diff --git "a/deduped/dedup_0490.jsonl" "b/deduped/dedup_0490.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0490.jsonl"
@@ -0,0 +1,39 @@
+{"text": "In order to confirm a previous finding of linkage to alcoholism on chromosome 1 we have carried out a genetic linkage study.DNA from eighteen families, densely affected by alcoholism, was used to genotype a set of polymorphic microsatellite markers at loci approximately 10 centimorgans apart spanning the short arm and part of the long arm of chromosome 1. Linkage analyses were performed using the classical lod score and a model-free method. Three different definitions of affection status were defined, these were 1. Heavy Drinking (HD) where affected subjects drank more than the Royal College of Psychiatrists recommended weekly amount. 2. The Research Diagnostic Criteria for alcoholism (RDCA) 3. Alcohol Dependence Syndrome (ADS) as defined by Edwards and Gross (1976) and now incorporated into ICD10 and DSMIV.Linkage analyses with the markers D1S1588, D1S2134, D1S1675 covering the cytogenetic region 1p22.1-11.2 all gave positive two point and multipoint lods with a maximum lod of 1.8 at D1S1588 (1p22.1) for the RDCA definition of alcoholism. Another lod of 1.8 was found with D1S1653 in the region 1q21.3-24.2 using the HD affection model.These results both support the presence of linkage in the 1p22.1-11.2 region which was previously implicated by the USA Collaborative Study of the Genetics of Alcoholism (COGA) study and also suggest the presence of another susceptibility locus at 1q21.3-24.2. Epidemiological studies report that alcoholism as defined by the Research Diagnostic Criteria (RDC) affects almost 10\u201315% of the general population in the USA and 1\u20135% in Europe . The oveSelection criteria for the families eliminated all but 9% of the families contacted from all sources. Press contacts were found to be the most productive source of suitable families willing to participate in the study, accounting for over 50% of subjects recruited. There appeared to be no bias in the affection status of subjects recruited from the different sources . The affAssuming dominant transmission, two-point heterogeneity LODS (HLOD) for linkage to the HD affections status gave a score of 1.8 near the marker D1S1653. The three-point multipoint analysis produced an HLOD of 1.8 with the markers D1S1653 and D1S1677. Analyses with the same markers assuming recessive transmission produced an HLOD of 1.1 with a two-point analysis and an HLOD of 1.5 with a three-point analysis. The model-free (MFLINK) analysis produced an MLOD of 1.5 for both the two-point and three-point analyses. Three-point analyses of D1S1677 and D1S1679 produced an HLOD of 1.7 assuming recessive transmission and a MALOD of 1.3 for the model-free three point analysis. The marker D1S1675, on the short arm of chromosome 1, produced an HLOD of 1.2 with both a two-point analysis and a three-point analysis in combination with D1S3723 assuming dominant transmission, Model-free analyses of D1S1588 produced a MALOD of 1.5 and 1.2 using two-point and three-point analyses, respectively. Figure Assuming recessive transmission the marker D1S1679 was linked to RDC alcoholism with a two-point HLOD of 1.0 and a three-point HLOD of 1.6 with the markers D1S1677 and D1S1679. The MLOD two point MFLINK score with D1S1677 was 0.9 and this increased to 1.4 with a three-point model-free analysis.For the RDCA level of affection status the highest MALOD score of 1.8 was found near the telomere of chromosome 1p near the marker D1S1588 under the model free analysis. Figure The marker D1S1591 gave the highest maximum admixture lod (MALOD) of 1.00 with the model-free method of analysis for the ADS category. The results of MFLINK multipoint analysis for this and the other affection status models are shown in table The COGA study first reported evidence of a locus linked to alcoholism on chromosome 1p with the markers D1S532 and D1S1588 linked to Alcohol Dependence . Curtis Dick et al  who analIn the UK linkage study the two regions on chromosome 1 are implicated with two different affection status categories. We could speculate that the two different loci on chromosome 1 could be mediating an effect on alcoholism through two loci that have different types of effect on susceptibility. The most interesting and probably important finding from the COGA linkage study is that the stratification of families that have members with both alcoholism and depression maximizes the lod to 5.12 on chromosome 1p near the markers D1S1648 and D1S1588 . WithoutPrior to commencing the study, ethical permission for this research project was obtained from the University College London Medical School Clinical Investigations Panel which has been updated in 2003 with multicentre research ethics committee (MREC) approval. Information stored on computer was registered under the 1984 Data Protection Act.Caucasian families multiply affected by alcoholism, and suitable for linkage studies, were ascertained with the following selection criteria.(a) Presence of two or preferably more cases of alcoholism as defined by the RDC.(b) Large families, preferably with two or more generations willing and able to participate.(c) Evidence of unilineal inheritance of alcoholism in the parental generation, which meant that families were excluded where both parents were affected.(d) Willingness of as many family members as possible, especially affected individuals, to participate in the research project. The families were identified from hospital records, clinicians, advertisements in the media and other contacts . The famFifty nanograms of total genomic DNA was extracted from venous blood samples and amplified by Polymerase Chain Reaction (PCR) with oligonucleotide primers using standard methodology . Short T. Positions of the markers are shown in table Ten markers on 1p21-35 were genotyped: D1S1591, D1S2134, D1S1665, D1S1728, D1S532, D1S1588, D1S551, D1S1631, D1S3723 and D1S1675. Four markers on 1q were genotyped: D1S1595, D1S1653, D1S1677 and D1S1679. Marker order and intermarker distances were as compiled in the Ensembl database Genotypes were read blind to diagnostic information. Tests for Mendelian inheritance of marker data were performed and inconsistent genotypes were repeated or omitted.The linkage analysis was performed using the classical lod score method and using likelihood-based model-free analysis carried out with the MFLINK program . For lodIG carried out the genotyping and produced the manuscriptCCHC collected the multiplex family sample and participated in the design of the studyWK participated in genotypingAD participated in genotypingAM participated in genotypingDC performed the linkage analysisHMDG conceived the study and participated in its design and coordinationAll authors read and approved the final manuscript"}
+{"text": "The analysis focused on developing models for four biomarkers of potential harm (BOPH): white blood cell count (WBC), 24 h urine 8-epi-prostaglandin FRandom Forest was used for initial variable selection and Multivariate Adaptive Regression Spline was used for developing the final statistical modelsThe analysis resulted in the generation of models that predict each of the BOPH as function of selected variables from the smokers and nonsmokers. The statistically significant variables in the models were: platelet count, hemoglobin, C-reactive protein, triglycerides, race and biomarkers of exposure to cigarette smoke for WBC (R-squared = 0.29); creatinine clearance, liver enzymes, weight, vitamin use and biomarkers of exposure for EPI8 (R-squared = 0.41); creatinine clearance, urine creatinine excretion, liver enzymes, use of Non-steroidal antiinflammatory drugs, vitamins and biomarkers of exposure for DEH11 (R-squared = 0.29); and triglycerides, weight, age, sex, alcohol consumption and biomarkers of exposure for HDL (R-squared = 0.39).Levels of WBC, EPI8, DEH11 and HDL were statistically associated with biomarkers of exposure to cigarette smoking and demographics and life style factors. All of the predictors togather explain 29%-41% of the variability in the BOPH. Commonle stress -13, urine stress ,13,14, ae stress .The Total Exposure Study (TES) was a stratified, cross-sectional, multi-center study in 3585 adult smokers and 1077 nonsmokers, designed with the primary objective of estimating the exposure to cigarette smoke constituents in a population of U.S. adult cigarette smokers . A seconThe TES study database contains data on biomarkers of potential harm, biomarkers of exposure (BOE), smoking history, medical history, concomitant medications, clinical laboratory results, and demographics for 3585 adult smokers and 1077 non-smokers. Details about the study have been previously reported ,17. The In the data mining, variables were selected based on their scientific relevance to the targeted biomarkers of potential harm. Table Separate imputed data mining data sets were constructed for each BOPH. In these data sets, cases were dropped if the value of the dependant variable was missing; values for predictor variables were imputed using methods that are described below. In addition, an unimputed data mining data set was constructed. No cases were dropped from the unimputed data sets and no imputation of missing values was performed on it. The data mining data sets were randomly divided into analysis and validation data sets using an 80/20 split.The Random Forest procedure -20, a daStarting with the large, medium and small predictor sets selected by the Random Forests procedure, the MARS algorithm  was usedIn our study, the large, medium, and small predictor variable sets were augmented by adding all nine BOE and a binary indicator of smoking status. Finally, when ordinal categorical variables appeared in any of the predictor sets, they were replaced with appropriately chosen ordinal dummy variables. Starting with the modified large, medium and small predictor sets, exploratory MARS models were fit for a variety of model types, settings for the number of initial basis functions and penalties for adding new variables.In order to evaluate the appropriateness of the model, MARS uses generalized cross-validation (GCV) which is residual square errors penalized by a function related to complexity of the model . The numFinal MARS runs were performed using exact variable searches (SPEED = 1), three model types , 4 values for the number of initial basis functions , and 2 values for a penalty term for adding new variables . As before, a 10-fold cross-validation was used to estimate the cross-validated (or GCV) R-squared statistic. For each BOPH and predictor set, GCV R-squared, the number of final model parameters, and the number of final model variables were plotted against all other MARS control parameters. These plots (not included in this manuscript) were examined and a preferred model was selected for each BOPH and each study population. Models were preferred if they fit the data well  and parsimonious (i.e. had few predictors).Using the imputed analysis data sets the MARS procedure was used to fit models to each of the four BOPH using large, medium, and small predictor sets obtained in Random Forests. This procedure produced closed-form linear regression models that display explanatory power comparable to the best Random Forest models. For each of the four BOPH, a preferred MARS model was selected from the MARS runs based on considerations of goodness of fit and parsimony. The selected models were applied and refit in S-PLUS using the validation data set . GraphicVariable importance plots were provided for each BOPH. The marginal R-squared value for a group of predictor variables is the proportion of variance of the dependent variable explained by the group of predictor variables. The delta R-squared for a group of predictor variables is the difference between the marginal R-squared value for the full set of dependent variables and the marginal R-squared value for the full set of predictor variables with the specified group removed. The marginal R-squared is a measure of the quality of prediction obtained from a group of predictor variables acting alone, and the delta R-square is a measure of the improvement in the quality of prediction obtained when a group of predictor variables is added to the other predictor variables in the model.In general, missing data were present in the data set, but rare. In the data mining analysis, it was deemed prudent to impute missing data. Missing continuous variables were imputed in MARS and Random Forest Analyses by replacing missing observations with the median of non-missing cases for each variable: this was done separately for smokers and non-smokers, and for validation and analysis datasets. Imputation was carried out on predictor variables only, cases with missing dependant variables were dropped, not imputed, in the MARS and Random Forest analyses.Final regression models were fit to data sets in which no imputation was used on any variable, i.e. cases with missing dependant or predictor variables were dropped from the analysis and the number of cases dropped was noted in the regression output. In general, final regression results seemed little changed between imputed and unimputed datasets.For categorical variables, missing data were handled by adding an additional category as indicated in the following section. This approach does not depend on any assumptions about the sources of missing data and we do not regard it as a form of imputation.Below the lower limit of quantification (BLLOQ) flags were present in the data set for 9 variables of exposure . If a BLLOQ flag is positive for any of these variables and if the variable itself has a missing value, the value of the affected variable is set to 0. Non-missing value variables BLLOQ values with flags were left unchanged.The Random Forest and the MARS procedure are both designed to find optimal transformations of predictor variables. This minimized the need to perform variable transformations manually. Nonetheless a number of variable transformations were applied to a number of variables. In particular, character variables were transformed to dummy variable. A variable for creatinine clearance was also created. Initial random forest runs found some categorical variables that had natural ordinal interpretations: these variables were replaced with sets of ordinal dummy variables in the MARS and final regression analyses.Table Variable names in final regression models will be of one of the following forms1. <v.name>2. <v.name>.EQ.xxx, <v.name>.GT.xxx, <v.name>.LT.xxx, <v.name>.GE.xxx, <v.name>.LE.xxx3. <v.name>.IFLT.xxx, <v.name>.IFGT.xxxHere, <v.name> is the short name of a variable from Table Using this notation, regression coefficients can be interpreted as slopes. Positive slopes indicate that the dependent variable increases as the predictor variable increases and negative slopes indicate that the dependant variable decreases as the predictor variable increases. Variables of Form 3 are called transformations of the original variable and are thought of as the result of applying a function (or transformation) to the original variable. Other commonly used transformations that do not appear in our regression output are square root, power, and log transformations.Collectively, interactions and variables of forms 1, 2, and 3 are called basis functions. The MARS procedure, to be discussed below, may be thought of as a procedure for selecting an optimal set of basis functions that are to be used as the predictor of a given dependent variable. The basis functions used by MARS differ slightly from the basis functions described here. We have chosen to use the basis functions as described here in preference to those used by MARS, because the former seem easier to interpret.Tables The model for DEH11 contains predictors COTIN, UCRCAL, CRCL, AST, ALKPH, NSAID, and VITAMIN Table . The modepi-ProstaglandinF2\u03b1 Type III. Higher serum AST was either a predictor of higher or lower 24-hour excretion of urinary 8-epi-ProstaglandinF2\u03b1 Type III, depending on its concentration level. Use of vitamin supplements was a predictor of lower 24-hour excretion of urinary 8-epi-ProstaglandinF2\u03b1 Type III. In the validation data set the same predictors were significant with the exception of AST.The model for EPI8 contains predictors TOTNN, OHP, CRCL, AST, WEIGHTK, and VITAMIN and it accounts for 41% of the total variability in EPI8 in all subjects Table . Higher The model for WBC in all subjects contains predictors TOTNN, CRP, PLATE, HGB, TRIG, and RACE Table . The modThe model for HDL in all subjects contains predictors COTIN, TRIG, WEIGHTK, HGB, AGE, SEX, and ALCOHOL CONSUMPTION Table . The modTable The primary purpose of this analysis was to explore the quantitative associations of biomarkers of exposure and other variables with biomarkers of potential harm related to cigarette smoking. We examined the covariates (or secondary variables) to see whether they could mediate or modulate the effect of biomarkers of exposure. In pursuing this, we developed a systematic approach to the mining of a complex biomarker database. This approach helped us find interpretable linear models that could explain a substantial proportion of the variability for all four of the biomarkers of potential harm . These regression models summarize the information originally contained in 169 variables.We began by applying a general purpose data mining procedure (Random Forest) to find a list of important variables that could plausibly affect the chosen dependant variables and black box models that relate these variables to the four BOPH. Results from the Random Forest procedure were used as a starting point for the MARS algorithm which produced the multiple regression models. The regression models found by MARS were then applied and refit to a validation data set in SPLUS. It is remarkable that  of the new predictor with the remaining predictor(s). COTIN or TOTNN is included in the final model because its contribution and that from other existing predictors accounts for a larger variability in DEH11 and EPI8 than smoking status or nicotine equivalents. On the other hand, the contribution of smoking status or nicotine equivalents is most likely already captured by COTIN or TOTNN and other variables in the model.As shown in Figure The variables TRIG, SEX, WEIGHTK and ALCOHOL CONSUMPTION are all more important predictors of HDL than is the BOE COTIN. The situation is somewhat different for WBC, where the BOE TOTNN appears as the most important predictor, followed by the variables PLATE and CRP.The model for WBC contains the following predictors: TOTNN, CRP, PLATE, HGB, TRIG, and RACE. The model reflects some well known factors influencing WBC, such as smoking, race and inflammation. The model also indicates a relationship with other hematologic variables such as platelets and red blood cells. Metabolic factors are also known to impact WBC .The model for EPI8 contains the following predictors: TOTNN, OHP, CRCL, AST, WEIGHTK, and VITAMIN. The model suggests that kidney function and body mass are related to the excretion of this biomarker in urine. Exposure to cigarette smoke is thought to increases oxidative stress -13, wherThe model for DEH11 contains the following predictors: COTIN, UCRCAL, CRCL, AST, ALKPH, NSAID, and VITAMIN. The model suggests that kidney function and muscle mass are related to the excretion of this biomarker in urine. Exposure to cigarette smoke increases platelet activation, whereas use of non-steroidal anti-inflammatory drugs, e.g. aspirin and vitamin consumption decrease platelet activation . The relThe model for HDL contains COTIN, TRIG, WEIGHTK, AGE, SEX, and ALCOHOL CONSUMPTION. It suggests that bodyweight and male gender impact HDL negatively, whereas older age, female sex and regular alcohol consumption have a positive effect on HDL cholesterol. Higher triglycerides is generally associated with lower HDL cholesterol .In summary, levels of WBC, EPI8, DEH11 and HDL were statistically significantly related to biomarkers of exposure to cigarette smoking, demographics and life style factors. The statistical models successfully captured a large amount of variability in the biomarkers and depicted the important biological relationships between the biomarker and the effects. Considering the numerous potential sources of variability for the 4 biomarkers and their complex relationships, the R-squared values of 29% to 41% are significant.The abbreviations of all model variables are listed in Table All authors except JHW are or were employees of Philip Morris USA Inc./Altria Client Services Inc. JHW was an employee of Pharsight Corporation when he was conducting the modeling for this paper. Pharsight Corporation received funding from Philip Morris USA for the modeling.JHW contributed as the primary modeler. He carried out the statistical modeling and participated in developing the manuscript. QL contributed as the corresponding author of the manuscript. He participated in developing the models and finalized the manuscript. MS participated in developing the manuscript. PEM participated in developing the manuscript. HJR initiated the project and participated in developing the models and the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/10/19/prepub"}
+{"text": "These results indicated that silencing the expression of adenosine A2b receptor in HepG2 cells can suppress cell growth effectively by blocking the cell cycle. Downregulation of adenosine A2b receptor gene expression with RNA interference could be a new approach to hepatocellular carcinoma therapy.To investigate the biological effect of adenosine A2b receptor (A2bR) on the human hepatocellular carcinoma cell line HepG2, three A2bR siRNA constructs were transiently transfected into HepG2 cells. The results showed that A2bR siRNA reduced the levels of A2bR mRNA and protein. In order to further detect the function of A2bR, we established a stable hepatocellular carcinoma cell line (HepG2) expressing siRNA targeting the adenosine A2b receptor. Targeted RNAi significantly inhibited tumor cell growth  Recently, Spychala discovered that activation of adenosine receptors may be involved in tumor progression [Adenosine is an intermediate product of adenine nucleotide metabolism. In many organs, adenosine is released into the extracellular space when the oxygen supply is decreased or energy consumption is increased , 2. In pgression . In a previous study, we collected 64 samples of hepatocellular carcinoma from clinical patients and found that A2b receptors were highly expressed in tumor tissue and expressed in peritumoral tissues to a lesser extent by real-time PCR, Western blot, and immunohistochemical staining. These results indicate that the A2b receptor may contribute to hepatic tumor progression and may represent a good therapeutic target .In recent years, RNA interference (RNAi) has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer . In thisHind III/BamH I) vector (Ambion) which contains the human H1 promoter and neomycin resistance gene to enable antibiotic selection in mammalian cells. Three pairs of complementary oligonucleotides  were synthesized, targeting adenosine A2b receptor cDNA (GenBank: NM_000676\uff1bCDS 333\u20131331) at nucleotides 591\u2013610, 856\u2013875, and 909\u2013928, respectively. The oligonucleotides encoding the human adenosine A2b receptor shRNA targeting the adenosine A2b receptor were as follows (http://www.ambion.com/techlib/resources/RNAi/index.html). Our vector is based on the pSilencer 3.1-H1 neo  encoding a shRNA contained a sequence not present in the mouse, human, or rat genome databases. The sequence was as follows. 5\u2032-GATCCAGTTCAACGACCAGTAGTCTTCAAGAGAGACTACTGGTCGTTGAACTTTTTTTGGAAA-3\u2032 and 5\u2032-AGCTTTTCCAAAAAAAGTTCAACGACCAGTAGTCTCTCTTGAAGACTACTGGTCGTTGAACTG-3\u2032.2 at 37\u00b0C. Cells were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions with 8\u2009\u03bcg pSilencer 3.1-H1 neo-mix  and pSilencer-3.1-Y. One day after transfection, cells were screened in medium containing G418 (0.4\u2009mg/mL) and resistant clones were maintained in medium containing 0.4\u2009mg/mL G418. Stably transfected cells were plated in 60-mm dishes (1.5 \u00d7 106 per dish). The results were observed under the microscope.HepG2 cells were cultured in Dulbecco's modified Eagle's medium , supplemented with 10% heat-inactivated FBS in a humidified incubator with 5% CO\u03b2-actin . Each PCR reaction was performed using an optimized number of cycles (25 cycles) of 94\u00b0C for 1 minute, 56\u00b0C for 30 seconds, and 72\u00b0C for 40 seconds, with a final extension of 72\u00b0C for 7 minutes. The PCR reactions were visualized on a 1.2% agarose gel containing 5\u2009\u03bcg/mL of ethidium bromide. Intensity of the DNA bands was analyzed by Glyko BandScan Analysis software, using \u03b2-actin as an internal standard.The treated cells were trypsinized and then centrifuged for 2 minutes at 12,000\u2009rpm at 4\u00b0C. Cell pellets were washed with PBS, collected, and lysed with TRIzol reagent (Gibco). Total RNA was isolated by phenol/chloroform extraction, isopropanol precipitation, and 75% ethyl alcohol wash and dissolved in DEPC water. The reverse transcription reaction was set up according to Promega's Reverse Transcription System protocol using primers for the A2b receptor  and \u03bcL of RIPA lysis buffer (0.05\u2009M Tris-HCl (pH 7.4), 0.15\u2009M NaCl, 0.25% deoxycholic acid, 1% NP-40, and 1\u2009mM EDTA) containing protease inhibitors . Protein concentration was measured , and samples were resolved by reducing SDS-PAGE, transferred to nitrocellulose, and incubated in blocking buffer . Membranes were incubated with an antibody to the adenosine A2b receptor  at 4\u00b0C overnight. The membranes were washed in blocking solution and incubated with an HRP-conjugated secondary antibody for 1 hour at room temperature. Detection was performed using the Pierce chemiluminescence HRP substrate according to manufacturer's instructions. Blots were exposed to X-ray film for the appropriate time period.Cell monolayers in six-well culture plates were washed twice with ice-cold PBS and lysed with 150\u20092 cells/well were suspended in complete medium containing 0.3% agarose (Gibco) and seeded in triplicate in six-well plates onto a bottom layer of complete medium containing 0.6% agarose. The plates were cultured for 14 days. Colonies were counted after methanol fixation and Giemsa staining.A total of 2 \u00d7 10A total of 50,000 cells were used for fluorescence-activated cell sorter analysis (FACS). Briefly, the cells were harvested, washed twice with PBS buffer, and then incubated at room temperature for 45 minutes. After two PBS washes, the cells were resuspended in PBS and filtered through Spectra Mesh filters (Spectrum). Data were analyzed by CellQuest software (Becton-Dickinson) and the ModFit/LT software. At total of 20,000 events were acquired from every sample.t-test.HepG2 cells were passed into 96-well plates  24 hours after transfection. Viability and proliferation of cells were measured using MTT assays from the second until the seventh day after passage. For each group, 6 wells were measured every day. Experiments were carried out a total of three times, and the difference in average OD (490\u2009nm) between treated groups was compared using the unpaired, two-tailed t-test for paired or independent samples. Results were expressed as mean \u00b1 standard error (SE). Values with P < 0.05 were considered significant.Statistical analyses were performed with SPSS11.0 software. Significance was evaluated by Student's Hind III/BamH I) vector to construct four interfering vectors: pSilencer3.1-H1 neo-1, pSilencer3.1-H1 neo-2, pSilencer3.1-H1 neo-3, and pSilencer3.1-H1 neo-Y. Plasmids were verified by sequencing  and pSilencer3.1-H1 neo-Y (as control) into the HepG2 cell line. RT- PCR showed that transfection of mixed vector could decrease the A2b receptor mRNA about 66% \u00b1 5%, while pSilencer3.1-H1 neo-Y had no effect . Western blot analysis of A2b receptor was comparable to the RT-PCR results . Cells tTo assay the potential role of A2b receptor, HepG2 cells were stably transfected. MTT assays were used to investigate anchorage-dependent growth rates. Equal amounts of control vector pSilencer3.1-neo-Y were transfected into HepG2 cell lines. Untransfected cells were used as an additional control. After seven days in culture, we compared the proliferation rate of the three groups of cells. A significant difference was observed after five days in culture. The cells transfected with pSilencer3.1-neo-mix showed a significant decrease in the proliferation rate after five days in culture. However, cells transfected with pSilencer3.1-neo-Y and untransfected cells had similar proliferation rates . P < 0.05) . In contrast, stably transfected cells showed a decreased colony forming ability of 60.33 \u00b1 9.6% compared with HepG2 cells . Significant advances have been made in the understanding of the molecular pharmacology and physiological relevance of adenosine receptors, but little is known about A2b receptors. A2b receptors have been implicated in mast cell activation  and asthCaenorhabditis elegans and Drosophila melanogaster [RNA interference (RNAi) is a natural silencing process first described in nogaster  by whichnogaster . Specifinogaster , 27 or anogaster . RNAi tenogaster , 30 and nogaster , 32. RNAnogaster \u201335. RNAinogaster .In this study, we constructed three RNAi vectors which target the A2b receptor gene to investigate if silencing can convert the tumor phenotype. First, the mixed plasmid constructs were transiently transfected into HepG2 cells. As shown by RT-PCR and Western blot, transfected cells showed specific silencing of the A2b receptor gene without interrupting other molecular interactions. A stably transfected HepG2 cell line which silences the expression of A2b receptors was constructed to observe any changes in phenotype. MTT and soft agar assays show that the proliferation rate of the stably transfected cells was significantly decreased compared with control-transfected or untransfected HepG2 cells. FCM experiments revealed that 89.56 \u00b1 3.15% of stably transfected cells were in the G1 phase. Taken together, these results show that RNAi silencing of the A2b receptor gene alters the phenotype of HepG2 cells, and this method might lead to development of novel therapies for the human hepatocellular carcinoma."}
+{"text": "In the crystal, pairs of N\u2014H\u22efN hydrogen bonds link molecules into inversion dimers featuring R22(8) graph-set motifs.In the title mol\u00adecule, C \u00c5b = 12.5553 (9) \u00c5c = 13.3705 (11) \u00c5\u03b1 = 68.321 (7)\u00b0\u03b2 = 83.678 (6)\u00b0\u03b3 = 78.567 (6)\u00b0V = 1079.04 (13) \u00c53Z = 2K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 293 K0.30 \u00d7 0.20 \u00d7 0.20 mmOxford Diffraction Xcalibur Sapphire3 diffractometerCrysAlis RED; Oxford Diffraction, 2010Tmin = 0.874, Tmax = 1.000Absorption correction: multi-scan (7584 measured reflections4233 independent reflectionsI > 2\u03c3(I)2679 reflections with Rint = 0.023R[F2 > 2\u03c3(F2)] = 0.047wR(F2) = 0.121S = 1.014233 reflections286 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.19 e \u00c5\u22123\u0394\u03c1min = \u22120.15 e \u00c5\u22123\u0394\u03c1CrysAlis PRO  used to solve structure: SHELXS97  I, New_Global_Publ_Block. DOI: 10.1107/S1600536814003821/lh5692Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536814003821/lh5692Isup3.cmlSupporting information file. DOI: CCDC reference:  crystallographic information; 3D view; checkCIF reportAdditional supporting information:"}
+{"text": "Accounts of altered eating behavior in semantic dementia generally emphasize gluttony and abnormal food preferences. Here we describe two female patients with no past history of eating disorders who developed early prominent aversion to food in the context of an otherwise typical semantic dementia syndrome. One patient (aged 57) presented features in line with anorexia nervosa while the second patient (aged 58) presented with a syndrome more suggestive of bulimia nervosa. These cases add to the growing spectrum of apparently dichotomous behavior patterns in the frontotemporal dementias and illustrate a potentially under-recognized cause of eating disorders presenting in later life. Altered food preferences and abnormal eating behaviors are often early and prominent symptoms of the frontotemporal lobar degenerations (FTLD). Eating abnormalities are a defining feature of the behavioral variant of frontotemporal dementia as reflected in current diagnostic criteria for this syndrome , making a diagnosis of underlying Alzheimer\u2019s disease pathology unlikely.Brain MRI  showed bThough she had always been regarded by her family as fastidious in her culinary habits there was no history of an eating disorder in her earlier life. Around 10\u00a0years previously, she had begun to complain of nausea and anorexia for which no cause was identified. Her food intake diminished and her weight decreased from around nine to approximately seven stone over a period of months. She became obsessed that she was overweight and that her abdominal girth was increasing and her family were unable to dissuade her of this. To their concern and perplexity, she spontaneously placed herself on a rigid and restrictive diet consisting almost exclusively of soy milk, raspberries, and porridge. She did not develop any predilection for sweets or carbohydrates. However, having been a lifelong teetotaller, she began consuming alcohol in modest quantities. Though her weight stabilized, this unusual dietary pattern continued over several years prior to her presenting to our service.This 58-year-old right-handed retired hairdresser presented with a 5-year history of progressive deterioration of language skills, initially noted to affect spelling followed by impaired comprehension of speech and reading material. She had asked family members the meaning of words such as \u201ccholesterol\u201d and \u201cepilepsy\u201d while attempting to read the newspaper. For around 2 years she had had increasing difficulty recognizing faces of acquaintances and celebrities. She was forced to stop work as she was not able to carry out clients\u2019 instructions reliably, though she remained able to use credit cards and managed her own grocery shopping. She became less empathic toward her family, more outspoken toward strangers, made extravagant purchases, and exhibited markedly heightened interest in all kinds of music. She had been diagnosed with Raynaud\u2019s phenomenon but had no other medical history of note nor any known family history of dementia or psychiatric illness.Neuropsychological assessment  confirmeBrain MRI  showed fHer family reported that she had always been interested in \u201chealthy eating\u201d, but identified a clear change in her eating behavior, in that she had become obsessed with her weight and body image, frequently complaining that she was overweight . This was regarded by her family as highly uncharacteristic and a source of considerable concern; however, the behavior had intensified over several years. She became increasingly rigid when planning meals, stringently avoiding foods she considered high in calories in favor of a narrow repertoire of low-fat supermarket ready meals. She would become distressed if encouraged to broaden this repertoire. She talked continually about food and meals and frequently bought her children gifts of sweet foods. At the same time, she began periodically to binge on sweets, often attempting to hide this from others, and would seek out sweets that other family members had hidden from her. She began regularly to use a personal \u201cfat-vibrating\u201d machine, around four times a day and particularly after episodes of bingeing. This behavior led to difficulties at work, where she had been found secluded in the toilet bingeing on sweets. Attempted interventions by her family and a trial of fluoxetine were unsuccessful in controlling the behaviors.These patients developed various symptoms of aversion to food in the context of an otherwise typical syndrome of semantic dementia. Comparing their symptoms against current DSM-5 criteria for eating disorders (American Psychiatric Association, Detailed analyses of eating behaviors in patients with FTLD suggest that aversion to food is not uncommon. Despite this, food aversion has received little attention in the extensive literature devoted to eating abnormalities in semantic dementia and FTLD. In one series (Ikeda et al., Although direct neuroanatomical correlation was not possible for the present cases, focal anterior temporal lobe atrophy is a plausible candidate substrate for the spectrum of eating abnormalities these patients exhibit. Binge eating, hyperphagia, and pathological sweet tooth have previously been linked to disintegration of a fronto-insular, anterior temporal and mesolimbic neural network in FTLD (Whitwell et al., The burden of anorexia in older populations is difficult to assess accurately but it is likely to be substantial and to have been underestimated (Donini et al., Based on the case histories presented here, we argue that diseases in the FTLD spectrum should be considered in older people with anorexia and other eating disorders, particularly where accompanied by prominent cognitive, behavioral, or social dysfunction. From a neurobiological perspective, we hope these cases will motivate further systematic analyses of the eating behavior profile of FTLD in larger patient cohorts, ideally with longitudinal assessments and structural and functional neuroimaging, metabolic and neurohormonal correlation. From a broader clinical perspective, environmental modification strategies and medications that modulate central reward and satiety circuitry are potential avenues to manage eating disorders in the setting of neurodegenerative disease (McDaniel, Hunt, Hackes, & Pope,"}
+{"text": "Identifying viral sequences in mixed metagenomes containing both viral and host contigs is a critical first step in analyzing the viral component of samples. Current tools for distinguishing prokaryotic virus and host contigs primarily use gene-based similarity approaches. Such approaches can significantly limit results especially for short contigs that have few predicted proteins or lack proteins with similarity to previously known viruses.k-mer frequency based, machine learning method for virus contig identification that entirely avoids gene-based similarity searches. VirFinder instead identifies viral sequences based on our empirical observation that viruses and hosts have discernibly different k-mer signatures. VirFinder\u2019s performance in correctly identifying viral sequences was tested by training its machine learning model on sequences from host and viral genomes sequenced before 1 January 2014 and evaluating on sequences obtained after 1 January 2014.We have developed VirFinder, the first Veillonella genus prophage associated with cirrhosis patients.VirFinder had significantly better rates of identifying true viral contigs (true positive rates (TPRs)) than VirSorter, the current state-of-the-art gene-based virus classification tool, when evaluated with either contigs subsampled from complete genomes or assembled from a simulated human gut metagenome. For example, for contigs subsampled from complete genomes, VirFinder had 78-, 2.4-, and 1.8-fold higher TPRs than VirSorter for 1, 3, and 5\u00a0kb contigs, respectively, at the same false positive rates as VirSorter , thus VirFinder works considerably better for small contigs than VirSorter. VirFinder furthermore identified several recently sequenced virus genomes (after 1 January 2014) that VirSorter did not and that have no nucleotide similarity to previously sequenced viruses, demonstrating VirFinder\u2019s potential advantage in identifying novel viral sequences. Application of VirFinder to a set of human gut metagenomes from healthy and liver cirrhosis patients reveals higher viral diversity in healthy individuals than cirrhosis patients. We also identified contig bins containing crAssphage-like contigs with higher abundance in healthy patients and a putative k-mer based tool complements gene-based approaches and will significantly improve prokaryotic viral sequence identification, especially for metagenomic-based studies of viral ecology.This innovative The online version of this article (doi:10.1186/s40168-017-0283-5) contains supplementary material, which is available to authorized users. For exaaryotes) . In aquaaryotes) .However, our understanding of virus-host interactions for large portions of viral communities has been limited due to the difficulties of using traditional virus isolation techniques, especially for those that infect uncultivable hosts. Isolation approaches have to date only yielded a small portion of known viral diversity\u2013viruses have been isolated on less than 15% of known phyla of prokaryotic hosts (based on data in ). While k-mers to further increase the detection accuracy. These prophage detectors are not well suited for identifying viral sequences from assembled metagenomic data, because most assembled contigs are short, fragmented contigs and possess few or no complete predicted genes. Additionally, most of these prophage predictors are not optimized to process large numbers of contigs in a reasonable time . Tools for identifying proviruses from within prokaryotic genomes were first developed before the metagenomic era. While identifying proviruses is a different problem than finding viral sequences within mixed metagenomic samples, provirus finding tools laid the groundwork for current approaches and in general use the same principles used in current metagenomic tools. These provirus finding programs include Phage_Finder , Prophinime (see ), the exime  regardless of coding and non-coding regions, have been used with great success for many sequence discrimination and classification applications. Several k-mer based tools, including Glimmer [k-mers to identify bacterial genes from mixed samples containing eukaryotic sequences [k-mer frequencies [k-mers to index genomic sequences and speed up sequence comparison for taxonomically assignment of prokaryotic metagenomic sequences [k-mers from the whole sequence, coding or not, and then build a classification model based on the distribution of k-mers. Since no gene finding or gene similarity comparisons are needed, these methods can have superior performance for short sequences that have only a few or incomplete genes. The use of discretized k-mer patterns also avoids the reliance on hallmark genes or alignment to known viruses. Finally, if viruses universally use some k-mer patterns distinct from prokaryotes, then word-based methods may be more powerful in identifying novel viruses that are distantly related to currently known viruses and lack homologous sequences at the gene level.Sequence signature methods provide a promising and wholly different new avenue for improved identification of viral contigs. Characterization of sequences using frequencies of  Glimmer , Phymm [ Glimmer , PhyloPy Glimmer , Kraken  Glimmer , CLARK [ Glimmer , k-SLAM  Glimmer  exist foequences , and Phyequences . PhyloPyquencies . Moreoveequences \u201328. In gk-mer based tool for viral sequence was inspired during development of another tool, VirHostMatcher [k-mer frequency similarities. We and others have shown that viruses often share higher similarity in k-mer patterns with its specific host than with random hosts [k-mer similarity . In thek-mer based program for identifying prokaryotic viral sequences from metagenomic data. VirFinder uses machine learning methods to identify sequence signatures that distinguish viral sequences from host sequences, and as a result, constructs a scoring system to predict viral sequences based on sequence signatures. We have evaluated VirFinder for its performance in detecting viral sequences over a range of short (500\u00a0bp) to long \u2265\u20093000\u00a0bp sizes, including novel viruses. VirFinder exhibits improved performance over VirSorter in correctly identifying novel viruses, especially for short (1000\u00a0bp) contigs. VirFinder was applied to find and analyze viral sequences in human gut metagenomic data from healthy and liver cirrhosis patients. Diseased patients exhibited lower viral diversity, and 15 viral contig bins could be used to predict the disease status of liver cirrhosis with high statistical power, demonstrating the potential use of metagenomic viral diversity in the diagnosis of human disease states. VirFinder is available at https://github.com/jessieren/VirFinder.In this paper, we have developed VirFinder, to our knowledge, the first L = 500, 1000, 3000, 5000, and 10,000 bp, and the same number of non-overlapping fragments were randomly subsampled from the prokaryotic genomes , we calculated and plotted the fraction of true viral contigs that were correctly called as viral or the true positive rate (TPR) and the fraction of prokaryotic contigs that were incorrectly called as viral or the false positive rate (FPR). The area under the curve of these ROC curves (AUROC) was used to evaluate performance whereby high values indicate good performance. A score of 1 represents perfect identification of all true viral contigs with no false positives, and a score of 0.5 represents a random classification. For VirFinder, AUC values and thus performance increased as k-mer length increased . Overall, these high AUROC scores demonstrate the strong ability of our VirFinder tool to correctly identify newly obtained viral sequences.After training the model, VirFinder was evaluated on equal numbers of viral and host contigs subsampled from genomes sequenced after 1 January 2014. To evaluate VirFinder\u2019s performance, we used receiver operating characteristic (ROC) curves typically used to evaluate performance of classifiers. ROC curves were generated by setting a score threshold and calling contigs as viral if their scores were above that threshold. Over a range of incrementally decreasing thresholds  between different fractions of viral mixtures . The relatively large standard errors of TPRs were primarily due to the large range of FPRs from VirSorter\u2019s results and thus the subsequent determinations of VirFinder\u2019s TPRs. Note that for 500\u00a0bp contigs, VirSorter made no predictions so its FPR and TPR were both 0. VirFinder correctly identified 944 contigs as viral (TPR\u2009=\u20091.9%) at 0 FPR in this case. VirFinder correctly identified 78, 2.4, 1.8, and 1.2 times more viral contigs than VirSorter for 1000, 3000, 5000, and 10000\u00a0bp, respectively  and virus-enriched . At all contig lengths and both viral fractions, VirFinder\u2019s TPR exceeded that of VirSorter  , and we paid particular attention to 45 viruses (13%) that had no significant nucleotide similarity  to previously viral genome sequences, which we used as a proxy for what we refer to as novel viruses. Using a p value cutoff of 0.01 for VirFinder predictions and category I and II VirSorter predictions, VirFinder and VirSorter both predicted most of the viruses , and 3 were not predicted by either  and the hosts of that taxon group from the training dataset and then predicting those viruses from among mixed sets of subsampled virus and host contigs. As above, predictions were made on 30 replicate datasets with equal numbers of total host and viral contigs. Prediction results of the selected viruses that were excluded from the training set were assessed with AUROC values and compared to control results of predictions made for all other viral contigs using that same trained version of VirFinder Fig.\u00a0. AUROC s>0.9, and increased with increasing contig length. For 1000\u20133000 and \u22653000\u00a0bp contigs, the AUROC scores were as high as 0.94 and 0.98, respectively . VirSorter identified almost no viral contigs of 500\u20131000\u00a0bp viral contigs at the 3 category combinations used  . At the same FPRs levels as VirSorter, VirFinder successfully identified 5.9, 5.9, and 6.0% true 500\u20131000\u00a0bp viral contigs for the 3 VirSorter category combinations, respectively, which are undefined (VirSorter TPR was 0%), 30 and 13 times higher than VirSorter\u2019s TPRs. For contig lengths 1000\u20133000 and >3000\u00a0bp, both methods had higher TPRs. VirSorter\u2019s TPRs were 2.5 and 19% for 1000\u20133000 and >3000\u00a0bp, respectively, using categories I and II. At the same controlled FPR, VirFinder\u2019s had TPRs of 7.4 and 67%, or 3.0 and 3.5 times higher than VirSorter\u2019s TPRs.VirFinder and VirSorter\u2019s TPRs were next compared using assembled contigs from simulated 20 million read metagenomes. TPRs were compared at the same FPRs levels as found for VirSorter considering various VirSorter category results . VirFinder correctly identified more viral contigs than VirSorter at all ranges of contig lengths and for all three combinations of VirSorter categories used when tested with samples with equal numbers of viral and host contigs Fig.\u00a0. As befop\u2009\u2264\u200910\u20133)  method [Reads from 40 healthy and 38 liver cirrhosis patients, comprising 316\u00a0Gb of total sequence data were cross-assembled. Only the resulting 325,020 contigs that were >1000\u00a0bp in length were retained to achieve high prediction accuracy. The majority (76%) of contigs were 1000\u20133000\u00a0bp long  method , 38.k-mer frequencies and abundance patterns across samples to group similar contigs. This produced 86 and 116 bins for VirSorter and VirFinder contigs, respectively. The abundance profiles of contig bins across 78 samples of health and diseased patients were used to train classification models to distinguish health status. The logistic regression model with lasso regularization was used in order to enhance the prediction accuracy and interpretability. These models were then tested on an independent set of 230 samples from the same study [Contigs were binned using COCACOLA  based onme study  using ROE value <1e\u221210 for \u2265100\u00a0bp). It has recently been suggested that virus species distinguish from each other by ~95% nucleotide identity [E value <1e\u221210 for \u2265100\u00a0bp), such that 17% of the bins had no contigs with any significant similarity to nucleotide sequences in this database. For blastp searches, only 8% of contigs did not contain any predicted encoded protein with significant similarity  to any protein in the nr database. This translated to all but two bins that had at least one protein with significant similarity to a previously reported protein sequences. These 2 bins were comprised of 1 short contig each, 1119 and 1182\u00a0bp, with 1 and 3 predicted proteins on those contigs, respectively. We also note that, of 2657 contigs, ~10% had at least 1 protein for which its best hit to nr was a viral protein or has significant similarity to a viral Pfram domain. This resulted in 57% of bins having at least 1 viral protein, supporting that these binned contigs indeed are viral sequences.Similarity searches of contigs and their predicted proteins against NCBI\u2019s non-redundant nucleotide (nt) or protein (nr) databases were conducted to determine if contigs and bins do not have any similarity to previously known sequences and thus potentially represent novel viral sequences. Searches against nt and nr assessed if contigs are closely or distantly related to known sequences, respectively. Only 12% of contigs were \u226595% similar to another bacterial or viral sequence in the nt database (requiring an identity  thus thep\u2009<\u20090.001), while there was no difference for cluster 1  .Hierarchical clustering was used to cluster contig bins and patient samples  according to the relative abundance of bins , even when evaluated separately using the 3 different groups of viral bins.Except for two outlier samples (in grey) for which few bins were detected, samples clustered into three major groups , and the A and B groups contained two coherent subgroups each , suggesting that it is a lysogenic phage that is stably maintained in the host as a replicating plasmid like P1 phage [Veillonella, strongly suggesting that this viral contig occurs as a prophage in this genus. A recent analysis of the Qin et al. dataset also found that host sequences of the genus Veillonella were more abundant in cirrhosis patients [Using the lasso regularization method for variable selection , 42, we P1 phage . Four otpatients , consistk-mer frequencies to accurately identify viral contigs. To our knowledge, VirFinder represents the first virus identification tool that solely uses a nucleotide k-mer frequency based approach and stands in contrast to previous methods that primarily use similarity searches of predicted genes to known viral sequences . We do note that PhiSpy uses AT and GC skew, a coarse form of k-mer analysis, for prediction, but this is one of several search criteria PhiSpy uses. VirFinder adds to the growing number of recently developed tools that use powerful, alignment-free k-mer frequency approaches to rapidly categorize and/or analyze the similarity of sequence datasets [We have presented the development, validation, and application of VirFinder, a machine learning based tool that uses datasets , 44\u201349. k-mer patterns. We also attempted to use the support vector machine (SVM) with kernels, one of the most widely used non-linear classification methods, but it failed because the training sample size was too large  for the regular SVM to handle.VirFinder is trained using a logistic regression model with lasso regularization in order to enhance the prediction accuracy and interpretability. Other regularization methods such as ridge and elastic net had similar performance with no significant difference. We also tested a few other machine learning methods before selecting the logistic regression approach. Performance with a Na\u00efve Bayes classifier was worse than that of logistic regression (data not shown), possibly because of the violation of the independence assumptions for k-mer frequencies that allows it to extract predictive sequence informative without requiring the presence of specific hallmark genes on the query contig. VirFinder also provides a statistical framework to evaluate if the output score is significantly different from the distribution of host contig scores, which in turn can be used to estimate the false positive rate when selecting a particular VirFinder score threshold . Similarly, an additional benefit of our study is that we provide estimates of the false positive rates for VirSorter for contigs of various sizes, which was not extensively evaluated previously. Finally, VirFinder generates prediction scores that are static for each contig regardless of the other contigs being tested at the same time. VirSorter results in contrast are influenced by the particular collection of sequences being analyzed. This is because VirSorter first uses all contigs to estimate the background distributions for the various metrics it evaluates , and virus predictions are made by comparing individual contig values to these background distributions. Therefore, VirSorter results of individual contigs are not stable and are dependent on what other contigs are included in the query dataset.In side-by-side comparisons, VirFinder exhibited superior performance in terms of identifying true viral contigs when evaluated at the same false discovery rates as VirSorter, the current state-of-the-art, gene-based virus prediction tool. VirFinder in particular exhibited much better performance in virus identification for shorter contigs in part because VirSorter is limited to making predictions on contigs that have at least three coding genes. VirFinder\u2019s success is also probably due to its use of k-mer patterns also gives it a practical advantage over other gene-based methods when analyzing binned contigs. Recent binning methods have advanced analysis of assembled metagenomic contigs by grouping together fragmented contigs belonging to the same or closely related organisms with high fidelity based on tetramer frequencies and abundance patterns across multiple samples [VirFinder\u2019s reliance on  samples , 49, 50.k-mers specifically used by viruses. A helpful analogy is that viruses and hosts use the same \u201clanguage\u201d; the genetic code of nucleic acids, but the two have slightly different \u201caccents\u201d or \u201cdialects\u201d in their use of that code, which VirFinder is able to detect. While VirFinder clearly works well in practice, it will be interesting to understand in more detail, the evolutionary phenomena underpinning its success. VirFinder works in principle due to the reasonable underlying assumption that viruses and hosts use different k-mer patterns. While there were no individual k-mers identified that are unique to viruses or hosts, VirFinder\u2019s machine learning model instead uses the cumulative effect of slight differences in frequencies over many k-mers to distinguish virus and host sequences, and the cumulative frequencies of these k-mers are significantly different between viruses and hosts  sequences to detect the additive effect of many subtle differences in the frequencies of k-mer patterns that are universally shared across all viruses, or if it is more the case that distinct patterns exist for each larger group of viruses. The former appears to be the case at a broad level, as viruses exhibit slightly lower GC contents than host genomes [k-mers for predicting viruses are significantly more AT-rich (p\u2009<\u200910\u22124). It was previously hypothesized that the AT shift was due to the limited availability of G and C nucleotides and higher energetic costs imposed on viruses for utilizing these bases. Further examination of any discernable pattern among the informative k-mers could be instructive in understanding the evolutionary and mechanistic reasons for how and why viruses and hosts use k-mer space differently.In future studies, it will be interesting to determine if there are particular  genomes . We likek-mer usage patterns is true, this suggests that VirFinder could have a strong advantage in extending viral prediction to novel virus groups for which we have no sequences. This model is partly supported by results obtained when particular viruses were excluded from the training dataset  from the cirrhosis study have no significant nucleotide or protein similarity to known sequences, and the cirrhosis study recovered several contigs that appear to be variants of crAssphage that were not predicted by VirSorter . The process of \u201ccleaning\u201d such host genes from viral genomes is not trivial, but based on the results above, host genes in viral genomes likely do not significantly impact VirFinder\u2019s performance.The presence of host genes in the viral training set is potentially more problematic as this is predicted to inflate the FPR for viral prediction. False positives  should not be an issue for long contigs, but short contigs could potentially be called as viral if they contain a host gene that occurs as a horizontally transferred host gene in the viral training set. A prime example of such genes are auxiliary metabolic genes (AMGs) encoded in viruses that are acquired from their hosts and used to bolster the metabolism of the host for increased virion production \u201358. The bacteria \u201361. Hostclusters  and haveclusters , suggestnes from , VirFindZ\u2009=\u20091 if the contig is predicted as virus. Let the probability that the contig is a true viral sequence be P(V|Z\u2009=\u20091), where V denotes viruses and H denotes hosts. By the Bayes rule,It was observed that the balance of viral and host contigs can impact the magnitude of prediction performance. The reason for these differences can be explained using the simple Bayes rule. Suppose a contig is randomly picked from the testing dataset. Let P(V) and P(H) are the fractions of viral and host contigs, respectively. Here, P(Z\u2009=\u20091|V) is the probability that a virus can be correctly predicted and P(Z\u2009=\u20091|H) is the probability that a host is falsely predicted as virus. Both P(Z\u2009=\u20091|V) and P(Z\u2009=\u20091|H) do not depend on the ratio P(V) increases, the ratio P(V|Z\u2009=\u20091) increases. In fact, P(V|Z\u2009=\u20091) is equivalent to precision, the fraction of predicted viral contigs that are true [where are true . Therefore, PZ\u2009=\u2009|V is thek-mer and gene-based approaches, to make even better predictions. Case in point is the prediction of recently sequenced, novel virus genomes, whereby each method could uniquely identify virus genomes that the other could not . Since such shorter contigs typically dominate metagenomic assemblies, VirFinder will help greatly in expanding our knowledge of natural virus communities. Our example application of VirFinder to human gut microbiomes highlights its utility in identifying diagnostic differences in viral communities between healthy and diseased individuals. Since VirFinder can be broadly applied to any type of metagenomic sample, it will be invaluable in addressing a variety of questions in the ecology of natural viral communities across various habitats types . We also propose that VirFinder could be further implemented for identifying proviruses within large contigs, using a sliding window approach. Future integration of our k-mer based approach with previous gene-based tools, will further improve the accuracy and utility of virus prediction.Our development of an innovative L\u2009=\u2009500, 1000, 3000, 5000, and 10000\u00a0bp, viruses were split into non-overlapping fragments of length L and the same number of non-overlapping fragments of length L were randomly subsampled from the prokaryotic genomes. Fragments were generated for virus genomes discovered before 1 January 2014 and after 1 January 2014 and were separately used as training and testing sets, respectively  were selected for the analyses where viruses infecting these taxa were excluded from the training of VirFinder. For evaluation of the different trained VirFinder models, equal numbers of contigs of the excluded viruses and all other viruses were selected and then combined with randomly selected host contigs such that total virus and host contigs were equal in number.Highly represented host phyla  and genera  be the number of occurrences of the word w\u2009=\u2009w1w2\u2009\u2026\u2009wk and its complimentary word w to refer to the word patterns w and its compliment k\u2009=\u20094, only the 136 unique word pattern pairs are used. Based on sequence signatures, a binary classifier for identifying viral sequences was built. The classifier was trained using the training data and then was evaluated using the testing data.For a fragment sequence ed as in , 69. Fort statistic to test for each word w if the mean word frequency in viral sequences was significantly different from that in host sequences. Note that V(w) were subjected to the unit sum constraint p value (the least significant word). Then based on the selected words, we used the logistic regression model to build a binary classifier. We added a lasso regularization to make the model flexible and let the data choose the model with the highest accuracy.Given a training dataset composed of the same number of viral sequences and host sequences, we first used S1,\u2009S2,\u2009\u2026,\u2009Sn be n sequences. Let Yi\u2009=\u20091 if Si comes from viral sequences and Yi\u2009=\u20090 if it is from host sequences, and Vi(w) is the sequence signatures of Si, i\u2009=\u20091,\u2009\u2026,\u2009n. Then we model,Let or in other words,Thus, the objective function isl is the likelihood, \u03b2 is estimated by minimizing the objective function. We chose the parameter \u03bb to have the highest AUROC using 10-fold cross validation on the training data. The R package \u201cglmnet\u201d was used for the model training and testing [where  testing . ROCs we testing  and AUC  testing .p value was computed by comparing the score with the null distribution, that is, the distribution of scores of the testing host contigs. The p value was computed as the fraction of testing host contigs that have greater scores than the score of the query sequence. To estimate the false discovery rate (the proportion of predictions that are hosts), we used R package \u201cqvalue\u201d [p values. Then each query contig was associated with a false discovery rate, also known as the q value. The contigs were sorted by q values from the smallest to the largest. Given a threshold, the contigs with q values smaller than the threshold were predicted as viral sequences, and the largest q value among the predicted contigs gave the estimation of the false discovery rate for the prediction.In real metagenomic experiments, the assembled contigs are of various lengths. In order to compare scores from different prediction models, for each query contig, a \u201cqvalue\u201d , 38 to eMetagenomic samples were simulated based on species abundance profiles derived from a real human gut metagenomic sample  from the Human Microbiome Project (HMP) , commonlFollowing a similar simulation procedure as in , we firsTo obtain the true labels of the assembled contigs, reads in the simulated data were mapped to the set of contigs using \u201cbwa mem\u201d. A contig was labeled as a viral contig if it was assembled from reads only from viral genomes; similarly, a contig was labeled as a host contig if it was assembled from reads from host genomes. A contig was labeled as chimeric if it was assembled from a mixture of virus and host reads. To validate the prediction, we plotted ROC (receiver operating characteristic) curves at different ranges of contig lengths, 500\u20131000\u00a0bp, 1000\u20133000\u00a0bp and \u22653000\u00a0bp. The ROC curves were based on the predictions of viral contigs from genomes sequenced after 1 January 2014 paired with the same number of randomly sampled host contigs.VirSorter was run in the \u201cViromes\u201d mode on the same sets of evaluation sequences as used for VirFinder. VirSorter reported predicted viral sequences in three categories: I for \u201cmost confident\u201d predictions, II for \u201clikely\u201d predictions, and III for \u201cpossible\u201d predictions.The data from Qin et al.  containsMegahit  was usedhttp://pfam.xfam.org/. Resulting domains were considered viral if their description contained one of the following terms: virus, phage, capsid, tail, head, tape, terminase, Gpnn (where n are digits), \u201cpodo\u201d, or \u201csipho\u201d.Blast analyses were used to assess if predicted viral contigs assembled from the cirrhosis study samples had similarity to previously reported sequences. Blastn and blastp searches were performed with default settings against NCBI\u2019s non-redundant nucleotide (nt) and protein (nr) databases from August 2016. Protein sequences were predicted for each contig using Prodigal , 82 withAdditional file 1:Supplemental material for Ren et al. \"VirFinder: a novel k-mer based tool for identifying viral sequenvces from assembled metagenomic data\". (PDF 3007\u00a0kb)Additional file 2: Table S2.NCBI accession numbers for prokaryotic host and viral genomes used in the training and evaluation of VirFinder.\u00a0(XLSX 2752\u00a0kb)Additional file 3: Table S3.The virus and prokaryotic species abundance profile used for the simulation of metagenomic samples.(XLSX 164\u00a0kb)Additional file 4:Table S4.Information about the 2,657 top-scoring predicted viral contigs assembled from 78 human gut microbiome samples from the liver cirrhosis study of Qin et al. 2014. (XLSX 520\u00a0kb)"}
+{"text": "Photoemission measurements on exfoliated 2D heterostructures reveal detailed electronic structure and hybridization effects. 2/WSe2 heterobilayers by using rational device design and submicrometer angle-resolved photoemission spectroscopy (\u03bc-ARPES) in combination with photoluminescence. We find that the bands in the K-point valleys are weakly hybridized, with a valence band offset of 300 meV, implying type II band alignment. We deduce that the binding energy of interlayer excitons is more than 200 meV, an order of magnitude higher than that in analogous GaAs structures. Hybridization strongly modifies the bands at \u0393, but the valence band edge remains at the K points. We also find that the spectrum of a rotationally aligned heterobilayer reflects a mixture of commensurate and incommensurate domains. These results directly answer many outstanding questions about the electronic nature of MoSe2/WSe2 heterobilayers and demonstrate a practical approach for high spectral resolution in ARPES of device-scale structures.Combining monolayers of different two-dimensional semiconductors into heterostructures creates new phenomena and device possibilities. Understanding and exploiting these phenomena hinge on knowing the electronic structure and the properties of interlayer excitations. We determine the key unknown parameters in MoSe It has been used extensively to determine two-dimensional (2D) band structures in large-area van der Waals structures , bilayer (2L), and multilayer (bulk) regions; their boundaries are indicated by red dashed lines. To illustrate our approach and demonstrate its effectiveness, we first studied the effect of hybridization between monolayers of WSeal image  shows an2 flake. The highest intensity peak shifts downward monotonically in energy as the number of layers increases. A SPEM map of the peak energy versus location . ED coincides with the Fermi level EF (red dotted line) to within the measurement accuracy of <50 meV, implying minimal charge transfer between WSe2 and graphene or doping of other origin. This, in turn, implies that there is no significant density of defect states in the gap of the WSe2. 2) in the 1L region. The valence band of the capping graphene is marked by a white dotted curve. It hybridizes with the WSe2 bands, producing avoided crossings (white arrows) similar to those seen in graphene on MoS2  partially overlapping a WSe2 monolayer (red dashed line), forming a heterobilayer region (H) (blue dashed line). The monolayers were aligned during transfer by identifying the crystal axes using polarization-resolved second-harmonic generation (fig. S3) . The spin-orbit splitting at K is much smaller in the MoSe2 than in the WSe2, and the valence band edge is substantially lower. In the heterobilayer, the bands near K are very similar to the bands in the monolayers, implying weak interlayer hybridization near K, as was the case for the WSe2 homobilayer. On the other hand, the bands at \u0393 are substantially different from those in the monolayers, implying significant hybridization, again as in the WSe2 homobilayer. Nevertheless, the valence band edge remains at K. This is important for the electrical and optical properties.The variation in band structure across the heterojunction is seen in the \u0393-K momentum slices in \u22121 of \u0393, not just the two that would be expected from homogeneous hybridization of one band from each monolayer. We note, however, that the third band resembles the upper band in the WSe2 homobilayer  reproduces the three apparent bands in H fairly closely. The remaining small discrepancy can be accounted for by shifts on the order of 100 meV in the incommensurate case, roughly independent of twist angle . The combined evidence that aligned heterobilayers are composed of mixtures of incommensurate and commensurate domains is therefore compelling.In support of this interpretation, DFT simulations of the commensurate heterobilayer reproduce the uppermost band at \u0393 (blue lines)  and the SO at K is 0.49 \u00b1 0.03 eV in WSe2 and 0.24 \u00b1 0.03 eV in MoSe2, in agreement with the literature  and Q (blue dashed line) calculated using DFT. Although DFT underestimates these energies, the predictions of variations within the family of materials and across the Brillouin zone are more reliable  and \u210f\u03c9(XW) are almost coincident with the corresponding valley excitons in the isolated monolayers, consistent with the observation that the band-edge states near the K points barely hybridize and implying that the binding energy of intralayer excitons in one layer is insensitive to the presence of the other layer. The third peak is the interlayer exciton XI. The small (~2%) variation of \u210f\u03c9(XI) between samples could be due to variations in substrate doping or twist angle.We can gain important insights into exciton binding by combining these results with optical measurements. Eb = Eb(XM) \u2212 Eb(XI) and the valence band offset, such that \u210f\u03c9(XM) \u2212 \u210f\u03c9(XI) = \u0394VBO \u2212 \u03b4Eb. The uniformity of \u210f\u03c9(XI) is consistent with \u0394VBO being an invariant parameter of the heterojunction. Hence, by combining optical and ARPES measurements made at the same temperature, we can deduce the magnitude of \u03b4Eb = \u210f\u03c9(XI) \u2212 \u210f\u03c9(XM) + \u0394VBO. Averaging over the samples, we get \u210f\u03c9(XM) \u2212 \u210f\u03c9(XI) = 0.22 \u00b1 0.02 eV, at 300 K. At 105 K, it is slightly larger, by about 0.03 eV (see section S7). Then, using \u0394VBO = 0.30 \u00b1 0.03 eV from above gives \u03b4Eb = 0.05 \u00b1 0.04 eV. That XI is more weakly bound than XM is not surprising because the electron and hole in different layers are, on average, further apart. The reported values of Eb for similar monolayers range from ~0.3 to 0.7 eV (2 (Eb(XI) = Eb(XM) \u2212 \u03b4Eb is at least ~0.2 eV. This is an order of magnitude larger than the binding energy of spatially indirect excitons in GaAs/AlGaAs double quantum wells.According to 2/WSe2 heterobilayers. The hybridization effects at \u0393 provide the first evidence for commensurate domains in such heterostructures, suggesting the possibility of band engineering by layering similar to that discussed in the context of graphene on hBN. Confirmation of this explanation will, however, require further research, such as higher-resolution ARPES measurements showing the absence of hybridization of bands from the spatially separated domains. The observations that the valence band edge remains at the K point and that the band alignment is type II are both significant for electronic and optoelectronic applications.The results described above establish the key electronic parameters of MoSeElectron doping is required to probe the conduction band of insulators by ARPES. Our samples are undoped, but the sample design offers the possibility of gate doping in situ in the ARPES chamber. In cases where the bands of the graphene cap may obscure features near the Fermi energy, the graphene can be replaced with monolayer hBN, which is equally effective but harder to work with.It is clear that the technique of \u03bc-ARPES combined with careful sample design provides invaluable information for realizing the potential of 2D semiconductor heterostructures. It will enable the local electronic structure and chemical potential to be determined in all types of other 2D materials and devices.\u22121, respectively. SPEM maps were acquired over the energy range of the fixed detector (~3.5 eV at the pass energy used), integrating over its angular range of ~15\u00b0 . Samples were annealed at up to 700 K for a total of 1 to 2 hours in ultrahigh vacuum before measurement to remove adsorbates that accumulated during exposure to the atmosphere. In some cases, repeating this anneal modestly improved the resolution. The sample temperature during measurements was 110 K.Samples were fabricated by exfoliation and dry transfer, as detailed in figs. S1 and S2. \u03bc-ARPES was performed at the Spectromicroscopy beamline of the Elettra light source, with linearly polarized radiation focused to an approximately 0.6-\u03bcm-diameter spot by a Schwarzschild objective  were completed in vacuum in a closed-cycle cryostat.The Quantum Espresso plane-wave DFT package  to 3, in"}
+{"text": "In this study, we first characterised the emotions joy, surprise and sadness via ratings of their concreteness, imageability, context availability and valence before examining the allocation of these emotions in vertical space. Participants from six linguistic groups completed either a rating task used to characterise the emotions or a word allocation task to implicitly assess where these emotions are positioned in vertical space. Our findings suggest that, across languages, gender, handedness, and ages, positive emotions are located in upper spatial locations and negative emotions in lower spatial locations. In addition, we found that the neutral emotional valence of surprise is reflected in this emotion being mapped mid-way between upper and lower locations onto the vertical plane. This novel finding indicates that the location of a concept on the vertical plane mimics the concept\u2019s degree of emotional valence.The valence\u2013space metaphor posits that emotion concepts map onto vertical space such that positive concepts are in upper locations and negative in lower locations. Whilst previous studies have demonstrated this pattern for positive and negative emotions e.g. \u2018 Interdisciplinary evidence from robotics , as well as categorise affective words like happy as positive or negative. Their results support the assumption that valence\u2013vertical space associations exist in semantic memory, so that faster responses were observed when target words were presented in spatially congruent locations (e.g. happy in the upper part of a computer screen). Similarly, Meier and Robinson . After reading a sentence, participants had to judge whether a probe word, displayed in either a high or low position on the screen, was congruent or incongruent with the previous sentence. The results showed a mapping between emotions and vertical space induced by sentences recreating representative emotional contexts. This evidence is in line with research  as found by Marmolejo-Ramos et al. . Thus, it is expected to support such finding via a rating task. It could be speculated that fewer verbal contexts and lower context availability ratings for the concept of surprise could be attributed to the neutrality of the concept, which, in turn, may hinder thinking of clear-cut scenarios associated with that given emotion.In regard to joy will be rated as highly positive, whilst sadness will be rated as highly negative. This result has also been reported in previous studies \u00a0\u00d7\u00a0four word rating dimensions ].With regard to the levels of concreteness, context availability, imageability and valence of each emotion word, some variability due to linguistic differences can be expected  is expected to not be significant; rather, it is hypothesised a significant difference between joy and sadness on the vertical plane exclusively.surprise is located half-way between the vertical locations of joy and sadness would show for the first time that surprise\u2019s emotional valence is mapped onto space. Specifically, we expect to find that given the neutral valence of surprise, this word would be mapped onto a vertical location near the mid-point (i.e. placed between joy and sadness). The non-linguistic differences originally reported by Marmolejo-Ramos et al.  and the word allocation (n\u00a0=\u00a0362) tasks. The experimental protocol was approved by the ethics committees of the institutions involved in the studies. Participants gave written informed consent to abide by the principles of the Declaration of Helsinki. Table\u00a0University undergraduate students and members of the community from six different linguistic backgrounds  voluntarily participated in the rating n\u00a0=\u00a035 and thejoy, surprise and sadness were used in the rating study. The ratings were performed via a simple paper-based task  on 10-cm horizontal lines; one line for each attribute. On the left end, the scales were labelled as \u2018highly abstract\u2019 , \u2018hard to imagine\u2019 , \u2018hard to think of a context\u2019  and \u2018highly negative\u2019 . On the right end, the scales were labelled as \u2018highly concrete\u2019 , \u2018easy to imagine\u2019 , \u2018easy to think of a context\u2019  and \u2018highly positive\u2019 . The three words were presented to participants for rating in a random order; however, the order of each rating  for each word was given in a fixed order  and word dimension, i.e. concreteness, imageability, context availability and valence (D). These factors were hierarchically entered in this order, and the dependent variable was the rating values.The data in both tasks were analysed via high-breakdown and high-efficiency robust linear regression modelling . These factors were entered in this order for the location values obtained in the X and Y axes; i.e. the two dependent variables in the word allocation study. The variables W, H and L were central to this study and added to the model based on previous research showing that they play a part in the mapping of words onto space  and their associated t and p values were reported to illustrate their influence on the model. For each hierarchical model, the variability accounted for was estimated as adjusted R2\u00a0\u00d7\u00a0100. The models\u2019 fits via ANOVA and robustified F tests (Fr).For the word allocation study, the independent variables were participant, i.e. all participants in word allocation study (P), language, i.e. the six languages studied (L), gender, i.e. males and females (G), handedness, i.e. right- and left-handers (H), age, i.e. the ages of the participants in the word allocation study (A), and word, i.e. n\u00a0=\u00a0sample size, was used to generate 95 % CI around the medians for assessing equality of medians at approximately 5\u00a0% significance level  was used via the R function \u2018apanova\u2019  and median absolute deviation (MAD), respectively. The formula joy received higher context availability ratings than surprise, and the three words differed in terms of imageability ratings; i.e. joy\u00a0>\u00a0surprise\u00a0>\u00a0sadness. Central to this study was the finding that, in terms of valence, joy was rated higher than sadness, and surprise\u2019s average ratings fell between the other two words.The rating results suggested no differences among the three emotion words regarding their concreteness levels. However, t and p values associated with the \u03b2 values. The other models had significant \u03b2 values . The variability accounted for by each model was 1.02\u00a0% (P), 4.57\u00a0% (P\u00a0+\u00a0L), 4.63\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G), 4.66\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H), 4.82\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A), 10.78\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W), and 18.41\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W\u00a0+\u00a0D). A comparison of the models further suggested that there was an improvement of the fitness of the hierarchical models to the rating data when P, L, and A were added; Fr\u00a0=\u00a040.90, p\u00a0<\u00a00.001, Fr\u00a0=\u00a022.49, p\u00a0<\u00a00.001 and Fr\u00a0=\u00a07.03, p\u00a0=\u00a00.006, respectively. However, the largest improvement occurred when W and D were finally added to the model; Fr\u00a0=\u00a0111.45, p\u00a0<\u00a00.001 and Fr\u00a0=\u00a0104.77, p\u00a0<\u00a00.001, respectively.Only the models P, P\u00a0+\u00a0L\u00a0+\u00a0G and P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H did not have significant r\u03c4\u00a0=\u00a00.02, z\u00a0=\u00a01.87, p\u00a0=\u00a00.06) such that, for example, the median rating of participants aged 17\u201325 was 6.7 [95\u00a0% CI ], and the median rating of participants aged 30 to 35 was 7.95 [95\u00a0% CI ].The model P was significant in that there were differences in the ratings across participants. For example, whereas a participant in the English sample had a median rating of 3.95 [95\u00a0% CI ], a participant in the Vietnamese sample had a median rating of 7.7 [95\u00a0% CI ]. Language had an effect on the ratings, which was due to median ratings differing across linguistic groups. For example, whilst the median rating in the Hindi sample was 5.4 [95\u00a0% CI ], the median rating in the Japanese sample was 6.5 [95\u00a0% CI ]. The effect of age on the ratings was graphically explored via a scatter plot with linear and smooth fit lines and a correlation test. The results indicated a near-significant positive correlation ], Mdnsurprise\u00a0=\u00a06.2 [95\u00a0% CI ], and Mdnsadness\u00a0=\u00a05.8 [95\u00a0% CI ].context\u00a0=\u00a07.4 [95\u00a0% CI ], Mdnimageability\u00a0=\u00a07.4 [95\u00a0% CI ]}, the average ratings in the concreteness and valence dimensions did {Mdnconcreteness\u00a0=\u00a05.7 [95\u00a0% CI ], Mdnvalence\u00a0=\u00a05.1 [95\u00a0% CI ]}. Also, the ratings for the words in the context and imageability dimensions were higher than the ratings for the words in the concreteness and valence dimensions {Mdncontext+imageability\u00a0=\u00a07.4 [95\u00a0% CI ] and Mdnconcreteness+valence\u00a0=\u00a05.2 [95\u00a0% CI ]}.The effect of word type (W) was substantiated by the non-overlap between the confidence intervals around the median ratings for the words 5\u00a0% CI 7.2, 7.77],joy {Mdn\u00a0=\u00a05.7 [95\u00a0% CI ]}, sadness {Mdn\u00a0=\u00a05.2 [95\u00a0% CI ]} and surprise {Mdn\u00a0=\u00a05.9 [95\u00a0% CI ]} did not differ . In the context dimension, there were differences between groups  due to the median rating of joy {Mdn\u00a0=\u00a07.6 [95\u00a0% CI ]} differing from that of surprise {Mdn\u00a0=\u00a07.2 [95\u00a0% CI ]} . Other pairwise comparisons in this dimension, and that involved the word sadness {Mdn\u00a0=\u00a07.3 [95\u00a0% CI ]}, were not significant . There were also differences between joy {Mdn\u00a0=\u00a07.8 [95\u00a0% CI ]}, sadness {Mdn\u00a0=\u00a07.5 [95\u00a0% CI ]} and surprise {Mdn\u00a0=\u00a07 [95\u00a0% CI ]} in the imageability dimension  due to all pairwise comparisons being significant . The non-overlap between the 95\u00a0% CIs of joy {Mdn\u00a0=\u00a09.1 [95\u00a0% CI ]}, sadness {Mdn\u00a0=\u00a01.65 [95\u00a0% CI ]}, and surprise {Mdn\u00a0=\u00a05.1 [95\u00a0% CI ]} in the valence dimension indicates that the average ratings between these groups differed significantly.Given the significant effects of W and D on the ratings, their relationship was analysed. Figure\u00a0Emotion word JOY: Analyses of the effects of the covariates participant (P), language (L), gender (G), handedness (H), and age (A), on the four types of ratings revealed an effect of P (i.e. P model) on the context availability (CA), imageability (I) and valence (V) ratings of joy . There was also an effect of L (i.e. P\u00a0+\u00a0L model) on the CA and V ratings of joy . All the other models were not significant; p\u00a0>\u00a00.05.Emotion word SURPRISE: Analyses of the effects of the covariates P, L, G, H, and A on the four types of ratings revealed an effect of P on the CA and I ratings of surprise . There was also an effect of A (i.e. P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A model) on the V ratings of surprise . All the other models were not significant; p\u00a0>\u00a00.05.Emotion word SADNESS: Analyses of the effects of covariates P, L, G, H, and A on the four types of ratings revealed an effect of P on the concreteness (C), CA, I, and V ratings of sadness . There was also an effect of A (i.e. P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A model) on the C ratings of surprise , an effect of L (i.e. P\u00a0+\u00a0L model) on the CA ratings , and an effect of G (i.e. P\u00a0+\u00a0L\u00a0+\u00a0G model) on the I ratings . All the other models were not significant; p\u00a0>\u00a00.05.joy was located in upper spatial locations and sadness in lower spatial locations. The neutral emotional concept of surprise was located mid-way between joy and sadness. In regard to the language factor, results were in line with those reported by Marmolejo-Ramos et al. . The variability accounted for by each model was 0.02\u00a0% (P), 0.23 % (P\u00a0+\u00a0L), 0.28\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G), 0.45\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H), 0.45\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A), and 0.66\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W). A comparison of the models further suggested no improvement of the fitness of the hierarchical models to the X-axis data; P model: Fr\u00a0=\u00a00.17, p\u00a0=\u00a00.66; P\u00a0+\u00a0L model: Fr\u00a0=\u00a00.34, p\u00a0=\u00a00.99; P\u00a0+\u00a0L\u00a0+\u00a0G model: Fr\u00a0=\u00a00.44, p\u00a0=\u00a00.49; P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H model: Fr\u00a0=\u00a01.40, p\u00a0=\u00a00.22; P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A model: Fr\u00a0=\u00a00.01, p\u00a0=\u00a00.88; and P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W model: Fr\u00a0=\u00a00.54, p\u00a0=\u00a00.90.In none of the models, the X axis suggests that they are not positioned differently on the horizontal plane , the median location for the three words was \u22121.The overlap between the confidence intervals for the words when located in the see Fig.\u00a0b. Indeedjoy) showed that there were non-significant results in the X axis .Analyses of the effects of the covariates participant (P), language (L), gender (G), handedness (H), and age (A) on the X values , and \u03b2sadness\u00a0=\u00a0\u221212.14 . The variability accounted for by each hierarchical model was 0.01\u00a0% (P), 0.26\u00a0% (P\u00a0+\u00a0L), 0.28\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G), 0.32\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H), 0.37\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A), and 49.88\u00a0% (P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W). A comparison of the models suggested an improvement of the fitness of the hierarchical models to the Yaxis data only when the predictor W was added; P model: Fr\u00a0=\u00a00.19, p\u00a0=\u00a00.66; P\u00a0+\u00a0L model: Fr\u00a0=\u00a00.40, p\u00a0=\u00a00.99; P\u00a0+\u00a0L\u00a0+\u00a0G model: Fr\u00a0=\u00a00.18, p\u00a0=\u00a00.66; P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H model: Fr\u00a0=\u00a00.29, p\u00a0=\u00a00.58; P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A model: Fr\u00a0=\u00a00.46, p\u00a0=\u00a00.49; and P\u00a0+\u00a0L\u00a0+\u00a0G\u00a0+\u00a0H\u00a0+\u00a0A\u00a0+\u00a0W model: Fr\u00a0=\u00a0373.43, p\u00a0<\u00a00.001.The same analysis described above for the data in the Y axis suggests that they are positioned differently on the vertical plane , and they had notably different locations on the Y axis. Specifically, whilst joy was located in the upper end of the square {Mdnjoy\u00a0=\u00a07 [95\u00a0% CI ]}, sadness was positioned on the lower end of the square {Mdnsadness\u00a0=\u00a0\u22127 [95\u00a0% CI ]}, and surprise was placed in between the other two words {Mdnsurprise\u00a0=\u00a03 [95\u00a0% CI ]}.The non-overlap between the confidence intervals for the words when located in the see Fig.\u00a0b. There joy and sadness only , such that some participants allocated these words more upward/downward than others . There was an effect of H in the case of surprise only , such that right-handers allocated this word higher {Mdn\u00a0=\u00a03, [95\u00a0% CI ]} than left-handers {Mdn\u00a0=\u00a02, [95\u00a0% CI ]}. All the other models in surprise had p\u00a0>\u00a00.05  is metaphorically mapped onto the vertical plane, such that joy is located in upper locations, sadness is located in lower locations and surprise is located mid-way between the other two words .The aim of the rating task was to characterise the words under scrutiny in their concreteness, context availability, imageability, and valence dimensions. The word allocation task aimed to determine the allocation of these three emotions in space by various linguistic groups. Overall, the results suggest that the valence of the emotion words joy, sadness and surprise have been assessed ]} indicates that this word is regarded as neither positive nor negative. This is a novel finding since it empirically demonstrates that surprise is a rather neutral emotion concept. It is interesting to note that we found an effect of language in the rating task, but such a factor did not mediate the word allocation task (see below).The results of the rating study agree with previous research in which the concreteness, imageability, context availability, and valence of the words s et al. , 2 in whjoy are mapped onto upper spatial locations, whilst highly negative emotions such as sadness are mapped onto lower spatial locations. This finding is in keeping with research suggesting a metaphorical association between emotion stimuli and the vertical spatial axis ]}. Numerically speaking, the exact mid-way location in the vertical axis between where joy and sadness were located is zero, and the exact mid-way location between zero and where joy was located is 3.5  is reflected in this emotion being mapped mid-way between upper and lower locations onto the vertical plane.The novel finding is that [95\u00a0% CI .58, 3.41Why is vertical space so salient? It has been argued that locations on the horizontal plane (i.e. left and right) are less salient than locations on the vertical plane (i.e. up and down) since people tend to confuse East\u2013West more than North\u2013South  in the vertical plane.Note that all studies on the valence\u2013space metaphor focus on mapping of the opposite ends of the affective continuum of a concept (e.g. positive emotions vs negative emotions) onto the opposite ends of the vertical plane . The results have consistently shown that high spatial locations are associated with positivity and low spatial locations are associated with negativity . It is reasonable to suggest that if valenced concepts were to be allocated in a three-dimensional physical space, highly positively valenced concepts would be placed near the body, highly negatively valenced concepts would be placed far away from the body, and neutrally valenced concepts mid-way between these two. That is, valenced concepts should also have different locations on the Z Cartesian coordinate. This is merely conjectural, and further empirical testing is needed to explore this notion.Whilst the emotions"}
+{"text": "The highly homogenous genetic structure of the Sardinian population has favored the search of relevant variants for disease-association studies. Moreover, malaria, once endemic in the island, has been shown to have contributed to shape the native population genome affecting the relative allele frequency of relevant genes. In Sardinia, the prevalence of HLA-B*2709, which differs from the strongly AS-associated B*2705 prototype for one amino acid (His/Asp116) in the F pocket of the peptide binding groove, is around 20% of all HLA-B27 alleles. We have previously hypothesized that malaria could have contributed to the establishment of this allele in Sardinia. Based on our recent findings, in this perspective article we speculate that the Endoplasmic Reticulum Amino Peptidases, ERAP1 and 2, associated with AS and involved in antigen presentation, underwent co-selection by malaria. These genes, besides shaping the immunopeptidome of HLA-class I molecules, have other biological functions that could also be involved in the immunosurveillance against malaria.The frequency of HLA-B27 in patients with Ankylosing Spondylitis (AS) is over 85%. There are more than 170 recognized HLA-B27 alleles but the majority of them is not sufficiently represented for genetic association studies. So far only two alleles, the HLA-B HLA-B27 and Ankylosing Spondylitis (AS) is a paradigmatic example of association between the HLA and an immuno-mediated disease , 2. Yet,http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/allele.cgi) have been identified. However, the majority of them is not sufficiently represented to enable association studies  that made highly specific this recognition. Noteworthy, this novel allele, named B*2709, was frequent enough to enable association studies in Continental Italy. Most interesting, this allele showed the highest frequency in Sardinia, a Mediterranean island of about 1.6 \u00d7 106 inhabitants, where it represents 20% of all HLA-B27 subtypes  are intracellular enzymes encoded by polymorphic genes contiguously located on chromosome 5q15. Some of these polymorphisms are functional and have been found associated with AS. In the case of ERAP1, the missense SNP rs30187 has been functionally related to the level of trimming activity and, notably, the allelic variant associated with AS shows a more efficient ERAP1 enzymatic activity . ERAP2,  with AS . Althoug do have .More recently, other ERAP2 functional polymorphisms have been described. In particular, our group has shown that the minor allele G at SNP rs75862629 in the promoter region of ERAP2 couples a lower expression of ERAP2 with a higher expression of ERAP1 . Intereshttps://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/) of the missense rs30187 in the ERAP1 coding region, as well as the distribution of rs2248374 and rs75862629 in the ERAP2 gene . These observations seem to suggest that ERAP2 could have been a target of selection and, more precisely, those alleles determining a lower expression of ERAP2 appear to be favored in the areas where the P. falciparum (There are some observations that could give support to this speculation: (1) the co-segregation with HLA-B27 subtypes whose occurrence has been already proposed as consequence of a selection by lciparum ; (2) thelciparum , whose ilciparum . Recent lciparum . The samlciparum  but not lciparum .It is therefore conceivable that malaria is the factor that has favored the establishment of polymorphisms correlating with a lower expression of ERAP2. The allele G at rs2248374 that determines the ERAP2 mRNA non-sense mediated decay, has a frequency higher than 60% in the equatorial Africa and, remarkably, the minor allele at rs75862629, also correlating with a lower ERAP2 transcription, reaches its highest frequency in the same regions Table . In thisP. vivax rather than P. falciparum, is the main cause of malaria (Of note, in East Asia, where the frequency of AS is much lower than in the western hemisphere , haploty malaria . This ob malaria . In addi malaria . Notewor malaria  is in LD malaria . This, a malaria .*2709 subtype. It will be interesting to investigate if this pair shows any functional interaction and if this has any correlation with AS susceptibility/protection.In conclusion, functional variants of the three aminopeptidases ERAP1, ERAP2, and LNPEP show a worldwide distribution compatible with a selective pressure by malaria. Some of these variants co-occur with HLA-B27 subtypes. In particular, in Sardinia the distribution of the ERAP2 rs75862629 minor allele correlates with the presence of the HLA-BThe ideas in this perspective article were jointly conceived by FP, MF, and RS, who wrote the manuscript. All authors contributed to the discussion of the draft and made the final corrections.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Biopolymers and their derivatives are being actively investigated as substitutes for petroleum-based polymers. This has generated an intense interest in investigating new solvents, in particular for cellulose, chitin/chitosan, and starch. This overview focuses on recent advances in the dissolution and derivatization of these polysaccharides in solutions of strong electrolytes in dipolar aprotic solvents. A brief description of the molecular structures of these biopolymers is given, with emphases on the properties that are relevant to derivatization, namely crystallinity and accessibility. The mechanism of cellulose dissolution is then discussed, followed by a description of the strategies employed for the synthesis of cellulose derivatives  under homogeneous reaction conditions. The same sequence of presentation has been followed for chitin/chitosan and starch. Future perspectives for this subject are summarized, in particular with regard to compliance with the principles of green chemistry. N,N-dimethylacetamide (DMAC), and dimethylsulfoxide (DMSO). These solvents induce swelling, but do not dissolve some of the above-mentioned biopolymers, namely cellulose and chitin. Addition of certain strong electrolytes, e.g., LiCl or quaternary ammonium fluoride hydrates, however, leads to the formation of clear polysaccharide solutions. This visual aspect does not necessarily mean the formation of molecularly dissolved biopolymer solutions. Aggregate formation has been experimentally demonstrated and is relevant to the accessibility of the hydroxyl groups of the polysaccharide. Consequently, different experimental conditions are required, e.g., for the derivatization of fibrous celluloses, as compared with those of its microcrystalline (MCC) counterpart. The need for considering the physico-chemical characteristics of the polysaccharide solutions is, therefore, justified. With this background, we present here an overview on the dissolution and derivatization of cellulose, chitin/chitosan, and starch by strong electrolytes in the above-mentioned solvents. To our knowledge, this is the first time that derivatization of these polysaccharides is jointly reviewed. After discussing the relevance of the subject to green chemistry, we consider briefly the structures of the above-mentioned polysaccharides. We discuss the outlines of their derivatization under heterogeneous- as well as homogeneous reaction conditions. The part on obtaining polysaccharide solutions includes the strategies employed for biopolymer activation, where required, and the mechanism of dissolution. We then discuss the synthetic strategies and reaction conditions that are usually employed for derivatization, and list the results obtained. We dwell more on cellulose derivatives, in particular the esters and ethers, because their synthesis has received more attention; they are also industrially applied on much wider scale than chitin/chitosan and/or starch.This overview focuses on recent advances in the dissolution and derivatization of cellulose, chitin/chitosan, and starch in solutions of strong electrolytes dissolved in dipolar aprotic solvents, in particular ca. 86% of energy and 96% of organic chemicals  that is formed by dehydration of enol tautomer of DMAC [CH2=C(OH)N(Me)2] This extremely reactive electrophile causes random chain cleavage, resulting in pronounced and rather fast changes in the molar mass distribution of cellulose . Therefore, molecular environment of Li+ progressively changes as cellulose is added to the solution. The interaction presumably involves an exchange between one DMAC molecules in the inner coordination shell of Li+ with a cellulosic hydroxyl group, in a cooperative manner. In addition, the bulky LiCl/DMAC complex would penetrate into the cellulose chains, creating more inner space within 3D biopolymeric structure, thus contributing further to dissolution. This exchange model is shown in The formation of these structures has been probed by NMR spectroscopy. For LiCl/DMAC , a decre\u2212\u00b7\u00b7\u00b7\u00b7\u00b7H-O-Cell, interactions for cellulose dissolution in LiCl/DMAC has been corroborated by the study of solvatochromism in these solutions. The latter term refers to the effect of medium on the spectra, absorption or emission, of certain compounds (solvatochromic substances or probes) whose spectra are especially sensitive to the properties of the medium. These properties include \u201cacidity\u201d, \u201cbasicity\u201d, dipolarity, and polarizability. The information on the properties of the medium is usually obtained from the dependence of solvatochromism  on some experimental variable, e.g., concentration or solution temperature. These probes have been employed in order to investigate the properties of cellulose proper; DMAC, LiCl-DMAC; and cellulose/LiCl-DMAC solutions /[AGU] are usually employed. In this regard, the tetraallylammonium fluoride represents an interesting alternative to TBAF\u00b73Hohydrate . The secohydrate , or via The fluoride ion is acting either as a general base for water attack on the ester acyl group, part (a) , or abst2=CH-CH2)4N+\u2212F + (RCO)2O\u2192RCOF + (CH2=CH-CH2)4N+\u2212OCR) has been demonstrated by FTIR. That is, a part of cellulose derivatization probably proceeds by the reaction of cellulose and acyl fluoride [Finally, the formation of acyl fluoride (RCOF) by the reaction between TAAF and acetic- or hexanoic anhydride  for several hours, followed by ester precipitation and purification. N reactions of cellulose tosylates.They are also good leaving groups, so that they can be substituted by Sivatives ,147. In ivatives . The mosThe etherification of cellulose in LiCl/DMAC and TBAF/DMSO, even with reactive halides, e.g., allyl- and benzyl bromide is slow and requires long reaction time ,150,151.O-propargyl cellulose by using thexyldimethylsilyl moieties as protecting groups, Another activation procedure involves imidazole, as shown in the synthesis of 3-Cellulose derivatizing agents and conditions most usually employed, as well as main techniques used, are summarized in Similar to cellulose, chitin dissolves in SE/DAS, allowing its derivatization. Although chitosan is soluble in aqueous acids, e.g., acetic acid, and starch can be dissolved DAS without the presence of SE, both biopolymers are included in our discussion of the SE/DAS solvent. The reason is that aqueous acid is not an appropriate medium for the derivatization of chitosan, due to hydrolysis of the derivatizing agent. Additionally, the use of SE/DAS accelerates the dissolution of starch. The mechanisms involved in their dissolution are essentially similar to those shown for cellulose (item 3.2.1.2); see ca. 10 nm diameter. Hexafluoro-2-propanol can be used instead of LiCl/DMAC and similar results are obtained when the solvent is evaporated, see The LiCl/DMAC solvent system has been used more recently in a variety of applications of (bio) technological relevance. One interesting example is its use in a process for fabrication of biogenic chitin nanofibers. The self-assembly process of dissolved chitin is initiated with the addition of water, producing fine nanofibers  of The HRS offers interesting opportunities for cellulose chemistry. New, elegant synthetic schemes have been devised in order to control important aspects of biopolymer derivatization, in particular DS of the products and regioselectivity of substitution. The possibilities will continue to be explored, in particular with regard to new solvent systems and synthetic strategies that are consistent with principles of green chemistry. Process optimization calls for extensive kinetic data that should result in economy of time, power consumption, and a decrease of side reactions. Heating by microwave irradiation may prove a valuable tool to enhance reaction efficiency (higher DS in shorter reaction times). Economy of reagents dictates the use of stoichiometric reagent/AGU ratios, where possible.In conclusion, the perspective for the HRS scheme is bright because it may be employed for obtaining specialty products, where the particularities of polymer structure and the consistency of product properties are central to performance. Examples include nano-composites; \u201csmart\u201d polymers that respond reversibly to external stimuli, and bio-compatible polymeric materials."}
+{"text": "The primary outcome was postoperative pain, evaluated using the visual analogue scale (VAS) score at 30 min, 2, 6, 12, 24, 48 h, 7 and 10 days following surgery. The secondary outcomes chosen were changes in postoperative swelling and maximum mouth opening values compared to preoperative ones. Compared to placebo, treatment with Flurbiprofen and Lornoxicam was characterised by an improvement in the primary outcome. Moreover, the treatment with Lornoxicam presented significantly lower median pain scores at 2 h (p < 0.001) and at 6 h (p = 0.016) compared to Flurbiprofen and at 2 h (p < 0.001), 6 h (p = 0.01), and at 24 h (p = 0.018) after surgery compared with placebo. Swelling and maximum mouth opening values were not significantly different between the groups at each follow-up session. This trial demonstrated that treatment with Lornoxicam showed a decrease in the incidence and severity of pain in the first postoperative phase following third molar surgery compared to Flurbiprofen and placebo.The aim of this study was to analyze the effectiveness of Lornoxicam and Flurbiprofen in reducing perioperative sequelae after impacted mandibular third molar surgery. Ninety-one patients who needed surgical extraction of an impacted mandibular third molar were selected for the study. All subjects were randomly allocated to receive one of the following treatments twice a day for 5 days after surgery: placebo ( Mandibular third molar surgery is one of the most commonly performed oral surgery procedures and is associated with a wide range of symptoms such as pain, swelling, and other important oral inflammatory sequelae . FollowiThe correct management of these inflammatory sequelae, mediators, and pain forms the basis of successful postoperative management . Many stNon-steroidal anti-inflammatory drugs (NSAIDs) and corticosteroids are the most widely used drugs, as other adjuvant local agents, in post-surgical oral and periodontal therapy due to their anti-inflammatory and analgesic properties ,7. AmongIt has been previously shown that NSAIDs mainly exert their anti-inflammatory action by inhibiting cyclooxygenases (COX)-1 and COX-2. However, as the inhibition of COX-1 is associated with a lack of gastric protection , a new cA recent randomized controlled trial studied the effects of a new and potent NSAID of the -oxicam class with anti-inflammatory and analgesic effects; Lornoxicam was used for the management of postoperative pain in patients undergoing third molar surgery . The resOn the basis of these encouraging pivotal results, the objective of this study was to evaluate the efficacy of Lornoxicam versus a commonly used anti-inflammatory drug (Flurbiprofen) and a placebo in the management of the postoperative discomfort after the surgical removal of mandibular third molars. The null hypothesis was that there would be no difference between the three protocols analysed.The study was designed as a single-center, randomized, triple-blind controlled clinical trial. The study was performed in accordance with the Declaration of Helsinki on medical research, as revised in 2016. Ethical approval was obtained at the beginning of the study from the Institutional Review Board of the University of Messina (#12\u201316). Written informed consent was obtained from each patient, all of whom were informed about the study protocol  and possible risks of the study  before any procedures were performed.All subjects were consecutively and randomly recruited from normal healthy subjects (according to the American Society of Anaesthesiology (ASA) classification, ASA I), aged \u226518 years, who required the surgical removal of an impacted third molar in the mandible. The enrolment of patients was performed between May 2016 and July 2018 at the Unit of Oral Surgery in the Department of Odontostomatology of the University of Messina, Messina, Italy.The inclusion criteria were as follows: (1) aged between 18 and 32 years; (2) good general health; (3) the presence of one impacted third molar in the mandible with a class II position, type B impaction ; (4) absThe sample size calculation was performed taking into account the identification of the three groups, with an effect size of 0.40, \u03b1 = 0.050, and with a power level of 0.80 for pain, which represented the primary variable selected for the analysis. The primary variable \u2018pain\u2019 presented a difference between groups of 0.62 (mean) and a standard deviation (SD) of 0.73. After an evaluation of these values, it was calculated that a minimum number of 29 patients in each group was necessary.An inter-examiner reliability test was performed for the study, which showed an agreement of 84.6% (\u03ba = 0.59) for the primary outcome (pain). Moreover, the intra-examiner agreement was evaluated by the measurement of Cohen\u2019s kappa coefficient; this was \u03ba = 0.834, indicating a high degree of reliability. The kappa coefficient was also calculated for the measurements taken at each follow-up session and an acceptable degree of reliability was established for every examination (intra-class correlation coefficient t = 0.764).n = 19), refused to participate in the study (n = 9), or were absent at the baseline (n = 6). Therefore, a final number of 91 patients were included in the analysis  from all patients who were referred to the Department of Odontostomatology of the University of Messina were recruited. After evaluation against the study criteria, 34 subjects  were excluded. These subjects did not meet the eligibility criteria  was given a placebo capsule  twice a day for 5 days; the Flurbiprofen group (n = 31) were given 200 mg Flurbiprofen twice a day for 5 days ; the Lornoxicam group (n = 31) were given 16mg Lornoxicam capsules  twice a day for 5 days. Before the procedure, each patient received 1 g Amoxicillin with clavulanic acid as preoperative prophylactic therapy, 1 h before surgery .Each enrolled subject was assigned to one of three groups in accordance with the postoperative medication received: the placebo group  score for pain of \u22654 at 5 days after surgery . No postThe assignment of each patient to a study group was determined by means of a randomization technique using sealed and numbered envelopes; details of the sequence were concealed from all clinicians who participated in the study. An operator not involved in the subsequent experimentation generated a random allocation sequence, in a 1:1:1 ratio, for the distribution of the patients to one of the three study groups, performed with a permuted block design using a computer generator.Before the start of each treatment, an operator who was not involved in the subsequent phases of the study or the data processing conducted the assignment of each sealed envelope (which contained the type of treatment and the patient\u2019s name and date of birth) to the therapist who subsequently prescribed postoperative therapy. The same operator who performed the statistical assignment phase was blinded to all patient clinical data and to the following analysis and evaluation of the data. For the codification of the single groups, it was decided, before the study, to assign the letter \u2018A\u2019 to the placebo treatment, the letter \u2018B\u2019 to the Flurbiprofen treatment, and the letter \u2018C\u2019 to the Lornoxicam treatment. Each envelope was used for each treatment assignment. In this phase, the type of treatment for each patient, useful for the subsequent statistical analysis, was registered. The patient, clinician, surgeon, and statistician who participated in the subsequent follow-up session were all blinded to the treatment data.All surgical procedures were performed by the same clinician in order to avoid any possible bias with regard to surgeon variability. Each enrolled subject underwent the same surgical extraction procedure, performed under similar clinical conditions. A local anesthetic technique was employed that included inferior alveolar nerve blocks using Mepivacaine 2% with Epinephrine 1:100000 . The total amount of local anesthetic used for the operation was recorded for each patient, by summing the number of dental cartridges used.The same mucoperiosteal flap with subsequent osteotomy (useful for accessing the tooth) was performed in all patients. The bone was removed with a round bur in a straight hand-piece under continuous saline solution irrigation. In all subjects, tooth sectioning and removal of the third molar was performed, following which granulation tissue was removed from the alveolar cavity. The surgical wound was closed using a 4\u20130 resorbable suture (Coated Vicryl (polyglactin 910); Ethicon, Somerville, N.J., USA).Immediately after surgery, postoperative therapy was carefully explained to each patient. They were instructed to follow a liquid and cold diet for the first 24 h. Patients were also motivated by oral hygiene and the possible symptomatology resulting from the surgical intervention. Possible surgical complications such as pain, swelling, and fever and the risks arising from the therapy including nausea, vomiting, or drug intolerance were explained to all patients.For the duration of the study, all patients were assisted by the surgical team in the event of any kind of postoperative problem, such as infection, uncontrolled pain, fever, or other complications due to the procedures, if necessary.Immediately after surgery, details of each operation were documented, together with the total duration of surgery. The amount of postoperative pain was the primary outcome variable measured. This allowed the patient to describe their discomfort more objectively. The intensity of the primary pain variable was recorded using a 10-cm VAS, ranging from 0 (no pain) to 10 (maximum pain). Each subject was invited to register their perceived pain at 30 min, 2, 6, 12, 24, 48 h, 7 and 10 days after the completion of surgery. At this stage, any additional analgesics or other drugs taken by each study participant were recorded.The second outcome analyzed was the appearance of postoperative swelling. For the analysis of this outcome, pre- and postoperative values  of the different facial measurements were compared, as described previously : mandibuFor the clinical analysis of possible trismus, the maximum degree of mouth opening was measured. This was done at baseline, 24, 72 h, 5, 7 and 10 days after surgery using a calibrated sliding caliper . The measurement was made by calculating the difference between the baseline value and that obtained at each follow-up session.The Kolmogorov\u2013Smirnov test revealed that the data examined were not normally distributed. Therefore, a non-parametric approach was taken for the analysis of the data. The Kruskal\u2013Wallis test was applied to compare pain scores, facial distances, and maximum mouth opening among the three groups at each observation time point. The Mann\u2013Whitney test was applied for two-by-two comparisons. The Friedman test was applied for the comparison of the measurements  at the different observation time points within each group. The Wilcoxon test was used to perform two-by-two comparisons between time observations, for each follow-up session. For the primary outcome, Bonferroni\u2019s correction was applied for the multiple comparisons, for which the significant alpha level 0.050 has to be divided by the number of possible comparisons between 8 time points, compared two-by-two. The \u201cadjusted\u201d significance level for this analysis was equal to 0.050/28 = 0.0018. The receiver operating characteristic (ROC) curve was realized in order to show an overall area under the curve for the three treatments, providing an additional level of resolution into their efficacy over the entire trial period. Thus, for each treatment, the area under the curve (AUC) was calculated with a relative 95% confidence interval (CI) and significance. The significance of the P-value was set at 0.05. The statistical analyses were performed using SPSS 17.0 for Windows statistical software .All enrolled patients completed the study without any postoperative complications. The mean age of the 91 patients  found to be eligible for the study was 29.6 \u00b1 2.8 years. Twenty-nine patients  were randomly allocated to the placebo group, 31 patients  to the Flurbiprofen group, and 31 patients  to the Lornoxicam group. Postoperative healing was uneventful in all patients and without any adverse events such as infections or abscesses during follow-up.The peak postoperative pain score was seen at 12 h in the placebo, 12 h in the Flurbiprofen group, and 6 h in the Lornoxicam group . p < 0.001) and with the placebo (p < 0.001) group. At 6 h following surgery, the median VAS score was significantly lower in the Lornoxicam group compared with the Flurbiprofen (p = 0.016) and with the placebo group (p = 0.01). At 24 h following surgery, compared with the placebo group, the median VAS score was significantly lower in the Flurbiprofen (p = 0.025) and Lornoxicam group (p = 0.018)  .p = 0.000). More specifically, the placebo group presented VAS score significantly at every time point, excluding when the VAS score values at 2 h were compared to the values obtained at 24 h (p = 0.0049) and when the VAS score at 6 h was compared to the values at 12 h (p = 0.453). The Flurbiprofen group improved the VAS score significantly at every time point, excluding when the VAS score values at 30 min were compared to the values obtained at 24 h (p = 0.0743), 48 h (p = 0.954) and when the VAS score at 6 h was compared to the values at 12 h (p = 0.0022). The Lornoxicam group improved the VAS score significantly at every time point, excluding when the VAS score values at 30 min were compared to the values obtained at 2 h (p = 0.0730), 24 h (p = 0.0048) and at 48 h (p = 0.066), when the VAS score at 6 h was compared to the values at 12 h (p = 0.1503) and when VAS score values at 24 h were compared to the values at 48 h (p = 0.7068).The differences between time points of the VAS score are represented in p = 0.208 was obtained, which was not significant. Similarly, for Flurbiprofen an AUC = 0.501 (CI 95% = 0.475\u20130.527), p = 0.937 was obtained, which was not significant; for Lornoxicam, instead, a higher AUC = 0.614 (CI 95% = 0.589\u20130.638) with a p-value < 0.001 was obtained , for the placebo, an AUC = 0.475  95% = 0.436\u20130.514), obtained .p = 0.344). The mean duration of surgery was similar in the three groups: 24.56 \u00b1 5.31 min for the placebo group, 23.19 \u00b1 5.24 min for the Flurbiprofen group, and 24.41 \u00b1 5.18 min for the Lornoxicam group (p = 0.166). The osteotomy and tooth sectioning was performed without intraoperative accidents or complications in all enrolled patients.There were no significant differences between the groups regarding the quantity of dental anesthetic used: placebo group, 2.6 \u00b1 0.6; Flurbiprofen group, 2.2 \u00b1 0.4; and Lornoxicam group, 2.4 \u00b1 1.3 (p > 0.05) (p > 0.05)  . Moreove > 0.05) . p < 0.001 and 7 days, p = 0.003); the Flurbiprofen group at 24 h (p < 0.001) and 5 days (p = 0.007); and the Lornoxicam group at 24 h (p < 0.001) 72 h (p = 0.007), and 5 days (p = 0.007) (p = 0.007)  . Moreove= 0.007) .The objective of this study was to evaluate the effectiveness of Flurbiprofen and Lornoxicam in the prevention of postoperative discomfort after mandibular third molar surgery. More specifically, it sought to assess the efficacy of Flurbiprofen and Lornoxicam in the management of postoperative pain, facial swelling, and mouth opening compared to placebo. Treatment with Lornoxicam resulted in a favorable significant decrease in the appearance of postoperative pain compared to Flurbiprofen and placebo during the first phases of postoperative healing following the surgical avulsion of the impacted mandibular third molar.During recent years, several NSAIDs have been demonstrated to be effective among anti-inflammatory drugs for the postoperative management of pain following the extraction of impacted third molars . HoweverAmong the NSAIDs, Lornoxicam has been demonstrated to be efficacious for dental pain management ,23. MojsPektas et al.  evaluatep < 0.001) and at 6 h (p = 0.016) compared to Flurbiprofen and at 2 h (p < 0.001), 6 h (p = 0.01), and at 24 h (p = 0.018) after surgery compared with placebo, suggesting a better analgesic efficacy of Lornoxicam compared to the other treatments during the first 24 h of healing after surgery (p < 0.001) which provided additional proof of resolution of the efficacy of Lornoxicam over the entire of the study period.In the present study, a 16 mg dose of Lornoxicam exhibited a substantial analgesic effect during the first postoperative 24 h compared with 200 mg Flurbiprofen and with placebo. The group of patients who received Lornoxicam therapy showed a peak in postoperative pain at 6 h following the intervention; pain values then decreased continuously over the subsequent follow-up sessions. In contrast, the peak pain score occurred at 12 h in the placebo group and 12 h in the Flurbiprofen group and scores remained higher up, in all groups, to 48 h following surgery. Moreover, the Lornoxicam group presented significantly lower median pain scores at 2 h  of the appearance of postoperative pain in patients undergoing dental procedures, oral malignancies, or third molar surgery ,27,28.With regard to swelling values, all groups presented comparable results. The swelling can be explained by the inflammatory and edema responses that occur as a result of surgical trauma. This mechanism occurs mainly through the production of prostaglandins and cyclooxygenases, which are synthesized following arachidonic acid release from the cell membrane of cells at the surgical site . DespiteThe assessment of trismus, measured by comparing the maximum mouth opening values obtained at baseline to those obtained at each follow-up session, showed a significant decrease in the Lornoxicam group at 24, 72 h and 5 days after surgery. Similarly to the present study, Norholt et al , who perPositive effects of Lornoxicam include its association with fewer episodes of pyrosis and upper and lower gastrointestinal lesions compared to other NSAIDs, also in patients with periodontal disease or who underwent oral anticoagulant therapy ,32,33,34During the last few decades, different drugs have been proposed with the aim of reducing postoperative discomfort by helping to reduce pain and swelling following surgery without causing adverse effects. Identifying even more effective drugs or combinations of drugs for pain management following third molar surgery, with the purpose of discovering treatment strategies other than NSAIDs or corticosteroids, should be encouraged.This study suggests that Lornoxicam used as postoperative therapy after third molar surgery shows favorable effects in the first phases of perioperative pain management compared to Flurbiprofen and placebo. However, there were no differences between treatments for the reduction of postoperative swelling and trismus.The results of this preliminary study are encouraging; however, further research is required to provide a better understanding of the potential benefits of Lornoxicam in postoperative therapy following impacted third molar surgery."}
+{"text": "Purpose: Healthiness is constructed, in Western culture, as a\u00a0moral ideal or\u00a0supervalue. This paper will interrogate the assumption that health and the pursuit of healthiness is always and unquestionably positive, by exploring how discourses of health and freedom interact to reinforce the current inequalities and detract from social transformation. Method: Twenty young South African adults were interviewed about their understandings and experiences of health. These discussions were analysed using Foucauldian discourse analysis. Results: Participants constructed healthiness as facilitating the experience of freedom, while at the same time being dependent on a\u00a0personal orientation towards freedom . Freedom discourses also played a\u00a0role in connecting health to neoliberal discourses idealizing economic productivity and hard work. Participants were able to construct a\u00a0self that is active, productive, valuable, hopeful, and self-assured\u00a0when talking about health using discourses of freedom. However, these discourses also functioned to moralise and idealise healthiness, which contributed to blaming poor health on its sufferers. Conclusion: Health/freedom discourses can further reinforce the neoliberal value of individual responsibility by constructing self-improvement\u00a0and self-work\u00a0as the solution to ill-health,\u00a0thereby contributing to victim-blaming and weakening support for public health interventions. Freedom is also unique in that it is the mother of all values. If we consider such values as honesty, love, or courage, we find, strangely enough, that they cannot be placed parallel to the value of freedom.May, \u201cThere is more than one kind of freedom,\u201d said Aunt Lydia. \u201cFreedom to and freedom from. In the days of anarchy, it was freedom to. Now you are being given freedom from. Don\u2019t underrate it.\u201dAtwood, \u201cThe truth is that we are not yet free; we have merely achieved the freedom to be free, the right not to be oppressed. We have not taken the final step of our journey, but the first step on a longer and even more difficult road. For to be free is not merely to cast off one\u2019s chains, but to live in a way that respects and enhances the freedom of others. The true test of our devotion to freedom is just beginning.\u201dNelson MandelaFoucault  emphasizThis section will briefly outline the relevance of neoliberalism in relation to discourses of freedom and health. The concept of freedom will then be explored in more depth, focusing on its value in contemporary societies, including South Africa and how it relates to health. Finally, the concept of healthism will be addressed, introducing one of the dominant health discourses of relevance to the present discussion.This research is located within ongoing efforts to reduce inequality and promote well-being in South Africa, however with respect to health, it diverges from both the state project of implementing public medical services, and the tacit project of globalised lifestyle media and consumer culture linking health to the marketing of personal lifestyle choices. This latter popular cultural form is in fact the object of investigation in this study. Our assumption is that it is only by formally identifying this network of ideas and critically examining how it functions, both in constructing individual identities and legitimating social policies, that we can identify some of the negative consequences of this specific construction of \u201chealthiness\u201d.Neoliberalism is the most recent form capitalism has taken, and is characterised by deregulation of market forces and the reduction of social welfare programs, amongst other social, political and global changes Kotz, . AlthougFreedom can be understood as the power people have to help themselves, to have an effect on the world, and to determine action without being hindered. As an ideal it is highly valued in many contemporary societies. Varman and Vikas  regard ffrom or freedom to. To be considered free one must be liberated from, \u201cbondage or slavery,\u201d  living in urban areas of Durban, Cape Town and Johannesburg .Freedom discourses when used in discussions around health often result in the understanding of health as an avenue to the experience of freedom.allow you then to operate optimally\u2018 and \u2018to do what you need to do\u2018. There is a general lack of specificity in the particular activities they would like to be doing and that a state of healthiness allows for. This indicates that the specific activity is not really the point and instead, it is the opportunity to choose what one will do without restriction that is appealing. Being healthy is understood to allow them a sense of freedom in how they live and what they can choose to do. Health is constructed as facilitating opportunities for action and the freedom to function \u201cnormally\u201d.Christina:Ja and its [health] just all the different aspects that make you a sort of functioning human on a day to day basis.Isobel:\u2026also being able to function well and kind of play a role in society as well.Owen:They have better energy, they have better capacity, and they have a socially positive approach to life\u2026Owen:\u2026all sorts of routines that support your health that allow you then to operate optimally.Christina:I think also we construct sort of roles and plans for our lives and dreams for our families and a lot of that is reliant on our health and to fulfil those rolesMany of the participants discuss the idea that being healthy allows for opportunities. Health was framed as empowering individuals to choose what they wanted to do without constraint. In the following quotes, participants use vague phrases such as \u2018live your life \u2026 freely\u201d, \u201cmake you a sort of functioning human on a day to day basis\u201d, \u201cfunction well\u201d, \u201cbetter capacity\u201d, \u201call sorts of routines\u201d, \u201cdo what I need to do\u201d show how the things that health enables participants to do are wide-ranging. From this point of view, it appears that health is necessary for any number of activities or goals. This is related to Wright, Flynn and MacDonald\u2019s (2006) findings where fitness was constructed as \u201cenabling\u201d. It is also a possibility that it is not only that their health needs to be good in order to complete certain tasks or achieve certain goals but also that good health facilitates the life they want. Bauman .These ideas of \u201cBauman\u2019s  Liquid Mtersen\u2019s  book Hoplightness and energy are supplemented by an avoidance of heaviness or being sedentary. This idea was both used to subtly criticize bodies labelled \u201cfat\u201d or \u201clazy\u201d, but also to defend against certain other kinds of ideal healthiness as is seen in Nathan\u2019s quote below. Certain forms of health were evaluated as superior to others based on their facilitation of freedom as mobility and agility.Nathan:I would never want to do bodybuilding because if your muscles are too big I feel like you\u2019re not mobile, you not agile, so I\u2019m quite a big built person but I prefer being toned because I feel like I can still have a little bit of speed and agility so um I\u2019m feeling I basically want to be more toned\u2026Discussions of freedom and bodybuilding\u201d which would require intense dedication, commitment, effort and sacrifice as he frames it in a way that makes it restrictive and therefore unappealing- \u201cyou\u2019re not mobile, you not agile\u201d. This kind of defensiveness is often seen in the participants\u2019 speech in this study. The emphasis in Nathan\u2019s quote on having a body that is functional and effective rather than aesthetically idealised, was also noted in a study by Pl\u00fcg and Collins  because she was able to overcome the limitations of her Meredith:I know at [company name] at the beginning of every- you tell your project leader this is what I\u2019m doing here and these are my goals to exercise, it\u2019s actually, the way they regiment it, it made me quite scared. You\u2019ve gotta tell them that you wanna exercise this many times a week, you wanna do this this many times a week, and then at the end of the week you\u2019ve gotta tick a form that says did you do this, did you do, this did you do that. So they can see if you\u2019re keeping up with your own health goals which is cool, but like I said it regiments it, and it doesn\u2019t become this free relationship and the enjoyment in exercise that it should be\u2026Also eating healthily\u2019s definitely on there, eat vegetarian once a week\u2026 your KPIs- key performance indicators, that\u2019s what you sent in the beginning.The intersection of discourses of freedom, health and productivity is particularly interesting in the context of corporate wellness programs. Some corporations provide employees with a number of health resources and yearly check-ups involving lifestyle assessments in a bid to improve employee wellbeing. This pursuit is believed to improve productivity and efficiency. The idea is that if employees are healthy they will be happy, positive and productive  seem to be prescribed. The dynamic Meredith describes, where individuals propose certain goals and are then supposed to account for their performance at the end of each week, is an illustration of the productive nature of biopower  are experienced as \u201cfree\u201d from external impositions. This understanding and experience of individual freedom of choice functions to successfully conceal the other ways in which power acts to govern individual conduct.However, Meredith is critical of this corporate wellness strategy, and resists it by also constructing ideal health behaviours as existing outside of power relations between people. She says that an individual\u2019s relationship to their own exercise should be Many companies have corporate wellness strategies that are less obviously regulatory than the one described by Meredith. They may offer team building exercises, healthy food options at work, and on-site exercise resources  is purposefully opaque. If health is viewed as key to performing any activity you could want, then it also means that improving health can be seen as mutually beneficial both to individuals as well as to corporations and This idea of health enabling a freedom to work is facilitated by the value our societies place on working and earning money. Definitions of success often rest heavily on material wealth and having the capacity to purchase symbols of success or certain lifestyles that are seen as indicative of success and worth James, . The ideRose  argues tThis paper explores how popular ideas of health are constructed using discourses of freedom, highlighting the potential implications these constructions have for both individuals\u2019 personal experiences of health, and for broader social structures. The analysis outlines the complex ways in which healthiness was constructed as freeing, highlighting how these shape individual lifestyle choices. In addition, the analysis provides a critique of the influence of neoliberal capitalism in these freedom/health discourses, particularly in the context of corporate wellness programmes. It has been argued that constructions of health that draw on discourses of freedom serve individuals as they allow them to resist certain prescriptive health ideals and facilitate a personal sense of hope. At the same time, however, they function negatively by concealing the ways in which health discourses can be individualising, stigmatising, and contribute to an increasingly marginalising social system by detracting from the importance of collective social welfare resources.Limitations and future researchOne of the limitations of this study is related to the lack of diversity in the sample. Although individuals from a range of \u201cracial\u201d categories and class backgrounds were interviewed, the majority of the participants identified as \u201cwhite\u201d and were from middle class backgrounds. Therefore, whilst the analysis provides an in-depth exploration of a small group\u2019s use of health discourses, discourses used by individuals from poorer or rural backgrounds or from racial categories other than \u201cwhite\u201d may not have come through as strongly as they would have had the sample been more diverse. The relatively small percentage of individuals who were from working-class backgrounds may be partially a result of the level of wealth or leisure time required to actively engage in the kinds of health promotion activities that are socially valued. A relatively good level of health- which is likely related in certain ways to class and race groups- may have played a role in the willingness of participants to be interviewed for this study.The lack of diversity mentioned above also relates to the reported health statuses of the participants. The group of individuals who were interviewed all described themselves as relatively healthy at the time of the interview, none were chronically ill and none were disabled. This may have influenced the kinds of discourses which were taken up and the ways in which these discourses played a role in the constitution of subjects. This also meant that this study wasn\u2019t able to explore the effects of these discourses on the subjectivities and experiences of those who would be more marginalised by them. This is an important area to explore in future studies."}
+{"text": "Median time to reach re-injection criteria was significantly longer for abobotulinumtoxinA (156 days) than placebo . Eleven (39.3%) patients receiving abobotulinumtoxinA did not require re-injection for \u226528 weeks versus two (14.3%) in placebo group. In this exploratory study, early abobotulinumtoxinA treatment significantly delayed time to reach re-injection criteria compared with placebo in patients with post-stroke ULS. These findings suggest an optimal time for post-stroke spasticity management and help determine the design and sample sizes for larger confirmatory studies.The ONTIME study investigated whether early post-stroke abobotulinumtoxinA injection delays appearance or progression of upper limb spasticity (ULS) symptoms. ONTIME (NCT02321436) was a 28-week, exploratory, double-blind, randomized, placebo-controlled study of abobotulinumtoxinA 500U in patients with ULS  2\u201312 weeks post-stroke. Patients were either symptomatic or asymptomatic (only increased MAS) at baseline. Primary efficacy outcome measure: time between injection and visit at which re-injection criteria were met . Forty-two patients were randomized (abobotulinumtoxinA 500U:  Spasticity, arising from involuntary activation of muscles, may lead to pain, disability, functional impairment, and eventually, contractures . Post-stBotulinum toxin A (BoNT-A) safety and efficacy in chronic focal spasticity treatment is well established ,15,16. BPrimary objective: assessment of time between upper limb (UL) injection of abobotulinumtoxinA (\u226412 weeks post-stroke) and the appearance or progression of symptomatic ULS. For this, ONTIME used a composite index, consisting of pre-selected, clinic-based, observable re-injection criteria, focused on hypertonicity and functional symptoms of spasticity.Secondary objectives: assessments of muscle tone in primary targeted muscle group (PTMG), UL active motor function, time to reach re-injection criteria stratified by baseline symptomatic/asymptomatic spasticity and global assessment of change. Concomitant non-drug therapy sessions were recorded.n = 28; placebo, n = 14). Safety and intention-to-treat (ITT) populations included all randomized and injected patients (n = 42). The per-protocol population included 40 (95.2%) patients. Two (4.8%) patients withdrew from the study: one patient (abobotulinumtoxinA) withdrew consent, and one (placebo) was lost to follow-up and excluded .Median  time between injection and meeting re-injection criteria was significantly longer for abobotulinumtoxinA (156.0 [86.0\u2013206.0] days) vs. placebo  did not meet re-injection criteria until after Week 12, vs. 5/14 (35.7%) for placebo . At studp = 0.0384; Wilcoxon: p = 0.0798). The asymptomatic cohort had insufficient patients (n = 10) for robust statistical testing.For the symptomatic spasticity cohort, a significant difference was observed between abobotulinumtoxinA and placebo . After Week 12, no robust calculation could be completed due to low placebo group patient numbers.Differences in muscle tone between abobotulinumtoxinA and placebo were statistically significant at first post-baseline assessment (Week 4) to Week 12, with the maximal decrease in muscle tone observed at Weeks 6 and 8 with abobotulinumtoxinA . At Weekp = 0.8754) and motor function improved with abobotulinumtoxinA until Week 12 (11.1 [3.5]).No statistically significant differences in motor recovery scores were observed. As most placebo group patients met re-injection criteria at Week 4 , motor fp = 0.6128); however, numerically higher proportions of patients treated with abobotulinumtoxinA were assessed as \u2018better\u2019 or \u2018much better\u2019  patients received concomitant non-drug therapies for PSS in their affected UL, including physiotherapy (85.7%) and occupational therapy (31.0%). Mean duration of physiotherapy was 157.9 days with abobotulinumtoxinA and 126.1 days with placebo . PatientConcomitant medications received during the study are described in Twenty-three treatment-emergent adverse events (TEAEs) occurred in 12 patients ; most wen = 11) who received abobotulinumtoxinA had not reached re-injection criteria, vs. 14.3% (n = 2) for placebo. These substantial benefits of abobotulinumtoxinA over placebo were observed despite any potential influence of the high level of concomitant non-drug therapy use in each group. AEs were similar between groups and there were no related TEAEs.The ONTIME exploratory study assessed whether abobotulinumtoxinA 500U, administered 2\u201312 weeks after stroke, delays development of symptomatic spasticity in adult patients with increased muscle tone (MAS \u2265 2). Baseline MAS \u2265 2 was based on results from a previous study . AbobotuWhile based on goals, a physician\u2019s decision to inject BoNT-A is not driven by increased muscle tone alone but by signs of impaired function, pain, or both, which can differ in presentation among patients. Thus, the novel composite re-injection criteria used in ONTIME, combining hypertonicity and associated symptoms of spasticity, may make the present results particularly relevant to clinical practice. Spasticity-related clinical accompaniments of the composite re-injection criteria were included, based on previous findings that identified pain, involuntary movements, and impaired active and passive function as key treatment goal areas for patients with post-stroke ULS . In thisThe long time to reach re-injection criteria observed during the ONTIME study (156.0 days for abobotulinumtoxinA vs. 32.0 days for placebo) is supported by the ABCDE-S study, which also assessed single injections of abobotulinumtoxinA 500U to hypertonic upper limb muscles . In bothWhile the ONTIME study suggests early abobotulinumtoxinA injection delays symptomatic spasticity development, the effects may not be restorative to maladaptive changes in the brain, due to the finite duration of treatment effect. However, early treatment may modify disease progression before secondary local biomechanical changes occur ,23,24. DEarly intervention with abobotulinumtoxinA and longer time to symptomatic spasticity progression may positively impact patients\u2019 lives with fewer injections and healthcare provider visits. In addition to patient benefit , early abobotulinumtoxinA has shown reduced caregiver burden in previous studies ,33. ExteAs ONTIME was an exploratory study, the sample size was chosen on the basis of determining the sample size estimation for further confirmatory studies, thus the generalization of efficacy and safety results should be approached with caution. ONTIME study limitations include low numbers of asymptomatic patients at baseline. Additionally, although a trend for improving motor recovery with abobotulinumtoxinA was observed until Week 12, a robust effect was not established due to limited placebo group data. If Fugl\u2013Meyer assessments were performed in all patients until Week 12, or the trial extended, an improvement in active motor function may have occurred. Difficulties in demonstrating motor function improvements with BoNT-A vs. placebo have been experienced previously ,26. FutuThe ONTIME exploratory study demonstrated that early administration of abobotulinumtoxinA, 2\u201312 weeks post-stroke in patients with spastic paresis, significantly increased time to re-injection criteria fulfilment, compared with placebo, due to prolonged MAS improvements and delayed appearance of spasticity symptoms. Due to the trial design, it was not possible to demonstrate significant differences in motor function. Safety results corresponded to the known profile of abobotulinumtoxinA, and no new safety signals were identified. These results demonstrate that early abobotulinumtoxinA has a good safety profile, may modify the disease course, delay symptom presentation, and lead to healthcare savings. These data provide a basis for future trials to select sample sizes that can confirm these results.Full details of the ONTIME study (NCT02321436) protocol have been published . ONTIME This study asked whether early abobotulinumtoxinA treatment, in patients with post-stroke ULS, delays time between injection and fulfilment of re-injection criteria (Class I evidence).ONTIME was a Phase IV, prospective, exploratory, double-blind, randomized, placebo-controlled trial, conducted at four centers in Malaysia, Thailand, Singapore, and the Philippines, initiated in December 2014 and completed in March 2016.\u25cb\u2018In general, how much does spasticity impact the following activities of daily living and/or your rehabilitation program: hygiene , dressing the affected limb, positioning the affected limb, splint application or removal?\u2019Impaired passive function .\u25cb\u2018In general, how much does spasticity impact the following activities of daily living and/or your rehabilitation program: reaching, grasping, releasing, gripping, holding, bimanual function, manipulating objects, dexterity, fine motor skills, lifting and carrying?\u2019 Impaired active function .Presence of involuntary movements, which occur during standing up, walking, and transfers  .Pain  .\u25cbAverage pain intensity over 1 week was collected.Question to each patient was oriented to obtain a relevant answer. Answers were spontaneous and not condition-dependent . A support could be used to help patients assess pain.Inclusion criteria included age 18\u201380 years, 2\u201312 weeks after first ischemic/hemorrhagic stroke onset, presence of ULS defined as MAS \u2265 2  in PTMG.Further details of inclusion and exclusion criteria are detailed in the published protocol .Patients were randomized, using an interactive web response system (IWRS) service, to abobotulinumtoxinA or placebo in a 2:1 ratio . The double-blind status of treatment allocation was ensured via separate lists for randomization and treatment numbering. Products were similar in size, color, smell, taste, and appearance. In exceptional instances of an AE, the blind could be broken on an individual basis following review with the Central Department of Pharmacovigilance at Ipsen, or if necessary, by the investigator obtaining a patients\u2019 treatment identification from the IWRS.\u00ae, Ipsen Pharma SAS, Paris, France), packed in vials containing 500U BoNT-A hemagglutinin complex or excipients of the investigational product, respectively. Vials were reconstituted with 2.5 mL of preservative-free sodium chloride for injection . Doses were administered per muscle according to investigators\u2019 judgements. Recommended dosing regimens were previously published [Patients received intramuscular injections, administered using a 25-gauge needle, of abobotulinumtoxinA 500U or equal volume placebo into selected muscles. AbobotulinumtoxinA and placebo were provided as white lyophilized powders for reconstitution  and visit at which both re-injection criteria were fulfilled .Re-injection criteria, evaluated at every visit from Week 4, assessed appearance/reappearance of symptomatic spasticity. \u2018Appearance\u2019 was assessed for patients asymptomatic and \u2018reappearance\u2019 for patients symptomatic at baseline.Secondary assessments included change in muscle tone (MAS) in PTMG, assessed at baseline and each subsequent visit. Active motor function in affected UL was evaluated using Fugl\u2013Meyer assessment  for: upper extremity (scored 0\u201336), wrist (0\u201310), hand (0\u201314), and in terms of coordination/speed (0\u20136) ,38. GlobAEs were monitored and recorded from provision of informed consent until end of participation. TEAEs were reported, events classified as mild, moderate, or severe, and assessed for any causal relationship. Physical examinations and measurement of vital signs were performed by physicians at baseline and all subsequent visits.The study schedule has been published previously . The firN = 42) was chosen for exploratory purposes and not intended for definitive conclusions about efficacy. Statistical analyses were performed using SAS v9.2. Efficacy analyses were performed on the ITT population. Primary endpoint was analyzed by Kaplan\u2013Meier (KM) survival analysis. Median survival time and 95% CIs were estimated for each treatment group using KM product-limit estimation. Data for patients not meeting re-injection criteria at Week 28 were censored at the patient\u2019s last study visit. Treatment differences between abobotulinumtoxinA and placebo groups were tested using two-sided, stratified log-rank and Wilcoxon tests . p-values are for exploratory purpose only.The sample size . For global assessment of change, differences between treatment groups at last visit were assessed using the Cochran\u2013Mantel\u2013Haenszel statistic, controlling for symptomatic spasticity status. Homogeneity of treatment effect across strata (symptomatic/asymptomatic) was assessed by the Breslow\u2013Day test. Safety analyses were based on safety population and AEs coded using Medical Dictionary for Regulatory Activities (MedDRA) v18.0.Treatment effect for muscle tone change was assessed using analysis of variance ; data are shown as adjusted means, 95% CI, and corresponding In January 2015, the protocol was amended to correct national legal minimum age in Thailand and clarify data collection methods. A minor statistical update to secondary MAS endpoint analysis was made to replace use of covariance analysis by ANOVA."}
+{"text": "N = 21, age M = 10.81, SD = 1.89) and without  developmental coordination disorder (DCD) during an adaptive locomotion task. Participants walked at a self-selected pace along a pathway, placing their foot into a raised rectangular floor-based target box followed by either no obstacles, one obstacle, or two obstacles. Stepping kinematics and accuracy were determined using three-dimensional motion capture, whilst gaze was determined using mobile eye-tracking equipment. The children with DCD displayed greater foot placement error and variability when placing their foot within the target box and were more likely to make contact with its edges than their typically developing (TD) peers. The DCD group also displayed greater variability in the length and width of their steps in the approach to the target box. No differences were observed between groups in any of the gaze variables measured, in mediolateral velocity of the center of mass during the swing phase into the target box, or in the levels of self-reported state-anxiety experienced prior to facing each task. We therefore provide the first quantifiable evidence that deficits to foot placement accuracy and precision may be partially responsible for the increased incidence of trips and falls in DCD, and that these deficits are likely to occur independently from gaze behavior and state-anxiety.This study examined stepping accuracy, gaze behavior, and state-anxiety in children with ( Developmental Coordination Disorder (DCD), also known as dyspraxia, affects around 5% of children and is characterized by difficulties in general motor skill learning and execution, which are independent of intellectual problems, visual impairments, and physical or diagnosed neurological disorders . The movAlthough laboratory studies have demonstrated that stability of gait is lower in children with DCD  and thatOne potential mechanism of walking difficulties in DCD is the coupling between the visual and locomotor system. When navigating complex environments vision is critical for the acquisition of necessary information to guide safe stepping behavior. For example, when faced with stepping over a future obstacle, individuals typically look several steps ahead, fixating the obstacle and other task-relevant areas to plan future foot placement . AdditioAnother potential mechanism for the movement problems in DCD, that has been hitherto unexplored, is the link between stepping accuracy and mental health issues, such as anxiety . There iThe aim of the current experiment was to provide the first detailed account of the visuomotor control of stepping in children with and without DCD and to determine the extent to which deficits in stepping accuracy may be explained by anxiety and gaze behavior. Building upon recent insights to gaze behaviors during precision stepping in adults with DCD , we repoForty-seven participants aged between 8 and 15 years of age participated in the study, of which 28 were initially recruited for our DCD group. Participants in the DCD group were recruited using social media and from local DCD support groups, whilst participants in the TD group were recruited from the children of student and staff members of Liverpool John Moores University. The children in the DCD group satisfied the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) criteria . For exaA 12 infra-red camera motion capture system  collected whole-body kinematic data at 80 Hz, with a total of 38 reflective markers placed on the feet, lower legs, thighs, pelvis, torso and head according to the conventional Plug-in Gait marker set. This included several additional markers to optimize segment tracking, one of which was placed on the \u201cfoot center\u201d to guide each child\u2019s stepping behavior (see below). Finally, a triangular cluster of three reflective markers (14 mm diameter) were placed on each shoe over the forefront to track virtual landmarks created by a digitizing wand  at the anterior-inferior (toe-tip) and posterior-inferior (heel-tip) point of each shoe. Marker trajectories were labeled and gap-filled using Qualisys Track Manager (QTM) before being exported as.c3d files to enable model application in Visual3D . Finally, data were exported and analyzed in MATLAB . All trajectories were smoothed using a bi-pass second order Butterworth low-pass digital filter with a 6 Hz cut-off.Eye movements were recorded using a Pupil Labs binocular eye-tracking headset  that fea1, which encompasses a 10-point \u201csmiley-face\u201d Likert scale ranging from 1 (low levels of anxiety) to 10 (high levels of anxiety). Specifically, each child was sat down on a chair and given a brief introduction to the thermometer. They were then asked how worried or anxious they currently felt about being in the laboratories and wearing our equipment. These simple scales have previously been validated against larger and more complex state-anxiety inventories , the lab was marked out ready for the testing protocol. Baseline levels of state-anxiety were then measured using a child-friendly \u201cfear thermometer\u201dentories .The present study adopted a modified-version of the protocol previously used by The target box was a raised blue rectangular sponge outline with edges that were 5 cm high and 4 cm wide. Bespoke target boxes were created for each participant, ensuring that the length of the inside stepping area was 8cm plus the length at the longest part of the participant\u2019s right shoe, and the width was 8cm plus the width at the widest point of the participant\u2019s right shoe. The obstacles were formed using two 30 cm \u00d7 10 cm \u00d7 5 cm (height \u00d7 depth \u00d7 width) stabilizing wooden blocks positioned either side of a 4 cm \u00d7 4 cm \u00d7 65 cm polystyrene rectangular block. To also ensure the obstacles presented the same stepping constraint for each participant, the polystyrene block was attached to each stabilizing block using Velcro so it could be positioned at a height equating to 12% of body height. This height was chosen to closely match the constraints previously shown to induce fall-related anxiety in older adults .Participants were informed that their goal was to reach the end of the course without knocking over the target box and/or the obstacles. Participants were also informed that they should step into the target box \u201cas accurately and centrally as possible\u201d \u2013 doing their best to minimize the distance between the additional \u201cfoot center\u201d marker and what they perceived to be the center of the box. Three task difficulties were used: (1) no obstacles following the target box (Target only), (2) one (near) obstacle following the target box (One obstacle), (3) two (near and far) obstacles following the target box (Two obstacles). Participants completed five successive trials of each difficulty (one block). The order of each block was randomized . Participants started each trial with their eyes closed, and after ten seconds, were verbally cued to \u201copen\u201d their eyes and initiate the trial. Starting each trial in this manner enabled route-previewing to be better standardized across participants and provide a point from which gaze data could be recorded. Immediately prior to each block of 5 trials, participants were again asked to report their levels of state-anxiety to determine how task difficulty influenced anxiety. Specifically, each child was asked how worried or anxious they currently felt about performing the upcoming set of trials.Foot placement error within the target box was determined as the relative distance between the foot center and the target center when the foot was placed inside the target. Foot center was calculated as the mid-point between the toe-tip and heel-tip. Target center was calculated as the mean of the four reflective marker  coordinates positioned on each corner of the target box. Both absolute error, constant error and variable error were calculated in the anteroposterior and mediolateral directions separately. Absolute error was defined as the mean scalar foot position distance (regardless of position) relative to the target center, reflecting foot placement accuracy. Constant error was defined as the mean vector foot position displacement (\u00b1) relative to the target, reflecting foot placement bias. Variable error was defined as the variability (one standard deviation) of the constant foot placement error across trial repetitions, reflecting precision of foot placement . Unlike Heel-strike and toe-off gait events were determined using the local maxima and local minima of the heel and toe referenced to the pelvis segment, respectively . Using tGaze fixations were defined as a gaze stabilization on a location in the environment for three frames or longer (corresponding to \u223c90 ms). Fixations were classified as being spatially located on one of three primary areas of interest: (1) immediate walkway ; (2) target box; (3) distal walkway . We chose to classify distal fixations as a single area of interest given their low summed-frequency, and to allow comparisons between the three task difficulties. These areas of interest were used to determine the duration spent fixating each location prior to stepping in the target box. Fixation durations were also normalized to individual trial length by presenting data as the percentage of time spent fixating each area of interest from the point when participants opened their eyes following the \u201copen\u201d cue, until the time when they stepped into the target box. We also measured the timing of the final gaze transfer toward the target box and the final gaze transfer away from the target box relative to foot contact within it, with a negative value denoting an early transfer of gaze. Other gaze variables included mean fixation duration, fixation rate (number of fixations per second), and number of gaze transfer between areas of interest.post hoc analyses were performed using pairwise comparisons with Sidak-corrections to account for the multiple comparison problem (p2), common indicative thresholds for which are small (0.01), medium (0.06) and large , within-subject effects of task difficulty , and interaction between terms. Significant effects were probed by polynomial trend analyses, and  problem . ANOVA ege 0.14; . The resrge 0.5; . All staF = 21.063, p < 0.001, \u03b7p2 = 0.363, and constant AP error, F = 7.020, p = 0.012, \u03b7p2 = 0.159. Children with DCD had greater absolute AP error (M = 2.6 cm) compared to TD children (M = 1.6 cm) and tended to undershoot their foot placement (M = \u22121.1 cm) compared to TD children (M = 0.2 cm). A significant main effect of Group was also observed for AP, F = 9.932, p = 0.003, \u03b7p2 = 0.212, and ML variable error, F = 10.011, p = 0.003, \u03b7p2 = 0.213. Children with DCD exhibited greater AP (M = 2.1 cm) and ML (M = 1.3 cm) variable error compared to TD children . There was also no main effect of Difficulty, or interaction between Difficulty and Group, for all foot placement variables  compared to the TD group (M = 1.00 \u00b1 1.24).Results from a Mann\u2013Whitney F = 2.968, p = 0.058, \u03b7p2 = 0.074, but was significantly described by a linear polynomial trend  with fastest approach speeds observed when faced with the target only (M = 0.995 m/s) and slowest approach speeds observed when faced with two obstacles (M = 0.969 m/s). There was no main effect of Group, F = 3.273, p = 0.079, \u03b7p2 = 0.081, and no Group \u00d7 Difficulty interaction, F = 0.174, p = 0.841, \u03b7p2 = 0.005.The main effect of difficulty failed to reach significance, F = 6.423, p = 0.016, \u03b7p2 = 0.148, with greater variability observed in the DCD group (M = 10.6 cm) compared to the TD group (M = 6.7 cm). There was also a main effect of Group for step width variability, F = 4.958, p = 0.032, \u03b7p2 = 0.124, with greater variability again observed in the DCD group (M = 5.0cm) compared to the TD group (M = 3.8 cm). There was no main effect of Difficulty and no Group x Difficulty interaction for either step length or step width variability.Results showed a significant main effect of Group for step length variability, F = 0.128, p = 0.722, \u03b7p2 = 0.003, no main effect of Difficulty, F = 0.228, p = 0.796, \u03b7p2 = 0.006, and no Group x Difficulty interaction, F = 1.00, p = 0.373, \u03b7p2 = 0.026, in the maximal mediolateral CoM velocity during the swing phase into the box. There was also no effect of Group, F = 1.762, p = 0.193, \u03b7p2 = 0.045, no effect of Difficulty, F = 0.137, p = 0.872, \u03b7p2 = 0.004, and no Group \u00d7 Difficulty interaction, F = 1.914, p = 0.155, \u03b7p2 = 0.049, in the inter-trial variability (1 SD) of maximal CoM mediolateral velocity.There was no main effect of Group, Gaze fixations to task related areas of interest accounted for an average of 75.0, 73.7 and 73.5% of the total time taken to step into the target box for the Target-only, One obstacle, and Two obstacle conditions, respectively. There were no significant differences between groups for fixation duration, fixation rate, number of gaze transfers between AOI\u2019s, the total time spent fixating each AOI, or the onset of the final gaze shift toward the target prior to heel contact. These data are presented in U-tests were utilized to investigate between participant effects. A Friedman\u2019s ANOVA showed the allocation of gaze to significantly differ between AOI\u2019s when faced with the target alone, X(2) = 54.500, p < 0.001, one obstacle, X(2) = 52.757, p < 0.001, and two obstacles, X(2) = 47.197, p < 0.001. Follow-up Wilcoxon tests with Bonferroni corrections (\u03b1 adjusted to 0.0167) showed that for all task difficulties gaze-allocation was significantly greatest for the target-box (ps < 0.001), whilst there was no significant difference in gaze allocation between the immediate walkway and distal AOI\u2019s (ps < 0.065). A Friedman\u2019s ANOVA also showed distal fixations to significantly change across task difficulties, X2(2) = 11.123, p = 0.004, with Wilcoxon tests with Bonferroni corrections (\u03b1 adjusted to 0.0167) showing significantly greater distal fixations to occur when faced with either one obstacle, Mdn = 7.00%, z = -2.855, p = 0.004, r = -0.4694, or two obstacles, Mdn = 7.00%, z = -2.812, p = 0.005, r = -0.4623, compared to the target alone (Mdn = 2%). Fixations to the immediate walkway, X(2) = 2.279, p = 0.320, and to the target box, X(2) = 3.748, p = 0.153, did not significantly change across task difficulties. Finally, separate Mann-Whitney U tests comparing the spatial allocation of gaze between TD and DCD groups for each AOI, and across each task difficulty, failed to show any significant differences between groups (ps > 0.176). These data are presented in As data for gaze location were non-normally distributed, Friedman\u2019s ANOVA\u2019s was utilized to investigate within-participant effects and Mann\u2013Whitney F = 8.128, p = 0.001, \u03b7p2 = 0.203, with post hoc comparisons revealing significantly earlier transfers of gaze when faced with one obstacle  or two obstacles  compared to when faced with the target box alone (M = 121 ms). There was no main effect of Group, F = 0.004, p = 0.948, \u03b7p2 = 0.000, and no Group \u00d7 Difficulty interaction, F = 0.986, p = 0.379, \u03b7p2 = 0.030  = 12.854, p = 0.005, with post hoc Bonferroni corrected (\u03b1 = 0.012) Wilcoxon signed ranks tests revealing significantly higher levels of anxiety at baseline (M = 2.06) compared to when faced with the target only  and when faced with one obstacle . Results from separate Mann\u2013Whitney U-tests showed no significant differences between groups at any point of measurement (ps > 0.075). These data are presented in A Friedman\u2019s ANOVA showed anxiety to significantly differ across each instance of measurement, The present study is the first to quantify foot placement accuracy in children with DCD and to determine the underlying characteristics of gaze and anxiety. Our results show that children with DCD are less accurate than their TD peers when tasked with precisely placing their foot within a floor-based target and are more likely to accidentally contact its edges. The DCD group primarily showed lower foot placement accuracy than the TD group in the anteroposterior plane, which, when considering constant foot placement error , appeareContrary to our hypotheses, no differences in gaze behavior were found between groups on any metric reported. Both groups allocated the majority of their gaze toward the target box during the approach toward it, with fixations to the distal pathway minimal, yet increasing when a future obstacle(s) had to be negotiated . The timing between looking away from the target box and stepping within it was also similar between groups, occurring approximately 120 ms after foot contact when faced with the target alone, and approximately at the instant of foot contact (\u223c10 ms) following the introduction of an obstacle(s). These similarities may be explained by the fact that our DCD participants did not experience heightened state anxiety pertaining to the completion of our task. Indeed, anxiety was generally low and highly variable in the DCD group, with at least 50% of the cohort reporting the lowest possible levels of anxiety prior to facing each of the three walking tasks. Anxiety was also highest at baseline for both groups, which suggests an anxiety response unrelated to the fear of falling, such as the fear of performing to unfamiliar people in unfamiliar surroundings (i.e., social phobia, see Given the similarities in gaze behavior and anxiety between the DCD and TD groups, the results of the present study suggest that difficulties producing precise stepping actions in children with DCD occur independent of anxiety and overt attentional processes related to gaze behavior. As such, fall-risk in children with DCD may be better-explained by general deficits in neuromuscular control and the integration of acquired perceptual information during locomotion. For example, previous research has shown children with DCD exhibit greater variability in their shank and thigh movements during gait, suggesting an inherent difficulty controlling the lower limbs during locomotion . The extabsence of task-related anxiety. It is therefore important for future research to experimentally manipulate anxiety if we are to fully explore its role in fall-risk in children with DCD.The results of this study may be limited by several factors. For example, it is important to acknowledge that our sample size is relatively small, and the age range of our participants is relatively heterogenous. Researchers should therefore take care when extrapolating our findings to children with DCD of all ages given evidence that the control of visually guided stepping goes through distinct changes throughout development  and thatTo conclude, our findings provide the first quantifiable evidence that children with DCD display reduced foot placement accuracy and precision compared to their TD peers. We also provide evidence that these reductions in foot placement accuracy are likely to occur independently of differences in gaze behavior and anxiety, suggesting a general deficit in neuromuscular control and a reduced ability to rapidly integrate perceptual information from the visual, proprioceptive and vestibular systems to guide stepping actions. However, as state anxiety was generally low, more research is needed to explore whether children with DCD may be more susceptible to anxiety-driven maladaptive gaze under more demanding situations.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.The studies involving human participants were reviewed and approved by the Liverpool John Moores Ethics Committee. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.MH, RF, and GW acquired the funding and edited the manuscript. MH, RF, GW, and JP designed the study. JP undertaken the data collection, completed the statistical analysis, figure preparation, and the first draft of the manuscript. All authors approved the final version of the manuscript for submission.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Cancer diagnosis and cancer treatment can cause high levels of distress, which is often not sufficiently addressed in standard medical care. Therefore, a variety of supportive nonpharmacological treatments have been suggested to reduce distress in patients with cancer. However, not all patients use these interventions because of limited access or lack of awareness. To overcome these barriers, mobile health may be a promising way to deliver the respective supportive treatments.The aim of this study is to evaluate the effects and implementation of a mindfulness and relaxation app intervention for patients with cancer as well as patients\u2019 adherence to such an intervention.In this observational feasibility study with a mixed methods approach, patients with cancer were recruited through the web and through hospitals in Switzerland. All enrolled patients received access to a mindfulness and relaxation app. Patients completed self-reported outcomes  at baseline and at weeks 4, 10, and 20. The frequency of app exercise usage was gathered directly through the app to assess the adherence of patients. In addition, we conducted interviews with 5 health professionals for their thoughts on the implementation of the app intervention in standard medical care. We analyzed patients\u2019 self-reported outcomes using linear mixed models (LMMs) and qualitative data with content analysis.P=.04), distress (P<.001), fatigue (P=.01), sleep disturbance (P=.02), quality of life (P=.03), and mindfulness (P<.001) over the course of 20 weeks. Further LMM analyses revealed a larger improvement in distress (P<.001), a moderate improvement in anxiety (P=.001), and a larger improvement in depression (P=.03) in patients with high levels of symptoms at baseline in the respective domains. The interviews revealed that the health professionals perceived the app as a helpful addition to standard care. They also made suggestions for improvements, which could facilitate the implementation of and adherence to such an app.A total of 100 patients with cancer  with a mean age of 53.2 years (SD 11.6) participated in the study, of which 25 patients used the app regularly until week 20. LMM analyses revealed improvements in anxiety (This study indicates that a mindfulness and relaxation app for patients with cancer can be a feasible and effective way to deliver a self-care intervention, especially for highly distressed patients. Future studies should investigate if the appeal of the app can be increased with more content, and the effectiveness of such an intervention needs to be tested in a randomized controlled trial. Cancer diagnosis and subsequent medical treatments can cause high levels of distress -4. HowevHowever, the uptake of supportive treatments in distressed patients with cancer is moderate . BarrierAlthough mHealth interventions have some advantages over web-based eHealth interventions , little is known about the best practices for the implementation of mHealth interventions ,33. In aThe aim of this study is to assess the feasibility of this mHealth intervention using the Reach, Effectiveness, Adoption, Implementation, and Maintenance (RE-AIM) evaluation framework, which was developed for the evaluation of public health interventions . AlthougFor this feasibility study, we used a mixed methods approach. For quantitative data, we assessed 4 paper-and-pencil questionnaires that were sent to patients with cancer at baseline and at weeks 4, 10, and 20. Demographics and patient characteristics were assessed at baseline, and health outcomes  were assessed over the 4 time points. Qualitative data consisted of semistructured interviews with 5 health professionals. In those interviews, we inquired about health professionals\u2019 perspectives on a mindfulness- and relaxation-based mHealth intervention for patients with cancer and its implementation in standard medical care. To receive feedback from different health professionals, we conducted 2 face-to-face group interviews (1 interview with 2 nursing experts and the second interview with 2 psychologists providing MBM treatment for patients with cancer) and 1 individual interview with an oncologist. All interviewees received access to the app before the interview and could test the app. The interviewer also demonstrated the app and its content to the interviewees before the interview started.To assess the feasibility of our mHealth intervention, we used the RE-AIM implementation science framework . EthicalPatients were eligible if they (1) had any cancer diagnosis at any stage of cancer, (2) were aged 18 years or older, and (3) owned either an iPhone (Apple Inc). or an Android-based smartphone with at least a weekly connection to the internet. Patients were excluded if they had suicidal ideation or insufficient German language skills, if they intended to move to another country, or if they had insufficient knowledge on how to use a smartphone. The patient recruitment process is described in detail elsewhere . For theAll enrolled patients received the mindfulness and relaxation app, which was specifically developed for this study and only available for patients participating in the study. The app could be downloaded in the Apple iTunes store and Google Play Store for Android devices and accessed with a code, which was provided to the patients after study inclusion. The app offered 3 exercises: mindfulness meditation, guided imagery, and progressive muscle relaxation. The exercises were included in the app as audio files with a duration of approximately 15 minutes each, and the patients could choose between a female or male narrator. Patients were free to choose which exercises they wanted to use and how often they wanted to practice. However, we recommended to the patients to use an exercise of their choice on a daily basis, ideally 5 times per week. To help patients practice regularly, the app included an optional notification feature that patients could set up to receive a daily push notification on the mobile device, reminding them to practice at an individually set time. Information about the use of exercises  was saved in the backend and was only accessible to the researchers as an XML log file. More information about the app is presented in a previously published paper .As we conducted a single-arm study without a control group, we were not able to assess the effectiveness of the app intervention. Therefore, for the RE-AIM dimension effectiveness, we looked into pre-post effects in a variety of health outcomes relevant to patients with cancer. We assessed physical, mental, and social health using the Patient-Reported Outcomes Measurement Information System (PROMIS 29) . PROMIS For the assessment of health-related quality of life for patients with cancer, we administered the Functional Assessment of Cancer Therapy\u2014General (FACT-G) ,40. The For the assessment of distress, we administered the Distress Thermometer . The DisFor the assessment of mindfulness, we administered the short version of the Freiburg Mindfulness Inventory (FMI) . The FMIWe measured anxiety and depression using the Hospital Anxiety and Depression Scale (HADS). The HADS assesses 7 items for the subscales anxiety (Cronbach \u03b1=.79) and depression (Cronbach \u03b1=.67) on a 4-point scale, with a maximum score of 21 for each subscale. A score of up to 7 is considered normal, a score between 8 and 11 is considered borderline, and a score above 11 is considered caseness .For the assessment of fear of progression, we administered the Fear of Progression Questionnaire-Short Form (FoP-Q-SF) . The FoPWe assessed PROMIS 29, FACT-G, and FMI at baseline and at weeks 4, 10, and 20 and HADS, FoP-Q-SF, and Distress Thermometer at baseline and at weeks 10 and 20. We defined a continuous app user as a patient who regularly used the app exercises (at least one exercise per week). We counted an exercise as completed if the patient played the exercise audio file for at least 10 minutes of the total time of 15 minutes. We defined an intervention dropout as a patient who stopped using the exercises for 4 consecutive weeks because regular practice might be a prerequisite for a beneficial intervention. We defined the first week when the patient stopped using the exercises as a dropout week. A patient who never used an app exercise was counted as a week 1 intervention dropout.For the RE-AIM dimension adoption, we looked at the number of completed app exercises over 20 weeks and app exercise preferences. We reported the median of completed app exercises by all enrolled patients per week as well as the median of completed app exercises by continuous app users. For exercise preferences, we reported frequencies of used exercises for all enrolled patients, stratified by gender of the patient and the narrator.For the RE-AIM dimension implementation, we reported results from interviews with health professionals regarding their opinion on the implementation of the app intervention in addition to standard medical care. In the interviews, we inquired about the general impression regarding the app, implementation of the app as an addition to standard medical care, and suggestions for improvements.t test with an \u03b1 level set at .05 and a small effect size of Cohen d of 0.28.One aspect evaluated in our feasibility study was the characteristics and number of patients with cancer who participated in the study , which was reported previously . TherefoAll printed case report forms were entered by trained researchers into the electronic database REDCap (Research Electronic Data Capture), which was hosted at the University Hospital Zurich. All analyses were carried out in SPSS version 25.0 (IBM Corp).g effect sizes were calculated as mean differences (baseline and week 20) divided by pooled SDs for each health outcome of interest.For baseline characteristics of patients, we used descriptive statistics . For the analyses of pre-post effects, we used linear mixed models (LMMs) to analyze changes over time  in health outcomes as well as differences between continuous app users and intervention dropouts in health outcomes. All patients who provided baseline data were included in the analyses, and because we used LMMs, patients with missing data in weeks, 4, 10, and 20 questionnaires were included. The dependent variables were the 7 PROMIS 29 domains, FACT-G, HADS subscales anxiety and depression, Distress Thermometer, FMI, and FoP-Q-SF. Furthermore, we looked at the changes in the respective health outcomes for subsamples with high distress (Distress Thermometer score \u22655), high anxiety (HADS anxiety score of \u22658), and high depression (HADS depression score of \u22658). As a covariance type, we used an autoregressive covariance structure (AR1). Time was included as a fixed effect. For group analyses, (continuous app users vs intervention dropouts), we added group and time-by-group as fixed effects. Hedge For the dimension implementation, we recorded the interviews and transcribed the interviews verbatim. We used thematic coding for structuring the interviews using MAXQDA 11 (VERBI Software), and we used content analysis according to Mayring .Between June 2016 and December 2018, we were able to recruit 100 patients with cancer, all of whom provided baseline information. At week 20, 72 (72%) patients completed questionnaire 4 . Baseling=0.53). The mean HADS anxiety score at baseline was 6.88 (SD 3.50) and dropped to 6.31  at week 20. Overall, 35% (35/100) of patients reported an elevated HADS anxiety score (\u22658) at baseline , which dropped to 8.85  at week 20. For HADS depression, the mean score at baseline was 4.96 (SD 2.78) and dropped to 4.55  at week 20. Overall, 20% (20/100) of patients reported an elevated HADS depression score (\u22658) at baseline , which dropped to 8.85  at week 20. For the remaining measures without a proposed threshold , changes from baseline to week 20 were small, with Hedges g effect sizes ranging from 0.04 to 0.33.The health outcome values at baseline and at week 20 as well as effect sizes for the total sample and the high distress, high anxiety, and high depression subsamples are presented in P<.001), fatigue (P=.01), sleep disturbance (P=.02), and anxiety (P=.04) measured with the HADS. Furthermore, there was a significant increase in quality of life (P=.03) and mindfulness (P<.001). No significant effects were found for physical functioning, anxiety measured with PROMIS, depression, ability to participate in social roles and activities, and fear of progression. LMM analyses for the subsamples revealed that distress decreased significantly in the high distress subsample (P<.001), anxiety decreased significantly in the high anxiety subsample (P=.001), and depression decreased significantly in the high depression subsample (P=.03). Dose-response analyses using LMMs with group-by-time revealed no significant results.The results for effects over time are presented in According to our definition, 25% (25/100) of all enrolled patients used the app continuously  at week 20 of the intervention. The average number (median) of completed exercises during the 20-week intervention for all patients as well as continuous app users is presented in The percentage of completed exercises is presented in Furthermore, female patients showed a preference for exercises with a female narrator . However, male patients preferred exercises with a male narrator . The probability of choosing the same sex in audio files is therefore increased for women by 87% and for men by 127%, which corresponds to a 2-fold higher preference for the same sex as the narrator.A total of 5 health professionals took part in an interview: 2 female nursing experts (one from an inpatient unit and the other from an outpatient oncology unit), 2 female MBM psychologists, and 1 male oncologist. Interviews were conducted between January and March 2018 and lasted for an average of 45 minutes (SD 9.54). The qualitative analysis of the interviews yielded 4 themes: (1) general impression of the app, (2) suggestions for improvement, (3) implementation in standard care, and (4) experience with recommending the app to patients.Overall, the general impression of the app was positive. For instance, the oncologist summarized his impression of the app as follows:I think [the app] is a very helpful thing because it is relatively easy [to use]. You can test it. You can try it and if you like it, you can integrate it relatively easy into everyday life. I think it is very practical. It is a practical thing and if patients are interested, I also see that they take it up willingly.All health professionals perceived the app as appealing, clearly structured, and as a helpful supportive tool. In addition, the MBM psychologists liked the app as an addition to the 10-week face-to-face MBM course and appreciated the app as a good self-help tool complementing the course. The oncologist also stated that many patients with cancer look for something they can use to add to standard care and an app can provide a low threshold aid. As a negative aspect, a nursing expert stated that a smartphone is required and not every patient possesses such a device.All health experts made various suggestions for improving the app. A shared opinion was that the content of the app  could be increased, as over an extended period, patients might get bored with a choice limited to 3 exercises. A nursing expert suggested that a new exercise could, for instance, be unlocked after completing the same exercise several times. An MBM psychologist suggested that every week, a different selection of exercises could be activated with alternating topics such as meditation, relaxation, self-compassion, or body exercises. In addition, the inclusion of exercises with different degrees of complexity was suggested. An MBM psychologist stated that exercises for beginners  as well as exercises for patients experienced in mindfulness and relaxation could be added. MBM psychologists and nursing experts also recommended that some exercises should be accompanied by soothing background music because longer periods of silence might be uncomfortable for some patients. They also recommended exercises with various lengths of time so that patients had more flexibility if they were facing time constraints or if they were too impatient for longer exercises. The oncologist mentioned that adding exercises specifically for sleep disorders might be a good addition to the app, especially for inpatients, because poor sleep in hospitals is very common. As an additional topic that could be added, he mentioned body exercises such as yoga. An MBM psychologist mentioned that an app mirroring the MBM course more closely would be great:If I could make a wish, then I would say, it would be totally cool to have an accompanying Mind Body Medicine app. That is to say that a lot of exercises\u2014not all of them\u2014but a lot of exercises we do [could be added to the app]. Possibly also guided body exercises. That would be totally cool.The interviewees mentioned several factors that could influence the implementation of a mindfulness- and relaxation-based app into standard care. Both nursing experts and one of the MBM psychologists stated that the time point when the information of the app is delivered to the patient might be important. These health professionals mentioned that the patients were bombarded with information during the first consultation or during the first day when a patient enters the hospital and additional information about the app might overwhelm some patients. The outpatient nursing expert also mentioned that they are often limited because of time constraints during consultation hours:On the one hand there are the concerns of the patients, which you have to discuss. But you also have a little bit of pressure, [to tell them] all relevant information. [...] And sometimes it\u2019s already two minutes before the end [of the consultation]. [...] And you can\u2019t just hand out the flyer. You also need to say a few words [about the app] and that\u2019s why I sometimes forgot [to mention the app]. Due to shortage of time.The nursing experts also mentioned that the nurses oftentimes forgot about the app because it is not part of standard care. Therefore, the nursing experts stated that it might be helpful to better inform the nurses about the app and setting up standards regarding the communication about the app, for example, when to inform the patients and how. In addition, the nursing experts stated that it might be helpful if they had a demonstration device at the oncology unit so that they could better explain the app to the patients. All interviewed health professionals further mentioned that patients with cancer are very diverse and that although some patients are very eager to try out various treatments, others are not. One MBM therapist also stated that not all patients perceive relaxation as important and that those patients might need some additional information which indicates why relaxation is good for them. All health professionals also stated that implementing such an app does not result in a lot of additional work for them and they appreciate the app, which they could recommend to suitable patients.Regarding their experience with recommending the app to patients, health professionals shared the opinion that female patients are more drawn to mindfulness and relaxation exercises. Furthermore, the MBM therapists stated that patients who already practiced some form of relaxation or meditation often did not participate in the study. The MBM therapists also noticed that the composition of the MBM group had an influence on how many patients were willing to try out the app. For instance, if one patient was very motivated and expressed interest in the app, hesitant patients sometimes followed suit and were willing to try the app as well. One MBM therapist also noticed that many older people were willing to use the app:I was surprised that so many older patients had the app on their phone and also used the app regularly [...]. I had the impression, that it appeals to the young. [...]. But oftentimes, the older people have more time, because they don\u2019t work anymore.In this study, we explored the feasibility of a mindfulness- and relaxation-based self-help app for patients with cancer. To evaluate the feasibility, we used the RE-AIM framework , and in For the dimension effectiveness, we looked into pre-post effects. Our results suggest that the app might have the potential to reduce distress, fatigue, sleep disturbance, and anxiety as well as improve health-related quality of life and mindfulness. This is in line with a recent pilot study , in whicAs depressive symptoms and anxiety were not significantly reduced in the total sample in our study, we also looked at subsamples with higher HADS scores. In the high anxiety and high depression subsamples, anxiety and depression, respectively, decreased significantly over time. This might indicate that a mindfulness and relaxation mHealth intervention is especially beneficial for patients with cancer with higher emotional distress. This is also in line with a study by Barth et al , where hFor adoption, our results showed that at week 20 of the intervention, 25 of 100 patients were using the app continuously. With 54 of 100 continuous app users at week 10 , this leThe results from the interviews with health professionals provide some insights into the implementation of a mindfulness and relaxation mHealth intervention into standard care. In general, all interviewed health professionals perceived the app as a helpful addition to standard care. The health professionals also suggested some improvements, which might increase the acceptance and long-term use of such mHealth interventions by patients. A suggested improvement shared by all health professionals is the increase in the content of the app, such as additional exercises or variations of the exercises. A statement about the implementation of the mHealth intervention given by several health professionals was the adequate provision of information. One of the interviewed MBM psychologists as well as the nursing experts stated that patients with cancer are, on the one hand, flooded with information, especially when they start their treatment. However, the provision of some information to the patients about a mHealth intervention is necessary, at least to let the patients know about the existing intervention. On the other hand, nursing experts also mentioned that nurses often forgot about the intervention, although they approve this kind of intervention. Therefore, a standardized procedure for informing patients about the mHealth intervention might facilitate the implementation of the intervention. In addition, health professionals such as nurses might have to be informed regularly about such interventions because it is not part of their standard treatment; therefore, they might forget about it, as seen in this study. Regarding the recruitment process, the health professionals made the observation that female patients were more interested in this mHealth intervention. This is also reflected by the gender ratio in this study\u2019s sample, with 76 female and 24 male patients with cancer, which is typical for complementary and alternative treatments -53. ThisThis study has several strengths and limitations. A strength of the study is the collection of objective data in the form of logging the exercise use for each patient over the course of 20 weeks. Therefore, data on using the app exercises were not biased through self-report. Another advantage of this study was the use of a mixed methods approach, which is recommended for the development of digital interventions .A limitation of the study is that we did not have a control group. Therefore, the effectiveness of the app cannot be determined in this study because regression to the mean could have an impact on the improvement of well-being. Furthermore, we used paper-and-pencil questionnaires, which might have led to more missing data compared with web-based questionnaires . HoweverTherefore, future studies should investigate this topic with a randomized controlled trial to determine the effectiveness of a mindfulness and relaxation mHealth intervention. Our study provides some insights regarding the effects that might be expected in a similar study, which will be helpful to power future studies sufficiently. We also looked at aspects of implementing an mHealth intervention. All interviewed health professionals perceived such an mHealth intervention as a helpful addition to standard care, but as described earlier, they also stated barriers to the implementation of such an intervention, which should be investigated in future studies. Future studies could also investigate an mHealth intervention with more content than in this study app, as suggested during the interviews by health professionals. For instance, audio files with background music or exercises with variations in their duration could be added. In addition to mindfulness and relaxation exercises, physical exercise programs could be added. Physical exercise can have beneficial effects on symptoms of patients with cancer , and phyThe results of this observational feasibility study indicate that a mindfulness and relaxation app can be a feasible and an effective way to deliver a self-care intervention for patients with cancer. Our results indicate that such an intervention might be especially beneficial for highly distressed patients with cancer. The appeal of such an app could be increased with more diverse content, which might also positively affect the adherence of patients to such an intervention. The effectiveness and further aspects regarding the implementation of such an mHealth intervention should be investigated in a future randomized controlled trial."}
+{"text": "Currently, decision-making regarding biochemical recurrence (BCR) following prostatectomy relies solely on clinical parameters. We therefore attempted to develop an integrated prediction model based on a molecular signature and clinicopathological features, in order to forecast the risk for BCR and guide clinical decision-making for postoperative therapy. Using high-throughput screening and least absolute shrinkage and selection operator (LASSO) in the training set, a novel gene signature for biochemical recurrence-free survival (BCRFS) was established. Validation of the prognostic value was performed in five other independent datasets, including our patient cohort. Multivariate Cox regression analysis was performed to evaluate the importance of risk for BCR. Time-dependent receiver operating characteristic (tROC) was used to evaluate the predictive power. In combination with relevant clinicopathological features, a decision tree was built to improve the risk stratification. The gene signature exhibited a strong capacity for identifying high-risk BCR patients, and multivariate Cox regression analysis demonstrated that the gene signature consistently acted as a risk factor for BCR. The decision tree was successfully able to identify the high-risk subgroup. Overall, the gene signature established in the present study is a powerful predictor and risk factor for BCR after radical prostatectomy. Prostate cancer (PCa) is the second most commonly diagnosed cancer in men worldwide . Over haNowadays, advancements in high-throughput techniques such as microarray and RNA-sequencing (RNA-seq) have provided new insights into transcriptome profiling, which facilitate the utilization of molecules as diagnostic and prognostic biomarkers ,9. Some In this study, we established a gene expression-based signature to improve the prediction of BCR after radical prostatectomy, using a univariate and least absolute shrinkage and selection operator (LASSO) Cox model. Then, the prognostic value of the gene signature was further validated in five independent datasets across multiple platforms and our patient cohort. As regards clinical application, the gene signature was combined with clinicopathological features to build a decision tree to improve risk stratification for BCR. In addition, bioinformatic analyses were performed to reveal the biological processes and potential pathways underlying the gene signature.http://www.icgc.org). Written informed consent was obtained from each patient as described in our previous study [In total, 903 PCa samples with full-scale clinical annotations  from six independent cohorts were included in our study. Three cohorts were from Gene Expression Omnibus (GEO), one cohort from The Cancer Genome Atlas (TCGA), one cohort from Memorial Sloan Kettering Cancer Center , and our patient cohort was collected from University Medical Center Hamburg-Eppendorf, Germany . GSE70769 and GSE70768 were involved in the same research , and theus study . GSE7076ix, jx: each pair of genes; cor: Pearson\u2019s correlation; \u03b2: soft-power threshold). The topological overlap matrix (TOM) was constructed based on the adjacency, and the corresponding dissimilarity (1-TOM) was used as the distance measure, with deepSplit of 2 and minModuleSize of 30, to assign whole-genome genes into different modules via hierarchical clustering analysis. Unassigned genes were categorized into the gray module. Gene significance quantifies the association of individual genes with biochemical recurrence-free survival (BCRFS) status, and module membership represents the correlation between the module eigengene and the gene expression profile. Among non-gray modules, the modules which had the highest absolute correlations with BCRFS status were selected as candidate modules for further selection. Genes from these modules were submitted for high-throughput univariate Cox regression analysis to screen for prognostic candidates. Subsequently, the LASSO Cox regression model was used to further screen for the most robust prognostic markers [The weighted gene co-expression network analysis (WGCNA) R package  was used markers . FinallyWGCNA was used to construct a scale-free co-expression network and to identify the most significant modules, with a risk score based on TCGA RNA-seq data. Hub genes with gene significance >0.3 in the black module were extracted and submitted for Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis, and a Circos diagram was used to visualize outputs . Moreovehttp://www.r-project.org) were used to analyze data and plot graphs. The Kaplan\u2013Meier method was applied to draw survival curves, and the log-rank test was used to evaluate survival difference. The Cox proportional-hazards regression model was used to evaluate the significance of each parameter for biochemical recurrence-free survival (BCRFS). Time-dependent receiver operating characteristic (tROC) analysis was performed to measure the predictive power, using the \u201csurvivalROC\u201d package [2 < 30%, fixed-effect model) was performed to evaluate the prognostic value in the pooled cohort. The Z-score method was used to normalize risk scores in each cohort. Recursive partitioning analysis (RPA) was performed to construct decision trees using the \u201drpart\u201d package [IBM SPSS Statistics version 20 , GraphPad Prism 8.0 , Stata 12  and R software  were identified  remained with their individual nonzero LASSO coefficients  + (0.364318 * expression level of ASNS) + (0.67184 * expression level of FAM171B) + (\u22120.54351 * expression level of FREM2) + (\u22120.4304 * expression level of RSPO2) + (\u22120.17707 * expression level of SRD5A2) + (0.094559 * expression level of SSTR1) + (0.040268 * expression level of TRIM14) + (\u22120.77555 * expression level of VPS4A).Risk score = . Multivariate Cox regression analysis showed that the risk score was an independent risk factor for BCRFS . tROC analysis indicated that the risk score also functioned as a powerful predictor for BCR, with an average AUC(t) of 0.836 at 36 months follow-up  ones. Kaplan\u2013Meier survival analysis demonstrated that the two groups exhibited significantly different outcomes (Hazard Ratio (HR) = 5.787, ollow-up A.p = 0.0005; validation II: HR = 2.684, p = 0.0008; validation III: HR = 4.790, p = 0.0011; validation IV: HR = 5.708, p < 0.0001; validation V: HR = 5.193, p = 0.0004). Furthermore, multivariate Cox regression analysis was performed on the risk score and clinicopathological features including age, Gleason score (GS), pathological T stage (pT) and surgical margin (SM), to evaluate the significance of each for BCR risk. Notably, the risk score was always an independent risk factor for BCRFS in all five validation series . tROC analysis demonstrated that the risk score exhibited the most powerful prediction in validations I and II, while having similar predictive power to some clinicopathological parameters such as Gleason score or pT in validations III, IV, and V. Interestingly, among all the clinical variables, age was neither a risk factor nor a promising predictor for BCR in all five validation cohorts.To confirm the prognostic robustness of the gene signature, it was further validated in five other independent cohorts B\u2013F. Consp < 0.0001).Next, meta-analysis was used to analyze the prognostic value of the gene signature in the pooled cohort. Our result indicated that a higher risk score was correlated with a significantly worse prognosis in the pooled cohort  was performed to construct a decision tree to further improve risk stratification for BCR. Based on the pooled cohort, four parameters, namely, GS, pT, SM, and RS, were used as inputs for decision tree construction. Clusters 1\u20134 (C1\u20134) with different labels were identified as the outputs of the decision tree. C1 was considered as the low-risk subgroup, C2\u20133 as intermediate, and C4 as high-risk. The Sankey diagram shows the outcomes of different risk subgroups A. Risk sp = 8 \u00d7 10\u221228). With a threshold of gene significance >0.3, hub genes extracted from the black module were submitted for KEGG enrichment analysis. The Circos diagram showed that hub genes were mainly enriched in terms of \u201cCell cycle\u201d, \u201cOocyte meiosis\u201d, and \u201cOocyte maturation\u201d  in TCGA, MSKCC, and our cohort. Notably, the risk score was the only significant predictor in all six cohorts, with an extremely stable AUC(t) value of at least 0.75 for each cohort. Furthermore, the prognostic value of the risk score was also validated in the pooled cohort with Z-score normalization.A decision tree was generated to further optimize risk stratification by combining the risk score with traditional clinicopathological factors. In the pooled cohort-derived decision tree, the risk score functioned as the dominant factor for risk stratification. When stratified by the decision tree, BCRFS varied dramatically in different risk subgroups.ASNS, one risk biomarker in our study, was reported to function as a therapeutic target in castration-resistant prostate cancer [SSTR1 was widely related to the progression of various cancers [TRIM14 has been reported to promote invasion in glioblastoma [SRD5A2, one protective biomarker in our study, inhibits the invasion of prostate cancer cells via regulating the ERK/MAPK pathway [SRD5A2 contributes to resistance to androgen-deprivation therapy [ALDH1A2, another protective biomarker in our study, it has been reported that the promoter region was significantly hypermethylated in prostate cancer, and overexpression of ALDH1A2 resulted in decreased colony growth, suggesting that ALDH1A2 serves as a tumor suppressor in prostate cancer [VPS4A repressed growth and invasion in hepatocellular carcinoma, acting as a tumor suppressor [Some biomarkers involved in our gene signature have been investigated in cancer, even in prostate cancer. For instance, e cancer . SSTR1 w cancers ,29,30, a cancers ,32. TRIMblastoma  and coloblastoma . SRD5A2, pathway , and pol therapy . Regardie cancer . In addippressor . In a woAs our gene signature showed considerable power in risk stratification, the potential biological process and signaling pathways need to be investigated. Using WGCNA co-expression network construction and KEGG enrichment analysis, we observed that the gene signature-related hub genes were mainly enriched in terms of cell cycle. In addition, GSEA indicated that the predicted results that correlated with high risk score were shown as \u201cE2F targets\u201d, \u201cG2M checkpoint\u201d, \u201cMYC targets\u201d, and \u201cMitotic spindle\u201d, which are also mainly involved in cell cycle-related processes. We suppose that the gene signature-derived cell cycle alteration might contribute to cancer progression and poor prognosis in PCa patients.Some limitations of our study should be acknowledged. First, this is a retrospective study, so the robustness of the predictive value of the gene signature should be further validated in large prospective clinical trials. Second, experimental studies are required to further elucidate the biological functions underlying the gene signature in PCa.In conclusion, we established a gene-expression signature to predict BCRFS in PCa after radical prostatectomy. Integrated with clinicopathological features, a decision tree was generated to further improve the risk stratification for BCR after radical prostatectomy. Our model could be a useful tool for personalized management of PCa patients."}
+{"text": "More accurate models are essential to identify high-risk bladder cancer (BCa) patients who will benefit from adjuvant therapies and thus helpful to facilitate personalized management of BCa. Among various cancer-related hallmarks and pathways, cell cycle process (CCP) was identified as a dominant risk factor for cancer-specific survival (CSS) in BCa. Using a series of bioinformatic and statistical approaches, a CCP-related gene signature was established, and the prognostic value was validated in other independent BCa cohorts. In addition, the risk score derived from the gene signature serves as a promising marker for therapeutic resistance. In combination with clinicopathological features, a nomogram was constructed to provide more accurate prediction for CSS, and a decision tree was built to identify high-risk subgroup of muscle invasive BCa patients. Overall, the gene signature could be a useful tool to predict CSS and help to identify high-risk subgroup of BCa patients, which may benefit from intensified adjuvant therapy. Bladder cancer (BCa) is a common malignancy in the urological system worldwide, with an estimated 430,000 newly diagnosed cases per year. Among these cases, about two-thirds are non-muscle-invasive bladder cancer (NMIBC), while the rest are classified as muscle-invasive bladder cancer (MIBC) . DespiteIn recent years, advancements in high-throughput techniques such as microarray and RNA-sequencing (RNA-seq) have provided new insight into transcriptome profiling, highlighting the role of molecule markers in cancer diagnosis and prognosis ,5. SeverIn this study, we mined public databases and developed a cell cycle process-related risk score (CCPRS) to predict cancer-specific survival (CSS) in BCa patients, which was further validated in other independent cohorts from Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA). In combination with clinicopathological features, we aimed at constructing an integrated model to improve predictive power and risk stratification for CSS of individual BCa patients.Four microarray datasets including 587 BCa patients with clinical annotations and CSS information were downloaded from Gene Expression Omnibus (GEO). GSE13507 was produced by Illumina human-6 v2.0 expression beadchip and was used as the training set in our study. GSE31684 (Affymetrix Human Genome U133 Plus 2.0 Array) and GSE32894 and GSE32548 (Illumina HumanHT-12 V3.0 expression beadchip) were used as independent validation cohorts. Probe IDs were mapped to gene symbols according to the corresponding annotation file, and expression measurements of all probes linking to a same gene were averaged to obtain a single value. RSEM-normalized RNA-seq data, copy number data, and clinical phenotypes of MIBC samples were obtained from The Cancer Genome Atlas (TCGA). Copy number data and TPM data of 22 bladder cell lines were obtained from Cancer Cell Line Encyclopedia (CCLE) . All micp value of GS < 0.0001 and p value of univariate Cox regression < 0.0001, 64 candidates from CCP module remained. Subsequently, a least absolute shrinkage and selection operator (LASSO) Cox regression model was used to further screen out the most robust prognostic genes [In brief, the levels of cancer-related hallmarks and pathways in each sample from the training set were quantified by a single-sample gene set enrichment analysis (ssGSEA)  algorithic genes . A detaihttp://www.r-project.org) were used to analyze data and plot graphs. Z-score method was used to normalize ssGSEA scores and CCPRS when necessary. GSEA [t-test or one-way analysis of variance (ANOVA) was used to analyze differences between groups in variables with a normal distribution. A p value less than 0.05 was considered statistically significant.IBM SPSS Statistics 20 , GraphPad Prism 8.0 , Stata 12 , and R software  was identified as the dominant risk factor for CSS in BCa patients among various cancer-related hallmarks and pathways A. Then, p = 0.0004; The levels of each cancer-related hallmark and pathway were quantified by ssGSEA. A hierarchical clustering dendrogram was generated to show the distance between different hallmarks and pathways, and WNT/\u03b2-catenin signaling appeared to be the most distinct A. Moreovp = 7 \u00d7 10\u221252; p < 1 \u00d7 10\u2212200; p < 0.0001; p = 0.0002; p < 0.0001; p = 0.0011; Firstly, WGCNA was performed with transcriptome profiling data and CCP ssGSEA Z-scores in the training set A. Samplep value for GS less than 0.0001, hub genes from the brown module were submitted to univariate Cox proportional-hazards model. The volcano plot showed that with a threshold of p value for Cox regression analysis less than 0.0001, 64 promising candidates were filtered out . In addition, copy numbers of RCE1 and CEP72 were frequently amplified in most BCa cell lines, and highly positive correlation between copy number and mRNA expression of RCE1  and CEP72  was observed in 22 BCa cell lines  of the four cohorts showed that higher CCPRS was correlated with a significant worse CSS  along with MI and LNM.CCPRS for each sample was calculated and normalized to Z-scores in each cohort. Heatmaps of the associations between CCPRS Z-scores and different clinicopathological features in each cohort were plotted A,C,E,G. p = 0.0208; p = 0.0241; p = 0.0050; CR: complete remission, PR: partial remission, SD: stable disease, PD: progressive disease; NMF consensus clustering was performed to divide 1018 cell lines into two clusters based on the gene signature expression matrix when k = 2, and cluster 1 was identified as CCP-high cluster according to the distribution of expression pattern A. We obsTo quantify risk assessment and predict CSS probability for individual BCa patients, a nomogram was constructed in combination of CCPRS and clinicopathological features A. The prp < 0.0001; p = 0.0090; p = 0.0002; Considering MIBC accounts for a considerable part and contributes to the major mortality in BCa, we sought to optimize the risk stratification for MIBC patients by integrating CCPRS with traditional prognostic parameters. Various parameters including age, gender, LNM, grade, pT, and CCPRS were submitted for recursive partitioning analysis. Finally, CCPRS along with LNM and pT remained in the decision tree for CSS, and three different risk subgroups were defined D. PatienAlteration of cell cycle process (CCP) acts as a critical hallmark of cancer ,22. DysrSince Cuzick et al. reported an established cell cycle progression score in prostate cancer in 2011 , many stAmong various cancer-related hallmarks and pathways, CCP was identified as the dominant risk factor for cancer-specific survival (CSS) in BCa. Subsequently, WGCNA was performed to identify CCP-related gene module based on transcriptome profiling data and CCP ssGSEA score. Consensus clustering was used to evaluate whether the identified \u201cCCP module\u201d could represent CCP. Univariate and LASSO Cox regression analyses were successively used to filter out most robust prognostic biomarkers to establish a CCP-related gene signature. The risk score derived from CCP-related gene signature is named as CCP-related risk score (CCPRS) in our study. The prognostic value of CCPRS was evaluated in the training and other independent validation cohorts across different platforms. Moreover, patients with higher CCPRS exhibited worse outcomes in the adjuvant therapy groups, suggesting CCPRS could serve as a useful marker for resistance to anti-cancer treatments. Regarding clinical application, a nomogram was constructed in combination of CCPRS and clinicopathological features to quantify risk assessment and predict CSS probability for individual patients. Considering the significant proportion and high mortality of MIBC in bladder cancer, we combined CCPRS with traditional prognostic parameters to build a decision tree to optimize risk stratification for CSS of MIBC patients.Most biomarkers involved in the gene signature are dysregulated in BCa compared to normal tissues, and some of them have also been studied in other cancer types. For example, ADM2, one risk biomarker in the gene signature, was reported to predict poor survival in patients with pancreatic adenocarcinoma . MoreoveSome limitations in our study should be acknowledged. First, this is a retrospective study, so the prognostic robustness and clinical usefulness of the gene signature need further validation in prospectively designed clinical trials. Second, further experimental studies are needed to reveal the regulatory role of the gene signature in BCa progression.In summary, a novel CCP-related gene signature was established to predict CSS in BCa patients. The prognostic value of CCPRS was further validated in independent cohorts. In combination of the gene signature and clinicopathological features, a nomogram was constructed to quantify risk assessment for individual patients, and a decision tree was built to optimize risk stratification for CSS of MIBC patients. We hope the novel CCP-related gene signature could be a useful tool to select high-risk BCa patients who may benefit from adjuvant therapies and contribute to personalized management of BCa."}
+{"text": "The SARS-CoV-2 outbreak originated in China in late 2019 and has since spread to pandemic proportions. Diagnostics, therapeutics and vaccines are urgently needed. We model the trimeric Spike protein, including flexible loops and all N-glycosylation sites, in order to elucidate accessible epitopes for antibody-based diagnostics, therapeutics and vaccine development. Based on published experimental data, six homogeneous glycosylation patterns and two heterogeneous ones were used for the analysis. The glycan chains alter the accessible surface areas on the S-protein, impeding antibody-antigen recognition. In presence of glycan, epitopes on the S1 subunit, that notably contains the receptor binding domain, remain mostly accessible to antibodies while those present on the S2 subunit are predominantly inaccessible. We identify 28 B-cell epitopes in the Spike structure and group them as non-affected by the glycan cloud versus those which are strongly masked by the glycan cloud, resulting in a list of favourable epitopes as targets for vaccine development, antibody-based therapy and diagnostics. Close to 17.5 million reported infections and over 675,000 death have been reported as of August 1st, and these numbers are likely greater due to insufficient testing in parts of the world and asymptomatic carriers2.A cluster of viral pneumonia emerged in Wuhan, Hubei Province, China in December 2019. Shortly after, the aetiological agent was determined to be a novel coronavirus now referred to as Severe Acute Respiratory Syndrome 2 (SARS-CoV-2) which causes Corona Virus Disease 2019 (COVID- 19). Since its emergence, SARS-CoV-2 has spread across the globe, establishing local outbreaks in over 200 countries3. The receptor binding domain (RBD) of SARS-CoV and SARS-CoV-2 shares 72% identity at the amino acid level4. Thus, it is no surprise that some antibodies are species specific5; while other cross-reactive antibodies between SARS-CoVs have also been reported6. However, SARS-CoV-2 has a flexible loop which projects into the hydrophobic pocket of ACE2, conferring a stronger interaction with the receptor than observed for SARS-CoV7. While this S-protein protrusion out of the viral envelop facilitates receptor recognition and binding, it also leaves the protein exposed to recognition by the host immune system.SARS-CoV-2 is a member of the betacoronavirus genus with a single stranded RNA genome. Encoded in the genome is the immunodominant Spike protein (S). The S-protein is translated as a single protein and subsequently cleaved into two subunits. Three S-proteins assemble on the surface of the virion to form a trimeric spike. The S1 subunit is involved in receptor recognition and binding, while the S2 subunit contains a fusion peptide and necessary machinery for fusion, typically observed in class I fusion proteins. The S-protein binds host receptor angiotensin converting enzyme 2 (ACE2) and mediates viral entry into the host cell, similar to 2002 SARS-CoV9. A candidate monoclonal antibody isolated from SARS-CoV patients during the 2002 outbreak can cross-neutralise SARS-CoV210. Accordingly, potential SARS-CoV-2 epitopes have been suggested based on homologous regions of the SARS-CoVs S-protein that are known to be immunogenic9. Strictly relying on known SARS-CoVs epitopes shared with SARS-CoV-2 limits the selection of antigenic sequences to non-SARS-CoV-2 specific epitopes9. A limitation of these published studies is the failure to consider the impact of glycosylation, which could shield some of the selected epitopes.Consequently, the S1-subunit epitopes of SARS-CoV and SARS-CoV-2 are target candidates for induction of a B-cell responseAs the number of COVID-19 cases continues to increase around the world, there is an urgent need for diagnostics, therapeutics and vaccines. This may be hampered by heavy glycosylation of the SARS-CoV-2 S-protein trimer, hindering exposure to the host adaptive immune system. With the critical need for a vaccine, it is crucial to identify epitopes that are conserved, accessible and unrestricted by the glycan chains to elicit a robust neutralising antibody response from the host. Thus, we aimed to identify epitopes, which are readily available to the host immune system. We identify various epitopes in the S-protein, considering the protein structure, the flexible loops and stearic hindrance resulting from protein glycosylation in the hope that this may advance vaccine development and antibody-based therapies and diagnostics.13. The 22 N-glycosylation positions are unevenly distributed across the two S-protein subunits, accounting for 66 sites in the trimeric structure  cells or insect cells confirmed the complete occupancy of the 22 sites13. A large percentage of these glycosylated residues (18/22) are conserved in SARS-CoV  reconstructing the flexible loops not present in the starting structure and (iii) model glycan chains attached on the N-linked glycosylation sites in order to be able to (iv) compute the solvent-accessible surface area (SASA) and antibody-accessible surface area (AASA) and (v) predict the B-cell epitopes and glycan masking  and Shajahan et al. (pat2)11. However, it is important to note glycosylation patterns and glycan species can vary in different cell types15 and are altered in malignant cells compared to non-malignant cells16. As these previous S-protein glycosylation studies were performed in HEK293 cells12, which were immortalised by adenovirus, it is possible that the glycosylation pattern may not reflect a natural infected cell. Consequently, we chose to additionally include common glycosylation types found in proteins of healthy human cells. Noteworthy, these sugars are highly flexible dynamic structures which adopt various conformations and hence, rendering a single structural arrangement misleading when representing an in vivo structure. Here, we chose to use two different conformations to model each of the glycan chains.We sought to build a glycosylation pattern model of the SARS-CoV-2 S-protein to identify accessible antigenic epitopes that were not masked with glycosylation by (i) retrieving the trimeric S-protein from the protein data bank (PDB) ing Fig. . Six dif 13 Fig. . Two add17 was used to calculate the ASA for a de-glycosylated model, the cryo-EM structure, and the eight glycosylated models elucidated in this study . Firstly, the solvent-ASA (SASA) was calculated by using the probe radius of a water molecule to be used as reference. As expected, the SASA profile in the de-glycosylated and glycosylated models do not differ greatly  was subsequently computed using a large probe radius comparable in size to the recognition domain of an antibody, allowing surface points available for protein-protein contacts, such as antibody-antigenion Fig. . Notablyion Fig. . In cont-15 Fig. . While tBased on the AASA profile of the de-glycosylated model Fig. , we idenThe COVID-19 pandemic has spread rapidly worldwide. It has exhausted health systems, burdened the global economy and brought many countries to a standstill. The international community is now looking to researchers to alleviate the impacts of SARS-CoV-2 through potential drugs, antibody therapy and most importantly, novel vaccine candidates. Here, we accounted for the N-glycosylation sites in different conformations on the SARS-CoV-2 trimeric S-protein in order to identify promising antibody accessible epitopes.13. The degree of glycosylation is a key feature to consider when selecting potential B-cell epitopes and designing antibody-based diagnostics, therapeutics or vaccines, as the number of accessible epitopes is limited. Noteworthy, is the differential distribution of these glycan along the protein. The S2 subunit glycosylation is more concentrated, especially towards the membrane while the S1 subunit contains more exposed domains possibly due to accessibility required for RBD and CL  of the S-protein, rather than the open structure observed during receptor binding19. Nevertheless, this model still allowed us to capture a previously identified epitope S230-CoV-119 from the open conformation, that corresponds in part to the epi11, supporting the validity of our model.We modelled the N-glycosylation pattern garnishing the S-protein in its trimeric conformation considering the flexible loop regions which were absent in the published experimental cryo-EM structure22 , and S21P2 , correspond to epi14 and epi21, respectively, described in this study 26 and F26G19 (PDB id 3BGF)27, show the involvement of epitopes corresponding to SARS-CoV2 epi10 to epi12 antibody recognition sites found here. The partial match between our RBD epitopes and the antibody-binding regions in SARS-CoV RBD emphasises the dissimilarities of the two SARS-CoVs RBDs as confirmed by the poor cross-reactivity of these three antibodies28. Nevertheless, cross-reactivity has been reported with the monoclonal antibody S309 derived from memory B-cells from a 2003 SARS-CoV convalescent patient that recognises discontinuous eptiopes10. Our model correctly identified fragments 333-346 and 440-441 (corresponding to epi9 and epi10) which are approximately 25\u2009\u00c5 apart, but did not identify fragment 354-361 in the discontinuous epitopes recognised by antigen S30910 , where the receptor binding proteins are masked by heavy glycosylation shielding antigen exposure referred to as a glycan shield33. De-glycosylation of sites on HIV\u2019s glycoprotein gp120 results in enhanced immunogenicity and neutralising antibody production34. Interestingly, a fraction of HIV positive patients are capable of developing antibodies to the glycan shield itself35. Although, the SARS-CoV-2 S-protein is not as glycosylated as the HIV glycan shield, the glycan chains mask critical areas of the S-protein; hence the use of the term \u201cglycan cloud\u201d. It will be interesting to ascertain whether convalescent sera of SARS-CoV-2 individuals recognise the glycan cloud. The binding of recently identified SAR-CoVs antibodies S309 and BD-23 from convalescent patients have already been shown to be facilitated by the presence of the glycan chain22.The glycan masking of epitopes may address why some patients\u2019 sera is limited in its ability to prevent pseudovirus entry into host cells36, supporting the selection of epitopes on the S-protein. As monoclonal antibodies enter clinical trials, it is crucial to monitor the sequence variation in the S-protein for potential escape mutants. Variants anywhere in the S-protein have the potential to impact the 3D structure. Thus, genome sequence of the whole S-protein should be highly monitored. HIV escape mutants were found to evade the host antibodies without changing the epitope sequence, and rather by changing the glycan chain orientations at alternative sites, masking the previously exposed epitope33. This highlights the need for the epitope as well as the glycosylation pattern to be conserved.Ultimately, we provide a selection of B-cell epitopes that are exposed to the host immune system including epitopes located in flexible loops, which were previously overlooked. Some suggested epitopes remain exposed regardless of the type or conformation of glycan chains at N-glycosylation sites on the SARS-CoV-2 trimeric spike. The S-protein of the SARS-CoV-2 has proven to be highly conserved this far into the pandemicIn conclusion, we constructed a 3D model of the SARS-CoV-2 trimeric S-protein, completed with the flexible loops and N-linked glycan chains. This structure successfully enabled protruding epitopes, unmasked by the glycan cloud to be elucidated. Such epitopes can serve as targets for antibody therapeutics or to be incorporated in the urgently needed vaccines.This study used a structure-based approach of the SARS-CoV-2 Spike protein, taking into account the glycan chains, with the objective of identify B-cell epitopes unshielded by glycosylation. A complete trimeric 3D model of the S-protein was first built and used a based on which several glycosylated models were generated. As glycosylation is a dynamic process, six different carbohydrate chains were used, assuming complete and homogeneous glycosylation site occupancy. In addition, two heterogeneous glycosylation patterns were included (see Supplementary Table 14 (PDB id 6VXX). Amino acids missing in the structure were constructed using Modeller9.2437. These residues are in the following loop segments: 70-79, 144-164, 173-185, 246-262, 445-446, 445-446, 469-488, 502, 621-640, 677-688 and 828-853. The modelling was performed in the presence of N-acetylglucosamine moieties found in the cryo-EM structure, with the exception of the Asn122 site whereby the N-attached N-acetylglucosamine has been replaced by a larger glycan .As initial model for our analysis we used a pre-fusion structure of the trimeric S-protein solved by cryo-EM at 2.80\u2009\u00c5 resolution40 (www.glycosciences.de)) was employed to attach carbohydrate chains at each N-linked glycosylation sites onto the full trimeric S-protein structure41. Six different glycans were considered for full homogeneously glycosylation patterns that are schematically depicted in Fig. 14, and the second conformation was built from a statistical evaluation of the occurrence of N-glycan orientations in the PDB39. Thus, ten models were proposed for each of the SARS-CoV-2 glycosylation patterns. All the 3D models are available from the authors upon request.The GlyProt tool  was determined using a 1.4\u2009\u00c5 radius to model a water molecule. Subsequently a 10\u2009\u00c5 radius was use as this size is comparable to an antibody recognise region, resulting in the calculated antibody-ASA (AASA). To determine the AASA profiles, a smoothing procedure was applied consisting in a seven-point moving window procedure according the formula listed below, where Ni is the considered residue at position i.In order to predict potential epitope exposed to the immune system unshielded by glycosylation, the ASA was computed for each model as well as de-glycosylated model using FreeSASA according to the Lee & Richards algorithmi\u2009=\u2009[7Ni +6(Ni\u22121 +Ni+1)+3(Ni\u22122 +Ni+2)\u22122(Ni\u22123 +Ni+3)]/2142. The B-cell epitopes were determined using a cut-off of 45 \u00c52, chosen to produce a good concordance between our predictions and experimental epitopes derived from the structure between the SARS-CoV-2 S-protein and the neutralising monoclonal antibody S30910. All epitopes that were less than 3 residues in length were excluded. Epitopes separated by a single residue were grouped together. At one given position, the SASA or AASA was averaged over the three chains, over the five loop models and over the two models of glycan conformation. To quantify the impact of glycan cloud, the AASA is expressed as a percentage in relation to the value of the de-glycosylated model taken as 100%.NFurther information on research design is available in the Supplementary InformationReporting Summary"}
+{"text": "Zygomycetes fungi are often used in SSF as an effective cell factory able to valorize a wide range of hydrophilic and hydrophobic substrates and produce lipid-enriched bioproducts. In this study, for the first time, the strain Mortierella alpina was used in SSF for the bioconversion of animal fat by-products into high value fermented bioproducts enriched with arachidonic acid (ARA). Two cereals-based matrixes mixed with four different concentrations of animal fat by-product were evaluated for finding optimal conditions of a fat-based SSF. All obtained fermented bioproducts were found to be enriched with ARA. The highest substrate utilization (25.8%) was reached for cornmeal and it was almost double than for the respective wheat bran samples. Similarly, total fatty acid content in a fermented bioproduct prepared on cornmeal is almost four times higher in contrast to wheat bran-based bioproduct. Although in general the addition of an animal fat by-product caused a gradual cessation of ARA yield in the obtained fermented bioproduct, the content of ARA in fungal biomass was higher. Thus, M. alpina CCF2861 effectively transformed exogenous fatty acids from animal fat substrate to ARA. Maximum yield of 32.1 mg of ARA/g of bioproduct was reached when using cornmeal mixed with 5% (w/w) of an animal fat by-product as substrate. Furthermore, implementation of attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy in characterization of obtained SSF bioproducts was successfully tested as an alternative tool for complex analysis, compared to traditional time-consuming methods.Solid-state fermentation (SSF) is a powerful fermentation technology for valorizing rest materials and by-products of different origin. Oleaginous  In Europe, approximately 16 million tonnes of animal fat (AF) by-products are processed annually by meat processors and renderers . In addiw/w) of triacylglycerols (TAGs) containing high amount of essential PUFAs as a storage material of the cells [Fungal fermentation is an emerging technology for upgrading different types of by-products ,5. A cerhe cells . Fungal Mucorales and Mortierellales, for converting various waste materials and by-products based substrates by SSF into fermented BPs enriched with a wide range of essential PUFAs, such as \u03b3-linolenic acid , ARA or EPA [SSF is a fermentation technology using solid or semi-solid substrates in the absence of any water or using a low level of free-flowing water . SSF hasA or EPA ,16,17,18A or EPA ,15,16.Mortierella alpina is a well-known and thoroughly described species with a high capacity of lipid accumulation and good ability to produce industrially relevant essential PUFAs, especially ARA in both submerged fermentations and SSF [M. alpina is able to incorporate and transform exogenous fatty acids [M. alpina should also be able to utilize and convert solid lipidic waste, such as AF by-products.Oleaginous fungus  and SSF ,20,21. Ity acids . Thus, ity acids . Such knWhen developing a new SSF process and optimizing SSF processes, it is crucial to monitor key process parameters, such as humidity, airflow, oxygen transfer and controlling the quality of final fermented bioproduct. Quality parameters of the final fermented BP are fatty acid profile, total lipid content, amount of fungal biomass and total biochemical profile. For the determination of fatty acid profile and content, gas chromatography coupled with flame ionization detector (GC-FID) is the most commonly used technique , while tM. alpina. Furthermore, the presented study introduces, describes and evaluates FTIR spectroscopy as an alternative method for accurate SSF monitoring.To the authors knowledge, this is the first study investigating the possibility to develop an efficient bioconversion of AF by-products into functional lipid-rich fermented bioproduct by SSF using Mortierella alpina CCF2861 used in this study was obtained from culture collection of fungi . The strain was kept on potato-dextrose agar media  at 4 \u00b0C and regularly re-inoculated every 3 months.The oleaginous fungal strain \u00ae\u00ae 40 and suspension was diluted to achieve a final concentration of 106 spores/mL.The spore suspension for the inoculation of the fermentation substrate was prepared from a 14-day-old culture grown on PDA medium. Spores have been washed using an aqueous solution of 0.05% Tween\u00ae\u00ae 40  were added. SSF experiments were performed using two waste cereal-based matrixes: cornmeal  and wheat brans . The composition of AF used is summarized in SSF cultivation was performed in the microporous high-density polyethylene bags (20 \u00d7 30 cm) containing 20 g of dry cereal-based matrix, to which various amounts of AF by-products  mixed with Tween\u00ae\u00ae solution or AF emulsion, as per M. alpina. The fermentation ran for 10 days at 20 \u00b0C. In order to maintain the homogenous growth of fungi, substrates were mixed thoroughly after inoculation. During the fermentation process, the whole content of the fermentation bags was gently mixed once a day. All experiments were performed in three independent biological replicates.The cereal materials were soaked for 2 h in 20 mL (ratio solid to liquid 1:1) of either distilled water, Tween 40\u00ae\u00ae 40 emulsions, where the emulsifier Tween\u00ae\u00ae 40 formed a film around the dispersed lipid droplets and thereby reduced interfacial tension [Due to the fact that cereal-based matrixes have a hydrophilic nature while AF is hydrophobic, there is a need to perform the pretreatment of the fat materials before mixing it with cereal matrixes for obtaining homogenous substrates for SSF. The pretreatment of AF by-product was performed by preparing homogenous fat-water-Tween tension .\u00ae\u00ae 40 and AF using a combination of heating  and sonication (15 min) using VWR USC300T sonicator .AF emulsions were prepared from distilled water, TweenThe obtained fermented bioproducts were collected and the humidity was measured. The humidity of substrates was measured by Moisture Analyzer Radwag 50/1. R . Subsequently, the substrates were dried at 65 \u00b0C until a constant weight was achieved. The substrate utilization was calculated from the weight difference of the dry non-fermented substrate (control) and dry fermented bioproducts. Each sample was homogenized using a blender and stored in sterile Falcon tubes at laboratory temperature before the analysis was performed.To estimate the amount of fungal biomass in the fermented bioproducts, the method based on the estimation of glucosamine (GlcN) content was used ,31. In tM. alpina was cut out from the SSF matrix, suspended in 500 \u00b5L of sterile distilled water and observed by a confocal microscope Leica DM750 , equipped with Leica HI PLAN 100x/1.25 oil objective lens . Snapshots of individual hyphae were carried out with a Leica DFC290HD digital camera .The snapshots of fermented bioproducts were obtained by Dino-Lite Pro USB microscope. Fungal mycelia of Fatty acids (FA) from the SSF matrixes were converted into their methyl esters (FAMEs) by a modified method of \u010cert\u00edk and Shimizu : 20 mg ov/v) according to original Folch et al. method [The lipids for the analysis of lipid classes were extracted with chloroform/methanol .Fourier transform infrared (FTIR) spectroscopy was done employing an attenuated total reflectance (ATR) accessory for profiling the total biochemical composition of the obtained fermented bioproducts. ATR-FTIR measurements were performed using a Vertex 70 FTIR spectrometer  with a single-reflection attenuated total reflectance (SR-ATR) accessory. The ATR-FTIR spectra were recorded with 32 scans using a horizontal SR-ATR diamond prism with 45\u00b0 angle of incidence on a Specac  High Temperature Golden Gate ATR Mk II. Of each homogenized dried fermented sample and of each non-fermented substrate sample, 10 mg of sample mass was prepared by homogenization with 2.8 mm stainless steel grinding balls  using tissue homogenizer  Percellys Evolution . The samples were subsequently transferred to the surface of the ATR crystal. All ATR-FTIR measurements were performed in five technical replicates, resulting in 360 spectra in total. Spectra were recorded in a region between 7000 and 600 cmThe fatty acid GC-FID and GlcN data were analysed by ANOVA using Microsoft Excel (Microsoft Office 365 software pack) equipped with a data analysis tool. Post-hoc testing was performed for the ANOVA results using Tukey\u2019s HSD test in programming language R and in Python v. 3.7 using StatsModels libraries.\u22121, selected as the spectral region containing bands distinctive for lipids, proteins and polysaccharides. The analysis of FTIR-ATR spectra was performed by first applying pre-processing and then principle component analysis (PCA). The pre-processing was performed by transforming to second-derivative spectra using the Savitzky\u2212Golay algorithm with a polynomial of degree 2 and a window size of 11. The second-derivative spectra were pre-processed by extended multiplicative signal correction (EMSC) [\u22121 combined with 1800\u20131700 cm\u22121), protein (1700\u20131500 cm\u22121) and polysaccharide (1200\u2013700 cm\u22121), using 11 principle components. The following software packages were used for data analysis: Unscrambler X version 10.5.1 , Orange data mining toolbox version 3.24  [FTIR-ATR spectra were obtained for the region of 4000\u2013600 cmn (EMSC) ,36. PCA lovenia) .M. alpina. We evaluated two single-component control substrates, eight two-component control substrates containing Tween\u00ae\u00ae 40 and eight three-component animal fat-based substrate mixtures    and prodIt was also found that the utilization of control substrates and AF-based substrates in SSF varied depending on the type of cereal matrix used and the amount of AF added . GeneralM. alpina grown on control single- and two-component substrates and AF supplemented substrates were found. M. alpina was able to completely cover the substrate surface and its hyphae also sufficiently penetrated inside the substrate. Moreover, the presence of lipid structures formed in individual fungal hyphae was detected  AF supplementation.It was found that increasing the amount of AF in substrate mixtures reduced the humidity of the fermented bioproducts . FermentM. alpina CCF2861 is definitively able to utilize exogenous fatty acids of AF by-product added to the substrate not only for its own fatty acids biosynthesis, but for hyphae proliferation and growth as well.We observed that for the production of fatty acid-rich fungal biomss the CM is a more suitable substrate compared to WB . Althougw/w) of AF) down to 21.2 mg ARA/g BP (addition of 30% (w/w) of AF). However, the content of ARA in bioproducts from the three-component CM-based substrates was at least double comparing to single- and two-components substrates. On the other hand, the addition of AF increased the yield of ARA in WB-based bioproducts up to 21.4 mg ARA/g of bioproduct  in comparison to the fermented bioproducts from single-component substrates  the biomass ).M. alpina. Principal component analysis (PCA) of obtained FTIR-ATR spectra was used to study variations in the biochemical profile of the fermented bioproducts. The PCA scatter plot of the lipid-related spectral regions (3050\u20132800 cm\u22121 and 1800\u20131700 cm\u22121) shows significant chemical differences in the lipid profile for the individual fermented bioproducts obtained in SSF of substrates with various addition of AF (w/w) of AF, while the lipid profile of bioproducts from the substrates with 20% and 30% (w/w) of AF showed a very different lipid profile (w/w) of AF than in the case of WB substrates  were used in this study. Cereal-based matrixes are easily accessible and well-known as a good matrix for SSF substrates. Due to their chemical composition, such as presence of easily accessible carbon, organic nitrogen and other macro- and micro-nutrients, cereal-based matrixes provide a useful source for good fungal proliferation, hyphae penetration and stable lipid accumulation in fungal cells [M. alpina is able to incorporate and transform exogenous fatty acids [M. alpina CCF2861.Oleaginous fungus al PUFAs ,20,21. Ial cells ,15. In oal cells . It was ty acids . In this\u00ae\u00ae 40 emulsions, where emulsifier Tween\u00ae\u00ae 40 forms a film around the dispersed lipid droplets and thereby reduces interfacial tension [Due to the fact that cereal-based matrixes have a hydrophilic nature while animal fat is hydrophobic, there is a need to perform pretreatment of the fat materials before mixing it with cereal matrixes for obtaining homogenous substrates for SSF. The pretreatment of the AF by-product was performed by preparing homogenous fat-water-Tween tension .w/w) of the total carbon, whereas wheat bran contains only up to 24.5% of starch and up to 50% of cellulose and hemicellulose [M. alpina is known to effectively use starch as a carbon source, however the cellulose and hemicellulose polymers are not suitable source of carbon for this strain [M. alpina on CM in contrast to WB. Analysis of protein content using the automatic Kjeldahl method for nitrogen content showed that WB contained higher amount of proteins (17.4%) than CM (6.5%), indicating lower C/N ratio in WB than in CM. However, the amount of proteins was sufficient for fungal growth and proliferation in SSF process for both substrates.While the total carbon content in both substrates is very similar (37.4% for CM and 37.9% for WB), the difference is in the profile of the dominant carbon source. The main carbon source in cornmeal is starch accounting for up to 85% , significant changes in pH values were also noticed. Subsequent TLC analyses of lipid classes of extracted total lipid clearly indicated that AF contains relatively higher levels of free fatty acids , which wM. alpina to produce ARA  the peak related to the ester bond stretching at 1745 cm\u22121, indicating the total lipid content in the cell; (iii) the peak related to the carboxyl bond vibrations in free fatty acids at 1710 cm\u22121, and (iv) the peak related to =C-H stretching at 3010 cm\u22121, indicating the unsaturation level of cellular lipids. Proteins are observed in the spectral region 1700\u20131500 cm\u22121 with the main peaks for amide I (1650 cm\u22121) and amide II (1540 cm\u22121) bonds and polysaccharides are observed in the region 1200\u2013900 cm\u22121. PCA of FTIR-ATR spectra proved distinct variations between individual samples in accordance with different composition of analyzed fermented samples. PCA score plots show large difference between all tested conditions, which could be caused by different composition of cereal substrate itself, as mentioned above. Higher similarity of complete biochemical profile in CM control samples with the CM substrates supplemented with 5% and 10% (w/w) of AF than in the case of WB substrates can be explained by the higher homogeneity of fungal growth and various cereal-based substrate utilization for the WB-based and CM-based substrates.FTIR-ATR spectroscopy performed on all obtained fermented samples has proved possible high potential of this method for analysis of different types of materials. This method requires low sample amounts and does not involve extraction of any chemical components . The infThis is the first study on effective utilization of AF by-product into functional high-valued fermented bioproducts by SSF and obtained results represent broad fundamentals for subsequent research. Optimization of such fermentation process and extension for application of different fungal strains can lead to increased yields of desired metabolites or formatting a various high-value fungal specific product. Moreover, successful application of ATR-FTIR spectroscopy for rapid analysis of SSF bioproducts has been described, which can possibly extend industrial potential of the whole solid-state fermentation technology."}
+{"text": "Determining the infectiousness of patients with coronavirus disease 2019 is crucial for patient management. Medical staff usually refer to the results of reverse transcription polymerase chain reaction tests in conjunction with clinical symptoms and computed tomographic images.We report a case of a 62-year-old Japanese man who twice had positive and negative test results by polymerase chain reaction for severe acute respiratory syndrome coronavirus 2 over 48\u2009days of hospitalization, including in intensive care. His respiratory symptoms and computed tomographic imaging findings consistent with coronavirus disease 2019 improved following initial intensive care, and the result of his polymerase chain reaction test became negative 3\u2009days before discharge from the intensive care unit. However, 4\u2009days after this first negative result, his polymerase chain reaction test result was positive again, and another 4 days later, he had a negative result once more. Eight days after the second polymerase chain reaction negative test result, the patient\u2019s test result again became positive. Finally, his polymerase chain reaction results were negative 43\u2009days after his first hospitalization.This case emphasizes the importance of repeat polymerase chain reaction testing and diagnosis based on multiple criteria, including clinical symptoms and computed tomographic imaging findings. Clinical staff should consider that a negative result by polymerase chain reaction does not necessarily certify complete coronavirus disease 2019 recovery. A number of cases of \u201cunknown viral pneumonia\u201d related to a market in Wuhan City, Hubei Province, China, were reported in December 2019. The novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was identified, causing coronavirus disease 2019 (COVID-19), which rapidly spread from China to other countries all over the world. In the absence of specific therapeutic drugs or vaccines for COVID-19, it is essential to be able to detect the disease at an early stage and immediately isolate the infected person from the healthy population. According to the latest guidelines for the Diagnosis and Treatment of Pneumonitis Caused by 2019 Novel Coronavirus  published by the Chinese government, the diagnosis of COVID-19 requires testing respiratory or blood samples by reverse transcription polymerase chain reaction (RT-PCR) or gene sequencing and is considered the key indicator for hospitalization. Chest computed tomography (CT) reveals typical radiographic features in almost all patients with COVID-19, which include ground-glass opacities, multifocal patchy consolidation, and/or interstitial changes with a peripheral distribution. We now have a great deal of experience in treating patients with frequent changes from positive to negative PCR results, then back to positive and negative again. We therefore propose that accurate diagnosis and treatment of COVID-19 requires a comprehensive assessment that includes not only PCR results but also chest CT images.2) on room air at the time of hospitalization was 94%, and CT showed peripheral ground-glass opacities with interlobular septal thickening consistent with a \u201ccrazy paving pattern\u201d strongly indicative of COVID-19 . He was intubated and put on a ventilator . Other therapeutic procedures included administration of favipiravir, and, given concerns regarding pneumonia due to other pathogens, broad-spectrum antibiotic therapy using tazobactam/piperacillin and levofloxacin was initiated. The results of blood cultures and a respiratory viral panel were negative. The patient recovered without further incident and was transferred back to a convalescence ward in an affiliated hospital after confirmation of SARS-CoV-2 negativity by PCR. However, on the same day as the transfer, the patient complained of shortness of breath and dyspnea, and his respiration rate increased to 20 breaths/minute. His SpO2 decreased to 86% under 10\u2009L/minute of 100% oxygen inhalation by face mask, and he was again intubated. At this time, the finding of PCR was once again positive for SARS-CoV-2, and the patient was readmitted to our hospital and transferred back to the ICU to restart respiratory care on a ventilator . Four days after readmission, his respiratory condition had improved, and his PCR results were again negative. Nine days after readmission, he was weaned off respirator care, extubated, and transferred to a COVID-19 ward in the same hospital. Over the remainder of his hospital course, the patient was treated by supportive measures and monitored for any worsening of respiratory function. Despite his respiratory condition not worsening, his PCR result again became positive 3\u2009days after discharge from the ICU for the second time. At 8 and 11\u2009days after this, his PCR results were negative once more. Following confirmation that his clinical condition and CT findings were stable, he was finally discharged from our hospital 54\u2009days after his first admission.A 62-year-old Japanese man without coexisting disease initially presented to our hospital with a persistent fever of 38.0\u2009\u00b0C, dyspnea, and hypoxia after close contact with a coworker known to be infected with SARS-CoV-2. His oxygen saturation (SpOFor successful management of the COVID-19 pandemic, diagnosis and discharge criteria have been discussed extensively with reference to the sensitivity and specificity of the clinical and virological status of patients before discharge. The PCR test is considered the gold standard for detecting infection and is widely used for diagnosis and public heath surveillance of disease prevalence. In this report, we describe a patient who repeatedly had positive test results and then negative and positive test results again several times during the course of his COVID-19 disease. Although there are several reports of PCR reverting to positivity following a negative result, twice repeating such a positive and negative course in one patient seems to be rare. Considering safe management for clinical staff and the patient him- or herself, the importance of repeat testing and screening based on clinical symptoms and exposure history cannot be overstated. PCR has emerged as the test of choice for detection of viral nucleic acids and the infectiousness of infected individuals. Although some reports in the literature emphasize the importance of PCR screening for early containment of the disease, the sensitivity of PCR tests has been shown to be anything but perfect. A study conducted in China found that almost 25% of SARS-CoV-2-positive individuals had had a negative result in initial testing , 4. ConsOur patient initially presented with fatigue progressing to fever, cough, and shortness of breath, symptoms that are most commonly attributable to COVID-19 pneumonia , 6. HoweFirst, a negative PCR test result confirms neither recovery from COVID-19 nor that the patient is no longer infectious. Considering the poor sensitivity of PCR, repeat testing is essential to identifying SARS-CoV-2-positive individuals at initial diagnosis. A second important conclusion is that isolation and treatment practices should be guided by a combination of testing, symptomology, and radiologic evidence at the time of discharge and should not rely solely on PCR. Careful consideration based on these multiple parameters may prevent premature discharge of the \u201cpresumed negative\u201d patients and thus also prevent unexpected exposure of healthcare workers and the population at large."}
+{"text": "Long non-coding RNAs (lncRNAs) play important roles during the initiation and progression of cancer. We identified DiGeorge Syndrome Critical Region Gene 5 (DGCR5) as a clear cell renal cell carcinoma (ccRCC) cancer- and lineage-specific lncRNA. Agarose gel electrophoresis analysis and sanger sequencing verified two main isoforms of DGCR5 in ccRCC patient tissues and cell lines. Quantitative polymerase chain reaction further demonstrated that the expression level of DGCR5 major isoform (isoform-1) was higher in ccRCC tissues than that in papillary/chromophobe RCC and other multiple solid malignant tumors. We investigate the biological functions of DGCR5 isoform-1 in ccRCC and show that DGCR5 isoform-1 exerts a tumor-promoting effect in ccRCC. DGCR5 isoform-1 is localized in cytoplasm and shares the same binding sequence to the tumor-suppressive miR-211-5p with the epithelial-to-mesenchymal transition key component SNAI. Furthermore, cellular and molecular experiments demonstrate that DGCR5 isoform-1 could sequester miR-211-5p, leading to the elevation of Snail protein and downregulation of its downstream targets and further promoting ccRCC cell proliferation and migration. Thus, our study indicates that DGCR5 isoform-1 could contribute to ccRCC progression by sponging miR-211-5p through regulating the expression of Snail protein and could serve as a reliable diagnostic biomarker in ccRCC. Clear cell renal cell carcinoma (ccRCC) is the most common kidney cancer in adults and also the most fatal cancer among all urinary malignant tumors . PatientLong non-coding RNAs (lncRNAs) have more than 200 bases in length and limited protein-coding capability. They actively participate in various cellular activities, including carcinogenesis. Some LncRNAs present in certain cancers with lineage-specific expression patterns, which make lncRNAs useful as cancer biomarkers . Our preThis study investigates the isoforms of DGCR5 and demonstrates that the silencing of DGCR5 isoform-1 suppresses the malignant phenotype of ccRCC. DGCR5 isoform-1 could sponge the tumor-suppressive miR-211-5p to regulate the expression of Snail protein as well as its downstream targets. Therefore, our study first identified the isoform-1 of DGCR5 in ccRCC, which has the potential to be a reliable diagnostic biomarker as well as a novel therapeutic target in ccRCC management.This study was approved by the Ethics Committee of Qilu Hospital of Shandong University. Signed patient consents were obtained from all participants in this study.Sixteen pairs of ccRCC cancer tissues and adjacent non-cancerous tissues collected from ccRCC patients during surgery at the Qilu Hospital of Shandong University between May 2018 and September 2018 were immediately snap-frozen and stored in liquid nitrogen until use. No patients had received radiotherapies or chemotherapies prior to surgery.2.The human RCC cell lines  and immortalized normal human proximal tubule epithelial cell line HK-2 were purchased from American Type Culture Collection . A498 and A704, 786-O and HK-2, Caki-1 and HEK-293 were cultured, respectively, in modified Eagle\u2019s medium , RPMI-1640 medium (Gibco), McCoy\u2019s 5A medium (Gibco), and Dulbecco\u2019s MEM (Gibco) supplemented with 10% fetal bovine serum  at 37\u00b0C in a humidified incubator containing 5% CO\u2013\u0394\u0394CT method. All reactions were tested in triplicate.Total RNA was extracted from cells or tissues with TRIzol  according to the manufacturer\u2019s protocols. The concentration and purity of RNA were determined by NanoDrop ND2000 . The reverse transcription of RNA was performed using a ReverTra Ace qPCR RT Master Mix with gDNA Remover . The quantitative PCR was carried out with SYBR Green Realtime PCR Master Mix (Toyobo) on a CFX96 Real-Time System thermal cycler  in accordance with the manufacturer\u2019s instructions. The primers used were synthesized by GenePharma Co., Ltd.  and are listed in The agarose gel was made by the heating of agarose powder  and Tris-acetate-EDTA  buffer followed by mixing with GelRed . Electrophoresis was performed in 1% TAE running buffer at 90 V for 50 min. The results were obtained and analyzed by an ultraviolet transilluminator with Image Lab software .Nuclear/cytoplasmic subcellular fractionation of DGCR5 in A704 cells was performed using the NE-PER Nuclear and Cytoplasmic Extraction Kit  according to the manufacturer\u2019s instructions. qRT-PCR was carried out to assess the expression of DGCR5 in nuclear and cytoplasm. The cytoplasmic and nuclear expression of DGCR5 was normalized to \u03b2-actin and U1, respectively.SiRNAs targeting DGCR5 (siDGCR5), FAM-siRNA, and negative-control siRNA (siNC) as well as miRNA negative controls (miR-control) and miR-211-5p mimics and inhibitors were designed and synthesized by GenePharma Co., Ltd. , and the sequences are listed in Post-transfected A704 cells were seeded 5000 cells per well in 96-well plates. The cell counting kit-8  assay was performed to analyze the cell viability at time points 24, 48, 72, and 96 h. Optical density was measured at 450 nm using a microplate reader .4 cells per well in 24-well plates and cultured for 24 h. The proliferation of A704 cells was detected using a 5\u2032-ethynyl-2\u2032-deoxyuridine (EdU) kit  per the manufacturer\u2019s instructions. The percentage of positive cells stained with both EdU and Hoechst was used to compare cell proliferation capabilities in different groups.The transfected A704 cells were seeded 3 \u00d7 10A704 cells post-transfection for 48 h were washed with cold PBS three times, stained with the BBcellProbe Kit  according to the manufacturer\u2019s protocols, and fixed with 75% ethanol overnight at 4\u00b0C. The cell cycle was analyzed by flow cytometer . The experiments were performed in triplicate.4 cells per well into the Transwell upper chambers  coated with Matrigel . Then, 700 \u03bcl complete media was added to the lower chambers. After incubation for 48 h at 37\u00b0C in a 5% CO2 incubator, cells were fixed by methanol and stained with 0.1% crystal violet. The invasive cells were counted in five random fields (\u00d7100) for quantification after wiping off non-invasive cells of the upper chambers. The assays were performed in triplicate.Transfected A704 cells were harvested, suspended with serum-free MEM medium, and seeded at a density of 4 \u00d7 104 cells per well into the Transwell upper chambers . Medium supplemented with 10% FBS was placed in the lower chamber. The non-migrated cells were carefully wiped out after incubation for 24 h. The migrated cells were fixed with methanol, stained with 0.1% crystal violet, and counted in five random fields (\u00d7100). The tests were performed in triplicate.A704 cells were harvested, suspended with serum-free MEM medium, and seeded with a density of 3 \u00d7 10A704 cells were seeded into six-well plates after 48 h of transfection, and the monolayer was carefully scratched with sterile 200 \u03bcL pipette tips after reaching 90\u201395% confluence. After removing floating cells with PBS, wound closure was obtained at 0 and 24 h. The percentage of wound closure calculated by the healing wound width at 24 h to the initial wound width at 0 h was used to analyze the cell migration abilities in various groups. Experiments were performed in triplicate.1. The Oncomine database with Jones  or wild-type (WT) miRNA response elements (MREs) for miR-211-5p of DGCR5 sequences were synthesized and cloned into a pGL3 basic vector . The reporter plasmids and miR-211-5p mimics were cotransfected into HEK-293 cells using Lipofectamine 2000 transfecting reagent . The luciferase activity was examined after transfection of 48 h by the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer\u2019s instructions. Renilla luciferase activity was used for normalization.Total protein was extracted from transfected cells using RIPA buffer  containing PMSF (Beyotime) according to the manufacturer\u2019s protocols. After determination of protein concentration by BCA kits (Beyotime), 20-\u03bcg protein samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes  followed by blocking in Tris-Buffered Saline Tween-20 with 5% bovine serum albumin (Beyotime). The membranes were incubated at 4\u00b0C overnight with specific primary antibodies: Snail , \u03b2-actin . After incubating with HRP-conjugated secondary antibody , protein bands were visualized using Chemiluminescent HRP Substrate (Millipore) on a Western blot imaging system . \u03b2-actin was used for normalization.t-test was used for comparison of two groups, and one-way analysis of variance (ANOVA) followed by Tukey\u2019s post hoc test was performed for multiple comparisons. P < 0.05 was considered as statistically significant.All quantitative data were presented as mean \u00b1 SD. All statistical analyses were carried out with SPSS version 17.0 . Student\u2019s P < 0.0001, To determine the expression of lncRNA DGCR5 in human RCC cell lines and tissues, we first screen for PCR primers targeting different exons of DGCR5  and barely detected in chromophobe RCC (chRCC). Our results are consistent with the previous microarray studies . It is kSimilar to protein-coding genes, lncRNAs undergo active splicing, and various isoforms of lncRNAs exist . When weThe tumor-promoting or -suppressive role of DGCR5 during carcinogenesis is not clearly understood. DGCR5 is found to promote cell proliferation and cancer stem cell properties and contribute to the radioresistance in laryngeal carcinoma cells by sponging miR-506 and miR-195 . DGCR5 win vitro. For unknown reasons, the knockdown of the second-major isoform (isoform-2) using an RNA interference strategy proved challenging. Therefore, we focused solely on the major isoform (isoform-1) of DGCR5. Consistent with the above findings, we also found that isoform-1 of DGCR5 was mainly localized in the cytoplasm in human ccRCC cells. Recently, multiple studies demonstrate that lncRNAs could modulate miRNA activities to further manipulate the expression of other RNAs in trans trough competitive endogenous RNA (ceRNA) interactions, which mainly occurs in the cytoplasm  is exclusively expressed in ccRCC tissues, which could serve as a diagnostic biomarker for ccRCC. DGCR5 isoform-1 could promote ccRCC cell proliferation, migration, and invasion, which is, at least partially, through sponging the tumor-suppressive miR-211-5p to regulate the expression of EMT key component Snail protein as well as its downstream targets, E-cadherin and CLDN7. Thus, DGCR5 isoform-1 can be a diagnostic biomarker and a novel therapeutic target in ccRCC.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by the Ethics Committee of Qilu Hospital of Shandong University. The patients/participants provided their written informed consent to participate in this study.XZ and Z-HX designed the experiment. G-XZ, JW, DL, and Y-JF performed the experiments, collected, and analyzed the data. G-XZ performed the bioinformatic analysis under the guidance of B-QL and XZ. JW and XZ contributed to the interpretation of the results. XZ, JW, and G-XZ contributed to the writing and revision of the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Ra =1.45 \u03bcm) considering a vertical step size of 0.25 mm with a 5 mm tool tip diameter. These findings are confirmed through plotting SPIFed Stribeck curves for the soybean and corn oils that show small hydrodynamic span regime changes for an increasing sample step-size forming process. This article elucidates the effects caused by mineral and vegetable oils on the surface of aluminum parts produced as a function of Single Point Incremental Sheet Forming process parameters.This paper focuses on studying how mineral oil, sunflower, soybean, and corn lubricants influence friction and wear effects during the manufacturing of aluminum parts via the single point incremental forming (SPIF) process. To identify how friction, surface roughness, and wear change during the SPIF of aluminum parts, Stribeck curves were plotted as a function of the SPIF process parameters such as vertical step size, wall angle, and tool tip semi-spherical diameter. Furthermore, lubricant effects on the surface of the formed parts are examined by energy dispersive spectroscopy (EDS) and scanning electron microscope (SEM) images, the Alicona optical 3D measurement system, and Fourier-transform infrared spectroscopy (FTIR). Results show that during the SPIF process of the metallic specimens, soybean and corn oils attained the highest friction, along forces, roughness, and wear values. Based on the surface roughness measurements, it can be observed that soybean oil produces the worst surface roughness finish in the direction perpendicular to the tool passes ( The single point incremental forming process (SPIF) is widely used to manufacture small batches of metallic and polymeric parts at room temperature using a CNC milling center, a support fixed to the metallic sheet to be formed, a spherical tip tool, and lubricants to reduce wear and friction force effects. In this sense, Allwood et al.  investigBy controlling tool rotations, Eyckens et al.  found th2 nanoparticles has during the SPIF of Al6061 metallic parts. Using Stribeck curves, they found an improvement on surface roughness and friction attained by the aluminum samples when reinforced lubricants were used. To investigate the impact that tool roughness has on controlling sheet metal forming, Sigvant et al. performed sheet metal forming simulations using a new a friction model with AutoFormplus, finding that the tool surface roughness plays an important role in sheet metal forming . The tested sliding distances of each material sample was 2000 m.\u00b5i is used to quantify the friction condition effects. This friction indicator is determined using the following equation [fF is the friction force, Fform is the forming force, aF represents the magnitude of the along force, and NF provides the normal contact force magnitude.For illustrative purposes, the collected SPIF forming forces experienced by the specimens are illustrated in equation ,27: (1)\u03bcTo determine the forming forces and the friction coefficients that the aluminum samples experienced during the SPIF process, a series of tests with different oils were carried out. z = 0.25 mm with a 5 mm tool tip diameter. From The along forming force magnitude curves of the metallic sheets are shown in The curves of S = \u03b7U/NF, where U is the mean speed, \u03b7 is the dynamic viscosity assumed to have a constant value, and NF describes the forming normal force [U depends on the distance travelled of the tool path along the surface sample and on the time span needed to complete the tool cycle for each vertical forming depth value. Thus, U can be found from the following equation: U = \u03c9d/(2\u03c0), where d is the tool travel distance at each forming depth value, \u03c9 is the frequency value related to the time span needed to complete one tool cycle. Normal force is found by considering the projection of the vertical force acting on the tool along the normal angle \u03b2 to the line of sliding contact in the plane of the aluminum surface sample, as illustrated in In this section, the SPIFed Stribeck curves are plotted to capture the behavior of the lubricants under hydrodynamic, mixed, and boundary regimes during manufacturing process of the aluminum sheets using the equation al force ,29. Here\u03b7U/NF. The lubricant fluid film then becomes thinner, and the metal\u2013metal contact starts to occur (mixed and boundary lubrication regimes). The corn and sunflower SPIFed Stribeck oil curves exhibit similar behavior. In both cases, the boundary lubrication regime is found to start at about S = 0.015 \u00d7 10\u22123 m\u22121. It is also interesting to observe from S close to the value of 0.015 \u00d7 10\u22123 m\u22121, the mineral oil (black solid line) causes a friction coefficient value that does not exceed of 0.27. Furthermore, for certain forming step depth and wall angle values, the contact interface between the surface sample and the tool\u2019s hemi-spherical tip moves through the boundary film lubrication regime (asperity contact), reaching the maximum friction coefficient magnitude values and then, the friction coefficient values start to decrease because of the SPIF bending moment effects [ effects .\u03b7U/FN, the friction coefficient linearly descends because of the film lubrication. When the normal force FN increases or the lubricant viscosity or velocity U decreases, the magnitude of \u03b7U/FN becomes smaller. This is an indication of oil film thickness reduction with an increase of the friction coefficient due to the degree of debris particles during the SPIF processing of the aluminum sheets. For smaller values of \u03b7U/FN, the tool tip with aluminum sheet  contact starts to occur and thus, the friction coefficient tends to increase sharply (boundary lubricant regime) [\u22123 m\u22121 to 0.14 \u00d7 10\u22123 m\u22121. Here, the boundary regime takes place for values of \u03b7U/FN less than 0.03 \u00d7 10\u22123 m\u22121. regime) . In both\u03b7U/FN from which the lubrication regime changed from a mixed film to the boundary regimes when the wall angle and SPIF depth values changed. Additionally, the experimental characterization of the samples surface with SEM show that the worn surface of the metallic material samples produced with vegetable oils have increased surface roughness when compared to those produced with mineral oils. Based on the surface roughness measurements, it has been found that soybean oil produces the worst surface roughness finish in the perpendicular direction to the tool passes, with a value close to Ra = 1.45 \u03bcm for a vertical step size of 0.25 mm and a 5 mm tool tip diameter. These findings are confirmed by plotting SPIFed Stribeck curves for the soybean and corn oils that show small hydrodynamic span regime for increasing sample step-size forming process.The effect that petroleum and vegetables oil-based lubricants have on the friction coefficient, wear, along forces, and surface roughness of metallic sheets manufactured using the SPIF process has been investigated by considering the vertical step size, wall angle, and semispherical tool tip diameter values. It was found that during the SPIF process metallic sheets, soybean and corn oils attained the highest friction, along forces, roughness, and wear. These results are confirmed by SPIFed Stribeck curves of the soybean and corn oils in which these lubricants exhibited small hydrodynamic regime span for an increasing sample forming process. From these SPIFed Stribeck curves, it is possible to identify the values of The FTIR experimental characterization of vegetables oils used during the SPIF process of the metallic parts show that when vegetable oil lubricants are subjected to pressure and frictional forces and metallic impurities, isomeric changes occur that allow sigmatropic rearrangement in their chemical molecular structure. However, less wear occurs in parts produced with mineral oil due to the absence of functional groups, low chemical affinity, and more efficient packaging of the linear hydrocarbonated chain. Therefore, one can conclude that the friction between the tool and the metallic sheet surface plays an important role in material deformation. Furthermore, the tool tip diameter, wall angle, depth, vertical step size, and tribological properties of the oil lubricant have a strong influence on the surface-finishing of parts produced by the SPIF process."}
+{"text": "During the single-point incremental forming (SPIF) process, a sheet is formed by a locally acting stress field on the surface consisting of a normal and shear component that is strongly affected by friction of the dragging forming tool. SPIF is usually performed under well-lubricated conditions in order to reduce friction. Instead of lubricating the contact surface of the sheet metal, we propose an innovative, environmentally friendly method to reduce the coefficient of friction by ultrasonic excitation of the metal sheet. By evaluating the tool-workpiece interaction process as non-linear due to large deformations in the metal sheet, the finite element method (FEM) allows for a virtual evaluation of the deformation and piercing parameters of the SPIF process in order to determine destructive loads. Robotized single-point incremental forming (SPIF), whereby a small-sized tool deforms a sheet of metal, is ideal for replacing expensive stamping processes, assuring flexibility and cost-effectiveness, as well as increasing the competitiveness of companies. This technology opens up new possibilities compared to traditional small-series production methods wherein added value is determined by skill and qualification. The forces resulting from friction between the tool and the workpiece during machining play an important role in product quality. The influence of petroleum and vegetable-oil-based greases on the coefficient of friction, abrasion, forming forces and surface roughness of metal sheets produced by SPIF was investigated in . LubricaVarious research methods have been used to evaluate the mechanical features of the robotized SPIF process ,3,4. TheThe complexity of SPIF mechanics and special conditions, such as bending under stress and cyclic bending/unbending, as well as the shear deformation process, which contribute to the improvement of overall formability, require innovative research efforts and techniques. Major parameters affecting formability are tool size, step down (drawing angle) and thickness and material properties of the metal sheet ,6,7. ForThe behaviour of the ultrasonically excited forming tool during the SPIF process was investigated in ,9. An FEIn order to reduce computational time in SPIF simulations, the FEM mesh is composed of several non-overlapping parts subjected to plastic and elastic deformations . The plaMaterials such as aluminium alloys are widely used to manufacture automotive, aerospace and other components due to their good strength, low weight and formability. Therefore, the peculiarities of SPIF processes using these alloys have been extensively studied by researchers ,14,15,16Multiple experiments have been carried out wherein material laws and corresponding material variables were selected and adjusted to correctly define the behaviour of the material. In order to define the deformation behaviour of sheet metal in real production, it is essential to accurately determine the ultimate deformations of the SPIF process compared to traditional material-formation limits and the effect of the process parameters on these deformations . In addiA review of the scientific literature shows that no attempt has been made so far to reduce friction between the tool and sheet metal by removing environmentally unfriendly petroleum products, which also affect the chemical composition of the formed sheets. Another important point is that the lubricated surfaces need to be cleaned after the forming process, which also increases the development time and cost of the product.SPIF is a process in which many independent parameters operate simultaneously, and it is an important task for engineers to anticipate these factors. A review of published research results suggests that alternative methods to reduce the coefficient of friction between the tool and the metal-sheet contact surfaces have not yet been proposed; the dynamics of the process have not been sufficiently investigated, and there is a lack of physical evidence suggesting that virtual models are appropriate.Metallic materials used in deforming processes, such as single-point incremental forming (SPIF), visibly deform on contact with the tool area. The key challenge of the SPIF process is to effectively assess the shaping forces. The forces generated during SPIF may be controlled by varying the coefficient of friction between the tool and the workpiece. Lubrication is an important factor in the SPIF process, reducing friction in the tool-workpiece contact area, but the use of grease is associated with environmental problems. Therefore, it is necessary to find other ways to reduce the shaping forces associated with the process dynamics. This requires, in particular, the development of a physically adequate mathematical model of the process, the mechanical parameters of which can be adjusted experimentally using the 3D scanning device shown in A 300 \u00d7 300 \u00d7 0.5 mm aluminum alloy AW1050 sheet embedded in a 30 \u00d7 30 mm L angle profile welded steel frame was formed. The frequencies of the resonant modes were determined using the COMSOL Multiphysics FEM. In order to change the lubrication of the contact surface between the forming tool and the metal sheet, an attempt was made to excite the metal sheet by vibrations. For this purpose, equipment, the scheme of which is presented in This equipment consists of an angled-profile metal frame (2) to which piezoceramic elements (3 and 4) are glued on different planes in order to excite bending oscillations of the higher harmonics in the frame. Since the metal sheet is rigidly attached to the frame by its outer contour, the vibrations of the frame also excite the metal sheet. This principle of ultrasonic 3D vibration excitation in the metal sheet makes it possible to reduce the friction between the metal sheet and the tool during SPIF in order to improve the lubrication conditions at the tool-workpiece contact pair and, in some cases, to completely eliminate the need for lubrication. The number of piezoceramic elements in the rectangular frame used to excite the 3D vibrations in the metal sheet can range from 2 to 8, according to the given scheme , by alimA 0.5 mm thick sheet of aluminum alloy, EN AW1050A H24, was used for experimental and numerical analysis. Material properties, taken from the supplier datasheet, are presented in As failure strain is a parameter dependent on stress state  and the \u03b5 is uniaxial strain.The stress-strain relationship needed for numerical analysis was obtained by a reverse-engineering approach using data from the physical cupping test. The physical cupping test was chosen to describe the material behaviour according to the power-law material model in order to reduce the number of material-model constants needed to calibrate. Using the range of material properties from the material datasheet , the power-law parameters, such as strength coefficient (K), hardening exponent (n) and failure strain, were calibrated using the LS-Opt system. The input range of the stress-strain curves for the power-law models used in LS-Opt is presented in In order to develop a validated numerical model of the SPIF process, several sets of experimental tests were performed. Firstly, the material model was calibrated by reverse engineering using experimental results of the cupping test. Subsequently, the same material model was used for the SPIF simulation. In order to characterize the plastic behaviour and ductile fracture of the aluminum alloy sheet, the Erichsen cupping test was performed on square aluminum plates, in accordance with ISO 20482: 2013 . The Erichsen standard provides information on fracture under the equi-biaxial state of stress. The results are influenced by sheet thickness and the friction between the sheet and the tool surface. For the Erichsen compression test, the specimen was attached to a 55 mm die with a heavy flange and bolts tightened to achieve a force of approximately 10 kN on the workpiece holder . The radThe experiment was carried out by applying a hemispherical punch to a sheet of metal until a crack appeared.In order to find a more efficient method to control the forming force, an attempt was made to excite the aluminum-alloy sample with ultrasonic vibrations. The experimental setup created for this purpose is shown in The metal-sheet vibrational analysis, performed with the Polytec scanning vibrometer, PSV-500-3D-HV, presented in a = 0.30\u20130.33 \u03bcm, and with ultrasonic vibrations, surface roughness was in the range of Ra = 0.18\u20130.25 \u03bcm.In order to assess the effect of vibrations on the SPIF of an aluminum-alloy sheet, of surface-roughness measurements of the sheet were taken with and without ultrasonic vibrations. An advanced surface-roughness tester, TR200 , was used to measure roughness. The measured surface roughness of the sheet formed without ultrasonic vibrations varied in the range of RIn order to determine the frictional force between the tool and the aluminum-alloy sheet a, calculL is the length of the tool link connecting the sphere and moment gauge (150 mm); \u03b1 is an angle between the sample sheet surface and the tool link (30\u00b0); OM and TM are tool-pressing-force- and tool-friction-force-generated angular momentums, respectively; OF and TOF are tool pressure force and the friction force projection to tool link, respectively; NF and TF are the tool\u2018s sphere pressure and friction force, respectively; Tk is the friction force coefficient between the sample sheet and the steel-tool sphere; and sv is the steel tool\u2018s sphere speed on the surface of the sample sheet (mm/s).Since the roughness momentum gauge was placed with an angle of 30\u00b0 degrees, both pressure and friction torque could be obtained. Friction force can be calculated as follows:The mechanical friction between the steel tool and aluminum-alloy sheet was measured using a torque sensor, STJ100, connected with a BGI series digital force gauge  and a PC . The torStrain path, stress state and prediction of the formability of the SPIF were evaluated by FE analysis. In all subsequent simulations, the explicit FE code LS-Dyna was used. The aluminum sheet was modelled using fully integrated shell elements with thickness stretch allowed. Through the thickness, linear variation of strain was evaluated by five integration points, and a shear correction factor of 0.833 was used. Contact between the punch/tool and the aluminum sheet was described using the keyword: * CONTACT_FORMING _ONE_WAY _SURFACE_TO_SURFACE. There were no damage models involved; only a simple failure model was used, based on maximum failure effective strain criteria.To simulate the cupping test and calibrate the material model. The FE model consisted of four parts: a deformable aluminum sheet, a rigid spherical punch, a bottom holder and a top holder. The holders were compressed with a force of 10 kN. The size of the shell elements varied between 0.5 at the centre/contact zone and 1 mm on the external side of the specimen. The FEM model a consistAfter curve fitting, the experimental force-displacement relation and the FE simulation prediction b correlaThe SPIF model consisted of two parts: an aluminum sheet and a forming tool . The aluThe load was applied by three functions of tool displacements: f(x), f(y) and f(z). All functions were continuous and varied so that the horizontal displacement per revolution was 0.5 mm and the vertical displacement per revolution was 0.5 mm. In an explicit numerical model, the speed of the forming tool was about 2 m/s; in physical experiments, it was 1.2 m/min. The trajectories of the forming-tool path are shown in The experimentally obtained ultrasonic excitation effect on friction forces was evaluated numerically by applying different friction coefficients. Various simulations were carried out, with coefficients of friction ranging from 0 to 0.5. The effect of friction on the horizontal-force component is shown in It can be seen that increasing the coefficient of friction from 0 to 0.5 increases the amplitudes of the X-force component by a factor of approximately two. In contrast, the effect on the vertical Z-force component is negligible a. The eft0 is the initial thickness; ft is the final thickness; and \u03b1 is the drawing angle between the initial flat surface and the deformed surface.SPIF is characterized by a reduction in the wall thickness of the final finished part compared to the initial thickness of the sheet metal. The excessive-thickness reduction ratio in the deformation zones when the sheet metal is formed separately has a significant effect on the forming limit. Prediction of the thickness of the deformation zone is an important approach to control the thinning ratio. With regard to the object of study, aluminum alloy, the principle of thickness deformation in the SPIF process is presented in The drawing angle obtained in the simulation varied from 47\u00b0; therefore, according to the sine law, this would lead a reduced thickness by up to 0.34 mm. In contrast, the minimum thickness obtained in the simulation was 0.335 mm. Three elements  with different drawing angles of 47\u00b0, 30\u00b0 and 17\u00b0, respectively, after a forming depth of 25 mm show the development of the thickness reduction. The results obtained from the SPIF simulation correlate well with the sine law. Strain distribution after a forming depth of 25 mm is presented in Deformation phenomena during incremental formation are still under discussion. In the absence of direct experimental evidence, some researchers have claimed that deformation is caused by stretching, while the others state that it is caused by through-thickness shear ,22. If oThe results show that the through-thickness shear strains have significant values compared to the in-plane  shear strains. In particuar, the transverse through-thickness deformation of element No. 6285 accounts for about 50% of the in-plane shear deformation.As vibrational excitation of the sheet-metal sample was performed by piezo actuators attached to the steel frame, the calculations were also performed by exciting the frame in which the aluminum-alloy sheet was mounted. The results of experimental and theoretical studies for the first embedded sheet in steel-frame mode, presented in The force-displacement response was obtained by plotting the reaction force on the punch vs. the displacement of the punch .maxF = 1160 N, Erichsen index IE = 5.36 mm. Force vs. displacement curve was chosen as the validation criterion for the numerical model.The maximum load for all five cupping tests was The SPIF experiment was performed under dry, lubricated and vibration-excited friction on the contact surfaces of the tool and the sheet metal. The vertical force dependences on the process conditions are given in Accordingly, to verify modelling results  were found to be much higher than the values given in the material datasheet since tensile failure strain constitute 3\u20138%, and the values of failure strain calibrated by the cupping test constitute 38%. This confirms that failure prediction in the incremental forming process is not straightforward."}
+{"text": "A recent study has established that thinkers reliably engage in epistemic appraisals of concepts of natural categories. Here, five studies are reported which investigated the effects of different manipulations of category learning context on appraisal of the concepts learnt. It was predicted that dimensions of concept appraisal could be affected by manipulating either procedural factors  or declarative factors . While known effects of these manipulations on metacognitive judgements such as category learning judgements and confidence at test were replicated, procedural factors had no reliable effects on the dimensions of concept appraisal. Effects of declarative manipulations on some forms of concept appraisal were observed. Questions surrounding the nature and role of concepts in thought have been at the forefront of research in psychology for many decades. A less explored aspect of concepts is the way in which thinkers assess their own concepts. In a previous empirical study, we have discovered that people evaluate their concepts epistemically. We called this aspect of thinking about concepts \u201cconcept appraisal\u201d . To explThe existence of dimensions of concept appraisal raises the question of whether and how these dimensions could be manipulated. This question is directly relevant to some of the issues that motivated the initial study, and in particular to issues surrounding conceptual engineering in philosophy , a projeAs a way of operationalising the issue, we looked at the metacognitive literature exploring the factors that influence people\u2019s evaluations of their own judgements, beliefs, and categories. In this literature a distinction is drawn between procedural or experiential factors  and declarative or theory-based factors  and manipulated their size to induce experiences of fluency and disfluency. Size has been shown to influence metacognitive judgements . Study 3Studies 4 and 5 turn to declarative factors. They test the possible impact of information about the structure of the newly learnt categories on concept appraisal. Here we adapted a design from Inspired by research on category learning judgements , we adopstudy phase was presented on either Microsoft Visual Basic version VB15x  or Qualtrics , at least half of which had not been seen previously, and had to decide which category the exemplar belonged to. After each classification, participants provided a confidence judgement about their classification on a scale of 1 (very unconfident) to 5 (very confident). Participants were unable to change their classification judgements after making a selection. All exemplars appeared in a random order. Participants were given as much time as they needed to complete the concept appraisal questions and the test phase.The In the first study we wanted to explore whether the spacing effect shown in the previous metacognition literature  would inN = 41 . Sample size was sufficient to provide a power of 0.87 to detect a medium sized effect (d = 0.5).1Forty-three participants  recruited through an opportunity sample through the recruitment pool at City, University of London, participated in this study in exchange for a small monetary reward. Two participants whose performance fell more than two standard deviations below the mean (20% or less correct) were excluded from the study leaving www.whatbird.com. All presented images were 450 px by 450 px. Initially 12 bird families were selected . A pre-test (N = 33) obtained ratings of within-family similarity for each family of birds on scales of 0 (extremely dissimilar) to 100 (extremely similar)  were selected for use in this study. Ten exemplars from each of these bird categories were selected as stimuli for this study, five or which were presented in the study phase. There were some marginal differences between the six families of birds in terms of similarity . The 30 exemplars used for the study phases were presented one at a time for 4 s in two blocks of 15 trials. These exemplars were then each presented a second time for 2 s each in another two blocks of 15 trials. Exemplars were randomised between blocks.To select stimuli for the study, we selected ten exemplars from bird families used by N = 22) or SMSM (N = 21), where M refers to blocks where the categories were presented in a massed fashion, and S referred to blocks where the categories were presented in a spaced fashion. Blocks 3 and 4 used the same categories as Blocks 1 and 2, respectively. Exemplars were presented in a new random order for each participant. In the test phase, all ten exemplars from each category of birds were presented to participants for naming.A 2 factor (Study: Massed vs. Spaced) within-subjects design was implemented whereby participants learned six categories of birds, three of which were presented in a massed sequence and three in a spaced sequence. In the study phase, for massed blocks, participants were presented with study items from three categories, with five from the first, then five from the second and then five from the third. In spaced blocks, the 15 birds from the three categories were randomly ordered. Which bird families were assigned to massed versus spaced conditions was balanced across participants, and the type of study presented first in the experiment was also counterbalanced. The blocks were presented in one of two orders MSMS  = 6.23, p = 0.02, \u03b7p2 = 0.14], indicating that participants overestimated their future performance on the task . Further, there was a main effect of Study, with estimated and actual performance, taken together, higher for massed categories  than for spaced categories . The benefits of massed categories were qualified by a significant interaction between Study and Performance . Unlike t(40) = 4.62, p < 0.001, d = 0.77] and not when categories were presented in a spaced fashion .To examine the accuracy of participants\u2019 predictions, in this and subsequent studies, CLJs (estimated performance) for massed and spaced categories were converted into a percentage and compared to the percentage of exemplars from these same categories that were correctly classified. Comparison of estimated (CLJ) and actual performance was treated as a within-subjects factor labelled Performance. The results are shown in the first panel in M = 3.31, SD = 0.74) than exemplars that were novel . However, there was no significant difference between massed and spaced categories , indicating that the manipulation did not have an effect on post-dictions. There were no other main effects or higher order effects from this analysis.At test, participants rated confidence in each of their categorisation judgements on a scale from 1 to 5. Mean confidence was calculated for each condition. Means are shown as the first row in the top panel of F = 1.14, p = 0.37, \u03b7p2 = 0.25] or Study , and no significant interaction  (Wilks Lambda reflects the proportion of variance not attributable to effects). Thus, we found no evidence that a massed vs. spaced manipulation that succeeded in modifying CLJs had any influence on either confidence judgements, or judgements of concept appraisal.Having established that our manipulation was effective, we next tested whether the manipulation influenced the nine dimensions of concept appraisal. Results are also shown in the top panel of F ratios for the univariate effects of the Study factor on the nine dependent variables was used to calculate a Bayes Factor using How strong was the evidence for the null hypothesis here? Bayesian statistics for MANOVA are complex , so a siContrary to The second study used image size  to introMAge = 34.91) were recruited at an Institute of Philosophy Public Engagement event (\u201cSelf Impressions\u201d) at the Tate Modern in London, and completed the procedure. Sample size (limited by attendance at the event) provided power of 0.64 for a medium-sized effect (d = 0.5). Because of the need to keep the study time to a minimum for our volunteers, we focussed on just two concept appraisal dimensions Induction and How Much to Learn, as representing appraisals of the dependability of the classification.Eighty-nine participants  aged between 18 and 76  or small . First was a study phase where participants were presented with an image of a painting and were given 5 s to decide whether the painting was a minimalist or an expressionist style of painting. They were provided with feedback about the correct classification after each trial. Participants completed one block of 20 trials. Following the study phase participants gave CLJs (predicting how well they would do in the test phase) and a further judgement about how well they thought they had done in the study phase, both on scales from 0 to 100%. The test phase occurred directly after the study phase. The test phase had the same structure as the study phase, using new images, but no feedback was given after each trial, and images were presented at intermediate size.A between-subjects design was implemented. Participants were randomly assigned conditions where the images presented in the study phase were either large  = 4.02, p = 0.048, \u03b7p2 = 0.044]. Participants generally underestimated their performance on the task , but this effect was qualified by a significant interaction . As predicted, participants presented with large images  thought they had done better than participants presented with small images  although actual performance was the same.Percentage Correct in training and judgements of how well they had performed in training are shown in the second panel of the top row in F = 43.50, p < 0.001, \u03b7p2 = 0.33], with participants predicting 76% correct as against performance of 87%. The interaction of Performance with Size approached significance . Size of the paintings had a significant effect on CLJs , but not on percent correct at test  and actual test performance , a between-subjects MANOVA was conducted, and results are shown in the middle panel of F = 2.17, p = 0.12, \u03b7p2 = 0.045], indicating that our fluency manipulation had no effect on how subjects assessed the concepts for the two tested dimensions of concept appraisal: Induction and How Much To Learn. Bayes Factors for the two univariate ANOVA were 0.32 and 0.26, indicating weak evidence in favour of the null.To test for the effect of the fluency manipulation on concept appraisal  on subjects\u2019 estimations of both their past and future performance: subjects who saw larger images thought they had done better, and predicted better performance than those seeing smaller images, even if their estimates did not track actual performance.We did not find an effect on the two tested dimensions of concept appraisal. Fluency did not show any influence on subjects\u2019 judgements about how good the two categories would be for making inductions nor for how much there is to know about the two categories. One possibility is that concept appraisal is related to the subjects\u2019 propositional knowledge and not to the visual information related to the concept in question. To explore this option, in the next study we used lists of written descriptions that described categories instead of using visual categories directly. These stimuli were more similar to the ones we used in our original study on concept appraisal .In Study 3 we changed the type of stimuli from visual categories (pictures) to verbal categories (lists of features) and we applied a fluency manipulation to the stimuli by varying the type of font used: one font was easy to read, whereas the other font made reading more difficult. Previous metacognitive research showed that this manipulation can influence a variety of metacognitive assessments  includinMAge = 33.74). Power was estimated as 0.77 for a medium-size effect (d = 0.5).To increase the power of our between-subjects design, 125 participants were recruited for an online study through Prolific Academic in exchange for a small monetary award. Five participants withdrew part-way through the study, two participants indicated using additional aids to complete the task, and four participants performed more than two standard deviations below the mean. These participants were all excluded from the final analyses. The final sample for this study consisted of 114 participants  aged between 18 and 65 (Kehoe ants and Victoria ants) which were adapted from the categories used by The design of this study followed the general method. Participants learned two categories of fictional ants (N = 60) or a 12 pt Blackadder ITC font , and reliability  = 0.01, p = 0.81, \u03b7p2 < 0.001]. Although, participants greatly underpredicted their performance on the task , this underconfidence was not moderated by a higher order interaction with fluency condition . This result differs from the findings in Studies 1 and 2 and indicates that the fluency manipulation may not have been effective in this Study on CLJs.As with Study 1, CLJ were converted into percentages to allow for a more standardised comparison between CLJs and actual performance. Results are shown in the lower left panel of M = 2.49, SD = 0.92) were found to be more confident in their performance at test than participants in the disfluent condition . There was no main effect of Stimuli , and no significant interaction between the two independent variables . Therefore, whilst fluency did not influence people\u2019s prediction of their future performance, there is some evidence that it affected people\u2019s confidence in the test phase, suggesting that the verbal manipulation may have influenced a different of metacognitive process than visual manipulations.Average Confidence judgements across trials at test were calculated for each condition and are shown as the first row of the bottom panel in F = 0.09, p = 0.98, \u03b7p2 = 0.003]. Bayes Factors for the null were 0.20\u20130.21 for the four dimensions, indicating weak support for the null. Thus, once again we found no evidence that fluency manipulations, which are strong enough to replicate known effects on metacognitive judgements, have any effect on subjects\u2019 appraisal of concepts.Having established the effectiveness of fluency for manipulating confidence, we next tested whether the manipulation influenced subjects\u2019 appraisal of concepts. Results are shown in the lower panel of In the study we applied a manipulation of processing fluency by changing the font of the texts the subjects read. We used texts describing fictional natural categories consisting of species of ants  instead Having now reported three studies exploring whether fluency manipulations can have an impact on how subjects assess their own concepts, we hypothesise that concept appraisal might not be influenced by experiential and procedural factors such as a feeling of fluency.As a result, we turned from procedural to declarative factors. We decided to explore whether manipulations of beliefs associated with the concepts would have an impact on concept appraisal. This is the aim of Studies 4 and 5: here we manipulate subjects\u2019 explicit beliefs about the categories and explore whether this has an impact on how they assess their concepts for understanding, reliability, and communication.In this study we manipulated subjects\u2019 explicit beliefs about new categories. To do so we adapted a design from M = 35.48). Power was estimated at 0.82 for a medium-size effect (f = 0.25).Two hundred and one participants recruited for an online study through Prolific Academic participated in this study in exchange for a small monetary award. Sample size in this study and the next reflected the increase in the number of between-subject conditions from 2 (in Study 3) to 4 in Studies 4 and 5. Two participants withdrew part-way through the study, three participants indicated using additional aids to complete the task, and eight participants were identified as extreme outliers in the test phase (more than two standard deviations below the mean). These participants were all excluded from analyses. The final sample for this study consisted of 188 participants  aged between 18 and 73  and a control condition. These were the same conditions used by N = 46) were informed that the first feature (level of iron sulphate in the blood) caused the emergence of the other four features. Those in the \u201ccommon effect\u201d condition (N = 51) were told that the last feature (body weight) was caused by the other four features. Finally, participants in the \u201ccausal chain\u201d condition (N = 48) received information that the five characteristics form a causal chain so that each one influences the next one along the chain starting with the first feature (level of iron sulphate in the blood) and ending with the last feature (body weight). Each causal relationship was described by a single sentence. In the control condition (N = 43) there was no information about relations between features. Participants assigned to the \u201ccommon cause\u201d condition , participants made classification and confidence judgements of 16 exemplars, based on four \u201cnovel\u201d exemplars from each category, not previously seen in the study phase, and four \u201cold\u201d exemplars from each category, which they had seen in the study phase. Following this, as an additional test of classification confidence, participants completed a second task (the Single Feature Task) that provided participants with ten new exemplars in random order. Each of these exemplars reported a single feature that was typical of either one category or the other. Participants made classification and confidence judgements for each of these exemplars.Participants were first presented with the same backstory about the two fictional categories presented in Study 3. When participants turned the page, they were shown a table of the prototypical features of one of the two fictional categories and were given as much time as they needed to study the table. Participants in the three causal conditions were also presented with further information about the causal relationships between the five features. Participants then received the corresponding information about the second fictional category. Participants in the control condition were only presented with the table of features associated with each category of ant. Following presentation, participants completed the study, metacognitive and appraisal, and test phases. The study was completed on Qualtrics.To test the effectiveness of the causal category manipulation we assessed the differences between the four conditions in performance during the test phase. We anticipated that if the causal category manipulation was effective then participants would rely upon the causal structure information given in the first part of the study during the test phase, leading to differences in performance.F = 0.78, p = 0.51, \u03b7p2 = 0.01]. However, there was a main effect of actual (Mean 74.9%) vs. estimated (Mean 50.2%) performance, indicating that participants underestimated performance on the task . Crucially there was no significant interaction between the two independent variables . These results provide very little indication that that the causal manipulation had an effect on individuals\u2019 metacognitive beliefs.Percent Correct and CLJs transformed to percentages were calculated for each condition and are shown in the lower right panel of F = 1.23, p = 0.30, \u03b7p2 = 0.02], suggesting again that there were very limited differences in actual performance between the four conditions.Percent correct was also calculated for the single feature task, and results are also shown in F = 1.04, p = 0.38, \u03b7p2 = 0.02]. There was a main effect of Stimuli . Strangely, participants were more confident with novel exemplars than previously seen exemplars (Old: 3.07 vs. Novel: 3.19), but this was not qualified by a significant interaction with causal condition . These results suggest that causal condition may have only limited influence on confidence judgements. In support of this conclusion, the Single Feature task also showed no differences between conditions in confidence in classification performance .We next tested differences between causal conditions in confidence judgements given during the test phase. Mean confidence judgements for Study 4 are to be found in F = 1.60, p = 0.09, \u03b7p2 = 0.04]. Exploratory univariate analyses revealed a significant difference between conditions in Knowledge (How Much You Know) ; in post hoc comparisons, participants assigned to the three causal conditions  felt more knowledgeable about the two categories of ants than participants assigned to the control condition . Participants who were assigned to the three causal conditions and received further information about the two categories of ants were aware of their greater knowledge of the categories. No other post hoc tests were found to be significant. There were no significant differences between conditions for the two reliability judgements (Informativeness: p = 0.48 and Induction: p = 0.63).2 These results indicate that whilst the subjects\u2019 assessment of how well they understood the concept could be manipulated by providing further information about the category, the subjects\u2019 assessment of how reliable the concepts are may be more difficult to manipulate.More crucial to our aims, we next tested whether the causal manipulation had an effect on participants\u2019 appraisal of how well they understood the categories and how reliable they were . However, having new information had no impact on their judgements about the reliability of the new concept. Perhaps presenting participants with several exemplars that contradicted the causal structure of the category of ants reduced the legitimacy of the category. We test this in Study 5.Studies 1\u20133 showed no effect of fluency manipulations on dimensions of concept appraisal. In Study 4 we tested a manipulation of beliefs associated with new categories (new species of ants) to explore whether these beliefs relating to the structure of two distinct categories could have an impact on how subjects appraised their concepts. We found that having declarative information about the causal structure of the category made subjects rate the categories higher on the dimension In the final study instead of using two categories of ants, we only used one. We presented different groups of participants with three types of causal relations  and had a control group that didn\u2019t see any type of causal relation. We added a quiz to ensure the features and causal structures were understood, so that it could be taken into account in appraising the categories. To widen our exploration of the influence of causal knowledge on concept appraisal we also expanded the list of appraisal questions from the previous studies to a total of 15 dimensions. We were interested to discover if other diverse metacognitive questions would show an influence of the manipulation of causal structure.M = 35.16). Power was estimated as 0.96 to find an effect size, Pillai V = 0.4.Two hundred and nine participants were recruited for an online study through Prolific Academic. Eight participants withdrew before the concept appraisal phase of the study and six participants answered more than one question incorrectly during the feature and/or the causal structure quiz. These participants were excluded from analyses. Final analyses were conducted on 196 participants  aged between 18 and 70 (N = 46), Common Effect (N = 50), or Causal Chain (N = 50), or a Control condition (N = 50). The four conditions were identical to Study 4, except participants only learnt about one category of ants (\u201ckehoes\u201d). After learning, participants were tested on their knowledge of the features associated with kehoes. Participants were presented with five questions, which each asked about one of the five features associated with the category. For each question participants were asked which of two characteristics was associated with the category . The five questions were presented in a random order. Participants had two attempts to get every question correct before moving on to the next part of the study.This study again drew influence from Next, participants in the three causal conditions also completed questions about the causal structure associated with kehoes. Participants were presented with four questions, corresponding to the four causal relationships they learned about in the first part of the study. Each question in the quiz asked participants to choose which of two statements correctly described the relationship between two features possessed by kehoes . Again, participants were given two attempts to get every question correct. The full list of quiz questions can be found in The concept appraisal phase was similar to the previous studies. Participants completed a series of concept appraisal questions about the category they had just learnt about see . To asseTo begin with, participants were presented with the same backstory about the fictional category of ants presented in Studies 3 and 4. When participants turned the page, they were shown a table of the prototypical feature of the fictional category and were given as much time as they needed to study the table. Next, as in Study 4, participants in the three causal conditions were presented with further information about the causal relationships between the five features. Next, participants completed the quiz section of the study. After participants had successfully answered all of the questions (being excluded after two failed attempts), they completed a series of concept appraisal questions. The study was completed on Qualtrics.F = 1.33, p = 0.08, \u03b7p2 = 0.101]. To further explore planned effects on concept appraisal, two additional analyses were conducted looking at the effect of the manipulation first on the four original dimensions of concept appraisal, and second on the five questions relating to essentialist beliefs about the category.The focus of this study was on the fifteen concept appraisal questions. Mean judgements are shown in F = 1.68, p = 0.035, \u03b7p2 = 0.035; How Much You Know  and Explain . Participants in the common cause condition  felt that they knew more about the category than participants in common effect  and control conditions . Participants in this condition  also felt more able to explain kehoes than participants in the common effect , causal chain , or control conditions . There were no differences between conditions in Induction (p = 0.51) and Informativeness (p = 0.34). These findings are similar to Study 4.A between-subjects MANOVA analysis of the four concept appraisal dimensions revealed a main effect of causal condition . Univariate analyses were all non-significant, with Bayes Factors between 0.18 and 0.39 favouring the null hypothesis.A similar analysis tested whether the causal manipulation influenced perceptions of essentialism about the category  and the control condition. They also felt they could explain more about the category in the common cause condition as opposed to the common effect, causal chain, and control condition. We did not, however, find any effect of the common cause condition on raising subjects\u2019 ratings of the reliability of the concept.In a previous study we found that people assess their concepts for their usefulness in their thinking process. They assess concepts for understanding, reliability, and as tools for communication. To show this we tested eight dimensions of concept appraisal and found that these dimensions were valid between subjects and ranged across many conceptual domains . This waOur interest in concept appraisal stems in part from the hypothesis that the way people appraise a concept epistemically will be an important determinant of whether and why individuals abandon and replace certain concepts. Across a social group, this would give some insight into why the concepts we use change over time, for example during a scientific revolution. Conceptual change is also bound up with changes in cultural norms (most likely part cause and part effect). The project of \u201cconceptual engineering\u201d aims to effect changes to concepts in common use in order to further social and political aims. Yet little is known about how such changes can be carried out and what kinds of interventions are effective. Manipulations that affect concept appraisals, through changing concept-users\u2019 Sense of Understanding of a concept, or their epistemic appraisals along other dimensions, offer one avenue for potential interventions on the repertoire of concepts in common use. The current study is the first, preliminary examination of whether manipulations that are known to affect other forms of metacognitive assessment can also affect concept appraisal.We aimed to explore two main questions. First, we wanted to establish whether manipulations that are known to modulate metacognitive judgements could indeed have an effect on concept appraisal. Second, if so, we wanted to discover what type of manipulation would be effective: procedural manipulations based on a thinker\u2019s subjective experience in processing information, or declarative manipulations that provide new information that can connect with the person\u2019s beliefs and knowledge about the category. The rationale behind the exploration of these two questions connects the discovery of the existence of epistemic appraisals of concepts with the issue of how these dimensions could be manipulated . We looked at a body of literature that shows that subjects\u2019 epistemic evaluations of beliefs and judgements about categories could be manipulated by factors stemming from the way in which information is processed (fluency vs. disfluency) and by declarative knowledge about the categories.Studies 1\u20133 used metacognitive manipulations of fluency and replicated known effects on metacognitive judgements, but yet showed no effect of fluency on concept appraisal. Studies 4 and 5 used manipulations of the causal structure of the categories and showed that a category\u2019s having more causal structure has an impact on thinkers\u2019 appraisal of how much they know about the category but not on their assessment of the reliability of the categories themselves.More studies are needed to better understand this difference. One future direction of research is to try other metacognitive manipulations commonly used in the literature. A possible factor is familiarity which can be manipulated in different ways, such as pitting familiar against unfamiliar concepts and measuring participants\u2019 appraisals. Another approach would consist in comparing epistemic evaluations of concepts in familiar and unfamiliar domains.A second direction for future studies could explore the different aspects of concept appraisal separately. As already said, our previous study  showed tFuture studies may focus on manipulations of the different dimensions of concept appraisal in isolation. It could be that we come to the same conclusion when exploring each dimension separately; in this case we might have reason to conclude that many metacognitive manipulations do not affect dimensions of concept appraisal . Alternatively, we might find that different aspects of concept appraisal are sensitive to different types of metacognitive manipulations. It is very possible that any appraisal of concepts is difficult to affect by piecemeal manipulations, since concepts tend to be complex bodies of information that include beliefs, prototypical representations, and other pieces of knowledge clustered in a representation. We might also need to use a finer-grained way to manipulate concept evaluations, not only by studying each dimensions of concept appraisal separately, but also by disentangling the different aspects of a conceptual representation.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Psychology Research Ethics Committee, City, University of London. The patients/participants provided their written informed consent to participate in this study.ST, JS, JQ-D, NS, and JH conceived and planned the experiments. ST carried out the experiments and wrote the first draft of the manuscript. ST and JH contributed to the analysis and the interpretation of the results. JS wrote the final version of the manuscript. All authors provided critical feedback, helped to shape the research, analysis, and manuscript, and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Data regarding the inter- and intraobserver variability in the radiological assessment of sialolithiasis using cone beam computed tomography are missing in the current literature. This study assessed the inter- and intraobserver variability in the radiological assessment of sialolithiasis using cone beam computed tomography (CBCT). In 107 patients, 130 salivary glands (65 parotid and 65 submandibular) with clinical signs of obstruction were assessed by four independent observers; 2 residents OMFS and 2 experienced OMFS. The observers analyzed the CBCT images and determined the absence or presence of one or more salivary stones in the affected gland. This procedure was repeated after three months. Interobserver agreements showed kappa values of 0.84 for the parotid gland, and 0.93 for the submandibular gland. Intraobserver agreements for the whole group reported kappa values between 0.83 - 0.95. There was no significant difference between residents and experienced OMFS. Due to the good inter- and intraobserver agreement, CBCT appears to be a reproducible imaging modality for detecting salivary stones in patients with signs and symptoms of obstructed parotid and submandibular glands. Key words:Salivary gland calculi, cone-beam computed tomography, observer variation. Symptomatic sialolithiasis is a disease whereby the outflow of saliva of a major salivary gland is mechanically blocked due to calculi within the salivary duct. A salivary stone originates from a nidus that is composed of various ratios of organic and inorganic substances and can eventually lead to obstruction of a salivary gland duct. Patients often present with recurrent, sometimes mealtime-related, painful unilateral gland swelling. This can remain transitory or be complicated by a bacterial superinfection.et al reported that parotid glands are affected up to 40% of the cases which is very high percentage and may be explained by the sensitivity of the detection methods used  radiography, ultrasonography (US), magnetic resonance imaging (MRI), computed tomography (CT) and sialography. Each of these imaging modalities has its own advantages and disadvantages. US and 2D radiography are routinely used owing to the readily availability cost-effectiveness, and absence and lower radiation dose, respectively .Recently more research attention is being paid to the conebeam computed tomography (CBCT) application for salivary stone diagnosis. A mean sensitivity and specificity for salivary calculus diagnosis of 98,85% was reported in a retrospective study . It was A prospective study to evaluate the value of CBCT in de detection of salivary stones prior to sialendoscopy, was performed by our research group . A sensiHowever, data regarding the inter- and intraobserver variability on the interpretation of CBCT images related to the possible presence of salivary stones are missing. But imaging techniques do not make diagnoses; rather, they aid observers who make the diagnosis -10. ObseThe patients were referred to the Department of Oral and Maxillofacial Surgery of the Medical Centre Leeuwarden, the Netherlands, for the diagnosis and management of salivary gland obstruction of the submandibular or parotid gland during the period January 2012 to August 2016. A CBCT scan was performed at the first visit to determine the absence or presence of one or more salivary stones. The selection of this cohort was described in our prospective study , 28 patiAll CBCT images were acquired with a PaX-Zenith 3D scanner  . The CBCT images were retrospectively analyzed using a workstation, which was technically approved for radiological diagnostics, consisting of a 17-inch LCD monitor and a computer. Four observers participated in this study: two experienced oral and maxillofacial (OMF) surgeons with each more than twenty years of clinical experience and two residents of OMF surgery with each a minimum of 2 years clinical experience. All the observers interpret daily CBCT images. The observers had freedom to navigate the CBCT images and they could adjust the greyscale.In the first session the observers were provided with the set of CBCT images and the specification of the affected gland . No further clinical information or patient data were given to the observer. The reviewing observers were fully aware that their judgment would be compared to others and had no calibration exercises beforehand. The observers analyzed the CBCT images and determined the absence or presence of one or more salivary stones in the affected gland . Three months after the first session, each of the four observers repeated the procedure. The order of data of the set was randomly changed.- Statistical analysisThe collected data were analyzed using statistical software SPSS (IBM SPSS Statistics 26) and R (version 3.6.3 (r77832)). R was used for assessment of the interobserver variability of all observers by calculation of Lights Kappa and kappa statistics of SPSS was used for assessment of the intraobserver variability by calculation of Cohens Kappa . Kappa . The folInter- and intraobserver variability rates are summarized in The results of the present study demonstrate good agreement in the radiological assessment of the absence or presence of salivary stones in the parotid and submandibular gland Fig. , Fig. 2 The result may be explained by the routinely daily exposure and therefore experience with interpretation of medical CT and CBCT images for various reasons by residents.In this study, cases with inter- or intraobserver disagreement showed specific diagnostic difficulties. Firstly, some cases were difficult to interpret due to anatomic interpretations, especially in the area on the medial site of the ascending ramus of the mandible where it may be hard to distinguish between stones in the deep lobe of the parotid gland, the uncinate processs of the submandibular gland, or the tonsil Fig. . SecondlA limitation of the current study is the exclusion of 28 patients from the original cohort due to missing data. Another limitation is that the data do not indicate whether the observers agreed in their assessment on the same calcification. In other words, observations with a true positive and false positive outcome could be scored as agreement.Other studies that have determined the inter- and intraobserver variability in the diagnostic assessment of various aspects on CBCT showed comparable good results, including buccal bone measurements of dental implants, assessment of temporomandibular joint condylar morphology, detection of periodontal defects, identification of apical periodontitis, assessment of impacted mandibular third molars, and mandibular condyle fractures -18. ThesBesides CBCT, a variety of imaging modalities is used for the detection of salivary stones. Each of these modalities has its advantages and disadvantages such as the sensitivity and specificity for the diagnosis of a salivary stone, dose of ionizing radiation, the costs and the readily availability of the technique in daily practice.US is the least invasive method. Based on low costs, high availability, and no radiation dosages, US is routinely used in many practices . The senDue to the low costs, high availability and low radiation dosages, 2D radiography is often used in daily practice but the sensitivity is quite low with a reported rate of 60.7% . For intMedical CT displays a high accuracy in the detection of salivary stones, with a reported sensitivity rate of 98% when using sialendoscopy as a gold standard . In our When a stone is detected on a CBCT-scan in a patient with clinical signs and symptoms of salivary gland obstruction, the majority of cases require treatment. A variety of minimally invasive techniques is available for this purpose: sialendoscopy, transmucosal surgical approach, a combined approach and intra- or extracorporeal stone fragmentation.et al. presented a therapeutic decision tree for determining the best minimally invasive technique to treat submandibular and parotid calculi, according to the diameter of the calculi and their position in the ductal system (Foletti l system . They sul system . More reCBCT appears to be a reliable imaging modality for detecting salivary stones in patients with signs and symptoms of obstructed parotid and submandibular glands with a good intra- and interobserver agreement."}
+{"text": "Much applied research on the consequences of conflicts for health suffers from data limitations, particularly the absence of longitudinal data spanning pre-, during- and post-conflict periods for affected individuals. Such limitations often hinder reliable measurement of the causal effects of conflict and their pathways, hampering also the design of effective post-conflict health policies. Researchers have sought to overcome these data limitations by conducting ex-post surveys, asking participants to recall their health and living standards before (or during) conflict. These questions may introduce important analytical biases due to recall error and misreporting.We investigate how to implement ex-post health surveys that collect recall data, for conflict-affected populations, which is reliable for empirical analysis via standard quantitative methods. We propose two complementary strategies based on methods developed in the psychology and psychometric literatures\u2014the Flashbulb and test-retest approaches\u2014to identify and address recall bias in ex-post health survey data. We apply these strategies to the case study of a large-scale health survey which we implemented in Colombia in the post-peace agreement period, but that included recall questions referring to the conflict period.We demonstrate how adapted versions of the Flashbulb and test-retest strategies can be used to test for recall bias in (post-)conflict survey responses. We also show how these test strategies can be incorporated into post-conflict health surveys in their design phase, accompanied by further ex-ante mitigation strategies for recall bias, to increase the reliability of survey data analysis\u2014including by identifying the survey modules, and sub-populations, for which empirical analysis is likely to yield more reliable causal inference about the health consequences of conflict.Our study makes a novel contribution to the field of applied health research in humanitarian settings, by providing practical methodological guidance for the implementation of data collection efforts in humanitarian contexts where recall information, collected from primary surveys, is required to allow assessments of changes in health and wellbeing. Key lessons include the importance of embedding appropriate strategies to test and address recall bias into the design of any relevant data collection tools in post-conflict or humanitarian contexts.The online version contains supplementary material available at 10.1186/s13031-022-00446-0. Civil conflicts have become more common and more physically destructive since the mid-20th century, affecting poorer countries disproportionately, with devastating consequences for health , 13, 14.causal effects of conflict exposure on post-conflict population outcomes (net of the influence of other socio-economic determinants of these outcomes), as well as of (2) the causal pathways for these effects. Often, these data shortcomings have resulted in studies drawing conclusions from methods that are inherently flawed to support reliable inference , being therefore unable to offer robust guidance for the implementation of post-conflict policies that can effectively target those groups that are most vulnerable to the damaging consequences of conflict violence [Assessing the dynamics of health and living standards during and after conflict is critical to the development of public policies that are effective in promoting the health and wellbeing of conflict-affected populations . Neverthviolence , 14.Violence and security concerns are common obstacles for data collection efforts in times of live confrontations, and even in the aftermath of a formal cessation of hostilities. Researchers have usually sought to overcome the impossibility of collecting household or individual baseline data during conflict periods by conducting surveys after the events, asking participants to recall their health and living standards before the onset of, or during, conflict . AlthougFirst, it is well established that recall may change depending on the language that is used in questionnaires, i.e. how questions are framed or phrased . Second,changes in outcomes for e.g. individuals exposed and not exposed to conflict violence, eliminates the confounding influence from any individual characteristics that can be considered time-invariant during the timeframe of analysis, such as genetics or risk attitudes [Recall error can pose major problems for analyses that rely on ex-post surveys to measure the consequences of conflict on health. With information about the same individuals for the periods post-conflict and before (or during) conflict, obtained through recall questions, a natural empirical strategy is to compare reported outcomes after the conflict with those reported for the previous period, contrasting average outcomes for individuals who were exposed and not exposed to certain conflict events, or for individuals who were exposed to different intensities of conflict violence. Since exposure to conflict cannot be randomised, studies have usually attempted to overcome challenges for inference by employing regression techniques for longitudinal data based on generalisations of difference-in-differences (DD) estimation . This isttitudes .Unfortunately, as discussed above, recall ability may change even in short periods also due to conflict exposure itself, potentially introducing biases for causal inference based on ex-post survey data, which cannot be addressed by DD or similar estimation approaches. People who were exposed to intense conflict violence may have had their recall ability affected differently  than less exposed people, in a way that affects reported outcomes and the corresponding comparisons between these two groups. This makes it hard to support claims that differences in e.g. health outcomes have been driven by exposure to conflict. In the absence of carefully identified natural experiment settings that mimic randomisation of conflict exposure  was signed in 2016. Our survey collected information about health and socio-economic characteristics of the respondents and their households in the survey years, and also asked respondents to evaluate the same characteristics in the reference year of 2014 (i.e. before the peace agreement) through recall questions.Our case study illustrates how strategies developed in the psychology and psychometric fields, in particular approaches based on \u201cFlashbulb\u201d test and test-retest strategies, can be used to ensure that recall questions in ex-post conflict surveys are appropriately framed to capture the phenomena of interest. Our study also illustrates how these test strategies can indicate which groups of health-related characteristics have been reliably captured (or not) via recall questions for the purposes of quantitative inference, when complemented by an assessment of differences in recall error patterns and attrition across surveyed groups. We draw key lessons for similar studies, such as the importance of having recall error testing strategies embedded from the outset into any ex-post health data collection instruments. Our main goal is for the lessons drawn from our study to contribute to the applied conflict and health researcher\u2019s toolkit. As such, our paper makes a much-needed contribution to the still incipient knowledge base about strategies to measure and improve the validity of health surveillance systems, survey and data collection methods in conflict and emergency settings .The remainder of this paper is organised as follows. The \u201cWe begin this section with a more detailed presentation of the problem imposed by recall bias for applied survey-based research, focusing on the case of conflict and health research. This is followed by the presentation of the two complementary approaches that we propose to identify and address recall bias\u2014the Flashbulb test and test-retest strategies\u2014for the general case of conflict surveys. This provides the basis for discussing the adaptation of these strategies to our own health survey in Colombia.i, Consider the following empirical specification:If the presence of conflict was randomly assigned across geographical areas, as in an experiment, then However, the use of retrospective survey data about individual outcomes for estimating the model above adds another potential source of error, namely recall error, which can bias the estimation of In a model with no covariates, In this model with covariates, the condition required for recall errors not to bias other unobservable confounders influencing We propose below complementary approaches to assess the presence of non-random recall bias in studies of conflict effects that use retrospective longitudinal survey data, analysed through the standard model as in Eq. . AlthougWe suggest here a recall bias test strategy that is based on the concept of flashbulb memories developed in the psychology literature. The original \u201cFlashbulb Memory\u201d concept hypothesises that major events, such as natural tragedies or traumatic events, should be recalled vividly and reliably, and that these events trigger in the subject not only memories of the main event in the long term, but also of other personal circumstances of the subject at the time of such event. Brown and Kulik , in theiFor this study, our interest does not lie in how accurately survey respondents can recall specific events per se, but rather in whether the patterns of inaccuracies in retrieving such events, or the forgetting process, differ between survey respondents living in areas more and less affected by conflict violence. We build on the Flashbulb Memory concept to construct a simple but novel recall bias test, which we call Flashbulb recall test, to assess how forgetting and memory functioning can affect inference from conflict and health survey responses. More specifically, we propose the use of a well-known past event, that can be corroborated objectively, to test if recall errors differ across areas affected and not affected by conflict, between two time periods generally defined here as pre- and post-peace.i at the time of the post-peace survey \u201ct\u201d. We can then test the conditional independence assumption in a model with covariates, i retrieves accurately the past event, and 1 if the individual retrieves the event inaccurately , then we would expect to find a statistically significant estimate of Even if, on average, patterns of recall ability do not seem to differ across populations exposed and not exposed to conflict violence, it is still possible for recall errors to be systematically different across these populations at least for specific modules of a health survey. This could be the case if individuals exposed to conflict violence have a different attitude to responses about certain topics, which mediates their recall process.To test for this possibility, we suggest an adapted test-retest method that is implemented by comparing the individual responses about a single past event that occurred in the pre-peace period \u201ct\u2009\u2212\u20091\u201d, where those responses are provided by the person in two different post-peace survey rounds, \u201ct\u201d and \u201ct\u2009+\u20091\u201d. The presence of recall error for a specific survey question (or set of questions), specifically defined as discrepancy between the two responses provided by the same individual, can then be expressed as:By contrast with Eq. , \\docume1 in Eq. , it suff1 in Eq. . Non-rejA useful feature of this test-retest approach is the possibility of its separate application to different modules of a health survey, allowing the analyst to identify specific sets of questions likely affected by recall bias. This can help the researcher in selecting empirical methods that may be more appropriate than DD estimation for analysing specific topics, as well as in interpreting the reliability of specific empirical conclusions. However, this test-retest approach is data-hungry, in that it requires individual responses to the same questions to be collected in at least two different periods.degrees of conflict intensity instead.The exposition so far has focused on comparisons of outcomes for individuals living in areas affected versus not affected by conflict violence. We show here that it is trivial to extend the suggested recall bias tests to the case of comparisons across individuals living in areas affected by different k=1,\u2026,K groups of geographic areas, where areas within each group were affected by the same degree of conflict intensity, with groups ranging from unaffected to severely affected areas. A slightly modified estimating equation for both recall tests, for the case of no covariates, is:Consider the case of where The inclusion of observed covariates in the estimating equation does not materially affect the conclusions above. Consider:Although Since 1948 an estimated 220,000 people have died in Colombia and around 8 million have been displaced due to one of the longest civil conflicts in the world, with an estimated 7 million direct victims of conflict violence between 1985 and 2015 , 26. GueFollowing an extensive negotiation process, a peace accord between the FARC and the Colombian government was agreed in November 2016. Despite ongoing reports that other armed groups remain active in certain areas of the country, where violence levels are still high, former FARC guerrillas have largely adhered to the demobilisation process outlined in the peace accord, leading to a reduction in violence levels after the peace agreement particularly in the areas where FARC were historically active .We planned primary survey data collection about the health and wellbeing of Colombians before and after the peace accord, as part of a large study about the health-related consequences of the Colombian conflict.2Conflicto, Paz y Salud)\u2014household survey was conducted in all 29 municipalities of Meta in late 2018. The survey questionnaire and consent forms were approved by the relevant ethics boards of Universidad de los Andes (Colombia) and the University of York (UK). Informed consent was taken from each household prior to the questionnaire being administered. Data collection was directed to the household heads or (in their absence) a resident aged 18 years or older. For questions about child health, the mother or another adult female was asked to provide responses. Information was collected electronically by a local survey company and monitored daily by field supervisors for any inconsistencies. Sampling design ensured that CONPAS information is representative of the total, urban and rural populations of Meta, as well as of the populations living in municipalities \u201cheavily\u201d, \u201clightly\u201d or \u201cnot affected\u201d by conflict violence and in the capital Villavicencio.The first round of the CONPAS\u2014Conflict, Peace and Health , household composition, displacement history and some health-related information . Where there was disagreement between the initial responses provided by the main and second respondents , enumerators encouraged individuals to reach a consensus response.Secondly, enumerators were trained to ask the participant, before conducting the 2014 questions, to recall a personal or family event that occurred in that year. This was followed by prompts to help participants situate their responses in time, before the start of each relevant survey module. These prompts contained mentions to two noteworthy events that occurred in 2014 and that were easily discernible for respondents: the presidential election  and the FIFA 2014 football World Cup .To mitigate recall errors for the \u201ccontemporaneous\u201d questions referring to years 2018 and 2019, relatively short recall times were preferred, most of which are usual practice in household health surveys, e.g. the Demographic and Health Surveys (including its Colombian version).5CONPAS presented high acceptability with usually low item non-response rates (<\u200910%). However, we mentioned previously that the second CONPAS round conducted in 2019 was affected by an attrition rate of about 15.4% , which is higher than the 10% oversampling included in the first round of CONPAS to mitigate loss-to-follow-up. If individuals with certain characteristics\u2014e.g. those who lived in areas where conflict intensity was the highest pre-2016 accord\u2014were more likely to drop out from the sample between survey rounds, this would introduce a source of bias for any comparisons of outcomes between people affected by different levels of conflict violence, by under-representing the recall responses of those most affected by the conflict. On the other hand, if attrition between rounds occurred in such a way that was not correlated with conflict exposure or key individual observable characteristics, such as education or socio-economic status, it is more likely that people who dropped out from the sample also had similar unobservable characteristics (on average) to those who remained in the sample. Random loss-to-follow-up would still allow standard regression-based panel data methods like DD to recover the \u201ctrue\u201d effects of conflict exposure on individual health, using recall data as that in our CONPAS survey.In order to estimate the association between probability of sample attrition and exposure to conflict violence, we ran a simple ordinary least-squares linear regression of a binary loss-to-follow-up dependent variable  on a set of binary variables representing each of the levels of conflict intensity in the respondent\u2019s municipality of residence . We also included in this regression a set of individual demographic controls , along with the municipality\u2019s population density to prevent undue influence in the estimation results of a few Meta municipalities with large populations.Additional file For our adapted Flashbulb test approach, we added to the 2019 CONPAS questionnaire a set of questions about a well-known past event, Colombia\u2019s national football team performance in the 2014 FIFA World Cup . The main regressors of interest were the set of binary variables representing the levels of conflict intensity in the respondent\u2019s municipality of residence (\u201cnot affected\u201d was the reference category). We ran separate regression specifications as in Eq. , which iAlthough CONPAS did not ask about traumatic events directly, it could be the case that some people failed to report illnesses or healthcare episodes that did occur, if those episodes were vividly associated with exposure to conflict events. Such misreporting (including by forgetting) could therefore reflect a coping mechanism.We implemented an adapted version of the test-retest approach to test for differences in recall error patterns across areas. We selected 17 questions that referred to year 2014 and which were included in the 2018 survey round, spanning all CONPAS modules, to be asked again from all respondents during the 2019 survey round.For each selected question referring to year 2014, we ran a separate ordinary least-squares linear regression where the dependent variable was either a binary variable taking the value of one if the participant\u2019s 2018 and 2019 responses differed, zero otherwise (for yes/no questions), or the absolute numeric difference between 2018 and 2019 responses (for numeric questions). The key regressors of interest for this test were the set of binary variables representing the levels of conflict intensity in the respondent\u2019s municipality of residence (\u201cnot affected\u201d was the reference category), complemented by the basic individual demographic controls  and the municipality\u2019s population density, following the specification in Eq. , mental health and disability aspects, as well as for most indicators of household living standards.Yet there are a few instances where we find evidence that patterns of misreporting were indeed correlated with living in areas heavily affected by the conflict. For example, the third estimated coefficient in column 20  for the investigation of conflict effects. Through the case study of two rounds of a large-scale health survey (CONPAS), which we implemented in Colombia in the post-peace agreement period, but that included recall questions referring to the conflict period, we demonstrate how adapted versions of the Flashbulb and test-retest strategies can be used to test objectively for the presence of recall bias in (post-)conflict survey responses. Our case study also shows how these test strategies can be incorporated into post-conflict health surveys already in their design phase, accompanied by other ex-ante mitigation strategies for recall bias , to increase the reliability of longitudinal health data analysis.In this paper, we discuss key challenges related to the collection and analysis of ex-post health survey data for conflict-affected populations. We focus primarily on the issue of potential recall bias when survey respondents are asked, in a post-conflict period, about life events, health and living conditions experienced before or during the conflict. We show how in that context recall bias threatens causal inference about the health effects of conflict exposure on individuals, when analyses are conducted using standard quantitative methods. We then propose two complementary strategies based on methods developed in the psychology and psychometric literatures\u2014the Flashbulb and test-retest approaches\u2014to identify and address recall bias in ex-post health survey data. The test-retest method and the Flashbulb recall tests are complementary in the sense that, whilst the latter seeks to assess Our study makes a novel contribution to the field of applied health research in humanitarian settings. Previous studies have highlighted the glaring knowledge gaps in the areas of survey design, data collection and surveillance systems for research and policymaking in these settings. Grais et al. , in theiThe case of our CONPAS survey illustrates how health survey design can incorporate objective tools to permit: (1) the assessment (and improvement) of the performance of pre-post recall modules against formal reliability criteria, and (2) data analysis that identifies the survey domains, and sub-populations, for which standard empirical analysis of the information gathered is likely to yield more reliable conclusions. For example, the application of the Flashbulb and test-retest strategies to the CONPAS survey data indicated that, for most survey modules, recall ability and misreporting patterns do not vary systematically with the levels of conflict intensity in the areas where respondents live, implying that standard regression methods can alleviate concerns about recall bias for analyses of the causal effects of the Colombian conflict using such pre-post data. However, there was indication that misreporting patterns for some questions  were systematically different between respondents living in areas more and less affected by conflict violence. For these groups of questions, recall bias is more likely to lead to unreliable comparisons of conflict effects through standard empirical approaches such as difference-in-differences estimation. This result emphasises the importance of careful selection, by the applied health researcher, of appropriate comparison groups in standard longitudinal analyses. These comparison groups may need to be different depending on the domains (responses) being evaluated. The recall bias test strategies illustrated in our paper constitute a mechanism for selecting such comparison groups in a way that is transparent and informed by data evidence. Applied researchers can use the evidence from these tests either to obtain reassurance about the low importance of recall bias in their impact evaluation context, or to help interpret the results of their impact evaluations as lower or upper bound effects, after taking into account the identified direction and magnitude of existing recall biases.Despite the challenges for gathering reliable recall information about conflict or emergency periods through surveys conducted after these events, our study shows that this can be done so as to permit highly informative analyses. We share useful guidance on this based on the lessons from our experience with CONPAS in Colombia. By doing so, our study offers related research a blueprint for survey design and data analysis, not only in the health field but also for development research more generally. A key lesson is the importance of embedding appropriate strategies to test and address recall bias into any relevant data collection tools, already during the survey design phase. This is particularly useful in settings where primary recall data collection is deemed necessary, but the researcher has reasons to believe that the phenomenon under study\u2014e.g. exposure to conflict violence or another humanitarian disaster\u2014may have influenced recall ability (memory functioning) more for certain groups of respondents, or even where contextual incentives may have been introduced for certain respondents to misreport past experiences  the population of interest, so as to effectively assist with accurate memory retrieval of past personal events. Moreover, there is a limit to how many such questions can be added without becoming a burden to respondents, and encouraging inaccurate answers or non-responses. These concerns, and our knowledge of the Colombian context, led us to our choice of using only the FIFA World Cup as the basis for implementing our Flashbulb test. At this point, we must reiterate the importance of there being a strategy in place to mitigate recall error in any survey-based study (beyond just testing for its presence), and such strategy must be multidimensional. In our study, this strategy includes the use of other potential \u201cflashbulb events\u201d to situate respondents in time for the main questionnaire, namely: (a) asking the participant, before conducting the 2014 questions, to recall a personal or family event that occurred in that year; along with (b) also referring the respondent to the 2014 presidential election. Similar strategies should be adopted by researchers seeking to apply the recall test methods illustrated here to other contexts.There are, of course, caveats that must be considered for the application of our recall bias test strategies in other research contexts. First, the selection of any one question for use in the Flashbulb recall test should be done in a manner that is informed and appropriate to the particular research setting, but at the end such selection is unavoidably subjective.A second caveat for applying the learnings from our case study to other contexts is that incorporating the full suite of proposed ex-ante mitigation and ex-post test strategies for recall error hinges on the possibility of conducting more than one survey round with the same respondents. This is the case for the test-retest approach more specifically. The researcher also faces a trade-off when adopting the test-retest strategy, between the scope of survey modules scrutinised  and its cost . It is therefore advisable for the researcher to focus primarily on certain survey modules that may be representative of the survey as a whole, and/or on modules containing questions considered of essential importance for the analysis planned. Although, for any given study, the most appropriate questions to be selected for test-retest will thus depend on the study\u2019s main goals, the principles and application of the test-retest approach illustrated here are generalisable to a wide range of studies based on retrospective survey data. Furthermore, strategies such as the use of well-known events to situate respondents in previous periods of time and the Flashbulb test approach can be applied using a single survey round, representing readily available tools for the design of appropriate surveys and robust analysis of any retrospective health-related information collected.Additional file 1.Table S1: CONPAS questionnaire modules. Table S2: Selected demographic and socio-economic characteristics of CONPAS respondents, by survey year (2018 and 2019). Table S3: Sample of questions \u2013 CONPAS 2014 and 2018. Table S4: Cronbach\u2019s alpha test results by CONPAS modules and survey years. Table S5: IRT reliability test results by CONPAS modules and survey years. Table S6: Probability of attrition in the second round of CONPAS. Table S7: Questions selected for the test-retest approach \u2013 CONPAS 2019."}
+{"text": "The specificity of human esterase activity (EA) from the stimulated (SS) and non-stimulated (NSS) saliva toward different typical wine odorant carboxylic esters and its inhibition by the wine phenolic compounds has been evaluated. For the specificity, six p-nitrophenyl linked esters with different carbon chain lengths (from 2 to 12 carbons) were employed. The five single phenolic compounds  at typical wine concentrations were assayed in the salivary EA inhibition study. Additionally, the inhibition exerted by the mixtures of wine polyphenols was evaluated using four commercial phenolic extracts . Finally, the saliva EA under the wine consumption conditions (pH = 5 and 11.3% ethanol) was evaluated. The results showed a higher EA in SS than NSS. It was also shown that the EA was higher toward the smaller than bigger esters regardless of the saliva types (SS or NSS). However, the inhibition exerted on saliva EA by the individual and mixtures of phenolic compounds was proven. Catechin was the phenolic compound that mostly inhibited saliva EA, while resveratrol showed the lowest EA inhibition. This inhibition was mainly related to the concentration of the phenolic compounds, but also with its structure. Finally, under simulated wine consumption, a decrease in EA was produced, which was mainly provoked by the decrease in the salivary pH. Nonetheless, since salivary pH recovers a few seconds after wine consumption, saliva EA might be relevant for the long-lasting perception of wine esters. One The saliva esterases originate from different sources, such as salivary glands, oral microbiota, or epithelial cells . BecauseIn addition, it is important to note that different types of enzymes could contribute to the total saliva EA, such as carboxylesterases , carboniIn addition to saliva, the esterase enzymes are present in different human tissues and have wide substrate specificity , 20. AmoIn the case of wine, the effect of some matrix components, such as the phenolic compounds or ethanol in the oral release of wine esters is reported , 22, whiFor all the above, this study aimed to provide insight into the potential role of saliva EA during wine oral processing. To do so, the specificity of saliva esterases toward six different types of carboxylic esters with different chain lengths and representative of the wine volatile profile was investigated in the SS and NSS samples from 10 individuals. Additionally, the inhibitory effect of single wine phenolic compounds , and mixtures  in saliva EA, was assessed. Finally, the inhibitory effect of wine in the saliva EA was evaluated in more similar conditions to those found in the mouth during wine consumption that means under acidic pH and in the presence of ethanol (11.3%).The NSS and SS from the 10 volunteers (five women and five men) between 25 and 67 years of age were collected in the morning between 9 and 11 a.m. and for 5 min . The NSSThe volunteers did not report oral diseases. The donors were not allowed to eat or drink anything 1 h before the saliva collection. The participants were informed about the purpose of the study, and they gave their written consent to participate. These experiments were authorized by the Bioethical Committee of the Spanish National Council of Research (CSIC), Spain.2HPO4\u00b712H2O). The pH of the reaction mixture was 6.7.The saliva EA was measured following the colorimetric method previously described in the study of P\u00e9rez-Jim\u00e9nez et al.  by usingThe EA determinations were performed in m96 microplates . To do so, the microplates were incubated for 35 min at 36\u00b0C, and the absorbance (\u03bb = 410 nm) was measured every 5 min  by using a microplate spectrophotometer . The EA was calculated as the units of EA (UI) per min . One uniTo determine the specificity of the saliva EA toward different carboxylic esters, six p-NP-linked esters were employed as substrates: p-NP-acetate (NPA), p-NP-butyrate (NPB), p-NP-hexanoate (NPH), p-NP-octanoate (NPO), p-NP-decanoate (NPD), and p-NP-dodecanoate (NPDD) . They diThe inhibitory effect of five single wine polyphenols, such as catechin , quercetin (Sigma), kaempferol , myricetin (Extrasynth\u00e8se), and resveratrol (Extrasynth\u00e8se), was assayed . These w\u00ae), GSEM and GSEO, and an RWE) (Provinols\u2122). The GSE and their purified fractions (GSEM and GSEO) were from Les D\u00e8rives Resiniques & Terp\u00e9niques, S.A. (France), while RWE was from Safic-Alcan Especialidades, S.A.U. (Barcelona). The individual phenolic composition for GSE is shown in S\u00e1nchez-Pat\u00e1n et al.  and catechin were selected among the six ester substrates and the five single wine polyphenols . The inhTo evaluate the effect of ethanol, 14 \u03bcl of absolute ethanol  was added to the microplate well. To maintain the final volume of the reaction mixture (124 \u03bcl), the volumes of the reagents were recalculated: 21.3 \u03bcl Tris , 67.4 \u03bcl saliva, 21.3 \u03bcl McIlvaine buffer (pH = 5), and 14 \u03bcl ethanol.To evaluate the wine tasting conditions in the terms of acidic pH on EA, a preliminary assay was performed to know the salivary pH after the wine tasting. The results are shown in Then, the pH of the reaction mixture in the well was modified by replacing the Tris  buffer with the McIlvaine (pH = 4.56) buffer. The effect of changing the buffer was previously checked, showing that the EA measurements were not affected.To evaluate the effect of both factors (ethanol 11.3% and pH = 5), the volumes of the reaction mixture were recalculated as explained before and the Tris  buffer with the McIlvaine (pH = 4.56) buffer. Then, the EA was measured following the same procedure as explained in section Saliva esterase activity measurement.p < 0.05) in the EA: between the SS and NSS, to check the inhibitory effect of the single and mixtures of wine polyphenols and to determine the influence of ethanol (11.3%) and acidic pH (pH = 5) in the inhibitory effect of catechin. To do so, version 2020.3.1 of the XLSTAT  software was used.One-way ANOVAs and Tukey's tests for mean comparison were applied to check for the significant differences  that differed in carbon chain length (from C2 to C12). The mean values of EA (UI/min) and SD are shown in As it can be seen , the EA On the other hand, Prior to the inhibitory assay of EA by the wine phenolic compounds, the use of B4NP as a positive control for the inhibition of saliva EA was checked, as B4NP is widely known to be a specific inhibitor of carboxylesterases , 50, 51.The results showed that the inhibitory effect of B4NP was not dose-dependent as seen previously , 51, 52.Therefore, 0.1 mM concentration of B4NP was selected for the following assays, which is within the range that was previously used by other authors , 53, 54.The EA inhibitory effect of single wine polyphenols  was prevp < 0.05) inhibitory effect in EA compared with the control saliva (without phenolic compounds). Nonetheless, for the same substrate, NPDD, but in the NSS, there were no significant differences in the EA among the saliva samples with or without the phenolic compounds. The odd results obtained for NPDD could be due to the low EA proven for this substrate   , which cp < 0.05) in all the cases, except for resveratrol in the NSS. For this phenolic compound, the EA toward NPA (two carbons) was also reduced (13%) compared with the control saliva, but this reduction was not statistically significant  higher inhibitory effect (from 2 to 28%) in NSS compared to SS was observed. Despite this, the differences in the inhibition between SS and NSS were in general lower than 15%, although in some of the cases , these differences increased up to 28%.The inhibitory effect of each type of wine phenolic compound varied depending on the type of saliva (SS and NSS) and the type of p-NP-ester substrate  . RegardiAs stated before, the effect of the wine phenolic compounds varied depending on the p-NP-ester substrate. In the case of catechin, its inhibitory effect toward saliva EA increased as the length of the ester increased (from 2 to 10 carbons). The inhibition exerted by catechin was 24% (in SS) and 46% (in NSS) higher in NPD (10 carbons) compared with NPA (two carbons) . On the In a further step, the inhibitory effect of four mixtures of wine polyphenols (phenolic extracts) on the saliva EA was evaluated. For this, different phenolic extracts were employed  at different concentrations, which were selected considering the maximal concentration of the main individual phenolic components that naturally occur in the wines . The perp < 0.05) for most of the samples. Apart from this, and similar to the results found in the section earlier for the single phenolic compounds, a large variation in the percentage EA using NPDD (12 carbons) was noticed. Because of this and as previously explained, the results from NPDD were excluded from the following discussion.As shown in However, the inhibitory effect of the mixture of wine polyphenols also varied depending on the type of saliva (SS and NSS), the type of p-NP-ester , and the type of phenolic extract  .p < 0.05) higher inhibitory effect of the polyphenol extracts was found in NSS compared with the SS. The differences in the inhibition between SS and NSS were, in general, lower than 28%, although in the case of the addition of RWE at the highest concentration assayed (RWE4) in NPO, these differences increased up to 51%.As previously observed for the single wine polyphenols, a significantly , except in NPO, which was the RWE2 extract (74% inhibition), and in NPA, which was GSEM (43% inhibition). Similarly, in the NSS, the GSEO2 and RWE2 extracts showed the highest EA inhibition (inhibition higher than 60%), except in the case of NPO in which RWE4 showed the highest EA inhibition (82% inhibition). Interestingly, the extracts which showed the highest EA inhibition in both the types of saliva , contained more catechin in their composition . Among tRegarding the effect of the phenolic extract concentration, differences were observed in the EA inhibition. For example, in the case of GSEO extracts (GSEO1 and GSEO2), a greater EA inhibition (up to 55%) was observed when the extract was assayed at higher (GSEO2) than lower (GSEO1) concentrations in both the saliva types (SS and NSS) and toward the six p-NP-ester substrates. Since GSEO is composed of 70% flavan-3-ols, these results suggest that as the concentration of flavan-3-ol increased, the EA decreased. Contrarily, in the case of RWE, which was added at four different concentrations , no relationship between the concentration of the extract and the inhibition of EA was observed. This indicated that in the case of anthocyanins (significant phenolic compounds in RWE), the inhibitory effect toward saliva esterases was not concentration-dependent.Therefore, these results showed that the mixture of wine polyphenols exerted an inhibitory effect on the saliva EA, which varied depending on the concentration and on the phenolic composition of the extract.Finally, to evaluate how EA could be modified during the wine tasting conditions and if phenolic compounds could also inhibit this enzymatic activity, a new assay was set up. For this, the EA was first measured in the presence of ethanol and acidic conditions. The results  showed, The EA was then, measured in the saliva samples at acidic pH (pH = 5) or standard salivary pH (pH = 7), in the presence or absence of polyphenol (catechin), and also in the presence and absence of ethanol (11.3% v/v). The results, expressed as a percentage of EA, are shown in As it can be observed , the preRegarding salivary pH, the EA of both saliva types (SS and NSS) was significantly reduced by more than 90% when the pH of the well-decreased to 5 and in all the assayed conditions, with or without catechin and ethanol . These rThis study showed for the first time the effect of wine polyphenols on the salivary EA from the SS and NSS and using six different ester substrates. The results showed a higher EA toward the smaller than the bigger esters. However, the addition of typical wine polyphenols individually or as a mixture, at natural concentrations found in the red wines decreased the saliva EA. This decrease was related to the concentration and the type of each phenolic compound. Among the single wine polyphenols, the flavan-3-ols (catechin) showed the highest EA inhibition followed by the flavonols  and stilbenes (resveratrol). The differences in the inhibitory effect of single polyphenols, depending on the concentration occurring in wine, but could also be related to their molecular structure (rings and hydroxyl groups). In the case of the mixtures of wine polyphenols, the highest EA inhibition was exerted by the oligomer GSE (GSEO2) and the RWE (RWE2), both assayed at the highest concentration, which were those that showed the highest concentration of catechin. While RWE at the lowest concentration assayed (RWE1), which presented the lowest catechin concentration, also exerted the lowest EA inhibition. In the simulated wine consumption conditions (11.3% ethanol and pH 5), the activity of saliva esterases was compromised, but the fact that saliva is constantly being generated and replenished, and, as the pH of the oral environment returns to the normal values within few seconds, salivary esterases could also keep their activity, and therefore play an important role in the long-lasting perception of esters during wine tasting. Overall, this study will contribute to better understand how aroma compounds might modify during the wine tasting, and how this could be related to the combined action of chemical wine composition and individual physiology, which could be explored as a strategy to get more personalized and appealing wine types.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by the Bioethical Committee of The Spanish National Council of Research (CSIC). The participants provided their written informed consent to participate in this study.MP-J: investigation, methodology, formal analysis, data curation, and writing\u2014original draft. CM-G: data curation and writing\u2014review and editing. MP-B: conceptualization, funding acquisition, supervision, and writing\u2014review and editing. All authors have read and agreed to the final version of the manuscript.This research was funded by the Spanish MINECO and CAM through the PID2019-111734RB-100 and 2019T1/BIO13748 projects respectively. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Phoebe bournei-dominated forest, spanning about 65\u2009years of forest development in a subtropical region. Illumina MiSeq sequencing of 16S and ITS genes was employed for the assessment of soil bacterial and fungal community composition and diversity, respectively. The relative abundance and \u03b1\u2013diversity of soil bacteria and fungi showed a differential trend over forest succession. The dominant fungal phyla (Basidiomycota and Ascomycota) changed more frequently than the dominant bacterial phyla , indicating that soil fungi have a more sensitive relationship with forest succession compared with bacteria. The soil microbial community variation induced by forest succession was significantly affected by soil total phosphorus, dissolved organic carbon content and pH. Compared to deterministic processes, stochastic processes mainly dominated the community assembly of soil microbial communities. Meanwhile, the relative importance of stochasticity in soil fungal communities increased in the later stages. In Particular, dispersal limitation and drift accounted for a large proportion of bacterial and fungal community assembly, respectively. In addition, the co-occurrence networks of soil microbial communities became more complex as succession proceeds. Soil bacteria and fungi exhibited more competition and cooperation along the forest successional gradient. Collectively, our findings suggest that forest succession improves the complexity of soil microbial interactions and the ecological stochasticity of community assembly in Phoebe bournei-dominated forests, providing key insights into the relationship between microbial communities and forest succession.Forest succession is a central ecological topic, due to the importance of the associated dynamic processes for terrestrial ecosystems. However, very little is currently known about the community assembly and interaction of soil microbial communities along forest successional trajectories, particularly regarding the microbial community dynamics in contrasting seasons. To bridge these knowledge gaps, we studied soil bacterial and fungal community compositions, assemblages, and co-occurrence networks in a well-established successional gradient of  Forest succession is a critical process in which one forest community evolves into another due to natural and/or anthropogenic forces . The natSoil bacteria and fungi, as important components of terrestrial ecosystems, are responsible for organic matter decomposition and the regulation of nutrient cycling . GeneralIdentifying the relative contribution of deterministic  and stochastic  processes that control the assembly of soil microbial communities during forest succession is essential for predicting ecosystem responses to environmental changes . DetermiPhoebe bournei is a protected and valuable evergreen tree species distributed in Chinese subtropical regions   forests , more coThe experiments were conducted at Mingyueshan state-owned forest farm, Anfu County, Jiangxi Province . The mean annual precipitation is 1,553\u2009mm and the mean annual temperature is 17.7\u00b0C. This region has a typical subtropical monsoon climate, with distinct wet and dry seasons. The dry season is from October to February, and the wet season is from March to September. The geomorphology is mainly composed of sandstone, shale, and carbonaceous slate. The soil type in this study area is acrisol.P. bournei forests, including P. bournei monocultures and natural or semi-natural forests. The P. bournei monocultures were established in 2003, and the stand age is 15\u2009years old. The semi-natural P. bournei-dominated forests were primarily generated from the monoculture plantations without any anthropogenic management. There are three representing ages of the semi-natural P. bournei forests , which were identified as being in the early, middle, and late stages of P. bournei forest succession, respectively. We selected four typical stages of P. bournei forests succession as the subject of this study: a) the initial stage of succession , in a typical P. bournei monoculture plantation with density of 92.9%, with Photinia vulgaris and Elaeocarpus decipiens as the subdominant species; b) the early stage of forest succession , with density of P. bournei of 71.8%, subdominated by Schima superba and Cunninghamialanceolata; c) the middle stage of forest succession , with density of P. bournei of 65.30%, followed by Quercus glauca and Magnolia liliflora; and d) the latter stage of succession , having density of P. bournei of 58.6%, with the forest mainly composed of Elaeocarpus decipiens, Cunninghamia lanceolata, Quercus glauca, and Magnolia liliflora. For more detailed information, we refer the readers to the study of The sites located at the Mingyueshan farm are dominated by P. bournei-dominated forests were chosen for the current study; namely initial (S1), early (S2), middle (S3), and late stages (S4) . For each successional stage, three independent representative plots (25\u00d7 25\u2009m) with basically similar site conditions were randomly selected. The distance between stages ranged from greater than 300\u2009m to less than 5\u2009km, and the greatest distance between two plots within a stage was less than 120\u2009m. Collectively, a total of 12 sites  were included in our study area. In April and October 2018 , eight soil samples were collected within each plot by scraping an \u201cS\u201d shape from the top 10\u2009cm of soil using a stainless steel corer (5\u2009cm diameter) after removing the surface litter. These samples were then mixed as one composite sample for each replicate plot. Each soil sample was immediately passed through a 2\u2009mm sterilized sieve, and the visible plant roots, stones, and debris were removed. Each composite soil sample was divided into two subsamples and placed in sterile bags to be processed and used for the following analyses: 1) stored at 4\u00b0C for the measurement of soil physicochemical properties; 2) stored at \u221280\u00b0C for DNA extraction of soil microbes.In April 2018, the abovementioned four successional stages of the 4-H2SO4. The soil dissolved organic carbon (DOC), nitrogen (DON), and phosphorus (DOP) contents were extracted with K2SO4 solution and were measured according to the method described in 3\u2212\u2013N) and ammonium (NH4+\u2013N) contents were determined using a continuous flow analytical system .After shaking a soil\u2013water  suspension for 30\u2009min, the soil pH was measured using a pH meter . Soil organic carbon (C) content was measured by UV spectrophotometry based on the hydration heat potassium dichromate-sulfuric acid-colorimetry. Soil total nitrogen (N) was measured using an automatic discontinuous chemical analyzer. The total phosphorus (P) content in soils was determined colorimetrically using a UV spectrophotometer  after wet digestion with HClOSoil microbial genomic DNA was extracted from approximately 1\u2009g (wet weight) of soil using a MoBio PowerSoil DNA Isolation Kit  following the manufacturer\u2019s instructions. After the soil sample DNA was extracted, the extracted genomic DNA was detected by 1% agarose gel electrophoresis. The fungal universal ITS1 region was amplified with the primers ITS1-F (5\u2032-CTTGGTCATTTAGAGGAAGTAA-3\u2032) and ITS2 (5\u2032-TGCGTTCTTCATCGATGC-3\u2032) . The bacThree PCR products per sample were pooled, purified, and quantified by real-time PCR. Parallel-tagged sequencing was performed on an Illumina MiSeq platform according to standard protocols. Specifically, split reads were merged using FLASH V1.2.11  and sortp\u2009<\u20090.05, whereas a T-test was performed to assess the significance of differences between contrasting seasons. Using the \u2018vegan\u2019 package in R software (v4.0.5), the nonmetric multidimensional scaling (NMDS) ordinations based on Bray\u2013Curtis distance matrices was employed to analyzed soil bacterial and fungal community compositions. Using the \u2018adonis\u2019 function of the \u2018vegan\u2019 package (999 permutations), permutation multivariate analysis of variance (PERMANOVA) was conducted to test for statistically significant differences in the community compositions by forest succession and season. The partial Mantel test with 999 permutations was performed to assess the main drivers that were significantly correlated with the soil bacterial and fungal communities based on Spearman\u2019s correlation (p\u2009<\u20090.05) using the \u201cvegan\u201d package.All data were tested for normality (Kolmogorov\u2013Smirnov test) before statistical analysis. Two-way analysis of variance (ANOVA) was used to explore the effects of renewal stages and seasons on soil microbial diversity and composition, using the SPSS software . Tukey\u2019s honestly significant difference test was conducted to test differences among different successional stages at bray) null model based on Bray\u2013Curtis dissimilarity were further used to quantify dispersal-based stochastic ecological processes generating the turnover of community composition. For detailed descriptions of the method used, we refer the reader to the study of The phylogenetic normalized stochasticity ratio (pNST) was used to quantify the relative importance of deterministic and stochastic processes in community assembly. The beta nearest taxon indices (\u03b2NTI) and Raup-Crick  in the wet season were 190.9 and 117.0% higher than in the initial stage (S1), respectively , Acidobacteriota (26.2%), and Actinobacteriota (12.8%) at the phylum level . The relFor soil fungi, a total of 4,773 OTUs were identified, distributed among 14 phyla, 42 classes and 558 genera. At the phylum level, the fungal community was dominated by Basidiomycota and Ascomycota, with relative abundances of 42.0 and 35.0%, respectively . Higher p\u2009<\u20090.05; Forest succession had a significant effect on soil bacterial and fungal \u03b1\u2013diversity \u2013F. The nR2stage\u2009=\u20090.369, R2season\u2009=\u20090.261; fungi, R2stage\u2009=\u20090.175, R2season\u2009=\u20090.118; Nonmetric multidimensional scaling (NMDS) analysis was conducted to visualize the differences in soil microbial community composition among different groups . The bacBased on the taxonomic and phylogenetic metrics, the phylogenetic normalized stochasticity ratio (pNST) was calculated, in order to assess the ecological processes associated to bacterial and fungal community assembly , 5. SeasSoil total P, DOC, DOP and pH were significantly correlated with the soil bacterial and fungal community compositions across all seasons . In the Molecular ecological networks for soil bacteria and fungi were constructed, in order to explore the effect of forest succession on the microbial interactions in both seasons . Forest P. bournei-dominated forests became progressive limited in soil N and P contents from the initial stage to late stage of forest succession  and fungal (more cooperation) communities exhibited a contrasting pattern over forest succession. Our findings have important implications for understanding how complex soil microbial communities dwelling in P. bournei-dominated forests respond to forest succession and season. Further investigations focus on the ecological functions of specific taxa are warranted, which is expected to be essential in order to obtain a better understanding of the potential functions of the microbiota during forest succession. Meanwhile, more compartments and niches should be taken into account in future research, in order to provide a more comprehensive view of microbial ecology along the forest successional trajectories.The intact secondary succession in The raw sequences data was deposited in National Center for Biotechnology Information (NCBI) with Sequence Read Archive (SRA) database under BioProject ID: PRJNA870323 (bacteria) and PRJNA870328 (fungi).GH and LJ conceptualized the experiment. YG and TP conducted the field work. TP and SW collected data. LJ and TP performed the data analyses. LJ, ZL, and GH wrote the manuscript and revised the manuscript. All authors commented and contributed to the final version of the manuscript.This work was financially supported by the Natural Science Foundation of China (32071752) and the National Key Research and Development Program of China (2021YFD2201303).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Brain herniation into arachnoid granulations (BHAG) of the dural venous sinuses is a recently described finding of uncertain etiology. The purpose of this study was to investigate the prevalence of BHAG in a cohort of patients with pulsatile tinnitus (PT) and to clarify the physiologic and clinical implications of these lesions.The imaging and charts of consecutive PT patients were retrospectively reviewed. All patients were examined with MRI including pre- and post-contrast T1- and T2-weighted sequences. Images were reviewed separately by three blinded neuroradiologists to identify the presence of BHAG. Their location, signal intensity, size, presence of arachnoid granulation, and associated dural venous sinus stenosis were documented. Clinical records were further reviewed for idiopathic intracranial hypertension, history of prior lumbar puncture, and opening pressure.p\u2009=\u20090.006). Sixteen out of 262 (6%) patients were found to have 18 BHAG. Eleven out of 16 (69%) patients had unilateral temporal or occipital lobe herniations located in the transverse sinus or the transverse-sigmoid junction. Three out of 16 (19%) patients had unilateral cerebellar herniations and 2/16 (13%) patients had bilateral BHAG.Two hundred sixty-two consecutive PT patients over a 4-year period met inclusion criteria. PT patients with BHAG were significantly more likely to have idiopathic intracranial hypertension than PT patients without BHAG (OR 4.2, CI 1.5\u201312, In patients with PT, BHAG is a prevalent MRI finding that is strongly associated with the clinical diagnosis of IIH. The pathogenesis of BHAG remains uncertain, but recognition should prompt comprehensive evaluation for IIH. Pulsatile tinnitus (PT) is the sensation of a \u201cwhooshing\u201d sound that corresponds to one\u2019s heartbeat, which affects nearly 3 million Americans \u20134. PT caIncreased scrutiny of these stenoses during imaging workup has led to the increased recognition of associated brain herniations into arachnoid granulations (BHAG) of the dural venous sinuses. A previously underrecognized entity, the pathophysiology of these herniations is unknown. Previous literature has variably referred to this entity as encephaloceles  or interTo further understand this phenomenon, we retrospectively analyzed a cohort of patients seen at our institution\u2019s Pulsatile Tinnitus Clinic to identify the presence of BHAG and explore correlations between the presence of BHAG with clinical diagnosis of IIH.We retrospectively reviewed imaging and charts of consecutive adult patients seen between January 2015 and May of 2019 in our Pulsatile Tinnitus Clinic using a study protocol approved by our Institutional Review Board. Inclusion criteria included age greater than 18, confirmed clinical diagnosis of PT, and complete T1 and T2 MR imaging with MR venogram.MR imaging was performed on 1.5 and 3.0\u00a0T scanners and all examinations contained angiographic sequences (MR venogram) in addition to standard morphologic sequences. In most cases, post-contrast 3D SPGR  was available for evaluation. Although MR imaging was a requisite for inclusion, all available cross-sectional imaging of the brain was analyzed in each patient. Examinations were reviewed separately by three experienced neuroradiologists blinded to patient\u2019s clinical data . Any discrepancies were resolved by consensus with a fourth rater, an experienced diagnostic and interventional neuroradiologist (MRA).In each case, raters assessed (1) the presence of BHAG, (2) the parenchymal origin of BHAG and continuity of the lesion with adjacent gyral tissue, (3) the location of herniation into dural venous sinus, (4) degree of sinus stenosis (>\u200950%), and (5) the presence or absence of signal abnormality of the BHAG. For cases with multiple brain herniations, each lesion was analyzed separately.In addition, raters evaluated each case for the presence or absence of conventional MR imaging signs of IIH including empty sella, enlarged Meckel\u2019s caves, optic nerve buckling and sheath subarachnoid space prominence, flattening of the posterior globe and optic disc protrusion, narrowing of the dural venous sinuses, and thinning of the calvarium and skull base. Laterality of the dominant dural venous sinus pathway and any other possible causes of PT identified on the imaging were also recorded Table .Table 1PMedical records of all patients from this cohort were reviewed for age, sex, BMI, duration of PT, documented clinical diagnosis of IIH using the modified Dandy Criteria \u201311, histp\u2009<\u20090.05.Patients from our PT cohort were divided amongst those with MR imaging findings of BHAG and those without BHAG. Within these two groups, further subdivision was performed between patients with and without clinical diagnosis of IIH and comparison was made to identify the significance of BHAG in increasing the odds of IIH, specifically for patients with PT. Statistical analysis was then performed using chi square and odds ratio tests to assess for intergroup differences. Significance was defined as Review of our Pulsatile Tinnitus Clinic database identified 262 patients over the 4-year inclusion period. The overall prevalence of BHAG in this population was 6% . Median age was 44\u00a0years (range 25\u201379). 81% were females. Median time to presentation from symptom onset was 12\u00a0months (range 1\u201370\u00a0months).contralateral to side of symptomatic PT.Of the 16 patients with BHAG, 11 (69%) had unilateral temporal or occipital herniations into the transverse sinus or the transverse-sigmoid junction, respectively. Three patients (19%) had unilateral cerebellar BHAG. One patient (6%) had bilateral temporal BHAG into the transverse-sigmoid junctions, and another patient had left occipital and contralateral right cerebellar BHAG into the transverse sinuses. Of patients with unilateral BHAG, 7/14 (50%) occurred on the same side as PT symptoms. The remaining 7/14 (50%) patients had unilateral BHAG Abnormal T2-hyperintense signal of the herniated brain parenchyma was seen in 7/18 (39%) BHAG. No other MR signal abnormality was noted, including enhancement or reduced diffusion.Twelve out of 16 (75%) patients with BHAG had a unilateral dominant dural venous sinus. The dominant venous sinus pathway was ipsilateral to PT symptoms in 11/12 (92%) patients. Eight out of 16 (50%) patients had associated ipsilateral osseous thinning at the dominant transverse-sigmoid sinus junction, dolichoectasia, or high riding jugular bulbs. Patient and imaging characteristics are summarized in Table In PT patients with BHAG, 9/16 (56%) had clinical diagnosis of IIH as determined by modified Dandy Criteria with 7/9 (78%) confirmed by lumbar puncture with a median opening pressure of 28\u00a0cm of water. All 9 IIH patients had focal stenoses in the dural venous sinuses. Of these patients with BHAG and IIH, 7/9 (78%) had sinus stenosis ipsilateral to PT symptoms .The overall frequency of IIH by modified Dandy Criteria was significantly higher in patients with BHAG than in those without BHAG . The latter observation confirms the clinical importance of diagnosing BHAG, which should prompt evaluation for underlying IIH in this patient population. Radiologists, neurologists, otorhinolaryngologists, and other clinicians who care for patients with PT should be aware of this relationship to prevent blindness and other morbidity associated with untreated IIH.This study describes the prevalence and clinical and imaging characteristics of BHAG in a large, consecutive cohort of patients undergoing diagnostic evaluation for PT. We identify two key observations in this analysis: First, BHAG are a relatively common imaging finding in PT patients, with a prevalence of 6% of this cohort. This suggests that BHAG may be underreported and/or underrecognized by neuroradiologists. Second, patients with PT and BHAG are significantly more likely to have underlying IIH than PT patients without BHAG (OR 4.2, CI 1.5\u201312, The present data suggest that BHAG are likely an underrecognized entity in neuroimaging. This observed prevalence of BHAG in PT patients was substantially higher than a prior estimated prevalence of\u2009<\u20091% in the general population in a study of over 6000 MRI studies . AlthougAlthough laterality of BHAG in our cohort did not co-localize with PT symptom side, we did observe a strong relationship between laterality of dural venous sinus dominance and PT symptoms, consistent with prior work . It seemBHAG occurred in typical locations of arachnoid granulations, predominantly in the transverse, sigmoid, and superior sagittal sinuses Fig.\u00a0. While tVarious nomenclature currently exists to describe brain herniations into dural venous sinuses including internal cephaloceles, encephaloceles, or simply \u201cbrain herniations\u201d , 15, 16.never been reported into a thrombosed sinus. As such, identifying a BHAG can help reassure thrombus is not present in that section of vein and the stenotic lesion is an arachnoid granulation, thus obviating the need for anticoagulation in these patients.In the setting of PT, BHAG is important to distinguish from other etiologies that result in a stenosis or focal defect of the dural venous sinuses to appropriately guide patient management and treatment. Differential considerations for BHAG include simple arachnoid granulation, thrombus, tumor, and vascular anomaly such as dural arteriovenous fistula . It is iUnderstanding the relationship of BHAG with IIH in patients with PT is of the upmost clinical interest as IIH is a serious and debilitating condition associated with PT. Specifically, the role of imaging to identify venous anatomy variants in patients with both PT and IIH can hold significant value in diagnosing these conditions. Prior work has demonstrated that venous sinus stenosis is the most sensitive MR imaging finding in patients with IIH, occurring in 94% . This rePathologic flow patterns in the dural venous sinuses play an important role in the pathogenesis of venous PT . Prior swithout associated BHAG have also been associated with IIH and have been implicated as a compensatory mechanism [Arachnoid granulations echanism . In thesechanism , 28, altechanism .VSS across an encephalocele has been shown to be safe and feasible . Our curSeveral limitations of this study merit additional discussion. First, as a retrospective study, from a single quaternary-referral center, these results may not extend to the general population. Although our institution has significant experience with these lesions, we did not investigate the diagnostic test characteristics for BHAG detection on MRI nor did we evaluate inter-radiologist agreement. Given the often-subtle appearance of BHAG, these questions will be important to address in future work. Finally, this retrospective study design is potentially affected by confirmation bias as the study neuroradiologist evaluated the presence of BHAG and neuroimaging features of IIH during a single imaging review. However, the final determination of IIH was independently adjudicated using clinical criteria.BHAG are an underrecognized entity and are prevalent in patients with PT. The presence of BHAG is strongly associated with IIH, therefore, these lesions are an important neuroimaging finding which should prompt expedited clinical workup. Future work is needed to clarify the mechanistic relationship underlying this association."}
+{"text": "Moreover, we here observed specific activated CD3+ T lymphocytes during the acute phase of liver injury by monitoring of human leukocyte antigen receptor (HLA-DR) expression. Furthermore, improvement of biochemical markers of liver injury after POTABA withdrawal was associated with a rapid decline of CD3+ HLA-DR+ immune cells. In contrast, CD14+ monocytes expressing HLA-DR remained stable during recovery from liver injury. These observations implicate a specific involvement of activated T lymphocytes in liver injury mediated by POTABA. Clinicians should be aware of POTABA-induced liver injury, and measurement of activated immune cells by assessment of HLA-DR could provide pathomechanistic insights enabling biomonitoring of recovery from DILI.Potassium para-aminobenzoate (POTABA) is used to treat Peyronie\u2019s disease by decreasing fibrosis and plaque size progression. Among potential side effects, drug-induced liver injury (DILI) attributed to POTABA administration has been reported in a few cases and inferred to immune hypersensitivity. In the present case, we investigated clinical Peyronie\u2019s disease is a connective tissue disorder of the penis characterized by an abnormality in the collagen structure of the penile tunica albuginea, promoting fibrous plaque formation and fibrosis by collagen deposition .Drug-induced liver injury (DILI) remains a relevant problem in drug development and clinical routine. The idiosyncratic origin of DILI impedes mechanistic studies, and only little is known of its distinct pathogenesis . Reactivposition . Peyroniposition . Potassiposition . Among pposition . We here+ monocytes and CD3+ T lymphocytes was analyzed using flow cytometry, as previously described , a scoring tool determining the probability of a causal link between a noxious agent (a drug or herb) and liver injury . Updatedescribed . AntibodA 73-year-old man presented to our emergency department with a history of dark yellow urine for 2\u00a0weeks, as well as jaundice for 3\u00a0days . The pat+ HLA-DR+: 185 cells/\u00b5L, 99.7% of the CD14+ population) and T lymphocytes  complex and CD4 molecules, HLA-DR expression reflects T lymphocyte activation and is critical for efficient peptide presentation to CD4+ T lymphocytes (+ immune cells to acute liver injury has already been experimentally described, requiring further investigation (+ HLA-DR+ T lymphocytes in DILI, particularly to POTABA therapy. We are aware that this observation is not causal and attributable to every drug and DILI. However, we here provide first evidence that HLA-DR+ immune cells may allow biomonitoring of liver injury and recovery from DILI. In the context of POTABA, clinicians should be aware of POTABA-induced liver injury, and the correct management appears to be the immediate withdrawal of POTABA and supportive therapy. Finally, measurement of activated immune cells by assessment of HLA-DR could provide pathomechanistic insights into idiosyncratic DILI.The development of DILI is considered to be multifactorial, depending on a combination of drug properties, immunological determinants, as well as environmental factors . The immphocytes . The cautigation . Althoug"}
+{"text": "It is unclear if the impact of frailty on mortality differs between patients with viral pneumonitis due to COVID-19 or other causes. We aimed to determine if a difference exists between patients with and without COVID-19 pneumonitis.This multicentre, retrospective, cohort study using the Australian and New Zealand Intensive Care Society Adult Patient Database included patients aged \u2265\u200916\u00a0years admitted to 153 ICUs between 01/012020 and 12/31/2021 with admission diagnostic codes for viral pneumonia or acute respiratory distress syndrome, and Clinical Frailty Scale (CFS). The primary outcome was hospital mortality.p\u2009<\u20090.001) and less frail  than non-COVID-19 patients. The overall hospital mortality was similar between the patients with and without COVID-19 . Frailty alone as a predictor of mortality showed only moderate discrimination in differentiating survivors from those who died but was similar between patients with and without COVID-19 . Increasing frailty scores were associated with hospital mortality, after adjusting for Australian and New Zealand Risk of Death score and sex. However, the effect of frailty was similar in patients with and without COVID-19 .A total of 4620 patients were studied, and 3077 (66.6%) had COVID-19. The patients with COVID-19 were younger (median [IQR] 57.0 [44.7\u201368.3] vs. 66.1 [52.0\u201376.2]; The presence of frailty was an independent risk factor for mortality. However, the impact of frailty on outcomes was similar in COVID-19 patients compared to other causes of viral pneumonitis.The online version contains supplementary material available at 10.1186/s13054-022-04177-9. The coronavirus disease 2019 (COVID-19) pandemic has had a devastating global impact. The clinical spectrum ranges widely from asymptomatic to severe respiratory failure, multiorgan failure, and death , and thaHealthcare in many parts of the world has been severely strained due to insufficient intensive care unit (ICU) beds and workforce capacity . This prPre-pandemic, patients with frailty were also common among patients admitted to ICU. These patients had more than double the risk of death and functional dependence than patients without frailty \u201321. A stThis was a retrospective multicentre cohort study, which analysed ICU admissions reported to the Australian and New Zealand Intensive Care Society (ANZICS) Adult Patient Database (APD) between 1 January 2020 and 31 December 2021.The ANZICS-APD is a binational database that prospectively collects high-quality de-identified patient information, including demographics (such as age and sex), chronic health status, physiological and biochemical variables within the first 24\u00a0h of admission required for the Acute Physiology and Chronic Health Evaluation (APACHE)-III-j and IV illness severity scores and Australian and New Zealand Risk of Death (ANZROD), as well as ICU and hospital outcomes. Each patient is allocated a single diagnosis which reflects the primary cause of admission to ICU using the ANZICS modification of the APACHE-IV diagnosis coding system .Adult patients (age\u2009\u2265\u200916\u00a0years), with a documented CFS score, admitted to Australian and New Zealand ICUs with an ICU admission diagnosis of Viral Pneumonia or Acute Respiratory Distress Syndrome (ARDS) were included. Patients were further classified using a subcode of \u201csuspected or confirmed pandemic infection\u201d to indicate which were highly likely to have COVID-19  CFS, ICU organ supports , treatment limitation order, the incidence of delirium (developed during the current ICU admission), ICU and hospital mortality, and respective length of stays. Treatment limitation was defined as that medical treatment would be constrained by either patient wishes or medical futility but does not necessarily imply that the patient was expected to die during this ICU admission.Data included patient demographics , obesity status  or frail  . TerminaThe exposure variable was frailty status based on CFS categories in patients with and without COVID-19. The confounding variables were illness severity (measured with ANZROD), and sex.We aimed to investigate whether the impact of frailty on mortality differed between patients with COVID-19 pneumonia and other aetiologies of viral pneumonia. The primary outcome was hospital mortality. Secondary outcomes included ICU mortality, ICU, and hospital length of stays and discharge destination.Predefined subgroup analyses based on biological sex, age (\u2265\u200965\u00a0years), and those needing mechanical ventilation were performed.t tests for normally distributed data, and Mann\u2013Whitney U or Kruskal\u2013Wallis tests for nonparametric data depending on the number of categories examined. Data are reported as frequencies (%), means (standard deviations [SD]), or medians (interquartile range [IQR] 25\u201375%), respectively. Illness severity was determined using ANZROD, a highly discriminatory, locally derived, and well-calibrated mortality prediction model used for benchmarking ICU performance in Australia and New Zealand which combines age, chronic illnesses, acute physiological disturbance, and diagnosis [p value of\u2009<\u20090.05 was used to indicate statistical significance.The group comparisons between patients with and without COVID-19 were made using chi-square tests for proportions, student iagnosis , 35. Theiagnosis . SensitiDuring the study period, a total of 5735 patients were admitted to 153 Australian and New Zealand ICUs with admission diagnoses of either viral pneumonia or ARDS that were reported to the ANZICS-APD. Of these, 4620 patients had a documented CFS and were included in the study. There were no differences in age, sex, the proportion of treatment limitations, or hospitalization prior to ICU or pre-ICU hours between the 4620 patients and 1115 patients without a documented CFS. However, a lower proportion of those with missing frailty data had COVID-19 and these patients had higher illness severity scores  and less frail , than patients without COVID-19. A higher proportion of patients with COVID-19 were male . Patients with COVID-19 had lower APACHE-III scores and less frequently had chronic comorbidities such as respiratory, cardiovascular, renal, liver, immunosuppressive conditions, and metastatic cancer, but were more likely to be obese and have delirium, than patients without COVID-19. Admissions to ICU following a rapid response team review were less frequent for patients with COVID-19 . More patients with COVID-19 were receipt of mechanical ventilation, tracheostomies, ECMO therapies, and vasoactive agents, whereas fewer patients were receipt of non-invasive ventilation or renal replacement therapy than patients without COVID-19 . Higher hospital mortality was observed in COVID-19 patients compared to those without COVID-19 at equivalent frailty levels  and CFS-4 , compared to patients without COVID-19  for CFS categories, than those without COVID-19 (p\u2009=\u20090.91). The ICU readmissions were lower in patients with COVID-19 for CFS categories CFS-1\u20133, CFS-4, and CFS-6, than in those without COVID-19 (p\u2009<\u20090.001). Overall, the patients with COVID-19 were less likely to be discharged home or to a nursing home, when compared to patients without COVID-19 (both p\u2009<\u20090.001) respectively.The unadjusted ICU mortality rates were higher only for non-frail patients with COVID-19 for CFS categories CFS-1\u20133 . Although the increasing frailty scores were associated with mortality, after adjusting for ANZROD, the effect of frailty was similar in both groups . A higher proportion of male patients had COVID-29 . In patients aged\u2009\u2265\u200965\u00a0years, although the increasing frailty scores were associated with mortality, after adjusting for ANZROD and sex, the effect of frailty was similar in patients with and without COVID-19 . Their median age was similar between the 2 groups . Although the increasing frailty scores were associated with mortality, after adjusting for ANZROD and sex, the effect of frailty was similar in patients with and without COVID-19  were mechanically ventilated. Although more patients with COVID-19 received mechanical ventilation overall,  had COVID-19 . Despite the increasing frailty scores were associated with mortality, after adjusting for ANZROD and sex, the effect of frailty was similar in both groups  admitted, 38.1% (5.2% admin\u2009=\u20092942) were patients with COVID-19 . Although the increasing frailty scores were associated with mortality, after adjusting for ANZROD and sex, the effect of frailty was similar in patients with and without COVID-19  admitted, 85.1% n\u2009=\u2009942 were This multicentre retrospective observational study that compared viral pneumonia patients with and without COVID-19 admitted to ICU in Australia and New Zealand revealed that: firstly, the mortality increased with increasing frailty, but the impact of frailty was similar in patients with and without COVID-19 pneumonitis. Secondly, patients with COVID-19 were less frail and younger than patients without COVID-19. Thirdly, the CFS independently predicted hospital mortality in both patients with and without COVID-19 pneumonitis but had a low discriminatory capacity. Fourthly, only one in ten patients with frailty with COVID-19 received mechanical ventilation. Finally, the mortality was higher in patients \u2265\u200965\u00a0years of age and those requiring mechanical ventilation, especially with increasing frailty.There were few studies that compared outcomes of COVID-19 with influenza patients. These studies showed the overall hospital mortality; the need for ICU admission and mechanical ventilation was substantially higher in patients with COVID-19 \u201339. HoweOur key study finding was that although the risk of death increased with frailty, the impact of frailty on hospital mortality was comparable between patients with and without COVID-19 pneumonitis. It is important to note that the Australian experience of the COVID-19 pandemic has differed from that internationally . Our morIt is well established that higher degrees of frailty have been associated with poor outcomes and higher mortality rates during and after ICU admission , 43. SimPatients with frailty were associated with lower use of mechanical ventilation , 44. A rAustralia and New Zealand\u2019s healthcare system was not as overwhelmed as other parts of the world in 2020. However, the impact was much greater in 2021. At the peak in October, 55% of all public ICU beds in Victoria and almost 40% of all public ICU beds in New South Wales were occupied by patients with COVID-19 . This caThe inclusion period of 2\u00a0years encompassed patients from several different waves that also witnessed changes in treatment and the introduction of vaccinations. The rates of COVID-19 vaccine administration steadily increased since the rollout in February 2021. The vaccinations were initially prioritized in Victoria and New South Wales, which had the highest case numbers. At the end of the study period, >\u200990% of all eligible people had received the first dose Australia wide and >\u200984% received their second dose . FurtherOur study found that frailty independently predicted mortality in both patients with and without COVID-19 pneumonitis, but the impact of frailty was similar in patients with and without COVID-19 pneumonitis. This implies that, regardless of COVID-19 status, the patients\u2019 care was no different. This may at least in part reflect that Australia and New Zealand have evaded the magnitude of the pandemic that has overwhelmed healthcare systems in many parts of the world. Moreover, the intensive care resource availability is owing to stringent public health measures in Australia and New Zealand. Our study has demonstrated that more patients with COVID-19 admitted to ICU had CFS scores between 1 and 3. It is possible that the intensive care teams were more selective in admitting frail patients with COVID-19 into their ICUs.Our study has several notable strengths. Firstly, the multicentre design, incorporating high-quality data Australia and New Zealand wide, as well as a larger sample size than many other studies. Secondly, the CFS, which is the most used frailty assessment tool for critically ill patients. Thirdly, we incorporated pre-specified several secondary analyses, to assess the impact of frailty on several important patient-centred ICU outcomes. To our knowledge, this is the only study to compare the impact of frailty among patients with and without COVID-19 pneumonitis. There are a few limitations to this study. Firstly, the retrospective study design meant that data collection was reliant on existing datasets and medical records. Secondly, despite the ANZICS-APD being recognized as a high-quality clinical registry dataset, the effect of data coding inaccuracy on the study findings could not be assessed. Thirdly, in the absence of having linkage to infection notification data and without site-based auditing of diagnostic coding over the pandemic, we cannot be certain about the degree of misclassification, if any. Fourthly, the CFS was adopted in the assessment of frailty in ICUs across Australia and New Zealand. Despite being an attractive tool to distinguish the different grades of frailty, the reliability of a single assessment tool may be inadequate, especially when it comes to justifying the rationing of medical treatment. Fifthly, the patients with COVID-19 admitted to the ICUs with an alternate diagnosis could have been missed. Sixthly, we do not have any information regarding the number of patients that were referred for ICU admission and denied ICU admission, or the COVID-19 pandemic may have led to an increased presentation of COVID-19 to the ICUs, while non-COVID-19 patients had a transient reduction in hospital presentations as well as ICU admissions. Seventhly, although some evidence suggests that CFS is a major determinant of long-term mortality in patients with COVID-19, we only reported on hospital mortality, as the ANZICS-APD only captured hospital-based outcomes. Finally, the Australia and New Zealand healthcare system has been very fortunate with the magnitude of COVID-19 infections being largely under control, and therefore, the results may not be generalizable in resource-constrained healthcare systems.This multicentre retrospective study that compared viral pneumonitis in patients with and without COVID-19 admitted to ICU in Australia and New Zealand found that patients with COVID-19 were younger and less frail than patients without COVID-19. The frailty independently predicted hospital mortality in both patients with and without COVID-19 pneumonitis but had low discriminatory capacity. The impact of frailty, however, was no different in patients with and without COVID-19.Additional file 1: Figure S1 ICU Supports among patients with COVID-19 (red lines) with patients without COVID-19 (black lines), based on CFS score. Standard error bars are 95%-CI. Figure S2 Age comparison based on CFS categories. The CFS categories are denoted by the different stacked colours starting with CFS 1\u20133 at the bottom up to CFS 7\u20138 at the top. Figure S3 ICU bed days stratified by Clinical Frailty Scale (CFS) categories for patients with and without COVID-19. The bottom panels demonstrate the median length of stay among ICU survivors and non-survivors. Figure S4 Hospital mortality according to Clinical Frailty Scale (CFS) categories for patients with (red) and without (black) COVID-19 for patients admitted in 2020 (a) and 2021 (b). The top panel is unadjusted hospital mortality, while the bottom panel is adjusted for ANZROD and sex.Additional file 2: Table S1 Diagnostic codes and subcodes for patients included in the study between 1st January 2020 and 31st December 2021. Table S2 Missing data comparison for patients with and without the CFS scores. Table S3a CFS-1\u20133, CFS-4, and CFS-5 for patients with COVID-19 admitted to ICU with an admission diagnosis of viral pneumonia or ARDS. Table S3b CFS-6 and CFS-7\u20138 for patients with COVID-19 admitted to ICU with an admission diagnosis of viral pneumonia or ARDS. Table S4 Comparison of unadjusted outcomes. Standard error bars are 95%-CI. Table S5 Exposure and raw outcomes for male patients . Table S6 Exposure and raw outcomes for female patients . Table S7 Exposure and raw outcomes for patients \u2265\u200965\u00a0years . Table S8 Exposure and raw outcomes in patients needing mechanical ventilation . Table S9 Exposure and raw outcomes for patients who were cared for in the year 2020 . Table S10 Exposure and raw outcomes for patients who were cared for in the year 2021 . Table S11 Predictors for hospital mortality with the Clinical Frailty Scale (CFS) categories, adjusted for ANZROD and sex."}
+{"text": "Background and Objectives: COVID-19 can be serious not only in the acute phase but also after the acute phase and some patients develop ME/CFS. There have been few studies on patients with long COVID in whom ME/CFS was diagnosed by physicians based on standardized criteria after examinations and exclusion diagnosis and not based on only subjective symptoms. The purpose of this study was to elucidate the detailed characteristics of ME/CFS in patients with long COVID. Materials and Methods: A retrospective descriptive study was performed for patients who visited a COVID-19 aftercare clinic established in Okayama University Hospital during the period was from February 2021 to April 2022. Results: Clinical data were obtained from medical records for 281 patients, and 279 patients who met the definition of long COVID were included. The overall prevalence rate of ME/CFS diagnosed by three sets of ME/CFS criteria  was 16.8% . The most frequent symptoms in ME/CFS patients were general fatigue and post-exertional malaise (89.4% of the patients), headache (34.0%), insomnia (23.4%), dysosmia (21.3%) and dysgeusia (19.1%). Dizziness, chest pain, insomnia and headache were characteristic symptoms related to ME/CFS. The male to female ratio in ME/CFS patients was equal in the present study, although ME/CFS was generally more common in women in previous studies. Given that patients with ME/CFS had more severe conditions in the acute phase of COVID-19, the severity of the acute infectious state might be involved in the pathophysiology of ME/CFS. Conclusions: The prevalence rate of ME/CFS and the characteristic sequelae in the long COVID condition were revealed in this study. The pandemic of novel coronavirus disease 2019 (COVID-19) has been continuing for more than 2 years and more than 285 million cases of infection and 5.4 million deaths have been reported worldwide . VariousIn COVID/post COVID-19 conditions, general fatigue and post-exertional malaise (PEM) are the most common sequelae ,6 and itIn community-based epidemiological research, the prevalence rate of ME/CFS in adults in the United States has been estimated to be 0.42%  and a rePrevious studies on the prevalence of ME/CFS after COVID-19 have been conducted by using questionnaire-based surveys ,17,18. HThis study was a descriptive study conducted in a single facility. A COVID-19 aftercare clinic (CAC) was established on 15 February 2021 in the Department of General Medicine, Okayama University Hospital, a tertiary hospital with 865 beds located in the western area of Japan. The purpose of establishing the CAC was to evaluate and manage patients who have suffered from post COVID-19 condition symptoms for more than one month (four weeks) after the onset of COVID-19. Most of the consulting patients were referred from outside medical facilities.Clinical information on patients who visited the CAC was obtained retrospectively. Medical records for 281 patients during the period from February 2021 to April 2022 were carefully reviewed. Long COVID was defined as symptoms that persist for more than one month after the onset of COVID-19 ,19. Info2 tests for categorical variables. A p value of less than 0.05 was considered statistically significant.All statistical analyses were performed using Stata/SE 17.0 . The characteristics of ME/CFS patients and non-ME/CFS patients were compared using Mann\u2013Whitney U-tests for continuous variables and Fisher\u2019s exact tests or Pearson\u2019s \u03c7Information regarding the present study was provided on our hospital wall and on the website of our hospital, and patients who wished to opt out were offered that opportunity. Informed consent from the patients was not necessary due to the anonymization of data. This study was approved by the Ethics Committee of Okayama University Hospital (No. 2105-030) on 28 April 2022 and adhered to the Declaration of Helsinki.Of the 281 patients who were enrolled, we excluded two patients because they visited our CAC in less than 4 weeks after the onset of COVID-19, and data for 279 patients visiting our CAC were obtained. There were no patients with obvious endocrine or metabolic abnormalities. The percentages of patients meeting the three sets of criteria were 17.2% for Fukuda Criteria, 17.9% for CCC, and 17.9% for IOM criteria . Forty-sp = 0.02), while the percentages of patients who received corticosteroids and/or oxygen supplement were not significantly different between the two groups. The severity of COVID-19 in its acute phase was defined by the Ministry of Health, Labour and Welfare in Japan [p = 0.006). The numbers (proportions) of ME/CFS patients with incomplete COVID-19 vaccination (who did not receive vaccination or received only one dose) and vaccination with at least two doses were 33 (70.2%) and 13 (27.7%), respectively. The number of patients with adequate vaccination (two or three doses) was not significantly different between the ME/CFS and non-ME/CFS groups. The median durations after the onset of COVID-19 to the first visit were 4.2 months in ME/CFS patients and 2.5 months in non-ME/CFS patients (p < 0.001).The clinical backgrounds of the post COVID-19 patients with ME/CFS and the post COVID-19 patients without ME/CFS are shown in in Japan . The pern = 47, non-ME/CFS: n = 232) are shown in The vital signs at the first visit in the ME/CFS patients and non-ME/CFS patients were not notably different . The patn = 279). The symptoms of long COVID were varied in more than 10 symptoms, and the most frequent symptoms were general fatigue and PEM , dysgeusia , dysosmia  and headache . The lower panel of The upper panel of In the present study, we clarified the proportion and characteristics of long COVID patients who had ME/CFS patients in long COVID. To the best of our knowledge, this study is the first study in which ME/CFS was diagnosed in long COVID patients after face-to-face consultation and exclusion of diseases and the first study to show the proportion of long COVID patients with ME/CFS, which is a novel part of this study. In our study, the prevalence of ME/CFS was revealed to be 16.8%, which is close to the prevalences reported previously .p < 0.0001), lower quality of life scores  and higher SDS  at the time of the first visit as shown in The results of this study showed that patients in the ME/CFS group had a longer time between the onset of COVID-19 and the first visit (4.2 months in the ME/CFS group vs. 2.5 months in the non-ME/CFS group as shown in p = 0.006). An association between long COVID and initial disease severity during the acute phase of COVID-19 was not found in most studies [Considering that the SDS scores were higher in ME/CFS patients at the first visit, it is likely that such patients already had a depressive mood at an earlier stage. However, SDS is a self-administered questionnaire, and it is possible that SDS was higher in ME/CFS patients because they had strong symptoms of general fatigue and post-exertional malaise. Since a six-month symptomatic period is required as a criterion for diagnosis of ME/CFS, it is possible that the duration after the onset of COVID-19 to the first visit to our CAC was also longer. Furthermore, more ME/CFS patients had a severe status in the COVID-19 acute phase (percentage of patients with moderate to severe status: 40.4% in ME/CFS patients vs. 21.6% in non-ME/CFS patients,  studies ,8. Howev studies ,27.The patients with ME/CFS in this study had fewer symptoms including dysosmia, dysgeusia and hair loss than did the non-ME/CFS patients at the initial visit to our CAC . This suOur study is also unique in that all of the patients received face-to-face examinations, which were not conducted in previous studies ,30. We wThe lower panel of The present study has several limitations. First, this study was carried out to determine the prevalence of ME/CFS in post COVID-19 patients who visited an outpatient clinic that is a single center in Japan. Moreover, the backgrounds of patients were long COVID patients who were referred to our CAC, therefore it is possible that the patients suffering more severe and prolonged symptoms were included in this study. Second, we may not have adequately detected patients with ME/CFS, since the study included patients who had ME/CFS only a few months after the onset of ME/CFS, and there are patients in the non-ME/CFS group in whom ME/CFS might have developed in the future. Third, this study included only patients who were referred to a specific outpatient clinic and the entire long COVID or post COVID-19 population was not examined. Fourth, various strains of COVID-19 including Delta and Omicron strains have emerged, but the differences in symptoms due to these strains were not investigated in this study. Finally, changes in symptoms over time due to vaccination were not evaluated.Collectively, we revealed the prevalence rate of ME/CFS and characteristic sequelae in patients with long COVID who visited our CAC, which is an outpatient clinic specializing in long COVID. Overall, 16.8% of long COVID patients met the ME/CFS criteria. Medical practitioners who care for patients with long COVID should also consider the possibility of ME/CFS in cases of prolonged symptoms including general fatigue and PEM. Further research is needed to determine the pathophysiology of ME/CFS and the possibility of medical and physical treatments."}
+{"text": "OsPP65 in rice osmotic and salt stress tolerance were investigated. Here, we report that OsPP65 is responsive to multiple stresses and is remarkably induced by osmotic and salt stress treatments. OsPP65 was highly expressed in rice seedlings and leaves and localized in the nucleus and cytoplasm. OsPP65 knockout rice plants showed enhanced tolerance to osmotic and salt stresses. Significantly higher induction of genes involved in jasmonic acid (JA) and abscisic acid (ABA) biosynthesis or signaling, as well as higher contents of endogenous JA and ABA, were observed in the OsPP65 knockout plants compared with the wild-type plants after osmotic stress treatment. Further analysis indicated that JA and ABA function independently in osmotic stress tolerance conferred by loss of OsPP65. Moreover, metabolomics analysis revealed higher endogenous levels of galactose and galactinol but a lower content of raffinose in the OsPP65 knockout plants than in the wild-type plants after osmotic stress treatment. These results together suggest that OsPP65 negatively regulates osmotic and salt stress tolerance through regulation of the JA and ABA signaling pathways and modulation of the raffinose family oligosaccharide metabolism pathway in rice. OsPP65 is a promising target for improvement of rice stress tolerance using gene editing.Although type 2C protein phosphatases (PP2Cs) have been demonstrated to play important roles in regulating plant development and various stress responses, their specific roles in rice abiotic stress tolerance are still largely unknown. In this study, the functions of The online version contains supplementary material available at 10.1186/s12284-022-00581-5. As sessile organisms, plants are always faced with various environmental stresses such as high salinity, drought, and low temperature  OsPT2 and OsPT8 and influencing their trafficking from the endoplasmic reticulum to plasma membrane in rice  is remarkably induced by various stresses and that knockout of OsPP65 enhances tolerance to osmotic and salt stresses in rice. Further analysis showed that OsPP65 regulates rice responses to abiotic stresses by regulating the abscisic acid (ABA) and jasmonic acid (JA) signaling pathways independently. Moreover, analysis of the primary metabolomes of the wild-type cultivar Nipponbare and OsPP65 knockout plants indicated that the raffinose family oligosaccharide (RFO) metabolic pathway might play important roles in stress tolerance conferred by loss of OsPP65 in rice.In our previous study to screen for proteins interacting with OsGF14b that are involved in rice drought response  at multiple time points from 0 to 24\u00a0h post treatment (hpt). The results showed that the transcription level of OsPP65 was significantly induced at almost all the time points after the NaCl and PEG treatments  was driven by the promoter of OsPP65. Histochemical analysis revealed GUS activity in all the tissues examined  plants using CRISPR/Cas9 gene editing technology. Two target sites were selected for gene editing and 20 independent transgenic lines were obtained. Through PCR amplification and sequencing analysis, three homozygous lines with different frameshift mutations  were chosen for stress tolerance evaluation   Fig.\u00a0E. Moreovent Fig.\u00a0F. To obsing Fig.\u00a0D. Since nts Fig.\u00a0C, indicaOsPP65 in tolerance to salt stress, seeds of the wild-type and OsPP65 knockout plants were germinated on 1/2 MS medium supplemented with or without NaCl. As shown in Figure S2, no significant differences were identified between the wild-type and OsPP65 knockout plants in terms of seedling growth in the absence of NaCl. In the presence of 150\u00a0mM NaCl, the shoot and root growth of both the wild-type and OsPP65 knockout plants were severely inhibited at 6\u00a0days after germination, but the OsPP65 knockout plants were markedly less inhibited by NaCl treatment than the wild-type plants  analysis of global gene expression was conducted in the wild-type and ko6 plants under normal conditions and 4\u00a0h after osmotic stress treatment. Under normal conditions, only 36 up-regulated genes and 20 down-regulated genes in ko6 plants were observed to have transcript levels more than twofold higher and lower, respectively, than those in the wild-type plants  proteins, which are involved in ABA signaling, implying a role of OsPP65 in the control of the ABA signaling pathway. In addition, two allene oxide synthase genes (OsAOS2 and OsAOS3), which function in JA biosynthesis, were up-regulatedin ko6 plants compared with the wild-type plants, suggesting that the stress tolerance conferred by loss of OsPP65 might also be associated with the JA signaling pathway.To identify the possible downstream signaling pathways regulated by ko3, and ko6 plants under normal and osmotic stress conditions by qRT-PCR. The transcripts of two lipoxygenase genes (OsLOX2 and OsLOX9), which are involved in JA biosynthesis, were also analyzed in these plants. The results showed that seven OsLEA genes (OsLEA1/2/3/14/19/25/29) were strongly induced by osmotic stress in both wild-type and OsPP65 knockout plants, but their expression levels were significantly higher in the OsPP65 knockout plants than in wild-type plants under osmotic stress conditions  on the growth of OsPP65 knockout plants. The results showed that elongation of the roots of OsPP65 knockout seedlings was less sensitive to exogenous ABA and MeJA treatments than that of the wild-type seedlings  in the wild-type and OsPP65 knockout plants after ABA treatment, as well as the transcription of two ABA synthesis-related genes (OsNCED3 and OsNCED4) and five OsLEA genes after JA treatment. ABA treatment did not affect the transcription of the four JA synthesis-related genes, and the endogenous contents of JA were not remarkably affected by ABA treatment in both the wild-type and OsPP65 knockout plants  with (4\u00a0h) or without (0\u00a0h) osmotic stress treatment by gas chromatography tandem mass spectrometry (GC\u2013MS). The omics data matrix consisted of retention time, an accurate mass-to-charge ratio (m/z), and the relative content of each metabolite in each sample  with \u00a0h or wito6) with \u00a0h or witOsPP65 knockout plants , raffinose synthase 2 (OsRS2), and alkaline \u03b1-galactosidase 1 and 3 (OsAGA1 and OsAGA3) in both the wild-type and OsPP65 knockout plants, but the fold changes of these enzymes were higher in OsPP65 knockout plants compared with those in the wild-type plants . Because of its multiple functions in both abiotic and biotic stresses, we believe that OsPP65 provides a promising target for improvement of stress tolerance and disease resistance in rice plants using a gene editing approach.PP2C-type protein phosphatases are a group of highly conserved regulatory proteins that are present in virtually all eukaryotic organisms   diminishes ABA accumulation in Arabidopsis  and the effects of ABA on other aspects of the JA signaling pathway were not investigated in our present study. Therefore, we cannot rule out the possibility that the JA and ABA signaling pathways act in concert with each other in relation to these other aspects.Given that previous studies have indicated that dehydration stress-induced JA accumulation is dependent on ABA in Arabidopsis  or 1% H2O2. Seedlings were sampled at 3\u00a0h, 6\u00a0h, 9\u00a0h, 12\u00a0h, and 24\u00a0h after treatment for gene expression analysis.The japonica cultivar OsPP65 using CRISPR/Cas9 technology, two target sites (CGGGTTCGTCAAGACGGACA and CTCACCATGTCATGCAGATA) were selected and the expression cassettes were obtained by overlap PCR using the corresponding primers . Quantitative RT-PCR analysis was performed as described in our previous study . The light intensity was 540\u00a0\u03bcmol\u00a0m\u22122\u00a0s\u22121 and humidity was 75%. After two weeks, the seedlings were subjected to osmotic stress by transferring them into fresh Kimura B nutrient solution containing 20% PEG6000. Five days later, the treated seedlings were recovered in fresh Kimura B nutrient solution for another 5\u00a0days. To measure the ion leakage, the second and third leaves were excised from the seedling and incubated in 10\u00a0ml of distilled water overnight. The ratio of conductivity values measured by a DDS-11AT conductivity meter  before and after boiling was calculated as the ion leakage from the leaves. The water loss rates of the wild-type Nipponbare and OsPP65 knockout plants were measured using the same method as described by Liu et al.  or without (0\u00a0mM) NaCl for 7\u00a0days. Next, the lengths of shoot and primary roots were measured.For salt stress treatment, seeds of wild-type and Nipponbare and OsPP65 knockout plants were fixed with 2.5% glutaraldehyde, and pictures of stomata were acquired by scanning electron microscopy  as described previously  with (4\u00a0h) or without (0\u00a0h) osmotic stress treatment were collected for RNA-seq analysis. The quality of the RNA-seq raw reads was assessed, and the reads were trimmed by the software trim_galore with the parameters \u201c\u2013stringency 3 \u2013length 36 -e 0.1\u201d. Sequencing reads that passed quality control were mapped onto the Nipponbare  reference genome using STAR (2.7.1a) software  with accession number PRJNA808176.Seedlings (15 plants for each replicate) of the wild-type Nipponbare and OsPP65 knockout plants (lines ko3 and ko6) with (4\u00a0h) or without (0\u00a0h) osmotic stress treatments were collected for hormone quantification and metabolomic analysis. Hormones were measured using LC\u2013MS while the metabolomic analysis was conducted using GC\u2013MS as described in our previous studies  of the wild-type Two independent experiments were conducted for stress treatment, hormone quantification and untargeted metabolomic analysis. Three or four biological replicates were performed for each experiment. Three independent experiments were conducted for stress tolerance analysis, stress-related gene expression analysis, and three biological replicates were performed for each experiment. All results are presented as means\u2009\u00b1\u2009standard derivation (SD) of three biological replicates. Statistically significant difference analysis is conducted by \u201cDunnett's test\u201d using IBM SPSS statistics software (version 23).Additional file 1: Fig. S1. Phenotypes of the wild-type (WT) and OsPP65 knockout plants at 30 days after flowering under normal conditions. Fig. S2. OsPP65 knockout rice plants show enhanced salt stress tolerance at the germination stage. A, Seeds of the WT and OsPP65 knockout plants were germinated on 1/2 MS medium with (150 and 200 mM) or without (0 mM) NaCl for 7 days. B, Shoot lengths of the germinated seeds of WT and OsPP65 knockout plants. C, Root lengths of the germinated seeds of WT and OsPP65 knockout plants. Data represent means \u00b1 SD of three biological replicates (20 plants for each replicate), and the asterisks indicate significant differences compared with the WT plants at *P < 0.05 (Dunnett's test). Fig. S3. The OsPP65 knockout seeds were less sensitive to exogenous ABA relative to the wild-type seeds. A, Photograph showing the germinated seeds of WT and OsPP65 knockout plants with or without ABA treatment. B, Shoot lengths of the germinated seeds of WT and OsPP65 knockout plants. C, Root lengths of the germinated seeds of WT and OsPP65 knockout plants. Data represent means \u00b1 SD of three biological replicates (20 plants for each replicate) and the asterisks indicate significant differences compared to the WT plants at *P < 0.05 (Dunnett's test). Fig. S4. The OsPP65 knockout seeds were less sensitive to exogenous JA relative to the WT seeds. A, Phenotypes of the germinated seeds of WT and OsPP65 knockout plants with or without JA treatment. B, Shoot lengths of the germinated seeds of WT and OsPP65 knockout plants. C, Root lengths of the germinated seeds of WT and OsPP65 knockout plants. Data represent means \u00b1 SD of three biological replicates (20 plants for each replicate) and the asterisks indicate significant differences compared to the WT plants at *P < 0.05 (Dunnett's test). Fig. S5. Exogenous ABA treatment did not affect the JA signaling pathway in OsPP65 knockout plants. A, Transcription analysis of four JA biosynthesis genes in the WT and OsPP65 knockout plants before and after ABA treatment. B, Quantification of endogenous JA in the WT and OsPP65 knockout plants before and after ABA treatment. FW, fresh weight. Fig. S6. Exogenous JA treatment did not affect the JA signaling pathway in OsPP65 knockout plants. A, Transcription analysis of two ABA biosynthesis genes and five OsLEA genes in the WT and OsPP65 knockout plants before and after JA treatment. Data represent means \u00b1 SD of three biological replicates and the asterisks indicate significant differences compared to the WT plants at **P < 0.01 and *P < 0.05 (Dunnett's test). B, Quantification of endogenous JA in the WT and OsPP65 knockout plants before and after JA treatment. FW, fresh weight. Fig. S7. Score plot generated from the GC\u2013MS metabonomics data using the crossvalidated OPLS-DA model. Fig. S8. The fold changes of other sugars or amino acids in WT and OsPP65 knockout plants at 4 h osmotic stress treatment relative to 0 h treatment. Data represent means \u00b1 SD of three biological replicates and the asterisks indicate significant differences compared to the WT plants at **P < 0.01 and *P < 0.05 (Dunnett's test). Fig. S9. Expression levels of OsSPCH2 and OsICE1 in WT and OsPP65 knockout plants under normal condition. Data represent means \u00b1 SD of three biological replicates and the asterisks indicate significant differences compared to the WT plants at *P < 0.05 and **P < 0.01 (Dunnett's test). Fig. S10. Expression levels of OsJAR1 in WT and OsPP65 knockout plants with or without osmotic stress treatment. Data represent means \u00b1 SD of three biological replicates and the asterisks indicate significant differences compared to the WT plants at *P < 0.05 (Dunnett's test).Additional file 2: Table S1. Differentially expressed genes in ko6 plants by RNA-seq analysis before (0 h) and after (4 h) osmotic stress treatment. |log2 Ratio| \u22651 and FDR \u2264 0.05.Additional file 3: Table S2. Cis-elements analysis of the OsPP65 promoter.Additional file 4: Table S3. 120 metabolites identified by GC-MS in WT and the OsPP65 knockout plants. Number after the metabolite represents the isomer.Additional file 5: Table S4. Primers used for vector construction and quantitative RT-PCR analysis."}
+{"text": "The observed lipid oxidation capacity in WTM followed the order metHb\u00a0>\u00a0hemin\u00a0>\u00a0oxyHb\u00a0>\u00a0Fe2+ > Fe3+. Added Fe2+ accelerated auto-oxidation of oxyHb and oxyHb-mediated lipid oxidation. Hb auto-oxidation to metHb increased as the pH decreased from 6.6 to 5.0. NaCl promoted oxyHb-mediated lipid oxidation due to NaCl causing decreased pH value and increased formation of metHb. STPP inhibited oxyHb-mediated lipid oxidation and weakened the pro-oxidative effect of NaCl. This could be attributed to STPP increasing the pH, inactivating free iron, and inhibiting formation of metHb.This study examined the effects of sodium chloride (NaCl) and sodium tripolyphosphate (STPP) on lipid oxidation induced by oxyhemoglobin (oxyHb) in washed turkey muscle (WTM) model. To explore the reasons for observed effects, the pro-oxidant abilities of Hb derivatives (e.g., metHb, oxyHb, hemin, Fe This prVarious non-meat ingredients are used to manufacture processed meats to enhance their flavor and texture. Sodium chloride (NaCl), or salt, is added to meat products to improve flavor, preservation, water holding capacity, tenderness, and juiciness . NeverthSodium tripolyphosphate (STPP) is commonly added to meat products and is used for its similar effects to NaCl in textural properties of meat products . HoweverAlthough recent developments have been significant, it is challenging to elucidate how NaCl accelerates lipid oxidation while STPP inhibits this process activated by heme proteins in meat and meat products. These challenges exist due to simultaneous and continuous complicated phenomena such as heme protein auto-oxidation, heme dissociation, ferryl radical formation, and iron release by heme destruction. Therefore, this study aimed to estimate the effects of NaCl and STPP on lipid oxidation mediated by hemoglobin using washed turkey muscle (WTM) and explore the reasons for those effects.22.1Ferric chloride, streptomycin sulfate, ferrous sulfate, barium chloride, ammonium thiocyanate, and sucrose were obtained from Sigma-Aldrich . Chloroform (ethanol stabilized), methanol, and tris-(hydroxymethyl)-aminomethane (Tris) were obtained from Fisher Scientific . All other chemicals used were analytical grade.2.2g for 10\u00a0min at 4\u00a0\u00b0C) in a Beckman J-6B centrifuge . The red blood cells were washed three times more using 10 volumes of the same washing buffer (g for 15\u00a0min at 4\u00a0\u00b0C) in a Beckman L8-70\u00a0M ultracentrifuge . Hemolysates were then stored at \u221280\u00a0\u00b0C until use.Pig blood was obtained under Wisconsin State Inspection in the UW-Madison Meat Science and Muscle Biology Laboratory. Four volumes of pig blood were mixed thoroughly with 1\u00a0vol of anticoagulant containing 150\u00a0mM NaCl and sodium heparin (120 Units/ml). To remove the plasma, washing buffer  were added to heparinized blood and centrifuged  using 1\u00a0mM Tris, pH 8.0 as a reference. Hemoglobin concentrations were based on a heme basis and calculated using the peak absorbance occurring near 578\u00a0nm .2.4Hemoglobin (Hb) was converted into metHb by adding potassium ferricyanide and incubating on ice for 10\u00a0min . Ferricy2.5Meleagris gallopavo) muscle was obtained from Kraft Oscar Mayer . WTM was prepared according to the method described by Turkey (2.6WTMs were moved into an amber bottle (30\u00a0mL capacity). The Hb derivatives , NaCl (1.5\u00a0%), and STPP (0.3\u00a0%) were added to the mixture and mixed for 2\u00a0min using a plastic spatula. Following this mixture, streptomycin sulfate (200\u00a0ppm) was added to inhibit microbial growth . The moi2.7The rate of metHb formation was calculated from absorbance changes at 540, 560, and 576\u00a0nm as described previously . To conf2.8Hexanal from WTM was extracted using a solid-phase microextraction (SPME) technique. Samples (1\u00a0g) were transferred into a 10\u00a0mL vial with 20\u00a0mm clear crimp. The vial was sealed with a metal hole cap with PTFE/silicone septa . Before extraction of hexanal, fiber  was conditioned by heating in a gas chromatograph  injection port equipped with capillary column  and flame ionization detector (FID) at 260\u00a0\u00b0C for 30\u00a0min. Vials containing samples were preheated for equilibration at 40\u00a0\u00b0C for 5\u00a0min, and SPME fiber for extraction of hexanal was exposed to the headspace above the sample at 40\u00a0\u00b0C for 10\u00a0min. After injection of SPME fiber into the GC/FID injection port, hexanal extracted from samples were isolated from SPME fiber at 250\u00a0\u00b0C for 5\u00a0min. Helium as a carrier gas and splitless mode was used. The flow rate of the carrier gas was 1\u00a0mL/min. Inlet and detector temperatures were 250 and 270\u00a0\u00b0C, respectively. The oven temperature was programmed at 40\u00a0\u00b0C for 5\u00a0min with a 10\u00a0\u00b0C/min ramp rate until 90\u00a0\u00b0C. Hexanal was identified by comparison of retention time of hexanal standard  in GC/FID. The quantity of hexanal in the sample was calculated using an external standard method. Hexanal solutions prepared in different concentrations in Milliq water were used to make the standard curve. The hexanal solutions (1\u00a0mL) were analyzed using the same procedures described for the samples above.2.9sec. The homogenate was then filtered with Whatman no. 1. About 1\u00a0mL of filtrate and 1\u00a0mL of thiobarbituric acid solution (0.02\u00a0M) were mixed and incubated at 100\u00a0\u00b0C for 40\u00a0min. After cooling, the mixture was centrifuged at 2,000 g for 5\u00a0min at 4\u00a0\u00b0C using a Beckman J-6B centrifuge . Absorbance was then measured at 532\u00a0nm.Thiobarbituric acid reactive substance (TBARS) values were measured according to the method described by 2.10p\u00a0<\u00a00.05.Data were analyzed using a one-way analysis of variance (ANOVA) with SPSS 12.0. The results were reported as mean\u00a0\u00b1\u00a0standard deviation (SD) (n\u00a0\u2265\u00a02). Means were separated using Student-Newman-Keuls's multiple range test. The threshold for significance for all tests was set at 33.13.2Effects of pH, NaCl, and STPP on the auto-oxidation rate of oxyHb were measured while stored at 37\u00a0\u00b0C, and data are expressed as relative rates of auto-oxidation (metHb %). As shown in 2+ showed a large shift from 415\u00a0nm to 405\u00a0nm. Whereas in the oxyHb only treatment, only very slight shift at 415\u00a0nm was observed during 5\u00a0days incubation. The metHb was 68.1\u00a0% in oxyHb with FeCl2 and 20.9\u00a0% in only oxyHb after 5\u00a0days incubation. These results indicated that Fe2+ accelerated Hb auto-oxidation to the met-Hb form.The ability of added Fe 2\u00a0+\u00a0to facilitate Hb auto-oxidation was also examined at 4\u00a0\u00b0C at pH 5.9 . The oxy3.3To compare the pro-oxidative activities of Hb-derivatives in lipid oxidation of the muscle system, oxyHb, metHb, hemin, ferrous iron, and ferric iron were separately added to WTM . Among t3.43.5To identify the role of ferrous iron in oxyHb-mediated lipid oxidation, ferrous iron was added into WTM in the presence of oxyHb. As shown in 44.13+ did not show any pro-oxidant ability when using WTM. Similarly, 3 did not promote lipid oxidation based on PV and TBARS in an aqueous beef residue model system. Additionally, Fe2+ also generated no detectable increase in TBARS during storage. This finding was in agreement with the data reported by 2 did not initiate lipid oxidation in washed cod muscle system during the 8\u00a0days of storage on ice. The negligible pro-oxidant ability of both Fe2+ and Fe3+ in the present study may be attributed to the fact that the FeCl2 and FeCl3 were water-soluble and not accessible to lipid phases . Specific types of chelators that form a complex with iron were necessary to facilitate iron-mediated lipid oxidation  . HoweverThe addition of STPP strongly decreased oxyHb-mediated lipid oxidation over 6\u00a0days of storage, as shown in 2+ and thereby inhibit the ability of Fe2+ to incur oxidative reactions. It was previously shown that Fe2+ increased the formation of oxidized heme proteins and lipid oxidation in a pork homogenate system  did not show pro-oxidant activity in WTM. Additionally, the addition of NaCl significantly increased the oxyHb-mediated lipid oxidation. The decrease in pH value and increase of % metHb partly explained why NaCl increased the pro-oxidant activity of oxyHb. STPP inhibited oxyHb-mediated lipid oxidation. The increase of pH value, inactivation of iron, and inhibition of the formation of metHb seem to explain the inhibiting effect of STPP on oxyHb-mediated lipid oxidation in WTM. These studies provide foundational knowledge for understanding the effect of NaCl and STPP on lipid oxidation in meat. Furthermore, these findings could provide foundational information for controlling lipid oxidation in processing meat products involving NaCl and STPP.Among Hb derivatives, metHb in WTM acted as the most effective pro-oxidant, followed by hemin and oxyHb. However, free iron (FeThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "Artemisia annua L. (Asteraceae family). One of the most widely used modes of treatment for malaria is an artemisinin-based combination therapy. Artemisinin and its associated compounds have a variety of pharmacological qualities that have helped achieve economic prominence in recent years. So far, research on the biosynthesis of this bioactive metabolite has revealed that it is produced in glandular trichomes and that the genes responsible for its production must be overexpressed in order to meet demand. Using biotechnological applications such as tissue culture, genetic engineering, and bioreactor-based approaches would aid in the upregulation of artemisinin yield, which is needed for the future. The current review focuses on the tissue culture aspects of propagation of A. annua and production of artemisinin from A. annua L. cell and organ cultures. The review also focuses on elicitation strategies in cell and organ cultures, as well as artemisinin biosynthesis and metabolic engineering of biosynthetic genes in Artemisia and plant model systems.Artemisinin is an anti-malarial sesquiterpene lactone derived from  Artemisia annua (L.). Artemisinin is a sesquiterpene lactone molecule with an endoperoxide structure that has anti-malarial properties [A. annua is a member of the Asteraceae family that grows in tropical and subtropical climates. The plant is native to China and it is known as qinghao, commonly called sweet annie and worm wood in English. The plant is recorded in ancient Chinese texts as being used to cure fevers [Plasmodium falciparum is the causative organism for malarial infection, which completes its life cycle through multiple hosts [Medicinal plants have long been a component of human civilization. Plants are utilized to heal ailments and have saved people from countless pandemics, according to Ayurvedic writings and kindred scriptures. Medicinal plants are high in pharmacologically significant bioactive chemicals that define the plant\u2019s medicinal properties. Artemisinin is one such medicinally important metabolite derived principally from the aerial parts of the medicinal herb operties . A. annue fevers . Studiese fevers . Accordie fevers . Plasmodle hosts .15H22O5 (282 Da) and a melting point of 156\u2013157 \u00b0C [A. annua with glandular trichomes. Glandular trichomes in Artemisia are rich in transcriptional factors, which activate the genes responsible for the biosynthesis of artemisinin [Artemisinin was discovered by Youyou Tu in 1972, for which she was awarded the Nobel prize in 2015. Her extensive studies revealed that artemisinin is a colorless crystalline compound with the molecular formula C15H22O5 22 Da and emisinin  and antiemisinin  of artemAs there are so many possible pharmacological aspects, there is a need for artemisinin production and a rise in its output. Conventional artemisinin production will not be enough to fulfill demand. As a result, current biotechnological approaches such as plant cells, tissue and organ cultures, bioreactor-based scaling up, and metabolic engineering strategies must be utilized. The present review focuses on the significance of artemisinin, its biosynthesis, production using in vitro technologies, such as tissue and organ cultures, elicitation strategies for boosting the yield, and bioreactor-based scaling up of production of artemisinin. This review also helps in understanding the metabolic engineering element, which allows us to understand the biosynthesis and genes involved in artemisinin production, ultimately allowing us to build a better strategy for artemisinin production.A. annua is a medicinal herb with significant anti-malarial effects, it is critical to understand how to regenerate it, utilizing in vitro techniques to boost its bioactive compound content while also preserving its excellent quality germplasm.The in vitro regeneration approach allows us to conserve and proliferate rare and therapeutic plant species for the extraction of diverse bioactive compounds. Since A. annua.Direct organogenesis is associated with the formation of organs such as shoots and roots directly from cultured explants, avoiding the callusing phase of in vitro regeneration. Seeds, leaves, and shoot regions are some of the successful explants used for direct organogenesis in Multiple shoots were developed from seed explants collected from the European region when inoculated on an MS medium supplemented with 0.1 mg/L of benzyl adenine (BA) along with 1.0 mg/L of indole-3-acetic acid (IAA), and subsequently, when the shoots were sub-cultured on a Murashige and Skoog (MS) medium supplemented with 1.0 mg/L naphthalene acetic acid (NAA) along with 0.1 mg/L kinetin (KN), gave roots . Optimal3) along with 10% coconut milk. These developed shoots were subjected to rooting when further transferred on a half-strength MS medium supplemented with indole-3-butyric acid (IBA) at 2.46 \u00b5M concentration [Induction of multiple shoots was observed with 100% efficiency (57 shoots per explant) when stem explants were inoculated on an MS medium supplemented with 0.1 mg/L thidiazuron (TDZ) and successive rooting was established on an MS basal medium . Nodal entration . Adventintration . The MS ntration .Explants, especially leaf and petiole obtained from seedlings, showed 100% regeneration efficiency when compared to greenhouse-grown plants. It is seen that leaves and petiole explants when inoculated on an MS medium supplemented with 1.0 mg/L TDZ showed direct organogenesis with shooting and rooting ; especiaA. annua developed multiple shoots when inoculated on an MS medium supplemented with 1.0 mg/L BAP. Subsequent subculturing of shoots on MS media incorporated with 2.0 mg/L IBA developed roots [A. annua using various concentrations and combinations of auxins and cytokinins, as well as their responses.The nodal segments from the inflorescence of ed roots . Table 13, initiated the growth of calluses, and further sub-culturing on the same medium developed multiple shoots [Indirect organogenesis refers to the formation of organs such as shoots and roots following the intrusion of the callusing stage. Callusing is a very important stage, which helps in the establishment of cell suspension cultures, usually used for metabolite production. Multiple shoots were developed from calluses induced on media supplemented with 5.4 \u00b5M NAA upon further sub-culturing on an MS medium supplemented with 13.32 \u00b5M BA and 1.08 \u00b5M of NAA . Hypocote shoots .A. annua, when inoculated on an MS medium supplemented with 0.1 mg/L BAP along with 0.05 mg/L NAA, helped in the induction of friable calluses. Further sub-culturing on an MS medium supplemented with 0.4 mg/L BAP along with 0.2 mg/L NAA exhibited multiple shoot regeneration [A. annua using various concentrations and combinations of auxins and cytokinins, as well as their responses.Leaf explants of neration . Leaf exneration . The MS neration . Table 2Employing somatic tissues or cells for the development of the whole plant is the chief characteristic of somatic embryogenesis. Studies suggest that somatic embryogenesis is one of the most successful techniques which helps us to better understand the development of plants and is regarded as one of the best approaches to clonal propagation and disease-free varieties of plants . VariousA. annua has not been explored completely, but a basic understanding has been established  for the production of bioactive secondary metabolites from medicinal plants is very much successful. There are many economically viable plant secondary metabolites produced from organ cultures. The metabolite of interest, Artemisinin, is also produced from organ cultures such as shoots and hairy roots. The following subsections provide details on the production of artemisinin from different organ cultures.P. falciparum. It is not only used in the treatment of malaria; the drug also finds importance as an anti-cancerous agent and is active against both chloroquine-sensitive and resistant strains of Plasmodium sp. Thus, the content of secondary metabolites must be elevated in the plant body by means of other compounds such as additional elicitors. Another bottleneck to this is the low level of production of artemisinin (0.01\u20131%) in plants, which can be improved by the production of the same using tissue culture approaches or whole plants of A. annua. Various branches of plant biotechnological advances have helped in the development of increased production of artemisinin in plants. One such report includes the usage of 4.4 \u00b5M BA and 0.35 \u00b5M IBA to yield the highest shoot production [When the growth of organs from an explant is administered artificially with the help of growth regulators, in synthetically prepared media, this is referred to as organ culture. It can be either a vegetative explant  or a reproductive  one. Specifically in the treatment of malaria, drug artemisinin and its semisynthetic derivatives have shown effects against species of oduction . A good Keeping the issues of somatic variation and seasonal bacterial invasions on the plants in mind, ultimately leading to low organic synthesis, in vitro plant tissue culture solves the complexity of low yield to a high extent . There hA. annua and the shoot cultures were established using diversified explants. Seeds of A. annua were used for establishing shoot cultures on an MS medium supplemented with 0.5% sucrose and 0.2 mg/L BAP along with 0.05 mg/L NAA. The same shoots, when cultured on a medium with 0.5 g/L casein hydrolysate, showed an increase in artemisinin content of 169% [3 [Scientific reports help us to understand that significant artemisinin is produced from shoot cultures of  of 169% . The MS  of 169% . Artemis 169% [3 .Artemisinin content expressed in shoot cultures seems to have a correlation with the root number. A study carried out by Ferreira and Janick (1996)  suggestsA. rhizogenes, a Gram-negative soil bacterium that possesses the capacity to integrate its \u2018Ri plasmid\u2019 (root inducing) into the host genome after co-integration of the foreign gene inside it. Of the many reports on plasmid insertion in A. annua using A. rhizogenes, one includes a report by Ahlawat (2012), which claims that the transformants are genetically stable, rapidly growing and produce a higher level of metabolite [Hairy root culture is an ideal tool to study secondary metabolism in plants as they exhibit a high growth rate, genetic stability and can grow in a hormone-free medium. To produce artemisinin under large-scale culture conditions, hairy root cultures were optimized but failed to give good yields. The process of hairy root formation can be initiated using tabolite . The emetabolite . There aA. rhizogenes LBA 9402 strain transformed hairy root cultures of A. annua selected on the basis of high metabolite content, the highest productivity rose up to 390 \u03bcg/L/day when measured in terms of volume. Along with that, the combination of plant growth regulators placed and the in vitro culture media should be chosen accurately, as that determines the level of metabolite content in the regenerated plant. Among the many plant growth regulators available, 0.5 mg/L TDZ and 0.1 mg/L IAA exhibited the highest occurrence of regeneration (75%) according to Beigmohammadi et al. (2021) [A. rhizogenes-mediated hairy root formation as that also plays a major role in the degree of transformation. When the process was attempted using four bacterial strains, A4, ATCC 15834, MSU 440, and MAFF-02-10266, the highest transformation frequency (80.7%) was observed using MSU 440, as confirmed by PCR, in addition to reflecting the highest artemisinin content (0.05%), as shown using HPLC [When the . (2021) . Besidesing HPLC .A. annua, once carried out using A. rhizogenes, can elevate the amount of artemisinin content in the plants as proven by an array of experiments. Hairy root-based transformation using the above bacterium has already been used for improving the quantitative content of target products. Instead of using antibiotic-resistant genes, herbicides and the natural process of insertion of rol B and C genes into the host genomes should be favored. Another experiment was performed on similar lines along with wild-type A. rhizogenes, which exhibited high transformative capacity [rolB gene as compared to rolC in the formation and accumulation of artemisinin and its derivatives in the transgenics on being transformed using A. rhizogenes [rolB gene (nine-fold), the second-highest increase was credited to the rol C gene (four-fold). The gene responsible for the expression of the trichome index, TAFR1, was also expressed highly in transgenic plants as compared to wild ones. Keeping the genes responsible for increased artemisinin content in mind, transformation can be executed using a natural genetic engineer, Agrobacterium, thereby uplifting the overall level of artemisinin production worldwide and making it available at cheaper rates for treatment of malaria along with other biopharmaceutical applications.An antimalarial drug, artemisinin, has served as a good biopharming agent too. Once genetically engineered, the metabolite can be produced at an industrial scale, thereby reducing the cost of production and increasing its availability to the public. The production and utility of genetically engineered organisms for the industrial benefits of humankind refer to biopharming technology. Thus, genetic manipulation of sources of artemisinin, capacity . Hairy rizogenes . While tCallus induction and the development of cell suspension culture from explants have received a lot of attention, especially for the production of bioactive molecules from medicinal plants. Calluses with parenchymatous cells, produced when tissues are cultured, formed by proliferation of the parent tissue are attributed to the callus culture, while the growth of cell aggregates in a liquid media is attributed to cell suspension culture. At the cellular level, it will be simple to investigate metabolic variations under stress or the action of any exogenous elicitor.P. falciparum [G.D. Brown (1993) reported that artemisinin is produced from the callus grown on an MS medium supplemented with 0.5 mg/L NAA along with 0.5 mg/L BAP, and it is seen that the biosynthetic capabilities for artemisinin production are similar to that of the mature plant . Traces lciparum . Calluselciparum .Agrobacterium. The transfer of a segment of its T-DNA to the host species is the most distinguishing feature of Agrobacterium tumefaciens that enables this soil bacterium to be of great importance in causing infection to plants. In order to increase the metabolite content in plants, root and shoot cultures of A. annua were transformed using A. tumefaciens strain T37 in a hormone-free medium. The artemisinin content found in them was 0.018 \u00b1 0.004% dry weight (DW) [3 was supplemented with the media as compared to that in the control and lower levels of artemisinin (0.01% DW) in the case of transformed root cultures. There were prominent results obtained when Kiani et al. in 2012 [Artemisia dubia using transformed plants via A. tumefaciens strain LBA4404 with pRT99 [A. tumefaciens as confirmed using HPLC. In another report, in which two strains of A. tumefaciens of nopaline wild-type were used, the artemisinin content of the transformed type (0.063 \u00b1 0.002 g/100 g DW) was higher than in the non-transformed (0.0179 \u00b1 0.002 g/100 g DW) one [A. tumefaciens that generated in vitro could regenerate spontaneously, thereby producing shooty teratoma of varied phenotype.Besides using plant growth regulators, plant genetic engineering helps in the production of high levels of artemisinin using recombinant DNA from the ght (DW) . In the  in 2012  tried toth pRT99 . Interes DW) one . In addiA. tumefaciens. It is necessary because it serves as an important precursor in the synthesis of higher metabolites such as dolichols, ubiquinones, carotenoids, sterols and others, along with being an important constituent of isoprenoid biosynthesis [A. annua using A. tumefaciens strain LB4404. Modern technologies, such as PCR and Southern and Northern blotting helped to confirm the transformation, subsequent integration of foreign genes into the plant genome and expression of the gene at a transcriptional level, respectively. Further analysis revealed the presence of a 2\u20133 times higher quantity of artemisinin (8\u201310 mg/g DW) in the transformed plants as compared to that of the non-transformed ones. The procedure can be applied not only in the case of the farnesyl diphosphate synthase gene, but also to introduce other desirable genes into the plant system using this natural genetic engineer. When analyzing the real importance of the metabolite artemisinin, it is highly essential to bring down the cost of processing the drug and make it available for commercial purposes, as the only reliable source for it is A. annua (0.01\u20130.8% DW). Furthermore, more alternatives of production need to be researched\u2014one of the most practical ones is development using A. tumefaciens from other naturally present sources. One such report includes that of Dilshad et al. (2015), in which Artemesia carvifolia Buch was used for genetic transformation. The metabolite content was determined by LC-MS after transformation of the wild-type shoots using A. tumefaciens GV3101 on inserting the rolB and rolC genes. Both genes are modulators of plant cell growth. While the former gene is related to making cells more tolerant to environmental stresses, thereby increasing the defense potential, the latter is easily connected to the growth of hairy roots. There was a remarkable 3\u20137-fold increase in the artemisinin content in transgenic plants with the rolB gene and 2.3\u20136-fold for the rolC gene as compared to the control ones. For the genes involved in the biosynthesis of artemisinin, such as cytochrome P450 and aldehyde dehydrogenase 1, differential expressions of genes were observed using real-time qPCR, which revealed a higher transcription level in the transformed ones [The expression of specific desirable genes, such as farnesyl diphosphate synthase and others, can also be initiated using transformed plants such as ynthesis . Using lynthesis . The promed ones .rolB and rolC genes, which is connected to the higher level of artemisinin in the same. This also demonstrates that plant secondary metabolism is affected by rol genes. Thus, many types of desirable genes can be introduced into the plant species using A. tumefaciens in order to elevate the artemisinin content and make the antimalarial drug easily available for commercialization at cheaper rates by increasing the number of sources of the metabolite.In association, there was an enhancement in the trichome index of those transformed with the Plant cells are considered to be biochemical factories for producing high-value secondary metabolites. There are different strategies employed to improve the yield of bioactive compounds for commercial purposes. Elicitation is one of such successful strategies for the production of secondary metabolites. The addition of biotic and abiotic components into the culture medium, with organ cultures and cell suspensions, would aid in the regulation of the metabolism of metabolite production. For artemisinin production, a conventional breeding technique was employed that resulted in new superior breeds, yielding 2% artemisinin DW. A major limitation of this method is the formation of heterozygotes that can show a huge variation in their ability to produce artemisinin. Elicitation of plant cell cultures with physical, chemical and biological agents can drastically improve the yield of metabolites from plants. Furthermore, for its best performance, one has to optimize various influential parameters such as elicitor dose, contact time, growth regulator, age and type of the explant selected and nutritional requirements of the cell .Colletotrichum sp. B501 cell wall-derived oligosaccharide was tested for its elicitation effect on A. annua hairy root cultures for better yield of artemisinin. Hairy root culture in the late growth phase was exposed to elicitor at a concentration of 20 mg/L for four days, which enhanced the yield by 68.29% in comparison to the control. When examined, the peroxidase activity increased in the culture supplemented with elicitor-indicating cells, which were under stress conditions. Furthermore, cellular morphological studies revealed nuclear fragmentation and cell shrinkage leading to programmed cell death. As a part of the plant\u2019s defense strategy, the hairy root culture reportedly produced a more valuable secondary metabolite\u2014artemisinin [Fusarium oxysporum, Pythium sps, and Botrytis sps and is reported to be a non-race specific elicitor for plant secondary metabolites. Studies emphasize the significant role of cerebroside as an effective elicitor in the production of artemisinin using hairy root culture. Studies have reported cerebroside to be a novel and potential lipid-based elicitor that can result in a higher accumulation of artemisinin produced by both MAV and MEP pathways. Exposure of cerebroside induced oxidative bursts in the hairy root culture, liberating nitric oxide (NO). This is one of the significant signaling molecules for the biosynthesis of artemisinin. NO inhibitors and NO scavengers when supplemented in media were able to deteriorate artemisinin production [Endophytic fungi emisinin . Cerebrooduction .A. annua root that was elicited with a fungal-derived oligosaccharide. The oligosaccharide isolated from Fusarium oxysporum mycelial biomass was supplemented into the culture media which resulted in the generation of NO and an enhanced accumulation of artemisinin by 20-day-old hairy root culture, after four days of exposure to elicitor in order to confirm the participation of NO as a signaling molecule in the biosynthesis of artemisinin. The culture was treated with sodium nitroprusside (SNP) the NO donor and OE (oligosaccharide elicitor), which has resulted in a maximum yield of the metabolite recorded as 28.5 mg/L\u2014a two-fold increase compared to the culture treated with OE alone. This suggests that generations of endogenous NO in the biosynthesis of artemisinin can trigger with the fungal-derived oligosaccharide elicitor [Zhang et al. (2008)  studied elicitor .Colletotrichum sp. is an endophytic fungus living in mutual association with A. annua. Mycelial extract of this fungus was proved to be a potential elicitor of the hairy root culture of A. annua. The 23-day-old late-phase culture was exposed to 0.4 mg total sugar ml\u22121 of the elicitor for four days, showing a 44% enhancement of artemisinin accumulation. There was an increase in metabolite production with an increase in dose concentration of the elicitor [P. indica, as an endophytic fungus, can colonize on the root and penetrates the root system with its hyphae, further proliferating in the root cortex. Fungi can induce the root cells to produce a precursor for artemisinin production such as artemisinic acid and dihydroartemisinin in roots. These are translocated to shoot where they are transformed into artemisinin [A. annua was induced to produce regenerated plantlets on MS media with 5.0 mg/L 6-BA and 1.0 mg/L NAA and incubated at 25 \u00b1 1 \u00b0C under 16 h photoperiod. Both calluses and callus-regenerated plantlets were exposed to endophytic fungi P. oxalicum B4 to elicit the cultures for artemisinin production. Calluses showed a negative response with browning of tissue, necrosis and no artemisinin, while rooted plantlets after 30 days of exposure to endophytic fungi resulted in a better yield of artemisinin, which was estimated to be 1.32 mg/g DW, about 43.5% more than the control [A. annua shoots derived from nodal explants were cultured on different media such as MS basal media, MS media + 5 \u03bcM IBA, MS + P. indica and MS + 5 \u03bcM IBA + P. indica. Root regeneration was less in media without P. indica. Artemisinin content was significantly high in shoots established on MS media with 5 \u03bcM IBA + P. indica [elicitor . P. indiemisinin . An embr control . A. annu. indica .2 NPs were used as an elicitor for hairy root culture for a better yield of artemisinin. NPs sized 101.8 \u00b1 8.9 nm were supplemented into culture media at a concentration of 900 mg/L for three days. This has induced oxidative stress in a hairy root culture due to the gradual release of Ag+ resulting in malonyldialdehyde (MDA), an indicator of lipid oxidation, along with a high generation of hydrogen peroxide and catalase activity. Artemisinin production was estimated to be 13.3 mg/L, which was 3.9-fold better in yield compared to the control [A. annua were subjected to chitosan nanoparticles of varying concentrations (5\u201315 mg/L) that were examined for their effect on artemisinin production and expression levels of genes associated with the biosynthesis of artemisinin after 8, 24, 48 and 72 h of treatment. Studies confirmed that 5.0 mg/L was more effective in elicitation with improved yields of artemisinin and upregulated expression of ADS, CYP, CPR, DBR2 and ALDH genes [A. annua on MS media with 0.5 mg/L NAA, 0.5 mg/L BAP, and 30 g/L sucrose was elicited with cobalt nanoparticles for better artemisinin production. A total of 5.0 mg/L cobalt nanoparticles supplemented into media enhanced artemisinin production after 24 h of elicitation, while its concentration decreased with time. To understand the effect of nanoparticle elicitation on the expression of two key genes involved in biosynthesis of artemisinin, SQS and DBR2, it was analyzed using qRT-PCR. These genes had a negative influence on artemisinin production. Expressions of these genes were low when the callus was elicited with cobalt nanoparticles. On the other hand, HPLC quantification reported an increase in artemisinin yields. The increase in the artemisinin content can be attributed to the activation of other genes involved in the biosynthetic pathway. Furthermore, to have a very clear understanding of the elicited product, it is essential to check the expression of various genes involved in the biosynthesis of the product rather than just studying two or three genes of the biosynthetic pathway [Nano elicitors are gaining more importance in secondary metabolite production using plant cell culture as they can alter physiological activities and biochemical processes inducing the plant cells to make secondary metabolites. Ag-SiO control . Cell suDH genes . A callu pathway .A. annua, sp. was subjected to elicitors, such as ultraviolet B (UV-B) and dimethyl sulfoxide (DMSO), to improve the yield, but elicitation had no effect on the yield of artemisinin. PCR studies revealed the absence of ADS, DBR2 and ALDH1, whose products have a significant role in the biosynthesis of artemisinin [A. annua shoots with roots. DMSO elicitation was performed on unrooted shoots which did not show any improvement in artemisinin production compared to the rooted shoot that was stimulated by the elicitor. This emphasizes the significant role of the root system in artemisinin production in shoots. Furthermore, DMSO elicitation resulted in the liberation of ROS, which was studied with DAB staining. The rooted plantlets showed an increased DAB stain, indicating ROS is used in shoots as a defense strategy, while unrooted plantlets failed to show any ROS in their leaves. The study has shown that the expression of two gene ADS (amorphadiene synthase) and CRP  involved in the biosynthesis was monitored using RT-PCR. The ADS transcript did not show any response to DMSO elicitation, while CYP transcript was inversely proportional to the artemisinin produced [A low artemisinin-producing cell suspension culture of emisinin . DMSO waproduced .A. annua for artemisinin production. The effect on DIMEB and methyl jasmonate was studied separately towards metabolite production. Studies confirmed the combined effect as 50 mM DIMEB and 100 \u03bcM methyl jasmonate were optimal with the highest artemisinin of 27 \u03bcmol/g dry weight which was 300-fold higher than untreated suspension culture [Native \u03b2-cyclodextrins were chemically modified to heptakis -\u03b2-cyclodextrin (DIMEB), which was used as a chemical elicitor in cell suspension culture of  culture . Oligoga culture . Oligoga culture .A. annua. Gamma radiation of different doses (5\u201335 Gy) was used to study its effect on callus growth, cell survival and artemisinin production. The growth and regeneration of calluses are reduced with increasing doses of gamma radiation. To examine its impact on artemisinin production in five successive in vitro subcultures, artemisinin was quantified using HPLC. A low dose of gamma radiation was found to be effective as an elicitor for artemisinin production when compared to a non-irradiated callus culture. This confirms that a low dose of gamma radiation resulted in mutants with enhanced artemisinin production [A. annua variety (136 P) was subjected to elicitation with UV-B radiation for different time intervals and varying concentrations of DMSO to stimulate the suspension culture and soil-grown 136 P. There was no elicitation or stimulation in artemisinin production in the case of suspension culture while there was enhanced yield of artemisinin in soil-grown plants [Gamma radiation is an efficient abiotic elicitor that has enhanced the yield of artemisinin in the callus culture of oduction . A low-yn plants .A. annua was set to study the effect of sodium acetate (SA), mevalonic acid lactone (MAL), casein acid hydrolysate (CAH) and cholesterol (CH) as precursors in artemisinin production. A positive response with a better yield of artemisinin was recorded with sodium acetate (25 mg/L), mevalonic acid lactone (50 mg/L) and casein acid hydrolysate (500 mg/L). Feeding the media with sodium acetate resulted in increased acetylco-A in the cell which can boost cellular activities for secondary metabolite production. When the culture was supplemented with mevalonic acid lactone (MAL), it served as the precursor of the lactone ring that enhanced the production of artemisinin. Supplementing casein acid hydrolysate into media will provide aromatic amino acids that can improve the yield of artemisinin. When abiotic elicitor methyl jasmonate was supplemented along with a mevalonic acid lactone (MAL) precursor, it proved to be the best combination as this has resulted in a synergetic effect, with a maximum yield of 110.20 mg/L, which was 5.93 times more than the control [Cell suspension culture of  control .3 had a positive effect on the shoot culture of A. annua for artemisinin when supplemented at a concentration of 10 mg/L in MS media. A significant increase in artemisinin was observed at the blooming stage and its effect was only for one cycle, but its effect on artemisinin production ceased in later cycles. In another approach, sterol biosynthesis inhibitors  were used so that the C15 intermediates are channeled towards artemisinin production. Among the examined inhibitors, naftifine showed an excellent result with its increase in concentration of the product obtained, while terbinafine was toxic to culture and minconazole had a negative impact [GAe impact .A. annua. Cells when treated with varying concentrations of sorbitol resulted in osmotic stress in plant cells, which was monitored by estimation of MDA and H2O2 that are considered to be the indicators of oxidative stress. When the culture was pre-treated with coronatine (Cor), it greatly reduced this oxidative stress, as it can stabilize the cell membrane, maintain the integrity of plant cells and also stimulate antioxidant activities to overcome stress. Cell cultures showed a better yield of artemisinin when exposed to 30 g/L of sorbitol. Beyond this, the concentration had a negative impact on artemisinin production due to the ROS-mediated cell disruption. Pre-treatment of cell cultures with Cor also resulted in increasing the yield of artemisinin, but the combined effect drastically increased the yield eight-fold [This is a study of the synergetic effect of two elicitors on artemisinin production using the cell suspension culture of ght-fold .A. annua on MS media containing 30 g/L sucrose and 10 g/L agar were maintained at 25 \u00b1 2 \u00b0C for 16 h under cool-white light (35 mmol m\u22122s\u22121). These shoots were transferred to liquid MS media and subjected to elicitation with silver and copper nanoparticles. Studies confirmed that when nanoparticles were used at concentrations above 10 \u03bcM, they inhibited the shoot growth and reduced chlorophyll content. These heavy metal NPs induced oxidative stress liberating more H2O2, which augmented the production of secondary metabolites such as artemisinin as a defense strategy in shoots [A. anuua was optimized for increased artemisinin production with gibberellic acid which had a profound effect on its growth. Artemisinin production increases as gibberellic acid induces branching of roots, induction of flowering and accumulation of artemisinin will be always high before flowering [Shoots generated from the sterilized seeds of n shoots . The hailowering .Alternaria alternate, Curvularia limata, Fusarium solani, and Piriformospora indica), farnesyl pyrophosphate and miconazole, the results obtained indicated the synergistic effect of abiotic (MeJA at 100 \u00b5M) and biotic (CH of P. indica at 3% v/v), elicitors improving the production of artemisinin [A. annua hairy root culture was subjected to chitosan, methyl jasmonate and yeast extract as the elicitors to stimulate the culture for a better yield of commercially important artemisinin production. Studies confirmed that all these elicitors when supplemented in MS media at concentrations of 200 \u00b5M (methyl jasmonate), 2.0 mg/L (Yeast extract) and 150 mg/L (chitosan) were found to be the optimal dose of elicitors for the highest yield of bioactive substances, recorded as 1.52 \u00b1 0.32 and 0.95 \u00b1 0.01 mg/mg dry wt, and 1.84 \u00b1 0.02 mg/mg dry wt., respectively [When the culture was elicited with methyl jasmonate (MeJA) and fungal elicitors , casein acid hydrolysate (50 \u00b5g/L) and sodium acetate (500 \u00b5g/L), while in the control, the yield was only 0.4 mg/g [A. dubia was transformed with A. rhizogenes LBA9402 that was elicited with gibberellic acid and salicylic acid for artemisinin production. Gibberellic acid exhibited a better elicitation potential at a low concentration of 0.01 mg/L with 80 \u00b1 3 \u00b5g/g of DW, which was 93% more than the control. Salicylic acid could also stimulate the culture at a concentration of 13.8 mg/L yielding 79 \u00b1 3 \u00b5g/g of artemisinin, which was 38% more than the control [In order to know the effect and to optimize the concentration of elicitors on biomass and artemisinin production using a hairy root culture of 0.4 mg/g . The hai control .A. absinthium was cultured on MS media using the raft culture method to investigate the influence of growth factors and amino acids. This culture, when maintained with cysteine amino acid at a concentration of 12.5 mg/L, resulted in 2.8 \u00b5g/g of artemisinin, while when media were supplemented with growth factors such as BAP (2 mg/L) and NAA (2 mg/L), it improved the yield of artemisinin to 3.05 \u00b5g/g and 1.95 \u00b5g/g, respectively. Other combinations of amino acids and growth factors had the least effect on the culture regarding artemisinin production [A callus that was initiated from the leaf explant of oduction . Table 3Bioreactors are considered to be the heart of industrial biotechnology aiming at the mass production of commercial and pharmaceutical products for humankind. Construction and optimization of the various factors for optimal functioning of the bioreactor are challenging fields of research. The main factors considered in designing a plant bioreactor are multiplication rate, oxygen, and nutrient transfer, reduction in power supply, labor and space. These are generally automated machines that facilitate the controlled operation for a better yield of biomass and metabolites. However, there are limitations that can reduce the performance of bioreactors. The needs to be addressed are the accumulation of inhibitors, foaming, shear stress, contamination and hyperhydricity. By eliminating these limitations, bioreactors can be the ideal tool for mass production of metabolites in a short period of time at a large scale to satisfy the global demand .A. annua to optimize the yield of artemisinin for commercial applications. In order to examine the efficiency of the modified airlift bioreactor, a multi-plate radius-flow bioreactor and an ultrasonic nutrient mist bioreactor shoot culture were initiated and maintained in these bioreactors. The modified airlift bioreactor resulted in the lowest yield of artemisinin as shoots were hyperhydrated leading to vitrification. The mist bioreactor provided excellent support compared to the multiple plate radius bioreactor. Nutrients were provided in the gas phase as a mist, which ensures a good nutrient supply to cultures that improved the yield of artemisinin by 3.3- and 1.4-fold, compared to the airlift and multiple plate radius reactor, respectively. The amount of artemisinin obtained was recorded as 48.2 mg/L after 25 days in the mist bioreactor [A. annua in MNB to ensure homogenous growth of the shoots in the bioreactor. The mist cycle was optimized to 3/90, in which the mist was on for 3 min and off for 90 min, which also resulted in the highest biomass and artemisinin yield, which were 13.4 and 46.9 mg/L [The work by Patra et al. (2016)  focused oreactor . The MNB6.9 mg/L .A. annua in MNB. Three key factors, namely mist cycle, carrier gas and nutrient composition, that can influence the kinetics of the root and the accumulation of artemisinin, were considered in this experiment. Setting the mist cycle can directly influence the root growth as well as the artemisinin production, as they can distribute the nutrients uniformly in the bioreactor and also mediate oxygen transfer. A 1 min on/15 min off mist cycle resulted in a good branching of the root with a fresh weight of 4.6 \u00b1 1.0 mg, while 5 min on/15 min off caused browning of the root and necrosis with a fresh weight of 3.4 \u00b1 1.4 mg. A 1 min on/60 min off mist cycle resulted in thinner roots with the least branching of roots with a fresh weight of 3.9 \u00b1 0.6 mg. Furthermore, when 1% CO2 was used as the carrier gas, it had no impact on root growth but greatly reduced necrosis. Conditioned B5 media were found to be more effective in maintaining the roots in the log phase for a long time, and branching was also extensive [A. annua for the highest yield of artemisinin. Sucrose (37 g/L) was fed at a constant rate of 0.1 L/day for 10\u201315 days, which resulted in improved artemisinin accumulation of 0.77 mg/g, while another batch culture, which was maintained in a pseudo-steady state fed with (20.8 g/L) for 10\u201315 days, resulted in the highest artemisinin accumulation recorded as 0.99 mg/g [Wyslouzil et al. (2001)  standardxtensive . Patra axtensive  used mat.99 mg/g .A. annua to examine and optimize the factors associated with the operation of a stirred tank bioreactor for the high accumulation of artemisinin in the culture. When the culture was set beyond 70 rpm, it resulted in sheer stress. Similarly, other parameters, such as temperature (25 \u00b0C), size of inoculum (1 g/L DW), age of inoculum (8 d) and medium to vessel volume ratio (0.18), were optimized for the best performance of the stirred tank bioreactor towards the mass production of artemisinin. A high biomass accumulation of 6.3 g/L dry weight (37.50 g fresh weight) and 0.32 mg/g was obtained after an incubation period of 25 days [A. annua. The mist cycle was set in such a way that every 90 min interval, three mins of misting was applied for effective nutrient supply and oxygen transfer. After 25 days of incubation, with an airflow rate of 0.5 L/min, artemisinin yield was estimated as 46.9 mg DW/L of the culture media [Patra and Srivastava (2014)  set a ba 25 days . A batchre media . Kim et re media . The haire media . Table 4E. coli. Studies carried out by Martin et al. (2003) showed that the yield of precursors such as amorpha-diene was increased by engineering the amorpha-4,11-diene synthase gene from Saccharomyces cerevisiae [Conventional and in vitro modes of artemisinin production in plant systems alone can not meet the demand for artemisinin, as biosynthetic studies revealed that their production is restricted to specific tissues such as glandular trichomes. From recent studies, it is known that modern biotechnological applications such as metabolic engineering have helped in deriving the required metabolites from plants and microbes. It can be seen that terpenoids were produced by engineering mevalonate pathways in revisiae . Similarrevisiae ,91.E. coli and they could reach 50% identity. Later, upon introduction to the tobacco plant system, they found that it resulted in significant expression. This transgenic tobacco model system successfully helped in the production of amorpha-4,11-diene (0.2\u20131.7 ng/g FW) [Nicotiana benthamiana [The expression of amorpha-4,11-diene is particularly significant in metabolic engineering for the manufacture of artemisinin and it is produced from the precursor farnesyl diphosphate. Wallaart et al. (2001)  successfng/g FW) . Amorphang/g FW) . Employing/g FW) . Agroinfthamiana .Artemisia species will help to reach the expectation in terms of the production of artemisinin. When compared to conventional methods of production, bioreactor-scale production of artemisinin might be regarded as a substantial alternative. The characterization of other species of Artemisia can be explored for the quantification of artemisinin, and simultaneous tissue culture studies can be explored for artemisinin production. Biotechnological applications, such as metabolic engineering in other Artemisia species and heterogeneous host technology, can yield better results, allowing for more exploration for the sustainable production of artemisinin.Extensive research on artemisinin indicates that it is an effective anti-malarial drug with a variety of other pharmacological properties. This review reveals that the traditional method of producing artemisinin in vitro and from glandular trichomes is insufficient, and that specific biotechnological techniques are essential. Hairy root technology along with elicitation of cell and organ cultures of"}
+{"text": "Occlusal splints with sensors help in the bruxism diagnosis and monitoring, by recording the patient\u2019s bite force. The aim of this study was to evaluate the accuracy of a pressure sensor when it is covered with different thicknesses of a 3D printing resin .  In this preliminary study, the evaluated sensor  was firstly calibrated without any type of cover material, and later tested with 3D printing resin with different thicknesses . The load tests were performed by a force tester .  When the pressure sensor was covered with resin of 1mm and 1.6 mm thick specimens, a higher difference was found between the applied load and the corresponding sensor reading.  It was concluded that it is possible to use this type of pressure sensor and that it showed better accuracy with the 1.15 mm and 1.4 mm 3D printing resin covering. Polysomnography is the gold standard for diagnosing bruxism, but it is not widely used because it is an expensive procedure and must be performed in a hospital environment.3 Sleep bruxism is classified as an activity of the masticatory muscles, rhythmic or non-rhythmic, with teeth grinding or clenching during sleep.4 Thus, occlusal splints are used to prevent tooth wear and help in muscle relaxation.5 Some studies report the use of occlusal splints with the inclusion of pressure sensors in order to quantify the bite force and consequently help diagnose bruxism.6 However, despite the diversity of devices described, one of the limitations reported is related to its volume, resulting from the inclusion of sensors and electronic devices necessary for its operation, which makes the splint uncomfortable for the patient.7 Thus, it is important to understand which are the ideal conditions for the inclusion of the sensor, namely the maximum thickness of the material that can cover the sensor and, at the same time, allow a correct reading. To answer this question, the aim of this study was to evaluate the load sensitivity of a pressure sensor when it is embedded in a splint and covered with different thicknesses of a 3D printing resin. Currently, there is no consensus on the most effective treatment for bruxism, with the suggestion of symptom relief through intraoral devices, pharmacotherapy, behavioral strategies and physical therapy. First the 3D printing resin specimens  were printed by the LCD technique on the Phrozen Sonic Mighty 4K 3D Printer . One specimen (10 mm\u2005\u00d7\u200510 mm\u2005\u00d7\u20051 mm) was printed  with a s The load tests were performed on a force tester . First, the pressure sensor  was calibrated by applying loads ) directly over the sensor included in the \u201cbase specimen\u201d. It was confirmed if the values were the same in the MultiTest and in the sensor software. After this calibration, the tests were performed with the sensor interposed between the \u201cbase specimen\u201d and the different thickness 3D printing resin specimens. A preload of 1N was applied in all tests to standardize the initial conditions for all specimens. Thus, displacements of 60 millimetres per minute (mm/min) were applied, with cycles of 15 repetitions, which allowed reaching loads of about 20N , to eval With this test, the applied load and corresponding sensor reading values were obtained for each of the test specimens. The applied load was registered by the sensor differently according to the thickness of the specimen. The percentage of difference between these two parameters was calculated, and it was found that the 1.15 mm and 1.4 mm specimens have a lower percentage of difference .8 However, there are no reports in the literature on the incorporation of sensors in splints made by 3D printing. There are some studies describing the inclusion of pressure sensors in a splint.10 In this work, the pressure sensor covered with 1.15 mm or 1.4 mm specimens was found to have the best response. For a clinical point of view this could be important, not only for sensor accuracy, but also because these thicknesses may be well tolerated, as they do not lead to an occlusal vertical dimension increase, which could be considered harmful for the majority of the patients.11 Some authors, who have developed studies with the inclusion of pressure sensors in occlusal splints, stated that sensors should be located approximately 1mm below the occlusal surface, and therefore the sensor is covered by 1 mm of thickness of the splint material.12 used a pressure sensor like the one presented in this article , but covered with a resilient material, ethylene vinyl acetate. The authors tested the pressure sensor between specimens with 2 mm thick and 30 mm in diameter, applying load at a rate of 0.25 mm/min. The authors concluded that, in this configuration, it was only possible to reliably measure forces up to 70N, forces much higher than those used in this study, so not only the thickness but also nature and modulus of elasticity of the material could affect the performance of this kind of pressure sensor.13 Kinjo et al13 performed an experimental test to calibrate the pressure sensor they developed for placement in an occlusal splint. They initially tested the sensor between two metal plates and applied 0.5 mm of compression at a speed of 1.0 mm/min, 5 times, with a Zwick instrument to test the sensor response. Subsequently, they used polymethylmethacrylate in different thicknesses (0.8 to 1.4 mm) to cover the sensor and found that the acrylic cover affects the sensitivity of the pressure sensor, because the applied load induces a bending in the acrylic, which may result in incorrect detection of the applied load. The thicker the layer covering the sensor, the greater the force required to achieve the same load on the sensor. Kim et al14 incorporated pressure sensors in an occlusal splint and found as a limitation of their work the difficulty in controlling the material thickness covering the sensor and how it interferes with sensor accuracy. The conclusions of these authors corroborate the results of this work that presents differences between the sensor reading and the load applied with different thicknesses of covering material. Aoki et al It can be concluded from this study, under these investigation conditions, that this type of sensor covered by a 3D printing resin is sensible to different applied loads. It was also found that the thickness of the resin on the sensor influences its accuracy, with resin thicknesses of 1.15mm and 1.4 mm showing better results. Rita Rynkevic for her help to development the experimental procedures. Not applicable. Not applicable. The authors received no financial support, all costs were supported by the authors."}
+{"text": "In recent years, the concept of physical literacy (PL) has gained interest worldwide. Yet, only a few interventions targeting PL exist on a global scale. A promising theory-based and nationally tested intervention, Youth-Physical Activity Towards Health (Y-PATH), has proven to be effective in improving children's and adolescents\u2019 physical activity levels and motor skills in Ireland. Using this protocol, we aim to context-adapt the Irish Y-PATH into an intervention that works through the schools in Denmark and targets PL among pupils in 4th and 5th grades.We apply a stepwise approach to intervention adaptation, inspired by the Medical Research Council\u2019s guidance for developing complex interventions as well as the \u2018consensus informed guidance for adapting interventions to achieve a good fit between the intervention and context\u2019 (ADAPT) process model and its principles and actions. First, we combine evidence synthesis with stakeholders' and researchers\u2019 engagement to identify relevant and tentative adaptations and to understand barriers and enablers of the promotion of physical literacy in school-based interventions. Next, we adjust and improve our intervention adaptation ideas by collecting detailed data through interviews with purposively sampled stakeholders and pre-pilot tests of selected prototypes of materials in a \u2018real-world\u2019 setting. Finally, we clarify the intervention adaptations \u2013 its components, materials, and content \u2013 in a discussion with purposively sampled stakeholders, and finally, we test the study design.A Danish version of the Y-PATH intervention, ready for feasibility testing within a Danish context, and a TIDieR intervention description checklist suitable for testing and further refinement in a feasibility study. The process will further increase our knowledge and understanding of the Danish school context as well as the teacher and pupils\u2019 needs for an intervention promoting PL. In this presentation, we will present the preliminary results from the adaptation process, including the intervention components, materials, and content.The intervention adaptation forms part of an overarching feasibility study that is financed by the Foundation TrygFonden (Grant ID #153181)."}
+{"text": "Xenopus tropicalis tadpoles do not exhibit distinct external phenotypes when exposed to new predation threats. Accordingly, we examined the brains of X. tropicalis tadpoles to understand their response to novel predation pressure in the absence of apparent external morphological adaptations. Principal component analysis of fifteen external morphological parameters showed that each external morphological site varied nonlinearly with predator exposure time. However, the overall percentage change in principal components during the predation threat (24\u00a0h) was shown to significantly (p < 0.05) alter tadpole morphology compared with that during control or 5-day out treatment (5\u00a0days of exposure to predation followed by 5\u00a0days of no exposure). However, the adaptive strategy of the altered sites was unknown because the changes were not specific to a particular site but were rather nonlinear in various sites. Therefore, RNA-seq, metabolomic, Ingenuity Pathway Analysis, and Kyoto Encyclopedia of Genes and Genomes analyses were performed on the entire brain to investigate physiological changes in the brain, finding that glycolysis-driven ATP production was enhanced and \u00df-oxidation and the tricarboxylic acid cycle were downregulated in response to predation stress. Superoxide dismutase was upregulated after 6\u00a0h of exposure to new predation pressure, and radical production was reduced. Hemoglobin was also increased in the brain, forming oxyhemoglobin, which is known to scavenge hydroxyl radicals in the midbrain and hindbrain. These suggest that X. tropicalis tadpoles do not develop external morphological adaptations that are positively correlated with predation pressure, such as tail elongation, in response to novel predators; however, they improve their brain functionality when exposed to a novel predator.Organisms adapt to changes in their environment to survive. The emergence of predators is an example of environmental change, and organisms try to change their external phenotypic systems and physiological mechanisms to adapt to such changes. In general, prey exhibit different phenotypes to predators owing to historically long-term prey-predator interactions. However, when presented with a novel predator, the extent and rate of phenotypic plasticity in prey are largely unknown. Therefore, exploring the physiological adaptive response of organisms to novel predators is a crucial topic in physiology and evolutionary biology. Counterintuitively,  Rana pirica tadpoles are developed in response to native predators, such as the larval Hynobius retardatus , to hinder consumption   . Althougng speed .Predation stress is also known to elevate corticosterone concentrations in tadpoles, activating the neuroendocrine stress axis . CorticoX. laevis tadpoles exposed to novel predation stress in a previous study and investigated changes in signal transduction pathways using ingenuity pathway analysis (IPA).Therefore, we performed RNA sequencing (RNA-seq) of the whole brain of X. laevis tadpoles did not exhibit noticeable phenotypic changes, such as the bulgy formation observed in R. pirica tadpoles; however, certain signaling pathways in the brain were suppressed following a 6\u00a0h exposure to predation threat, with many pathways being re-activated after 24\u00a0h and then re-suppressed after 10\u00a0days. In the experiment, we found that the axonal extension from the nostrils to the diencephalon noticeably increased after 24\u00a0h of predation exposure, and there were changes in neural networks in the brain in response to novel predation within 24\u00a0h (X. laevis tadpoles exposed to predation stress (unpublished data).The results showed that hin 24\u00a0h . FurtherX. tropicalis is generally known to have a much smaller habitat than X. laevis, as its range is restricted to the equatorial area. In addition, salamanders reportedly do not exist on the African continent  to an unfamiliar predator . is a suitable system for studying phenotypic plasticity in predator\u2013prey interactions using novel predators.ontinent  or are oX. tropicalis tadpoles were exposed to H. retardatus larvae and changes in external morphology at 15 sites, including the head and tail, were analyzed to determine whether the tadpoles showed tail elongation in response to predation stress, as in the case of X. laevis. Furthermore, to determine whether the increased expression of hemoglobin genes observed in X. laevis tadpoles also occurs in the brain of X. tropicalis in response to a novel predator, we performed RNA sequencing (RNA-seq) using whole brain of X. tropicalis, and then identified differentially expressed genes (DEGs), which were subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG: https://www.kegg.jp/kegg/kegg1.html) pathway enrichment analysis . In Japan, no special ethics document is required for experiments on amphibians (https://www.mext.go.jp/b_menu/hakusho/nc/06060904.htm), and Nihon University approved this and our experiments with amphibians. The American Veterinary Medical Association (AVMA) Guidelines for Euthanasia of Animals (2020) and the guidelines of Science Council of Japan (https://www.scj.go.jp/ja/info/kohyo/pdf/kohyo-20-k16-2.pdf) were used for veterinary best practices on the anesthesia and euthanasia of animals. Since live Xenopus was used in this study, we conducted the experiments in adherence to ARRIVE guidelines (https://arriveguidelines.org).The authors declare that the research presented in this manuscript complied with the Animal Welfare Guidelines for Journal Publication. All animal housing and experimental protocols were in compliance with the Japanese Government Animal Protection and Management Law (No. 105) and Japanese Government Notification on Feeding and Safekeeping of Animals (No. 6). All experimental protocols were approved by the Japanese University Regulations for the Conduct of Animal Experiments, and the experiments were conducted in accordance with Japanese University protocols  were randomly selected from the holding tank and were placed in 2\u00a0L glass aquaria (25 \u00d7 10 \u00d7 8\u00a0cm) containing 1\u00a0L tap water treated with activated charcoal  for 24\u00a0h. Tadpole developmental stages were determined based on the X. laevis stage series . Tadpoles were fed Sera Micron  and were housed at 25\u00b0C throughout the experiment. Detailed information on the experimental animals and design is provided in the The H. retardatus) egg masses were sampled from natural ponds in Asahikawa and Nayoro, Hokkaido, Japan , where they were mixed. X. tropicalis specimens were then randomly sampled from the mixed samples, placed in a transparent plastic case for measurement, and photographed with a camera . The images were used for measurement of morphological changes .260/A280 . 18S to 28S ribosomal RNAs were visually observed using gel electrophoresis.Total RNA was extracted from the brain for RNA-seq. To this end, three tadpoles from each replicate aquarium were pooled as a single sample  Group . Details are provided in the https://bioconductor.org/packages/release/bioc/html/edgeR.html)  (eR.html) . EdgeR fTadpoles were anesthetized in an ice water bath and decapitated. Then, they were immediately dissected on ice. The brains were excised under a microscope, placed in a tube, and instantly frozen with liquid nitrogen. Brains from two tadpoles were combined to form a single sample because the brain of one tadpole is not enough for metabolite analysis. Three samples were treated as one experimental group. Details on the CE-MS procedure were previously published  and are X. tropicalis tadpoles were sampled and soaked in ice cold 1% Ethyl 3-aminobenzoate methanesulfonate for anesthesia, followed by removal of excess water using paper towels. Next, they were weighed, immediately frozen in liquid nitrogen, and maintained at \u221280\u00b0C until analysis. Tadpoles were homogenized using a Polytron homogenizer  at maximum speed on ice. The mixture was then centrifuged at \u00d712,000\u00a0g for 15\u00a0min at 4\u00b0C. Then, 20\u00a0\u03bcL supernatant was used for free radical analysis using the d-ROMs test  was used to determine the gene expression profiles of X. tropicalis  mounted on a Leica  stereomicroscope. Hemoglobin was visualized by analyzing the generated hyperspectral images with the normalized difference vegetation index  and then rehydrated with ethanol and phosphate-buffered saline with Tween 20 (PBSTW) (1X PBS +0.1% Tween 20). The samples were washed with PBSTW(x) (PBSTW+5% dimethyl sulfoxide) and blocked with PBSTW(x) + 10% normal goat serum (NGS). They were then incubated overnight with primary hemoglobin subunit epsilon 1 (HBE1) anti-rabbit antibody  diluted (1:500) in PBSTW(x) and 1% NGS at 4\u00b0C. After washing the primary antibody with PBSTW(x) and 1% NGS three times for 5\u00a0min, the samples were incubated with the Alexa Fluor 546 anti-rabbit secondary antibody diluted  in PBSTW(x) and 1% NGS overnight at 4\u00b0C. After washing the secondary antibody with PBSTW(x) and 0.1% NGS, brains were removed from the tadpoles and embedded in DPX mountant for histological analysis (Sigma-Aldrich) and were observed using confocal microscopy (Leica TCS SP8).Tadpoles anesthetized with ice cold 1% Ethyl 3-aminobenzoate methanesulfonate were fixed with 4% paraformaldehyde solution overnight at 4\u00b0C. The samples were then prepared for immunostaining using sequential dehydration with ethanol and were stored in 100% ethanol at \u221280\u00b0C until use. For immunostaining of the brain, tadpoles were depigmented with hydrogen peroxide solution   . Data wev.2.1.0) . To analv.2.1.0) . Reads mv.2.1.0) , and theMean values of the first and second components for the control, Ex 24, Ex 48\u00a0h, Ex 10\u00a0days, and Ex 5\u00a0days-Out groups are shown in pygm). Overall, PCR efficiency was >0.90, indicating that RNA-seq results were reasonably reliable.DEGs between the six groups were identified based on a false discovery rate (FDR) < 0.05 . Major m\u00df-oxidation pathways  expression was downregulated from 6\u00a0h to 10\u00a0days afterward  type I\u2013II to the mitochondria for \u00df-oxidation  was significantly (p < 0.05) elevated after 6\u00a0h of predation stress exposure. Radicals peaked after 6\u00a0h of predation stress and were significantly (p < 0.05) reduced after 10\u00a0days of predation stress. The branched-chain amino acids (BCAAs), valine , leucine (Leu), and isoleucine (Ile), increased with increasing predation stress  between the Ex 6 and Ex 48\u00a0h groups and the Ex 10\u00a0days and Ex 5\u00a0days-Out groups  via RNA-seq. In contrast, glucose-6-phosphatase catalytic subunit 3 (g6pc3) was upregulated, indicating that protein-driven glycogenesis was active  production by inhibiting the TCA cycle. ROS levels were higher in the Ex 6\u00a0h group than in the control , a-ketoisovaleric acid (KIV), and a-keto-beta-methylvaleric acid (KMV)] inhibit the mitochondrial respiratory chain  . The levry chain . Howeveralas2] and hemoglobin subunit alpha-3 [hba3]) increased in all experimental groups compared with that in the control. Specifically, there was a gradual increase in the expression of these genes from 6 to 24\u00a0h, and a slower subsequent increase up to 10\u00a0days  in response to the duration of predation stress, but as physiological changes in brain homeostasis and metabolism, including ROS suppression via TCA cycle inhibition and protection of the medulla oblongata through the binding of oxygen and hemoglobin to form oxyhemoglobin, which is essential for proper brain function. This suggests that at least Xenopus sp. may have a strategy to protect the brain by increasing hemoglobin synthesis during novel predator stress.Collectively, the results of the current study indicate that"}
+{"text": "Negative emotional states are known to interact, potentially aggravating one another. In this study, we used a well validated paradigm  to determine if pain from a common procedure (disbudding) influences responses to a reward downshift. Holstein calves (n\u2009=\u200930) were trained to approach a 0.5\u00a0L milk reward. Latency to approach, number of vocalisations and pressure applied on the bottle were recorded during training. To assess how pain affected responses to reward downshift, calves were randomly assigned to one of three treatments before the downshift. Two groups were disbudded and provided the \u2018gold standard\u2019 of pain mitigation: intraoperative local anesthesia and analgesia. One of these disbudded groups was then provided supplemental analgesic before testing. The third group was sham disbudded. All calves were then subjected to the reward downshift by reducing the milk reward to just 0.1\u00a0L. Interactions were detected between test session and daily trials on pressure applied for the Disbudded group (estimate\u2009\u00b1\u2009SEM: 0.08\u2009\u00b1\u20090.05), and on vocalisations for the Sham (0.3\u2009\u00b1\u20090.1) and Disbudding\u2009+\u2009Analgesia (0.4\u2009\u00b1\u20090.1) groups. Our results indicate that SNC is a promising paradigm for measuring negative affect in calves and suggests that pain potentially affects the response to a reward downshift. A well-developed paradigm for provoking this response is the successive negative contrast (SNC) test, where animals learn to obtain feed rewards which are then reduced in quantity or quality. Multiple lines of evidence indicate that this experience is distressing for animals, including increased levels of physiological markers of stress in rats and pigs5, and development of a preference for anxiolytic medication in rats6. In addition, responses to SNC are aggravated when an animal is in a pre-existing negative emotional state at the time of the test. For example, rats bred to be more anxious had higher latencies to approach a reward after a downshift7, and rats in amphetamine withdrawal displayed greater and longer reductions in reward consumption following a downshift8.A large body of research, primarily on rodents, has shown that sudden declines in reward levels are highly salient and provoke a negative affective response consistent with feelings of frustration or disappointment9. Housing conditions (barren vs. enriched) also affected pigs\u2019 sensitivity to reward loss10. To our knowledge, SNC has not been used to assess the emotional impact of pain in any species.The influence of current affective state on SNC responses provides a compelling opportunity for the assessment of animal welfare, although only a handful of studies have employed this approach. In one study, rats housed in barren environments showed an extended increase in latency to approach the downshifted reward in comparison to rats housed in enriched environments, suggesting that these animals were more sensitive to reward loss than were rats in enriched housing12, and that pain can aggravate frustrating situations13.Research conducted on humans report that patients in a negative emotional state are more inclined to show anger responses18. In this study we assessed the responses to SNC (in this case reducing the amount of milk available) in calves for three days following disbudding. Although providing a combination of local anesthesia and analgesia is considered a gold-standard in pain mitigation following disbudding, the duration of pain control has been challenging to estimate18, and disbudding pain has been suggested to last for several days21. For ethical reasons, all disbudded calves were provided local anesthesia and analgesia at the time of the procedure. To explore the potential longer-term pain caused by disbudding, a group of calves were provided additional fast-acting analgesia before tests. We predicted that calves in pain would respond to the downshift by increased pressure applied on the bottle containing the milk, number of vocalisations and latency to approach the reward. By exploring a novel approach to assessing the affective component of pain in animals, we hope to further the understanding of the emotional impact of a common farm procedure and, more generally, how negative states can interact to influence animal welfare.In this study we tested if pain aggravates responses to SNC testing. Young cattle experience pain associated with routine farm procedures including hot-iron disbudding, indicated by physiological, behavioral and emotional responses to the procedureP\u2009=\u20090.005) and daily trials  , and a tendency for the Sham group . There was no evidence of an interaction for pressure in the Disbudding\u2009+\u2009Analgesia group . Calves produced fewer vocalisations across days  and daily trials  . No interaction was found for the Disbudding group . Calves took longer to approach the reward across daily trials , with no effect of the test day  , whereas no interaction was found for the Disbudding  and Disbudding\u2009+\u2009Analgesia groups .Maximum pressure applied to the reward bottle decreased across test days , vocalisations and pressure both decreased, suggesting calves updated their expectations over time. Following the downshift, calves also increased their approach latency across trials within daily test sessions. This result is consistent with previous reports noting that approach latency increased after reward downshift Disbudding group suggests some level of maintained frustration over tests. Similarly, only calves who had not been disbudded tended to decrease their approach latency across trials whereas calves from the Disbudding and Disbudding\u2009+\u2009Analgesia groups maintained their latency increase. This result is consistent with results from Burman and colleagues9 who reported a more prolonged response to reward downshift (i.e. higher latency) from rats assumed to be in a more negative affective state. This result is also consistent with work on calves showing increased anticipatory behavior in response to a reward downshift for animals housed in a more barren environment23. We had expected that calves receiving supplemental ketoprofen before the daily test sessions would have responded similarly to the sham calves. That these animals appeared to have some similar responses to the other disbudded calves suggests that our ketoprofen treatment protocol might not have mitigated the pain associated with disbudding during tests. Ketoprofen has been noted as appropriate pain control for disbudding27, but conflicting results have also been reported29.We found some indication of a treatment effect on responses to the downshift over test days and daily trials. The significant positive interaction in pressure applied on the bottle over days and trials for the 30 found a gradual increase in approach latency and an immediate response in consummatory behaviours. They noted the gradual increase to be consistent with Thorndike\u2019s law of effect31, analogous to an extinction mechanism where a less valuable reward induces a less \u2018enthusiastic\u2019 response over time. The disparity with consummatory responses was suggested to relate to the different timeframes of the measures: anticipatory responses such as approach latency might require conditioned learning, and therefore change more slowly. However, consummatory responses such as pressure applied are immediate indicators of reward evaluation, and therefore do not require an adjustment delay.In a study on SNC in chickens, Davies and colleaguesDisbudding group did not vocalize more than the other treatment groups after the downshift. These results remain unclear to us, but the very low number of vocalisations past the first test day questions the sensitivity of calves vocalisations counts when used in SNC paradigms.Contrary to our predictions, calves from the 32. Moreover, such pessimism was also linked to the anhedonic response (i.e. a decrease in interest in a consummatory reward) following hot-iron disbudding33. Calves\u2019 individual differences could also be dependent on the severity of the sensitization of their head caused by the procedure35, causing increased pain when coming into contact with the bottle. Alternatively, sucking on the nipple (even without milk) may be positive for calves36 and may also provide pain relief in the hours after disbudding37.The high variability among calves in their response to the downshift could be associated to intrinsic individual differences. Individual differences in traits such as fearfulness have been linked to pessimistic responses to a judgment bias testFollowing a reduction in a milk reward, calves who experienced a painful procedure appeared to potentially display an extended response to the downshift. Although SNC seems a promising avenue, our results remain tentative and further development of the paradigm and its applications must be investigated to identify its relevance to animal welfare assessment.38. Reporting followed ARRIVE guidelines.Procedures were approved by The University of British Columbia Animal Care Committee under application A21-0111 and conducted in accordance with guidelines form the Canadian Council of Animal Care9) and pigs (sixteen subjects per treatment group10). Considering this range and our own practical limitations, we settled on a sample size of ten subjects per treatment group. Thirty-five Holstein calves  were initially enrolled in the study. Five calves were removed from the trial: three fell ill (scours and fever), one showed an extreme stress response when moved outside of her home pen, and one was not feed-restricted before a test. The thirty remaining had an average (\u00b1\u2009SD) birth weight of 38.3\u2009\u00b1\u20094.1\u00a0kg and were enrolled at 39.9\u2009\u00b1\u20094.1 d of age.The study was conducted at The University of British Columbia's Dairy Education and Research Centre. To our knowledge, no study has used a similar paradigm in calves. To establish a sample size estimate, we relied on welfare studies using analogous SNC paradigms but applied to other species: rats . Calves were provided ad libitum access to water and hay , and time-restricted access to 12 L of whole milk through a nipple feeder . To avoid long delay during trials, small replicates (average number of subjects per replicate\u2009=\u20093.5) were conducted.The experimental apparatus was located in the same barn as the calves\u2019 home pen, approximately 10\u201330\u00a0m away. The apparatus was a 1.8\u2009\u00d7\u20091.2\u00a0m start-box leading to a 3.6\u2009\u00d7\u20092.4\u00a0m pen through a vertical gate . Latency to contact the bottle (with mouth or tongue), latency to finish the reward, number of vocalisations and maximum pressure applied to the bottle were recorded live. The calf was then brought back to the start-box, the bottle refilled, and two more trials were conducted . After these trials were completed, the calf was returned to her home pen with full access to her daily milk allowance of (12\u00a0L/d). Training took place over three consecutive days, for a total of nine training trials. During the first day of training , no cues were given to the calf for the first minute after opening the start-box gate. After one minute, auditory  and tactile (finger suckling) cues were given from the experimenter from outside the test-pen to get the calf\u2019s attention towards the bottle. If these cues had failed after an additional minute, the experimenter would go inside the test pen and lead the calf to the bottle.The trial was divided in three phases over seven days: training (three days), treatment (one day) and testing (three days). During training, calves were feed-restricted overnight (from 22:00\u00a0h) to ensure a high motivation for milk rewards over repeated trials. At approximately 10:00\u00a0h calves were individually brought into the apparatus, with no set order, and then placed in the start-box. The vertical gate was lifted and calves could approach and drink a 0.5\u00a0L milk reward from the bottle . Once a calf had approached the bottle, she had three additional minutes to finish the reward.Disbudding, Disbudding\u2009+\u2009Analgesia, or Sham; ten calves each). Treatment assignment was balanced for age and birthweight . On treatment day, calves were not feed-restricted and went through their treatment in their group pen at approximately 10:00\u00a0h. Regardless of treatment, calves were weighted and administered a multimodal pain mitigation strategy of sedative, local anesthesia and analgesia. The sedative was used to facilitate following injections and disbudding . After sedation was reached , a local anesthetic was injected as a cornual nerve block to mitigate the acute pain of the procedure , an NSAID was provided to minimize inflammation , and the horn bud area was shaved with an electric trimmer. Ten minutes after lidocaine injection, a pinprick test was done on the horn buds to test for pain reflex. For calves in the Disbudding and Disbudding\u2009+\u2009Analgesia treatments, a pre-heated electric dehorner  was applied to both horn buds until a consistent dark ring formed around each bud (requiring approximately 10 to 15\u00a0s). Calves from the Sham group were treated identically but instead of being disbudded, only pressure on the horn buds was applied with the plastic handle of the dehorner. After the procedure was completed, calves were positioned in sternal recumbency and left to recover in the pen. As the magnitude and duration of NSAID effects following disbudding remain unclear 18, calves from the Disbudding\u2009+\u2009Analgesia group received an additional NSAID injection  1\u00a0h before each of the three test sessions to provide supplemental pain control at the time of testing. Based on a previous study on the efficacy of ketoprofen after disbudding29, we expected ketoprofen to provide analgesic effects for up to 2\u00a0h following treatment.Calves were pseudo-randomly assigned to one of three treatments  1\u00a0h before each of the three test sessions. After each session calves were returned to their home pen and again provided access to their full milk allowance (12\u00a0L). After the three test days calves were returned to routine farm care.In the three days following treatment, calves were tested for sensitivity to reward loss. Tests were similar to training: calves were brought individually to the apparatus after overnight feed restriction, and allowed access to a milk reward three times in a row , but during testing the reward was reduced to 0.1\u00a0L. The time allowed for calves to approach and drink the reward was matched with their performance during training. Maximum pressure applied to the bottle, number of vocalisations and latency to approach were recorded. Calves from the 40. For pressure and latency, data were log transformed to fit model assumptions of linearity, normality and homoscedasticity. For vocalisation counts, we used a Poisson mixed model. Fixed factors were treatment (2 df), test day (1 df), daily trial (1 df) and their interaction (3 df). Daily trial, nested within day and Calf ID, was included as a random factor. Significance and tendency thresholds were set at P\u2009\u2264\u20090.05 and P\u2009\u2264\u20090.10, respectively.\u00a0Data  on test phases (post treatment) using R\u2019s lme4 packagetest day  df, dailreatment  df, testSupplementary Information 1.Supplementary Information 2."
\ No newline at end of file