37. The knowledge of population studies on the genetic diversity, population structures, and demography is essential to understanding the role of past and present evolutionary processes of chickens over the course of domestication.Early studies reconstructing the matrilineal history of domestic chickens based on mitochondrial DNA (mtDNA) analysis supported a monophyletic origin of the red junglefowl (RJF), which serves as the primary wild ancestor of domestic chickensHere, we generated complete mtDNA D-loop sequences of chickens from mainland SEA , the Philippines, and Fiji, spanning a geographical transect that is believed to encompass possible translocations of this taxon in the region. By combining these newly generated sequence data with previously published data from ISEA chickens (the Philippines and Indonesia) and Pacific chickens, as well as other neighboring chicken populations in Asia, we sought to obtain an updated perspective of the matrilineal phylogeny and demographic events that shaped the genetic diversity of SEA and Pacific chickens. Specifically, we would like to estimate their lineage-specific divergence, genetic similarities, and differentiation within and between continental and island populations.n\u2009=\u2009173), Laos (n\u2009=\u200963), Thailand (n\u2009=\u200925), Myanmar (n\u2009=\u200978), the Philippines (n\u2009=\u20096), and Fiji (n\u2009=\u200924) generated in this study and including previously published sequences from the Philippines (n\u2009=\u2009129), Indonesia (n\u2009=\u200910), and Pacific (n\u2009=\u200911). A total of 133 haplotypes were identified, with 70 variable sites consisting of 10 singletons and 60 parsimony informative sites. We documented 82.7% geographically unique haplotypes, while 17.3% of haplotypes were shared transregionally across SEA, suggesting high polymorphism among the studied individuals. Island populations  accounted for 28% of all unique haplotypes identified, while 72% were unique to continental populations. Summary of observed polymorphic sites and haplotype variations are presented in Supplementary Tables We analyzed complete mtDNA control region sequences of chickens from Cambodia (Hd\u2009=\u20090.963\u2009\u00b1\u20090.005) and nucleotide diversity (\u03c0\u2009=\u20090.00782\u2009\u00b1\u20090.00398) than the Island Southeast Asia (ISEA) chickens , although no major differences were observed. The highest value of Hd and \u03c0 was found in Thai chickens (with 72% RJF population in our dataset), whereas the least was observed in Pacific chickens. These results should be taken with caution, given the Pacific chickens have a relatively small sample size, and the Thai chicken dataset was predominated with RJFs (18/25)  (Hap_103) at the basal position of the sub-clade  Hap_03 at the37 previously characterized this island sub-group as the \u201cPhilippine-Pacific sub-clade.\u201d This sub-clade is defined by five unique mutational motifs, A281G, C296T, T306C, A342G, and G686A, and includes diagnostic motifs from the downstream region of the complete mtDNA control region sequence  have a shared genetic affinity for predominant haplogroup D1. Godinez et al.nce Fig.\u00a0. These fConsistent classification of the major mitochondrial lineages of SEA chickens was also depicted in the median-joining\u00a0(MJ) network analysis Fig.\u00a0. NotablyFST\u2009=\u20090.06936), while MSEA populations showed more a diverse assemblage, consistent with the phylogenetic analyses and haplogroup variations. In addition, we documented closer relationships between Myanmar chickens and Yunnan chickens than any other Chinese chicken population. The pairwise FST value confirmed that Myanmar and Yunnan chickens were not differentiated from each other . Meanwhile, within MSEA chickens, transregional population substructures were observed ranging from 0.06895 between Laos and Thailand to 0.19202 between Cambodia and Myanmar  could be attributed to within-population differentiation, specifically chickens distributed across Southeast and East Asia  at the different points along with the genealogical timescale. The Bayesian Skyline Plot (BSP) showed evidence of MSEA chicken populations experiencing an episode of population stasis during the early Holocene period, but Ne started to increase around 4000\u00a0years BP, and imminent population growth commenced about 3000\u20133500\u00a0years BP  tree estimating the divergence time using a calibration method under an uncorrelated lognormal relaxed clock model revealed age estimates for biogeographically important nodes of haplogroups D and V in our dataset Fig.\u00a0c. The no31. The consensus among researchers and several molecular studies confirmed that domestic chickens evolved from red junglefowl somewhere in South and Southeast Asia31, but identifying their exact geographic center of origin has been challenging13. Here, we present a comprehensive resolution of mitochondrial lineage diversity and phylogenetic analyses, population differentiation, demographic inference, and divergence time estimates of chickens in Southeast Asia and the Pacific region. Patterns of sequence variation indicated that chickens in the MSEA region have higher intrapopulation genetic diversity than island populations. The average genetic diversity values of Southeast Asian chickens  observed in this study were higher than those of Chinese chickens 38, Japanese chickens (\u03c0\u2009=\u20090.00162\u2009\u00b1\u20090.00103)40, South Asian chickens , Egyptian chickens 43, and East African chickens 32. The substantial diversity of SEA chickens reflects the high matrilineal genetic variation documented in the major haplogroups, particularly haplogroup D with a large number of divergent haplotypes and haplogroup V, which has been detected only in Thailand, Cambodia, and Laos  of domestic chickens in southwestern China and Southeast Asia11. However, topological discrepancies have also been documented in genome-wide data, often explained by differences in data sources and taxon sampling46. The scope of the present study defines new evidence for modern chicken genetic information with increased data sources spanning Southeast Asia and Oceania. Furthermore, zooarchaeological DNA analysis can further clarify the evolutionary history of chickens in this region47.Pioneering molecular studies and DNA sources based on the hypervariable region 40. Haplogroup F was primarily represented in Myanmar chickens and shared this matriline with chicken populations in adjacent Yunnan Province, China34. Consistent with the phylogenetic analyses, the pairwise FST value of Myanmar chickens was not genetically different from those of Yunnan chicken populations . The previously reconstructed mtDNA phylogenetic tree described by Huang et al.31 assigned some of the previously identified haplogroup C samples to haplogroup V and linked them as a sister clade to the macrohaplogroup CD. However, because of the expanded sample distribution and increase in samples, we characterized haplogroup V as a sister group to haplogroup C only  in the entire Asia\u2013Pacific region17. The favorable seasonal weather patterns  and vegetation in much of the south, central, and west of the hotspot17 make it a suitable habitat for chicken dispersal18.Population genetic and phylogenetic analyses of more than 500 complete mtDNA control region sequences unveiled new perspectives on the population dynamics of SEA and Pacific chickens. Consistent with reports from various population genetic analyses, haplogroups A and B were widely distributed in East and Southeast Asia, while haplogroup E had the widest global distributionons Fig.\u00a0. This caens Fig.\u00a0. Transrely Figs. . This rely Figs. . The fav37. This recently expanded lineage is unique to this region, suggesting a human-mediated scenario of its phylogeography. This may be due to the dispersal of Austronesian speakers to the Philippines  and continued movement eastward to the Melanesian islands  and as far as Remote Oceania54. This translocation route has been reliably defined by the recovered ancient DNA from Polynesian chickens, which identified the Philippines as a homeland for the diversity of Pacific chickens55. Similarly, the phylogeographic dispersal of the sub-haplogroup D1b, which first diversified in the Philippine archipelago, likely corresponds to the initial introduction pattern of their ancestral matriline  from MSEA. This translocation pattern may have been influenced by the numerous waves of human migration to the Philippines brought by the Negritos across the continental landmass of Sundaland58. The introduction of the Manobo and Sama ancestry into the southern Philippines and Palawan cannot be ruled out, as they showed high genetic relatedness to MSEA-affiliated populations58. The timing of migration of people of Manobo ancestry  and people of Sama ancestry  is the closest possible translocation scenario58, which is consistent with archaeological evidence suggesting that the domestication of chickens in Southeast Asia occurred long before 8000 BP6. However, there are few reports of chicken remains in Southeast Asia24, and prehistoric exploitation has yet to be discovered25. Therefore, zooarchaeological and paleoclimatic studies are essential to identify their exact geographic center of origin reliably. On the contrary, we cannot assume a unidirectional north-to-south translocation of chickens from Taiwan because Taiwan's indigenous chickens  and gamecock (Hua-Tung) share genetic similarities with East Asian chicken haplotypes and populations introduced from Japan and the Indian subcontinent59.Meanwhile, the presence of the sub-haplogroup D1b classified for the Philippine and Pacific chicken populations is well documented in the present study and strongly supported by bootstrap and posterior probabilities. This matriline represents genetic uniformity and shows no significant signals of population structure despite geographic isolation between the Philippines and the Pacific region60. The timing of the demographic expansion of MSEA chickens observed in this study can be explained by the cultural importance of stock-raising in the archaeological sites of Non Nok Tha and Ban Chiang in Thailand around ca. 4000\u20133000 BP49. Bones of animals  and clay animal figurines were excavated in the human burial sites, suggesting that animals were part of the ritual practices during prehistoric inhumation49. It was well documented that agriculture and animal-raising were among the subsistence activities of domestic communities during prehistoric settlements in the broad valleys of the Lower Mekong49. In addition, ancient DNA of Thai chickens that were recovered in Ban Non Wat dated back to around 2500 BP, also supported the demographic expansion of MSEA chickens24. Recent morphological bone identification further documented the existence of chicken remains from other known archaeological sites in Thailand as early as 4000 BP25. On the other hand, the demographic expansion pattern of the island chicken population seems to suggest the timeline of Austronesian settlement in the region62.Our coalescent-based Bayesian demographic analyses detected earlier effective population size expansion in MSEA chickens, while island populations showed more recent demographic growth signatures. Although our BSP results consider relevant sampling schemes with high sample sizes per demes, we still carefully acknowledge the potential impact of population structure on demographic estimates36 and secondary calibration from previous estimations by Lawal et al.20. The latter calibration can provide close derived estimates from true time depending on the type of primary calibrations used64. Modelling the minimum\u2013maximum constraints allows proximate measurement of uncertainties for estimated times and includes true time boundaries in the derived time CI range66. These calibrations and our robust phylogenetic trees allowed us to estimate the divergence of major haplogroups and the coalescence ages of some lineage-specific matrilines that shaped the population demographics of Southeast Asian chickens. For example, the coalescence time estimate for the node of macrohaplogroup CDV is\u00a0estimated around 6.67 kya (95% HPD: 4235\u20137996\u00a0years). A similar age estimate was reported by Huang et al.31 under a relaxed molecular clock model using the same molecular rate. The evidence of earlier coalescence age of haplogroup D ancestral matriline  from MSEA exemplified dispersal patterns to the ISEA, and thereafter island clade diversified as a distinct group, a phylogeographic scenario that was also documented in other avian taxa68. Earlier paleoenvironment and biogeographic evidence69 and more recent evidence on stable carbon isotope records from bat guano sequences70 suggest that seasonal forest or open vegetation existed in the continental landmass of Sundaland during the Last Glacial Period, which likely facilitated early human dispersal through the region71. The most recent common ancestor (TMRCA) of modern Philippine-Pacific chickens  and the ancient Pacific samples date back to 2.1 kya (95% HPD 1467\u20132815\u00a0years). This estimate predates the sample ages of the recovered ancient Pacific chickens in Anatoloa site, Niue Island and Anakena site, Rapa Nui36. The age estimate of haplogroup V indicates an older coalescence age  than the previous estimate of this reclassified haplogroup31. Caution is warranted for this interpretation because the coalescence age estimate of gene copies in ancestral populations is not equivalent to a population split73, nor does it represent the actual onset of domestication.The time tree phylogeny in the coalescent framework allowed us to estimate nodal ages of haplogroups relevant to this study. We combined primary calibration  from ancient Pacific chickensIn conclusion, this study provides a comprehensive insight into the genetic diversity and unique population dynamics of Southeast Asian chickens. High-resolution matrilineal phylogeny sheds new light on the evolutionary history of globally acknowledged haplogroups of SEA and Pacific chickens. It provides evidence of a new divergent matrilineage  distributed across its native range in the Lower Mekong subregion. The phylogeographic and time tree phylogeny suggests human-mediated translocation of the haplogroup D ancestral matriline  from MSEA, which later diversified, forming a divergent sub-haplogroup D1b distinct to the island populations . Future integrated genome-wide and environmental adaptation studies are required to unravel new elements of genomic evolution of SEA chickens for sustainable genetic improvement for climate resilience, effective management strategies, and future conservation endeavors.Animal care and experimental procedures were approved by the Institutional Animal Care and Used Committee Guidelines of Hiroshima University as established by the Laboratory of Animal Genetics, Graduate School of Integrated Sciences for Life . All blood sample collections were conducted following the fundamental Guidelines on the Use of Experimental Animals of the Laboratory of Animal Genetics, Hiroshima University, Japan.n\u2009=\u2009173, domestic chickens), Laos , Myanmar , Thailand , Philippines , and Fiji, Melanesia  37 and directly submitted sequences of Indonesian (n\u2009=\u200910) and Pacific chickens (n\u2009=\u200911) retrieved from GenBank . Second, the amplified fragments were used for segmental amplification of the complete mtDNA D-loop region (1.3\u00a0kb) following the primer sets: Gal1F 5\u02b9-AGGACTACGGCTTGAAAAGCCATTG-3\u02b9 and Gal1R 5\u02b9-GCTGAGTACCCGTGGGGGTGTGGCT-3\u02b9 in 20\u00a0\u03bcl reaction volume containing 2\u2009\u00d7\u2009PCR buffer, 0.4\u00a0mM dNTPs, 0.3\u00a0\u03bcM concentrations of each primer, 0.4 U of KOD-FX Neo DNA Polymerase, and 15\u201325\u00a0ng of amplified fragment DNA as template. The PCR cycling condition began with a preliminary denaturation at 94\u00a0\u00b0C for 2\u00a0min, followed by 30 cycles of DNA denaturation at 98\u00a0\u00b0C for 10\u00a0s, annealing of primers at 59\u00a0\u00b0C for 30\u00a0s, and primer extension at 68\u00a0\u00b0C for 30\u00a0s, using a GeneAmp PCR System 9700 . The DNA fragments obtained from the segmental amplification were cleaned and purified using Exonuclease I (ExoI) and Shrimp Alkaline Phosphatase (SAP) to degrade the residual PCR primers and dephosphorylate the remaining dNTPs, respectively. The two PCR primers and one internal primer: Gal1-2F 5\u02b9 -TCCACCTCACGAGAGATCAGCAACCC-3\u02b976 were used for the sequencing reaction. Subsequently, the mtDNA D-loop fragments were directly sequenced using 3130/3130xl Genetic Analyzers .The target complete mtDNA control region (1232\u00a0bp) was amplified in two procedures. First, about 5.0\u00a0kb mtDNA D-loop fragments were amplified using a long and accurate\u2014PCR (LA-PCR) kit  with chicken DNA as a template and LA-PCR primer sets: http://genestudio.com/). Ambiguous sites were trimmed, and cleaned sequences were aligned in MEGAX77 with ClustalW78. Aligned nucleotide sequences were viewed using BioEdit 7.2.5 software79. All newly generated sequences were deposited in the GenBank database with accession numbers OM240181-OM240549 , and nucleotide diversity (\u03c0) were estimated using the DnaSP v6.0 software80.Intrapopulation level and intraclade genetic diversity indices such as the number of haplotypes (Ht), haplotype diversity  determined by Modelfinder82. Statistical node support was calculated using ultrafast bootstrap support83 and SH-aLRT84 with 1,000 replicates. Bayesian inference was performed using BEAST2 v2.6.685 under uncorrelated relaxed clock log-normal distribution setting a clock rate 3.13 86. We used a general time reversible (GTR) nucleotide substitution site model with assumed rate heterogeneity among sites modeled under gamma distribution and a coalescent-based model as a tree prior. The second-best model in BIC (GTR model) was implemented because the TIM2 model is not available in BEAST2 v2.6.6. We estimated posterior distributions of parameters via Markov chain Monte Carlo (MCMC) with duplicate runs of 50 million generations, sampling every 10,000 steps, and the initial 10% trees of each MCMC run were discarded as burn-in. Convergence of MCMC chains was assessed using Tracer v.1.7.1 and sufficient sampling was verified with all estimated parameters exceeding 200 ESS values. A maximum clade credibility (MCC) tree (target tree) was obtained from a sample of trees using TreeAnnotator v2.6.385. Phylogenetic trees were visualized and edited in FigTree v1.4.4. (http://tree.bio.ed.ac.uk/software/figtree/).Phylogenetic analyses were inferred using two different model-based approaches: maximum-likelihood (ML) and Bayesian inference (BI). Maximum-likelihood analysis was performed in IQ-TREE87. The number and assignment of haplotypes were determined using DnaSP v6.0 software. The definition of haplogroups was employed in DomeTree (http://dometree.kiz.ac.cn/) and MitoToolPy (http://mitotool.kiz.ac.cn/)88.Median-joining network was constructed to infer the evolutionary relationships between haplotypes using PopArt v1.7 softwareFST  was estimated using Arlequin v3.5.2.2 software 89. Population pairwise FST values were plotted into the principal coordinate analysis (PCoA) using GenAlEx v6.50390 to visualize the pattern of genetic relationships between geographical populations. Estimation of the genetic structures was calculated by the analysis of molecular variance (AMOVA) as implemented by Arlequin v3.5.2.2 software. The level of significance was evaluated based on 1,000 random permutations.The population pairwise net genetic distance based on population pairwise D91 and Fu\u2019s Fs statistics92. These population expansion tests measure haplotype frequencies under neutrality. Statistical tests and confidence intervals were based on a coalescent simulation algorithm under a neutral infinite-site model. To further support the inference for the population expansion signal, a coalescent-based Bayesian Skyline Plot (BSP) was cautiously used to quantify the relationship between genealogies and the demographic history of the population93. BSP was simulated to infer deeper insights into the demographic history of Southeast Asian and Pacific chicken populations as implemented in BEAST v2.6.385. BSP was generated with a relaxed molecular clock model and setting with 3.13 86. The piecewise constant function and HKY\u2009+\u2009G4 nucleotide substitution model as determined by BIC in jModelTest v2.1.194 was used for the analysis. The MCMC chain was run for 5 Ne) to the likelihood stationary distribution was evaluated using Tracer v1.7.1 software95.Inference for the population growth model was initially estimated by statistical neutrality tests, such as Tajima\u2019s 86 under uncorrelated lognormal distribution and GTR\u2009+\u2009G4 substitution model as determined by BIC in jModelTest v2.1.1. We set a coalescent-based constant population to model the tree prior. The ancient DNA records of Polynesian chickens were used to calibrate the crown node of sub-haplogroup D1b (Philippine-Pacific sub-clade) 20 as a secondary calibration. We used a lognormal prior  covering the confidence interval range of the divergence time estimate66. Time tree analysis was run for 50 million generations, sampling every 5000 generations, and the initial 10% trees of each MCMC run were discarded as burn-in. The resulting log files were examined in Tracer v1.7.1 software95 to confirm acceptable mixing and convergence of all parameters in the independent runs and adequate effective sample sizes (ESS\u2009>\u2009200). The MCC tree was created from the tree file using TreeAnnotator v2.6.385 with the posterior probability set to 0.5 and common ancestor node heights summarized. These results were visualized as a single tree in FigTree v1.4.4. (http://tree.bio.ed.ac.uk/software/figtree/).Bayesian analyses were performed to estimate divergence times using the program BEAST2 v2.6.6. We employed a relaxed molecular clock model, which allows substitution rates to vary across branches setting with 3.13 Supplementary Information 1.Supplementary Information 2."}
+{"text": "The Maternal Mortality Ratio in Indonesia has remained high, making it a national priority. The low utilization of maternal health services at community health centers is considered to be one of the reasons for poor maternal health status. This study aims to assess the influence of sociodemographic factors on utilization of maternal health services. The analysis was completed using binary and logistic regression to examine the association between sociodemographic variables and maternal health services utilization. A total of 436 women participated in the survey. In the multivariable analysis, age, education, ethnicity, parity status, distance to health centers and insurance ownership were associated with the utilization of maternal health services. Ethnicity  and distance to the CHC  were significantly associated with ANC visits. The association between parity and place of delivery was statistically significant . A positive association between basic health insurance ownership and PNC services was reported . Several sociodemographic factors were positively associated with the utilization of maternal health services at the CHCs. The required measures to improve the utilization of maternal health services at the CHCs level have to take into consideration the sociodemographic factors of reproductive age women. Maternal death remains a global health problem, particularly in many Low and Middle-Income Countries (LMICs). Most of these countries are continuing to prioritize programs to reduce maternal mortality in order to achieve Sustainable Development Goal (SDG) target 3, which aims to reduce the maternal mortality ratio to less than 70 per 100,000 live births by 2030 ,5.Indonesia is one of the biggest LMICs, with a rapidly developing economy, yet the health sector is still a major concern, including the high maternal mortality ratio (MMR). The country has one of the highest maternal mortality ratios among neighboring countries in Southeast Asia . Data shClearly, it has been challenging for Indonesia to reduce the maternal mortality target for the last 15 years. Several key strategies for reducing MMR have been implemented, including the provision of comprehensive Maternal Health Services (MHS) at Community Health Centers (CHCs) with the aim to provide equal services for communities in both rural and urban areas ,11. MateThe varying degree of utilization of maternal health services at the primary healthcare level is caused by a range of factors that can be categorized as structural and intermediary determinants . The strThe Province of Jambi is one of the small provinces in Indonesia where the MMR remains high  compared to other provinces in the country ,22. AlthThis was a cross-sectional and descriptive study with a quantitative approach that measured the outcomes and exposures in the study population at the same time . The stuThe study population of this research included reproductive age women who had given birth at least once and resided in the area for the last 12 months. Data of reproductive age women were obtained from the maternal cohort book provided by midwives at the CHCs.The number of respondents required for the study was calculated using Slovin\u2019s formula .n = N/ visits to CHCs during pregnancy, delivery by skilled health personnel and in the primary healthcare facilities, and Postnatal Care (PNC) visits to CHCs within 42 days of delivery. The independent variables included demographic characteristics . The socioeconomic characteristics included household income , religion, educational status, occupation, health insurance and distance to health facilities.p < 0.05 [Data from respondents were checked and entered into Microsoft Excel. Then, the data were exported and analyzed using SPSS . The survey dataset was calculated to generate descriptive data, and then was used to calculate the prevalence of maternal health services utilization. The analysis was followed by binary regression to measure the association between the outcome and predictor variables of the study . The variables that met the requirements in the multiple logistic regression model were calculated to analyze the factors influencing ANC visits, delivery and PNC visits. The results of the regression models were presented as odds ratio (OR) and 95% confidence interval (CI). Statistical significance was assumed at Regarding maternal health services utilization , most  in the investigated three regions in the Province of Jambi. However, significant progress has been made in terms of ANC visits at the community health centers, particularly for the first visit. A high ANC coverage is associated with the government\u2019s new policy, called the triple elimination initiative. The triple elimination initiative of mother-to-child transmission of diseases requires all pregnant mothers to receive ANC services at the CHCs ,27. The This study has identified a number of sociodemographic characteristics of reproductive age women for maternal health services utilization at CHCs. Multivariate analysis in this study found that women with low educational attainment were more likely to have ANC and deliver in community health facilities compared with women who were well-educated. This finding is consistent with research findings from a study conducted in another part of Indonesia. The study found that low education women tended to visit community health centers for ANC, whereas the highly educated group chose other health facilities . In otheIn addition, the findings of this study confirmed that non-working mothers utilize the CHCs\u2019 service for ANC visits and delivery more often than working women. The government of Indonesia has developed a program to provide free maternal health services at the CHC level for all groups of women. However, the services are not entirely utilized. In big cities, women generally hold formal and informal jobs instead of being housewives. Limited time to visit is one of the possible reasons for working women not using the maternal health services at the CHCs. Women tend to receive the service from private clinics or hospitals, where scheduling the visit appointments is flexible. Moreover, working mothers can afford to pay for ANC and delivery services at private health institutions by out-of-pocket payments. Similar studies in Timor-Leste and Nepal identified that financial hardship has been an issue for unemployed women to obtain adequate maternal health services ,32. The This study revealed that all of the respondents reported having delivered their last child in health facilities. The majority of women opted to have a normal delivery at private clinics rather than delivery at CHCs. The inpatient community health centers generally provide free basic maternal health services for those who live in the CHC\u2019s area. The CHCs have 24/7 emergency services with 24 h emergency midwives available and a relatively greater number of better-equipped facilities. However, the utilization of these services is still considerably low. A possible reason behind this fact could be that more mothers might have health insurance to cover normal delivery at private clinics and hospitals. This is also associated with the excellent services offered by the private institutions, which is considered more convenient than the services at the CHCs. Similar findings from two studies conducted in Myanmar  and the With regard to the age of the study participants, this study shows that the majority of young women went to the government health institutions for delivery. A similar finding was observed in a study in Vietnam, where the average age of women using the CHCs was 26 years old . Other sThis study found that PNC visits to the CHCs were significantly low. Most of the women who experienced caesarean delivery received PNC services from the CHCs\u2019 midwives within 42 days after delivery. The CHCs\u2019 health providers have made great efforts to raise women\u2019s awareness about the importance of PNC for both normal and caesarean delivery. Although the health workers had carried out health promotion on postnatal services during the pregnancy period, the women\u2019s interest in receiving PNC services is still low. Similar findings from other developing countries found the utilization of postnatal care services was low, accounting for less than a half of total respondents ,39,40.PNC services are crucial for the health of both mothers and newborns. Studies have shown that the utilization of PNC services has numerous impacts on major causes of maternal mortality among the population ,42. A stThe results from both bivariate and multivariate analyses confirmed several characteristics of the women in terms of utilization of maternal health services at the CHCs. Ethnicity and distance to the CHC were significantly associated with ANC visits. The study shows that the respondents belong to the Malay ethnicity and live close to the CHCs\u201470% and 45%, respectively. This finding is consistent with another study that ethnicity influenced the use of maternal health services . NowadayThe current study also found that the association between parity and place of delivery was statistically significant. This finding was supported by other studies in India, where parity was found to be a strong predictor for the utilization of delivery services at the health facilities ,47. A siA positive association between basic health insurance ownership and PNC services was reported in this study. Insurance coverage was generally the underlying reason for mothers using the PNC services at all types of health facilities. Hence, a few mothers prefer to receive the services to private clinics or hospitals other than the CHCs. This contrasts another study , which rThe utilization of services at the primary healthcare level has been considered the most relevant intervention to reduce negative maternal health outcomes as the facility is close to the women. Most importantly, the health providers at the CHCs easily understand the needs and conditions of the community. The government should pay attention to improving the quality of CHCs to attract women\u2019s attention in utilizing maternal health services at the community health centers. Further improvement is required to develop a holistic maternal health program at the CHCs by considering the characteristics of the reproductive age women, in order to meet the users\u2019 expectations.This study explored the sociodemographic characteristics of ANC, government institutional delivery and PNC services in three regencies of the Province of Jambi, Indonesia. Several sociodemographic factors, including women age, ethnicity, education level, parity, distance to health facilities and health insurance ownership, were positively associated with the utilization of maternal health services at the CHCs. Despite the remarkable progress in the utilization of the services in general health facilities, community health center-based delivery and postnatal care must be a focus of attention. It was observed that women were less likely to take advantage of the two services, hence interventions should focus on how to improve women\u2019s interest in using the CHCs for delivery and PNC services. Particularly for well-educated and working mothers, a massive campaign for delivery and PNC at CHCs is needed through various platforms, such as social media."}
+{"text": "Tesmin KO male mice, indicating that the TESMIN-BioID2 fusion can physiologically replace TESMIN. Furthermore, biotinylated protein pull-down and affinity-purification followed by mass spectrometry using the TESMIN-BioID2 transgenic mice captured components of the MYBL1\u2013MuvB complex that regulate cell-cycle gene expression. Thus, our study shows that proximity labeling proteomics can be applied in male germ cells, although the choice of biotin ligase needs to be carefully tested.Characterization of protein\u2013protein interactions (PPI) is a key to understanding the functions of proteins of interest. Recently developed proximity-dependent biotin identification (BioID) has been actively investigated as an alternative PPI mapping method because of its usefulness in uncovering transient PPI. Here, as an example of proximity labeling proteomics application in the testis, we generated two transgenic mouse lines expressing two biotin ligases (BioID2 or TurboID) fused with TESMIN, which translocates from the cytosol to the nucleus during meiotic progression and is required for reproduction. The BioID2 transgene, albeit not the TurboID transgene, rescued fertility defects of the  Furthermore, the CRISPR/Cas9 system3 has reduced the time and cost of preparing negative controls  and affinity-tag knock-in animals, facilitating PPI characterization in animal models. AP-MS thus remains a versatile and fundamental approach. Still, in recent years, proximity-dependent biotin identification (BioID)6 methods have begun to be actively investigated because of their usefulness in identifying insoluble proteins and transient PPI8.Proteins generally work as multi-component complexes, and these protein\u2013protein interactions (PPI) are essential for their proper functions. Therefore, the identification of interacting partners is a fundamental approach to elucidating the role of proteins of interest. Over the past decades, affinity purification followed by mass spectrometry (AP-MS) has been the most often used method to characterize PPI11, harsh conditions such as 0.4% Sodium Dodecyl Sulfate (SDS) can be used for cell lysis in proximity labeling experiments6. Furthermore, covalent biotinylation before cell lysis in proximity labeling approaches enables us to capture weak and transient PPI, which are difficult to detect in AP-MS12. Due to these benefits, proximity labeling proteomics has been rapidly adopted for animal models such as mice17. So far, two improved biotin ligases, BioID25 with slower kinetics and TurboID4 with faster kinetics, have been actively investigated for their adaptation. However, further consideration is still needed to examine whether the fused biotin ligase affects the protein of interest.The proximity labeling proteomics methods rely on fusing a promiscuous biotin ligase with a protein of interest, which acts as bait. Upon the addition of excess biotin, the fused biotin ligase biotinylate neighboring prey proteins. Those biotinylated proteins can be purified using streptavidin coupled to a solid support after cell lysis. As streptavidin tetramer and biotin-streptavidin binding are highly stable18, has been reported20 to localize to the cytoplasm of pachytene spermatocytes until stage IX of the seminiferous epithelial cycle22 and then to translocate into the nuclei of germ cells in stage X, corresponding to the appearance of diplotene spermatocytes. Although we previously showed male infertility of Tesmin knockout (KO) mice due to meiosis defects23, the mechanism and physiological importance of the TESMIN translocation remain unclear. Therefore, in this study, we generated two transgenic mouse lines expressing TESMIN fused with BioID2 or TurboID to fully decipher the TESMIN interactome.TESMIN, a testis expressed metallothionein-like protein, which is highly expressed in spermatocytes Fig. 18, has bTesmin KO mice, whereas the small isoform of TESMIN (TESMIN-S) is not required for spermatogenesis23. Therefore, we used the TESMIN-L encoding sequence (ENSMUST00000025840.16) for transgenic mouse production and referred to it as TESMIN throughout this study. We injected a DNA construct having 3xFLAG-tagged Tesmin-BioID2 or Tesmin-TurboID under the control of the testis-specific Clgn promoter24 . However, KO male mice carrying the Tesmin-TurboID transgene were infertile .We previously showed that a transgene expressing only the long isoform of TESMIN (TESMIN-L) rescues the meiotic defects and male fertility in 22. As we previously reported23, spermatogenesis in Tesmin KO testis was predominantly arrested at an early stage of meiosis. Almost no spermatocytes existed in tubules after seminiferous stage IV\u2013V  staining of testicular sections Fig. a. Then, V\u2013V Fig. a; KO. Ones Figs. a,b. Howeles Fig. c,d. Theses Figs.  and S3.19. However, TESMIN-BioID2 in the KO background existed in both the cytoplasm and nuclei of spermatocytes before seminiferous stage VIII and localized to the nuclei after stage IX  of less than 3%, from both IP-MS and proximity labeling proteomics using BioID2-Tg positive KO mice  and the Center for Animal Resources and Development  at Kumamoto University , C57BL6/N (SLC), ICR (SLC), and ty Table . AnimalsTesmin cDNA (ENSMUST00000025840.16) was tagged BioID2-3xFLAG or TurboID-3xFLAG with a rabbit polyA signal inserted under the control of CAG promoter. After confirmation of enzymatic activity in HEK293T culture cells, the promoter sequence was replaced by the mouse Clgn promoter for transgenic mouse production. These original and Tesmin cDNA inserted plasmids will be available from both the Riken BRC DNA bank (RBD) and Addgene  are available in Table The mouse ne Table . After lProteins from testis were extracted using NP40 lysis buffer . Proteins were separated by SDS-PAGE under reducing conditions and transferred to polyvinylidene fluoride (PVDF) membrane using the Trans-Blot Turbo system . After blocking with 10% skim milk , the membrane was incubated with primary antibody overnight at 4\u00a0\u00b0C, and then incubated with HRP-conjugated secondary antibody for 1\u00a0h at room temperature. Chemiluminescence was detected by ECL Prime Western Blotting Detection Reagents  using the Image Quant LAS 4000 mini . The antibodies used in this study are listed in Table To examine fertility, sexually mature male mice were caged with wild-type females (B6DF1) for at least three months. The vaginal plugs and pup numbers were recorded at approximately 10 AM to determine the number of copulations and litter size. Numerical data is available in Table 32.To observe testis gross morphology and measure testicular weight, mice over 12\u00a0weeks of age were euthanized after measuring their body weight. Numerical data is available in Table 2O2 at room temperature for 5\u00a0min for endogenous peroxidase inactivation, followed by a labeling reaction with TdT enzyme and FITC-conjugated dUTP at 37\u00a0\u00b0C for 1\u00a0h.TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit , according to the manufacturer\u2019s instruction. Briefly, testes were fixed with Bouin's fixative, embedded in paraffin, and sectioned (5\u00a0\u00b5m). After paraffin removal, the slides were boiled in citrate buffer  for 10\u00a0min and incubated in 3% H32. Numerical data is available in Table For chromogenic detection of apoptosis, the sections were incubated with HRP-conjugated anti-FITC antibody at 37\u00a0\u00b0C for 30\u00a0min. The section was then incubated in ImmPACT DAB  working solution, counterstained with Mayer's hematoxylin solution for 3\u00a0min, dehydrated in increasing ethanol concentrations, and finally mounted with Permount. The sections were observed using a BX53 (Olympus) microscope. Seminiferous tubule stages were identified based on the morphological characteristics of the germ cell nucleiTestes were fixed in 4% paraformaldehyde (PFA) overnight at 4\u00a0\u00b0C, followed by dehydration in increasing ethanol concentrations and 100% of xylene, embedded in paraffin, and sectioned (5\u00a0\u00b5m). After paraffin removal, the slides were boiled in pH 6.0 citrate buffer for 10\u00a0min, blocked and permeabilized with 10% goat serum and 0.1% Triton X-100 for 20\u00a0min in PBS, and incubated with primary antibody overnight at 4\u00a0\u00b0C or 1\u00a0h at room temperature in blocking solution. After incubation with Alexa Flour 488/546-conjugated secondary antibody (1:200) at room temperature for 1\u00a0h, samples are counterstained with Hoechst 33342  and mounted with Immu-Mount . The antibodies used in this study are listed in Table Seminiferous tubule stages were identified based on the morphological characteristics of the germ cell nuclei and acrosome staining with Alexa Flour 488/568-conjugated lectin PNA . The sections were observed using a BX53 (Olympus) microscope and a Nikon Eclipse Ti microscope connected to a Nikon C2 confocal module . Fluorescent images were false-colored and cropped using ImageJ Fiji software.33. Seminiferous tubules were unraveled using forceps in ice-cold DMEM  and incubated in 1\u00a0mg/mL collagenase  in DMEM (20\u00a0mL) at 37\u00a0\u00b0C for 15\u00a0min. After 3 washes with DMEM, the tubules were transferred to 20\u00a0mL trypsin/DNaseI medium  and incubated at 37\u00a0\u00b0C for 10\u00a0min. After adding 5\u00a0mL of heat-inactivated FCS and pipetting, the solution was filtered through 59\u00a0\u00b5m mesh  to remove tubule debris. The collected testicular cells were resuspended in hypotonic solution [100\u00a0mM sucrose] and 10\u00a0\u00b5L of the suspension was dropped onto a slide glass with 100\u00a0\u00b5L of fixative solution . The slides were then air-dried and washed with PBS containing 0.4% Photo-Flo 200  or frozen for longer storage at \u2013\u00a080\u00a0\u00b0C.Spread nuclei from spermatocytes were prepared as previously describedThe spread samples were blocked with 10% goat serum in PBS and then incubated with primary antibodies overnight at 4\u00a0\u00b0C in blocking solution. After incubation with AlexaFlour 488/546-conjugated secondary antibody (1:200) at room temperature for 1\u00a0h, samples are counterstained with Hoechst 33342 and mounted with Immu-Mount. The samples were observed using a BX53 (Olympus) microscope. The antibodies used in this study are listed in Table Proteins were extracted using NP40 lysis buffer . Protein lysates were mixed with 20\u00a0\u03bcL Protein G-conjugated magnetic beads  with 2.0\u00a0\u03bcg antibody. The immune complexes were incubated for 1\u00a0h at 4\u00a0\u00b0C and washed 3 times with NP40 lysis buffer. Co-immunoprecipitated products were then eluted by resuspension in 2\u2009\u00d7\u2009SDS sample buffer  and 10\u00a0min incubation at 70\u00a0\u00b0C. The antibodies used in this study are listed in Table 34 supplemented with 50\u00a0\u00b5M and 500\u00a0\u00b5M Biotin  followed by 16\u00a0h and 1\u00a0h incubation at 34\u00a0\u00b0C for BioID2 and TurboID, respectively. Biotin was dissolved in DMSO at 100\u00a0mg/mL, stored at \u2212\u00a030\u00a0\u00b0C, and diluted at the time of use. After 3 washes with PBS, TGCs were incubated in NP40 lysis buffer  for 20\u00a0min at 4\u00a0\u00b0C with gentle agitation for protein extraction.For preparing testicular germ cells (TGCs), seminiferous tubules were unraveled using forceps in ice-cold PBS and transferred to a 1.5-mL tube with 1\u00a0mL of accutase , followed by clipping the tubules, a 5\u00a0min incubation at room temperature. After filtration with a 59\u00a0\u00b5m mesh and centrifugation, TGCs were suspended in an organ culture medium 15 for 3\u00a0days.The freeze-thawed 100\u00a0mg/mL biotin dissolved in DMSO was diluted 100 times in PBS immediately before use. The 1\u00a0mg/mL biotin solution was intraperitoneally injected into animals once daily at 24\u00a0\u03bcg/g body weight35 with slight modification. Briefly, protein lysates were mixed with 50\u00a0\u00b5L SA-conjugated magnetic beads , followed by 1\u00a0h incubation at 4\u00a0\u00b0C with gentle agitation. Beads were washed once with 1\u00a0mL wash solution 1 [2% SDS], once with 1\u00a0mL wash solution 2 , once with 1\u00a0mL wash solution 3 . Biotinylated proteins were then eluted by resuspension in 2\u2009\u00d7\u2009SDS sample buffer  and 5\u00a0min incubation at 95\u00a0\u00b0C.Biotinylated protein pulldown was performed as previously describedm/z range of 100\u20131700. During the collection of MS/MS data, the TIMS cycle was adjusted to 1.1\u00a0s and included 1 MS plus 10 parallel accumulation serial fragmentation (PASEF)-MS/MS scans, each containing on average 12 MS/MS spectra (>\u2009100\u00a0Hz), and nitrogen gas was used as the collision gas.Protein samples were first subjected to chloroform/methanol precipitation to remove SDS. Then, the dried pellets were dissolved in 20\u00a0\u03bcL of 0.1% RapiGest  and reduced with 10\u00a0mM dithiothreitol (DTT), followed by alkylation with 55\u00a0mM iodoacetamide, and digested by treatment with trypsin and purified with a C18 tip . The resultant peptides were subjected to nanocapillary reversed-phase LC\u2013MS/MS analysis using a C18 column  on a nanoLC system  connected to a tims TOF Pro mass spectrometer  and a modified nano-electrospray ion source . The mobile phase consisted of water containing 0.1% formic acid (solvent A) and acetonitrile containing 0.1% formic acid (solvent B). Linear gradient elution was carried out from 2 to 35% solvent B for 18\u00a0min at a flow rate of 400\u00a0nL/min. The ion spray voltage was set at 1.6\u00a0kV in the positive ion mode. Ions were collected in the trapped ion mobility spectrometry (TIMS) device over 100\u00a0ms and MS and MS/MS data were acquired over an https://reprint-apms.org/). Analysis parameters for SAINT are as follows: Choice of Controls: user controls, Combining Replicates: average, #Number of virtual controls: 10, n-burn: 2000, n-iter: 4000; minFold: 1, lowMode: 0, Normalize: 1. Analysis parameters for the emperical fold change score are as follows: Choice of Controls: user controls, Combining Replicates: average, #Number of virtual controls: 10. The overall results are available in Dataset 29.The resulting data were processed using DataAnalysis version 5.1 , and proteins were searched using MASCOT  against the SwissProt database. The MASCOT search results were filtered by Scaffold version 5 . The quantitative values  are available in Dataset All animal experiments were approved by the Animal Care and Use Committee of the Research Institute for Microbial Diseases, Osaka University (#Biken-AP-R03-01-0), and all experiments were performed in accordance with these guidelines. This study is reported in accordance with the ARRIVE guidelines. Sample size and statistical methods were described in each legend or/and in the figure panel. P-value was calculated using R ver. 4.0.2.Dataset S1.Dataset S2.Supplementary Information 1."}
+{"text": "Acute lymphoblastic leukemia (ALL) represents the most common pediatric cancer accounting for about one-third of all malignancies in childhood. The differential diagnosis for a pediatric patient manifesting with joint pain and refusal to bear weight is wide and includes trauma, transient synovitis, septic arthritis, rheumatologic disorders, and malignancy. Overt complaints from the musculoskeletal system as the initial manifestation of ALL may present in up to 30% of cases with normal laboratory tests and without hepatosplenomegaly or lymphadenopathy, perplexing the establishment of a definite diagnosis. Herein, we report the case of a three-year-old male who presented with recurrent hip pain and fever masquerading as septic arthritis recalcitrant to intravenous (IV) antibiotics, irrigation, and debridement of the hip joint with a final diagnosis of acute lymphoblastic leukemia confirmed by bone marrow biopsy. Acute lymphoblastic leukemia (ALL) displays the commonest pediatric malignancy, with a peak incidence among children aged one to four years . Accordi3/\u03bcL, low hemoglobin level, and a platelet (PLT) count of 472 \u00d7 103/\u03bcL. The C-reactive protein (CRP) value was 5.8 mg/L . Biochemical laboratory tests were within normal values, except for a significant lactate dehydrogenase (LDH) elevation . Abdominal examination revealed right lower quadrant (RLQ) abdominal tenderness in deep palpation without guarding, with normal bowel sounds. No distension, hepatomegaly, or splenomegaly was noted. During the musculoskeletal examination of the lower extremities, passive flexion and internal and external rotation of the right hip were significantly painful without visible erythema or swelling; however, passive range of motion was preserved. Neurologic examination was unremarkable with intact cranial nerves and normal muscle tone, strength, and sensation. Emergent laboratory investigation of complete blood count (CBC) highlighted a white blood cell\u00a0(WBC) count of 14.7 \u00d7 10A review of the patient\u2019s previous hospitalization at the private pediatric center revealed that the child had presented with constant right hip pain that disturbed sleep and a limp. At the time of admission, the hematological profile was normal, but inflammatory markers were found to be elevated Table .\u00a0A subseAfter the initial assessment at the emergency department of the hospital, the patient was referred to the pediatric surgery department for further evaluation of the abdominal pain. A blood specimen for culture was collected, and the patient was switched from oral to IV antibiotics with a single dose of ceftriaxone, piperacillin, and amikacin, along with a standard dose of\u00a0vancomycin. Urgent abdominal u/s displayed a small volume of free intraperitoneal fluid, while right hip u/s demonstrated milder joint effusion (2.4 mm from 3.14 mm) compared to the initial right hip u/s from the private pediatric center  tended to also present less remarkable anemia (p < 0.05) and leukocytosis (p < 0.01) [Regarding the laboratory data, CBC routine test may reveal cytopenia; however, a retrospective study by Jonsson et al. found that patients with ALL with predominant bone pain\u00a0presented nearly normal hematological indexes, resulting in a delayed diagnosis . In addi < 0.01) . Inflamm < 0.01) . UsuallyIn the event of ALL presenting with osseous pain, radiological assessment can be useful\u00a0as it may reveal periosteal reaction with new bone formation, osteolytic/sclerotic or mixed lesions, radiolucent metaphyseal bands, permeative bone destruction, osteopenia, and pathologic fractures; however, none of the aforementioned radiographic abnormalities are pathognomonic for ALL ,14. AccoChildhood ALL treatment involves three phases: induction, consolidation, and maintenance therapy, with a maximum duration of two and a half years. Along with the conventional approach of chemotherapeutic agents, new strategies such as immunotherapy and molecular targeted therapy have come up, with hematopoietic cell transplantation (HCT) being utilized for very high-risk patients. Children with ALL are divided into three risk groups  based on certain prognostic factors in order to be enrolled in risk-based treatment protocols. Age, WBC count at diagnosis, race, sex, T-cell or B-cell immunophenotype, central nervous system involvement, MRD assessment, specific genetic alterations-translocations, hyperdiploidy/hypodiploidy, and response to initial chemotherapy are all factors taken under consideration for treatment assignment . Prior tIn the setting of an acutely limping child, vigilance is warranted by the clinician. First of all, the age of the patient can help in the differential diagnosis, as certain conditions such as slipped capital femoral epiphysis and Legg-Calve-Perthes disease present more often in adolescents. Migratory joint pain, morning pain, and stiffness should make the caretaker think of a rheumatoid process, while night pain interrupting sleep and constitutional symptoms should raise suspicion of an underlying malignancy.\u00a0In addition, referred pain from the spine or knee must be taken under consideration during a meticulous\u00a0physical examination. Differentiation between transient synovitis and septic hip can be challenging, as the range of motion can be restricted in both conditions. If infection is suspected, the assessment of CBC, CRP, and ESR and joint aspiration can help in establishing a definite diagnosis. Although ultrasound can detect the presence of a minor effusion, it cannot distinguish septic from reactive effusion. Plain radiographs of the area of interest should always be ordered as they could exclude or verify the presence of a fracture or reveal joint space narrowing, hip dysplasia, slippage of the femoral head, or bone fragmentation.In this article, we highlight\u00a0the case of a child with refractory hip pain and fever with initially non-obvious hematological aberrations except for remarkable elevated inflammatory markers that were managed as septic arthritis. Septic arthritis constitutes an orthopedic emergency that necessitates prompt intervention, as delayed management can lead to joint degeneration, loss of motion, and functional impairment. Even sterile cultures from joint aspiration cannot rule out septic arthritis, considering that approximately 50% of cases of bacterial arthritis are proven\u00a0negative . An upcoIn the acute presentation of a child with musculoskeletal symptoms, red flags indicative of a possible diagnosis of leukemia are apparent deviations of the three major cell lineages and significant serum LDH elevation along with symptoms reflecting hematopoietic insufficiency and leukemic organ infiltration. Of note, acute leukemia with dominant orthopedic complaints will less commonly present with abnormal hematological indexes and organ infiltration, so clinical alertness is required for prompt diagnosis and management. A bone marrow biopsy or the identification of blasts in peripheral blood smear will eventually confirm the diagnosis."}
+{"text": "Dear Editor,1 To investigate the role of CRC-derived EVs in the remodeling of the liver PMN, we isolated EVs from CT26 cell culture supernatant. The characteristics of EVs  were identified by transmission electron microscopy (TEM), Nanoparticle Tracking Analysis (NTA), and western blotting -derived extracellular vesicles (EVs) on liver pre-metastatic niche (PMN) remain incompletely understood.2 We analyzed the evolution of MDSCs by flow cytometry in the liver PMN before and after EVs education. We found that EVs education significantly increased the CD11b+Gr1+ cells  number in the liver PMN  are major regulators of the immune response in pathological conditions and key contributors to tumor progression.PMN Fig. .2 However, the mechanism by which the recruited MDSCs induce the liver PMN to enter an immunosuppressive state remains to be elucidated. As a prominent cellular component of the innate immune system, natural killer (NK) cells play a vital role in the early monitoring of tumor immune escape and the regulation of distant metastases.3 Our xenograft assay demonstrated that tumor cells evaded the immune system\u2019s surveillance, suggesting that NK cells had decreased cytotoxicity after EVs education. Moreover, we further confirmed that the expression of NKG2D, the main functionally activated receptor in NK cells, was significantly reduced after EVs education, although the number of NK cells did not change  (Supplementary Fig. 5 In this study, we also confirmed that Tgf-\u03b21 was the major component in EVs that induced HSCs transformation into CAFs phenotype (Supplementary Fig. + Gr1+ cells subset after EVs education. There was no significant difference between the PBS group and EVs with CXCL12 depletion group (Supplementary Fig. Our previous study revealed that gastric cancer-derived EVs carrying Tgf-\u03b21 remodel the preperitoneal PMN and promote tumor peritoneal metastasis.Next, we used the CRISPR\u2013Cas9 method to knock out CRC-derived exosomal Tgf-\u03b21 and further confirmed the Tgf-\u03b21 enrichment in EVs is a key cytokine that induces liver PMN formation (Supplementary Fig. In conclusion, CRC-derived EVs carrying Tgf-\u03b21 activate the HSCs chemokines signaling pathway and induce HSCs to transform into CAFs phenotype. After HSCs activation, MDSCs are further recruited into the liver PMN to inhibit NK-cell cytotoxicity by downregulating the expression of NKG2D. Finally, CRC-derived EVs remodel the liver PMN and promote tumor liver metastasis Fig. .Supplementary marterials"}
+{"text": "D) ratio, and the lung injury score. The levels of malonaldehyde (MDA), superoxide dismutase (SOD), interleukin (IL)-1\u03b2, tumor necrosis factor (TNF)-\u03b1, and angiotensin (Ang) (1\u20137) in the lung were measured through biochemical and ELISA kits. The expressions of angiotensin-converting enzyme (ACE)2, mitochondrial assembly receptor (MasR), and nuclear factor (NF)-\u03baB in lung tissue were detected by qRT-PCR and western blotting. Positive reaction cells of MasR were observed by immunohistochemistry. The results show that XQLD significantly ameliorated septic lung injury including edema and hemorrhage, as well as improved pulmonary function and arterial blood gas. Furthermore, XQLD markedly decreased the levels of IL-1\u03b2, TNF-\u03b1, MDA, and NF-\u03baB while increased the levels of SOD, Ang (1\u20137), ACE2, and MasR in septic ALI rats. Pearson correlation showed that the expressions of ACE2 were inversely related to IL-1\u03b2, TNF-\u03b1, MDA, and NF-\u03baB and positively correlated with SOD contents. Our data indicated that XQLD pretreatment alleviated inflammation and oxidative damage in septic ALI rats, which might be related to the up-regulation of ACE2-Ang (1\u20137)-MasR axis and inhibition of the NF-\u03baB pathway.Xiaoqinglong decoction (XQLD), a classic prescription of Traditional Chinese Medicine, has already been used clinically to cure acute lung injury (ALI), but its mechanism remains unclear. This subject aimed to explore the preventive role of XQLD in septic ALI rats besides its effects on angiotensin-converting enzyme (ACE)2 and its downstream factors. After, respectively, administrated with different concentrations of XQLD  for 5 days and dexamethasone  for 0.5\u2009h, the rat models of ALI were established by intraperitoneal injection of lipopolysaccharide  for 24\u2009h. All rats were evaluated by lung function test, arterial blood gas analysis, morphological observation, lung wet/dry (W/ Sepsis is a heterogeneous syndrome caused by a disordered host response to infection . It is c\u03baB pathway , housed at room temperature (21\u2009\u00b1\u20091\u00b0C) with 12h light/dark cycles, and were allowed to freely eat and drink water. All rats were randomly divided into six groups with eight rats in each: Control, ALI, XQLD low-dose (XQLD-L), XQLD medium dose (XQLD-M), XQLD high dose (XQLD-H), and dexamethasone (DEX). XQLD at 6.25\u2009g/kg/d was the minimum dose (XQLD-L) which corresponds to 1\u2009g/kg/d  for human dose [g were puThe rats were anesthetized 24 hours after the LPS challenge by intraperitoneal injection of sodium pentobarbital (50\u2009mg/kg). After endotracheal intubation, rats were placed supine in the plethysmograph, and the lung function of rats was evaluated with AniRes 2005 Lung Function System  as the following parameters: forced vital capacity (FVC), the forced expiratory volume (FEV) in 0.1\u2009s (FEV0.1), 0.3\u2009s (FEV0.3), and the ratio of FEV0.1 or FEV0.3 to FVC .2), carbon dioxide partial pressure (PaCO2), pH value, and blood oxygen saturation (O2Sat).To evaluate the arterial blood gas of the rats, blood was collected from the abdominal aorta at 24\u2009h after LPS administration. The blood gas analyzer was used to measure the oxygen partial pressure (PaOD) was reckoned.The left lower lobe of the lung was collected to assess pulmonary edema. The weight of fresh left lung tissue was weighed with an electronic balance as wet weight, then the dry weight was obtained after 36 hours in a thermostatic oven at 60\u00b0C. The wet/dry (W/\u00b5m thick sections were cut and dyed with hematoxylin and eosin (H&E) for histological examination. The histopathologic score was evaluated following the method described by Yu et al. [The upper lobe tissue of the right lung was soaked in 10% formalin for 24\u2009h and embedded after dehydration. The 4-u et al. . Briefly\u03b2, TNF-\u03b1, and Ang (1\u20137) contents of BALF and lung tissue in septic ALI rats were determined by ELISA kits.After trachea intubation, the right lung of rats was ligated, normal saline was used to lavage the upper lobe of the left lung three times, and the bronchoalveolar lavage fluid (BALF) was collected. The supernatants of BALF and the middle lobe of the right lung homogenate were separated by centrifugation at 3000\u2009rpm for 15 minutes at 4\u00b0C. The IL-1MDA is considered a lipid peroxidation marker, especially in the lungs. SOD protects the lung tissue from oxidative damage by scavenging reactive oxygen species (ROS). The levels of MDA and SOD in BALF and lung tissue in septic ALI rats were assessed according to the manufacturer's instructions for the chemical detective kits.\u03baB in the lung tissues of rats were examined by quantitative real-time PCR (qRT-PCR). The primer sequences are shown in \u00b5l), forward primer , reverse primer , cDNA (1\u2009\u00b5l), and RNase-free water (2\u2009\u00b5l). Samples were incubated for an initial denaturation at 95\u00b0C for 1\u2009min, followed by 40 cycles at 95\u00b0C for 20\u2009s and 60\u00b0C for 1\u2009min. The \u03b2-actin served as the internal parameter, and the 2-\u25b3\u25b3Ct value of relative expression of the target gene in each sample was calculated accordingly.The mRNA expressions of ACE2, MasR, and NF-\u03baB (1\u2009:\u20091000), and \u03b2-actin (1\u2009:\u2009500), which were then incubated with horseradish peroxidase-conjugated secondary antibodies  for 1.5\u2009h, followed by the addition of washing buffer (PBST) for 10\u2009minutes each and 3 washings in total. Corresponding protein expressions were measured using an enhanced chemiluminescence reagent kit . The semiquantitative analyses of immunoblots were performed through Image J.The total proteins of fresh lung tissues in rats were extracted by radio immunoprecipitation assay lysis fluid . Then the samples were centrifuged at 12,000\u2009rpm at 4\u00b0C for 10\u2009min. After the separation of SDS-polyacrylamide gel electrophoresis buffer, they were transferred to a polyvinylidene fluoride (PVDF) membrane. After the transfer solution on the membrane was washed away, western blocking solution was added, and the mixture was slowly shaken on a shaking table and blocked at room temperature for 2 hours. The membrane was incubated with the following primary antibodies at 4\u00b0C overnight: ACE2 (1\u2009:\u2009500), MasR (1\u2009:\u2009500), NF-\u00b5m thick paraffin sections were cut and stored at 58\u00b0C for 3\u2009h after dewaxing in xylene. MasR (1\u2009:\u2009500) primary antibody was then added and incubated overnight at 4\u00b0C. Thereafter, the sections were flushed with PBS three times and incubated with secondary antibodies (1\u2009:\u200920000 dilution) for 20\u2009min. This was followed by visualization with 3,3\u2032-diaminobenzidine (DAB) horseradish peroxidase color development kit . Immunohistochemical positive signals were stained brown in the cell membrane [The immunoreactive expression of MasR in the lung was observed by immunohistochemistry staining. The 4-membrane , and theP < 0.05 was considered statistically significant.The statistical description proceeded via SPSS 22.0 software for Windows. All measured values were presented as mean\u2009\u00b1\u2009standard deviation (SD). The intergroup differences in normal distribution were performed via one-way analysis of variance (ANOVA), which was followed by the least significant difference (LSD) test for multiple comparisons. Chemical components of XQLD were preliminary analyzed using the UPLC-MS/MS and GC-MS system , 20. TheP < 0.001\u223c0.01) in a dose-dependent manner. XQLD of high-dose (P < 0.001) had a better effect than that of low-dose (P < 0.01) and middle-dose (P < 0.001\u223c0.01) groups, and the medium dose is superior to the low-dose group. Furthermore, both XQLD-H (P < 0.001) and DEX (P < 0.001) groups showed equally potent prophylactic effects in septic ALI rats.Compared with the control group, the lung function of model rats with septic lung injury induced by LPS was seriously damaged . Our resn\u2009=\u20098 per group, \u25b2P < 0.05, \u25b2\u25b2P < 0.01, \u25b2\u25b2\u25b2P < 0.001, vs control group; #P < 0.05, ##P < 0.01, ###P < 0.001, vs ALI group; \u2206P < 0.05, \u2206\u2206P < 0.01, \u2206\u2206\u2206P < 0.001, vs DEX group). FVC: forced vital capacity; FEV0.1: forced expiratory volume in 0.1\u2009s; FEV0.3: forced expiratory volume in 0.3\u2009s; ALI: acute lung injury; XQLD-L: Xiaoqinglong decoction low dose (6.25\u2009mg/kg/d); XQLD-M: Xiaoqinglong decoction medium dose (12.5\u2009mg/kg/d); XQLD-H: Xiaoqinglong decoction high dose (25\u2009mg/kg/d); DEX: dexamethasone (1\u2009mg/kg).The values were presented as mean\u2009\u00b1\u2009standard deviation (SD) and the intergroup differences were performed via one-way analysis of variance followed by least significant difference (LSD) test for multiple comparisons. (2 (P < 0.001), pH (P < 0.01) and O2Sat (P < 0.001) levels  (P < 0.05) group was clearly more normalized than that in the DEX (P < 0.05) group after the LPS challenge for 24\u2009h (P < 0.05) group on PaO2   , while b < 0.05) . Furtherfor 24\u2009h . However on PaO2  was supe < 0.05) . The meaX groups .P < 0.001) and DEX (P < 0.001) pretreatment (D of XQLD-H group is lower than that of the DEX group (P < 0.05), which indicates that the XQLD-H group has a better effect on pulmonary edema. Furthermore, the septic rats showed markedly higher lung injury scores than those of control rats (P < 0.001) (P < 0.01) and DEX (P < 0.001) rats  . Compare01) rats . Moreove\u03b2 and TNF-\u03b1 in rat lung tissues and BALF were examined by ELISA, moreover, the expression of MDA and SOD in the lung were also detected. As depicted in \u03b2 (P < 0.001)   level increased and SOD (P < 0.001) activity decreased in ALI group rats compared with the control group. Still, there were significantly improved for MDA (P < 0.001\u223c0.01) and SOD (P < 0.001\u223c0.01) after XQLD and DEX pretreatments, whether in the lung or BALF   and MasR (P < 0.001\u223c0.01), while promoted the expression of NF-\u03baB (P < 0.001) in the lung . and MasR (P < 0.001), and the Ang (1\u20137) (P < 0.001\u223c0.01) level inhibited the expression of NF-\u03baB (P < 0.001)  level and the expression of NF- Figures  in the l Figures . In cont< 0.001) .Furthermore, the results of immunohistochemistry revealed that the expression of MasR in lung tissue was consistent with that of RT-qPCR and western blotting . MasR is\u03b2, TNF-\u03b1, MDA, SOD, and expression of NF-\u03baB in lung tissue. The results showed that the expressions of ACE2 were inversely related to IL-1\u03b2, TNF-\u03b1, MDA, and NF-\u03baB  measurement results showed that XQLD and DEX significantly reduced inflammatory infiltration and edema of lung tissue in septic ALI rats. Lung injury usually leads to diminished oxygenation and further aggravates the systemic inflammatory response [In sepsis, the lung is the most vulnerable target organ . The majresponse . Our res\u03b2 and TNF-\u03b1 exert a vital deteriorating effect on the systemic inflammatory response. The severity of lung injury has been demonstrated to correlate with IL-1\u03b2 and TNF-\u03b1 activity [\u03b2, TNF-\u03b1, and MDA levels, increased SOD activity in lung tissue and BALF, which suggested that the preventive effects of XQLD are brought by mediating the depression of inflammatory response, restoring the defensive activity of endogenous antioxidants, and reducing the lipid peroxidation levels.The signaling molecules IL-1activity . Furtheractivity . Our dat\u03baB directly modulates the expression of inflammatory cytokines such as IL-1\u03b2, TNF-\u03b1, and IL-6 [\u03baB pathway, thus raising inflammatory mediators [\u03baB activity may be involved in the oxidative stress process and the subsequent pathological process of lung injury. The present findings demonstrated that the NF-\u03baB activity was significantly raised in ALI rats, whereas both pretreatments of XQLD and DEX showed a great restriction for the NF-\u03baB activity. These results indicated that XQLD alleviated the inflammatory reaction, and oxidative damage may be related to the down-regulation of NF-\u03baB.As a pivotal transcription factor, NF-and IL-6 . In geneand IL-6 . In thisediators , which s\u03baB\u03b1 (I\u03baB\u03b1)/NF-\u03baB signaling but other signaling such as mitogen-activated protein kinases (MAPKs), which produce pro-inflammatory mediators and chemokines to regulate the inflammatory response [\u03baB and phosphorylation of c-Jun NH2-terminal kinases (JNK) and ERK1/2 signals in LPS-stimulated RAW 264.7 cells [Anti-inflammatory characteristics of XQLD are not only related to the inhibition of response . It has response , 42. In .7 cells .\u03b2, TNF-\u03b1, and MDA, while positively correlated with SOD contents. These results suggested that XQLD may reduce the expression of downstream NF-kB and inflammatory factors, as well as lipid peroxidation damage by promoting the expression of ACE2. Therefore, we speculated that RAS may be an important new therapeutic target for septic ALI, and XQLD probably plays a certain regulatory role.In terms of our results, the protein and mRNA relative expressions of ACE2 and MasR, as well as Ang (1\u20137) levels in the lung of ALI rats were all suppressed. In contrast, NF-kB levels increased significantly, suggesting that LPS administration could trigger severe inflammation in the lung, accompanied by down-regulation of upstream signals like ACE2 and up-regulation of NF-kB activity. Moreover, the lung tissues of ALI rats pretreated with XQLD and DEX were protected against LPS infection, in which the expression of ACE2 was activated while the expression of NF-kB was inhibited. Furthermore, Pearson correlation showed that ACE2 expressions were inverse to NF-kB, IL-1In vitro, recent cell culture experiments proved that A779 (a selective MasR inhibitor) pretreatment significantly enhanced the phosphorylation of NF-kB p65 [The RAS plays a vital function in modulating electrolyte balance and blood pressure . Lately,F-kB p65 . In addiF-kB p65 , 47, 50,\u03baB pathway.In conclusion, current research indicated that inflammatory response and oxidative stress played a crucial role in septic ALI. In addition, XQLD actively protected rats against LPS-induced septic ALI by anti-inflammatory and antioxidants, which are possibly related to the up-regulation of the ACE2-Ang (1\u20137)-Mas axis and inhibition of the NF-"
\ No newline at end of file