diff --git "a/deduped/dedup_0888.jsonl" "b/deduped/dedup_0888.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0888.jsonl"
@@ -0,0 +1,36 @@
+{"text": "Cancer incidence among 3,727 offspring of women hospitalised for epilepsy in Denmark between 1933 and 1962 was evaluated in a record-linkage survey with the national cancer registry. The children were identified from hospital charts, population listings, and parish registries. For all children , no excess of cancer was found in comparison with the general population (49 observed vs 53.8 expected). Among the 2,579 children born after their mothers' first admission for epilepsy, and thus presumably exposed in utero to anticonvulsant drugs, 14 cancers were identified compared to 13.8 expected . Contrary to some previous reports, cancers of the brain and nervous system were not significantly increased (3 observed vs 2.2 expected). These data provide no evidence that anticonvulsant drugs are transplacental carcinogens, and indicate that overall increases in risk as high as 80% are unlikely."}
+{"text": "In the crystal, the mol\u00adecules are linked into chains along the b axis by inter\u00admolecular N\u2014H\u22efO and C\u2014H\u22efO hydrogen bonds. Adjacent chains are linked by \u03c0\u2013\u03c0 inter\u00adactions [centroid\u2013centroid separation = 3.5748\u2005(15)\u2005\u00c5].In the title compound, C \u00c5                           b = 13.0566 (18) \u00c5                           c = 12.183 (2) \u00c5                           \u03b2 = 107.322 (3)\u00b0V = 1624.1 (4) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.09 mmT = 223 K                           0.60 \u00d7 0.34 \u00d7 0.30 mm                                 Rigaku Mercury diffractometerT                           min = 0.770, T                           max = 0.975Absorption correction: multi-scan 2476 reflections with R                           int = 0.043                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.064                           wR(F                           2) = 0.138                           S = 1.18                           2978 reflections228 parametersH-atom parameters constrainedmax = 0.22 e \u00c5\u22123                        \u0394\u03c1min = \u22120.18 e \u00c5\u22123                        \u0394\u03c1                                 CrystalClear (Rigaku, 2000CrystalClear; data reduction: CrystalStructure (Rigaku/MSC, 2003SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S160053681000591X/ci5030sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053681000591X/ci5030Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
+{"text": "Once formed, these urchin barrens can persist for decades. Trophic plasticity in the sea urchin may contribute to the stability and resilience of this alternate stable state by increasing diet breadth in sea urchins. This plasticity promotes ecological connectivity and weakens species interactions and so increases ecosystem stability. We test the hypothesis that sea urchins exhibit trophic plasticity using an approach that controls for other typically confounding environmental and genetic factors. To do this, we exposed a genetically homogenous population of sea urchins to two very different trophic environments over a period of two years. The sea urchins exhibited a wide degree of phenotypic trophic plasticity when exposed to contrasting trophic environments. The two populations developed differences in their gross morphology and the test microstructure. In addition, when challenged with unfamiliar prey, the response of each group was different. We show that sea urchins exhibit significant morphological and behavioural phenotypic plasticity independent of their environment or their nutritional status.The trophic interactions of sea urchins are known to be the agents of phase shifts in benthic marine habitats such as tropical and temperate reefs. In temperate reefs, the grazing activity of sea urchins has been responsible for the destruction of kelp forests and the formation of \u2018 Grazing by regular sea urchins (Echinodea) plays a crucial role in structuring a range of marine habitats, and has been linked to phase shifts in tropical Psammechinus miliaris used in this experiment is in excess of ten years Following a sea urchin induced phase shift, the trophic environment is radically altered in terms of the gross amount of food available and its nature. The trophic environment changes from a plentiful supply of easily accessible detached kelp fronds within the kelp forest, to one in which the sea urchins are scraping encrusting algae and invertebrates off rock Once a new stability domain is entered, the domain can persist for decades, with sea urchin populations remaining relatively stable following the initial boom Psammechinus miliaris. This species is a small regular echinoid with a distribution along the north-eastern Atlantic from Scotland to North Africa. It is known to be strongly omnivorous P. miliaris with two nutritionally equivalent, but physically different trophic environments and examined the nature of their phenotypic response, in terms of any changes in gross and microstructural characteristics and behaviour to their trophic environment.Sea urchins are well known for their morphological and behavioural plasticity. It has long been observed that populations from different habitats were morphologically distinct Psammechinus miliaris were spawned in the invertebrate hatchery at the Scottish Association for Marine Science. In April 2008, post metamorphosis (circa 1\u20133 mm diameter) the juvenile sea urchins were randomly separated into two populations and kept in four replicate aquaria. The sea urchins were fed one of two experimental diets. The \u2018wild type\u2019 diet consisted of fresh Laminaria spp. and whole mussels , reflecting the diet typically found in kelp beds The second diet was designed to be nutritionally equivalent, but to have very different material properties and require very different prey handling by the sea urchin to consume. The diet consisted of finely milled Laminaria spp. and mussel flesh in an agar binder (the processed diet). This diet has been previously used within the Scottish Association for Marine Science (SAMS) sea urchin production facility and was readily consumed by the sea urchins. Fresh Laminaria spp. and M. edulis were collected at approximately 2 week intervals from the Isle of Seil, west coast of Scotland and supplied ad libitum to the sea urchins. The \u2018Prepared Diet\u2019 was supplied to the sea urchins three times per week in excess of what could be consumed. The sea urchins were raised under these conditions until December 2009.The experimental populations of For comparison, wild sea urchins were collected from two locations in Loch Creran, which were approximately 2 km apart (Site 1 & 2) and each consisted of an intertidal and a subtidal population. Intertidal sea urchins were collected by hand at low tide on a boulder and sand habitat. Subtidal sea urchins were collected at each location from a depth of approximately 2 m and from a habitat of dense intact kelp, which runs parallel at a distance of \u223c10 m to the intertidal population. Loch Creran is a Special Area of Conservation and not in private ownership, however no specific permits were required for the collections, and the species is not endangered or protected.Forty individuals from each of the four populations  were dissected to obtain morphometric data for allometric analysis. Nine linear and five mass characteristics were measured for each sea urchin. Linear characteristics included: test height, test diameter, diameter of peristomal opening and spine length (mean of five longest spines), test thickness (interambulacra) at ambitus (maximum test diameter) and lantern length and diameter were determined using digital vernier callipers to an accuracy of 0.01 mm. The measurement of the lantern length followed the procedure used by Black et al. (1982), where length was measured on freshly dissected, un-disarticulated lanterns from the shallow notch in the oral end of the pyramid to the slight depression in the aboral surface of the epiphysis. Mass characteristics included: wet mass (live), gonad wet mass, and lantern wet mass following 5 mins air-drying and were determined using laboratory scales to an accuracy of 0.01 g. Lantern dry mass was determined after 24 hrs drying in an oven at 105\u00b0C and lantern calcite free dry mass was determined by the method described in Hagen http://rsb.info.nih.gov/ij/) image analysis program. As plate microstructure is known to be heterogeneous across the face of the plate, each plate was divided into a central and peripheral region. From each region 30 non overlapping quadrats (100\u00d7100 \u00b5m) were randomly placed on the image and the number of pores per quadrat, the average pore area, and the pore circularity  was calculated.In addition, electron micrographs were used to examine the test plate microstructure. Ten sea urchins from each of the \u2018wild diet\u2019 and \u2018processed diet\u2019 populations were used. One interambulacral plate was removed from the ambitus of the eviscerated test, which had been dried to a constant weight at 60\u00b0C and cleaned in a 3 Mol solution of NaOH for 48 hours. The plates were rinsed with distilled water and allowed to dry prior to gold coating and examination under the SEM. The electron micrographs were then analysed using the ImageJ 1.44  statistical package. The data were normalised (the mean of the variable is subtracted from each data point and the resultant number is divided by the standard deviation of the variable) and converted into similarity matrices using Euclidean distances as the metric. Permutation based analysis of similarity (ANOSIM) routines were used as the hypothesis testing framework. Parametric analysis was conducted using GMAV5 , all data was tested for homoscedasticity using Cochran\u2019s test. Any data not meeting this assumption was transformed. Student Newman\u2013Keuls post hoc testing was used where primary terms or interactions were significant at the 0.05 level. The responses in terms of time to successful predation were modelled using probit binary response and the binary logistic regression models in Minitab 14 was used to test for significant differences between the two treatments.Mytilus edulis) , 2) large blue mussels , 3) pacific oyster (Crassosttea gigas) (20\u201330 mm n\u200a=\u200a20 urchins from each treatment). The pacific oyster was used to expose the sea urchins to a novel prey species that neither population had prior experience.To test if the sea urchins from the two experimental treatments exhibited different prey handling behaviour a series of predator-prey interaction trials were conducted. Individual sea urchins from each of the \u2018wild diet and \u2018processed diet\u2019 populations were placed in clear plastic aquariums with a single prey item. Then at regular intervals observations were made and note would be made as to whether a successful predation event had occurred. All prey items were bivalves and so a successful predation event was defined as the sea urchin having successfully opened the valves of the prey item. Three successive trials were conducted, and new animals were used in each trial; 1) small blue mussels . Mortality during this period was less than 5% for each population.The sea urchins grew from post metamorphosis to an average test diameter 30.8 mm \u00b1 1.7 mm (95% CI) for the wild type diet population and 32.6 mm \u00b1 2.1 mm (95% CI) for the processed diets populations. There was no significant difference in the test diameter of the two populations  different . As post-hoc test was unable to discern amongst the groups, we can state that the processed diet population (the lowest) ratio was significantly different from the subtidal population from site 1 (the largest ratio).There were significant differences amongst the populations .The subtidal population of site 1 had a significantly higher ratio of lantern height to test height . As post hoc test was unable to discern amongst the groups, we can state that the processed diet population (the lowest) ratio was significantly different from the subtidal population from SS (the largest ratio).There were significant differences between the population .The sea urchins fed on wild type diet had significantly higher ratio of lantern muscle mass to total lantern mass than any of the other populations .The sea urchins fed on wild type diet had significantly higher ratio of lantern muscle mass to total test height than any of the other populations .Relative to test height, sea urchins fed processed diets had thicker tests than any of the other populations .Relative to test height, sea urchins fed processed diets had longer spines than any of the other populations . The sea urchins fed the processed diet had the highest GSI, followed by the wild type diet, the intertidal and then the subtidal.There were significant differences in the GSI between the wild type diet, the processed diet, the intertidal and the subtidal (FScanning electron micrographs of the test showed that the sea urchins fed on the wild type diet had significantly fewer and larger pores in their test compared to those urchins fed the processed diet. However the shape of the pores in terms of their circularity was not significantly different between the treatments .Crassostrea gigas) was more complex, the processed diet treatment initially opened more of the oysters at a faster rate, while the wild type population was slower to open them initially but by 300 hours they had more successful predation events.There was no significant difference in the predator-prey response curves of sea urchin fed wild type diets and processed diet when presented with small mussels  with botWhen confronted with different trophic environments (diets that required very different prey handling attributes) but were nutritionally equivalent, a genetically homogenous population of sea urchins exhibited significant phenotypic plasticity in response. They developed gross morphological and microstructural differences to their tests and exhibited different prey handling behaviour. Such plasticity is well observed in sea urchins, but has been ascribed to a number of environmental or genetic drivers. Of the environmental drivers, nutrient limitation has received the greatest focus. Differences in the jaw structure Centrostephanus rodgersii between kelp forests and urchin barrens have been previously reported Those sea urchins that were fed the processed diet developed morphologies distinct from those fed the wild type diet. This wild type diet morphology was closer to the morphologies of the natural populations as shown by the multivariate analysis, although several of the univariate morphometric measurements showed that there was no significant difference between the processed diet and the wild type diet populations, such as ratio of test diameter to test height, ratio of lantern muscle mass to total mass and the ratio of lantern muscle to test height. For these three morphometrics the response of the sea urchins fed on the wild type diet was greater than was observed in the population from the natural environment . The diet of the natural populations of these sea urchins has been shown to consist of predominantly macroalgae and filter feeding invertebrates with intertidal populations consuming a higher proportion of filter feeding invertebrates compared to the subtidal P. miliaris had not coevolved with), there were significant differences in the prey handling response between the sea urchins fed the wild and the processed diets. These behavioural differences indicate that trophic plasticity in sea urchins is not just limited to a morphological response but they are also capable of adaptive behavioural responses.There is also evidence that the sea urchins developed a behavioural plasticity according to their trophic environment. Sea urchins in the wild exhibit a range of behavioural plasticities in regards to their diurnal activity P. miliaris is known to be strongly omnivorous The trophic environments that the two experimental populations were challenged with were very different in terms of the prey handling characteristics of the two diets. As a result the two populations exhibited a large degree of trophic plasticity in terms of their gross morphology, test microstructure and prey handling behaviour. We have shown that sea urchins are capable of exhibiting true phenotypic plasticity as a result of the trophic environment, independent of nutrient limitation."}
+{"text": "Vascular injury represents less than 1% of all injuries, but deserves special attention because of its severe complications. Amputation or retention of a painful functionless limb is the most untoward result of severe vascular injury or inadequate treatmet. Thus, vascular injury needs a judicious and multidimensional approach.This retrospective study was done to asess the outcome of minor modifications of the methodology of extremity fasciotomy by making it liberal with respect to incision and definition.Out of 55 patients in 2008, 45 patients (Group A) had either no fasciotomy or limited primary fasciotomy, 10 patients (Group B) had primary liberal fasciotomy. Another group from 2008 onwards had undergone primary liberal fasciotomy in all the 45 patients (Group C).In group A, we had 5 amputations and one death. In group B, there were no amputations or deaths and from group C, we had one amputation and no deaths.Blunt and distal traumatic vascular injury of the extremities and its repair should always combined with primary liberal fasciotomy, which although increases manageable morbidity, avoids disability . Vascular injury represents less than 1% of all injuries, but deserves special attention because of their severe complications. Amputation or retention of a painful functionless limb is the most untoward result of severe vascular injury or inadequate treatment, so vascular injury needs a judicious and multidimensional approach. Patients with pain out of proportion to injury, pain upon passive stretching, sensory changes, weakness or parasthesia after vascular repair indicate vascular compromise due to compartment syndrome and need immediate fasciotomy. Popliteal artery injuries continue to result in maximum limb loss, possibility due to use of limited fasciotomy.This study was done to assess the outcome of minor modifications of the methodology of extremity fasciotomy by making it liberal with respect to incision and definition.We studied 55 patients in 2008 with firearm or splinter vascular injuries of extremities; 45 patients (Group A) underwent different methods of vascular repair either without primary fasciotomy or with limited fasciotomy. Only 10 patients (Group B) had liberal primary fasciotomy. After 2008 to date, we treated 45 patients (Group C) with different types of vascular injuries, by different reparatory methods all of which received primary liberal fasciotomy.Assessment included emergency work-up: clinical examination, CBC, KFT, ECG, chest x-ray, USG abdomen, color flow Doppler, blood grouping and cross-matching; only 6 patients were subjected to pre-operative angiography.Vascular repair was done by primary end-to-end anastomosis or reverse sephanous vein graft either without fasciotomy or with varied limits of fasciotomy.Limited fasciotomy included superficial incision with inadequately cut deep fascia, isolated compartment fasciotomy, inadequate length of fasciotomy not passing across proximal and distal joints. Liberal fasciotomy included cutting through skin, deep fascia as well as outer covering of underlying exposed muscles (epimysium), till muscle pouts out. Oozing blood from muscle indicates adequate blood flow through the repaired vessel as well as adequacy of fasciotomy, thus it has therapeutic as well as diagnostic importance. Checking muscle viability with low voltage electric cautery stimulation. Confirming muscle viability helps in adequate debridement to prevent infective complications of dead tissue.We use S-shaped incision both at elbow and popliteal fossa, closure of this incision does not cause any constricting effect, while in case of liberal primary fasciotomy, the same incision is extended. The repaired vessel is loosely covered either by surrounding fat or muscle to prevent desiccation of the vessel. Curved fasciotomy incisions decompress the maximum area of the extremity and avoids superficial venous injury.Ensure muscle pouting along fasciotomy wound. All-compartmental fasciotomy is better than isolated-compartment fasciotomy. Dressings should not be tight. Avoid entrapment of adventitia in the anastomotic suture line.Passing a Fogarty catheter damages endothelium and increases tendency of thrombosis, thus anticoagulation is recommended.From group A, we had 5 amputations and one death (death due to infective complications of gangrene followed by DIC - despite that the limb was amputated); from group B we had no complications and from group C one amputation and no deaths were recorded; 12 patients from group A needed either extension of fasciotomy or secondary fasciotomy.Most of the patients with liberal primary fasciotomy need care by a plastic surgeon. But 25% patients were discharged and referred to their respective primary health care centers for regular dressings and admitted subsequently for split-thickness skin grafting with favorable results.All those patients with primary liberal fasciotomy even with borderline muscle viability at the time of primary vascular repair had the least amputation rate. There was no significant increase in infection rate. Soaked dressings were changed regularly. One significant complication with primary liberal fasciotomy was pain which needed short interval analgesics. Also changing dressings in these patients was time consuming and significantly painful which demanded extra patience by patient as well as attending resident. These patients have long lasting paresthesia at graft site with varied presentation. Patients in high dependency units with no or limited fasciotomy obscured signs of compartment syndrome due to liberal use of analgesics. Delayed or revised fasciotomy in these patients helped to a very limited extent, and in the long run gave a functionally disabled limb with chronic pain in saved limbs.Delayed fasciotomy, revision fasciotomy and disability due to amputation/vegetative limb or chronic limb parasthesia all have a very strong psychological impact in contrast to less morbidity associated with primary liberal fasciotomy.In patients with primary liberal fasiotomy crossing knee and ankle in lower limb, elbow and wrist in upper limb with cutting some fibers of reticulum at ankle or wrist appreciably improved blood flow. Any vascular injury associated with blunt trauma limb, fracture, venous injury, longer duration of ischemia; below knee/elbow vascular repair needed primary liberal fasciotomy whether the patient had a tense compartment at the time of vascular repair or not.Extensive soakage from fasciotomy wound needs frequent change of dressings, which is painful and cumbersome for patient. Frequent analgesics make patients apprehensive. Painful postural changes and difficulty in assuming comfortable postures effects sleep. Longer hospital stay is uncomfortable.Compartment syndrome is a surgical emergency characterized by raised pressure in an unyielding osteofascial compartment caused by trauma, revascularization, myocyte edema after ischemia-reperfusion injury, or resuscitation -4. The cBlunt and distal traumatic vascular injury of extremities and its repair should be combined with primary liberal fasciotomy, which may although increase manageable morbidity, will avoid lifelong disability. No fasciotomy can be acceptable when chances of compartment syndrome are absolutely nil; however, limited fasciotomy is absolutely discouraged in favor of primary liberal fasciotomy."}
+{"text": "Positive end-expiratory pressure (PEEP) is fundamental to prevent lung collapse in ARDS patients. A common method to titrate PEEP is to perform a PEEP test, recording the variation of cardiorespiratory parameters after a PEEP change . The aim2O and TV 7 ml/kg - Baseline) were randomized to two groups: in the PEEP 15 group, PEEP was increased from 10 to 15 cmH2O; while in the PEEP 5 group, PEEP was decreased from 10 to 5 cmH2O. Arterial gas analyses were performed in both groups after 5, 15, 30 and 60 minutes from the change of PEEP.Mechanically ventilated patients (PEEP 10 cmH2/FiO2 (P/F) and PaCO2 were similar in both groups . In the PEEP 15 group, P/F significantly continuously increased over time. In PEEP 5, P/F significantly decreased after 5 minutes and remained stable over time. In the PEEP 15 group, PaCO2 did not change within 60 minutes after PEEP increase. When PEEP was reduced (PEEP 5) PaCO2 remained stable for the first two steps, while at 30 and 60 minutes PaCO2 was significantly higher than at Baseline (Figures We enrolled 44 ARDS patients: 23 in the PEEP 15 group and 21 in the PEEP 5 group. At Baseline, PaOOur data indicate that it is important in critically ill patients to allow sufficient time for the full effect of PEEP increase on oxygenation and to prevent excessive delay when P/F decrease occurs following the application of a lower level of PEEP."}
+{"text": "Gigantol and syringic acid (SA) have been shown to synergistically prevent formation of diabetic cataract (DC). However, the exact mechanism of this effect is unknown. Here, we investigate the effect of these compounds on the activity of aldose reductase (AR) and cataract formation.We examined the synergistic anti-cataract efficacy of gigantol and SA in the high glucose- and streptozotocin -induced DC rat model; synergism was evaluated using Jin\u2019s formula. We investigated possible mechanisms of action by measuring AR expression and activity and levels of sorbitol using enzyme kinetics, Western blot, and RT-PCR. Finally, we examined binding interaction between AR and both compounds using a combination of site-directed mutagenesis, recombinant expression of wild-type and mutant proteins, and enzyme kinetics.Combination treatment of gigantol and SA synergistically protected both HLECs grown in vitro and DC formation in STZ-induced rats in vivo. Synergism was attributed to inhibition of AR activity, downregulation of AR expression via impaired transcription, and decreased sorbitol levels. Enzyme kinetics studies showed that the activity of an AR Asn160Ala mutant protein was significantly decreased compared to wild-type AR, confirming that Asn160 is a key residue for interaction between AR and both compounds.Combined administration of gigantol and SA synergize to enhance anti-cataract efficacy. The synergistic effect is mainly attributed to disruption of the polyol pathway and inhibition of AR activity. Cataract formation in patients suffering from diabetes is a major cause of blindness. This is particularly true in developed countries in which individuals tend to eat high-fat diets, which are linked to an increased incidence of diabetes. Cataract formation associated with diabetes  can severely affect patients\u2019 vision and quality of life . ImportaAlthough cataract surgery is quite common and provides an effective cure, a better understanding of cataract development might help delay or even prevent cataract onset in diabetic patients. Furthermore, patients with diabetes mellitus have more complications associated with cataract surgery, including rapid acceleration of retinopathy, rubeosis, macular edema, and cystoid macular edema \u20137. Both The pathogenesis of diabetic cataract development is still not fully understood. Multiple mechanisms, including increased sorbitol pathway activity , 13, nonPrevious studies have established that the enzyme aldose reductase (AR) catalyzes the reduction of glucose to sorbitol through the polyol pathway, a process linked to the development of diabetic cataracts . AR is tDendrobium Sw. plants of Orchidaceae. According to several Chinese medical reports, Caulis Dendrobii has been shown to improve vision [Caulis Dendrobii, a traditional Chinese herb, is the fresh or dry stem of the e vision , 31. We e vision , 33. As e vision . We havee vision . Taken tThe molecular mechanisms underlying the synergistic effect of gigantol and SA are not fully understood. Moreover, many of the previous studies have made use of galactose- or hydrogen peroxide-induced cataract animal models, which typically fail to mimic human disease , 36. As STZ, MTT, DMSO  was obtained from Italian Roth Corp. Pirenoxine eye drops were obtained and produced by Wuhan Tiantianming Pharmacy Co. Ltd. (P. R. China). Ammonium acetate was purchase from Gene-Tech Co. Ltd. All other reagents were obtained domestically and were deemed to be analytically pure.Dendrobium aurantiacum var.denneanum (kerr) Z.H. Tsi were acquired from Wan\u2019an Dendrobium Industry and Development Co., Ltd. . These specimens were authenticated by Professor Tingmo Zhang of the Chengdu University of Chinese Medicine. Gigantol and SA were extracted at >98\u00a0% purity using the method previously described [Live specimens of escribed , 40.\u03bcm membrane to generate the drops. Eye drops containing gigantol or SA alone were prepared as described above except for the addition either gigantol alone (2\u00a0g) or SA alone (2.5\u00a0g).The eye drops containing both gigantol and syringic acid were prepared as previously described . Briefly2 humidified atmosphere [5 cells/well in 100\u00a0\u03bcL for 24\u00a0h followed by incubation with high glucose , normal glucose , or mannitol  [HLECs  line SRA01/04, generously provided by the Ophthalmology Center of the Sun Yat-sen University (P.R. China), was cultured in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 20\u00a0% fetal bovine serum (FBS), 100\u00a0IU/mL penicillin, and 100\u00a0mg/mL streptomycin at 37\u00a0\u00b0C in a 5\u00a0% COmosphere . HLECs wl group) .Cells were treated for 72\u00a0h with high glucose (50\u00a0mmol/L glucose-DMEM) and various concentrations of gigantol and syringic acid, either alone or in combination. Gigantol was administered at doses of 0, 0.1, 0.5, 1.0, and 2 \u03bcg/mL. Syringic acid was administered at doses of 0, 0.125, 0.625, 1.25, and 2.5 \u03bcg/mL. The doses used for the combination are listed in Table\u00a0The synergistic effect of gigantol and syringic acid was analyzed by applying the modified B\u00fcrgi formula  , 38. Theg for 10\u00a0min. The reaction was carried out in 1.5\u00a0mL incubation medium ; DL-glyceraldehyde was added the last. Enzyme activity was measured spectrophotometrically by estimating NADPH oxidation from a decrease in absorbance at 340\u00a0nm. The assay was carried out at room temperature with an appropriate blank subtracted from each reaction to correct for non-specific oxidation of NADPH during the measurement. One unit of enzyme activity is defined as the amount of enzyme catalyzing the oxidation of 1\u00a0\u03bcmol NADPH/min under the present assay conditions.AR activity in the cytosolic fraction of HLECs was spectrophotometrically estimated as previously described \u201346. Harvad libitum and had free access to water. Food intake was monitored daily. This study was approved by the Animal Care Committee of Guangzhou University of Chinese Medicine and conducted in accordance with the institutional guide for the care and use of laboratory animals.Totally 100 Wistar rats with an average body weight of 220\u2009\u00b1\u200910\u00a0g  were obtained from the Laboratory Animal Center at the Guangzhou University of Chinese Medicine. Rats were housed in an air-conditioned animal house under a normal day/night cycle. All animals were fed a normal rodent chow diet n\u2009=\u200915) received only 0.1\u00a0M citrate buffer, pH\u00a04.5 as vehicle. Other animals in experimental groups were overnight-fasted, then diabetes (type I) was induced by a single intraperitoneal injection of 1\u00a0% (W/V) STZ (30\u00a0mg/kg body weight) in 0.1\u00a0M citrate buffer, pH\u00a04.5 [n\u2009=\u200915/group): DC rats treated with normal saline , DC rats treated with syringic acid eye drops (group III), DC rats treated with gigantol eye drops (group IV), DC rats treated with combination gigantol and syringic acid eye drops (group V), and DC rats treated with 0.053 \u03bcg/\u03bcL pirenoxine sodium eye drops as suggested by the manufacturer . Drug administration was performed by applying 50 \u03bcL of eye drops to each eye, 3 times per day, for 60 consecutive days.Prior to the experiment, rats were administered tropicamide eye drops to check their lenses under the slit lamp . After one week of adaptable feeding, the rats were divided into six groups. Control rats  using Trizol reagent  as previously described , 50. LenThe lens homogenate from each of the five groups (groups I to V) was prepared in PBS (pH\u00a07.4). Sorbitol levels in the lens were measured as previously described , 53. BriHindIII  and XhoI  digestion sites; after amplification, these fragments were cloned into the pET28a expression vector. The accuracy of the insertion sequence was verified by sequencing. AR Asn160 mutant expression plasmids were constructed using pET28a-AR expression plasmid as template and rapid one-step PCR-medicated site-directed mutagenesis. Asn160 was mutated to alanine (Ala)  plasmid carrying full-length cDNA encoding AR was used as the template, and AR cDNA fragments were specifically amplified using primers containing restriction enzymes E.coliBL21 (DE3) . E. coliBL21 (DE3) were used for expression of wild-type and mutant AR. Bacteria were cultured on LB (Luria-Bertani) plates containing Kanamycin ; incubation was performed overnight at 18\u00a0\u00b0C with constant shaking at 180\u00a0rpm. Transformation of E. coliBL21 (DE3) competent cells with blank vector pPELB served as the control. Successfully transformed positive clones were screened. Expression was detected by 12\u00a0% sodium dodecyl sulfate polyacrylamide gel electrophoresis.The pET28a-AR and mutant pET28a-AR Asn160 expression vectors were used to transform 2PO4, 300\u00a0mM NaCl, 20\u00a0mM imidazole, pH\u2009=\u20098.0), disrupted by ultrasonic treatment after suspension, and centrifuged at 10,000\u00a0g, 4\u00a0\u00b0C for 30\u00a0min. The supernatant was transferred to a centrifuge tube, mixed with lysis buffer-treated Ni-NTA beads, and then slowly shaken on ice for 1\u00a0h to fully mix the beads and protein. The bead-protein solution was transferred to a chromatographic column, and the beads were allowed to naturally sediment. Next, the beads were washed twice with 8\u00a0mL eluent . The target protein was eluted into 1.5\u00a0mL EP tubes using elution buffer ; between four and six elutions were performed, and 1\u00a0mL eluent was collected each time. Steps of the procedure involving sedimentation, rinsing, and elution were all performed in a refrigerator. Protein concentration was determined by the Bradford method. Sample purity was determined by 12\u00a0% sodium dodecyl sulfate polyacrylamide gel electrophoresis. Purified protein plus 15\u00a0% glycerol  was stored at \u221280\u00a0\u00b0C.The bacteria solution was centrifuged at 10,000\u00a0rpm for 30\u00a0min at 4\u00a0\u00b0C, mixed with lysis buffer . There was no difference in viability between the normal control group and the osmolarity control group (P\u2009>\u20090.05), suggesting that osmolarity had no significant effect on HLECs viability.Compared to either the normal control group or the osmolarity control group, HLECs treated with high glucose (50\u00a0mM) became swollen and exhibited cavitation and formation of small particles when viewed under an inverted microscope. The decrease in cell density and the increased numbers of floating cells suggested that high glucose inhibits HLECs proliferation. Treatment of these cells with various concentrations of gigantol and SA, either alone or in combination, restored HLECs morphology back to normal. MTT assay showed that HLECs viability in the model group was significantly decreased as compared to any of the other treatment groups (Table\u00a0P\u2009<\u20090.01). As such, concentrations of 1\u00a0\u03bcg/mL gigantol and 1.25\u00a0\u03bcg/mL syringic acid were chosen for further investigation for combined effects and mechanisms.Using the Jin\u2019s formula , 38, we P\u2009<\u20090.01). Moreover, the combined administration of gigantol and SA (Group V) was more effective than either agent alone (p\u2009<\u20090.05).We next examined the effect of gigantol and SA eye drops on cataract formation in the STZ-induced rat model. Cataract scores in each of the experimental groups following 60\u00a0days of treatment are summarized in Fig.\u00a0P\u2009<\u20090.01) to 15.34\u00a0mU\u2009\u00b7\u2009min-1\u2009\u00b7\u2009\u03bcg-1 protein, suggesting that high glucose can significantly activate AR. Compared to the high glucose group, AR activity in the gigantol, syringic acid, and combination groups was significantly decreased (P\u2009<\u20090.01), suggesting that treatment with these compounds inhibits AR activation induced by high glucose in a dose-dependent manner . This increase was significantly inhibited by gigantol and SA, and, importantly, the combined treatment of gigantol and SA performed better than either agent alone (p\u2009<\u20090.05). These findings indicate that combination gigantol/syringic acid significantly attenuates STZ-induced AR expression in vivo, which may, at least in part, explain the synergistic effect of combination treatment.The effect of gigantol and SA on AR activity prompted us to examine the effect of these compounds on its protein expression. We performed Western blot analysis for AR expression in the lens from the various treatment groups Fig.\u00a0. AR exprp\u2009<\u20090.01). Importantly, combined administration (group V) was more effective than either compound alone (p\u2009<\u20090.01), indicating that gigantol and syringic acid synergistically inhibit STZ-mediated increase in AR mRNA expression.Since we found that gigantol and SA modified AR protein expression, we next examined whether these compounds regulated AR at the mRNA level as well. We performed real-time RT-PCR and found low level of AR mRNA expression in control rats (Group I). AR mRNA transcripts were significantly elevated in the diabetic model group, showing a 4.85-fold increase in AR mRNA expression in STZ-induced rats . Treatment with either gigantol or SA effectively attenuated this STZ-mediated increase. Moreover, combined treatment with gigantol and SA performed better than either agent alone . Positive clones were screened and sequenced. Following the sequencing and assembly of sequencing data, the BLAST result showed that the AR mutant with Asn160 was changed to Ala and was generated to test the binding sites predicted by docking simulation.Using recombinant plasmid pET28a-AR as template, we performed site-directed mutagenesis to generate the AR Asn160Ala mutant. As expected, a 1\u00a0kb band was amplified. This amplified product was digested with Differential expression was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Wt-AR and mutant AR were expressed at similar levels Fig.\u00a0. As expeCombined treatment of gigantol and SA inhibited wt-AR in a dose-dependent manner, and the inhibition ratio of combination treatment was consistent with our previous work . FurtherThe development of cataracts in patients suffering from diabetes can lead to blindness at late stages of the disease. The polyol pathway, advanced glycation end products (AGEs), and oxidative stress have all been implicated in the development of DC \u201358. LensThe Dendrobium species (Orchidaceae), locally known as \u2018Shihu\u2019 or \u2018Huangcao\u2019, have long been used in traditional Chinese medicine for their antipyretic, eye-benefiting, immunomodulatory, and anti-aging effects , 79. OurGalactosemic animal models are widely used to study sugar-induced complications. This is because galactose can rapidly produce cataracts, and animal survival in this model is typically better due to less severe systemic metabolic changes. As such, this animal model is often favored over the diabetic model, particularly for initial screening of new investigational agents . TherefoIn an effort to understand the synergistic mechanism of gigantol and syringic acid, we treated STZ-induced rats with a combination of both compounds. We found that combined gigantol and SA treatment inhibited HLECs apoptosis and lens opacification. To better understand the underlying synergistic effect, we examined AR activity, expression level of AR, and sorbitol accumulation in the lens. We found that treatment with gigantol and/or syringic acid decreased AR activity and expression, particularly in the combination group. Furthermore, a significant decrease in the accumulation of sorbitol was observed when both compounds were simultaneously administered, which correlated with decreased HLECs apoptosis. AR downregulation by gigantol and/or syringic acid might explain their synergistic anti-cataract effect in the lens.We next examined the importance of Asn160 in AR for its inhibition by gigantol and SA. Enzyme kinetics showed that the Q160A mutant was not inhibited by gigantol and SA to the same extent as the wild-type protein. These findings confirmed that Asn160 is a key residue within AR mediating the inhibitory effects of gigantol and SA, and this information was not previously reported \u201392. The In conclusion, combined treatment of gigantol and syringic acid synergize to significantly protect against DC formation and, as such, may represent a promising therapeutic option. The synergistic effect might be due to decreased AR expression and activity. These results add to the growing body of evidence supporting a therapeutic role for gigantol and SA in preventing cataract formation in patients with diabetes.Ala, alanine; AR, aldose reductase; ARI, aldose reductase inhibitors; BLAST, basic local alignment search tool; cDNA, complementary DNA; Da, Dalton; DC, diabetic cataracts; DMEM, Dulbecco\u2019s modified Eagle\u2019s medium; DMSO, dimethyl sulfoxide; FBS, fetal bovine serum; HLECs, human lens epithelial cells; MD, molecular docking; MTT, 3--2,5-diphenyl-2-H-tetrazolium bromide; NAD, nicotinamide adenine dinucleotide; NADPH, reduced nicotinamide adenine dinucleotide phosphate; OD, optical density; PBS, phosphate buffer saline; PCR, polymerase chain reaction; PDB, protein data bank; Q160A, Ala substitution at Asn 160; RIPA, radio immunoprecipitation assay; SA, syringic acid; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; STZ, streptozotocin; wt-AR, wild-type AR"}
+{"text": "In 2016, it is estimated that there will be 62,700 new cases of kidney cancer in the United States, and 14,240 patients will die from the disease. Because the incidence of kidney renal clear cell carcinoma (KIRC), the most common type of kidney cancer, is expected to continue to increase in the US, there is an urgent need to find effective diagnostic biomarkers for KIRC that could help earlier detection of and customized treatment strategies for the disease. Accordingly, in this study we systematically investigated KIRC\u2019s prognostic biomarkers for survival using the reverse phase protein array (RPPA) data and the high throughput sequencing data from The Cancer Genome Atlas (TCGA).With comprehensive data available in TCGA, we systematically screened protein expression based survival biomarkers in 10 major cancer types, among which KIRC presented many protein prognostic biomarkers of survival time. This is in agreement with a previous report that expression level changes  may have a better performance for prognosis of KIRC. In this study, we also identified 52 prognostic genes for KIRC, many of which are involved in cell-cycle and cancer signaling, as well as 15 tumor-stage-specific prognostic biomarkers. Notably, we found fewer prognostic biomarkers for early-stage than for late-stage KIRC. Four biomarkers  were found to be prognostic for survival based on both protein and mRNA expression data.Through pan-cancer screening, we found that many protein biomarkers were prognostic for patients\u2019 survival in KIRC. Stage-specific survival biomarkers in KIRC were also identified. Our study indicated that these protein biomarkers might have potential clinical value in terms of predicting survival in KIRC patients and developing individualized treatment strategies. Importantly, we found many biomarkers in KIRC at both the mRNA expression level and the protein expression level. These biomarkers shared a significant overlap, indicating that they were technically replicable.The online version of this article (doi:10.1186/s12864-017-4026-6) contains supplementary material, which is available to authorized users. Cancer remains a leading cause of death in the United States . The ideEGFR [KRAS [BRAF [There are many types of potential biomarkers for cancer. DNA alterations are a major type of biomarker candidates, including single nucleotide variants (SNVs), small insertions and deletions (indels), copy number variations (CNVs), and structural variants (SVs). Most successful examples of DNA mutations as biomarkers were found in well-studied cancer genes, such as EGFR , KRAS [4AS [BRAF . Gene exAS [BRAF , and thiAS [BRAF \u201311, yet AS [BRAF , althougVHL, which is involved in the degradation of hypoxia inducible factor and is associated with both the sporadic and familial forms of KIRC [PBRM1, a gene involved in chromatin remodeling [BAP1; and PTEN. Notably, in KIRC it is the tumor-suppressor genes that are most prone to mutation, whereas in other cancer types mutation is most common in oncogenes.In 2016, it is estimated that there will be 62,700 new cases of kidney cancer in the United States \u2014 an increase of approximately 8% compared to 2010 \u2014 and that 14,240 patients will die from the disease . Because of KIRC ; PBRM1, modeling , 20; BAPIn this study, we conducted a systematic screening for somatic-mutation, mRNA-expression, and protein-expression prognostic biomarkers. We started with a pan-cancer screening, which helped us to discover only moderate numbers of significant biomarkers in most cancer types. Remarkably, our pan-cancer results highlighted an unusually large number of protein biomarkers in KIRC compared to other types of cancer. Therefore, we focused on the further analyses of these protein biomarkers in KIRC. Specifically, we explored their correlation with changes in mRNA expression, their co-expression patterns, their crosstalk with other domains of data, and their unique power to predict patient outcome in KIRC samples from specific stages of cancer. In summary, the present study provides a comprehensive overview of the protein biomarkers in KIRC.As is depicted in Fig. p values in statistical tests .In seeking prognostic biomarkers, we considered somatic mutations, mRNA expression, and protein expression. For each cancer type, we collected samples that had clinical information and corresponding genetic mutation data, gene expression data and protein expression data from TCGA or the cBio Cancer Genomics Portal . Figure ZNF536, padjust\u00a0=\u00a09.6\u00a0\u00d7\u00a010\u22124; BRWD1, padjust\u00a0=\u00a00.02; CENPE, padjust\u00a0=\u00a00.03; MED12, padjust\u00a0=\u00a00.03; DLGAP4, padjust\u00a0=\u00a00.03 and FAM179A, padjust\u00a0=\u00a00.04 where padjust indicates multiple-testing-corrected p values calculated using the Benjamini and Hochberg method). For GBM, we also detected six prognostic biomarkers, including ZFHX3 (padjust\u00a0=\u00a08.2\u00a0\u00d7\u00a010\u22125), CTTNBP2 (padjust\u00a0=\u00a02.2\u00a0\u00d7\u00a010\u22124), ZNF99 (padjust\u00a0=\u00a00.02), CARD11 (padjust\u00a0=\u00a00.03), IGFN1 (padjust\u00a0=\u00a00.03) and WDR63 (padjust\u00a0=\u00a00.04). We identified four prognostic biomarkers in HNSC . LUSC had six significant biomarkers, including UGT8 (padjust\u00a0=\u00a01.5\u00a0\u00d7\u00a010\u22129), DDC (padjust\u00a0=\u00a03.9\u00a0\u00d7\u00a010\u22124), SOGA2 (padjust\u00a0=\u00a01.6\u00a0\u00d7\u00a010\u22123), SEPT14 (padjust\u00a0=\u00a01.6\u00a0\u00d7\u00a010\u22123), HERC6 (padjust\u00a0=\u00a00.01) and ZNF81 (padjust\u00a0=\u00a00.02). OV had one survival biomarkers: PLB1 (padjust\u00a0=\u00a00.04). In KIRC, we found only one mutation biomarker, MTHFD1 (padjust\u00a0=\u00a00.01), which was mutated in five of 414 samples. UCEC had >10 mutation biomarkers. Among all the cancers we examined, UCEC had the largest number of SNV survival biomarkers with somatic mutations in 31 genes. The strongest prognostic biomarkers in UCEC were GPR124 (padjust\u00a0=\u00a08.1\u00a0\u00d7\u00a010\u22128), KCNJ4 (padjust\u00a0=\u00a04.0\u00a0\u00d7\u00a010\u22126), TFIP11 (padjust\u00a0=\u00a01.8\u00a0\u00d7\u00a010\u22125), YIF1A (padjust\u00a0=\u00a01.5\u00a0\u00d7\u00a010\u22124), SLC22A6 (padjust\u00a0=\u00a08.9\u00a0\u00d7\u00a010\u22124), and FSD1L (padjust\u00a0=\u00a01.1\u00a0\u00d7\u00a010\u22123). Five of 247 UCEC samples carried GPR124 mutations. All five patients from whom the tested samples were taken had survival times of less than 10\u00a0months, substantially shorter than the 34-month average survival time seen in patients whose samples did not contain mutations in GPR124.For somatic mutations, we only considered non-silent SNVs and indels  and mapped these variants to genes using ANNOVAR . We screTo find other potential survival biomarkers, we next screened protein expression data measured by the RPPA platform. According to TCGA data, the RPPA assay investigated 187 RPPA antibodies targeting 155 proteins. The original study of cancer functional proteomics had categorized these proteins into ten pathways . The numn\u00a0=\u00a0403) and OV (n\u00a0=\u00a0407) were similar to the sample size for KIRC (n\u00a0=\u00a0454), but there were only 14 prognostic protein biomarkers for UCEC and seven for OV, substantially less than the 86 for KIRC. This confirmed that the large number of prognostic biomarkers we found in KIRC was only slightly attributable to the size of the sample. Moreover, there was substantial overlap in the protein biomarkers found in different sample groups. As shown in Fig. The results above changed slightly when we conducted the analyses on the PC group. When the PC sample group was compared to the PMC sample group, the number of significant biomarkers increased for KIRC (86 in 454 PC samples vs. 85 in 436 PMC samples), OV (14 in 407 PC samples vs. 0 in 201 PMC samples), and UCEC (7 in 403 PC samples vs. 3 in 300 PMC samples). In addition, we examined the impact of sample size on prediction of biomarkers across cancer types. For example, in the PC sample group, the sample sizes for both UCEC , our finding of a large number of protein biomarkers has important implications for the development of precision medicine approaches to treat patients with KIRC. Hereafter, we refer to the 85 RPPA biomarkers found in the PMC sample group as the KIRC protein biomarkers and utilized them in subsequent analyses.Having observed that KIRC has a surprisingly large number protein biomarkers prognostic for survival, we next explored the mRNA expression levels of these protein biomarkers to determine whether the protein biomarkers\u2019 mRNA counterparts were also useful for prognosis. The consistency between mRNA biomarkers and protein biomarkers would presumably rely on the correlation between mRNA and protein expression of each gene, which was subjected to many factors, such as post-transcriptional regulation, mRNA and protein degeneration, the corresponding technology in data generation, the heterogeneity of the cancer samples, and the clinical treatment the patients from whom the samples were obtained had received. In this work, we investigated the mRNA expression of the 155 proteins measured in the RPPA platform. We found that 148 of these proteins had mRNA-expression data available in TCGA pan-cancer RNA-sequencing data. Thus, following an analysis strategy similar to that we had used in analyzing protein-expression data, we performed a Cox proportional hazards regression on the mRNA expression data for two different sample groups: a PMC group with protein-expression, mRNA-expression, and clinical data, and an MC group that had mRNA-expression and clinical data.n\u00a0=\u00a0436) yielded 84 significant mRNA biomarkers for KIRC , FOXM1 (padjust\u00a0=\u00a07.8\u00a0\u00d7\u00a010\u221211), CHEK2 (padjust\u00a0=\u00a09.8\u00a0\u00d7\u00a010\u221211), KDR (padjust\u00a0=\u00a02.4\u00a0\u00d7\u00a010\u221210), and FASN (padjust\u00a0=\u00a02.9\u00a0\u00d7\u00a010\u221210). In strong contrast, we did not find significant prognostic mRNA biomarkers for BLCA, BRCA, COADREAD, HNSC, LUSC, or OV. There was one mRNA biomarker in GBM and one in LUAD, and there were five in UCEC. We then performed the analysis using the MC sample group. Likely due to an increase in sample size, we observed a few more significant mRNA biomarkers in some cancer types, e.g., 11 in HNSC, 18 in LUAD, and 15 in UCEC. However, the number of mRNA biomarkers in KIRC was still substantially higher than that in any other cancer type, consistent with our findings using the protein expression data. Hereafter, we refer to the 84 mRNA prognostic biomarkers found in the KIRC PMC sample group as the KIRC mRNA biomarkers and used them in subsequent analyses.Screening for prognostic mRNA biomarkers using the PMC sample group . Hereafter, these 52 overlapped biomarkers . In addition, a previous study curated ten pathways that are covered by the antibodies measured in the RPPA platform [p\u00a0=\u00a00.03). In summary, we found many prognostic biomarkers for KIRC at both the mRNA- and protein-expression levels. These biomarkers overlapped significantly and were enriched in cancer-related pathways, which suggested their potential clinical value.To explore the functions of these 52 genes, we conducted a pathway enrichment analysis using both the canonical Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations and the ten pathways originally targeted by the RPPA platform [We next asked whether the biomarkers we had observed represented distinct expression patterns or whether they were driven by a few unique processes, while others were only co-expression partners. We used the Pearson Correlation Coefficient (PCC) to explore the co-expression pattern and calculated it for the 52 overlapping genes using protein-expression and mRNA-expression data, respectively Fig. . As showWe also compared the 52 overlapped genes with other genes used in the same platform for their consistency between mRNA and protein expression. This allowed us to examine whether these biomarker genes exhibited especially high correlations at the mRNA and protein levels. We compared the protein-mRNA expression correlations of the 52 biomarkers with the correlations of other genes whose encoding proteins were measured in the RPPA platform. As shown in Fig. S1 , stage II (n\u00a0=\u00a041), stage III (n\u00a0=\u00a0107), and stage IV (n\u00a0=\u00a078). In each of these stages, we applied the same analysis strategy in searching for biomarkers using both mRNA and protein expression. We referred to the biomarkers that were significant in particular stages as stage-specific biomarkers.Tumor stage is one of the most important clinicopathologic factors associated with patient outcome. To determine whether the biomarkers we had observed provided prognosis power beyond stage information, we performed stratified survival analyses for each stage of KIRC. We downloaded sample stage annotations from TCGA and grouped the KIRC samples into four stages: stage I . A detailed list of the results is presented in , two in stage II , four in stage III , and seven in stage IV  (Table PEA15) was prognostic in stage III  but marginally missed our criterion in stage IV . Another biomarker, AR (encoding gene: AR), was prognostic in stage IV  and had a nominal p\u00a0=\u00a00.012 in stage III.At FDR\u00a0<\u00a00.05, we observed five protein biomarkers in stage I, four in stage III, and 18 in stage IV. We found no significant protein biomarkers in stage II, although there were two antibodies  with marginal significance  Table . No signHSPA1A. Deregulated expression of Hsp70 at the protein level has been reported in KIRC [p\u00a0=\u00a00.709). A second biomarker, STAT5-alpha (encoding gene STAT5A), was prognostic for survival in stage II . Compared with the stage-specific protein biomarkers, mRNA biomarkers were surprisingly deficient in the early stages of KIRC  but were abundant in stage IV . In contrast, in stage IV we found a total of 15 mRNA biomarkers, including KDR.Using the PMC sample group, we screened for mRNA biomarkers and discovered 15 that were stage-specific and prognostic , ACACA , and CCNB1 .Only four genes were associated with both stage-specific protein biomarkers and mRNA biomarkers: ACACA, BCL2, CCNB1, CCNE1, DVL3, ERBB3, FASN, RAD51, and RB1.Next, we compared the 15 stage-specific protein biomarkers and the 15 stage-specific mRNA biomarkers with the 52 genes shared between the protein and mRNA biomarkers. As a result, we found seven stage-specific protein biomarkers among the 52 general biomarkers: ACC1, Cyclin_B1, FASN, GATA3, GAB2, MAPK_pT202_Y204, and Rad51. In addition, we found nine stage-specific mRNA biomarkers among the 52 general biomarkers: VHL, BAP1, PBRM1, and STAG2, are associated with frequent somatic, nonsynonymous mutations [VHL displayed modest prognostic power [VHL as a stage-specific mRNA biomarker in stage IV . Among the four genes shared by stage-specific protein biomarkers and mRNA biomarkers, only the biomarker ACC1 (gene: ACACA) had sufficient mutation data for survival analysis; that is, no other biomarker had at least five samples with mutations. However, our analysis indicated that ACC1 has no prognosis power, even though both its mRNA and protein expressions were significant prognostic biomarkers for stage IV KIRC  is another stage II-specific biomarker. Its corresponding protein participates in the signal transduction process by mediating cellular response to ERBB4 [STAT5A\u2019s involvement in many cancers, including prostate cancer [GAB2) is an adaptor protein that is important for cancer-signaling transduction processes, including ERK signaling and PI3K-AKT signaling [PEA15, is involved in cell proliferation and apoptosis, and an ovarian cancer study showed that this gene is a promising target for cancer treatment [YAP_ps127 is a stage II-specific biomarker identified in our analysis. The corresponding gene, e cancer . STAT5-ato ERBB4 . STAT5A\u2019e cancer , oral sqe cancer , 34, bree cancer , has beeignaling . PEA-15 reatment . The stareatment .The most significantly enriched KEGG pathway for the 52 general prognostic biomarkers was prostate cancer. The renal clear cell carcinoma pathway (hsa05211) was not observed on the enriched pathways list. We manually checked the individual biomarkers that were involved in the renal clear cell carcinoma pathway, but only seven of 148 genes investigated in this study were found in the renal clear cell carcinoma pathway. This may explain why the pathway was not included on the list of enriched pathways.Although our study reported a number of candidate protein and mRNA biomarkers specific to KIRC, it had several limitations. The first limitation is the existence of covariates. Covariates data is important for constructing a reliable prognostic model . In our The second limitation of this study is that the proteins we investigated were restricted to those assayed in an RPPA array. Although these proteins were carefully selected and usually play important roles in cancer pathologies, it is possible that many other proteins that were not included in the RPPA array are also prognostic for KIRC survival. Wang et al. \u2018s  study, wThe third limitation of our study is that we were restricted in the types of cancer we could include. We observed that, among the cancer types we examined, there are many prognostic protein biomarkers only in KIRC. However, because of the rapid accumulation of multi-omics data for many other cancer types , we will soon be able to seek biomarkers in other cancer types/subtypes; thus, the statement that there are many prognostic protein biomarkers only in KICR may need to be revised. Finally, our study only included protein-expression and gene-expression data. It is possible that data on methylation and noncoding RNA (microRNA or long noncoding RNA) have now become available for KIRC. Gene regulation is a complex and dynamic process, and with the inclusion of additional data types, we will gain a deeper understanding of biomarker function and regulation in KIRC tumorigenesis. This knowledge, in turn, will lead to the development of better therapeutic strategies for specific subgroups of patients with KIRC. With the rapid accumulation of multi-omics data, a comprehensive investigation of the transcriptome and proteome changes in KIRC may serve as the first step to reveal the mechanisms underlying these biomarkers.p value threshold at 0.01, frameshift deletions in SETD2 was found to be significant (p\u00a0=\u00a04.88\u00a0\u00d7\u00a010\u22123).Mutation resolution is important in biomarker screening. For the mutation biomarker screening analysis in KIRC, we also screened the mutation biomarkers with mutation types taken into consideration. Because the number of samples available would decrease for a particular mutation type, we only considered 10 genes which were most frequently mutated in KIRC. Chi-square test was used to identify prognostic biomarkers. For each gene in the analysis, we required \u22655 samples to carry the mutations of each type. With nominal The results we presented in this work required further validation in independent datasets. Currently, TCGA is the only data source that provide both mRNA-expression data and protein-expression data for KIRC. With the rapid accumulation of multi-omics data for cancer, we expected that more data would be available and future studies would warrant the validity of our work.Our pan-cancer screening revealed a surprisingly large number of protein biomarkers that were prognostic for survival in patients with KIRC. This large number of biomarkers was similarly observed at the mRNA biomarker level, but not at the DNA mutation level. Additionally, this feature was observed in KIRC, but not in other common types of cancer. Furthermore, several stage-specific KIRC biomarker candidates were identified and discussed. In summary, our study suggests that protein-level biomarkers could potentially have clinical value in determining the prognosis for KIRC patients and in developing treatment strategies based on tumor stage.cgdsr. For each cancer type, we obtained the overall survival (in months) of the patients from whom the corresponding samples were taken.Preprocessed mutation data were retrieved from the TumorPortal . Both nop values were adjusted by the Benjamini and Hochberg method [For each cancer type, we included two somatic mutation types: insertion/deletion (indel) and SNV. Specifically, for indel mutations, we included all the available indel mutations except for silent indel mutations, and for SNVs, we excluded all the synonymous or silent SNVs. For our mutation analysis, we required \u226560 samples for each cancer type, and all ten cancer types fulfilled this criterion. We used the chi-square test to identify prognostic biomarkers in the filtered data. For each gene in the analysis, we required \u22655 samples carrying the mutation(s). Statistical g method . The FDRcoxph function in the R package survival. Multiple testing corrections were performed using Benjamini and Hochberg\u2019s method. Unless otherwise stated, we used an FDR threshold of 0.05 to define significant biomarkers.For each of the ten cancer types, we first identified three sample groups Fig. . The PC KIRC stage-specific prognostic biomarkers were screened using both protein-expression and mRNA-expression data. The samples in the PMC sample group were used to screen the stage-specific protein and mRNA biomarkers, and since both kinds of biomarkers were screened using the same sample set, the results were more comparable. Samples were categorized by their stage annotation, which was defined based on the American Joint Committee on Cancer sample stage information and available in the clinical data. For example, our main stage I included the American Joint Committee on Cancer\u2019s stage I, stage IA, and stage IB. We initially had five main stages for KIRC. For the follow up analyses, however, we excluded any main stages with sample sizes \u22643. This process removed main stage IV, so we only analyzed the data for the remaining four main stages.coxph in the R package survival. The p values from the Cox proportional hazards regression log- rank test were corrected for multiple testing using Benjamini and Hochberg\u2019s method [p value <0.001). Significant, stage-specific prognostic markers were used for downstream analysis.For each RPPA protein or corresponding gene, we performed survival analyses using s method . The sigTo perform the enrichment analysis of the KIRC protein and mRNA biomarkers, we converted the protein biomarkers into gene symbols and used genes as the basis for the enrichment analysis. We used a hypergeometric test to assess the enrichment level, as we had done in previous studies \u201347.We used the PCC to assess the coregulation of the 52 general prognostic biomarkers. We obtained the gene symbols corresponding to the 148 RPPA proteins and extracted their protein expression profiles. When multiple protein biomarkers were mapped to one gene, one representative protein biomarker was randomly chosen. Pairwise gene correlation was calculated for the protein expression profile, and samples with missing values were excluded from this step of PCC computation. We defined the distance as one minus the absolute value of the PCC and performed hierarchical clustering of the candidate biomarkers. The PCC for mRNA expression was calculated the same way and is plotted in the lower triangle of the heatmap in Fig. Oncoprint plots were used to confirm whether the most significant prognostic biomarkers clustered together in a subset of samples. We plotted oncoprints for both the protein-expression and the mRNA-expression data. For each protein or each gene, the 25% quartile and the 75% quartile of the gene-expression profile were calculated using data for the entire sample set. Samples with expression values >75% quantile were labeled as highly expressed, while samples with expression values <25% quantile were labeled as poorly expressed. Based on this procedure, we developed an in-house R script to generate oncoprint plots. The script is available upon request.Additional file 1: Table S1.Statistical summary of KIRC protein and mRNA biomarkers prognostic for survival (XLSX 19 kb)Additional file 2: Table S2.Gene set enrichment analysis results for protein biomarkers prognostic for KIRC survival (XLSX 16 kb)Additional file 3: Figure S1.Comparison of protein-expression and mRNA-expression correlations between prognostic proteins biomarkers and non-prognostic proteins (PDF 15 kb)Additional file 4: Table S3.Screening results for stage-specific RPPA protein biomarkers prognostic for KIRC (XLSX 61 kb)Additional file 5: Table S4.Screening results for stage-specific mRNA biomarkers prognostic for KIRC (XLSX 49 kb)Additional file 6: Figure S2.Kaplan\u2013Meier (KM) plots of ACC1 protein data  and mutation data  (PDF 39 kb)"}
+{"text": "Human-mediated vectors often inadvertently translocate species assemblages to new environments. Examining the dynamics of entrained species assemblages during transport can provide insights into the introduction risk associated with these vectors. Ship biofouling is a major transport vector of nonindigenous species in coastal ecosystems globally, yet its magnitude in the Arctic is poorly understood. To determine whether biofouling organisms on ships can survive passages in Arctic waters, we examined how biofouling assemblage structure changed before, during, and after eight round-trip military voyages from temperate to Arctic ports in Canada. Species richness first decreased (~70% loss) and then recovered , as ships travelled to and from the Arctic, respectively, whereas total abundance typically declined over time . Biofouling community structure differed significantly before and during Arctic transits as well as between those sampled during and after voyages. Assemblage structure varied across different parts of the hull; however, temporal changes were independent of hull location, suggesting that niche areas did not provide protection for biofouling organisms against adverse conditions in the Arctic. Biofouling algae appear to be more tolerant of transport conditions during Arctic voyages than are mobile, sessile, and sedentary invertebrates. Our results suggest that biofouling assemblages on ships generally have poor survivorship during Arctic voyages. Nonetheless, some potential for transporting nonindigenous species to the Arctic via ship biofouling remains, as at least six taxa new to the Canadian Arctic, including a nonindigenous cirripede, appeared to have survived transits from temperate to Arctic ports.The online version of this article (doi:10.1007/s00227-016-3029-1) contains supplementary material, which is available to authorized users. The introduction of nonindigenous species (NIS) by human activities is a key component of global environmental change  and shallow (mean depth\u00a0~\u00a0150\u00a0m) inland sea connected to the Arctic Ocean by the Foxe Basin in the north and the Labrador Sea by the Hudson Strait in the east , and after eight round-trip voyages from Halifax to Arctic ports in Canada between July and September of 2008\u20132012 Table\u00a0, SylvestWe processed all samples under a dissecting microscope in the laboratory following established protocols  niche areas, (2) bow, (3) stern, and (4) main hull. Niche areas, including sea chest grating, stern tube, rope guard, propeller, and rudder, are topographically complex and protected areas on ships; such locations are particularly vulnerable to biofouling . We classified all taxa into three categories: (1) existing: those that have previously been recorded in the Arctic region of Canada; (2) new: those that have not been reported from Canada\u2019s Arctic; and (3) unknown: taxa whose distribution could not be determined because they were not identified to species level. Existing species are presumably native to the port region, but insufficient baseline biodiversity information for Canada\u2019s Arctic coastal systems prevents us from confirming their biogeographic status . We also tested for differences in assemblage structure for matched samples (i.e. those collected at the same hull locations over time) quantitatively using permutational multivariate analysis of variance (PERMANOVA), following recommendations of Anderson et al. -transformed abundance data and used the Bray\u2013Curtis dissimilarity index as the multivariate distance measure. However, since both approaches provided consistent results, we present results obtained based on presence\u2013absence data only for brevity. All statistical analyses were conducted using PRIMER v6 with the PERMANOVA\u00a0+\u00a0add-on . A. improvisus has the potential to survive if propagules are released into Churchill, based on its known temperature and salinity requirements . The majority (73%) of these taxa were mobile invertebrates including acarines, amphipods, chaetognaths, chironomids, cladocerans, copepods, decapods, echinoderms, gastropods, isopods, nematodes, nemerteans, oligochaetes, ostracods, platyhelminths, and free-moving polychaetes, followed by sessile and sedentary taxa (18%) including bivalves, bryozoans, cirripedes, cnidarians, hydrozoans, tube- or burrow-dwelling polychaetes, and tunicates. Algal taxa (9%) were also present in biofouling samples. We classified 54, 58, and 181 taxa as existing, new, and unknown taxa, respectively (Table S1). When considering only samples collected at Canadian Arctic ports, we identified a total of 58 distinct taxa (Table S1). These include six taxa that have not been reported in the Canadian Arctic: the copepod Species richness of biofouling assemblages generally decreased (mean percent loss of 70%) as ships travelled from Halifax to Canadian Arctic ports but recovered  after ships returned to Halifax Fig.\u00a0a. PERMANChromadorina sp. 1 (dissimilarity contribution\u00a0=\u00a09.59%) and decreases in abundance of the copepod H. obscurus and the nematode Geomonhystera sp. 1 . In the case of during versus after Arctic samples, differences in assemblage structure were primarily a result of decreases in abundance of the nematodes Chromadorina sp. 1 and Geomonhystera sp. 1  and an increase in abundance of the copepod Tisbe spp. (dissimilarity contribution\u00a0=\u00a08.68%). Assemblage structure for samples collected before and after Arctic transits was not significantly different from each other  and nematodes (e.g. Chromadorina sp. and Geomonhystera sp.). We attribute increases in species richness after Arctic voyages to recolonization by port communities because there were delays of two to three days in resampling ships after their return from the Arctic and because assemblage structure is comparable between before and after Arctic samples. Collectively, our results suggest that biofouling assemblages on ships generally have poor survivorship, about 70 and 82% loss in species richness and total abundance, respectively, during passage in Arctic waters. Previous studies examining the pre- and post-voyage survivorship of biofouling organisms in temperate and Antarctic waters also observed significant losses in percent cover or abundance after transits  and balanomorph cirripedes on a research ship that travelled from the UK to the Antarctic Peninsula. In contrast, the likelihood of transferring NIS on ship hulls from Arctic to temperate ports seems low. Although there were biofouling taxa  present in after Arctic samples that were not recorded before Arctic, none are nonindigenous to Halifax.The potential to transport new species, including NIS, to the Arctic via ship biofouling is considerable, as six taxa that have not been reported from the Canadian Arctic including the copepod ely OBIS . A. imprWhile biofouling assemblage structure varied by hull location, temporal variation in assemblage structure during Arctic voyages was independent of location on the hull. A number of studies have found significant differences in biofouling species richness and percent cover across underwater locations on ship hulls, with niche areas such as sea chest gratings, propellers, and rudders tending to be more heavily fouled than the main hull itself  in biofouling samples after the exclusion of taxa present in control port water samples is interesting. It is unclear whether these species were members of the plankton community in ports or the biofouling assemblage on ships. It is possible that they are local planktonic species and that our control water samples (see Methods) were not sufficient to account for them in our analyses. If this is the case, their presence in biofouling samples may inflate species richness and abundance estimations. To further investigate this point, we compared species identified in this study to zooplankton species detected in water samples collected at Canadian Arctic ports using metabarcoding with >97% sequence similarity threshold in Basic Local Alignment Search Tool (BLAST) searches Supplementary material 2 (DOC 501\u00a0kb)Below is the link to the electronic supplementary material."}
+{"text": "Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism is poorly documented in HCC. Here, we found that people carry A allele at CA9 rs1048638, a 3\u2032UTR SNP, has higher risk of HCC. rs1048638-CA correlates with advanced stages, larger tumor sizes, more vascular invasion, and shorter survival of HCC patients. A allele at CA9 rs1048638 impairs miR-34a, a tumor suppressor miRNA in HCC, binding to CA9 3\u2032UTR and desensitizes CA9 mRNA to miR-34a-dependent RNA degradation. CA9 expression levels were also correlated with miR-34a levels and rs1048638 genotypes in HCC patients. rs1048638 influences HCC risk and progression through effects on miR-34a-targeted CA9 expression in HCC. In conclusion, genetic variations of the CA9 3\u2032UTR play important roles in regulating CA9 expression and cancer progression, which is a novel determinant and target for HCC metastasis and prognosis. Surgical resection, potentially curative treatment, is only applicable to the small subset of patients diagnosed at early stages2. Unfortunately, conventional or targeted chemotherapies have not been fully developed to have significant impacts on overall survival3. Therefore, it is pivotal to improve the prognosis of HCC patients by developing effective individualized treatments based on molecular classification.Hepatocellular carcinoma (HCC) possesses a dismal prognosis and is the second leading cause of cancer-related deaths worldwide2O\u2009+\u2009CO2\u2009\u2194\u2009H+\u2009+\u2009HCO3\u2212, which is crucial to tumor pH homeostasis5. CA9 expression is induced in tumor cells under hypoxia and helps maintain a normal intracellular pH while facilitating an acidic extracellular pH4. An acidic extracellular microenvironment is an important feature of cancer, and also promotes cancer progression through activating proteinase activity, disrupting adherence junctions, inhibiting drug uptake, and stimulating the metastatic potential8. CA9 expression is associated with poor clinical outcomes in several tumors including head and neck, cervix, kidney, and lung cancers11. Recently, CA9 expression was also identified as a poor prognostic factor in patients with resectable HCC12.Carbonic anhydrase IX (CA9) is a membrane-associated glycoprotein belonging to a family of zinc-containing enzymes. It catalyzes the reversible reaction HCA9 gene is localized on chromosome 9p12-1313. More than 30 single-nucleotide polymorphisms (SNPs) have been identified in the CA9 gene. Most of them are located in exon regions. These polymorphisms may affect CA9 activity and regulation, and some of them are thought to be genetic risk factors for disease susceptibility16. This suggests that genetic variations of CA9 may also induce differences in the incidence risks and outcomes of cancers. However, little is known about the impacts of CA9 polymorphisms on cancer susceptibility and progression of HCC. In this study, we first analyzed four SNPs  in a cohort containing 312 HCC patients and 312 healthy volunteers , was identified and further evaluated in another independent cohort of HCC patients (n\u2009=\u200986). To further explore the possible roles of CA9 polymorphisms in HCC progression and metastasis, we also performed functional analyses on the selected SNP using both in vitro and in vivo assays and evaluated their correlations with CA9 expression levels in HCC. We identified a critical microRNA (miR)-34a-CA9 regulation axis controlling HCC metastasis, and CA9 polymorphisms disrupt this crucial regulation.The human ers Fig.\u00a0. The prop\u2009>\u20090.05). These results suggest that HCC patient data were comparable to control data. To obtain adequate power for evaluating the potential association and test the putative functional relevance of CA9, three SNPs, including rs2071676, rs3829078 and rs1048638 with minor allele frequencies >5% were chosen. Furthermore, another SNP of CA9 gene  was selected since this SNP was found in the cancer patients15. For the four analyzed SNPs, the genotype distribution of controls was consistent with those expected from Hardy-Weinberg\u2019s equilibrium (p\u2009>\u20090.05). rs1048638 was the only SNP observed to be correlated with HCC risk , the most important predictor of HCC recurrence and survival17. Since our primary cohort had no patient survival data, we analyzed the survival probabilities of the rs1048638 polymorphism in another independent cohort composed of 86 HCC patients with complete follow-up information. The survival analysis showed that HCC patients carrying rs1048638-CA had shorter overall (p\u2009=\u20090.006) and disease-free (p\u2009=\u20090.019) survival times  and disease-free  survival rates compared to patients with low CA9 expression  duplexes of the miR-34a and CA9 3\u2032UTRs. The A allele of rs1048638 led to a far worse energy of \u221212.9\u2009kcal/mole than did the C allele  with miR-34a hybridization  mice. At 6 weeks after inoculation, primary tumors from CA9 knockdown cells showed a significant reduction in the luciferase signal compared to those of control-shRNA cells . Furthermore, metastatic tumors were found in the pancreas and mesentery of mice injected with control cells, but loss of CA9 led to a significant decrease in metastatic dissemination . To determine the miR-34a/CA9 regulatory axis in HCC metastasis, Mahlavu cells with control, miR-34a overexpression, CA9 overexpression, or miR-34a/CA9 co-overexpression were tested with the same orthotopic injection model using NOD/SCID mice. Overexpression of miR-34a led to a significant decrease in the primary tumor size in the liver and CA9 co-overexpression reversed this effect . Metastatic tumors were also barely detected in the pancreas and mesentery of mice injected with miR-34a-overexpressing cells compare with control cells , while CA9 co-overexpression slightly but not significantly increased pancreas and mesentery metastases. Taken together, these in vivo data provide further support that miR-34a and CA9 have functions in regulating tumor growth and metastasis of HCC cells.As the cell mobility and EMT process are critical to the development of tumor metastasisCA9 and miR-34a expression level was \u22120.21 , suggesting a negative correlation between them . On the contrary, miR-34a expression was not correlated with CA9 expression in specimens with rs1048638-CA or -AA . Collectively, the above clinical analysis suggests a pivotal role of the CA9 rs1048638 genotype in miR-34a-regulated CA9 expression in HCC.To evaluate the clinical correlations and importance of the rs1048638 polymorphism and miR-34a-CA9 regulation, we analyzed expression levels of miR-34a and CA9 in the TCGA HCC cohort, which is composed of 418 specimens. The correlation rho of hem Fig.\u00a0. Furtherhem Fig.\u00a0. To furt26. CA9 being expressed in many types of tumors indicates its relevance as a general marker of tumor hypoxia27. Despite the molecular and cellular functions of CA9 being well-characterized, the impacts of its gene polymorphism in cancer incidence and progression are not fully understand. In this study, we identified a single SNP, rs1048638, in the 3\u2032UTR of CA9 that significantly increases HCC risk and was correlated with poor outcomes in HCC patients. Patients carrying the A allele at rs1048638 were associated with an adverse disease status, represented by a larger tumor size, a higher vascular invasion level, and more patients at a late pathological stage. Notably, CA9 rs1048638-CA was associated with poor survival in uni- and multivariate analyses. In this regard, the CA9 polymorphism at rs1048638 may represent a novel genetic risk factor and prognostic marker of HCC.CA9 is the most widely expressed gene in response to hypoxia. Its crucial role in intracellular pH maintenance represents the means by which cancer cells adapt to the toxic conditions of the extracellular milieu29. In contrast, CA9 is expressed in a variety of cancer tissues, including malignancies of the brain, head/neck, lung, breast, cervix uteri, kidney, and colon/rectum31. The diagnostic value of CA9 can be traced to 1986, when a monoclonal antibody against G250, later revealing 100% identity to CA9, exhibited tumor-specific expression in many types of cancer32. Interestingly, the level of CA9 expression is also associated with staging and survival prognosis in several types of human tumors. Higher levels of CA9 expression are associated with poor clinical outcomes in cervical, rectal, breast, lung, and brain tumors35. However, there are also reports suggesting that low levels of CA9 expression indicate a poor prognosis in cancers such as renal cell carcinoma and cholangiocarcinoma37. Although the discrepancy might be related to different cutoff values proposed to discriminate between high and low expressions of CA9, it also implies that the CA9 expression level is not an unbiased prognostic marker. Besides, CA9 expression is highly regulated by hypoxia and results in the rather heterogeneous expression pattern of CA9 in tumors, rendering the measurement of CA9 expression more difficult38. Our previous studies of oral carcinoma suggested that the CA9 polymorphism at rs2071676 was correlated with lymph node metastasis15. People with at least one A allele of CA9 rs1048638 had an increased risk of invasive urothelial cell carcinoma16. The synonymous C allele variant of rs12553173 was associated with improved overall survival in metastatic renal cell carcinoma14. We herein identified the CA9 rs1048638 polymorphism as an independent prognostic factor in HCC. These lines of evidence suggest that CA9 SNPs may be suitable for predicting the risk and prognosis of cancers. As the cost and throughput of genotyping and DNA sequencing have rapidly improved in the past years, detecting the CA9 polymorphism may represent as a better strategy than assessing CA9 expression in the era of personalized medicine.The expression of CA9 in normal tissues has a limited distribution in the gastrointestinal tract epithelium, ovarian coelomic epithelium, pancreatic ductal cells, hair follicle cells, and fetal rete testes16, the prevalence rate of the \u201cA\u201d allele of rs1048638 may be similar or slightly lower in eastern populations.In the current study, frequencies of the CA genotype of rs1048638 were 18.3% (57/312) and 26.7% (23/86) in two Taiwanese HCC cohorts, comparable to the frequency estimated from TCGA HCC cohort . However, the AA genotype of rs1048638 was only present in TCGA HCC cohort at a frequency of 2.8% (9/325). This discrepancy may have been due to different prevalence rates of the \u201cA\u201d allele of rs168438 in eastern and western populations or the limited number of enrolled patients. However, since the AA genotype of rs1048638 was detected in 0.9% (4/462) of oral carcinoma cases and 1.4% (3/221) of urothelial cell carcinoma cases in our previous studies39. However, we did not observed significant increase of pancreas and mesentery metastasis after CA9 overexpression in our orthotopic xenograft model. The discrepancy may came from the cell model we used in this study. Among HCC cell lines we surveyed for CA9 expression, Mahlavu cells expressed the highest level of CA9 -1\u03b1 target gene under hypoxic conditions. However, little is known about the miRNA-dependent regulation of CA9 expression in cancer. We herein report that CA9 is targeted by miR-34a, and this results in decreases in both CA9 mRNA and protein levels. Interestingly, like CA9, miR-34a is also regulated under hypoxic conditions. Du et al. reported that hypoxia induces downregulation of miR-34a expression and thus promotes the EMT49. Similarly, we also observed that several mesenchymal markers were suppressed by miR-34a or CA9 short hairpin (sh)RNAs. However, miR-34a is not directly regulated by HIF-1\u03b1. A recent report demonstrated that Snail2 suppresses miR-34a expression in hypoxia-induced mammospheres. Consistent with our findings, they also suggested that CA9 is a miR-34a target50. Recently, it was reported that CA9 in some types of cancer was predominantly regulated by epigenetic events, such as CpG methylation, rather than by hypoxia47. The roles of miR-34a-dependent CA9 regulation, as another level of epigenetic regulation, in cancer under hypoxia or normoxia are still worth investigating in the future. Furthermore, in contrast to CA9, miR-34a is downregulated in multiple types of cancer51. We also observed a reverse correlation between miR-34a and CA9 levels in HCC specimens. Hence, these findings support an important role of miR-34a in CA9 expression, and thus highlight the importance of rs1048638 polymorphisms in controlling CA9 expression.CA9 expression and activity in cancer cells are tightly regulated at multiple levels, including DNA methylation, transcription, post-translational modification, and proteinase-mediated cleavageCA9 3\u2032UTR as a novel diagnostic and prognostic factor for HCC. The rs1048638-A genotype significantly affects miR-34a targeting and expression levels of CA9. The miR-34a-CA9 axis is important in controlling tumor growth and metastasis of HCC cells. This indicates that the genetic variation at rs1048638 of the CA9 3\u2032UTR plays an important role in regulating CA9 expression and cancer progression of HCCs, which is a novel determinant and target for HCC metastasis and prognosis. This provides further evidence for the important role of CA9 in HCC progression and new insights into the regulatory mechanism governing CA9 expression, which may be a novel therapeutic target for HCC.In summary, we identified an SNP in the This study was approved by the institutional review board of Chung Shan Medical University Hospital (CSMUH). Subjects, including 312 patients with HCC and 312 cancer-free controls, were recruited in this investigation from 2007 to 2015, and all participants provided informed written consent at enrollment. A diagnosis of HCC was histologically confirmed in all cases. During the same study period, ethnically matched individuals who had neither been diagnosed with HCC nor had a self-reported history of cancer at any site were enrolled as controls. The TNM classification of the American Joint Committee on Cancer (AJCC) was used for staging of hepatocellular carcinoma. Whole-blood specimens collected from controls and HCC patients were placed in tubes containing ethylenediaminetetraacetic acid (EDTA), immediately centrifuged, and stored at \u221280\u2009\u00b0C. Tumor RNA samples of 86 HCC specimens for a survival analysis were provided by the Taiwan Liver Cancer Network (TLCN). The TLCN is funded by the National Science Council to provide researchers in Taiwan with primary liver cancer tissues and their associated clinical information. The use of the 86 HCC tissues in this study was approved by the TLCN User Committee. All experiments were performed in accordance with relevant guidelines and regulations of TLCN and CSMUH.Genomic DNA was extracted using QIAamp DNA blood mini kits  following the manufacturer\u2019s instructions. We dissolved DNA in TE buffer  and then quantified it by measuring the OD260. The final preparation was stored at \u221220\u2009\u00b0C and was used to act as templates for the polymerase chain reaction (PCR).15.Allelic discrimination of the CA9 rs2071676, rs3829078, and rs1048638 allelic polymorphisms was assessed with an ABI StepOne\u2122 Real-Time PCR System , and analyzed with Sequence Detection Systems (SDS) vers. 3.0 software (Applied Biosystems) using the TaqMan assay. The final volume for each reaction was 5\u2009\u03bcL, containing 2.5\u2009\u03bcL TaqMan Genotyping Master Mix, 0.125\u2009\u03bcL TaqMan probe mix, and 10\u2009ng genomic DNA. The real-time PCR included an initial denaturation step at 95\u2009\u00b0C for 10\u2009min, followed by 40 cycles at of 95\u2009\u00b0C for 15\u2009s and then at 60\u2009\u00b0C for 1\u2009min. In addition, 376del393 allelic polymorphisms were assessed with the PCR as described previouslyhttp://bibiserv.techfak.uni-bielefeld.de/rnahybrid). RNAhybrid determined the most energetically favorable hybridization patterns using the minimum free energy (MFE) of two RNA fragments of different lengths, i.e., long (3\u2032-UTR of CA9) and short (mature miRNA sequences). The parameters used in the analysis were: the number of hits per target\u20133 nucleotides; maximum mismatch size\u20131 nucleotide; overhangs\u20132 nucleotides; and the MFE considered for each microRNA/target duplex was higher than \u221215\u2009kcal/mole assessable on a perfect match between the mature miRNA and its target52.In this study, we predicted the targets using the web-based tool, RNAhybrid on BiBiServ2 . 293T cells were co-transfected with the miR-34a or miR-449a mimic or negative control, and a vector containing the CA9 3\u2032UTR. The pRL-TK Renilla control vector (0.1\u2009\u03bcg)  was also co-transfected as an internal control for transfection efficiency. GenMuteTM siRNA & DNA Transfection Reagent  was used for this transfection process according to the manufacturer\u2019s instructions. Cells were harvested at 48\u2009h after transfection and analyzed for luciferase activity using the Dual-Glo Luciferase Reporter Assay System (Promega).2. Cells in the log phase of growth were harvested by trypsinization for use in various assays and in vivo studies.The Huh1, Huh6, and Huh7 HCC cell lines were obtained from the Health Science Research Resources Bank . The Hep3B and PLC5 cell lines were obtained from the American Type Culture Collection . HCC cells were cultured in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 10% fetal bovine serum . All cell types were cultured at 37\u2009\u00b0C in a humidified incubator containing 5% CO6) into 10-cm2 dishes 1 day before transfection. Cells were then transfected with 10\u2009\u03bcg of CA9 shRNA or an miR-34a-expressing plasmid together with 10\u2009\u03bcg of pCMV\u0394R8.91 (packaging vector) and 1\u2009\u03bcg of pMDG (envelope vector). After 6\u2009h of incubation, the transfection medium was replaced with fresh culture medium. Forty-eight hours later, the lentivirus-containing medium was collected from the transfections and spun down at 1500\u2009rpm for 5\u2009min to pelletize the cell debris, the supernatant was filtered with a 0.45-\u03bcm filter, and target cells were infected with the fresh lentivirus-containing medium supplemented with 8\u2009\u03bcg/ml polybrene for 24\u2009h.A lentiviral vector and its packaging vectors were transfected into 293T packaging cells by calcium phosphate transfection. Briefly, 293T cells were split (1053. About 2\u2009\u00d7\u2009105 cells were plated into the top chamber onto a Matrigel-coated (for invasion assay) or non-coated (for migration assay) membrane and allowed to invade into the lower chamber for 24\u2009h. Invaded cells were fixed and stained with 0.2% crystal violet. Stained cells were quantified by counting.The migration and invasion assay was performed as previously described53 using the following primary antibodies: anti-CA9 , anti-GAPDH , anti-vimentin , anti-Snail , anti-Slug , and anti-Twist .A Western blot analysis was carried out as previously described6) stably expressing CA9 shRNA or miR-34a were resuspended in 20\u2009\u03bcL of a 1:1 mixture of PBS and Growth Factor Reduced-Matrigel  and orthotopically injected into one lobe of the liver. Mice were sacrificed 4 weeks later, and the liver, pancreas, and mesenterium were removed. Metastatic lesions were monitored and quantified using a noninvasive bioluminescence system . Consecutive sections were also made for every tissue block of the organs and stained with hematoxylin-eosin (H&E).All animal work was done in accordance with a protocol approved by the National Taiwan University College of Medicine and National Taiwan University College of Public Health institutional animal care and use committees. Age-matched non-obese diabetic severe combined immunodeficient (SCID) male mice (6~8 weeks old) were used. Mahlavu cells . RNA (at 1\u2009\u03bcg) was reverse-transcribed with an iScriprt cDNA synthesis kit , and complementary (c)DNA obtained was used for the real-time quantitative PCR. The rhPCR assay primers were designed by beacon designer version 8.0 and synthesized by IDT : forward primer: 5\u2032-GTAACTGTCCTGTCCTrGCTCAA-3\u2032, and reverse primer: 5\u2032-TATAAATATTTATTTTAAAAAATTTCTTrUGCAGA-3\u2032. The reaction mixture (20\u2009\u03bcl) contained 2\u2009\u03bcl of the cDNA template, 0.4\u2009\u03bcl each of the primers (10\u2009\u03bcM), 200\u2009mU RNase H2 , and iQ SYBR Green Supermix  amplified as follows: denaturation at 95\u2009\u00b0C for 3\u2009min, followed by 40 cycles at 95\u2009\u00b0C for 10\u2009s and 60\u2009\u00b0C for 30\u2009s. Direct detection of PCR products was monitored by measuring the fluorescence produced due to SYBR Green dye binding to dsDNA after every cycle.To examine https://cghub.ucsc.edu/) as Binary Sequence Alignment Map (BAM) files. The genotype of rs1048638 in each LIHC sample was called using the Unified Genotyper tool of Genome Analysis Toolkit (GATK) with default settings54. If the read depth in a given sample for rs1048638 was less than six, no call was made; otherwise, if non-reference allele frequency was less than 20%, the call was \u201cCC\u201d; if the non-reference frequency was greater than 80%, the call was \u201cAA\u201d; if it was between 20% and 80%, the call was \u201cCA\u201d.The exome-sequenced liver hepatocellular carcinoma (LIHC) and matched normal samples generated by The Cancer Genome Atlas (TCGA) project were downloaded from CGhub (5 cells) with CA9 knockdown, CA9 overexpressed, miR-34a overexpressed, or their respective controls were orthotopically injected into left liver lobe of NOD/SCID mice (6\u20138 weeks old). Six weeks after implantation, the mice were sacrificed and tumor imaging in the liver, pancreas, and mesentery were performed by administration of luciferin  and bioluminescence technology (Xenogen IVIS-100 imaging system). Photons emitted from specific regions were quantified using Living Image\u00ae software (Xenogen Corporation). The use of animals for this study was approved by the National Taiwan University College of Medicine Institutional Animal Care and Use Committee.Male mice were randomly divided into groups of six to eight mice per group. Mahlavu cells .A goodness-of-fit v2 test was used to evaluate Hardy-Weinberg equilibrium for the biallelic markers. Differences in demographic parameters between HCC patients and cancer-free controls were estimated using Fisher\u2019s exact test or the Mann-Whitney U-test. The adjusted odds ratios  with their 95% confidence intervals (CIs) obtained by multiple logistic regression models after controlling for other covariates were used to assess the correlation of genotype frequencies with the risk of liver cancer plus clinical characteristics. The haplotype-based analysis was conducted using the Phase program 26. A Supplementary Information"}
+{"text": "How innate T cells (ITC), including invariant natural killer T (iNKT) cells, mucosal-associated invariant T (MAIT) cells, and \u03b3\u03b4 T cells, maintain a poised effector state has been unclear. Here we address this question using low-input and single-cell RNA-seq of human lymphocyte populations. Unbiased transcriptomic analyses uncover a continuous \u2018innateness gradient\u2019, with adaptive T cells at one end, followed by MAIT, iNKT, \u03b3\u03b4 T and natural killer cells at the other end. Single-cell RNA-seq reveals four broad states of innateness, and heterogeneity within canonical innate and adaptive populations. Transcriptional and functional data show that innateness is characterized by pre-formed mRNA encoding effector functions, but impaired proliferation marked by decreased baseline expression of ribosomal genes. Together, our data shed new light on the poised state of ITC, in which innateness is defined by a transcriptionally-orchestrated trade-off between rapid cell growth and rapid effector function. Innate T cells (ITC) contain many subsets and are poised to promptly respond to antigens and pathogens, but how this poised state is maintained is still unclear. Here the authors perform single-cell RNA-seq to align the various ITC subsets along an \u2018innateness gradient\u2019 that is associated with changes in proliferation and effector functions. These \u201cdonor unrestricted\u201d T-cell populations have been estimated to account for as much as 10\u201320% of human T cells2, and have critical roles in host defense and other immune processes. We and others now refer to these cells as innate T cells (ITC).Within the spectrum of immune defense, \u201cinnate\u201d and \u201cadaptive\u201d refer to pre-existing and learned responses, respectively. Mechanistically, innate immunity is largely ascribed to \u2018hardwired,\u2019 germline-encoded immune responses, while adaptive immunity derives from recombination and mutation of germline DNA to generate specific receptors that recognize pathogen-derived molecules, such as occurs in T and B cell receptors. However, the paradigm that somatic recombination leads only to adaptive immunity is incorrect.\u00a0Over the past 15 years, T-cell populations have been identified with T-cell antigen receptors (TCRs) that are conserved between individuals. Many of these effector-capable T-cell populations are established in the absence of pathogen encounter. Examples of such T-cell populations include invariant natural killer T (iNKT) cells, mucosal-associated invariant T (MAIT) cells, \u03b3\u03b4 T cells, and other populations for which we have a more limited understanding3. MAIT cells recognize small molecules, including bacterial vitamin B-like metabolites presented by another non-MHC-encoded molecule, MR14. It is not known whether specific antigen-presenting elements drive the development or activation of \u03b3\u03b4 T cells. One major \u03b3\u03b4 T-cell population bearing V\u03b32-V\u03b49 TCRs is activated by self- and foreign phospho-antigens in conjunction with a transmembrane butyrophilin-family receptor, BTN3A16. The antigens recognized by other human \u03b3\u03b4 T-cell populations are not clear, although a subset of these cells recognizes lipids presented by CD1 family proteins7. A second shared feature of ITC is that their responses during inflammation and infection exhibit innate characteristics, such as rapid activation kinetics without prior pathogen exposure, and the capacity for antigen receptor-independent activation. Inflammatory cytokines such as IL-12, IL-18, and type I interferons can activate ITC even in the absence of concordant signaling through their TCRs, and such TCR-independent responses have been reported in iNKT cells8, MAIT cells9, and \u03b3\u03b4 T cells10.ITC develop from the same thymic progenitor cells as adaptive T cells, and each of these populations is thought to develop independently. However, ITC populations share several important features that distinguish them from adaptive cells. First, they do not recognize peptides presented by MHC class I and class II. iNKT cells recognize lipids presented by a non-MHC-encoded molecule named CD1dGiven the similar functions reported among different ITC populations, we hypothesize that shared effector capabilities may be driven by common transcriptional programs. Here, using low-input RNA-seq and single-cell RNA-seq, we transcriptionally define the basis of innateness in human ITC by studying them as a group, focusing on their common features rather than what defines each population individually. Using unbiased methods to determine global interpopulation relationships, we reveal as a primary feature an \u201cinnateness gradient\u201d with adaptive cells on one end and natural killer (NK) cells on the other, in which ITC populations cluster between the prototypical adaptive and innate cells. Interestingly, we observe a decreased transcription of cellular translational machinery and a decreased capacity for proliferation within innate cell populations. Innate cells rather prioritize transcription of genes encoding for effector functions, including cytokine production, chemokine production, cytotoxicity, and reactive oxygen metabolism. Thus, growth potential and rapid effector function are hallmarks of adaptive and innate cells, respectively.P\u2009=\u20091.4e\u201305, Pearson correlation, t test). MAIT  and V\u03b42  populations drove this association , which is consistent with previous findings12. We observed covariance between the frequencies of MAIT\u00a0and\u00a0iNKT cells , corrected for the other cell types and age , body mass index , or smoking status  after accounting for age. Together, these results show that human ITC contribute to a substantial portion of the peripheral T-cell repertoire, are variable between individuals, and decrease with age.To characterize the abundance and variability of ITC in humans, we quantified four major populations of ITC from 101 healthy individuals aged 20\u201358 years by flow cytometry, directly from peripheral blood mononuclear cells (PBMCs) in the resting state. We assessed the frequencies of iNKT cells, MAIT cells, and the two most abundant peripheral \u03b3\u03b4 T-cell groups, those expressing a V\u03b42 TCR chain (V\u03b42) and those expressing a V\u03b41 TCR chain (V\u03b41). MAIT cells contributed from 0.1 to 15% of T cells (mean 2.4%), iNKT cells from undetectable to 1.1% (mean 0.09%), V\u03b41 cells 0.25\u20136.2% (mean 1.25%), and V\u03b42 from 0.08 to 22% (mean 4.7%). The sum of these four cell types accounted for 0.9\u201325.7% of an individual subject\u2019s T cells (mean 8.4%)  did not differ significantly, reflecting both high IFN-\u03b3 production among a subset of CD8+ T cells and heterogeneity in the level of IFN-\u03b3 production by ITC following activation with PMA and ionomycin  and ionomycin for 4\u2009h, followed by intracellular staining for interferon-\u03b3 (IFN-\u03b3) production. Between 35 and 85% of MAIT, iNKT, V\u03b41, and V\u03b42\u2009T cells produced IFN-\u03b3 under these conditions, while a smaller percentage of adaptive CD4+), V\u03b41, and V\u03b42 cells , using linear mixed models. This analysis revealed 1884 genes significantly associated with the innateness gradient . All subsequent P-values reported for association with the innateness gradient are derived from linear mixed models, likelihood ratio test), including protein coding and lncRNA genes .Principal component analysis (PCA) identified the major axes of variation in gene expression Fig.\u00a0. The firlls Fig. . We thenCCL3, CCL4, CCL5, XCL1, and XCL2 (P\u2009<\u20099e\u201312), consistent with a role for innate lymphocytes in recruiting other inflammatory cell types to initiate inflammation.The Gene Ontology (GO) terms most associated with innateness included NK cell and lymphocyte chemotaxis, NK cell-mediated immunity, cellular defense response, and several additional terms related to leukocyte migration and activation Fig.\u00a0. Using fIFNG (the gene coding for IFN-\u03b3) showed a significant association with innateness  emerged as the most-associated term  dye dilution. NK cells were omitted from this analysis, since they do not respond to anti-CD3/CD28-coated beads. Like MYC and ribosome biogenesis, proliferation was associated with adaptiveness and innate T cells proliferated less than adaptive T cells . The expression of these transcription factors across cell types clustered into four major groups , known for important roles in type 1 helper T cell (Th1) and iNKT-cell effector functions19, followed the innateness gradient at both the transcript and protein levels , reported to be induced by T-bet, has been shown to regulate persistence of effector memory Th1 cells, with upregulation in terminally differentiated cells20. ZEB2 (P\u2009=\u20091.8e\u201318) has been reported to cooperate with T-bet to induce terminal differentiation of cytotoxic T lymphocytes22. Two NFAT family proteins, NFATC2 (P\u2009=\u20092e\u201316) and NFAT5 (P\u2009=\u20091.1e\u20139), were associated with cluster 1 transcription factors. IRF8 (P\u2009=\u20093.1e\u201314), TFDP2 (P\u2009=\u20095.9e\u201313), NFIL3 (P\u2009=\u20092.7e\u201313), KLF10 (P\u2009=\u20092.1e\u201315), RUNX3 (P\u2009=\u20095.6e\u201318), LITAF (P\u2009=\u20096.2e\u201324), ZSCAN9 (P\u2009=\u20099.4e\u201317), and ZNF600 (P\u2009=\u20094e\u201317) were also in this cluster and significantly associated with innateness. Within the adaptiveness-associated cluster 2, besides MYC 23, BACH2 (P\u2009=\u20094.3e\u201310), NR3C2 (P\u2009=\u20091.8e\u201310), POU6F1 (P\u2009=\u20091.9e\u201310), and BCL11B (P\u2009=\u20092e\u201317).Within cluster 1 of innateness-associated transcription factors, T-bet , BHLHE40 (P\u2009=\u20098.1e\u201311), FOSL2 (P\u2009=\u20098.8e\u201314), and ZBTB16 , and ID2 have been reported to contribute to iNKT-cell development and/or activation in mice28. Id2 is also a major regulator of ILC development29, and has been implicated in the regulation of mouse iNKT30, ILC131, and CD8+ T cell32 effector functions in the periphery. Published transcriptional profiles of NK cells, ILC1, and influenza-specific Id2-deficient mouse CD8+ T cells showed a striking concordance of Id2-dependent expression with our innateness gradient genes, highlighted by TBX21, ZEB2, IL18RAP, CCR7, TCF7, cytotoxicity, and KLR genes33. TCF7, consistently downregulated in ITC, is negatively regulated by Id2, suggesting that in part, Id2 may drive the loss of adaptive T-cell identity observed in ITC. Taken together, these data suggest that Id2 may drive many features of innateness in human ITC, and may be a major transcriptional node involved in maintaining their baseline innate state.The third cluster of innateness-associated transcription factors, those enriched in iNKT cells, MAIT, V\u03b42\u2009T, and NK cells, included 35, MAIT cells35, and innate lymphoid cells36. Mean PLZF protein expression by intranuclear staining confirmed our mRNA expression results . PLZF expression in T cells was also associated with the aggregate expression of all cytokine and chemokine receptor activity genes , with major clock transcription factor genes like ARNTL (that codes for BMAL1), RORA, PER1, and CRY1 significantly upregulated in PLZF+ ITC compared with adaptive T cells  , many genes upregulated in PLZF+ ITC and identified as PLZF targets in mouse38 showed low expression in human NK cells, including CCR2, CCR7, CXCR6, RORC, CCR5, CCR6, and LTK  Fig.\u00a0. Both BH43. We sorted V\u03b43\u2009T cells and \u03b4/\u03b1\u03b2T cells in duplicate from one individual, and profiled their transcriptomes with ultra-low- input RNA-seq. \u03b4/\u03b1\u03b2 and V\u03b43 clones have been identified that, like iNKT cells, recognize \u03b1-galactosylceramide presented by CD1d43, suggesting that these cells might potentially play a similar role in immunity to iNKT cells. However, PCA revealed that \u03b4/\u03b1\u03b2 T cells were closer to adaptive T cells, and closest to CD8+ T cells, rather than segregating with iNKT cells and other innate T cells . To quantify the total level of innateness in each sample, we generated an \u201cinnateness score.\u201d For this metric, we used the PC1 weights (loadings) for genes included in our PCA , which had a higher innateness score than CD4+ naive T cells , suggesting that T-cell innateness was enriched at the site of disease  for the significant adaptiveness and innateness genes identified in the low-input RNA-seq data. Unsurprisingly, the single-cell gene expression associations with the innateness gradient replicated our low-input RNA-seq data .Before exploring heterogeneity, we wanted to ensure that the broad trends seen in the bulk RNA-seq data were replicated in the single-cell RNA-seq data. We first compared the single-cell and low-input RNA-seq datasets on a gene-by-gene basis. From our single-cell data, we calculated the level of innateness  mirrored those obtained for low-input RNA-seq, with sc-PC1 separating adaptive cells from innate cells. Among the innate populations, NK cells were on one end, iNKT and MAIT cells on the other end, and \u03b3\u03b4 T cells in-between . Adaptive T cells, followed by ITC and NK cells were spread across the UMAP Fig.\u00a0. Key innlls Fig.\u00a0.+ T cells exhibited the most striking heterogeneity, showing populations that clustered into three different states: CD8-1 clustered with adaptive CD4+ T cells, CD8-2 that was most similar to iNKT and MAIT cells, and CD8-3 cells that were most similar to \u03b3\u03b4 T cells . The CD8-2 population was characterized by intermediate expression of innateness and adaptiveness genes, rather than by expression of unique genes  were adaptiveness and innateness genes, including downregulated cytotoxic genes, such as PRF1 and KLRD1, and upregulated ribosomal machinery genes, such as RPL34, RPL22, and EEF1A1. This finding is consistent with recent reports on V\u03b41 populations being highly variable across donors, and with dynamic changes in response to infection, suggesting that a naive V\u03b41 state may be part of their development53. Besides NK cells, and MAIT cells, most of the lymphocytes assayed spanned multiple clusters. Taken together, our single-cell RNA-seq data demonstrate that the innateness cell-type hierarchy seen in low-input RNA-seq reflects an average of multiple cell states, and that individual innate and adaptive T populations variably populate these innateness states.For some cell types, we noted that sizeable subsets were present in multiple clusters Fig.\u00a0. CD8+ T lls Fig.\u00a0. When wenes Fig.\u00a0. Only foMAIT, iNKT, \u03b3\u03b4, and other innate-like T cells do not fit neatly into traditional paradigms of adaptive or innate immunity. Each population has been studied in depth individually, but rarely have they been considered in aggregate. Here, we set out to study human ITC as a group, addressing two important questions: (1) is there a shared transcriptional basis for their functions in immunity, and (2) how do ITC maintain their baseline \u201cpoised\u201d effector state? In quantitative, unbiased analyses using both low-input RNA-seq and single-cell RNA-seq, we discovered that ITC segregate along an innateness gradient between prototypical adaptive and innate populations. We propose that the large transcriptional programs positively and negatively associated with this gradient represent the transcriptional basis of lymphocyte innateness. Though they share the same lineage as adaptive T cells, our data support that ITC are indeed a \u201cfamily\u201d in a sense, with a common transcriptional basis for their similar functions in immunity, including rapid cytokine and chemokine production, chemotaxis to areas of inflammation, cytotoxicity, and TCR-independent responses. The functional and transcriptional conservation of innate-like functions in ITC suggests that they enhance evolutionary fitness. That humans dedicate such a large part of their T-cell repertoire to the generation of innate-like receptors is a testament to the teleological importance of innate immune surveillance even after the evolution of adaptive immunity.+ T cells and even some CD4+ T cells that clustered within the two \u201cinnate states\u201d that largely represent ITC populations. The genes that differentiated these populations were the same genes identified in the innateness gradient. These data suggest that lymphocytes can exist in defined states of innateness whether achieved developmentally, as is thought to be the case with ITC, or through experience, in the case of adaptive T cells.Strikingly, we observed that this innateness program could also differentiate adaptive effector populations in health and disease. Analysis of published datasets demonstrated that naive, memory, and effector-adaptive populations could be classified by their innateness. Thus, the study of ITC highlights important pathways used across innate and adaptive lymphocyte populations. Consistent with this notion, our single-cell RNA-seq data identified populations of CD853. Although they express much of the innateness program, V\u03b41 cells may not fit the ITC paradigm as neatly as the more-conserved MAIT, iNKT, and V\u03b42 populations. Indeed, V\u03b41 cells have greater TCR diversity, exhibit less cytokine-only activation, do not express PLZF, and a portion of these cells clustered with adaptive T cells in our single-cell RNA-seq analysis.The shared transcriptional programs associated with innateness included cytokine/chemokine production, cytotoxicity, and cytokine/chemokine receptor expression. For the genes positively associated with the innateness gradient, this is essentially an \u201ceffector gradient,\u201d which strongly supports a role for ITC in host defense. We found that human ITC rapidly produced IFN-\u03b3 after activation through their TCRs .\u201cInnateness\u201d and \u201cadaptiveness\u201d genes are those that in the low-input RNA-seq were significantly associated with the rank order of each lymphocyte population in the innateness gradient (CD4\u03b2 of the gradient variable within our linear mixed model in low-input RNA-seq or linear model in single-cell RNA-seq).\u201cInnateness level\u201d is the magnitude of the change in expression level by an increase of one in the gradient  multiplied by the rank of that cell type in the innateness gradient.+ T, CD8+ T), as well as NK cells as prototypical innate lymphocytes. Samples used for immunophenotyping and RNA-seq analyses were from healthy individuals. All human sample use was approved by the Brigham and Women\u2019s Hospital Institutional Review Board, including written consent for public deposition of RNA sequencing.To study the transcriptome of innate T-cell populations , we compared them with adaptive cells  at a read depth of 4\u201312 million read pairs (8\u201324 million reads). The goal of this study was to define the shared transcriptional programs between cell populations rather than variability between individuals. To avoid systematic technical error or batch effects, samples were randomized within the plate for library preparation, and all samples were sequenced together. Five samples were removed for low read depth (described below).For low-input RNA-seq, a matched set of populations were sorted from each individual to avoid batch effects. All blood draws were performed in the morning, and cells were immediately stained and double-sorted directly into lysis buffer. Based on previous RNA-seq analyses on the number of replicates and read depth for optimal differential expression analysis2-microglobulin) at 0.2\u2009\u03bcg/sample, one antibody for each cell type, and a second antibody to barcode each donor. Cells from each donor were pooled in equal proportions, and then analyzed by flow cytometry to ensure viability and representation of each population. Just before loading in the single-cell fluidics device (10X Genomics), cells from the two donors were mixed. Barcodes for cell type and donors are as follows: CD8+ T (GTCAACTCTTTAGCG), CD8+ T (TGATGGCCTATTGGG), MAIT (TTCCGCCTCTCTTTG), iNKT (AGTAAGTTCAGCGTA), V\u03b41 (AAGTATCGTTTCGCA), V\u03b42 (GGTTGCCAGATGTCA), NK (TGTCTTTCCTGCCAG), Donor 1 (CTCCTCTGCAATTAC), and Donor 2 (CAGTAGTCACGGTCA).For single-cell RNA-seq, cell populations were sorted from two healthy donors. The same sorting strategy was used for single-cell RNA-seq as was used for low-input RNA-seq, including the use of 5-OP-RU-loaded MR1 tetramers for MAIT cell identification. After sorting, cells were stained with DNA-barcoded hashing antibodies  were prepared for the 90 flow-sorted samples (each 1000 cells). These samples were composed of seven main cell types  from six healthy donors, and three additional cell types  from one healthy donor. Each sample had two duplicates. Samples were randomized within the plate. Twenty-five-base paired-end sequencing was performed yielding 4\u201312\u2009M read pairs . The following D7 index primer was used (sample barcode underlined): CAAGCAGAAGACGGCATACGAGATGACTGACAGTGACTGGAGTTCAGACGTGTGC.For single-cell RNA-Seq, mRNA and hashing library preparation58 to quantify gene expression using the Ensembl 83 annotation. We included protein-coding genes, pseudogenes, and lncRNA genes. As expected, protein-coding genes were the most highly expressed, followed by lncRNAs and then pseudogenes  counts separately and kept cells that passed QC in both modalities. We quantified gene expression with CellRanger version 2.1.0, mapping reads to the human genome (assembly GRCh38). We removed cells that expressed 500 or fewer unique genes, or had at least 20% of UMIs mapping to mitochondrial genes. We counted cell-hashing antibody UMI counts with CITE-seq count60. We used the function prcomp_irlba61 for PCA. For visualization, we used the top 20 principal components to compute the two-dimensional UMAP projection62. We ran UMAP with the following parameters: n_neighbors\u2009=\u200930\u2009L, metric\u2009=\u2009\u201ccorrelation\u201d, and min_dist\u2009=\u20090.1. Cells were clustered based on the top 20 gene expression PCs using shared nearest-neighbor modularity clustering (RunModularityClustering function in Seurat v263). The clustering algorithm was run with a resolution parameter of 0.4 and yielded four clusters.Gene expression UMI counts within each cell were normalized for library size  and log-transformed (ln(counts per 1e04\u2009+\u20091)). We performed PCA on the top 1545 most variable genes, ranked by the coefficient of variation, mean centered and scaled by their standard deviation. We performed an L2 normalization to induce cosine distance between cells. Cosine distance has previously been shown to be a more robust distance metric than Euclidean distance for single-cell RNA-seq dataWe used linear mixed models or linear models for our differential expression and expression association analyses. For these analyses, we used a likelihood ratio test between two nested models using anova in R, and a Bonferroni threshold to call significant cases .+ T, CD8+ T, MAIT, NKT, V\u03b41, V\u03b43, and NK, respectively). In the differential expression between adaptive cells and PLZF+ ITC, we used one fixed effect taking values of 0 or 1, respectively.For low-input RNA-seq, the dependent variable was quantile-normalized log2(tpm\u2009+\u20091) expression values. Within our predictor variables, we used in all cases donor ID as a random effect. For associations with the innateness gradient, we used one fixed effect composed of integers from 1 to 7 , and as covariates number of UMIs per cell (log-transformed), percent of mitochondrial UMIs, and donor . Only genes with a nonzero value in at least 100 cells were included. For differential expression between CD8+ T-cell subsets or V\u03b41 subsets, we used one fixed effect taking values 1 for the subset being analyzed or 0 for the other two subsets (for CD8+ T) or one subset (for V\u03b41). We included as covariates the number of UMIs and the percent of mitochondrial UMIs per cell. Only genes with a nonzero value in at least 60 cells were included.For differential gene expression in single-cell RNA-seq, similar to low-input RNA-seq, we fit a linear model per gene to identify genes associated with the innateness gradient or differentially expressed between cell-type subsets. The dependent variable was log-transformed library-normalized expression values. For associations with the innateness gradient, we used one fixed effect composed of integers from 1 to 7  of our differential expression analysis. We used the minimal hypergeometric test66 to test for significance. We confirmed significance of enrichment for the top GO terms using an alternative method: the function gsea of the liger package (https://github.com/JEFworks/liger).We downloaded Ensembl gene IDs linked to Gene Ontology (GO) terms on April 201667 from the Consensus Pathway Database-human http://cpdb.molgen.mpg.de/68 in March 2017. First, we calculated the F statistic per expressed gene in our dataset as a metric of variability between cell types. Then we tested whether the F statistics in genes of a certain pathway were higher than the other expressed genes using a Wilcoxon test. Three pathways had a P-value\u2009<\u20090.05. Since higher expressed genes tend to have higher F statistics, we further tested whether these three pathways had significantly higher F statistics than expected by controlling for gene expression. Specifically, we chose a null set of genes with similar expression levels by taking for each gene in a pathway, 30 random genes with mean level of expression  within 10% of the standard deviation. After this, only the pentose phosphate pathway had genes with F statistics higher than expected . We further tested enrichment of this pathway in genes associated with innateness gradient using gsea in the liger package.We downloaded genes pertaining to 12 KEGG pathwaysP-values), and when accounting for different clinical variables , were tested with linear regression using cell-type percentages in log scale . For iNKT cell abundance, there were two individuals with zero values, and these were converted to the next minimal value of 0.01 before log transformation. Covariation between cell types was performed with Spearman rank correlation .Associations among cell types and clinical traits were performed with Pearson correlation (t test for 38 (accession number GSE81772). We used genes from the mouse Gencode vM14 annotation. We defined gene targets as mouse genes with a PLZF peak in the gene body or within 2\u2009kb from the transcription start site (TSS). We downloaded mouse\u2013human gene homologs from BioMart69. We selected only genes with 1-to-1 orthologs. We then checked from the mouse PLZF gene targets to which human ortholog they correspond to. Finally, we performed logistic regression to determine whether gene targets are enriched in differentially expressed genes between PLZF+ ITC and adaptive T cells. Specifically, the response variable is 0 or 1 for nontarget or target gene, respectively. The predictor variable was the \u03b2 of the differential expression analysis of PLZF+ ITC versus adaptive T cells. We also tested enrichment defining gene targets if a peak was found only at the promoter region of a gene (\u20132\u2009kb to\u2009+\u20091\u2009kb from TSS) and found similar results.We downloaded PLZF ChIP-seq peaks from the Gene Expression Omnibus (GEO) database from Mao et al.45, we downloaded their processed microarray expression matrix containing HCMV-specific CD8+ T-cell samples. If multiple probes were present for a given gene, we calculated the average expression of those probes. From Ranzani et al.46, we downloaded fastq files for CD4+ T-cell subsets and processed them as our low-input RNA-seq data, quantifying gene expression with kallisto and using log2(tpm\u2009+\u20091) values. From Fonseka et al.47, we used processed log2(tpm\u2009+\u20091) expression values from all their CD4+ T-cell subset samples. From Azizi et al.49, we used their processed single-cell imputed expression data and their inferred cluster annotations for all T cells and NK-annotated cells , cells were stained with surface antibodies and dead cells were identified with 7-AAD (Biolegend). Using a FACSAria Fusion sorter fitted with a 100\u2009\u00b5M nozzle, 1,000 cells double-sorted in duplicate directly V-bottom plates with TCL lysis buffer (Qiagen) and stored frozen until processing. The gating strategy for sorting and validation studies is shown in Supplementary Figure\u00a0For immunophenotyping, Ficoll-isolated  PBMCs were prepared within 2\u2009h of overnight fasting with blood draw between 8 and 10 AM, stained, and data were acquired the same day. For sorting, freshly isolated PBMCs from donors that had at least 0.1% for each cell type were processed in accordance with the ImmGen standard operating procedure+CD161+ T cells.For validation studies, cryopreserved PBMCs were used from a total of 15 donors. The antibodies used for flow-cytometric validation are listed separately. Data were acquired with a five-laser LSR Fortessa or three-laser FACSCanto II (BD Biosciences) and analyzed with FlowJo (Treestar). A live\u2013dead dye was used for all staining, either 455UV (eBioscience) or ZombieAqua (Biolegend). For intracellular cytokine production studies, cells were fixed with 4% paraformaldehyde, then permeabilized with BD Perm/Wash (BD Biosciences), and stained with intracellular antibodies. For intranuclear staining to assess expression of transcription factors, cells were fixed and permeabilized using the FoxP3 buffer set (eBioscience). For validation studies, MAIT cells were identified as V\u03b17.2For 47S rRNA quantification, cells were sorted directly into RLT buffer (Qiagen) before RNA extraction . Primers were designed to span the first rRNA-processing site using the following sequences: forward: GTCAGGCGTTCTCGTCTC, reverse: GCACGACGTCACCACAT. HPRT was used as a housekeeping control . qPCR was performed using the Brilliant III Ultra-Fast SYBR QPCR Master Mix (Agilent), read on a Stratagene MX3000P system.L-glutamine, and 2-mercaptoethanol. Cytokines were from Peprotech except for IFN-\u03b1 (R&D Systems). For assessment of cytokine production, PMA  and ionomycin  were added along with Protein Transport Inhibitor Cocktail (eBioscience) containing brefeldin and monensin for 4\u2009h , HEPES, penicillin/streptomycin, 17 for use by flow cytometry. Puromycin was added for 5\u2009min in the presence of emetine (100\u2009\u03bcg per ml), followed by fixation with 4% paraformaldehyde, permeabilization with BD Perm/Wash, and staining with an antibody that recognizes puromycin (EMD Millipore).To assess ribosomal activity, we adapted a microscopic technique, ribopuromycylationSee Supplementary Data\u00a0Github.The R source code used in key analyses is available at Further information on experimental design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1Supplementary Data 2Supplementary Data 3Supplementary Data 4Reporting Summary"}
+{"text": "SLA (Specific leaf area), SRL (specific root length), mass\u2010based N (nitrogen) and P (phosphorus) concentrations of leaves and fine roots, root system, and plant sizes were measured in 23 woody species grown together in a common garden setting. SLA and SRL exhibited a strong negative relationship. There were no significant relationships between corresponding leaf and fine\u2010root nutrient concentrations. The interspecific variations in plant height and biomass were tightly correlated with root system size characteristics, including root depth and total root length. These results demonstrate a coordinated plant size\u2010dependent variation between shoots and roots, but for efficiency, plant resource acquisition appears to be uncoupled between the leaves and fine roots. The different patterns of leaf and fine\u2010root traits suggest different strategies for resource acquisition between the two organs. This provides insights into the linkage between above\u2010 and belowground subsystems in carbon and nutrient economy.Functional traits of leaves and fine root vary broadly among different species, but little is known about how these interspecific variations are coordinated between the two organs. This study aims to determine the interspecific relationships between corresponding leaf and fine\u2010root traits to better understand plant strategies of resource acquisition.  Leaves and fine roots are active organs with the primary function of plant resource acquisition  and specific root length (SRL) reflect organ potential growth rates associated with the resource capture of leaves and roots, respectively  within a common condition, having nutrient\u2010rich, noncompletive and r\u2010environment selects, leaf, and fine\u2010root traits relevant to resource acquisition would be strongly coordinated across species. Species with leaves exhibiting high SLA, and leaf N and P concentrations would also exhibit parallel trait syndromes in fine roots. (2) Interspecific variations in the plant height growth should be tightly related to their root system size. Species with deep root systems should have improved plant growth and competitive capacities for aboveground resources, owing to their ability to obtain resources and better support aboveground organ survival , Chinese Academy of Sciences, which is located in Maoxian County, Sichuan, China . The climate of the site is temperate semiarid. Monthly climatic data, including mean rainfall, air temperature, evapo\u2010transpiration, air humidity, and hours of sunshine during this study period, were provided by the MMERS Meteorological Observatory. This site experiences an annual precipitation 738.8\u00a0mm and has a raining season running from May through October. The annual mean temperature is 10.4\u00b0C, with maximum temperatures of 18.7\u00b0C in July and minimum temperatures of \u20131.4\u00b0C in January. Annual sunshine time, mean air humidity, and evaporation were 1317.8\u00a0h, 75%, and 1018.2\u00a0mm, respectively. The ground slope across the common garden is <10\u00b0. The garden soil is characterized as Udic luvisols with uniform physical and chemical properties over the entire field. The 0\u201320\u00a0cm soil layer was characterized by 17.22\u00a0\u00b1\u00a02.02\u00a0g\u00a0kgAilanthus altissima (Mill.) Swingle, Koelreuteria paniculata Laxm., and Robinia pseudoacacia Linn., are commonly used in the ecological restoration of dryland areas in China, and the 18 shrub and 2 subshrub species are native to the arid valley of the eastern Tibetan Plateau. Seeds of each species were collected from their natural habitats in the arid valley of the eastern Tibetan Plateau  in autumn 2008. After natural air drying for 4\u20138\u00a0days, seeds of the Rosaceae species were scarified with 98% H2SO4 for 4\u00a0h and then were stratified at 5\u00b0C for 8\u00a0weeks to break seed dormancy. Other seeds were stored at room temperature (10\u201325\u00b0C) until sowing. Before sowing, all the seeds were disinfected by immersion in 2.5% NaClO for 1\u00a0h. All species were grown in the garden beginning in the spring of 2009.This study used 1\u2010year\u2010old seedlings of 23 deciduous and xerophytic woody species. Fourteen families were included in this study. A full list of the observed species is shown in Appendix\u00a0S1. The three tree species, The experimental design was a randomized block design with each of the 23 species replicated in five blocks per species. We established 15 plots (4\u00a0m\u00a0\u00d7\u00a04\u00a0m) for the tree species and 100 plots (2\u00a0m\u00a0\u00d7\u00a02\u00a0m) for the shrub and subshrub species. For each species, 20 seeds of a similar size were sown in each of the five plots on 28 March 2009. Shortly after emergence, seedlings of all the species were thinned and 10 plants per plot were retained on May 20. The distance between the plants was ~60\u201380\u00a0cm in each plot. The plots were hand\u2010watered and shaded uniformly until seedlings were established (about 1.5\u00a0month after sowing). In this way, we ensured that seedlings were not affected by drought and radiation stress. The garden was not fertilized during the experiment, but was manually weeded twice each year to reduce competition from other plants.The leaves and roots of 115 plants of 23 woody species were collected at the end of the growing season (on 13 October 2009). We selected one plant with medium plant height and branch number in each of the five plots. To calculate the SLA, leaf area/leaf dry mass, 10\u201330 mature leaves of each plant were collected. Images of the leaves were recorded using a scanner , and leaf areas were calculated with Image J 1.45\u00a0days . Leaves were dried in an oven for 48\u00a0h at 70\u00b0C for dry mass measurements.Because the seedlings have small root systems and individual plants were separated from each other in each plot, an excavating method was used in this study. To measure the intact root systems of whole individuals, we unearthed one plant with medium plant height and branch number in each species and estimated their maximum rooting depths and widths prior to harvest. For each individual examined, an intact root system with soil was excavated and 95% RD (root depth) was estimated following the protocol of Cornelissen et\u00a0al. . All rooThe plant height growth of each selected plant was measured using a linear scale from the stem base to the top of the branches before harvesting on 13 October 2009. Once plants were harvested, shoots of each plant were divided into stems and leaves. The dry mass was determined for the same segment. During the experimental period, senesced and dropped leaves from all individuals were collected for total leaf dry mass determinations. The total plant BM (biomass) was calculated as the sum of root, stem, and leaf masses.2O2\u2013H2SO4.All dried fine roots and leaves were ground and homogenized manually in a mixer mill . The total N concentrations were determined using high temperature combustion in a Vario Macro Cube Elemental Analyser . The total phosphorus concentrations were analyzed using colorimetry after digestion with Hn\u00a0=\u00a05) and tested relationships between traits using species traits means. Appendix\u00a0S1 shows the means and standard errors of all the variables in this study. A PCA  was performed to determine the relationships both within and among the corresponding traits of leaves and fine roots for the 23 species and to determine plant trait syndromes using R software  were performed in the R software (using the picante package). The phylogenetic tree for 23 species was constructed using the Phylomatic utility, based on APG III and Flora of China. PICs were also performed to analyze the evolutionary relationships between a set of traits.The first two axes of the PCA explained ~63%  of the variability  generally had higher plant height growth values than species with shallow root systems  concentration relationships were found by others in grassland and savannah ecosystems . The results of the present study are in agreement with earlier finding , plant total biomass (BM), Plant height (PH), 95% root depths (95% RD), total fine root lengths (TRL), specific root lengths (SRL),fine root nitrogen concentrations (Root [N]), fine root phosphorus concentrations (Root [P]), specific leaf area (SLA), leaf nitrogen concentration (Leaf [N]) and leaf phosphorus concentrations (Leaf [P]). Values are means of five individuals.Click here for additional data file."}
+{"text": "A 13-year-old girl presented to the emergency department (ED) after her right knee was forced into valgus after making contact with the opposing goalkeeper while playing soccer. At the scene, she had experienced immediate severe knee pain and was unable to bear weight. Anteroposterior radiographs of the knee revealed a minimally displaced fracture to the lateral femoral condyle . ComputeCoronal fractures of the femoral condyle, first described by Hoffa in 1904, are uncommon clinical entities, typically seen in adults after high-energy trauma.What do we already know about this clinical entity?Hoffa fracture is uncommon, and poor outcomes have been reported with conservative treatment. Plain radiographs are not sufficiently sensitive and there is a risk of under diagnosis.What is the major impact of the image(s)?The computed tomography (CT) image in this report demonstrates injury of the distal femoral epiphyseal growth plate and a displaced coronal fracture of the lateral femoral condyle, which are underestimated on plain radiographs.How might this improve emergency medicine practice?This case report demonstrates emergency physicians should not hesitate to order CT to accurately diagnose Hoffa fracture.Documented patient informed consent and/or Institutional Review Board approval has been obtained and filed for publication of this case report."}
+{"text": "Nano-metamaterials designed to operate at a certain resonance frequency enhance the magnitude of terahertz (THz) wave transmission by three orders of magnitude or even more. In this pursuit, controlling magnitude of resonant transmission and tuning the resonance frequency is increasingly important for application in low power THz electronics and devices. THz optical properties of chemically doped poly:poly(4\u2010styrenesulfonate) (PEDOT:PSS) have been studied, however its effect on the THz transmission properties in combination with nano-metamaterials have not yet been demonstrated. Here we demonstrate the efficient control over resonant THz transmission and tuning of resonance frequency of different nano-metamaterials using PEDOT:PSS, without any toxic chemical doping. By ease of simple solution processing with single step and drop-casting 10\u2009\u03bcL aqueous solution of PEDOT:PSS on different nano-metamaterials with varied concentrations, we were able to dynamically control the THz transmission along with resonance frequency. This dynamic control of transmission and shift in resonance frequency can be attributed to improved conductivity of PEDOT:PSS and its interaction with strongly localized THz field of the metamaterial. Several attempts have been made to manipulate THz wave using semiconducting metamaterials10, electrically modulating the intraband transition in graphene13, thermally induced phase change in VO217 and doped conducting polymers20. Poly:poly(4-styrenesulfonate) (PEDOT:PSS) as a \u03c0-conjugated conducting polymer has high thermal stability, high transparency and tunable opto-electronic properties22. The conductivity properties of PEDOT:PSS could be tuned by chemical doping and has been studied using THz spectroscopy23. Also, doped PEDOT:PSS has been employed as a THz beam splitter, broadband THz antireflection coating, electrically tunable THz liquid phase shifter, efficient hole transport layer etc26. One of the advantages of PEDOT:PSS is its ease of solution processing and handling27. To date the effective control of THz in nano-metamaterials with the combination of cost effective techniques and nontoxic chemicals is still void in literature and needs to be explored. Also most of the reported nano-metamaterials work passively, in which the frequency response depends on their physical parameter.Functional terahertz (THz) devices have recently gained renown interest due to their wide range of applications in modulators, electro-optic devices, filters, wireless communication, THz spectroscopy & imaging, biomedical applications etc29. We show that by ease of fabrication and single step solution processing of PEDOT:PSS, we can dynamically control the resonant THz transmission through nano-metamaterial and tune its resonance frequency.Herein we report on control of THz transmission and tuning of resonance frequency using PEDOT:PSS with nano-metamaterial structures without any toxic chemical doping. Effective THz transmission of PEDOT:PSS coated sub-wavelength rectangular ring nanogap based antenna and slot antennas have been demonstrated. Different weight percentage (wt%) of aqueous PEDOT:PSS solution was drop casted over the antenna arrays forming a thin film. These PEDOT:PSS film coated resonant antenna arrays were utilized for THz transmission measurements. With increasing the PEDOT:PSS concentration, THz transmission through the antenna array was found to reduce, implying controlled transmission of the incident THz. Also red shift in the resonance frequency of the antenna was observed with increasing the concentration of PEDOT:PSS. This effective control over transmission and tuning of resonance frequency is a result of the enhanced extinction ratio of PEDOT:PSS due to strong THz field enhancement and localization effects30. The schematic of the fabrication processes of resonant metamaterial structure is presented in figures below. For 20\u2009nm gap fabrication,\u00a0large area rectangular metallic arrays were defined by UV photolithography in an image reversal photoresist (AZ5214) followed by metal evaporation and lift-off process. Next, conformal 20\u2009nm thin film of aluminium oxide (Al2O3) was deposited using atomic layer deposition. Subsequently, a second layer of metal deposition defines the vertically aligned metal-Al2O3-metal interfaces, where Al2O3 thickness defines the gap width. Since the Al2O3 is weakly bond to metal layer, excess of the second metal layer was exfoliated using scotch tape and the surface was milled using ion beam milling at a glided angle to flatten the gap surface. For slot antenna fabrication, a negative tone photoresist ma-N2405 (MicroChem) was spin coated (4000\u2009rpm) on Si substrate and soft baked at 120\u2009\u00b0C for 120\u2009sec. The array of rectangular pattern of desired dimensions was written using electron beam and developed in ma-D532 developer. Further, the metal evaporation and lift off processes were used to obtain the metamaterial structure of the slot nano-antenna array.Resonant THz nano-metamaterials based on 20\u2009nm gap width and slot antenna array were used to study the transmission characteristics due to strong THz field enhancement and localization. The array of 20\u2009nm nanogap metamaterial structure extended over rectangular dimension of 20\u00a0\u03bcm\u2009\u00d7\u200980 \u03bcm (w\u2009\u00d7\u2009l) and 100\u2009nm deep nanotrenches were fabricated by atomic layer lithography reported elsewhere2O, where PEDOT and PSS contents are 0.5\u2009wt% and 0.8\u2009wt% respectively were used as received. The pristine solution of PEDOT: PSS was diluted with DI water to get the desired concentration of 0.01\u2009wt%, 0.05\u2009wt%, 0.10\u2009wt% and 0.50\u2009wt%. Before using, the solutions were stirred for 12\u2009hours at room temperature to improve the uniformity. Due to different concentrations, the thickness of the drop-casted films was expected to be different and measured by cross-sectional scanning electron microscopy (SEM). The prepared films were annealed at 150\u2009\u00b0C for 15\u2009min to improve the crystallinity. Furthermore, to study the effect of ethylene glycol (EG) doping on THz transmission through the metamaterial structures, pristine solution of PEDOT: PSS was doped with 3\u2009wt% of EG and drop casted in similar manner. EG doping was done to prove that the conductivity enhancement plays the major role in controlling the THz transmission19. All the measurements were performed on single device after washing off with acetone and DI water each time.Control of THz in different nano-metamaterials using different wt% of aqueous PEDOT:PSS solution was demonstrated using THz time domain spectroscopy(THz-TDS). The aqueous solution of PEDOT:PSS (pristine solution) from Sigma Aldrich with concentration of 1.3\u2009wt% in H32, which have been used to study the shielding effect and also require multistep synthesis process. PEDOT:PSS has conducting nature due to presence of PEDOT molecules. The reduction in broadband THz intensity can be attributed to the change in the carrier density of PEDOT:PSS with change in PEDOT to PSS concentration. With increase in the concentration, the aggregation of the PEDOT and PSS particles increases which leads to the increased conductivity, which in turn leads to the reduced THz transmission20. The addition of 3\u2009wt% of ethylene glycol (EG) gives rise to improved carrier mobility and hence conductivity, which affects the THz transmission more significantly.First, we measured the broadband THz transmission through PEDOT:PSS drop casted on bare silicon (Si) substrate in the time domain as shown in figure\u00a033. For the 3\u2009wt% EG doped PEDOT:PSS coated nanogap metameterial, THz transmission is drastically reduced due to increase in its conductivity (charge density). A large change in transmission depth of ~75% was observed for 3\u2009wt% EG doped PEDOT:PSS compared to 1.3\u2009wt% PEDOT:PSS (~62%) as shown in figure\u00a0THz transmission properties of PEDOT:PSS through resonant nano-metamaterial structures such as nanogap (20\u2009nm) and nanoslot antenna were also investigated. The measurements were conducted on films of different concentrations of PEDOT:PSS and converted to frequency domain using fast Fourier transformation\u00a0(FFT). The transmission spectra through the PEDOT:PSS coated metamaterial structure were normalized by the transmission spectrum through the Si substrate. The normalized transmission through uncoated nanogap metamaterial structures is represented as the reference spectrum in the respective figures. Figure\u00a034. The normalized transmission spectra in the frequency domain are represented in figure\u00a0et al. for MXenes29. Microscopically, the field enhancement is explained in terms of accumulation of surface charges near the aperture edges in the presence of incident THz34. When the slot is filled with the conducting PEDOT: PSS, it is expected that it establishes the connection between the two edges of the slot antenna and prohibits accumulation of the charge and hence destroying the resonant transmission. This can also be confirmed from the measurements for slots coated with EG doped PEDOT: PSS, where the THz transmission was almost diminished  simulations implemented in COMSOL Multiphysics 5.3 to analyze the electric field profile for 20\u2009nm AlThe shift in resonance frequency for different concentration of PEDOT:PSS coating was calculated as shown in figure\u00a0In a nutshell, we have demonstrated effective control of THz transmission of PEDOT:PSS with different resonant nano-metamaterial structures along with tuning of resonance frequency. Pristine PEDOT:PSS was diluted with DI water to obtain various concentrations of it and its thin film on the nano-metamaterials were formed by drop-casting 10\u2009\u03bcL of aqueous solution and annealing at 150\u2009\u00b0C. The nano-metamaterials in combination with PEDOT: PSS thin films show significant reduction in transmission and change in resonance frequency with increasing the concentration. A transmission depth of greater that 60% and 85% were obtained for 20\u2009nm nanogap structure and nanoslot antennas respectively along with red shift in resonance frequency. The pristine PEDOT: PSS (1.3\u00a0wt %) thickness was found to be ~455\u2009nm and it is expected to be low for lower concentrations. The reduced transmission and change in resonance frequency can be related to the enhanced extinction coefficient of PEDOT:PSS due to strong localization of the THz field followed by field enhancement and increased conductivity. Further the performance of these nano-metamaterial structures can be restored by washing with hot DI water for other applications. Thus, a few 100\u2009nm thin films of PEDOT:PSS can effectively control the resonant THz transmission and holds potential applications towards optical switching, modulation and other THz devices."}
+{"text": "NKX2\u20105 is a homeobox transcription factor that is required for the formation of the heart and vessels during development, with significant postnatal down\u2010regulation and reactivation in disease states, characterized by vascular remodeling. The purpose of this study was to investigate mechanisms that activate NKX2\u20105 expression in diseased vessels, such as systemic sclerosis \u2013associated pulmonary hypertension (PH), and to identify genetic variability that potentially underlies susceptibility to specific vascular complications.NKX2\u20105 expression in biopsy samples from patients with SSc\u2010associated PH and in pulmonary artery smooth muscle cells (PASMCs) from patients with scleroderma. Disease\u2010associated putative functional single\u2010nucleotide polymorphisms (SNPs) at the NKX2-5 locus were cloned and studied in reporter gene assays. SNP function was further examined through protein\u2013DNA binding assays, chromatin immunoprecipitation assays, and RNA silencing analyses.We explored NKX2\u20105 expression in biopsy samples from patients with SSc\u2010associated PH was localized to remodeled vessels and PASMCs. Meta\u2010analysis of 2 independent scleroderma cohorts revealed an association of rs3131917 with scleroderma (P = 0.029). We demonstrated that disease\u2010associated SNPs are located in a novel functional enhancer, which increases NKX2-5 transcriptional activity through the binding of GATA\u20106, c\u2010Jun, and myocyte\u2010specific enhancer factor 2C. We also characterized an activator/coactivator transcription\u2010enhancer factor domain 1 (TEAD1)/Yes\u2010associated protein 1 (YAP1) complex, which was bound at rs3095870, another functional SNP, with TEAD1 binding the risk allele and activating the transcription of NKX2-5.Increased NKX2-5 is genetically associated with scleroderma, pulmonary hypertension, and fibrosis. Functional evidence revealed a regulatory mechanism that results in NKX2-5 transcriptional activation in PASMCs through the interaction of an upstream promoter and a novel downstream enhancer. This mechanism can act as a model for NKX2\u20105 activation in cardiovascular disease characterized by vascular remodeling. NKX2\u20105 is a transcription factor that belongs to the family of NK2\u2010homeobox DNA binding transcription activators. One of the earliest known markers of cardiac development in vertebrates SSc is a multisystem disease characterized by increased dysregulation of the immune system, inflammation, extensive fibrosis of the skin and internal organs, and prominent vasculopathy SSc\u2010associated PH occurs through several mechanisms, including World Health Organization (WHO) group I PAH, as well as WHO group II (postcapillary) and group III (lung fibrosis associated) forms. Collectively, these are termed SSc\u2010associated PH. PH can develop throughout the course of the disease, and recent studies suggest that 1\u20132% of SSc patients develop PH each year in a screened population Nkx2-5 gene has proven to be very complex, with a number of cis\u2010 and trans\u2010acting elements over a large 23\u2010kb genomic region regulating expression in a temporospatial\u2010specific manner Nkx2-5 activation through the binding of Smad and GATA transcription factors at an upstream enhancer Nkx2-5 regulation Nkx2-5 gene and the high homology (87%) between the mouse and human genes, little is known about the regulation of human NKX2-5. Most studies focus on NKX2-5 genetic variations, with 56 mutations and 250 single\u2010nucleotide polymorphisms (SNPs) having been identified, many of\u00a0which are associated with types of congenital heart disease Transcriptional regulation of the murine NKX2-5 resulting in increased expression in adult vasculature. We delineated a transcriptional mechanism through which NKX2-5 is activated. We also identified and validated a downstream enhancer, which results in enhanced transcriptional activation in human pulmonary artery smooth muscle cells (PASMCs).Postnatal activation of developmental regulatory pathways may explain the molecular pathology of the adult disease, and genetic association of functional polymorphisms can explain the susceptibility and phenotypic variability. In this study, we investigated the regulatory mechanisms of human Patient cohorts. A genetic study was conducted in 2 independent cohorts of Caucasian origin: UK and Spanish SSc patients. The UK cohort consisted of 1,334 SSc patients presenting to the Centre for Rheumatology at the Royal Free Hospital and the Centre for Musculoskeletal Research at the University of Manchester, as well as 901 control DNA samples matched to the patients for age, sex, and ethnicity. The Spanish cohort consisted of 1,736 SSc patients and 1,753 control DNA samples collected at the Institute of Parasitology and Biomedicine Lopez\u2010Neyra in Granada, Spain. The study was approved by the local ethics committees, in compliance with the Helsinki Declaration, and all participants gave written informed consent to participate in the study.All patients had a definite diagnosis of SSc, and the majority fulfilled the American College of Rheumatology/European League Against Rheumatism 2013 criteria for the classification of SSc Arthritis & Rheumatology web site at http://onlinelibrary.wiley.com/doi/10.1002/art.40419/abstract).Extended protocols and information regarding the experimental procedures are provided in the Selection of tagging SNPs. Tagging SNPs around the\u00a0NKX2-5 genomic region  were selected with Tagger software In silico analyses were performed using annotations from the following open\u2010access curated databases: Encyclopedia of DNA Elements (ENCODE) DNA extraction and genotyping. DNA was extracted from whole blood as described elsewhere Genetic association study. The case\u2013control association analysis and the subphenotype analysis were performed in Plink Cell culture, cloning, and luciferase assays. Primary human PASMCs  and immortalized human PASMCs  were used for the in\u00a0vitro experiments. NKX2-5 gene expression in patients with SSc\u2010associated PH and in matched controls was assessed in primary PASMCs isolated from human tissue as described previously Disease\u2010associated SNPs were cloned into reporter vectors and transfected into primary human PASMCs. Luciferase assays were then performed.RNA silencing, binding assays, and Western blotting. Immortalized human PASMCs were transfected for 48\u201372 hours with small interfering RNA (siRNA) oligonucleotides specific for transcription\u2010enhancer factor domain 1 (TEAD1), TEAD3, and Yes\u2010associated protein 1 (YAP1) . RNA and protein were extracted and subjected to quantitative PCR (qPCR), sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis (SDS\u2010PAGE), and Western blotting.Electrophoretic mobility shift assay (EMSA), DNA\u2013protein pull\u2010down assays, and chromatin immunoprecipitation (ChIP) assays were performed to identify protein complexes that bind the associated SNPs.Nuclear  and total cell (radioimmunoprecipitation assay) protein extracts were prepared. Cell lysates were subjected to SDS\u2010PAGE and Western blotting. Specific antibodies against NKX2\u20105, TEAD1, TEAD3, phospho\u2010YAP1, and YAP1 were used. GAPDH served as a housekeeping gene. Densitometry analysis was performed using ImageJ software RNA extraction and qPCR. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). NKX2\u20105 gene expression was normalized against the expression of the \u03b2\u2010actin gene or the TATA box binding protein, as indicated below.Immunohistochemistry. Immunohistochemistry was performed on formalin\u2010fixed paraffin\u2010embedded tissue. After antigen retrieval with citric buffer, pH 6.0, sections were immunodecorated with optimally diluted  antibody NKX2\u20105 . Biotinylated goat anti\u2010rabbit secondary antibody  diluted 2 \u03bcg/ml in TBS was used prior to developing with 3,3\u2032\u2010diaminobenzidine reagent . Specificity of staining was confirmed using isotype\u2010matched IgG control antibodies (2 \u03bcg/ml).Statistical analysis. Results are reported as the mean \u00b1 SEM of data from at least 3 independent experiments. Statistical analyses (Student's unpaired t\u2010test) and graphs were performed using GraphPad Prism 6 software. P values less than 0.05 were considered significant.Up-regulationofNKX2-5and expression in vascular diseases such as SSc-associated PH. Initially, NKX2-5 expression was determined in the pulmonary vasculature of patients with SSc\u2010associated PH. Immunohistochemical staining revealed that NKX2\u20105 was highly expressed in all muscularized arteries in the patients\u2019 lungs, but absent from the vasculature of the healthy subjects\u2019 lungs  expression and found a significant increase (P = 0.02) in NKX2-5 gene expression in the patients . Meta\u2010analysis of the 2 cohorts showed association of rs3131917 with SSc     and rs3095870 showed a marginal association with pulmonary fibrosis (corrected P = 0.04) in the Spanish cohort (Supplementary Table\u00a0http://onlinelibrary.wiley.com/doi/10.1002/art.40419/abstract).NKX2-5 using genotype data on the CEU population. The data showed an extended linkage disequilibrium pattern across the region , with similar patterns observed in the SSc cohorts  (Supplementary Table\u00a0http://onlinelibrary.wiley.com/doi/10.1002/art.40419/abstract). These findings suggest that there is a synergistic, rather than a single\u2010locus, effect of the SNPs and emphasize the importance of NKX2-5 in SSc and vascular pathologies as a whole.We further examined the structure of Presence of disease-associated SNPs in potential regulatory regions. The genetic association study revealed that rs3131917 and rs3132139 were strongly associated with SSc\u2010associated PH. Since our aim was to determine how NKX2-5 is activated in diseased vessels, we further explored the potential functional role of the SNPs. Due to the extensive linkage disequilibrium  in the Spanish cohort  binding site. TEAD1 is a member of the TEA/ATTS domain family transcription regulators with distinct and important roles in VSMC differentiation and in cardiovascular disease NKX2-5 transcriptional activity using luciferase reporter assays. A 1.6\u2010kb genomic region containing the rs3095870 C allele was cloned into a pGL4.10 reporter vector (pGL\u2010prom\u2010C) driven by the NKX2-5 minimal promoter (pGL\u2010minprom). The alternative T allele was introduced by site\u2010directed mutagenesis (pGL\u2010prom\u2010T), and the constructs were transfected into primary human PASMCs. Addition of the 1.6\u2010kb upstream region increased the relative expression of luciferase as compared to the minimal promoter, but only in the presence of the rs3095870 C allele (P < 0.01) , luciferase expression was increased significantly compared to\u00a0both pGL\u2010prom\u2010C and pGL\u2010prom\u2010T (P < 0.0001) . Supershift assays confirmed that TEAD1 and YAP1 are both components of the rs3095870 C\u2013binding complex \u2013treated immortalized human PASMCs   Figure\u00a0D. Taken NKX2-5. When TEAD3 was knocked down by siRNA, the gene and protein levels of NKX2\u20105 were significantly decreased . We next verified that YAP1 is a cofactor for TEAD1/3 proteins by showing that NKX2\u20105 gene and protein levels were significantly decreased when YAP1 was knocked down using siRNA  are located downstream of NKX2-5. This region was previously described as a candidate cardiac enhancer sequence due to its proximity to the NKX2-5 gene, although it has not yet been verified experimentally NKX2-5 enhancer in human PASMCs , and c\u2010Jun. Since enhancer effects are usually cell type\u2013specific, we performed ChIP assays in immortalized human PASMCs.NKX2-5 expression  being the most studied P = 0.029). This is a de novo finding of an association between SSc and a gene unrelated to immunity in a meta\u2010analysis across 2 independent cohorts of similar origin.Autoimmunity and dysregulation of immune responses are well\u2010established components of SSc, and the major histocompatibility complex has been predominantly associated with SSc by the majority of genetic studies and genome\u2010wide association studies NKX2-5 genomic locus is important in pulmonary/vascular pathology. In fact, rs3132139 showed a significant association (P = 0.006) in a meta\u2010analysis of 46 genome\u2010wide association studies in patients with coronary artery disease (CAD) The groups of SSc patients with pulmonary complications such as PH and pulmonary fibrosis have the highest mortality rates NKX2-5 in heart tissue by ChIP\u2010Seq analysis NKX2-5 enhancer. In reporter gene assays, luciferase activity was significantly increased in the presence of this enhancer compared to the proximal minimal promoter. We have shown that there is enriched binding of the transcription factors MEF\u20102C, GATA\u20106, and c\u2010Jun on this enhancer. This result supports early studies showing that MEF\u20102C/NKX2\u20105/GATA form a positive regulatory network Surprisingly, both rs3131917 and rs3132139 reside in a region that was identified as a putative enhancer  for NKX2-5 activation in human PASMCs. TEAD1 can only bind the NKX2-5 upstream promoter at \u20131.1 kb in the presence of the rs3095870 C allele. TEADs are expressed in VSMCs, where they are known to control phenotype modulation from the contractile to the synthetic state, as well as cell proliferation and the cell cycle NKX2-5 mRNA in siRNA knockdown experiments. On the contrary, specific siRNA for TEAD3 significantly decreased both the protein and RNA levels of NKX2\u20105. TEAD3 cotransfection in human PASMCs, however, did not increase luciferase expression.We also identified TEAD1 as a transcription regulator for NKX2-5 transcription through binding on another MCAT element located outside the 1.6\u2010kb upstream region containing rs3095870 . In the presence of TEAD1, however, the transcription is significantly enhanced (Figure\u00a0NKX2-5 by binding to the promoter containing rs3095870 in response to injury or disease\u2010associated stimuli.These data indicate a complex transcriptional mechanism that involves both TEAD1 and TEAD3. One explanation could be that TEAD3 is directly required for basal levels of NKX2-5 transcriptional regulation.A recent study showed that TEAD3 is required for TGF\u03b2 signaling through association with Smad3 in human aortic SMCs in a risk locus for atherosclerosis NKX2-5 gene in human PASMCs, which is described in detail in Figure\u00a0NKX2-5 in human PASMCs. Transcriptional activation, and therefore NKX2\u20105 expression, in VSMCs results in the up\u2010regulation of NKX2\u20105 downstream targets associated with inflammation, proliferation, migration, extracellular matrix production, and deposition within the vascular wall, all of which are key features of vascular remodeling and ultimately lead to disease\u2010associated pathogenic phenotypes We propose a new mechanism for the regulation of the NKX2-5 is genetically associated with SSc and PH, and we propose for the first time a regulatory mechanism for the transcriptional activation of the human NKX2-5 gene in diseased vessels. The mechanism involves an upstream promoter that binds the TEAD/YAP1 complex and a novel enhancer activated through the binding of GATA\u20106, MEF\u20102C, and c\u2010Jun. We believe that this is a key mechanism that is common in conditions characterized by different types of vascular remodeling, including but not limited to PAH, CAD, peripheral artery disease, and stroke.In summary, we have shown that All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. Ponticos had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.Dritsoula, Martin, Herrick, Abraham, Denton, Ponticos.Dritsoula, Ponticos.Dritsoula, Papaioannou, Guerra, Fonseca, Ponticos.\u00a0Click here for additional data file."}
+{"text": "Teeth are a fundamental tool in forensic odontology for identification in a legal context of those individuals who cannot be identified visually or by other means. Dentine presents physiological exchanges of in trace elements after a period of mineralization and several factors can affect its concentration. The aim of this study was to investigate the concentration of 25 trace elements in the coronal dentine according to sex and type of tooth to determine their relationship with age. A total of 25 trace elements were analyzed in 150 human coronal dentine. Teeth were classified into three age groups, sex and tooth type. The trace elements were grouped as potentially toxic or essential. Inductively Coupled Plasma-Mass Spectrometry and Atomic Emission Spectroscopy were used. The toxic and essential elements were detected in the following order of concentration: Al > Pb > Sn > Li > As > Cd and Ca > P > Mg > Na > S > K > Sr > Zn > Ba > Fe > B > Ti > Mn > Cr > Ni > Cu > Co > Se > V. Our findings show an increase in the concentration of toxic  and essential  elements in coronal dentin related to the age of the teeth, regardless of sex. The concentrations of Pb and K in dentin of molars and premolars are the elements that best relate their variations with age. In view of our results, the analysis of these trace elements in dentin in combination with other types of techniques could be established as an element to consider in age dating studies in different forensic situations. The hardness of dental structures allows teeth to be preserved over time, being resistant to decomposition and high temperatures, making them very useful in postmortem analysis and essential for the identification of human remains8. Recent studies have investigated the relationship between the trace elements in human teeth and pollution11 and as a bio-indicator of the nutritional status or disease12. Different methods are continuously being developed to estimate dental age using dental tissues, and histological, radiographic and biochemical procedures, but none is considered very accurate19. Dental age determination is becoming important in cases of people without any identity or bone remains21, competitive sports with age limits22, and also to estimate dental age among under aged commercial sex workers with the intention of rehabilitation, and in paleodontological studies23. Teeth, then, are an important adjunct in forensics.Teeth and oral structures are a fundamental tool in forensic odontology for identification in a legal context of those individuals who cannot be identified visually or by other means24. Teeth have the ability to incorporate many chemical elements into their structure, the most abundant being calcium, phosphorus, magnesium and sodium27. Dental structures contain a wide variety of trace elements but most studies analyze the concentration of trace elements in dental enamel28.The biomineralization of teeth is a dynamic, complex and lifelong process through which inorganic nanocrystal precipitations occur within the organic matrices to form hybrid biological tissues29. It also presents a physiological exchange of elements after a period of mineralization, contrary to that which occurs in enamel30. Moreover, dentine is characterized by having a non-active metabolism of elements after dentine formation is complete and the mobility of the substances it contains is low compared with other hard tissues, providing a permanent, cumulative and solid record of past and/or recent heavy metal environmental exposure34.Dentine is surrounded by enamel and cementum, and is not affected by the oral environment42. However, the concentration of trace elements in dental dentine may be affected by sex and show different degrees of sensitivity according to age, but dates on the trace elements found in tooth dentine is scarce43.Many studies show that there are several factors that can affect the concentration of trace elements in whole-teeth, when making correlations between samples and environmental conditions, life habits (diet and tobacco), region of origin, caries, diseases, such as diabetes or high blood pressure33. It is believed to be attributable to the fact that dentin contains a significant quantity of collagen fibers and that, after the elements that have affinity for collagen fiber are processed in the body and the accumulated dose increased, concentrations increase in relation to age.A study found that many dentin elements increase with age until the age of fiftyThe aim of this study was to investigate the concentration of twenty-five trace elements  in the coronal dentine of healthy teeth according to sex and type of tooth to determine any relationship between the accumulation of trace elements and age and, consequently, to establish the usefulness of dental dentine as a long-term dental element suitable for age studies in forensic situations.46.A total of 150 healthy permanent teeth were extracted from different patients due to orthodontic treatment or therapeutic interventions between 2016 and 2018 in the University Dental Clinic, University of Murcia (Spain). All the teeth belonged to patients of Spanish nationality, residing in Murcia, a Mediterranean city in the southeast of Spain  with an age range between 18 to 88 years. Of the dental pieces analysed 42% corresponded to men (n\u2009=\u200963) and 58% to women (n\u2009=\u200987). Teeth in poor condition  were excluded.The different dental pieces analyzed in this study were classified following the nomenclature of the World Dental FederationFor the study, the teeth were divided into three age groups and receiver operation characteristic (ROC) curves were used to find an optimal cut-off value for each group: Group 1 (<30 years), n\u2009=\u200956; Group 2 (30\u201350 years), n\u2009=\u200945 and Group 3 (>50 years), n\u2009=\u200949. A range of optimal values was obtained between 29.8 and 49.7 years, with sensitivity of 0.718\u20130.498, and specificity of 0.687\u20130.795. The final cut-off values of 30 and 50 years was chosen.Informed consent was obtained from all the participants included in the study. The study protocol was approved by the institutional ethics committee in accordance with the Helsinki Declaration of 2000 and the protocol was approved by the Ethical Research Committee of Murcia University (ID2035/2018).49, since this allows the crown to be separated from the root with the minimum risk of contamination.All the teeth were classified and washed in distilled water, air-dried and frozen at \u221220\u2009\u00b0C after extraction until use. All the instruments used during the teeth preparation phase were washed with 10% nitric acid and then rinsed with distilled water and dried in a laboratory incubator (70\u2009\u00b0C). Prior to analysis, the teeth were sterilized in a steam autoclave at 134\u2009\u00b0C and 30\u2009psi for 3\u2009min. To remove the soft tissues, gums and blood the teeth were soaked for 2\u2009h in 30% hydrogen peroxide with occasional agitation and washed three times with Milli-Q quality water and decoronated\u2212cm resistivity) and dried in an oven at 60\u2009\u00b0C for 2 h50. Once dry, each coronal dentine block was ground in an agate mortar, and 0.2\u2009g was weighed on a precision balance. Digestion was performed using a digester (Microwave Milestone Model Ultrawave). The sample was placed in a Teflon tube with 4\u2009ml of a high purity 65% nitric acid , 4\u2009ml of Milli-Q water and 2\u2009ml of 30% hydrogen peroxide. All the chemical reagents used during the analysis and preparation had been awarded quality certificates. After the digestion process, the resulting solution was transferred to a volumetric flask and was flushed with distilled water and stored at 4\u2009\u00b0C until analysis.Enamel, cementum and the pulp were removed, obtaining the coronal dentine block, which was again cleaned in an ultrasonic bath of ultrapure water , Barium (Ba), Calcium (Ca), Cobalt (Co), Chrome (Cr), Copper (Cu), Iron (Fe), Potassium (K), Magnesium (Mg), Manganese (Mn), Sodium (Na), Nickel (Ni), Phosphorus (P), Sulfur (S), Selenium (Se), Strontium (Sr), Titanium (Ti), Vanadium (V), Zinc (Zn); and those that have no known biological role and/or are potentially toxic: Aluminum (Al), Arsenic (As), Cadmium (Cd), Lithium (Li), Lead (Pb), Stannum (Sn)11. The working solutions were prepared by precisely measured dilution of the stock solutions with double distilled water for calibration.Trace elements were determined by Inductively Coupled Plasma-Mass Spectrometry , except for calcium (Ca) and phosphorus (P), which were determined by Inductively Coupled Plasma Atomic Emission Spectroscopy . Calibration of ICP-MS was performed using multielement calibration standard solution, 1000\u2009mg/L stock solution of each element  in 2% pure nitric acid. All of measurements had 3 replicas. Calibration of ICP-OES was carried out by means of a 1000\u2009mg/L multielement calibration standard solution of the analyzed elements  and the working standards were prepared with acidified ultra-pure water . The limit of detection for both teams was calculated as three times the standard deviation of the values of the blanksDemographic data and results were collected in a database  and the analysis was performed using SPSS 22.0  and the figures have been generated using GraphPad Prism 5 software. All results were expressed as mean \u00b1 SEM or as a percentage. The arithmetic mean (AM), standard error (SE), median, maximum (Max), minimum (Min), skewness and kurtosis values were estimated by descriptive statistical analysis. The nonparametric Mann-Whitney U test for two samples and the ANOVA Kruskal\u2013Wallis test by ranks for multiple samples were run to compare mean values and mean values with different data groups, and Spearman\u2019s rho correlation was used to measure the linear association between two variables. For continuous variables such as age, a receiver operation characteristic (ROC) curve was used to acquire a cut-off value for stratification. P-values below 0.05 were considered significant. The correlations between the elements present in teeth and age groups were assessed by regression analysis and principal component analysis (PCA). Kaiser\u2013Meyer\u2013Olkin\u2019s measure of sampling adequacy (KMO) was used to assess the usefulness of a PCA in each age group. KMO ranges from 0 to 1 and should be well above 0.5 if variables are very interdependent and a PCA is useful. Kaiser-Meyer-Olkin\u2019s measure of sampling adequacy (KMO) of a PCA in each age group were showed.\u22121).A total of 25 trace elements were analyzed in all the samples n\u2009=\u2009150) of coronary dentine (Supplementary Table\u00a050 of corThe concentrations of toxic elements were in the following order: Al > Pb > Sn > Li > As > Cd (Supplementary Table\u00a0\u22121) than in women . Similarly, Al concentrations in men (9.595\u2009\u00b1\u20094.734 \u03bcg g\u22121) were higher than in women\u2019s teeth (3.394\u2009\u00b1\u20090.635 \u03bcg g\u22121) but the differences were not statistically significant. According to tooth type, similar concentrations of all toxic elements were detected in all cases.An analysis of the concentration of toxic elements according to sex and type of tooth was made Fig.\u00a0. The con\u22121) compared with women  and a statistically significant increase in K (309\u2009\u00b1\u200917\u2009\u03bcg\u2009g\u22121), Co (0.049\u2009\u00b1\u20090.009\u2009\u03bcg\u2009g\u22121) and Ni (0.444\u2009\u00b1\u20090.2\u2009\u03bcg\u2009g\u22121) levels in men compared with the levels measured in women , Na (6739\u2009\u00b1\u200978.6\u2009\u03bcg\u2009g\u22121), Mn (0.598\u2009\u00b1\u20090.043\u2009\u03bcg\u2009g\u22121) were statistically higher in molars than in premolars, while Cr (0.287\u2009\u00b1\u20090.196\u2009\u03bcg\u2009g\u22121), Ni (0.216\u2009\u00b1\u20090.116\u2009\u03bcg\u2009g\u22121), Co (0.053\u2009\u00b1\u20090.007\u2009\u03bcg\u2009g\u22121) and V (0.009\u2009\u00b1\u20090.0006\u2009\u03bcg\u2009g\u22121) showed significantly lower levels in molars  was analyzed in total teeth, according to sex and type of tooth (molar and premolar) Fig.\u00a0.Figure 2Of the 6 toxic elements analyzed, only 3 elements  were significantly related with age (P\u2009<\u20090.05)  and group II (30\u201350 years) were Al\u2009>\u2009Pb\u2009>\u2009Sn\u2009>\u2009Li\u2009>\u2009As\u2009>\u2009Cd, while in group III (\u2009>\u200950 years) Pb levels were higher than those of Al Fig.\u00a0. A statiThe concentration of essential elements in all age ranges  were analyzed in total teeth, according to sex and type of tooth Fig.\u00a0, Fig.\u00a03aIn total teeth, the highest concentrations of essential elements found showed the following order of concentration: Ca\u2009>\u2009P\u2009>\u2009Mg\u2009>\u2009Na\u2009>\u2009S\u2009>\u2009K\u2009>\u2009Sr\u2009>\u2009Zn\u2009>\u2009Ba.As regards tooth age, small differences were found in group I (<\u200930 years) and group II (30\u201350 years) where the levels of Mg and Na were similar. In group III (\u2009>\u200950 years), the concentration of Ba was higher than Zn.In men, statistically significant differences were found for the following elements Mg, S, K, Co and Ba while for women it was K, Zn, Sr and V Fig.\u00a0. The disNext, the correlation between different trace elements was considered Table\u00a0. While sSignificant positive correlation between different essential elements were also found; for example, Mg with V although the correlation was negative with S. The essential element K showed positive correlation with Mg, S, Sr and Zn, while Sr showed a significant positive correlation with V and Zn. Finally, a positive correlation was observed between essential and toxic elements including B with Al, Pb, Li, Sn. The rest of the correlations are presented in Table\u00a0The correlation coefficients between the concentrations of elements in dentine and age was analyzed Table\u00a0. SignifiThe regression calculation was used to statistically describe the studied population. For dependencies of changes in age in the function of trace element concentration, Table\u00a0The analysis of the total of teeth shows how all the toxic elements increased linearly with age, although only the increase in Pb was statistically significant (P\u2009=\u20090.000). Similarly, the rest of the essential elements were positively correlated with age, and these correlations were statistically significant in the case of Sr, Mg, K, Ba, B. The essential elements Zn showed a negative regression or decrease in concentration with increasing age.In addition, the PCA was used to identify whether the samples differed and what trace elements were responsible for any difference Fig.\u00a0. In grouIn this study, we have analyzed the concentration of twenty-five trace elements in the coronal dentine of healthy teeth according to sex to determine any relationship between the accumulation of these trace elements and age and, consequently, to be able to establish dentine as an appropriate long-term dental element for age studies in forensic investigation.52. Trace elements have an important role both in general human health and dental health, since they participate in important biological processes, although in many cases the precise function is still unknown53. Previous studies indicated the importance of trace element analysis in dentine and permanent tooth enamel in order to provide chronological information on exposure, acting as a reliable bio-indicator of environmental pollution11.The trace elements incorporated in teeth enter the human body from different sources, such as food, water and air55. Molars and premolars are the largest pieces, with the best easy handling for dentin extraction, and because they are the best protected teeth in the oral cavity. Both types of teeth emerge and mark the beginning of dental replacement. Furthermore, from the forensic point of view, in cases of destruction of the corpse by putrefaction or in situations of major catastrophes, they are usually the best preserved teeth56.The molars and premolars have been the dental pieces analyzed in this study because they are the most common to extract for orthodontic purposes57. Our results showed that with the exception of Zn in both types of teeth and B and Ba in premolars, the rest of the elements increase in each age group, reaching statistical significance in several of them.In our study cohort, we had an acceptable sample size for both types of teeth (109 molars and 41 premolars) and for reason and with the sole purpose of corroborating previous observations made by other authors in different populations58. On the other hand, other authors59 showed that tooth type is not a major factor affecting lead accumulation in adults. On the other hand, other authors analyzed 40 carious teeth and no found differences in the concentrations of trace elements between incisors, canines, molars60 and premolars, the Kumagai study also found no difference between tooth types33.Therefore, based on our results, both types of teeth could be used to estimate age. There is little and disparate information on the concentration of trace elements according to the type of tooth. Regarding lead accumulation, a study showed that lead accumulation depends on tooth type: the older the tooth, the higher its lead content8.In our study, teeth were divided into three age groups and receptor operating characteristic curves (ROC) were used to find an optimal cut off value for each group with optimal sensitivity and specificity. It should be noted that giving a wide age range, about 20 years at least, is usual and recommended, especially in cases of deceased people and especially in adults. Since giving a minor age range can lead to incorrect dating19. Dental maturity plays an significant role in infant and adolescent age estimates61. The number and sequence of the outbreaked teeth will assess an individual\u2019s age reasonably. Radiographical methods will focus further on the various stages of mineralization63 and further help in a more reliable age calculation. Mineralization of teeth provides a better approximation of chronological age than bone mineralization64 since the stage of mineralization in the teeth is less affected by variability in the individual\u2019s nutritional and endocrine state. In this regard, the developmental stages of the teeth as given by Demirjian et al.65 are much in use for estimation of chronological age throughout the world56.Different methods for estimating dental age using dental tissues and histological, radiographic and biochemical procedures are continuously being established69. Different authors suggest that reference values of trace elements in dentin can be useful for estimating age70, since there is no metabolism of the active element after the formation of dentin, and it is not affected by the oral environment, it is considered a reliable biological factor. But despite all this, dates on the trace elements found in tooth dentine is scarce43.Several studies have analyzed how tooth age can be estimated based on aspartic acid racemization, morphological, histological and functional changes in teeth, dental imaging, changes in hardness and the modulus of elasticity of dentine33. Electron microscopy demonstrates that these tissue spaces ultimately become mineralized, including all the constituent collagen structures and all the space (volume) between them. Currently there is uncertainty as to whether more mineral resides within collagen or outside it, and recently certain electron microscopic studies indicate far more mineral deposited between collagen than within it. Electron microscopy also shows that collagen structures differ considerably in the extracellular space (volume) they occupy, a result depending on the species and tissues examined as well as their age and maturation71.Dentin formation continues throughout the life of the tooth, and its formation results in a gradual but progressive reduction in the size of the pulp cavity. That the pulp supports the dentin and that age changes within the pulp are reflected in the dentin has been emphasized. Since the amount of trace elements in dentin may change with age, this is considered to be a reliable biological load indexet al.33, in an analysis of the relation with age of 10 trace elements in dentine - boron (B), manganese (Mn), cobalt (Co),copper (Cu), zinc (Zn), rubidium (Rb), strontium (Sr), molybdenum (Mo), cadmium (Cd), and lead (Pb) - suggested that human dentine is an appropriate substance for relating sex and age, lending weight to the data obtained in our study.Kumagai 72. The analysis of lead (Pb) pointed to significant differences in terms of sex, with men presenting higher levels than women, corroborating the observations made by other authors33.Our data show that of the total of 25 analyzed elements, only twelve elements have a significant correlation with age, of which three are toxic or potentially toxic  and nine are essential . In the case of the toxic or potentially toxic elements, all three , have a significant and positive correlation with age, although the physiological function is not clear74, which has also been observed by other authors76. On the other hand, Pb is associated with environmental pollution processes78 and its accumulation can affect the concentrations of other essential elements such as Fe, Zn and Cu75. However, our data show that Pb accumulation significantly decreases the absorption of Na but not of the rest of the elements analyzed.The analysis of the mean concentrations of Pb, Li and Sn found a significant increase in all three age ranges analyzed while the rest of the toxic elements not showed this trend. The positive correlation of Pb with age may be due to its affinity for collagen fibers and the fact that it accumulates in calcified tissueet al.79 observed that both elements increase in concentration with age in women\u2019s hair. Lithium (Li) is widely used as an effective treatment for mood disorders and is associated with increased risk of reduced urinary concentrating, hypothyroidism, hyperparathyroidism, and weight gain80. Tin (Sn) intoxication has been seen to alter the activities of some enzymes, affecting the metabolism of Zn, Cu, Fe and Ca and modifying the concentration of some other elements in tissues11.Regarding lithium (Li) and tin (Sn), Skalnaya 81. These effects are attributed to strong chemical interactions between the components. According to the model proposed by Marel82, they assume that the metals Li on the one hand and Pb or Sn on the other hand have conduction bands that partially overlap. As lithium is applied to Pb or Sn, some conduction electrons can flow from the Li band into the Pb or Sn band.In a study it was observed how the values of Li and Sn (1.30\u2009V) were approximately equal to that of Li-Pb (1.25\u2009V). Therefore, the transfer of electrons from Li to Sn and Pb would take place, respectively, leading to ionic bonds and preferred heterocoordination83.Furthermore, neutron diffraction measurements of liquid Li-Sn alloys provide evidence for appreciable ordering in the liquid, probably accompanied by charge transfer from Li to Sn. The structural properties of the Li-Sn alloy system closely resemble those of the Li-Pb system84. There were variations in Mg, Sr, B, Ba, K, S, Zn, Co and V with respect to the age of teeth, but only Mg, Sr, B, Ba, K, S and Zn concentrations showed significant positive correlations with age, increasing as age increases.As for the essential or potentially essential elements, the highest concentrations in dentine were observed for Ca, P, Mg and Naet al.33 observed positive correlations between B, Co, Cu, Sr and Zn concentrations and age, corroborating our observations for B, Sr and Zn since the rest of the elements we analyzed were not analyzed in their study. Regarding cobalt and potassium, Derise et al.43 observed that the concentrations of both increased with age in the enamel; however our data do not agree with their observations for cobalt but do in the case of potassium.Kumagai 85.Potassium (K) is involved in apatite biomineralization, along with numerous trace elements. In our study, it is the essential element that best explains the variation in concentration with age. Similar results were obtained in a study where different essential elements in dentin were analyzed and only K exhibited significant positive correlation with age86. Magnesium metabolism imbalances are normal and contribute to multiple pathological conditions87. Recent studies indicate that periodontitis may be a risk factor for cardiovascular diseases, which were also associated with deficiencies in Mg88. Interactions between and among different steps in the pathogenesis of periodontitis may explain the relationship between periodontal status and the Mg/Ca ratio.Magnesium is considered physiological calcium antagonist. This can serve as a significant regulator of cell functions at the cellular level. In healthy subjects the serum concentration is remarkably stable. Big average serum Mg concentrations are protected against various diseases89. Boron has beneficial effects on lipid metabolism, obesity and thyroid metabolism and may be used as a cariostatic agent in dentistry90. Boron is believed to accumulate in bone several times greater than blood concentration and affects its calcium content89. Boron will deposit on teeth as calcium borate rather than calcium phosphate and change the properties of of teeth including its resistance to caries91. Our results show a negative correlation between B and Ca and a positive correlation between B-Li/Pb/Sn.Boron is an element commonly found in nature and the main source is food and drinking water, primarily through the use of fertilizers containing borate11. It has also been related with protection against tooth decay due to the exchange produced by calcium in hydroxyapatite92. It is an essential trace element in humans93. It is abundant in nature, it is present in all plants and animals, it is found in human tissues in relatively constant amounts, it is concentrated in the bones and teeth where it may have important functions such as bone and teeth hardening and dental caries prevention94. Many research has shown that having strontium in your diet improves the accumulation of dentin bone tissue in your teeth, and a lack of strontium in your diet causes your bones and teeth to become defectively mineralized. It has now been generally established that supplemented strontium as strontium ranelate decreases bone resorption and promotes osteoblast development and new bone formation in osteopor women95. It now appears that on osteoblastic cells there is also a particular receptor that responds to strontium alone and not to other minerals such as calcium or aluminum93. Our results show a strong correlation between Sr-Pb and Sr-Sn.\u00a0In the case of strontium, other studies corroborate our observations, observing positive correlations between concentration and age33.Strontium builds up in the bones and chronic or excessive exposure can cause metabolic dysfunctions and bone mineralization problems, lowering calcium in the bone and leading to hypocalcemiaet al.11 on 50 permanent teeth, it was observed that the concentration of Barium was higher in the older subjects, coinciding with our results. Barium is of minimal toxicity to humans in general and replaces calcium in dentine hydroxyapatite24 but high levels can cause acute intoxication11. Barium is found in a high percentage in bones and connective tissues and in small amounts in muscle, fat and skin91. Strontium in human bone has been found to increase regularly with age96. Some bone ligands are unlikely to unnecessarily discriminate between the small amounts of Group IIA elements. Large quantities of strontium are known it can cause rickets in laboratory animals, probably by displacing calcium86. Regarding the biological activities in mammals, there is some evidence that strontium could harden bones and teeth, making it considered an anticariogenic agent in men86. No demonstrable effects on a mammal\u2019s growth were found. In fact, there is no evidence that barium has particular function for optimum bone formation, and low bone concentrations are likely to be inertial.In the study carried out by Asaduzzaman in vitro86.With regard to the concentrations of cobalt and zinc, no correlation with the three age groups was observed until the age of 50, when the concentration increases weakly and then decreases. Osteoblasts exposed to ions such as cobalt (Co) and chromium (Cr) undergo a dose-dependent proliferation reduction. Titanium (Ti) ions have been shown to be toxic at concentrations of 10 ppm or greater for 24\u2009h. Additional past studies have shown that non-toxic metal ion concentrations affect the differentiation and function of osteoblast cells Our findings show an increase in the concentration of toxic  and essential  elements in coronal dentin related to the age of the teeth, regardless of sex. The concentrations of Pb as a toxic element and K as an essential element are the elements that best explain the variability of age. According to our findings, both molars and premolars can be used to estimate age. Also when used in combination with other morphological or molecular examination of the unknown dental remains can the dental trace elemental composition be used as a forensic method.It is necessary to increase studies on the concentrations of essential and toxic elements in dentin to increase the sample size and be able to reach normalized mean values of each element for each age, and thus be able to establish mathematical models that allow predicting the age. In view of our results, this will be our main objective in the future, since it will allow us to establish the age in forensic situations due to its long-term persistence.Supplementary Tables."}
+{"text": "In this paper we compared taxonomic results obtained by metataxonomics (16S rRNA gene sequencing) and metagenomics (whole shotgun metagenomic sequencing) to investigate their reliability for bacteria profiling, studying the chicken gut as a model system. The experimental conditions included two compartments of gastrointestinal tracts and two sampling times. We compared the relative abundance distributions obtained with the two sequencing strategies and then tested their capability to distinguish the experimental conditions. The results showed that 16S rRNA gene sequencing detects only part of the gut microbiota community revealed by shotgun sequencing. Specifically, when a sufficient number of reads is available, Shotgun sequencing has more power to identify less abundant taxa than 16S sequencing. Finally, we showed that the less abundant genera detected only by shotgun sequencing are biologically meaningful, being able to discriminate between the experimental conditions as much as the more abundant genera detected by both sequencing strategies. This developing field has been hugely affected by the emergence and optimization of high-throughput sequencing, that made metagenomics the key instrument to access complex ecosystems, such as the human and animal gut. The popularity of high-throughput sequencing is due to decreasing cost and augmented speed and scalability of experiments5, which are crucial aspects when researchers design a sequencing project.The study of the gut bacterial community composition has become a fast-developing field, both for the assessment of possible correlations with human diseases and pathologies6. To this aim, metataxonomics and metagenomics strategies are used. Metataxonomics consists in the targeted\u00a0sequencing of 16S rRNA gene hypervariable regions7, and allows representative bacterial taxonomic estimation8 even when a relatively small number of raw reads is obtained 10. The overall sequencing output of metataxonomics is a set of clusters of nearly identical sequences, referred to as Operational Taxonomic Units (OTUs)11 or Amplicon Sequence Variants (ASVs)12. From the analysis of such clusters, information on the community diversity, richness and evenness can be derived13, while accounting for the degree of divergence between different ecosystems or sample types14. However, the choice of primers used to amplify 16S rRNA leads to potential biases in the representation of the taxonomic units18.The main objectives of gut metagenomic studies are: (i) the identification of the gut microbiota taxonomic composition, (ii) the characterization of the relative abundances of taxa, (iii) the description of the functional contribution of each taxon and (iv) the understanding of the intra-species and/or intra-population gene heterogeneity6. To address this issue, shotgun metagenomic sequencing is the most suitable strategy. Here, long DNA molecules, such as complete chromosomes, are randomly broken into fragments that are then sequenced19. Hence, metagenomic data deliver knowledge on the taxonomic composition of the ecosystem under study but also on functional genes in the sample, an information that is not retrievable with 16S rRNA gene sequencing. On the other hand, shotgun metagenomics requires higher coverage than metataxonomics16.Besides the mapping of the taxonomic composition of a sample, the most challenging task for metagenomic studies is the evaluation of the genic contribution of each member of the investigated community in terms of functional genesLactobacillus acidophilus D2/CSL (CECT 4529) (LA) on the ecology of the bacteria colonising the chicken gastrointestinal (GI) tract20. Specifically, we investigated the crop and caeca microbiomes in treated animals and in a control group at 1, 14 and 35\u00a0days of rearing, using shotgun metagenomic sequencing. In the present study, the same DNA samples investigated in the previous research were analysed using the targeted 16S rRNA gene sequencing (16S). Then, the results obtained with both sequencing strategies were compared to answer three broad questions: (1) what is the resolution of bacterial populations observed by shotgun sequencing as a function of the total number of reads; (2) how many bacterial genera are retrieved exclusively by one sequencing strategy and not by the other; (3) how much the two sequencing strategies retrieve information about the specific experimental conditions, namely the different compartments of gastrointestinal tracts and the sampling time. To address these questions, we studied the dependence between the capability of detecting bacterial populations and the total number of reads and we showed that, when a sufficient number of reads is available, shotgun sequencing finds a statistically significant higher number of taxa than 16S sequencing, corresponding to the less abundant. Finally, we analysed bacterial community profiles exclusive to each strategy, demonstrating that the genera detected only by shotgun sequencing are able to discriminate between the experimental conditions better than those detected only by 16S sequencing.In a previous study we gained insights into the effects of 2-transformed distributions, except for 16S outliers, because none of the phyla is significantly rare  and the rarefaction curves. For each sample, we compared the RSA derived by shotgun and 16S sequencing. RSA histograms in logarithmic scale show that the distributions obtained by shotgun and 16S have similar shape at phylum level . This indicates that shotgun samples are characterized by a higher sampling size. According to Preston, left-skewed shapes of the RSA can be explained as artefacts of small sample size22, since insufficient sampling of the original space produces a truncation of the left tail of the RSA, increasing its skewness.On the other hand, at genus level, the two strategies display different shapes Fig.\u00a0, S3, S4.In shotgun samples, the RSA skewness at genus level is related to the total number of reads  and 0.75\u2009\u00b1\u20090.05 in the crop .The agreement between the taxonomic profiles estimated with the two strategies was further evaluated computing for each sample the Pearson\u2019s correlation coefficient (r) between the taxonomic abundances of genera common to 16S and shotgun sequencing. Overall, we observed a good agreement between the taxonomic abundances found by the two strategies Fig.\u00a0, with anA larger difference is observed between the number of identified taxa by the two strategies. The histogram on the left of Fig.\u00a0\u201316).The relationship between abundances detected by 16S and shotgun metagenomics was further investigated fitting a linear regression model on the abundance of genera common to both strategies in each sample. We considered, for each shotgun-16S pair of samples, the logarithmic abundances obtained with 16S as independent variable and those obtained with shotgun as dependent variable, so that the intercept in this model represents the number of shotgun reads corresponding to genera that are mapped to one single read by 16S sequencing, that we consider as a detection limit. Here, samples with low number of reads  were included for completeness. Results show that the model intercept increases as a function of the total number of reads available in shotgun samples  based on taxonomic profiling is performed, in order to identify possible sample stratification due to experimental conditions or to other unknown factors, we calculated the Bray\u2013Curtis beta diversity and performed a Principal Coordinate Analysis (PCoA). We considered for every sample a n-dimensional (n\u2009=\u2009678) vector of abundances, considering the genera that are common to all samples . Most of the bacterial genera were identified by shotgun sequencing, while, on average, 16S recovered less than 31% of the genera and less than 50% of the phyla.17 showed that several phyla were strongly under-represented in the 16S amplicon analysis in comparison to random shotgun DNA sequencing. Moreover, Laudadio et al. (2018)16 highlighted the higher resolution of taxonomic analyses performed by shotgun metagenomics as compared to 16S sequencing at different taxonomic levels, using the number of taxa identified in each sample as a metric to evaluate performance. Tessler et al. (2017)23 and Shah et al. (2011)24 showed instead that 16S rRNA sequencing identified more diverse bacterial phyla and families than shotgun sequencing, but we remark that in both studies the number of reads per sample used for taxonomic profiling was about 100 time smaller than in our study and in the two previously mentioned papers, thus this undersampling might be the reason of this apparent inconsistency 21. The genera detected only by shotgun sequencing are not very abundant, because even if they constitute about 75% of the identified genera, the associated read count is less than 9% of the total reads. Nonetheless, these less abundant genera provided reliable information and showed significant correlation with the different experimental conditions. The same conclusion could not be drawn for low-abundance genera exclusively identified by 16S sequencing. The latter were able to discriminate different compartments of the GI tract but failed to stratify samples according to the sampling time. Finally, our results allowed to provide an estimation of the number of genera that would likely be detected by shotgun sequencing and not by 16S sequencing.The RSA distributions obtained by the two sequencing strategies showed quantitative and qualitative differences at genus level, in particular for the left tail. When the total number of reads was as low as\u2009~\u2009200,000 in shotgun samples, the RSA shapes became strongly positively skewed, similarly to those obtained with 16S. On the other hand, increasing the sampling intensity enabled to detect less abundant genera20. In our study, we compared bacterial abundance profiles in 78 samples undergoing both 16S and shotgun metagenomic sequencing. Overall, 40 samples were from caeca  and 38 from crop  were collected.The experimental trial from which the samples were collected has been previously described in De Cesare et al. (2020)20, whereas for amplicon sequencing, the libraries were prepared following the Illumina 16S Library preparation protocol10, amplifying the variable V3 and V4 regions of the 16S rRNA. Sequencing was performed in paired-end at 150\u00a0bp in the Illumina MiSeq26. The maximum output of the v2 kit is 15 million reads per run, meaning approximately 187,500 reads per sample.Shotgun sequencing was performed as previously described27 and host depletion methods can be not effective for DNA libraries28, the samples were not depleted from host DNA. The reads not assigned to Bacteria domain were hence removed after taxonomic profiling.Since biomasses extracted from GI tracts (caecum in particular) have typically a high microbial loadOverall, 78 metagenomes were analysed: 40 metagenomes from caeca  and 38 from crop . The 16S and shotgun metagenomes analysed as well as their number of sequences mapping to Bacteria are detailed in Supplementary Table 29. Specifically, 16S reads were taxonomically classified using the Silva SSU reference database30, while the RefSeq database31 was used for shotgun reads. Singleton reads were discarded.Both 16S and shotgun raw reads were pre-processed and assigned to a genus using MG-RAST with default parameters29, in particular for samples obtained by shotgun sequencing. For this reason, we choose to perform the analysis of the bacterial communities up to genus level.MG-RAST advices against the reliability of taxonomic profiling at species levelData were processed and visualized in Python 3.6 and R 3.6.0 using custom scripts.32. Rarefaction curves were computed with an extension33 of the R package phyloseq 34 implementing the package vegan35.For each sample, the Relative Species Abundance distribution (RSA) was computed counting the number of genera that have a certain abundance. RSAs were visualized as Preston plots36, considering as significant those changes with an adjusted p-value lower than 0.05. High variability in the dispersion of the counts was adjusted with a shrinkage procedure by DESeq2, that led to smaller estimates of the fold changes in samples with a low number of total reads. For each sample, we calculated and visualized the Pearson\u2019s correlation coefficient between the taxonomic abundances obtained using 16S and shotgun, along with a p-value for correlation significance. For this analysis, we considered only genera that were present in both profiles.Counts normalization and differential genera abundance analysis were performed by DESeq2 package38 and considering normalized counts retrieved by DESeq2, that keeps into account the differences in sample size. Principal Coordinate Analysis (PCoA)39 was performed to visualize the samples based on the beta diversity. Silhouette Scores were calculated to assess the correspondence between sample displacement in the PCoA space and experimental factors . Sampling time corresponds to the days of rearing of the chickens .Beta diversity was computed using the Bray\u2013Curtis distanceThe experiments were conducted after obtaining the approval of Ethical Committee of the University of Bologna on 17/3/2014 (ID: 10/79/2014). All experiments were performed in accordance with relevant guidelines and regulations.Supplementary Information."}
+{"text": "Zung\u2019s Self-rating Anxiety Scale (SAS) is a norm-referenced scale which enjoys widespread use a screener for anxiety disorders. However, recent research  has questioned whether the existing cut-off for identifying the presence of a disorder might be lower than ideal.The current study explored this issue by examining sensitivity and specificity figures against diagnoses made on the basis of the Patient Health Questionnaire (PHQ) in clinical and community samples. The community sample consisted of 210 participants recruited to be representative of the Australian adult population. The clinical sample consisted of a further 141 adults receiving treatment from a mental health professional for some form of anxiety disorder.Mathematical formulas, including Youden\u2019s Index and the Receiver Operating Characteristics Curve, applied to positive PHQ diagnoses (presence of a disorder) from the clinical sample and negative PHQ diagnoses (absence of a disorder) from the community sample suggested that the ideal cut-off point lies between the current and original points recommended by Zung.Consideration of prevalence rates and of the potential costs of false negative and false positive diagnoses, suggests that, while the current cut-off of 36 might be appropriate in the context of clinical screening, the original raw score cut-off of 40 would be most appropriate when the SAS is used in research. Along with depression, anxiety disorders are the most prevalent of mental health conditions , 2. FormThe paper focuses on Zung\u2019s Self-rating Anxiety Scale  a normZung developed a method of scoring both the SDS  and SAS 1 cut-off of 36 most recently recommended by Zung appropriate or should it too be increased?In 1980, Zung  reduced To avoid furthering the confusion between raw and index scores, from this point on, only raw scores will be used in this paper. This includes scores taken from Zung\u2019s research which have been converted back to their raw score form.S.D. = 9.5) and for the normal adult population 33.4 (S.D. = 7.8).Zung  states tAside from examining means and standard deviations of populations with and without the condition in question, other commonly used methods to determine clinical cut-off points include the Youden Index and the Receiver Operating Characteristics (ROC) curve . The YouThe study conducted by Dunstan et al.  employedSD\u00a0=\u200917.43, range\u2009=\u200918\u201382). Participants who were receiving treatment from a mental health professional for either a depressive or anxiety disorder were expressly excluded from this sample. The clinical sample consisted of a further 141 adults  receiving treatment from a mental health professional for some form of anxiety disorder.Two separate samples of participants, all aged 18 and over, were recruited from Qualtrics survey panels. The community sample was recruited to be representative of the broad Australian adult community and consisted of 210 participants (108 men and 102 women) with a mean age of 45.59\u2009years  and somatic  in nature. Responses are given on a 4-point scale which range from 1  to 4 . Participants are instructed to base their answers on their experiences over the last week. Items include both negative and positive  experiences, with the latter being reverse scored. Raw scale scores for the SAS range from 20 to 80. The SAS has satisfactory psychometric properties. These include: internal consistency  [The Zung SAS is a self-report scale whose 20 items cover a variety of anxiety symptoms, both psychological  ; concurra\u2009=\u2009.82) ; and, tha\u2009=\u2009.82) . CronbacParticipants completed the two-page version of the PHQ, which consists of 9 self-report items covering the DSM-5 diagnostic criteria for Major Depressive Disorder and Other Depressive Disorder and 22 items relating to the criteria for Panic Disorder and Other Anxiety Disorder .\u201chad an anxiety attack, suddenly feeling fear or panic\u201d within the last 4\u2009weeks. Additionally, they must also endorse that such attacks have happened before, that some of them \u201ccome out of the blue\u201d and that these attacks either bother them a lot or that they are worried by the prospect of having more. Finally, they have to endorse four out of eleven somatic symptoms as having been present during their last attack [To qualify for a Panic Disorder diagnosis, an individual has to first identify as having t attack .feeling nervous, anxious, on edge, or worrying a lot about different things\u201d on more than half the days over the last four weeks. Additionally, they also have to endorse three of six other anxiety related symptoms  as occurring with at least similar frequency.To qualify for a diagnosis of other anxiety disorders, an individual has first of all to endorse \u201cSpitzer et al.  report tThe primary objective in analysis was to examine the impact on sensitivity and specificity of setting the clinical cut-off score for an anxiety diagnosis at different points.As a precursor to this analysis, however, it was important to reflect on the accuracy of the PHQ diagnoses on which they were based. First, while all members of the clinical sample reported that they were currently receiving treatment for anxiety, this did not necessitate that all would currently satisfy the criteria for an anxiety diagnosis. In an unspecified number of cases, one would expect symptom reductions due to treatment  to be such that, while treatment might still be continuing, those individuals would no longer meet diagnostic criteria. Additionally, there is the question as to the number of false positives and false negatives that are likely to have occurred in the PHQ diagnoses. Using the sensitivity (63%) and specificity (97%) figures reported by Spitzer et al. , it is pOn the basis of these estimates, false PHQ diagnoses can be expected to offer little concern amongst the Positive Clinical subsample. Similarly, false negatives in the Negative Community sample represent no more than 10% of the sample. Amongst the Negative Clinical sample, however, around 45% of the sample are likely to be false negatives, severely compromising the ability of this sample to serve as a test of the SAS\u2019s reliability.Given,the unreliability of PHQ diagnoses in this subsample, the approach taken in setting the cut-point for the SAS was to combine the sensitivity figures achieved in the Positive Clinical sample with the specificity figures achieved in the Negative Community sample. \u2009=\u20096.14, p\u2009<\u2009.001. For the community sample, severe problems with skewness and kurtosis in the subsample screening negative on the PHQ rendered the t-test invalid. However, a Mann Whitney U-test confirmed that there was a significant difference between the sub-samples SAS scores, U\u2009=\u2009673.5, p\u2009<\u2009.001.On the basis of these PHQ screenings, the clinical and community samples were each further split into those receiving a positive diagnosis of some sort and those who did not. The mean SAS scores for each of these four subsamples are detailed in Table\u00a0As detailed in the Data Analysis section, subsequent analysis focussed solely on the Positive Clinical and Negative Community subsamples. Sensitivity and specificity figures within these subsamples (detailing the extent to which SAS diagnoses were in agreement with those of the PHQ) for progressive cut-off points varying from 34 to 42 are detailed in Tables\u00a0The ROC curve that results using these two samples is shown in Fig.\u00a0Utilising these two samples, Table\u00a0With the existing cut-off score of 36, the SAS achieved a sensitivity of 89% in the positive clinical sample, a figure identical to that recorded by Zung in the research on which this cut-off was based . HoweverMathematical methods such as the Youden Index and ROC curve methods suggest a higher cut-off might be appropriate, with 38 emerging as the leading candidate. From a purely mathematical perspective, there is little to choose between the original cut-off of 40 and Zung\u2019s current recommendation . HoweverExamining these results reveals that the case for increasing the recommended clinical cut-off score is far less evident for the SAS than the SDS; see  for compA significant limitation of this study is the fact that the diagnoses on which the SAS sensitivity and specificity figures are based are made on the basis of self-report (namely the criterion-referenced PHQ) rather than clinician conducted interviews. While reported sensitivity and specificity figures for the PHQ itself suggest that errors in diagnosis for the two subsamples used in analysis would be few, the fact that the results for the Positive Community and Negative Clinical samples had to be excluded, limits the degree of confidence that can be placed on these results.A further potential issue is that similarities between the two self-report measures may inflate the correlations between diagnoses. However, the fact that the PHQ is a criterion-referenced rather than norm-referenced lessens this concern.Finally, it should be noted that the perspective taken by this study is broad-based: no distinction is made between different types of anxiety disorders, nor indeed between demographic sub-groups (e.g. differences in gender or by age-group). While this is a common approach in setting cut-off scores, it does leave the generalisability of sensitivity and specifity figures open to question.Ultimately, which SAS cut-off is most appropriate depends on the differential costs attached to false positives and false negatives. In a clinical screening situation where false negatives may result in patients not receiving appropriate treatment, there is an argument for retaining the current cut-off recommended by Zung . HoweverFinally, it should be noted that this study again demonstrates the value of the SAS as a screener for anxiety disorders. Not only is the area under the SAS ROC curve indicative of a discriminating test, but sensitivity and specificity figures more than bear comparison with those reported for the DASS anxiety index e.g., , 30, 31), 3130, 3"}
+{"text": "The obtained coefficients (R2) for some FA, such as \u03b1-linolenic acid with a R2 = 0.96 or n-3 polyunsaturated fatty acids (n-3 PUFA) with R2 = 0.93, demonstrate that FT-MIR spectroscopy is a valid technique to estimate the content of FA. In addition, samples were correctly classified according to the animal diet using discriminant analysis in the region 3000\u20131000 cm\u22121. The obtained results suggest that the FT-MIR spectroscopy could be a viable technique for routine use in quality control because it provides fast and sustainable analysis of FA content. Furthermore, this technique allows the rapid estimation of the FA composition, specifically n-3 PUFA and CLA, of nutritional interest in meat. It also allows the classification of meat samples by the animal diet.The aim of this research was to estimate the fatty acid (FA) content of intramuscular fat from beef by Fourier transform mid-infrared (FT-MIR) spectroscopy. Four diets were supplemented in 10% linseed (LS) and/or 2% conjugated linoleic acid (CLA): CON (without L or CLA), LS, CLA, and LS+CLA. For each diet, 12 young Holstein bulls were allocated. The spectral response of the beef samples was analyzed applying FT-MIR spectroscopy (from 400 to 4000 cm In recent years, the demand for high quality and safety in food production and development for new products enriched with bioactive compounds with health promoting properties has grown. Therefore, the food industries require appropriate analytical tools to satisfy this demand. Some of the features demanded for these technologies are that they are fast to perform, easy to apply, and that they require a simple manipulation of the samples, alongside the avoidance of samples destruction, waste minimization, and low cost .n-3 and n-6 polyunsaturated fatty acids (PUFA) which are considered essential to maintain the health [n-3 PUFA provide beneficial effects to human health. For instance, \u03b1-linolenic acid (ALA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) present potential anti-inflammatory properties against diseases, such as obesity or diabetes [Fat is a critical component of meat because it has a great influence on the maintenance of muscular tissue reducing protein breakdown and it is the energy storage reservoir. In addition, intramuscular fat is responsible for the organoleptic properties and a necessary component of meat products. Fat contributes to and influences palatability, tenderness, juiciness, and flavor of meat. Currently, the tendency of the meat industry is the modification of the lipid profile of meat products, by reducing the saturated fatty acids (SFA) content and increasing the e health . Moreovediabetes .n-3 PUFA and the CLA content in beef [n-3 PUFA is flax or linseed. The linseed coat provides protection to FA against biohydrogenation by ruminal microorganisms and thus facilitates the duodenal passage of PUFA [Meat composition is influenced by numerous factors. Animal diet is particularly interesting as it is a factor easy to manipulate and still has an important effect on its composition . Thus, s in beef . Therefo of PUFA . Thus, l of PUFA ,9 who ob of PUFA ,11 and S of PUFA  investign-3 PUFA supplementations, the FA profile changes must be evaluated in meat. That requires an appropriate method for extraction of fat from meat. This extraction has to be performed with minimal exposure to heat and light to prevent the modification of n-3 PUFA and CLA and to prevent changes in FA structure, which reduces the nutritional value of fats. Several techniques have been employed to analyze FA profile, gas chromatography (GC) being the most commonly used one. However, this method is not satisfactory, as it requires a lot of sample preparation and a lot of processing time. To overcome the limitations of classical chemical methods, alternative techniques based on physical methods have been sought. Mid-infrared (MIR) spectroscopy arises as an interesting alternative due to its high speed of analysis and environmental sustainability as no harmful substances for the environment are used [In order to assess the effectiveness of the different dietary are used .2 = 0.9173) using FT-MIR spectroscopy. Likewise, Ruiz et al. [The determination of the FA profile in different types of meat products has been carried out by different authors using Fourier-transform mid-infrared (FT-MIR) spectroscopy. For example, Ripoche and Guillard  and Flatn-3 PUFA of nutritional interest such as DHA, EPA, DPA, and CLA. The conventional method of extraction is based on the use of chemical solvents (chloroform-methanol) by multiple steps that requires several hours for the FA determination under study. Instead, FT-MIR spectroscopy could be an alternative technique to determine this type of FA of nutritional interest in meat, with or without prior removal of intramuscular fat. Therefore, the aims of this work are (i) to check the appropriate sample (meat or extracted fat) to predict the FA content in beef by FT-MIR spectroscopy; (ii) to discriminate beef samples with different contents in n-3 PUFA and CLA using FT-MIR spectroscopy.Currently, the challenge in the meat industry is to assess PUFA contents because they are quality attributes of meat products associated with consumers\u2019 health. Fast and environmentally sustainable methods are required for predicting minority PUFA content in a reliable way, especially \u00a9 pure, BASF, Ludwigshafen, Germany): CON (without LS or CLA), 10% LS, 2% CLA, and LS+CLA. Composition of the experimental diets, animal productive performance and carcass characteristics of the animals used in this study have been reported by Albert\u00ed et al. [Longissimus thoracis steaks (100 g) were cut at the sixth rib level from the left half-carcass, vacuum-packaged and frozen, and stored at \u221220 \u00b0C until analyses. Samples were gently thawed at 4 \u00b0C overnight prior to analyze.Beef samples were obtained from 48 Holstein bulls fed with one of four dietary treatments . Animals diets were isoenergetic and isoproteic and differed in their amount of whole linseed (LS) and rumen-protected CLA , a KBr beamsplitter , and a DLaTGS detector . An A225/Q Platinum Attenuated Total Reflectance (ATR) accessory was used to get all measurements. A calibration was done before each experiment by measuring the response without any sample on the ATR. Each sample was placed on the ATR touching the diamond crystal and 32 scans in the 4000\u2013400 cm\u22121 spectral range were recorded with a resolution of 4 cm\u22121. After the measurements, a data analysis was performed to select the wavenumbers of the peaks with higher intensities of absorption and to calculate then the standard deviation between the pair of absorption intensities.A Fourier-transform infrared (FTIR) Vertex 80v spectrometer  was used to obtain the infrared spectra. The configuration used in the experiments was a Globar IR thermal source  was used for building the models. The reference method to develop the regression equations and estimate the content of FA in this work was carried out by GC. Fatty acid profile was determined in previous research . For theR2), ratio of performance to deviation (RPD), and bias.MIR spectral data were preprocessed by applying the first derivative and vector normalization. Then calibration models between FA values and MIR spectra were computed by partial least square (PLS) regression and validated using cross-validation. Prediction residuals were then combined to calculate the root mean square error of cross-validation (RMSECV) ,23. It i\u22121 was omitted from PLS analysis, due to uncertainty in that range, which may be the consequence of the absorption of CO2.A spectral region between 2800 and 2300 cmp \u2264 0.05). The aim of these analyses was to determine the feasibility of classifying beef samples of the same diet together.The statistical software SPSS 23.0  was used to analyze the fat spectral information, performing a stepwise discriminant analysis . The diet enriched with n-3 PUFA led to increases of n-3 PUFA. The amount of ALA varies depending on the diet. This fatty acid is EPA and DPA precursor, and there is a relation between ALA and these fatty acids. When ALA amount in intramuscular fat is high, there are more EPA and DPA.As Gomez et al.  found, t\u22121. The assignment of the most important bands was done by matching the wavenumbers with the bibliography references. \u22121. This band is lined up with the C-H bond vibration of the unsaturated fatty acids, stretching vibration of cis double bond (C=CH) [\u22121 is related to asymmetric and symmetric stretching vibration of C-H bonds present on methylene (CH2) and methyl (CH3) groups in fatty acids [A broad band with low intensity appears around 3005 cmd (C=CH) ,25,26,27ty acids ,24,28.\u22121, there is a narrow peak around 1743 cm\u22121 that stands out from the rest with a higher absorption intensity than the others. This peak is related to the stretching vibration of carbonyl bond of esters and free FA [\u22121 is related to scissoring bending vibration mode of C-H bond in the methyl and methylene groups [\u22121 is associated to stretching vibration of C-O bonds and bending vibration of C-H bonds [\u22121 there is a band which is related to the overlapping of the methylene (CH2) rocking vibration and the out of plane vibration of cis-disubstituted olefins [Between 1800 and 400 cm free FA ,26,27,29e groups ,29,30,31-H bonds ,28,31. F olefins ,25,26,27The spectra of \u22121). At first sight, the CON sample spectra differ noticeably with respect to the other samples. This indicates that the method is able to detect beef enriched by n-3 PUFA and/or CLA.Partial least square (PLS) was used for constructing the prediction models. The model validation was done using cross validation, taking out one sample each time.R2) obtained for each prediction model and the errors are shown in R2 value informs how close the CG values and FT-MIR predictive values are. The values varied between 0.96 and 0.15 for the different FA. The main conclusion is that MIR spectroscopy can be used to predict some FA sums  but also for individual PUFA . The determination coefficients found in this study are lower than the results obtained in pork [The PLS analysis was done using the data of GC as reference values. The determination coefficients . This result could be explained because the difference in the content among the different groups was higher than the other FA analyzed by GC. G\u00f3mez et al. [R2 (94.65%) was the sum of n-3 PUFA. The worst R2 was obtained on the prediction of the CLAt10,c12 FA, which had a value of 15.48%. Although the results obtained in this work are interesting to estimate the FA in intramuscular fat, more studies are needed to improve the prediction in the content of other fatty acids such as C18:2n-6(LA), C18:0, and C18:1c9, and especially DHA.ALA was the best predicted FA . This is one reason why the diet should provide a sufficient amount of all these n-3 PUFA . On the diseases . Therefo\u22121 obtained in the fat extracted from beef samples were used.The last objective of this study was to classify the meat samples from animals fed with different dietary treatments , so stepwise discriminant analysis was employed. The spectral data from 3000 to 1000 cmThe classification matrix of the discriminant analysis is shown in Therefore, four groups of animal samples were separated depending on the diet provided  in terms of their spectra obtained by FT-MIR. These results evidenced that discriminant analysis can be used to explore the relationship between FA composition and the spectra of beef from bulls and their diets. Moreover, earlier works using discriminant analysis gave good results to characterize beef FA profile , to distn-3 PUFA and CLA, of nutritional interest in meat. Finally, discriminant analysis allows the classification of samples by the animal diet. In the absence of previous studies on intramuscular beef fat, the MIR technique allows an estimation of the content of FA in the intramuscular fat of beef. For that, the fat is extracted by a standardized method. This analytical technique can be applied for the quality control of beef, especially in case of nutritional interest n-3 PUFA and CLA, being a rapid and sustainable method.The present study confirmed the potential of FT-MIR technique for the rapid and nondestructive measurement of several intramuscular FA from beef. In general, the work related to the determination and quantification of the FA composition of the meat uses the conventional method of extraction employing an apolar solvent as it is less aggressive for GC. This requires several stages of extraction with chloroform-methanol using chemical solvents and several hours for the determination of the FAs under study. Even though the method precedes a fat extraction (6 h) the infrared method is faster because it requires only 1 min per sample in comparison to GC method (1 h). Additionally, infrared spectroscopy is easier to undertake and low cost. Furthermore, this technique allows the rapid estimation of the FA composition, specifically"}
+{"text": "This is a paper about mark making and human becoming. I will be asking what do marks do? How do they signify? What role do marks play in human becoming and the evolution of human intelligence? These questions cannot be pursued effectively from the perspective of any single discipline or ontology. Nonetheless, they are questions that archaeology has a great deal to contribute. They are also important questions, if not the least because evidence of early mark making constitutes the favoured archaeological mark of the \u2018cognitive\u2019 . In this paper I want to argue that the archaeological predilection to see mark making as a potential index of symbolic representation often blind us to other, more basic dimensions of the cognitive life and agency of those marks as material signs. Drawing on enactive cognitive science and Material Engagement Theory I will show that early markings, such as the famous engravings from Blombos cave, are above all the products of kinesthetic dynamics of a non-representational sort that allow humans to engage and discover the semiotic affordances of mark making opening up new possibilities of enactive material signification. I will also indicate some common pitfalls in the way archaeology thinks about the \u2018cognitive\u2019 that needs overcome. This strategy can be especially productive in the case of human becoming. Mark making has been the principle mode of our species\u2019 capacity for material signification and creative material engagement. By mark making I will refer to the creation of a perceived anomaly, or felt difference, on or in a surface. Material or enactive signification denotes the semiotic co-emergence of the signifier and the signified that brings forth meaningful affective experiences and novel conceptualisations of the world , I denote the process of ongoing transformation (inseparably evolutionary and ontogenetic) that characterizes the human condition as indeterminate and incomplete, or else, as always about to become  of material culture. That is what I mean by how they mean, instead of what they mean  is taken for granted. Moreover, they often make selective and superficial use of semiotics. This is especially evident in the use of early pragmatist and semiotician Charles Sanders Peirce, whose triadic scheme is often employed within a modernist dualistic representational framework that misrepresents the very foundation of his work in process ontology. His concept of \u2018synechism\u2019 offers a good reminder of that: We are mistaken, Peirce writes, \u201cto conceive of the psychical and the physical aspects of matter as two aspects absolutely distinct. Viewing a thing from the outside, considering its relation of action and reaction with other things, it appears as matter. Viewing it from the inside, looking at its immediate character as feeling, it appears as consciousness.\u201d Peirce , 6.268.et al.thinging to denote the ways in which things at once surround us and become part of our minds (brains and bodies). Thinging articulates the process of thinking and feeling with, through, rather than simply about things  . In particular, I advocate a Process Archaeology of Mind . Mark making can be additive or reductive depending on whether material is added (as in drawing) or removed (as in engraving) from a surface. For instance, the cross-hatched designs found engraved on several ochre pieces recovered from the Middle Stone Age levels at Blombos Cave, like the famous 8937 piece I discuss below, are reductive, since they are formed by removal of material from the surface itself  left by a continuous movement . Ochre is a good example of this transformation  that produced them. Other forms of signification, or diagrammatic reasoning (in the Peircean sense of thinking with icons), can be afforded or abducted during our meaningful engagement with marks (Iliopoulos e.g. footprints). Still, the hand seems to be the primary tool in mark making. This is not surprising for human becoming given the long tradition of eye-hand coordination and attentive material engagement that probably originates with the edging of stone  without any need to invoke mental representations (O\u2019Regan and No\u00eb My main contention is that markings (as signs) are not to be confounded with symbols and marking (as a process of signification) should not be confused with arbitrary representation. Mark making, I will argue, is an elementary form of enactive material signification. Explaining away those lines in the ochre as abstract representations for the sake of symbolism has stripped those lines from their true significance as enactive signs. Instead of reducing the creation and the perception of marks to mental happenings generated \u2018inside us\u2019, we should be thinking them as processes generated out there, \u2018inside the world\u2019. These processes involve complex interactions between brains, bodies and things , all humans are naturally equipped (born with) with a set of potential capacities which may, or may not, become realized with some variation in different cultural settings. This human potential is genetically fixed and pre-given (innate) and nothing that a human organism does or experience in the course of its life history is capable of changing it.Human becoming, instead, means something different. It refers to a situated process of speciation through ontogenesis. Human becoming is not a genetic set up or an evolutionary stage, but an open and ongoing process of creative engagement with the material world. Inspired by the process philosophy of Henri Louis Bergson ; there is only human becoming. In short, the process of human becoming side-steps the need to mark a point in time when hominins came to be \u2018modern\u2019 humans, that is humans like us living today.The question that naturally follows, given our purpose in this paper, concerns the implications of the above contrasting conceptualisations of the human condition relevant to the issue of mark making. In particular:i.e. becoming human, the place of marks in the evolutionary narrative of human origins (how we came to be human) has been to provide evidence for symbolic capacity . That evidence has been the best archaeological indication about when humans reached that stage or state of cognitive \u2018modernity\u2019 which defines the human condition. Turning now to the second construal, i.e. human becoming, mark making is not signifying a state of modernity, or the ability for symbolic representation; rather it provides itself a crucial semiotic mode of human becoming. In that sense the mark making process is not a symptom or index of achieving humanity (becoming human) but an actual part of the ongoing process of human becoming. This is the reason why, so far as the understanding human origins is concerned, the potential transformations in design thinking brought about, in the past, by the reductive/additive logic of MSA engravings, have the same epistemic value with any potential transformations, brought about in the present, for instance, by the associative logic of digital drawing and parametric design used in contemporary architecture  with one hand, in the right way, and to apply, with the stroking hand, the right pressure as well as to control the depth and direction of the incision. It is not the first time that hominins create lines. We said that cutting marks and natural marks do not count, because their making lacks the relevant intention and attention. Still, the cutting edge of a stone tool can also be seen as an assemblage of three dimensional lines. What is the difference between edging and engraving? One comparative way to phrase those questions is to ask what is it that connects or separates our understanding of the Blombos marks from the edge of a handaxe, or from the ways any contemporary set of marks left on a canvas, a pottery vessel, or a sheet of paper can be understood? If making an incised line is not as easy as one may think, making sense of that line is even harder, as I discuss later on.et al., It \u201cconsists of a row of cross hatching, bounded top and bottom by parallel lines and divided through the middle by a third parallel line that divides the lozenge shapes into triangles. Some of the lines are well-defined single incisions; others have parallel tracks along part or all of their lengths. Much of the parallel tracking may have resulted from a change in position of the engraving tool causing simultaneous scoring from more than one projection. The midline comprises three marking events. Examination of the intersections of the cross-hatched lines indicates that they were not executed as consecutive cross hatchings but that lines were made in first one direction and then another; the horizontal lines overlie the cross hatching\u201d  or forms of signification  can account for the creation and perception of the Blombos marks?Let us focus on one of the existing pieces of incised ochre. Take for instance, the famous, engraved piece with the cross-hatched design (ref n. M1\u20136/8938) recovered in 1999 and 2000 from c. 75,000\u2013100,000\u00a0year old levels at Blombos Cave, and curated at the Iziko-South African Museum, Cape Town. This is a relatively large rectangular piece of reddish-brown siltstone. The excavators describe the engravings on it as follows:These fundamental questions are not well understood. One reason for that is because the majority of researchers seem to take the meaning of \u2018making\u2019 for granted, as if it was something self-explanatory and simple. I would argue that understanding the meaning of marks is inseparable from our understanding of their making. Moreover, that understanding mark making will allow us to re-conceptualize the cognitive life and semiotic significance of marks without reference to symbolism. So where does the significance of \u2018making\u2019 marks reside?The general tendency in archaeology has been to treat those marks, for instance, the cross-hatched design, as \u2018representational abstractions\u2019 that travel from mind to world and communicate some kind of message that people of the Blombos community were able to identify and interpret. In other words, the general assumption has been that the intention that matters behind the cross-hatched design is not one that actually relates to the generative process and manual skills responsible for producing the cross-hatched design. Rather, the intention that matters is one that relates to the mental representational capacities that allow the conceptualisation of the cross-hatched design as a symbol for something else; something outside and beyond the actual cross-hatched design itself. In short, the intention that matters is not about mark making; instead, it is about symboling. As a consequence of that, the main question that occupies the focus of archaeological attention is about the symbolic meaning of \u2018marking\u2019.i.e. when did human become modern? In other words, what seems to be at the centre of attention from the very beginning is not the cognitive life and agency of mark making but rather the characterization of our species as cognitively modern, meaning, as capable of abstract representational thinking, or else, of symbolically mediated behaviour. The major objective that drives research in this context is focusing on establishing how those marks potentially allow archaeologists to infer explicit symbolic intent. This is important because symbolism, or the ability for \u2018representation\u2019, is generally perceived as evidence of cognitive modernity and a proxy for language  which stands for another but also as the relation between a thing and that which stands for. We may distinguish between two major types of representations, namely, \u2018internal\u2019 and \u2018external\u2019. \u2018External\u2019 representations are those material signs or sign systems that are publicly available in the world, whereas mental, or \u2018internal\u2019 representations, can be understood as referring to the private representational content of a certain intention or belief from the world, we process that information, and finally we externalize our mental contents into the world. On this representational construal, the marking process is essentially a substitution, transformation and simultaneous transposition of one mode of representation  to another external, specifically, graphic mode or medium of representation. The purpose of the mark is to deliver a coded message or symbolic description of the world. The function of the marking process is to assemble the actions needed in order to produce the mark that will deliver the desired symbolic description or message.Now the ontology of representation (what precisely a representation is) has been a central theme of research in the science of semiotics. External representations can take a variety of forms and have been studied by many disciplines usually adopting semiotic approaches often rooted in the philosophy of Peirce Davidson . InternaIn contrast to this representational description of our cognitive and semiotic universe, the material engagement approach I advocate in this paper holds that the study of material signs do not have to rely on this representational or symbolic idiom. For one thing, what neuroscientists refer to when they speak of neural \u2018representations\u2019 have little to do with the meaning of this term in archaeological discourse and semiotic analysis. Neurons simply form plastic dynamic networks, which produce activation and de-activation patterns that are structurally coupled with the rest of the human body and the material world. Obviously I am not challenging the important role that the brain plays in the constitution of meaning and signification, what I object is the misleading characterization of neural function and contribution using a representational vocabulary which is, often uncritically, promoted by certain cognitivist theories. Unfortunately, this strong \u2018computationalist\u2019 or \u2018internalist\u2019 tradition in philosophy and cognitive science was uncritically inherited by many archaeologists who continue to see in this representational or \u2018symbolic function\u2019 the defining feature of what it means to be a modern human cognizer.Every single piece of materiality, made or found, can be used to represent anything else in the world given the right cognitive ecology and social context. That applies to a line of stones or a flake as much as it applies to a letter. I do, however, think that without the right cognitive ecology or skillful intentionality  must exists when tools are being used, so it would be a mistake to think that where complex patterns of lines are incised or drawn there must exist a \u2018symbology\u2019 or \u2018iconology\u2019. Evidence for the presence of mark making, as is also the case with early tool making  that can demonstrate they had a symbolic function other than knowing how an \u2018interpreter\u2019 projects meaning onto them. However, when dealing with archaeological materials from human prehistory, the only \u2018interpreter\u2019 available is the contemporary archaeologist and not the MSA person that created and used them. Put it simply, MSA cannot be thought of as et al. et al.e.g. a symbol \u2018standing for\u2019 something else); the intention is to produce, re-produce and transform itself as a mark, that is, to enact the skill of mark making\u2014like the creation of a cutting edge enacts and propagates the skill of tool making. Of course, once produced, tools and marks open up a horizon of new possibilities and \u2018situational affordances\u2019  The first question is about making: For instance, what does it mean to \u2018make\u2019 a cross-hatched design; what is the mark made of? (2) The second is about sensing and seeing: What do we sense and what do we see when we look at the Blombos engravings?If, as suggested, we are to redirect our attention from the representational function of those marks to the cognitive ecology of mark making, then we need some clarity on what aspects of the process of making marks we should focus upon, and what questions we should ask of them. As pointed out in the previous section, two neglected questions immediately confront us which I believe are crucial to a proper appreciation of mark making on the basis of the archaeological data available to us: A simple way to begin our attempt to answering those questions is to create a cross-hatched design ourselves. We can try to re-create the three marking events, as these have been reconstructed by Henshilwood, d\u2019Errico and Watts  belies the profound, evolutionary, epistemological and ontological puzzles that these elementary creative gestures raise for us. A simple causal account would describe the marking process as having a mind to world direction of fit: the brain intends, directs and commands the hand to move the pen on the paper\u2019s surface leaving a trail of ink. On this construal, the mark is essentially the end product of human intention and design. Is this an accurate way to describe the mark making process? I propose that it is not. It presupposes that mark making can be better accounted for by reference to mental rather than physical processes. However, as I discuss below, which part of the process of mark making we describe as mental and which as physical is unclear and seems to reiterate an unhelpful distinction between mind and matter. Is this duality of mental and physical forces the only way to describe and account for the marking process? Fortunately there are also other ways to describe and account for the cognitive life of marks. For instance, we may see the mark not as a static end product, but rather, as the trace of a gesture, that is, the index of a process. In the former description, the mark is passive; it has derived intentionality and agency. In the latter case, the mark is active, it embodies intentionality and agency signifying the trajectory of bodily movement  as the point of initiation. Such a view saves us the trouble and, thus, helps us bypass the longstanding conundrum of having to get inside the engraver\u2019s head in order to understand what the engraving means or does. For what enactive signification tells us is that the meaning of those marks is not to be found in the inaccessible privacy of isolated minds but in the meaningful engagement of those marks as material signs (in the past or in the present). Mark making is not a way to represent one thing with another. Mark making is a way to bring forth a new world of semiotic affordances that different people  may or may not be able to attend, discover or even perceive in common.Specifically from the vantage point of material engagement theory that I advocate in this paper, I would recommend avoiding beginnings (in the head) and endings (in the world). Instead, we should try to re-describe the process of mark making by focusing in the middle: where brain, body and material world meet. That is, focusing on the moment where the hand of the engraver is still touching the ochre\u2019s surface. For the duration of that event, all three aspects of mark making, hylonoetic sensethinging  but rather to alter the world so as to help make available a new way of thinking about it through the discovery of new situational \u2018affordances\u2019  that allows new semiotic pathways of creative thinging. Put it simply people in the MSA communities learn to think through, with and perhaps eventually also about lines. If the Blombos engravings (as objects) \u2018represent\u2019 anything is the felt perceptual and tactile effect of engraving (as a process). They materialize the pleasures of capturing movement. In capturing movement on the surface of the ochre, those lines objectify one of the most successful synergies between perception and action in human semiotic history, i.e. mark making. This is a synergy that will shape, more than any other innovation, the future of human creativity and our collective ways of knowing.Mark making transform humans\u2019 perceptual relation to the world and provide new opportunities for creative material engagement and material imagination  produced by the drawing process itself. The role of the brain is not to provide a visual replica but to allow the eye to follow and touch the line bringing unseen features of the drawing process into perceptual attention. That happens through the powers of enactive signification and material imagination. Seen as enactive material signs, the Blombos engravings, as we discussed, are no longer considered as the end products (in terms of making) or starting points (in terms of perceiving) of a linear input/output sequence . Rather, they can be understood in terms of a dynamic sensorimotor loop of perception, affect and action. In that sense the engravings are no mere outputs but constitutive of perception. The making of each line produce feedback effects on subsequent sensations that directly affect what can be perceived and recognized in perception. The lines are inseparable from the actions and the perceptions of the subject. In that sense the Blombos motifs are not closed and fixed, inputs for the visual processing of an abstract message. Instead, they from dynamical attractors that draw attention on them only to reveal a new changing landscape of semiotic affordances , the activity of mark making is constituted as a material sign through its ability to leave a permanent trace that can be perceived and interpreted as an index of the crafting gesture. This is the case also with tool making but with mark making it becomes more explicit: we do not see a cutting tool, we see a line, and lines have no obvious function or purpose.I suggest that the enactive-ecological framework can be the basis for a more adequate approach to the study of human perceptual experience of marks. From such a perspective the visual experience of the Blombos marks is better described as a dynamic skilful exploratory activity attuned to sensorimotor contingencies of material engagement . We see and we read lines as part of our daily experience. All that knowledge, memories and know how about marks and lines are available to us and define our response to them. This familiarity of the line is both what captures our attention when we perceive the Blombos engravings and what distorts our perception and interpretation of them. That is, we see in them affordances and functions (e.g. symbolic representation) which would have not been perceptible in their original context. I do not mean to claim that the light projected from such a mark in the past would have followed a radically different physiological path . What I am arguing is that if we could compare our contemporary perceptual skills with those of our Palaeolithic ancestors , I doubt that we would find much in common in terms of our perceptual experience of mark making. As I have also argued in the case of the Palaeolithic image . What makes the archaeological interpretation of early marks so difficult is not just the things that we do not know and, probably, we can never learn about them, but also the things that we do know, or that we think we know based on our shared contemporary experiences with marks and lines. Since early childhood we have learned to identify, play with, read and use marks in specific ways, afforded in our specific educational environments. As archaeologists we need to try unlearn those ways if we are to develop methodologies that give the marking process its due. I suggest a more productive way to approach the study of these early engravings would be to see the marks as perceptual tools on a par with any other tool and then proceed to discover the exact properties of material signification they afford in different contexts.In their original non-modern context, those markings that the contemporary observer may identify as symbolic and use as evidence for representational ability may be better understood, not as media for representing the world, but as ways of probing more deeply inside the world and into human perceptual experience Ingold . Rather cf. Kirsh MSA markings can certainly be argued to have a semiotic dimension, but I do not think they qualify as arbitrary symbols in the conventional sense of external representations. Markings and mark-making activities are not yet reflective of pre-established symbolic traditions and behaviours. However, they do provide the material basis for the enactive construction of symbolic activities. Although the Blombos marks do not give us evidence that MSA humans have solved the hard problem of \u2018symbolic intent and representation\u2019 they do provide evidence for the externalization of its basic premises and a workable structure for engaging with the problem\u2019s parameters more effectively  is a key task for cognitive archaeology. I suggested that, contrary to the dominant symbolic paradigm, an enactive-ecological approach grounded on material engagement theory is making better use of the available empirical evidence and has rich implications to guide further research. I should clarify that the proposed shift of attention and change in analytical strategy has no intention to undermine either the significance of MSA markings or the value of traditional archaeological methods  as means of gaining valuable information on the process of mark making. On the contrary, material engagement theory enables us to make better sense of the temporal statigraphy and affordances (interactive possibilities) of the marking process as well as to recognize that process as a For the material-engagement approach, the epistemic and ontological status of those engravings changes. Lines no longer represent the end product of the engraver\u2019s mental template that is externalized on the ochre\u2019s surface. As I have argued also for the making of large bifacial stone tools if there is a \u2018mental template\u2019, this is indissolubly tied to the actual process of its realization  with the making of marks and lines. Beginnings and endings are of course relative terms in the context of archaeological discourse around lines. The edge of a stone can also be seen as a line, which makes edging stone the earliest form of three dimensional marking (Malafouris"}
+{"text": "Coronavirus disease 2019 (COVID-19) is sweeping the globe and has resulted in infections in millions of people. Patients with COVID-19 face a high fatality risk once symptoms worsen; therefore, early identification of severely ill patients can enable early intervention, prevent disease progression, and help reduce mortality. This study aims to develop an artificial intelligence-assisted tool using computed tomography (CT) imaging to predict disease severity and further estimate the risk of developing severe disease in patients suffering from COVID-19.Initial CT images of 408 confirmed COVID-19 patients were retrospectively collected between January 1, 2020 and March 18, 2020 from hospitals in Honghu and Nanchang. The data of 303 patients in the People\u2019s Hospital of Honghu were assigned as the training data, and those of 105 patients in The First Affiliated Hospital of Nanchang University were assigned as the test dataset. A deep learning based-model using multiple instance learning and residual convolutional neural network (ResNet34) was developed and validated. The discrimination ability and prediction accuracy of the model were evaluated using the receiver operating characteristic curve and confusion matrix, respectively.The deep learning-based model had an area under the curve (AUC) of 0.987  and an accuracy of 97.4% in the training set, whereas it had an AUC of 0.892 (0.828\u20130.955) and an accuracy of 81.9% in the test set. In the subgroup analysis of patients who had non-severe COVID-19 on admission, the model achieved AUCs of 0.955 (0.884\u20131.00) and 0.923 (0.864\u20130.983) and accuracies of 97.0 and 81.6% in the Honghu and Nanchang subgroups, respectively.Our deep learning-based model can accurately predict disease severity as well as disease progression in COVID-19 patients using CT imaging, offering promise for guiding clinical treatment. The coronavirus disease (COVID-19) is rapidly spreading worldwide, leading to a global crisis. The first outbreak was reported in Wuhan, China, in December 2019 , and theIn the field of artificial intelligence and medical big data analysis, using machine learning-based classification algorithms to automatically diagnose and judge the severity of disease and aid clinical decisions has always been important. Notably, deep learning, a complex machine learning approach that has emerged in recent years, performs much better on language and image recognition than previous related technologies . It has Currently, lesion annotation is necessary for most deep learning-based methods of disease diagnosis, particularly for disease detection in CT volumes. Considering the rapidly growing epidemic, significant effort is needed in terms of annotation by radiologists. Unfortunately, the current shortage of radiologists due to the urgent COVID-19 setting implies that annotation dependent algorithms may be insufficient for the present medical need. Thus, performing COVID-19 detection in an \u201cunsupervised\u201d manner while simultaneously maintaining good predictive accuracies is of huge importance. In this study, we established and verified a multiple instance deep learning model using CT imaging to predict disease severity and the risk of future development of severe COVID-19. This model is expected to assist doctors in performing clinical diagnosis and treatment.The Medical Ethics committee of Nanfang Hospital of Southern Medical University approved this retrospective analysis. Written informed consent from all study participants was obtained. This study included patients from the People\u2019s Hospital of Honghu and The First Affiliated Hospital of Nanchang University, who met the following selection criteria: (1) confirmed case of COVID-19 with positive tests for 2019-nCoV nucleic acid and compliance with the guideline of Diagnosis and Treatment Protocol for Novel Coronavirus Pneumonia  developeThe disease severity spectrum of COVID-19 covers states from mild to critical, according to the guidelines for novel coronavirus pneumonia . In thisPatients who maintained mild or moderate symptoms were assigned to the non-severe group. Those with critical or severe disease conditions on admission and those who had moderate or mild disease on admission but developed severe COVID-19 after admission were assigned to the severe group.The event of severe illness-free survival was defined as disease progression and the censored subject was defined as no occurrence of endpoint event by the time of discharge. Severe illness-free survival was defined as the time from the diagnosis of COVID-19 to the occurrence of disease progression.All CT images were downloaded via a picture archiving and communication system. Considering that each patient had received several CT examinations during hospitalization, there were multiple slices for each series. The patterns of rows/columns, pixel spacing, slice count, and thickness distributions for the data from The People\u2019s Hospital of Honghu and The First Affiliated Hospital of Nanchang University are shown in The overall preprocessing procedure for raw CT data was as follows. The window width and level were narrowed to 1600 and 600, respectively; a pixel value with <5 percentile was set to the value of 5 percentile; that with <95 percentile was set to the 95 percentile. All DICOM CT series were resampled to the target pixel , yielding median values in all CT series. In the resampled CT volume, the patch was cropped to as large as 3 \u00d7 224 \u00d7 224 (z \u00d7 y \u00d7 x); then, each CT value for the patch was scaled to the section between , and each patch CT value was normalized to a mean of 0.5 and a variance of 1 .https://download.pytorch.org/models/resnet34-333f7ec4.pth. The next steps included performing a full inference pass through the patch dataset, ranking the patches according to their probability of being positive or negative, and training the ResNet34 on the top four ranking patches from every three adjacent resampled CT slides. These three steps were repeated for 100 iterations, and a patient-level CT classification was generated via max-pooling of all the patches belonging to the same one  is a representation of deep convolutional neural networks integrated with images, auto-encoding, and classification. In a prostate cancer pathology dataset using more than 10,000 slides, ResNet34 was found to perform better than other architectures as a backbone model for multiple instance learning (MIL) . The arcsame one .Five-fold cross-validation was performed with 17,336 CT images from the resampled CT data of 303 patients who had been treated at the People\u2019s Hospital of Honghu, and 6,476 CT images from the resampled CT data of 105 patients at The First Affiliated Hospital of Nanchang University were used as the test dataset.There are several varieties of the network architecture for the ResNet series, including ResNet34 , AlexNetSeven general classification metrics, including sensitivity, specificity, positive prediction value (PPV), negative prediction value (NPV), false positive rate (FPV), false negative rate (FNR), accuracy, and AUC, were used to estimate the classifiers\u2019 performance of all deep neural network models used for the training. Their methods of calculation are given in Equations (1) \u2013 (7).Here, TP is the true positive, TN is the true negative, FP is the false positive, and FN is the false negative; the AUC value was obtained using R statistical software.Our implementation was based on the PyTorch (version 1.0) pretrained model for the ResNet34 network. Our training experiments were conducted in a Linux environment on a machine for data loading, building models, and training .https://github.com/dchealth/covid-mil.git.The source code and our best weights of the trained ResNet34 for this work can be downloaded from: Continuous variable data are presented as medians . Classified variable data are presented as n (%). Statistical analyses were performed using R statistical software version 3.5.0 . The receiver operating characteristic (ROC) curves were plotted with the pROC package . A confiA total of 408 patients with confirmed COVID-19 were included in this study, with 303 patients in the Honghu cohort and 105 in the Nanchang cohort as the training set and test set, respectively. The demographics and baseline characteristics of the Honghu and Nanchang cohorts are listed in Using CT imaging and ResNet34, a disease severity prediction model based on MIL was developed in the training cohort. The cross-entropy loss was close to 0.03  and the To \u201cuncover\u201d the black box and make our model more intuitive, we displayed slices associated with severe and non-severe COVID-19 cases from six randomly selected patients (three severe and three non-severe). It can be observed that disease severity is positively correlated with the area and density of lesions in lungs. For the severe cases , multiplNext, the predictive accuracy of the model was evaluated via a confusion matrix. In the training dataset, the model correctly discriminated against 97.7% of patients in the non-severe group and 95.8% of patients in the severe group , with anThe clinical significance of the predictive model lies in its ability to identify patients in the early stages of the disease who were mildly ill on admission but progressed to severe disease later. To further estimate the practical significance of the MIL model, we performed a clinically important subgroup analysis. Patients with severe symptoms on admission were excluded from both the Honghu and the Nanchang cohorts, whereas those who presented non-severe symptoms on admission were retained.This model achieved AUCs as high as 0.955 (0.884\u20131.000)  and 0.92P < 0.001; Nanchang: P < 0.001, log-rank test)  . These rIn this retrospective study, we developed and validated a MIL-based predictive model using CT imaging of 408 patients to enable accurate identification of patients with severe COVID-19. Subgroup analyses in patients with non-severe COVID-19 on admission revealed that this model could accurately predict disease deterioration in the early stages. To our knowledge, this is the first study to demonstrate a novel application of MIL to establish a disease severity predictive model for COVID-19. This model has the potential to contribute to computer-aided diagnosis and guide clinical treatment by preemptively identifying patients who have a high risk of experiencing more severe symptoms.Many models have been developed to facilitate early identification of patients with a high risk of progression. The parameters used in these models are mainly clinical indicators and imaging findings, which are known for their role in the diagnosis and prognosis of COVID-19 as specified by the Chinese guideline for COVID-19 . PredictAt present, there are two main methods for predicting the risk of progression using chest CT. In one method, radiologists manually assign a score for each image to identify patients with potential severe disease, represented by the \u201cCT severity score,\u201d whereas the other method utilizes artificial intelligence to automatically calculate the risk of progression.The CT severity score in the first method  is a semConventional supervised learning in the artificial intelligence-assisted method requires labeling information and lesion annotation for each object to guide learning of the algorithm. On the one hand, labeling is slow and laborious, and radiologists working in a COVID-19 setting do not have sufficient time to label every slice of a CT image. On the other hand, it is difficult for radiologists to mark the lesion area very accurately; thus, both the normal and pathological tissues could inevitably exist in the marked area, resulting in a large amount of noise in the training set that consequently affects the accuracy of learning. However, the MIL method adopted in this study differs from a supervised machine learning technique. It requires only patient-level labels to inform the algorithm whether the patient would progress to a severe symptom. Labels on each chest CT image and annotation of the lesion area are not needed in this method, thereby saving radiologists precious time and improving the accuracy of the algorithm to some extent.In this section, the overall advantage of our model in clinical practice is highlighted. Our model exploited the superiority of CT imaging, making the prediction procedure fast, intuitive, and non-invasive. Compared with the CT severity score, our model enabled a relatively objective and accurate diagnosis of severe COVID-19, which increased reliability and improved quality control. Our model can maintain the same diagnostic criteria anywhere and ensure that the AUCs are as high as 0.987 and 0.892, with accuracies of 97.4 and 81.9% in the training and test sets, respectively. Compared with other supervised AI-assisted predictive models, our AI system eliminates the huge workload of annotating the lesion, allowing radiologists to save time and increasing their capacity to handle emergencies quickly and effectively, while maintaining high accuracy. Easing the workload of radiologists in terms of lesion annotations as well as quick and accurate prediction of the procedure will facilitate risk predictions in daily practice, which is extremely important for COVID-19 management owing to the severe limitations that occur with regard to healthcare resources.There are several limitations to this study. First, our sample size was relatively small, which would inevitably result in some bias. Additional patient data is required to validate our model. Moreover, a disadvantage of all deep learning methods is the lack of transparency and interpretability. More efforts to determine the correlation between clinical processes and the prediction results of our model should be made in the future.We employed MIL, a deep learning method, using quantitative CT data to accurately predict the disease severity of COVID-19. By utilizing an inexpensive and widely available test, our model can be used to identify patients at high risk of disease progression in the early phase of the disease, which has important practical implications for conducting early intervention, preventing disease progression, and reducing mortality. We recommend that confirmed COVID-19 patients should undergo CT screening as soon as they are admitted to the hospital, so that physicians can use our model to determine the risk of severe disease. If the result indicates a potential worsening of the condition of the patient, closer monitoring and early intervention should be considered before the disease severity increases. We hope that this model would be of some help to clinicians to better manage patients and contribute to combatting COVID-19.Reasonable data requests are welcome. A proposal and detailed illustration of the study aims will be needed to assess the reasonability of requests. After approval from participating hospitals and the corresponding authors, de-identified clinical data will be provided.The studies involving human participants were reviewed and approved by the Medical Ethics committee of Nanfang Hospital of Southern Medical University. The patients/participants provided their written informed consent to participate in this study.HZ had full access to all the data in the study and took responsibility for the integrity of the data and accuracy of the data analysis. LX, PL, FS, YZ, and CX contributed equally to this work. LX, LL, and WS contributed to concept and design. F-QC, Y-LH, W-FZ, MG, LL, and LX acquired, analyzed, and interpreted the data. LX, FS, YZ, and CX drafted the manuscript. PL, HBZ, and S-CM critically revised the manuscript for important intellectual content. LX, FS, CX, and CH contributed to the statistical analysis. HZ and LL obtained the funding. WS, MG, F-QC, Y-LH, and W-FZ contributed to administrative, technical, or material support. HZ, WS, and LL supervised the study. All the authors contributed to the article and approved the submitted version.FS, CX, MG, and WS were employed by the Digital China Health Technologies Corporation Limited . The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Elevated NF\u2010kB levels have been identified in primitive bone marrow cells from patients with MDS/AML, suggesting NF\u2010kB as a therapeutic target in MDS/AML. We herein describe an MDS patient ineligible for SCT who, following treatment with azacitidine and bortezomib, transformed to leukemia, but maintained complete remission after monotherapy with ixazomib. Elevated NF\u2010kB levels have been identified in primitive bone marrow cells from patients with MDS/AML, suggesting NF\u2010kB as a therapeutic target in MDS/AML. We herein describe an MDS patient ineligible for SCT who, following treatment with azacitidine and bortezomib, transformed to leukemia, but maintained complete remission after monotherapy with ixazomib. We herein describe an MDS patient ineligible for SCT who, following treatment with azacitidine and bortezomib, transformed to leukemia, but maintained complete remission after monotherapy with ixazomib.Myelodysplastic syndrome (MDS) is a hematopoietic stem cell disorder that is characterized by ineffective hematopoiesis and often transforms into acute myeloid leukemia (AML). Although treatments for MDS/AML have advanced, the treatment for elderly patients who are not eligible for SCT remains inadequate. Thus, novel pharmacologic therapies capable of preventing or delaying disease progression are in critical need. Elevated nuclear NF\u2010kB levels have been identified in primitive bone marrow cells from patients with MDS, suggesting NF\u2010kB as a therapeutic target in MDS.We herein a report of successful treatment with ixazomib in a patient with MDS transformed to AML who previously failed to respond to azacytidine (AZA) and bortezomib treatment.29/L with 3% of peripheral blast cells), anemia (hemoglobin 64\u00a0g/L), and hyperproteinemia . Her renal function and levels of calcium, serum albumin, and lactate dehydrogenase were normal. The serum \u03b22\u2010microglobulin level was 4.0\u00a0mg/dL, and the concentrations of IgG and \u03ba\u2010light chain were 28.8\u00a0g/L  and 147\u00a0mg/dL , respectively. The serum free light chain ratio was 4.9 . Serum protein electrophoresis disclosed a monoclonal spike in the \u03b3\u2010globulin region, and urine electrophoresis also revealed a monoclonal spike. Serum immunofixation electrophoresis confirmed the presence of an IgG\u2010\u03ba chain monoclonal M component. Bone marrow examination showed that 18% were blasts with dysplasia of erythropoiesis, granulopoiesis, and megakaryopoiesis and flow cytometric analysis was positive for CD13, CD33, CD34, and HLA\u2010DR. Moreover, bone marrow aspiration showed 13% plasma cells and flow cytometric analysis was positive for CD38, CD138 and kappa, and negative for CD19, CD20, and lambda. Strong nuclear CD34 and p53 immunostaining was detected in 8% and 10% of hematopoietic cells, respectively, and CD138 immunostaining was noted in 5% of plasma cells. Karyotype analysis indicated a 46, XX karyotype (20/20 cells). Interphase fluorescence chromosomal in situ hybridization of the bone marrow cells revealed no gene abnormalities in 1q21, RB1, P53, D13S319, and IgH. She had no evidence of myeloma\u2010defining events or amyloidosis. A diagnosis of the simultaneous occurrence of MDS with excess blast\u20102  and monoclonal gammopathy of undetermined significance (MGUS) was made, and 5\u2010azacytidine (AZA)  treatment was initiated. After 2 cycles of this treatment, she had normal peripheral blood counts, and serum IgG paraprotein and \u03b22\u2010microglobulin (\u03b22\u2010MG) levels decreased to 16\u00a0g/L and 1.8\u00a0mg/L, respectively. A repeat marrow examination showed slightly hypercellular marrow, with a significant decrease in myeloblasts to 1% blasts and 5% plasma cells. Strong nuclear CD34 and p53 immunostaining decreased in hematopoietic cells and CD138 immunostaining was detected in a few plasma cells. She achieved hematological CR and continued AZA treatment.In 2016, a 78\u2010year\u2010old female was referred to our hospital with leukopenia , anemia (hemoglobin 56\u00a0g/L), and hyperproteinemia . Serum IgG paraprotein and \u03b22\u2010microglobulin (\u03b22\u2010MG) levels increased to 42\u00a0g/L and 4.0\u00a0mg/L, respectively. The serum free light chain ratio was 7.7. Marrow examination showed slightly hypercellular marrow, with 7% blasts and 8% plasma cells. Strong nuclear CD34 and p53 immunostaining was detected in 5% and 10% of hematopoietic cells, respectively, and CD138 immunostaining was noted in 20% of plasma cells. Karyotypic analyses indicated a 46, XX karyotype (20/20 cells). She was administered bortezomib and dexamethasone (VD) . After 3 cycles of the treatment, she achieved hematological CR, and her serum and urine M protein were negative by immunofixation, and bone marrow examination showed a decrease in plasma cells (4%). She continued the VD treatment.In September 2018, after 30 cycles of AZA, the patient exhibited evidence of disease progression, with leukopenia (white blood count 2.1\u00a0\u00d7\u00a0109/L and 5% of blast cells) and anemia (hemoglobin 70\u00a0g/L). Serum IgG paraprotein and \u03b22\u2010microglobulin (\u03b22\u2010MG) levels increased to 38\u00a0g/L and 5.8\u00a0mg/L, respectively. The serum free light chain ratio was 5.7. The bone marrow was hypercellular marrow and showed that blasts were 20% and plasma cells were 7% with dysplasia of erythropoiesis, granulopoiesis, and megakaryopoiesis , a master transcription factor involved in cell growth and proliferation. Elevated nuclear NF\u2010kB levels have been identified in primitive bone marrow cells from patients with MDS/AML, suggesting NF\u2010kB as a therapeutic target in MDS/AML.Ixazomib, the biologically active boronic acid form of ixazomib citrate that forms immediately upon exposure to aqueous solution or plasma, has a proteasome dissociation half\u2010life that is sixfold faster than that of bortezomib.The frequencies of TP53 mutations in MDS and MM were 7\u201019 and 8%\u201015%, respectively, and TP53 mutant clones may drive disease progression.To the best our knowledge, this is the first case report to document successful treatment with ixazomib alone as salvage therapy in an elderly relapse/refractory MDS patient. Although treatments for MDS/AML have advanced, the treatment for elderly patients who are not eligible for SCT remains inadequate. The mechanism of ixazomib action in AML/MDS is still unclear and further investigation is needed.None declared.SO: was involved in patient care and writing the manuscript. KO: has reviewed and arranged the pathology images.Informed consent was obtained from the patient for publication of this case report and the accompanying images.Bone marrow biopsies showed hypercellular marrow with myelodysplasia\u2010related changes and numerous blasts (A) and strong nuclear CD34 and p53 immunostaining was detected in 10% and 30% of hematopoietic cells (B and C). \u200bAfter ixazomib treatment, repeat marrow examination showed slightly hypercellular marrow, with a significant decrease in myeloblasts to 1% blasts and 2% plasma cells . Strong nuclear CD34 and p53 immunostaining decreased in hematopoietic cells ."}
+{"text": "The results showed that axSpA subjects have a higher tone and stiffness and a lower relaxation and creep than sLBP and healthy ones (p < 0.05). All lumbar and cervical MMPs, except for decrement, could correctly classify axSpA and healthy subjects and axSpA and sLBP patients . However, no MMP could differentiate between sLBP and healthy subjects. Each group had a different pattern of bivariate correlations between MMPs and sociodemographic and clinical data, with a worse state and progression of the axSpA group associated with a higher tone and stiffness in both spinal regions. This study supports that MMPs are different and show different patterns of correlations depending on the type of spinal pain.Different musculoskeletal disorders are a source of pain in the spinal region; most of them can be divided into mechanical, such as low back pain (LBP), or inflammatory origins, as is the case of axial spondyloarthritis (axSpA). Nevertheless, insufficient information is available about the muscle negative consequences of these conditions. Thus, the objective of this study was to identify whether mechanical muscle properties (MMPs) of cervical and lumbar muscles are different between patients with axSpA, subacute LBP (sLBP), and healthy controls. Furthermore, we aimed identify whether MMPs were related to sociodemographic and clinical variables in various study groups. The MMPs, sociodemographic, and clinical variables were obtained in 43 patients with axSpA, 43 subjects with sLBP, and 43 healthy controls. One-way ANOVAs and ROC curves were applied to identify whether the MMPs could differentiate between the study groups. Intra-group Pearson  Spinal disorders constitute a significant health problem with a high prevalence rate  that hasRheumatic pathologies, specifically axial spondyloarthritis (axSpA), are among the most relevant etiologies of spinal pain. This chronic inflammatory disease has an estimated prevalence of between 0.9 and 1.4% of the adult population in the United States  and 1.9%Low back pain (LBP) is the pathology that most contributes to the years lived with disability ,22. Its It has been described that muscle alterations may be an underestimated source of spinal pain  and thatThe MMP similarities or differences between axSpA and LBP patients along the spinal paraspinal muscles are still unknown. Their determination can be helpful to improve diagnosis and to control the evolution of patients in a clinical setting ,46. TherAn observational, cross-sectional case-control study with consecutive sampling was conducted. Participants were recruited with a non-probabilistic sampling from three centers, Physiobalance (private physiotherapy center), Rheumatology Department of the Hospital Universitario Reina Sof\u00eda, C\u00f3rdoba, and the Biosanitary campus of the University of C\u00f3rdoba, in Spain, from November 2018 to January 2021.The Research Ethics Committee of C\u00f3rdoba approved this project . All participants signed the informed consent form.Subjects of both sexes, over 18 years, participated in the study. Two groups of cases were defined. First, the axSpA group was composed of patients diagnosed according to the evaluation criteria of the SpondyloArthritis International Society (ASAS) . Second,The control group included healthy subjects that did not have spinal pain in the last six months or any neurological or musculoskeletal disorder.Exclusion criteria common to the three groups were history of vertebral fracture or spinal surgery; deformity due to scoliosis (Cobb angle higher than 20\u00b0); less than 20\u00b0 of a total range of rotation in either hip; received physiotherapy treatment in the last six months; pregnancy.2), and sex.To improve comparability between groups, for each subject with sLBP included in the study, one axSpA patient and one healthy subject were recruited, in both cases matched for age (\u00b13 years), body mass index (BMI) .f effect size of 0.33 for MMPs, common in clinical practice for musculoskeletal outcomes [Sample calculation was performed using the G*Power 3.1 software with the one-way ANOVA (F-test) as a statistical test. To achieve a moderate outcomes , with anSociodemographic aspects such as age, sex, weight, height, and BMI were collected. Commonly well-known questionnaires in clinical setting for axSpA and sLBP patients were applied to identify disability and QoL. Subsequently, an evaluation of the MMPs of the cervical and lumbar spine was carried out. After this, a record of spinal mobility was made using conventional metrology. Approximately 45 min were necessary for the complete evaluation of each subject.\u00ae Myoton AS, Tallinn, Estonia) was used to record the MMPs of the lumbar and cervical regions with the patient lying in the prone position with the arms along the body. The probe of the device was positioned perpendicular to the erector spinae, 2.5 cm from the spinous process of L5 in both sides [A manual myotonometer ; theth sides . The recording was performed during five seconds of apnea after exhalation  to reducwww.randomization.com, accessed on 5 November 2018) was used to establish the order of the evaluations (right/left). The first ten subjects in each group were reassessed after one week, and intraclass correlation coefficients (ICC) > 0.8 was obtained for all evaluations and MMPs to assess intra-rater reliability between days. The absence of differences between sides allowed the utilization of the mean of both sides for the analyses.A randomization plan generator  cervical rotation; (2) tragus-wall distance; (3) lateral spinal flexion; (4) modified Sch\u00f6ber test; (5) intermalleolar distance . AdditioThe 12-item short-format health survey (SF-12) was used to assess health-related QoL. It contains 12 questions that can be answered in less than two minutes. Each of the questions has a possibility of three to five responses; such a survey reflects the general state of health with two different scores: a physical component (PCS-12) and a mental component (MCS-12) ,57. ScorThe intensity of the patients\u2019 pain was recorded with an NPRS, whose reliability and validity are widely demonstrated ,49,60.p > 0.05).For descriptive purposes, frequencies and percentages of categorical variables were presented, while mean and standard deviation with a 95% confidence interval (95%CI) were used for continuous data. The Kolmogorov\u2013Smirnov test showed their normal distribution  curves were developed, with the Area Under the Curve (AUC) interpreted as follows: fail to discriminate (0.5 to 0.6), poor (0.6 to 0.7), acceptable (0.7 to 0.8), excellent (0.8 to 0.9), and outstanding (more than 0.9) .r coefficients were calculated to identify intra-group associations between the MMPs and sociodemographic and clinical data. Correlations were considered to be negligible (0.0 to 0.19), fair (0.20 to 0.39), moderate (0.40 to 0.69), strong (0.70 to 0.89) or almost perfect (0.0 to 1.00) [Finally, Pearson to 1.00) . \u00ae software, version 25 , was used for the analyses.The level of significance was set at 0.05. The IBM-SPSSp < 0.001), except for decrement, which was different only between axSpA and healthy groups. The axSpA patients showed a higher tone and stiffness, with more than 2 Hz and 80 N/m in mean, respectively. On the contrary, lower relaxation and creep was found for the axSpA group. The lumbar decrement was significantly higher (p = 0.007) in the axSpA group than in the control group , but was not significantly different compared with the sLBP group . No differences were detected between the sLBP and the healthy groups, although, as occurred with the axSpA group, the sLBP patients showed a higher tone, stiffness and decrement, and a lower relaxation and creep, on average, than the healthy ones.For the MMPs of the lumbar region, the one-way ANOVA showed significant differences between the axSpA group and the others (p < 0.001), except for decrement, which showed no statistical significance. Thus, tone and stiffness were higher, and the relaxation and creep were lower in the axSpA group (p < 0.001), with similar values for sLBP and healthy groups .When the cervical region was analyzed, a similar pattern of differences between the axSpA group and the other two groups was detected . The high AUC values were for tone, stiffness, relaxation, and creep (0.832< AUC < 0.855), while the lowest ones were for the decrement  (p < 0.001), except for decrement (p = 0.904). The AUCs were between 0.757 (95%CI 0.653\u20130.861) for the tone and 0.815 (95%CI 0.721\u20130.909) for the stiffness  a. The satiffness b.p < 0.001) (p > 0.05) when sLBP and healthy groups were analyzed.The ROC curves to classify patients with axSpA and sLBP were similar to those obtained for axSpA and healthy controls. Thus, with the only exception of the decrement, all lumbar and cervical MMPs showed AUCs with values higher than 0.8 (< 0.001) . On the The axSpA group showed multiple associations between MMPs and clinical variables, with a higher intensity for the lumbar region. Specifically, age was positively related to lumbar tone, stiffness, and decrement and negatively to cervical tone and decrement (0.323 < r < 0.696). Moreover, the evolution time was related to all lumbar MMPs and cervical tone, stiffness, and relaxation in moderate to strong fashion (|0.743 < r < 0.405|). Similarly, total pain, PCS-12, and MCS-12 were fair to moderately related to almost all the MMPs (|0.315 < r < 0.618|). BASMI, BASDAI, and BASFI showed fair to moderate relations with the MMPs, mainly for the lumbar region. In all cases, the higher tone, stiffness and decrement, and the lower relaxation and creep, the higher evolution time, pain, BASMI, BASDAI, and BASFI, and the lower PCS-12 and MCS-12.Some metrology variables showed fair and moderate correlations (|0.342 < r < 0.560|) with the lumbar MMPs, except for the decrement. Finally, only the lateral spinal flexion showed significant relations with cervical MMPs (|0.384 < r < 0.456|). In all cases, the lower the metrology values, the higher the tone, stiffness and decrement, and the lower the relaxation and creep .p = 0.025), and was positively related to cervical relaxation  and creep . Only fair correlations were found between the ODI and tone and stiffness at the lumbar level; no other clinical variable was related to the MMPs.In the sLBP group, few significant correlations were detected. In fact, only age showed a consistent trend of fair to strong relations with both lumbar and cervical MMPs (|0.360 < r < 0.767|), except for creep. The higher the age, the higher the tone, stiffness, and decrement, and the lower the relaxation and creep. BMI was negatively related to the cervical decrement  . In all cases, the higher tone, stiffness, and decrement, and the lower relaxation and creep, the lower the metrology values. Only the intermalleolar distance showed correlations with two cervical MMPs  .p \u2264 0.001), stiffness , decrement , cervical tone  and decrement , and negatively with lumbar relaxation  and creep . Furthermore, the anthropometrical variables showed a fair to strong relationship with the cervical MMPs, as occurred between cervical decrement  and relaxation , and height, and between all cervical MMPs and the weight (|0.401 < r < 0.665|) and BMI (|0.306 < r < 0.702|). With the exception of the negative relation between MCS-12 and cervical decrement , no other clinical variable was correlated with any MMP.For the control group, again the age was the variable that showed more quantity and more intensity correlations with MMPs. Specifically, the age was positively correlated with lumbar tone  and cervical relaxation , and the cervical rotation with lumbar tone , lumbar and cervical stiffness , and lumbar and cervical decrement . In all cases, the higher tone, stiffness, and decrement and the lower relaxation and creep were linked to the lower metrological variable values  . FurtherConcerning metrology, several outcomes also showed differences between the three groups. Specifically, the lowest cervical rotation was found in the axSpA group, followed by the sLBP group. This pattern of mobility restriction can be caused by the pathological status at the spinal level, with compensatory movements in other structures, such as the ribcage. In addition, lateral flexion and intermalleolar distance differentiated the axSpA group from the other two groups, but not the sLBP and healthy subjects. The mean values of both variables were similar to those reported by other studies with patients with spinal inflammatory pathology .Finally, the PCS-12 was higher in healthy subjects with respect to spinal pain patients, as has been previously reported in acute spinal pain , but theThe ROC curves of all lumbar and cervical MMPs, except for decrement, demonstrated an excellent capacity for classifying subjects with axSpA and healthy controls. A similar pattern yields the ROC curves for patients with axSpA and sLBP. No previous research studied the discriminant capacity of MMPs to identify axSpA patients, which prevents possible direct comparisons with the current data. However, it has been suggested that MMPs can become a specific marker of the axSpA status and progression ,45,64, iWith respect to sLBP and healthy groups, no other MMP could discriminate the subjects. In a previous study, the cervical decrement consistently classified subjects with acute LBP and healthy subjects . The elaIn general, there were different patterns of correlations depending on the study group. Therefore, different origins of spinal pain can determine specific associations between MMPs and other clinical and sociodemographic variables. The age was the variable correlated with a greater number of MMPs, which is directly related to tone, stiffness, and decrement, and inversely related to relaxation and creep, independent of the study group. These results agree with previous research at the spinal level, both in axSpA ,46 and cRegarding the metrological data, a negative relationship between the cervical rotation and lumbar tone and stiffness was observed in all groups. This relationship has already been reported for acute LBP patients  and coulThe clinical variables of the axSpA group, such as evolution time, BASMI, BASDAI, and BASFI, correlated with most of the lumbar MMPs and with cervical tone. This outcome is relevant since possible interactions between the muscle alterations and the clinical state could explain some pathological mechanism. In fact, it is known that mechanical stress is a relevant factor in the pathophysiology of the disease when an advanced structural damage is found . FurtherThe low number of correlations between MMPs and sociodemographic variables identified in the sLBP group, which agrees with previous patterns in acute LBP , differsOne of the strengths of this study was the evaluation of cervical MMPs in patients with a main alteration at the lumbar level, as previously suggested . On the Likewise, it is necessary to recognize some limitations of the study. First, the assessor was not blinded to the group assignment, as the subjects with spinal pain were in an active phase of disease. Second, the depth reached by the MyotonPRO device does not exceed 2 cm , which pThe lumbar and cervical MMPs are different depending on the type of spinal pain. The patients with axSpA show a higher tone and stiffness and lower relaxation and creep than those with sLBP and healthy controls. Furthermore, the spinal MMPs, except for decrement, are able to classify patients with axSpA and healthy subjects, but not subjects with sLBP and healthy ones, which increases the interest regarding the assessment of the spinal MMPs as a possible marker of the muscle state and progression in the clinical context of inflammatory spinal pain.The patients with axSpA show a specific pattern of correlations between MMPs and clinical and metrological variables that do not appear in sLBP and healthy subjects. This pattern associates a worse state and progression of axSpA to higher tone and stiffness in lumbar and cervical regions."}
+{"text": "The functional study on circRNAs has been increasing in the past decade due to its important roles in micro RNA sponge, protein coding, the initiation, and progression of diseases. The study of circRNA functions depends on the full-length sequences of circRNA, and current sequence assembly methods based on short reads face challenges due to the existence of linear transcript. Long reads produced by long-read sequencing techniques such as Nanopore technology can cover full-length sequences of circRNA and therefore can be used to evaluate the correctness and completeness of circRNA full sequences assembled from short reads of the same sample. Using long reads of the same samples, one from human and the other from mouse, we have comprehensively evaluated the performance of several well-known circRNA sequence assembly algorithms based on short reads, including circseq_cup, CIRI_full, and CircAST. Based on the F1 score, the performance of CIRI-full was better in human datasets, whereas in mouse datasets CircAST was better. In general, each algorithm was developed to handle special situations or circumstances. Our results indicated that no single assembly algorithm generated better performance in all cases. Therefore, these assembly algorithms should be used together for reliable full-length circRNA sequence reconstruction. After analyzing the results, we have introduced a screening protocol that selects out exonic circRNAs with full-length sequences consisting of all exons between back splice sites as the final result. After screening, CIRI-full showed better performance for both human and mouse datasets. The average F1 score of CIRI-full over four circRNA identification algorithms increased from 0.4788 to 0.5069 in human datasets, and it increased from 0.2995 to 0.4223 in mouse datasets. Only recently has circular RNA (circRNA) appeared as a hot research topic since it was first discovered in the 1970s . Differeet al found that exonic circRNA CDR1as can bind with miR-671, which can degrade CDR1as mediated by AGO (muscleblind (MBL) of Drosophila can encode MBL protein as a transcript factor, and MBL regulates the dynamic balance of circular transcript (circRNA circMbl) and linear transcript  directly. Reconstruction of circRNAs full-length sequences was effected by linear transcripts . Computacircseq_cup predicts circRNAs and constructs full-length sequences based on paired-end (PE) short reads. This method first relies on an alignment software  to idenLong-read sequencing, such as Nanopore sequencing, is capable of generating longer lengths, between 5,000 and 30,000 base pairs . Long reHomo sapiens (human) datasets, while CircAST was the better performer in Mus musculus (mouse) datasets . Among these assembly tools, CIRI-full assembled more circRNA full-length sequences with less than 57% of precision in human datasets, while circseq_cup and CircAST assembled few circRNAs full-length sequences with about 80% of precision in human datasets. After careful analysis, we have introduced a screening protocol that selects out exonic circRNAs with full-length sequences consisting of all exons between back splice sites as the final result. After screening, CIRI-full showed the best performance for both human and mouse datasets.In this study, we used three evaluation strategies  based on long reads to verify the quality of full-length sequences assembled based on short reads. In our results, each assembly algorithm showed its own advantage; in CircAST and circseq_cup, the precision was high but the sensitivity was low, whereas in CIRI-full, the precision was low but the sensitivity was high. CIRI-full performed better  in https://bigd.big.ac.cn/gsa) (accession ID: CRR194214 and CRR194215). Nanopore libraries  were downloaded from the Sequence Reads Archive  and the National Genomics Data Center . Short reads and long reads from the same database were derived from the same experiment samples. Sequencing data downloaded from the SRA were all derived from the cultured HEK293 cells, and data downloaded from the NGDC were derived from adult mice. Table S1 provides a summary of all of the datasets. The reference genomes of human (GRCh38/hg38) and mouse (GRCm38/mm10) were downloaded from UCSC.RNA-seq libraries  were downloaded from the Sequence Reads Archive  and the National Genomics Data Center  that were reconstructed based on short reads are correct according to long-read sequences, given that both short reads and long reads are derived from the same samples.In this study, we have used three strategies based on long reads to evaluate the assembled circRNA full-length sequences using the short reads .The correctness of the assembled sequence is evaluated using three strategies as shown in Another evaluation strategy (strategy 3) used long reads to evaluate the correctness of the assembled circRNA sequences directly. Three main steps of strategy three were 1) we moved a 20 bp fragment on the upstream of the full-length sequence to the end of the full-length sequence, which forms a new full-length sequence with back splice sites; 2) long reads were mapped to the new full-length sequences of circRNAs using minimap2 H.  with defIn all evaluation strategies, full-length circRNAs that were verified correct by long reads were defined as true positives, while those not verified by long reads were defined as false positives. Full-length circRNAs were verified correct in other assembly strategies, but those not assembled in the currently evaluated assembly strategy were defined as false negatives. The assembly performance is assessed using precision, sensitivity, and F1 score and defined as follows:Several identification algorithms have been developed for circRNA identification based on short reads. In this study, we selected four algorithms to identify circRNA in human and mouse datasets, including CIRI, CIRCexplorer, circRNA_finder, and find_circ. Among the identified circRNAs, 13,027 (31.60%) were observed between all four algorithms , while 1Full-length sequences are important to analyze the function of circRNAs, such as miRNA sponges, RBP sites, and expression. Three popular methods, circseq_cup, CircAST, and CIRI-full, were used in this study for reconstructing full-length sequences of circRNA for short reads datasets.As shown in Among three assembly tools, full-length circRNAs assembled using CIRI-full were more than those assembled using CircAST and circseq_cup. For example, for the circRNA identification result of CIRI on sample SRR10612068, 300 (6.21%) and 1868 (38.69%) full-length circRNAs were assembled using CircAST and CIRI-full, whereas circsesq_cup identified 323 full-length circRNAs for sample SRR10612068 . In addiThere are three assembly tools for assembly of circRNA full-length sequences from short reads, but it is unknown which one has the best performance. Here, we used three evaluation strategies  to evaluate the performance of nine assembly strategies due to different combinations of circRNA identification software  and assembly tools .As shown in In addition, the assembly strategy of CIRI plus CIRI-full showed the highest F1 score  using all three evaluation strategies in human datasets . HoweverAs shown in In Then, we compared precision of nine assembly strategies under three evaluation methods. In human datasets, read alignment showed the highest precision for all nine assembly strategies, while for mouse datasets, CIRI-long showed the highest precision for eight assembly strategies . EvaluatTo analyze the reason for the opposite trend observed between CIRI-long and isoCirc, we generated five subset samples from SRR10612050 according to read length  (Table S4). The majority of circRNAs were identified by CIRI-long for read lengths less than 1,000 bp, and isoCirc identified more circRNAs when read length was longer than 1,000 bp. The results showed that CIRI-long and isoCirc tend to behave differently for different read lengths.From the above analysis, it was found that using circRNA sequences that are verified by all three evaluation methods are more reliable; however, in order to generate enough number of circRNA sequences, we chose to use the circRNA sequences verified by at least two of the three evaluation strategies. In the flowing analysis, we combined all the correct full-length circRNAs verified by at least two evaluation strategies.It is found that the circRNA assembly results of circseq_cup and CircAST displayed higher precision than CIRI-full, whereas CIRI-full displayed the highest sensitivity. In this part, we analyzed the impact of the back splice reads on the precision of creditable full-length circRNAs which were verified by at least two evaluation methods.Previous results showed that for human datasets, circseq_cup and CircAST assembled a lower number of circRNA sequences with high precision and low sensitivities, and most of them (\u223c80%) were verified as correct. Meanwhile, CIRI-full generated more full-length sequences of circRNAs, and only less than 57% of circRNA sequences were evaluated as correct. Therefore, one can improve the precision by screening more credible sequences at the cost of sensitivity.We first analyzed the sequences of exonic full-length circRNAs in CIRI-full for human datasets . For fulIn addition, we calculated the ratio between full-length circRNAs that consisted of all exon back splice sites from CIRI-full and the correct ones. It was found that more than 80% of full-length sequences consisting of all exons between back splice sites were verified correctly. Thus, to improve the precision of CIRI-full, we screened exonic circRNA that full-length sequences consisted of all exon sequences between back splice sites; these sequences were considered more reliable and were selected as correct sequences. After applying the screening protocol, the average precision of CIRI-full over four circRNA identification algorithms increased from 43.26 to 82.77% in human datasets , and theThe same screening rule was also applied in the mouse datasets; the average precision of CIRI-full over four circRNA identification algorithms increased from 18.96 to 32.82% , and theReconstruction of circRNA full-length sequences is vital for its function identification. Three assembly tools were developed to assemble full-length sequences using short reads, and two of them, CircAST and CIRI-full, require identification information of circRNA to complete assembly.Here, we calculated the assembly rate of CircAST and CIRI-full in all datasets and the number of full-length circRNAs on circseq_cup . For theAs we know, in addition to BSJ, CIRI-full also proposed a new feature, named RO Y. . The comIn addition, as shown in As shown in This work indicated that the combination of CIRI and CIRI-full is a better assembly strategy for the single assembly algorithm, and several reported assembly tools should be used simultaneously to obtain comprehensive and reliable results. However, we only used two datasets (in human and mouse) to evaluate the performance of assembly tools, and human and mouse are both mammals. Thus, our conclusion is more applicable to mammals, and whether it is applicable to other animals or plants still needs further verification. In addition, developing a new assembly algorithm that has the advantages of lower data requirements and more reliable assembly results is more significant."}
+{"text": "Glioblastoma multiforme (GBM), as a deadly and almost incurable brain cancer, is the most invasive form of CNS tumors that affects both children and adult population. It accounts for approximately half of all primary brain tumors. Despite the remarkable advances in neurosurgery, radiotherapy, and chemotherapeutic approaches, cell heterogeneity and numerous genetic alterations in cell cycle control, cell growth, apoptosis, and cell invasion, result in an undesirable resistance to therapeutic strategies; thereby, the median survival duration for GBM patients is unfortunately still less than two years. Identifying new therapeutics and employing the combination therapies may be considered as wonderful strategies against the GBM. In this regard, circular RNAs (circRNAs), as tumor inhibiting and/or stimulating RNA molecules, can regulate the cancer-developing processes, including cell proliferation, cell apoptosis, invasion, and chemoresistance. Hereupon, these molecules have been introduced as potentially effective therapeutic targets to defeat GBM. The current study aims to investigate the fundamental molecular and cellular mechanisms in association with circRNAs involved in GBM pathogenesis. Among multiple mechanisms, the PI3K/Akt/mTOR, Wnt/\u03b2-catenin, and MAPK signaling, angiogenic processes, and metastatic pathways will be thoroughly discussed to provide a comprehensive understanding of the role of circRNAs in pathophysiology of GBM.Video AbstractThe online version contains supplementary material available at 10.1186/s12964-021-00809-9. Glioblastoma multiforme (GBM) is still known as a deadly brain cancer and accounts for approximately half of all primary brain tumors . CurrentNcRNAs are defined as a large group of RNA molecules with no potential of being translated, and can be classified into two subclasses based on their size; (I) short ncRNAs that are smaller than 200 nucleotides in size (e.g. microRNA (miRNA) with a length of about 20 to 23 nucleotides), and (II) long ncRNAs (lncRNAs) with a length of more than 200 nucleotides . CirculaSeveral studies have shown that metabolic and genetic disorders there are in patients with diabetes and cancer \u201316. In aAmong various malignant gliomas, GBM, which accounts for about 60\u201370% of all gliomas, is the most invasive form of the CNS tumors that can affect both children and adult population . GBM is Another categorization of GBMs is based on its clinical characteristics. In this classification, there are two subclasses; primary GBMs which are usually arisen de novo, during 3\u20136\u00a0months, and secondary GBMs which develop gradually from the low grade astrocytomas, over a 10 to 15-year period . PrimaryThe Cancer Genome Atlas (TCGA) has categorized GBMs into four molecular subclasses, including the classical, mesenchymal, proneural, and neural, based on the genomic and proteomic analyses . The ideCircRNAs are a substantial group of ncRNAs with covalently closed-loop structures without 5\u02b9-to-3\u02b9 polarity that are generated from pre-mRNA during the back-splicing or exon skipping, the processes that are different from the canonical splicing , 36. CirAlu, leading to the formation of different types of circRNAs, including the EcircRNAs and EIciRNAs [In the case of circRNA biogenesis, there are two speculative models that are broadly accepted; first, lariat-driven circularization, in which pre-mRNA is exposed by partial splicing due to its closeness to the exon-donor site and different exon acceptor sites on the same locations, resulting in the skipping of one or more exons . This prEIciRNAs .Like for linear RNAs, the biogenesis of circRNAs is controlled by RNA binding proteins (RBPs), including the muscle blind (MBL), quaking (QKI), double-stranded RNA editing enzyme- adenosine deaminase acting-on RNA (ADAR), and the nuclear helicase DHX9 . MBL andThe biological functions of circRNAs are closely associated with their specific structures and molecular features. The well-understood functions of these RNA molecules are classified as follows:MicroRNAs (miRNAs), as the other substantial ncRNA molecules, are able to induce the mRNA degradation or translation suppression via attaching to the target sites through the mRNA\u2019s 3\u2032- UTR . CircRNACircRNAs, which contain particular binding sites for RBPs, can specifically bind to particular proteins and act as protein sponges to change the activity of those proteins . For insCircRNAs located inside the nucleus, including the CiRNAs and EIciRNAs, are able to operate the parental gene expression at both transcriptional and post-transcriptional levels . EIciRNADue to the absence of a 5' cap structure or a 3' poly (A) tail, circRNAs were initially classified as non-coding RNAs that could not be translated into proteins. However, some circRNAs, such as the circ-SHPRH, circ-ZNF609, and circ-Mbl have surprisingly been shown to possess translational capability . The eleCircRNAs may be involved in various human diseases, such as different cancers, cardiovascular diseases (CVDs), neurological disorders, etc. First, circRNAs are greatly expressed in nervous tissues , suggestSecond, circRNAs are also highly expressed in cardiac tissues  and cancConsistent with their known functions in the modulation of cell cycles, cell proliferation, and cellular senescence, circRNAs have been implicated in the pathogenesis of cancers . A reseaCircRNAs are dynamically expressed in nervous tissues, suggesting their neurospecificity . This phThe phosphatidylinositol-3'-kinase/protein kinase B/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway is a vital intracellular signaling, which regulates different biological processes such as the cell proliferation, differentiation, apoptosis, angiogenesis, and cell survival . The actPrevious investigations have indicated that circRNAs affect the cell proliferation, differentiation, and migration in several malignancies, such as the liver cancer, gastric cancer, renal cell carcinoma, as well as GBM, through the PI3K/Akt/mTOR signaling. There are some valuable findings in this regard; PENG et al. reported an up-regulated hsa_circ_0010882 expression in plasma specimens of gastric cancer patients, as well as in gastric cell lines. They found that this overexpression promoted the proliferation, migration, and invasiveness of gastric cancer cell lines via activating the PI3K/Akt/mTOR flux . SimilarIn the case of miRNA sponges, circTTN acts as a miR-432 sponge to induce the cell proliferation and differentiation of bovine myoblasts through the IGF2/PI3K/Akt signaling. Indeed, miR-432 can inhibit the expression of IGF2 and a group of genes such as the IRS1, PI3K, and phosphoinositide-dependent Kinase-1 (PDK1), all of which are involved in the modulation of PI3K/Akt pathway. Still, the overexpression of xcircTTN may abolish these effects by sponging miR-432 . IGF2 alHsa_circ_0067934, generated from the chromosomal region 3q26, has been shown to become overexpressed in GBM tissues and is contributed to the GBM progression by stimulating of both proliferative and metastatic processes through the activation of PI3K/Akt signaling. The current finding suggests that hsa_circ_0067934, as an oncogene circRNA, may be considered as a novel prognostic biomarker to detect GBM patients as soon as possible .Using high-throughput RNA sequencing, researchers have reported that circ-AKT3 has insignificant expression levels in GBM tissues compared to non-GBM brain tissues. The circ-AKT3 encodes a new protein, containing 174 amino acid residues, called the AKT3-174aa, which blocks the AKT thr-308 phosphorylation and sequential activation via interacting with the active PDK1. Therefore, the circAKT3, as a tumor suppressor, has a negative modulatory role in operating the PI3K/Akt pathway and hampers the GBM cells proliferation, radiation resistance, and tumorigenicity .One of the other GBM-related circRNAs is the circNT5E. MiR-422a, as a tumor suppressive molecule, exerts its suppressive effects on GBM through regulating the PI3K/Akt/mTOR signaling . Wang etWnt/\u03b2-catenin signaling is a highly conserved signaling cascade that controls the fetal growth and adult homeostasis . The WntNeural stem cells (NSCs) are the major components of CNS. It has been reported that Wnt signaling is required for the differentiation of NSCs during the CNS development . TherebyAldehyde dehydrogenase isoform 3A1 (ALDH3A1) is a target gene for the canonical Wnt signaling in GBM that plays a significant role in tumor drug resistance . Suwala In this field, Chen and Duan found that hsa_circ_0000177 targeted the mir-638 to increase the expression of FZD class receptor 7 (FZD7), and activated the Wnt signaling in order to induction of malignant glioma behaviors through stimulating the cell proliferation and invasion . Circ_00CZNF292 is a circRNA that has been shown to be expressed in hypoxic conditions and modulates the GBM tube formation by activating the Wnt/\u03b2-catenin pathway , 134. YaMitogen-activated protein kinases (MAPKs) are highly conserved serine/threonine protein kinases that regulate various cancer cell-related processes such as proliferation, differentiation, transformation, stress response, apoptosis, cell survival, and death . There aOne of these circRNAs is circ-TTBK2, which Zheng and his collaborators have indicated its overexpression in both GBM tissues and cell lines. Surprisingly, if circ-TTBK2 is knocked down, miR-217 up-modulation can significantly inhibit the processes like cell proliferation, migration, and invasion, and accelerates the apoptotic events. Further investigations also presented that circ-TTBK2 might have the ability to induce the expression of hepatocyte nuclear factor\u00a01 (HNF1), as a crucial carcinogen in glioma cells, through sponging the miR-217 and further promotion of the GBM expansion. Scanning the promoter\u2019s sequence has exhibited that HNF1\u03b2 has a binding site on Derlin-1 promoter . PreviouCirc-MAPK4, also known as has_circ_0047688, is a special member of circRNA family, which is positively correlated with the pathological stage of GBM. He et al. declared that circ-MAPK4 promoted GBM cell survival and inhibited the apoptosis through suppressing the phosphorylation of p38/MAPK, as an apoptosis inducer and sequential inhibitor, working through miR-125a-3p sponging . Wei et Through a mechanistic evaluation, researchers found the cytoplasmic localization and molecular sponge role of circ-PITX1. They have revealed that this circRNA interacts with miR-379-5p, as well as the MAP3K2, in order to block the cell proliferation and accelerate the apoptotic flux, leading to the GBM development . Based oAngiogenesis is a physiological process through which new capillaries are generated from previous arteries. Physiological angiogenesis is a highly regulated process and is critical for growth, as well as wound healing and tissue formation . The indNeuropilin-1 (NRP-1) is a multifunctional receptor that is expressed in different human cancerous tissues, including the GBM, and its expression level is associated with tumor growth . Recent RBPs are reported to be involved in the operation of tumor angiogenesis by interacting with circRNAs. As an example, serine and arginine rich splicing factor 10 (SRSF10), belonging to the SR protein family, binds to the 5\u2032-end and 3\u2032-end of circ-ATXN1 pre-mRNA and increases the circ-ATXN1 biogenesis and inhibits the SRSF10, resulting in a dramatically repression of the tube formation in glioma endothelial cells (GECs). Moreover, circ-ATXN1 attaches to the miR-526b-3p and blocks the negative regulatory effect of miR-526b-3p on MMP2 and VEGFA, subsequently increases the GBM angiogenesis . AnotherSimilar outcomes were observed for the FUS/circ_002136/miR-138-5p/SOX13 feedback loop, which played a vital role in regulating the GBM angiogenesis . CircSMACancer metastasis is the process by which cancer cells separate from the primary tumor, settle and grow in a different or secondary site . In GBM,et\u00a0al. observed that hsa_circ_0008344 was greatly expressed in IDH1 wild-type GBM and its knockdown could also cease the GBM cell migration, invasion, and proliferation, and promoted the cell apoptosis [In this regard, circ-EPB41L5 (YMO1) is a direct target for miR-19a and is a critical tumor suppressive molecule that interacts with RhoC and inhibits its expression. Furthermore, circ-EPB41L5, which is down-regulated in GBM, is a circRNA gene that can inactivate the miR-19a, thereby inhibits the phosphorylation of the Akt through the EPB41L5 overexpression, and subsequently can repress the invasion and metastasis of glioma cells to inhibit the GBM tumorigenesis. Hence, these findings indicate that the circ-EPB41L5/miR-19a/EPB41L5/p-Akt regulatory axis plays a prominent role in GBM expansion . Zhou etpoptosis . Hsa_cirpoptosis .et\u00a0al., has presented that HMGB3 is a direct target for miR-628-5p, and circ-0001801 acts as a negative regulator of mir-628-5p. This study also showed the up-regulation of circ-0001801 and HMGB3, as well as the down-regulation of miR-628-5p in GBM. When the circ-0001801 is eliminated, miR-628-5p overexpression reduces the GBM cell proliferation, migration, invasion, and EMT [The major process responsible for regulation of metastasis is called EMT, where the cells lose their cell polarity and cell-to-cell or cell-to-matrix adhesion, become mesenchymal stem cells with migratory and invasive capabilities . MiRNAs  and EMT .et\u00a0al. confirmed the elevated expression of circPARP4 in GBM and showed that circPARP4 obviously promoted the glioma cell proliferation, migration, invasion, and EMT. This study also indicated that circPARP4 exerted its oncogenic effects by sponging the miR-125a-5p and through the regulation of FUT4 [Another overexpressed circRNA in GBM tissues is circPVT1. If circPVT1 is silenced, it can significantly reduce the viability and migration capability and induces the apoptotic processes via up-regulating the miR-199a-5p. Further investigation have also indicated that EGF-induced EMT was repressed after circPVT1 silencing, suggesting that circPVT1 promotes the GBM metastasis in an EMT-induced manner . Through of FUT4 . We know of FUT4 . Wang et of FUT4 . Circ-MM of FUT4   than those with lower grades (WHO I & II). These findings indicate that circ-BRAF, as a biomarker, may help the prediction of pathological grade and prognosis in GBM patients . Circ-00Recent assessments have identified peptides/proteins encoded by circ-RNAs as potential biomarkers in diagnosis of GBM. SHPRH-146aa, encoded by circ-SHPRH, is greatly found in normal human brain, while becomes decreased in GBM. This novel protein protects the full-length SHPRH from DTL-induced ubiquitination, leading to an increase in full-length SHPRH\u2019s half-life and induces the protein\u2019s tumor suppressive functions. SMO-193aa, encoded by circ-SMO, as another protein in this categorization, is essential for hedgehog signaling activation and promotes the self-renewal processes, cell proliferation, and tumorigenicity. The SHPRH-146aa overexpression and SMO-193aa silencing are negatively associated with patients\u2019 short survival period, indicating the clinical application of these proteins , 198.A number of circRNAs have been shown to affect critical biological processes associated with GBM, including cell proliferation, cell apoptosis, migration, invasion, and metastasis. Accordingly, therapeutic strategies targeting circRNAs are expected to provide a new perspective to cure the GBM. A recent evaluation, performed by Li et al. has indicated that circ_0001946, a miR\u2010671\u20105p sponge, was suppressed in GBM cells, promoting the cerebellar degeneration related protein 1 (CDR1) gene expression. This study also showed that CDR1 reduced the proliferation, migration, and invasion, and increased the apoptosis in GBM cells. Thereby, circ_0001946 seems to have anti-cancer functions, converting it into a promising target for GBM treatment . As a tuSome circRNAs are up-regulated in GBM, and then promote the oncogenic processes. For example, circFOXO3, which is highly expressed in GBM tissues, accelerates the proliferation and invasion of GBM cells by targeting the miR-138-5p and miR-432-5p, in order to abnormally express the nuclear factor of activated T-cells 5 (NFAT5) . It has et\u00a0al. found that circ\u20100,007,874 (circMTO1) was overexpressed in TMZ\u2010resistant GBM cells and tissues. Moreover, the circMTO1 overexpression remarkably decreased in vivo and in vitro TMZ\u2010resistance of these cells by suppressing the cell proliferation and inducing the apoptotic flux. Further analyses also revealed that miR\u2010630 was targeted by circMTO1 in GBM cells and its knockdown also reduced the TMZ\u2010resistance. Therefore, circMTO1 can reverse the TMZ-resistant property of GBM cells through the regulation of miR\u2010630, providing a novel and potential target to manage GBM [TMZ is commonly used to treat GBM patients, who have undergone the resection surgery. Using TMZ after the surgery prevents from the GBM recurrence and prolongs the patient\u2019s survival. However, the GBM chemoresistance limits the TMZ therapeutic effects . Rao et\u00a0nage GBM . AnotherDespite the surgical interventions, followed by chemotherapy and radiotherapy, the survival rate of GBM patients has remained very low and most patients do not unfortunately survive more than two years. The other issue is the GBM\u2019s histological heterogeneity and multiplicity of underlying molecular mechanisms, making it resistant to common radiotherapy and chemotherapeutic approaches. Consequently, targeted therapies towards the intracellular signaling pathways would be potentially effective strategies to defeat GBM. Not long ago, several analyses have examined the circRNAs\u2019 biological functions in different cancers. They presented that these RNA molecules could influence diverse biological processes in association with the GBM expansion, including cell proliferation, apoptosis, invasion, and treatment resistance. Many of these effects are obtained by operating of critical molecular mechanisms and/or signaling pathways. Some of these circRNAs can positively modulate the crucial pathways, such as the PI3K/Akt/mTOR signaling, Wnt/\u03b2-catenin pathway, and MAPKs cascade, while some negatively regulates them. The other ones can be involved in cancer development-related processes, including the angiogenesis and metastatic flux. According to aforementioned findings and extensive distribution of circRNAs, as they can be found in various biological specimens, a novel perspective has been proposed for both diagnosis and treatment of GBM. However, in comparison to mRNAs and miRNAs, there is a significant gap in our current understanding of circRNAs, and thus further studies are required to identify the precise mechanisms of GBM-circRNAs relationship. Currently, detecting circRNAs in cancer patients is mainly done by analyzing tissue specimens, which is an invasive method. Thereupon, it is critical to know how to employ non-invasive methods such as analyzing blood, urine, saliva, etc. Additionally, it is worth noting to investigate the association of different circRNAs with common GBM biomarkers. The development of newly found circRNA-identifying methods is improving the GBM circRNA-based diagnostics and therapeutic approaches, which will be a milestone in eradicating of this life-threatening malignancy."}
+{"text": "Sclerotinia sclerotiorum, has a broad host range and causes yield loss in dicotyledonous crops world wide. Genomic diversity was determined in a population of 127 isolates obtained from individual canola (Brassica napus) fields in western Canada. Genotyping with 39 simple sequence repeat (SSR) markers revealed each isolate was a unique haplotype. Analysis of molecular variance showed 97% was due to isolate and 3% due to geographical location. Testing of mycelium compatibility among 133 isolates identified clones of mutually compatible isolates with 86\u201395% similar SSR haplotype, whereas incompatible isolates were highly diverse. In the Province of Manitoba, 61% of isolates were compatible forming clones and stings of pairwise compatible isolates not described before. In contrast, only 35% of isolates were compatible in Alberta without forming clones and strings, while 39% were compatible in Saskatchewan with a single clone, but no strings. These difference can be explained by wetter growing seasons and more susceptible crop species in Manitoba favouring frequent mycelium interaction and more life cycles over time, which might also explain similar differences observed in other geographical areas and host crops. Analysis of linkage disequilibrium rejected random recombination, consistent with a self-fertile fungus, restricted outcrossing due to mycelium incompatibility, and only a single annual opportunity for genomic recombination during meiosis in the ascospore stage between non-sister chromatids in the rare event nuclei from different isolates come together. More probable sources of genomic diversity is slippage during DNA replication and point mutation affecting single nucleotides that accumulate and likely increase mycelium incompatibility in a population over time. A phylogenetic tree based on SSR haplotype grouped isolates into 17 sub-populations. Aggressiveness was tested by inoculating one isolate from each sub-population onto B. napus lines with quantitative resistance. Analysis of variance was significant for isolate, line, and isolate by line interaction. These isolates represent the genomic and pathogenic diversity in western Canada, and are suitable for resistance screening in canola breeding programs.The ascomycete,  Sclerotinia sclerotiorum, survives in the soil for several years as sclerotia (resting bodies) consisting of condensed hyphae surrounded by a melanised rind. In the spring, sclerotia in the top soil layer germinate with apothecia containing ascospores that are dispersed by wind to surrounding plants. Ascospores are unable to penetrate the plant\u2019s epidermis directly. Instead, they germinate with hyphae that colonize dead organic matter and form infection cushions [The ascomycete plant pathogen, cushions . These pSclerotinia sclerotiorum is a dikaryot organism with two nuclei in cells of actively growing hyphal tips and in each ascospore resulting from one meiotic and one mitotic cell division. Hyphal tips from two different isolates can unite in anastomosis as first demonstrated by Kohn et al. [S. sclerotiorum isolates on nutrient agar can distinguish between mycelium compatible isolates that grow as one colony, and incompatible isolates that grow as two colonies separated by a barrage zone. Test of mycelium compatibility can be applied to a population using a isolate by isolate paring matrix. Population studies comprising S. sclerotiorum isolates from various plant species and geographical areas have used a combination of mycelium compatibility test, genotyping with molecular markers, primarily amplifying simple sequence repeats (SSR), and tests for aggressiveness on selected host lines. A set of SSR markers was published in 2001 [S. sclerotiorum isolates. Different levels of aggressiveness among isolates inoculated onto various host species have been demonstrated [S. sclerotiorum is clonally propagated with some level of genomic recombination sometimes referred to as outcrossing.n et al. . Later, n et al.  observed in 2001 , and hasnstrated \u20137. A sumnstrated . Most stS. sclerotiorum pathogen has a wide host range among dicotyledonous plant species including canola (B. napus), bean (Phaselous vulgaris), soybean (Glycine max), lentil (Lens culinaris) and sunflower (Helianthus annus) [S. sclerotiorum that causes stem rot also know as white mould. Infection of canola occur during flowering when the ascospores grow on fallen petals and pollen adhering to plant surfaces. The most severe yield loss results from colonisation of the main stem which restricts vascular transport of water and nutrients to the seed. Stem symptoms consist of long, pale lesions that initially have a dark margin between infected and healthy tissues. Later, the lesions grow into the stem pith leading to soft and collapsed stems.The s annus) . Each yeS. sclerotiorum in B. napus as well as other crop species is a quantitative trait that rely on several defense genes and pathways with cumulative effect [B. napus lines with quantitative resistance after screening of more than 400 germplasm lines obtained from gene banks worldwide [S. sclerotiorum isolate, 321, collected in 1992 from a canola field in Olds, Alberta [Resistance to e effect , 10. Preorldwide . The phe Alberta . GermplaS. sclerotiorum by genotyping a population of isolates with an expanded set of SSR markers distributed across the fungal genome, and uses a new way of visualizing mycelium compatibility data among isolates. The results, combined with past evidence of chromosomal behaviour of the pathogen\u2019s two nuclei during meiosis, and new evidence on the lack of hard selective sweeps in the genome, helped us to determine the most likely sources leading to genomic diversity in this species and also assess the rate of genomic change. A population of S. sclerotiorum isolates collected from canola in western Canada served as model for this research. Examination of population structure allowed selection of isolates for further characterization of aggressiveness in canola, which has application for resistance screening in plant breeding programs.The present research characterizes the genomic diversity in S. sclerotiorum showed the pathogen was present in 88% of fields  for each SSR marker were highly correlated (r = 0.99) and ranged from 0.126 to 0.949 and 0.136 to 0.959, respectively  showed 97% of the genomic variance was explained by differences among isolates, while 3% was due to differences among provinces (P = 0.001) (D) between S. sclerotiorum populations was higher between the two distant provinces, Alberta and Manitoba (Nm) was highest between neighbouring provinces Manitoba and Saskatchewan, followed by Saskatchewan and Alberta, and the lowest gene flow occurred between the two most distant provinces, Alberta and Manitoba. The differentiation index (PhiPT) was not significant between the neighbouring provinces Manitoba and Saskatchewan, but was significantly different between both Saskatchewan and Alberta, as well as between Manitoba and Alberta  . Other a= 0.001) . As expeManitoba , than beManitoba . Congrue Alberta . EvidentS. sclerotiorum assessed both by province and combined for the three provinces showed the Index of association (IA) was statistically significant in all cases, thereby rejecting the null hypothesis of random recombination. Also, all standard index of associations (rBarD) were much closer to 0 than to 1 specifying non-random association  were highly correlated  (S. sclerotiorum isolate and B. napus line. The lesion length for each isolate across six B. napus lines showed a continuum from the least aggressive isolate AB7 (17.4 \u00b1 3.2 mm) to the most aggressive isolate AB29 (151.3 \u00b1 13.8 mm) (B. napus line across 17 isolates ranged from the highest level of quantitative resistance in PAK54 (48.3 + 3.2 mm) to susceptibility in Topas (161.2 + 6.6 mm)  . Lengthw< 0.001) . Thus fo13.8 mm) . Corresp 6.6 mm) . Lines c 6.6 mm) , which wparately ; this grnd PAK93 .S. sclerotiorum isolates from canola in a large geographical area, measuring 1500 km West to East and 1000 km North to South, combined with a new way of visualizing mycelium compatibility relationships gave us an informative \u2018snap-shot\u2019 of the pathogen population diversity in western Canada. The sequenced S. sclerotiorum genome [Effective genotyping of m genome  was utilSclerotinia sclerotiorum has two nuclei in each ascospore and in cells of actively growing hyphal tips [S. sclerotiorum for the following reasons; (1) the pathogen is homothallic with both mating type genes at the same locus, and readily form ascospores by self-fertilization thereby reducing the likelihood for out-crossing; (2) there is only one opportunity per growing season for genomic recombination between non-sister chromatids during a single meiosis leading to ascospore formation; (3) since the pathogen is mono-cyclic there is only one opportunity per growing season for transfer of nuclei between hyphae of different isolates, and furthermore require they infect the same plant and are mycelium compatible; (4) since transfer of nuclei only occur among mycelium compatible isolates in clones, strings and pairs, that have relatively similar genotypes compared to incompatible isolates, the likelihood for genomic recombination leading to new genotypes that are different from the parents is therefore very low. Microconidia contain a single nucleus and a few organelles [S. sclerotiorum isolate having 5% of asci with four smaller and four larger ascospores. This size dimorphism might result from mixing of different nuclei affecting some asci. However, in the present study, analysis of linkage disequilibrium rejected the hypothesis of random recombination in S. sclerotiorum, leading us to conclude that non-sister homologous recombination is absent or extremely rare in the fungal population in western Canada.hal tips , while ohal tips . The twohal tips , providiganelles , and areganelles . In the ganelles  identifiS. sclerotiorum isolates were connected in strings where isolate \u2018X\u2019 was compatible with \u2018Y\u2019, and \u2018Y\u2019 with \u2018Z\u2019, while \u2018X\u2019 was incompatible with \u2018Z\u2019, which resembled the \u2018ring-species\u2019 concept most often described for bird species [S. sclerotiorum in this study likely consisted of slippage during DNA replication and point mutation affecting individual nucleotides. Both mechanisms are particularly frequent in simple sequence repeats and accumulate with each cell division. The dataset seems to have captured isolates at various stages of divergence, beginning with clonal isolates having similar SSR haplotypes, followed by stepwise divergence into compatible isolates forming strings, pairs of compatible isolates, and ending with incompatible isolates with unique SSR haplotypes. It is conceivable that genetic information passes from one mycelium compatible isolate to another by hyphal anastomosis, but over time, certain genetic factors prevent further compatibility, after which isolates become distinct haplotypes where polymorphisms continue to accumulate. In addition, it was clear that physical separation contributed to divergence, seen as low (11%) mycelium compatibility between isolates from different Provinces compared to higher (35\u201361%) compatibility between isolates within each Province.Significant discoveries were made using diagrams visualizing the relationship among mycelium compatible isolates. Importantly, some  species . Most siS. sclerotiorum isolate was a unique haplotype. This finding seemed to contrast most previous publications, where haplotype frequencies were comparatively lower, but can be explained by the use of fewer SSR markers in those studies. Like us, these researchers used different sub-sets of markers published by Sirjusingh and Kohn in 2001 [S. sclerotiorum isolates from various plant species and geographic locations such as 6 SSR [S. sclerotiorum populations elsewhere, particularly those SSRs with high polymorphic information content on separate chromosomes marked in Counts of shared and private alleles demonstrated each  in 2001  to genotas 6 SSR \u201323, 10 Sas 6 SSR , 11 SSR as 6 SSR , 26, 12 as 6 SSR , and 13 as 6 SSR . UnderstS. sclerotiorum disease incidence in 2010 confirm these provincial differences with more disease in Manitoba followed by Saskatchewan and Alberta , all of which were related to one another in clones and strings . This ma Alberta . The genAnalysis of population structure clearly divided the isolates into two sub-populations with 63% of isolates in Q1, 33% in Q2 and 4% in an admix group . AnalysiB. napus lines with quantitative resistance, PAK54, PAK93, DC21, K22 and Tanto, and one susceptible control line, Topas. Moreover, the isolate by line interaction was statistically significant, particularly evident for isolate SK35, which was more aggressive on DC21 or K22 than on PAK54 or PAK93 , which infects the host directly. Derbyshire et al. [S. sclerotiorum has undergone a slow rate of evolution based on a low decay of linkage disequilibrium and a lack of hard selective sweeps in the genome, a process through which a new advantageous trait increases in a population. The latter investigation included five isolates, SK35, 321, MB52, MB21 and AB2, that were part of the present study. Taken together, S. sclerotiorum is a relative weak and unspecialized pathogen that rely on secondary metabolites in the infection phase. It is therefore unlikely changes in aggressiveness in the pathogen population will overcome quantitative resistance in new varieties since the primary source of genomic variation is slippage during DNA replication and point mutation, while the probability of non-sister homologous recombination is low. Still, it is prudent to evaluate crop varieties against S. sclerotiorum isolates that are representative of the genomic and pathogenic diversity in the area where they will be deployed.It is well known, pidermis . Badet epidermis  found S.e et al.  concludeS. sclerotiorum in all important canola producing areas of Alberta, Saskatchewan and Manitoba. A total of 168 fields were selected at random separated by at least 25 kilometers  separated by at least 10 meters  a field number and the letters a, b, c or d. The sclerotia and stem pieces were surface-sterilized in 0.6% sodium hypochlorite for three minutes, rinsed in sterile water and plated on potato dextrose agar  in 9 cm Petri plates. Cultures were incubated in a cycle of 16 h day (22 \u00b11\u00b0C) and 8 h night (18 \u00b11\u00b0C), and after three to four days hyphal tips from the edge of a growing colony were transferred to a new PDA plate and incubated as before. Sclerotia that formed along the edge of the Petri plates were collected after four to six weeks and stored in paper envelopes under dark and dry conditions at 4\u00b0C with an identical set at -10\u00b0C. The total collection consisted of 1392 individual S. sclerotiorum was examined using 133 isolates representing 28 fields in Alberta, 51 in Saskatchewan and 54 in Manitoba. Isolate 321 collected in 1992 from a canola field in Olds was part of the Alberta group [Mycelium compatibility in ta group . In addita group . Each isS. sclerotiorum genome available on the Broad Institute\u2019s web site [S. sclerotiorum SSRs were obtained from Sirjusingh and Kohn [S. sclerotiorum isolates from group \u2018a\u2019 described above. In preparation for extraction of genomic DNA, sclerotia of each isolate was surface sterilized, cut in half and placed on PDA in a 9 cm Petri plate. After 5\u20137 days incubation at 16 h light (22\u00b11\u00b0C) and 8 h dark (18 \u00b11\u00b0C) two 4 mm plugs were cut from the growing margin and transferred to potato dextrose broth in a 9 cm Petri plate and incubated as before. When mycelium covered 80% of the liquid surface it was harvested, washed twice with sterilized, distilled water and lyophilized.Simple sequence repeats were identified in the sequenced web site . A totalweb site . In addiand Kohn  and giveS. sclerotiorum mycelium using a Fungi/Yeast Genomic DNA isolation kit  according to the manufacturer\u2019s protocol. DNA was quantified using a Quant-it PicoGreen Assay  on an Appliskan microplate reader  and diluted to 10 ng DNA \u03bcl-1. Each PCR reaction was performed in 8.2 \u03bcl total volume containing 2.6 \u03bcl 10 ng \u03bcl-1 fungal DNA template, 0.30 \u03bcM M13 primer fluorescently labeled with one of FAM, VIC, NED, PET or LIZ , 0.076 \u03bcM forward primer (with M13 tail), 0.03 \u03bcM reverse primer, and 4.1 \u03bcl FideliTaq PCR master mix; FideliTaq 2x, 25 mM MgCl2, 20 mM dNTPs . PCR amplifications were optimized for BioRad DNA Engine Dyad  resulting in the following run conditions: 94\u00b0C for 3 min, then 22 cycles at 94\u00b0C for 30 s, a primer-specific temperature  was calculated in POPGENE 1.32 [The Genographer dataset was curated into Excel . Allele counts, including total number of polymorphic alleles, shared and private alleles, were conducted in the Microsatellite feature of the Toolkit program . The polENE 1.32 . The hapENE 1.32 .Nm), used the formula was Nm = 0.5 (1\u2014Gst)/Gst. Nei\u2019s unbiased genetic distance (D), population differentiation (PhiPT) for pairwise comparison of provinces were calculated using GenAlEx 6.5 in Excel with 999 permutations [LD) were used to test the null hypothesis that random recombination exists. For this, the index of association (IA) and the standardized index of association (rBarD) were calculated using the software Multilocus v.1.31 [rBarD equal 0 there was a non-random association of alleles, whereas rBarD equal 1 specified random association of alleles.The SSR data were grouped into the three provinces, Alberta, Saskatchewan and Manitoba, where the isolates were collected and used for several types of analyses. Contribution of isolate and geographical location to genomic variation was determined by analysis of molecular variance (AMOVA) using GenAlEx v 6.5 with 999 permutations, and the results presented in utations  Table 5Nm, used s v.1.31  for eachS. sclerotiorum isolates using Structure [ln(P) was graphed in Structure Harvester, a web-based program that visualizes output data from Structure [A Bayesian cluster analysis was used to infer genomic ancestry among the 127 tructure . Analysetructure . The resS. sclerotiorum isolates based on SSR polymorphisms was analyzed using NTSYSpc 2.2 with matrices of genetic distance coefficient function \u2018SIMGEND\u2019 sub-program and Nei72 similarity coefficient. Subsequently, neighbour-joining analysis (Njoin) was performed with default parameters. To visualize the results, the \u2018TREE\u2019 function was used to generate a phylogenetic tree, where the oldest isolate, 321 collected in 1992, was selected as the root and branches consisted of all other isolates collected in 2010  and the phylogenetic tree, 17 us study . These lSeeds of each line were sown into water-soaked peat pellets  and placed in a greenhouse. Plants at the 3\u20134 leaf stage were transplanted into natural soil in a phenotyping facility under semi-field conditions. The facility consisted of a 20 m x 40 m greenhouse structure with retractable roof and side walls made from reinforced polyethylene supported by permanent gable ends of corrugated polyvinyl . Plant growth relied on ambient sun light and temperature with rainfall supplement with overhead irrigation when needed. A weather sensor and computer program operated motors that closed the roof and side walls to protect the plants at temperatures below 10\u00b0C and wind speeds above 30 km per hour. At temperatures above 25\u00b0C the plants were cooled by activation of an overhead misting system and shaded by closing the roof 50%.B. napus lines in four replications planted as the main plot, with the 17 S. sclerotiorum isolates inoculated onto plants as sub-plots organized in a randomized complete block design. There were seven plants in each sub-plot for a total of 2,856 plants. The mean values for each combination of S. sclerotiorum isolate and B. napus line were calculated for the five disease traits . Correlations between these traits were analyzed in a pairwise manner using the Pearson correlation coefficient (PROC CORR) in SAS Enterprise 5.1. Analysis of variance (ANOVA) was conducted using the PROC GLM fixed-effect model in SAS Enterprise 5.1 to determine variation explained by isolate, B. napus line, and the interaction between isolate and B. napus line . After 4\u20136 days, 7 mm plugs of mycelium were transferred to cryo-freezer solution  and stored at -80\u00b0C until needed for inoculation. Inoculum of individual isolates was prepared by transferring mycelium plugs from the cryo-freezer onto PDA plates. The plates were incubated in a cycle of 16 h day (22 \u00b11\u00b0C) and 8 h night (18 \u00b11\u00b0C), and were ready for inoculation after 4\u20135 days at which point the culture was still actively growing, but had not reached the edge of the Petri plate. Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 x 7 cm pieces of stretched Parafilm  with the mycelium facing up. When each plant was at full flower, two internodes of the main stem were inoculated by attaching a mycelium plug with Parafilm as described by Gyawali et al. (11). The length of the developing lesions was measured at 7, 14 and 21 days after inoculation (dai), and subsequently used to calculate the area under the disease progress curve (AUDPC). In addition, depth of penetration into the stem tissue was assessed by placing a light pressure to the lesion with two fingers which was recorded as either firm, soft or collapsed and used to calculate percent soft + collapsed lesions for each isolate and line combination. The experiment consisted of six pus line , followepus line  Tables.S1 Table(XLSX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file.S5 Table(DOCX)Click here for additional data file.S6 Table(XLSX)Click here for additional data file.S7 Table(XLSX)Click here for additional data file.S1 Fig(JPG)Click here for additional data file."}
+{"text": "The immune system is capable of remarkably potent and specific efficacy against infectious diseases. For decades, investigators sought to leverage those characteristics to create immune-based therapies (immunotherapy) that might be far more effective and less toxic than conventional chemotherapy and radiation therapy for cancer. Those studies revealed many factors and mechanisms underlying the success or failure of cancer immunotherapy, leading to synthetic biology approaches, including CAR-T cell therapy. In this approach, patient T cells are genetically modified to express a chimeric antigen receptor (CAR) that converts T cells of any specificity into tumor-specific T cells that can be expanded to large numbers and readministered to the patient to eliminate cancer cells, including bulky metastatic disease. This approach has been most successful against hematologic cancers, resulting in five FDA approvals to date. Here, we discuss some of the most promising attempts to apply this technology to cancers of the gastrointestinal tract. Although Jenner did not fully understand the mechanisms of vaccination and its shaping of immune responses, his efforts would eventually lead to the eradication of smallpox in the 1980s, among several other infectious disease advancements.2A nearly two-century long period of \u201cexperimental immunology\u201d ushered in much of the foundations related to the understanding of the immune system. Although scholars have identified records of patients being inoculated with smallpox as far back as early Chinese antiquity, the English physician, Edward Jenner, is largely credited as the initial pioneer of vaccination in the late 1700s.3 The correct identification of distinct pathogens as the causative agents in infectious disease further spurred a period of rapid vaccine development. Building upon Jenner\u2019s observations of inoculation and conferred immunity, this led some to believe that perhaps cancer too could be stymied through immune modulation.2Further strides were taken across the subsequent century with the development of what was to become the modern \u201cGerm Theory of Disease\u201d by the separate efforts of Louis Pasteur and Robert Koch. Pasteur, a French chemist originally interested in alcoholic fermentation, correctly identified the source of fermentation, and by extension \u201cspoilage\u201d, as a biological process that manifests from organisms in the air. Koch, a German physician, also observed similar organisms in the blood of sheep afflicted with anthrax. Koch correctly identified that anthrax transmission in animals could occur through exposure and proximity, even from bacterial spores dormant for many years. These findings were the foundation for \u201cKoch\u2019s postulates\u201d, describing the relationship between microbes and disease.th century. Drs. Busch and Fehleisen each observed tumor regression in patients intentionally infected with pathogens responsible for erysipelas.4 Shortly thereafter in 1891, an American surgeon, William Coley, developed his cocktail of heat-killed bacteria that was used to treat sarcoma patients with remarkable success, including numerous documented cases of tumor regression following treatment.5 Although controversial during that period, Coley\u2019s observations have been validated by our modern understanding of cancer immunology and retrospective analyses.7While Jenner, Pasteur, and Koch established the early dogma of bacteriology and vaccinology, the study of immune modulation of cancer began with independent observations made by two German physicians in the mid-to-late 19th century focused primarily on infectious disease and the roles of innate immunity, the 20th century revealed much of what we now know about immunity and cancer. Only sixteen years following Coley\u2019s pivotal observations, Paul Ehrlich formulated a hypothesis that the high frequency of aberrant cell growth and transformation during human development is likely kept in check by \u201c[an] organism\u2019s positive mechanisms.\u201d8 Although unable to evaluate this experimentally, Ehrlich\u2019s \u201cpositive mechanisms\u201d roughly equated to the presence of an immunological surveillance mechanism actively engaging and eliminating neoplastic cells.9While the \u201cexperimental immunology\u201d era of the 1910 However, these malignant cells would simultaneously possess acquired, and highly specific neoantigens, evoking an immune response that could eliminate those malignant cells.11 Thomas supported a similar theory: that complex organisms evolved mechanisms to protect against malignancies using similar mechanisms that resulted in homograft rejection of transplanted tissues.12Roughly fifty years later, Ehrlich\u2019s proposition was independently revisited by both Australian, F. MacFarlane Burnet, and American physician, Lewis Thomas. Burnet believed heritable and acquired mutations in somatic cells undergoing abundant proliferation would push cells toward malignancy.13 A decade later, E. J. Foley, confirmed Gross\u2019 observations by demonstrating that chemically-induced tumors could be transplanted from one inbred mouse to another, and then subsequently removed, preventing further challenge with transplanted fragments of that same tumor.14In hindsight, Ludwik Gross had already evaluated this phenomenon experimentally just over a decade prior. Gross found that low doses of chemically-induced sarcomas could be resected and then transplanted into syngeneic mice leading to periods of tumor growth followed by gradual regression, suggesting an immune response to the tumor. Moreover, rechallenge with high doses of those same sarcomas resulted in outright rejection of tumors due to acquired immunity.16 Prehn and Main\u2019s series of experiments provided evidence that tumors indeed carried a unique antigen \u201csignature\u201d, resulting in tumor rejection by tumor-specific immunity.5Further experimental evidence for Ehrlich\u2019s immunosurveillance hypothesis was reported by Prehn and Main in the 1950s. In their studies, sarcomas induced with the chemical carcinogen MCA were transplanted into partnered syngeneic, na\u00efve mice. Further inoculation of these same mice with sarcomas from the original donors resulted in rejection, however, rechallenge with sarcomas from non-partnered mice resulted in engraftment. Moreover, transplantation of non-transformed skin tissues from the same sarcoma donor mice beforehand did not sensitize the recipient mice to sarcoma engraftment.17 explore mechanisms of antitumor immunity,19 and ultimately create immunotherapies to treat cancer.20 Those studies revealed T cells as primary mediators of cancer immunity and adoptive transfer of tumor-specific T cells isolated from tumors  as a potential therapeutic approach.21 However, several factors limit the use of TILs as immunotherapeutics, leading to synthetic biology approaches that employ genetically modified peripheral blood lymphocytes with antitumor specificity to potentially mimic TILs.22 That approach has evolved into the field of CAR-T cell therapy.These and other early \u201cimmunosurveillance\u201d studies provided the foundation of numerous investigators to search for immunosurveillance in humans,23 The production of CAR-T cells has been well documented but can be briefly summarized here. T cells are collected from a patient\u2019s blood via leukapheresis, genetically modified to express the CAR construct, expanded to large numbers ex vivo, and administered back to the same patient , leading to cytotoxic T-cell function and subsequent target cell death upon antigen recognition. patient .24 To be T cells . Natural T cells .Figure 26 The antibody-derived structure allows the CAR to recognize surface tumor antigens in their native form on tumor cells, without MHC molecules, stimulating production and release of cytotoxic granules and cytokines leading to target cell death.28 This is important because tumors can avoid immune surveillance by downregulating MHC molecules, which reduces antigen presentation and recognition of tumors cells.29 Bypassing antigen presentation eliminates an immune-escape tool from the tumorigenesis tool box and enables an important treatment option when a TAA is present.Importantly, CAR-T cells do not require APCs for their activation . Instead29 Initial 2nd-generation designs linked a costimulatory domain of either CD28 (28z) or 4\u20131BB (BBz) to CD3\u03b6 in the CAR construct.30 These designs have proven to be successful in treating hematological malignancies in patients and remain the only the FDA-approved CAR designs to date. The 3rd-generation CARs fuse both CD28 and 4\u20131BB to CD3\u03b6 (28BBz) and are hypothesized to produce long-lived and highly functional CAR-T cells, though a clear clinical benefit of this design over 2nd-generation designs has not yet been identified.30 The field of CAR design has expanded rapidly in the last five years, beyond the simple 1st, 2nd, 3rd generation paradigm. CAR-T cell designs may include constitutive or inducible cytokine production,31 cytokine signaling domains,32 and others. These are intended to improve T-cell activation, proliferation, effector function, longevity, resistance to the hostile tumor microenvironment, and more.First-generation CAR designs employed only CD3\u03b6 chain without additional costimulatory molecules. This design resulted in poor CAR-T cell longevity and efficacy leading to the inclusion of costimulatory domains in future CAR constructs.Currently, CAR-T cell therapy is approved for treating certain hematological malignancies, but not any solid tumors. Because CAR-T cell therapy involves administration of very large numbers of highly activated T cells, one of the biggest barriers to this therapy is successfully targeting an antigen to produce robust antitumor immunity without collateral on-target or off-target toxicity in healthy tissues. On-target toxicity to healthy B cells and the resulting B-cell aplasia that arises from CD19-directed CAR T-cell treatment of hematological cancers can be managed clinically, while toxicity to organ systems from other CAR-T cell therapies can be fatal. While no CAR-T cell therapies are FDA-approved to treat solid tumors, there are several clinical trials ongoing and a variety of targets being investigated to treat different gastrointestinal (GI) malignancies.33 While EpCAM is important for tumor cell survival it has been shown to reduce cell-to-cell adhesion by reducing E-cadherin, which increases cell motility leading to metastatic disease.34 Originally identified in colon cancer,35 overexpression of EpCAM has been observed in several different cancers and is, therefore, a potential target for CAR-T cell therapy.36 In preclinical trials a third generation EpCAM-targeting CAR-T cell was able to recognize and lyse target cancer cells in vivo, delay tumor formation and growth, and avoid inducing on-target, off-tumor toxicity.37 This CAR-T cell has since moved to Phase I clinical trials in patients with advanced gastric cancer with peritoneal metastasis (NCT03563326).38EpCAM is a transmembrane glycoprotein that is involved in proliferation and metastasis.39 While HER2 has traditionally been linked to breast cancer it is being investigated in various tumor types including GI cancers.40 For example, Bellicum Pharmaceuticals is currently investigating the efficacy of its dual-switch HER2-specific CAR-T cell to treat breast cancer and gastric cancer (NCT04650451).41 A unique aspect of this CAR-T cell therapy is that the activity of the T cells can essentially be eliminated using a \u201csuicide switch\u201d built into the CAR-T cells to treat or prevent toxicity.42 This is potentially critical reflecting the rapid toxicity and death of the first patient to receive a HER2-specific CAR-T cell therapy.43 A HER2-specific CAR-T cell clinical trial at Baylor Medical College is monitoring the efficacy of a CAR-T cell regimen to treat several different tumor types including gastric, colorectal, and esophageal cancer (NCT03740256).44 This CAR-T cell therapy is unique in that it incorporates an intratumoral oncolytic viral administration that enhances its efficacy in preclinical studies.45HER2 is a membrane tyrosine kinase that plays an important role in breast cancer progression and pathogenesis. HER2 is overexpressed in breast cancer cell, is an important prognostic indicator in breast cancer, and has been a major therapeutic target for several decades.46 CEA is expressed in adult gastrointestinal tissues, predominantly at the luminal surface.47 Moreover, CEA is a common TAA that is overexpressed in most colorectal tumors48 and detection in serum is a useful biomarker for monitoring colorectal cancer progression.46 While the role of CEA in tumor development or progression isn\u2019t clear, CEA can be a therapeutic target. A completed Phase 1 trial of CEA CAR-T cells showed some efficacy in many of the treated patients, while even the highest dose was well-tolerated by patients in this trial.49 That research group is currently recruiting for a Phase 2 clinical trial (NCT04348643).50CEA is a cell adhesion glycoprotein that is predominately expressed during fetal development.51 More importantly, this transmembrane protein is overexpressed in a variety of different cancer types and CAR-T cells targeting B7-H3 have shown positive results in treating pancreatic, ovarian, and brain cancers.53 Moreover, B7-H3 is overexpressed in esophageal cancer and CAR T-cell therapy effectively targets and treats esophageal squamous cell carcinoma (ESCC) xenografts in mice.54 Several B7-H3-directed CAR-T cell therapies are in early-phase clinical trials across a spectrum of adult and pediatric malignancies.B7-H3 (CD276) is a transmembrane protein and a member of the B7 family. This family of proteins is necessary for T-cell costimulation, while B7-H3 plays a predominantly inhibitory role in adaptive immunity, suppressing T-cell activation and proliferation.55 With all cancer targets, the goal is to target cancer cells while ignoring the same target on healthy cells. Claudin18.2 has proven to be a promising target because it is not only highly expressed in carcinomas, but also isolated from therapeutics in healthy tissue because it is embedded in gastric mucosa.56Claudin18.2, a splice variant of claudin 18, is part of a family of proteins that modulate the movement of molecules from cell to cell by interacting with tight junctions. While claudins are present in gastric, pancreatic, and lung tissue, claudin18.2 is specifically expressed in the stomach and, more importantly, it is highly expressed in gastric and gastroesophageal junction (GEJ) adenocarcinoma.57 This therapeutic has since moved to phase 1 clinical trials where it is being tested on patients with gastric and pancreatic cancer in both China (NCT04581473)58 and the US (NCT04404595).59While monoclonal antibodies have been the main approaches to treating claudin18.2+\u00a0tumors in the clinic, CAR-T cell therapy clinical trials have recently commenced. Preclinical data provided by CARsgen Therapeutics demonstrated that their claudin18.2-directed CAR-T cell therapy effectively targeted claudin18.2+\u00a0patient-derived xenograft (PDX) models of gastric cancer without toxicity.60 It has become an important target in colorectal cancer61\u201363 and recent data suggests that it can be targeted throughout the GI tract using a variety of approaches,65 including GUCY2C-directed vaccines.67 GUCY2C-directed CAR-T cells show efficacy69 and safety68 in animal studies of metastatic colorectal cancer, and PDX model data suggests potential efficacy against gastric and esophageal cancers.71 GUCY2C-directed CAR-T cell therapies are expected to enter clinical trials in 2022.While there are a variety of promising therapeutics currently in clinical trials, they are only the beginning for GI cancer therapies. Guanylyl Cyclase C (GUCY2C) is a transmembrane protein expressed on the luminal surface of intestinal epithelium.72 It is overexpressed and accessible to therapeutics in most epithelial cancers.73 There have been attempts to target MUC1+\u00a0tumors with CAR-T cells but there has not yet been any success in treating GI cancers. In addition to the above targets, there are many other potential targets for colorectal, gastric, and esophageal cancers in development, making it impossible to discuss them all here.MUC1 is another potential CAR-T cell target that has shown promise in targeting GI cancers. MUC1 is an adhesion ligand for stromal and endothelial cells and plays an important role in cancer metastasis.The study of immunology has been an evolving field for centuries. Primitive as it was, the initial principles of immunology were created centuries ago and led to the development of vaccines and eradication of life-threatening illnesses. Furthermore, it was these initial principles that not only led to prevention and treatment of bacterial and viral infections, but also discoveries in cancer treatment. It was discovered decades ago that tumor cells possess tumor-specific signatures that can be recognized by the host immune system leading to tumor rejection. Those and other observations laid the foundation for modern cancer immunotherapy.T cells are critical mediators of natural antitumor immunity which can be leveraged by TIL therapy or immune checkpoint blocking (ICB) therapy, such as antibodies directed against PD-1/L1 and CTLA-4 that established cancer immunotherapy as a pillar of cancer care a decade ago. CAR-T cell therapies go a step farther using a synthetic biology approach to create tumor-directed T cells, rather than rely on endogenous immunity. While there is enormous enthusiasm for this technology, significant work is required to create and identify therapies with sufficient efficacy and acceptable toxicity . Perhaps one or more of the strategies discussed here will become the first to meet those goals and become the first FDA-approved CAR-T cell therapy for GI cancers."}
+{"text": "E.coli RecQ helicase as a model system, and various conformationally defined DNA lesions, the unwinding rate constants obsk = U + kDk, and processivities P = (kU/(kU + kD) were determined . The highest obsk values were observed in the case of intercalated benzo[a]pyrene (BP)-derived adenine adducts, while obsk values of guanine adducts with minor groove or base-displaced intercalated adduct conformations were ~10\u201320 times smaller. Full unwinding was observed in each case with the processivity P = 1.0 (100% unwinding). The obsk values of the non-bulky lesions T(6\u22124)T, CPD cyclobutane thymine dimers, and a guanine oxidation product, spiroiminodihydantoin (Sp), are up to 20 times greater than some of the bulky adduct values; their unwinding efficiencies are strongly inhibited with processivities P = 0.11 (CPD), 0.062 (T(6\u22124)T), and 0.63 (Sp). These latter observations can be accounted for by correlated decreases in unwinding rate constants and enhancements in the helicase DNA complex dissociation rate constants.DNA helicase unwinding activity can be inhibited by small molecules and by covalently bound DNA lesions. Little is known about the relationships between the structural features of DNA lesions and their impact on unwinding rates and processivities. Employing  E. coli RecQ helicase, which unwinds double-stranded DNA with a 3\u2032\u21925\u2032 polarity by an ATP-driven inchworm mechanism pyrene (BP), also found in human tissues pyrene, known as (+)-or (\u2212)-anti-BPDE) was originally obtained from the National Cancer Institute Chemical Carcinogen Repository.Recombinant anti-BPDE with the oligonucleotide 5\u2032-d(CCATCXCTACC) with X = dG or dA. The diol epoxides BPDE react with purines by cis- or trans-addition of the exocyclic amino groups of guanine or adenine to the C10 carbon atom of BPDE (The bulky DNA adducts  were der of BPDE . The modThe thymine dimer (CPD) and the pyrimidine(6\u22124)pyrimidone T(6\u22124)T lesions were generated by UV irradiation of the oligonucleotide 5\u2032-d(GCAAGTTGGAG) in aqueous solutions. The oligonucleotide sequences containing the different photoproducts were separated from one another by HPLC methods and further purified by gel electrophoresis, as described earlier .26CCGGTAGCGATGGATGCCTGC-BHQ2 (Black Hole Quencher) by heating the solution at 90 \u00b0C for 5 min, followed by slow cooling to room temperature overnight to form the forked DNA substrates. We designed this forked DNA duplex with a short 10 nucleotide-long 3\u2032-overhang that can accommodate a single RecQ molecule13.The 32-mer helicase-translocating sequences  containi2, 2 mM DTT, 5% glycerol, and 0.1 \u03bcg/\u03bcL bovine serum albumin) using two manually driven syringes connected through a T-mixer to a quartz cell (3 \u00d7 3 mm). In typical experiments, equal volumes (50 \u03bcL) of a solution containing the forked DNA substrate and ATP (2 mM) in the first syringe were combined with a solution in the second syringe that contained the RecQ helicase. The time-dependent increase in the fluorescence intensity was monitored by a Photon Technology International Spectrofluorometer .The RecQ helicase-catalyzed DNA unwinding kinetics were monitored in real time by a fluorescence method . The forThe fluorescence of the Cy3 dye was selectively excited with a green diode laser  and the fluorescence emission was registered at 564 nm by a PC-interfaced photomultiplier (resolution 200 ms/point). The monitoring of the fluorescence signal was initiated within ~1 s after the flow-mixing of the reagents.Unwinding of the double-stranded DNA substrates results in the formation of free single-stranded oligonucleotides. At the 5 nM DNA concentrations used in most of this work, the re-annealing of Cy3- and BHQ2 single-stranded oligonucleotides was negligible on the time scale of our experiments .The fluorescence intensity corresponding to fully unwound DNA was measured independently in each unwinding experiment by subjecting an aliquot of the same DNA solution to formamide that resulted in the full unwinding of the double-stranded DNA.anti-BPDE to the exocyclic amino groups of guanine in DNA, each characterized by remarkable differences in adduct conformations, are shown in The effects of non-covalently bound small inhibitors on helicase activities have been extensively studied ,11. Howeobsk using unmodified DNA as a benchmark. We provide novel insights into (1) the magnitudes of helicase unwinding rates and processivities using sets of bulky and non-bulky DNA lesions as substrates, and (2) the relationships between the conformational and structural features of DNA lesions, and their impact on the helicase unwinding rate constants and processivities. The objective of this study was to determine the impact of a variety of conformationally distinct DNA lesions on the unwinding of double-stranded DNA catalyzed by the helicase RecQ [In this work, we used kinetic methods to determine the shapes of the unwinding curves and the unwinding rate constants ase RecQ . In the obsk is affected by two factors, the association rate constant for complex formation between RecQ and the DNA substrate (rate constant ak), and the unwinding processivity. The latter is defined as the probability that a helicase will successfully complete an unwinding step instead of dissociating from the DNA substrate [Analysis of the unwinding kinetics suggests that the apparent unwinding rate constant ubstrate ,9.obsk by fitting the experimental data points to the standard exponential equation [tot is the overall concentration of DNA molecules with or without lesions. Typical unwinding curves with unmodified forked DNA substrates (5 nM) at four different RecQ concentrations (5\u201330 nM) are shown in Following the injection of ATP into a pre-mixed helicase\u2013unmodified DNA solution with concentrations in the nanomolar range, a rapid burst phase is observable that is attributed to pre-existing helicase DNA complexes as described earlier ; this buequation :ssDNA(t)obsk were determined from the best fits of Equation (1) to the second, slow phase (red lines) superimposed on the experimental data points.The pre-steady state, single turnover kinetics of unwinding of double-stranded DNA by RecQ, was extensively studied by Zhang et al. . They shobsk increase linearly as a function of RecQ concentration (ak = (8.8 \u00b1 0.4) \u00d7 105 M\u22121s\u22121. The rate constant obsk depends on the bimolecular encounter rate constant ak and the processivity P according to the equation [The values of ntration , thus inequation :kobs = kCRecQ, and the observed unwinding rate constant obsk is defined as (kU + kD) [Uk and kD, respectively [The protein concentration is denoted by kU + kD) . The unwectively .p that a helicase will successfully advance by one step to unwind the next set of base pairs, instead of dissociating from the DNA molecule. The probability of unwinding per bimolecular encounter is defined by the ratio p = kU/(kU + kD) for each step. In the case of n-steps, the overall probability of fully unwinding a double-stranded DNA sequence is a product of individual probabilities:P derived from plots of the fractions of unwound ssDNA products as a function of reaction time, can level off at a value of less than 1.0 if any single pn value in Equation (3) is less than 1.0 for any of the steps in the double-stranded region. The presence of a DNA lesion in any of the n-steps will thus lower the overall processivity. The validity of Equation (3) was demonstrated experimentally using unmodified DNA substrates with double-stranded DNA sequences of different lengths [Adedeji et al.  consider lengths . In our obsk values were calculated from the best fits of Equation (1) to the experimental data points. The reported obsk values represent averages of three independent measurements.Typical examples of the impact of the bulky DNA lesions on RecQ-catalyzed unwinding kinetics are shown in the following figures. These experiments were conducted at concentrations of 5 nM DNA substrate and 5 nM RecQ, which correspond to the concentrations of the unmodified DNA experiment shown in Except for the BP-A:T duplexes, none of the other BP-modified DNA samples exhibited burst signals at these low RecQ concentrations (5 nM).N6-amino group of adenine. The modified adenine residue is paired with T in the opposite DNA strand, and the BP aromatic ring system assumes an intercalative conformation without displacement of the modified adenine and is also flanked by normal undistorted base pairs on both sides [syn-glycosidic conformation instead of the normal B DNA anti conformation, which weakens the BP-A:T base pairing at the site of the adduct. However, a less abundant anti conformation was also detected, which suggests that the major syn-conformer exists in equilibrium with a minor anti-conformer [The BP-A adducts are derived from the binding of the BPDE residue to the exocyclic th sides . The BP-onformer . This cotrans-BP-A:T adduct is the least DNA helix-distorting adduct as compared to all the guanine BP-G:C adducts studied in this work. Consistent with these physical properties, analysis of the (+)-trans-BP-A:T duplex unwinding curve  \u00d7 10\u22124 s\u22121; this value represents a moderate ~50% reduction relative to the unmodified DNA obsk value of (49.0 \u00b1 1) \u00d7 10\u22124 s\u22121 at the same RecQ and DNA concentrations (The (+)-ng curve  yields ttrations A.anti-syn interconversion detected by NMR methods suggests that the flexible conformations characterizing the BP-A adduct may enhance the successful bypass of the (+)-trans-BP-A:T adduct by the RecQ helicase, thus enhancing the magnitude of obsk.The trans- and (\u2212)-trans-BP-G adducts are attached to the exocyclic N2-amino group of guanine (G) but with opposite orientations [The polycyclic aromatic ring systems of the (+)-ntations ,21 relatobsk values are (1.22 \u00b1 10\u22124) s\u22121 (\u2212)-trans-, and (2.91 \u00b1 0.1) \u00d7 10\u22124 s\u22121 (+)-trans-BP-G:C duplexes.The kinetic unwinding curves for these two duplexes are shown in trans-adduct causes a stronger and significantly more flexible DNA bend than the (\u2212)-trans adduct which is more rigid [trans-BP-G-C and the greater conformational flexibility of the (+)-trans-adduct are correlated with the ~two-fold greater unwinding rate constant associated with the (+)-trans-BP-G:C adduct (trans/(\u2212)-trans product ratios after fixed incubation time intervals [It was shown earlier that the (+)-re rigid ,30. The C adduct . The higntervals .cis-BP-G:C adduct is characterized by a base-displaced intercalative conformation (The (+)-ormation  with theobsk value of the (+)-cis-BP-G:C duplex is 1.42 \u00b1 0.22 s\u22121, which is close to the (\u2212)-trans-BP-G:C value of obsk = 1.22 \u00b1 0.1 s\u22121. These two adduct conformations are stereochemically related since both are characterized by absolute R stereochemistry about the BP-deoxyguanosine linkage site. This means that in both cases, the BP aromatic ring systems are positioned on the 3\u2032-side of the modified guanine residues which sterically hinder the progress of the RecQ helicase translocating in the 3\u2032\u2192 5\u2032 direction. The unwinding curve is shown in in vivo and, if not removed by cellular DNA repair systems, can contribute to mutagenesis [trans-G:C duplexes, in G:Del duplexes the same adducts are fully intercalated between adjacent base pairs without displacement of the modified guanine residues from their usual positions [Deletion duplexes (Del) are identical to the full duplexes discussed up till now, except for the deleted canonical Watson\u2013Crick C nucleotide opposite the BP-G modified guanine residue (abbreviated as G:Del). The Del duplexes containing DNA lesions occur agenesis ,33. In cositions ,34.obsk value of the (+)-trans-BP-G:Del adduct (4.33 \u00b1 0.21) \u00d7 10\u22124 s\u22121 -trans-BP-G:Del adduct, the (\u2212)-trans-BP-G-Del kobs value is (8.35 \u00b1 0.6) \u00d7 10\u22124 s\u22121, which is ~seven times greater than the (+)-trans-BP- G:C kobs value.The 10\u22124 s\u22121  is modestrans-BP-G:C duplexes that are thermodynamically less stable [obs.kThis change is consistent with the minimal structural distortions of the G:Del duplex that is characterized by, a thermodynamically stabilized intercalative conformation , in conts stable . It is rcis-BP-G:Del adduct, the BP aromatic ring system remains intercalated as in the (+)-cis-BP-G:C duplex [cis-BP-G:Del duplex resemble those of the full (+)-cis-BP-G:C duplex [In the case of the (+)-C duplex . The strC duplex . The BP obsk values from 1.42 \u00b1 0.22 s\u22121 in the full (+)-cis-BP-G:C duplex, to 5.99 \u00d7 10\u22124 s\u22121 in the (+)-cis-BP-G:Del duplex -cis-BP-G:C duplex, except for the absence of the cytosine in the (+)-cis-BP-G:Del duplex. Indeed, the only apparent difference between the full (+)-cis-BP-G:C duplex and the (+)-cis-BP-G:Del duplex is the presence of the displaced cytosine positioned in the major groove of the full (+)-cis-BP-G:C duplex [cis-BP-G:Del duplex. The structural features of the (+)-C duplex . This orobsk values of all DNA adducts discussed up till this point are compared to one another in In summary, the S stereoisomer) is an oxidation product of 8-oxoguanine in DNA [obsk value determined from the Sp unwinding curve T lesion is significantly distorted with the two cross-linked thymine bases oriented with their planes perpendicular to one another; the helix is bent by 44\u00b0, and hydrogen bonding is absent at the 3\u2032-flanking base pair [obsk values of the CPD and T(6\u22124)T lesions are (24.6 \u00b1 1) \u00d7 10\u22124 and (21.2 \u00b1 2) \u00d7 10\u22124, respectively -trans-BP-A:T and BP-G:C adduct duplexes. In the case of CPD, P = 0.11, and only 0.062 in the case of the T(6\u22124)T lesion -T lesion .These observations suggest that the altered chemical structures of these three non-bulky lesions and the associated structural distortions of one (Sp), or two nucleobases (CPD and T(6\u22124)T), dominate the mechanism of inhibition.P = U/kobks, and obks = Uk + Dk, a decrease in Uk must be accompanied by a proportional increase in Dk since the obsk values remain constant. The strong reductions of the P values, but not the unwinding rate constants ). The unwinding rate constants (kobs) are not significantly smaller than the rate constants associated with the bulky DNA lesion, including the (+)-trans-A:T duplex. It is noteworthy that P decreases in value in the case of the non-bulky DNA lesions, while the obsk values do not change significantly. These results can be explained by considering that a decrease in Uk means that the residence time of the helicase bound to its DNA substrate becomes longer. In turn, the longer residence time suggests that the probably of dissociation of the helicase per step must also increase, thus leading to an increase in Dk, and a lower processivity P. Thus, there is a correlation between decreasing Uk and increasing Dk values in this case.The processivity is defined as the probability that a helicase will proceed to the next unwinding step rather than dissociating from the DNA. Since the processivity onstants , are dueUk rate constants of the two UV photolesions may be due to the fact the helicase needs to bypass two nucleotides rather than only one in the case of Sp and the bulky DNA adducts. In the case of the bulky polycyclic aromatic adducts, the same phenomenon does not manifest itself, possibly because of non-covalent Van der Waals interactions between the helicase and bulky polycyclic aromatic ring systems that diminish the helicase dissociation rate constant Dk. In the case of Sp, such interactions are most likely minimal because of its non-aromatic nature and small bulk . In the case of the adenine adduct, intercalation of the bulky BP polycyclic aromatic ring system does not strongly disrupt either base pairing or the normal B-DNA structure; the unwinding rate constant is diminished by a factor of ~two only, relative to unmodified DNA.The unwinding rates of double-stranded DNA catalyzed by the 3\u2032 \u2192 5\u2032 translocating P = 1.0).In the case of the bulky guanine adducts (BP-G:C), the BP aromatic ring system adopts two types of adduct conformations: minor groove, or intercalation with displacement of the modified guanine and partner C residues into the major or minor grooves of B-DNA. The strong distortions of the normal B-DNA conformations in both cases result in up to ~50-fold decreases in unwinding rate constants. However, all BP-G:C duplexes, regardless of BP-G:C adduct conformation, can be fully unwound (processivity ^T and T(6\u22124)T (kobs) are mostly and significantly greater than the rate constants associated with most of the bulky DNA adducts T . However adducts . Helicas"}
+{"text": "The elderly population in China is continuously increasing, and the disabled account for a large proportion of the elderly population. An effective solution is urgently needed for incontinence among disabled elderly people. Compared with disposable adult diapers, artificial sphincter implantation and medication for incontinence, the defecation pre-warning method is more flexible and convenient. However, due to the complex human physiology and individual differences, its development is limited. Based on the aging trend of the population and clinical needs, this paper proposes a bowel sound acquisition system and a defecation pre-warning method and system based on a semi-supervised generative adversarial network. A network model was established to predict defecation using bowel sounds. The experimental results show that the proposed method can effectively classify bowel sounds with or without defecation tendency, and the accuracy reached 94.4%. After entering the 21st century, the problem of aging population in the world is becoming increasingly prominent. Studies show that, by 2050, the number of people over 80 years old in the world will increase rapidly from 69 million in 2010 to 379 million [Disabled seniors are those who have lost the ability to take care of themselves. Incontinence is a painful experience for the elderly. First of all, complications, such as urine leakage  odor andFor the families of patients, incontinence will bring many difficulties to the nursing work of the disabled elderly and increase the economic burden of the family. In the near future, how to properly take care of the disabled elderly is a problem that almost every family will face. For the above reasons, the incontinence of the disabled elderly has become a problem that needs to attract the attention of society as a whole, and a simple and effective solution is urgently needed.With the improvement of living standards and the development of medical technology, researchers have proposed some measures to solve the incontinence problem of disabled elderly, which can be roughly divided into the following three methods.Disposable diapers and incontinence pads are often the first choice for incontinence patients. The proper use and timely replacement of incontinence pads can minimize the risk of skin odor and leakage and make life more comfortable for the disabled elderly. Disposable diapers and incontinence pads were first used in nursing homes in the United States in the 1980s , followeIn order to achieve reuse, Kim et al.  inventedSecondly, some doctors use drugs to treat incontinence. Bliss et al.  found anFor patients with severe incontinence, surgical treatment is an option after attempts at nonsurgical treatment have failed. Srinivas et al. proposed in the literature  that SphIn the past, when researchers solved the problem of fecal incontinence in elderly disabled patients, almost all of them focused on how to improve the treatment methods after the incontinence, and few studied how to solve the problem before the incontinence. In this paper, we attempted to find a way to predict the time of fecal excretion to predict fecal incontinence. In this paper, a method is proposed to predict the defecation time by monitoring the changes of bowel sound signals before and after defecation, as shown in As a universal phenomenon, bowel sounds have attracted people\u2019s attention for a long time. Farrar et al.  were theBowel sounds were chosen for two reasons. The first reason is that Saito et al. , in theiThis detection of bowel sounds is non-invasive, low-cost and painless. Dalle et al.  proposedDu et al.  realizedChing et al.  used an Turk et al.  proposedIncontinence is divided into fecal incontinence and urinary incontinence. This paper mainly studies the early warning methods of fecal incontinence (FI). In order to realize the early warning of defecation in the disabled elderly, we study and propose a pre-warning algorithm of defecation in the disabled elderly based on a semi-supervised generative adversarial network.Goodfellow et al.  proposedAt present, SSGAN has particularly outstanding performance in fault diagnosis , image cWe integrated a physiological signal acquisition system, which can collect three kinds of signals, such as bowel sounds, gastric electrical signals and ECG signals. In order to ensure the authenticity and authority of the experimental data, we collected data from Beijing Bo\u2019ai Hospital and South China University of Technology. The former is affiliated with the China Rehabilitation Research Center. All data were collected with the knowledge and consent of the volunteers.The physiological signal acquisition system can collect bowel sounds, gastric electrical signals, and ECG signals. The sensor for collecting bowel sounds is a Littmann 3200 electronic stethoscope (hereinafter referred to as the 3M stethoscope) manufactured by the 3M company . It is a piezoelectric stethoscope with a sampling frequency of 4 kHz, which can convert sound energy into electrical signals and record them  as shownIn this paper, the membrane filter built into 3M stethoscope was selected, which can amplify the sound of 20\u20132000 Hz and strengthen the sound of 100\u2013500 Hz. This is consistent with the frequency characteristics of bowel sounds and helps to collect bowel sounds. The sensors for collecting gastric and ECG signals are Biosignalsplux\u2019s four-channel sensors with a sampling frequency of 3 kHz. Each sensor collects EMG signals through three electrodes attached to the human body and transmits the collected information to an industrial control computer via Bluetooth. The three electrodes are positive, negative and reference electrodes, respectively.Industrial control computers are used to process the collected physiological signals. The data processing program was developed by Microsoft Visual Studio, which can realize automatic data collection and saving. After the pre-warning model is trained, the physiological data collected can be input into the model in real-time for classification.Among the three collected signals, the bowel sound data was selected as the experimental data in this study, and other data will be studied in the future.The abdomen of the human body is not a hollow cavity but is filled with soft tissue. The density of these soft tissues is also not completely uniform. Therefore, we considered two problems when collecting bowel sounds. One is that there is a sound delay between the source of bowel sounds and the sensor, and the other is that bowel sounds may be absorbed by soft tissue, thus, affecting the waveform.Peter et al.  mentioneThe period from the time when rectal dilatation exceeds the threshold to the time when defecation begins is the time period for collecting fecal bowel sounds in this study. The bowel sounds are caused by compressed feces and bubbles bursting between the contents of the rectum; thus, the stethoscope should collect data close to the rectum. After turning into feces, food debris moves through the large intestine at a rate of about 5 cm per hour and finally slowly enters the rectum from the sigmoid colon, which is on the left side of the rectum  as shownThe original bowel sounds signal is a one-dimensional time series. With the development of bowel sound collection and recording equipment, some common speech signal processing and fault diagnosis processing methods have been applied to bowel sounds processing. As early as 1975, Dalle et al.  adopted Gary et al.  summarizG and discriminator D, which is an application of zero-sum game theory. In the process of training the network, random noise is fed into generator G to produce output that looks like real data or a picture. The task of the discriminator is to distinguish the generated sample from the real sample and feed the discriminant result back to the generator.Goodfellow et al.  proposedD cannot judge whether the input is generated data or real data. The purpose of the discriminator is to continuously improve the discriminant ability to separate the generated data from the real data. This is the basic principle of GAN, and the above process can be expressed mathematically asx is real data; z is random noise of the input; The training process of GAN is to use the discriminant results of the discriminator to guide the training of the generator, whose purpose is to learn the distribution of real data and generate real data or images, so that D to full-connection layer output and the number of neurons from 1 to K + 1. K represents the number of data types in the training set, and the extra 1 corresponds to the data generated by generator G. In other words, discriminator D is changed into classifier C as shown in In the development of GAN, Springenberg et al.  proposedSSGAN has had some successful applications in image processing and signal processing. Han et al.  proposedG as unlabeled data and modified the discriminator into a classifier, thus, solving the two problems of insufficient data and data classification. Li et al. [Trinh et al.  proposedi et al.  proposedIn this paper, a defecation pre-warning algorithm based on a semi-supervised generative adversarial network (SSGAN) is proposed for the disabled elderly in bed. A real-time collection of bowel sounds was used to determine whether the volunteers wanted to defecate. The data collected by the stethoscope were divided into labeled training samples and unlabeled test samples. We used the labels 0 and 1, where 0 means \u201cdo not want to defecate\u201d and 1 means \u201cwant to defecate\u201d.G and classifier C.\u201cDo not want to defecate data\u201d refers to the bowel sounds collected during the time period when the subject has no desire to defecate after eating for at least one hour, labeled 0. If the subject felt a desire to defecate and successfully defecated within 15 min of collecting the bowel sound signal, the data were considered as \u201cwant to defecate\u201d and labeled as 1. Bowel sounds in the training set and test set were not duplicated, and all samples in the test set were unlabeled. The SSGAN structure designed in this study consists of two parts\u2014namely, generator The detailed structure and parameters of SSGAN are shown in Classifier C is improved from discriminator D in original GAN. The last layer of D is sigmod function, which outputs the numbers from 0 to 1 and can only distinguish true and false data. The last layer of C is the Softmax function, and the full connection layer has K + 1 neurons. In this paper, K is 2\u2014that is, the classifier divides the data into three categories .K after passing through softmax layer. The probability that the first class K are all true data. K = 2.Compared with the original GAN, the generator of SSGAN used in this paper has not changed; however, discriminator D is changed into classifier C. Therefore, this paper only needs to define the loss function of classifier C, which consists of the loss of supervised learning and the loss of unsupervised learning . The forThe hyperparameters will affect not only the training time of the model but also the classification accuracy of the model . ChoosinHowever, if the raw data is divided too finely to show the complete information of a bowel sound, the classification results will be meaningless. Finally, we found that the best results were obtained by dividing the data into a size of 10,000. See The generator is built from the architecture shown in The classifier is built from the architecture shown in The output of the last convolution layer is then fed into the full connection layer. The activation function of the final classification layer is Softmax, which has three neurons. The data were divided into three categories: fake data, with or without defecation tendency.To verify the effectiveness of the proposed method, we constructed a bowel sounds dataset. The data were collected at Beijing Bo\u2019ai Hospital and South China University of Technology, and all volunteers were informed and consented to our work. The data set included bowel sounds from 15 volunteers aged 23 to 70 years. They were not taking any drugs that affected bowel motility in the recent period of data collection. Before collecting the bowel sounds data, the hair on the patient\u2019s abdomen was cleaned and they laid down in a quiet environment to avoid noise and environmental noise caused by hair friction.A 3M electronic stethoscope was fixed on the lower right side of the volunteers\u2019 abdomen with medical tape The sampling frequency of the 3M stethoscope was 4 kHz, and the time of one sampling was 60 s. The length of data collected at one time was 240,000 \u00d7 1. If such long original data are directly placed into a one-dimensional convolutional neural network for training, many convolutional layers are required, resulting in a slow training speed and slow network convergence. In this experiment, 240,000 1 bowel sounds data of 1 min were segmented, and the size of the segmented data was 10,000 and labeled. Normal bowel sounds were labeled 0, and bowel sounds before defecation were labeled 1.In order to verify the effectiveness of the proposed method, three typical methods are selected for comparison. Trinh et al.  used CNNTo evaluate the performance of the proposed SSGAN method, a set of comparative experiments were designed. Six different test sets were placed into four models for classification. The data was processed with FFT before entering the network. The Adam optimization method was adopted. In network training, the batch size was set to 10. There were 200 data samples in each test set. Data before defecation was harder to collect, and thus there were fewer defecation data in the test set\u2014only 60. The classification accuracy of the six test sets in the four models is shown in It can be seen that on different test sets, the classification effect of the proposed method is superior to the three comparison methods. Our results confirm the feasibility of using SSGAN classification method. It should be noted that SSGAN\u2019s classification accuracy was 0 at the beginning. This is because it classifies all the data as fake data generated by the generator. It can be seen that the classification accuracy of the other three methods is not ideal in the training process. The proposed method based on SSGAN had high classification accuracy and stable effect. Since the test set in this paper is an unbalanced data set, the specificity and sensitivity indexes of the method proposed in this paper were calculated, and the results are shown in As shown in The experimental results show that the proposed method can effectively classify two bowel sounds with or without defecation tendency. A 3M electronic stethoscope was used to collect data in Beijing Bo\u2019ai Hospital. In fact, the bowel sounds classification network proposed is based on SSGAN, which can learn the characteristics of the data of different labels. A warning can be given when bowel sounds are detected in the application with a category of 1 (with defecation tendency). This has broad application prospects in the field of health care for the disabled elderly.Although the method proposed in this paper achieved a good classification effect in the experiment, it has some limitations. First, the signal must be acquired without noise interference, as noise can degrade the data quality. Second, the amount of bowel sounds before defecation is not particularly sufficient. In the future, we plan to improve the above two aspects by using filtering and data enhancement methods. At present, using deep learning to enhance small sample data is a popular direction.Incontinence among the disabled elderly is one of the challenges of population aging. In the health care of the disabled elderly, it is necessary to solve the problem of incontinence. In this paper, an early warning method of defecation based on SSGAN was proposed. By using the proposed method to process data and train networks, a strong robustness classification network was obtained. Based on the proposed method, we conducted a comparative experiment on the classification effect of different bowel sound datasets. The experimental results showed that the proposed method effectively classified bowel sounds as with or without defecation tendency.The proposed method is superior to the comparison method in classification accuracy. This shows that the method proposed in this paper is correct and feasible for the pre-warning of defecation in the disabled elderly, which is meaningful for their health care. The method proposed in this paper can effectively aid in the incontinence problem of the disabled elderly. Moreover, real-time monitoring can be performed, which provides a good possibility for reducing the burden of nurses and assisting doctors in treatment."}
+{"text": "Hypertension, a well-known risk factor, contributes to millions of deaths from cardiovascular and renal diseases worldwide. However, evidence on the association between frequency of dairy product consumption and hypertension is inconsistent.The data for the present study are from the Tongxiang baseline dataset of the China Kadoorie Biobank prospective study. A total of 53,916 participants aged 30\u201379\u00a0years were included in the final analysis. Multivariable logistic regression was utilized to evaluate the association of dairy product consumption with hypertension, and multiple linear regression was conducted to assess the association of dairy product consumption with systolic and diastolic blood pressure.Ptrend\u2009=\u20090.001), and for women were 0.88 (0.76\u20131.01) and 0.77 (0.65\u20130.91), respectively. (Ptrend\u2009<\u20090.001).Of the 53,916 participants, 2.6% reported consuming dairy products weekly, and 44.4% had prevalent hypertension. After adjusting for socio-demographic status, lifestyle factors, BMI, waist circumference, sleep duration and snoring, when compared with participants who never consumed dairy products, the odds ratios (95% CI) for hypertension among those consuming dairy products less than once per week, and\u2009\u2265\u20091 time per week were 0.85 (0.77\u20130.95) and 0.74 (0.65\u20130.84), respectively. The corresponding odds ratios (95% CI) for men were 0.85 (0.71\u20131.02) and 0.75 (0.61\u20130.92), respectively (In this large epidemiological study, higher frequency of dairy product consumption is associated with significantly lower odds of hypertension among Chinese adults.The online version contains supplementary material available at 10.1186/s12986-022-00703-2. Hypertension, along with pre-hypertension and other hazardously high levels of blood pressure, account for 8.5 million deaths from cardiovascular and renal diseases worldwide , 2. DespDairy products, abundant in nutrients such as protein, calcium, and vitamins , are amoDairy products represent a heterogeneous food group of solid, semi-solid and liquid, fermented or non-fermented foods, each differing in nutrients such as fat and sodium . FurtherOver past decades, the effects of dairy product consumption on chronic non-communicable diseases and other conditions, including cardiovascular disease, metabolic disorders, diabetes and cancers have been studied \u201315. WhilPrevious studies examining the association between dairy product consumption and hypertension provided inconsistent results. Several observational studies indicated that dairy product consumption was inversely associated with systolic blood pressure and the risk of hypertension \u201319. HoweDetailed information about the CKB study design, survey methods and participant characteristics has been reported previously \u201325. The All participants were required to avoid eating, drinking alcohol, smoking, and exercising for at least 5\u00a0min before taking measurements. Blood pressure was measured on the unclothed right upper arm, in a seated position at least twice using an Omron UA-779 digital sphygmomanometer. Two measurements were undertaken with a 5-min interval between measurements. If the first and second systolic blood pressure (SBP) measurements differed by\u2009>\u200910\u00a0mmHg, a third measurement was conducted and the last two measurements recorded. The average of the last two readings was utilized for analyses .Prevalent hypertensive individuals were defined as those with at least one of the following: (1) measured SBP\u2009\u2265\u2009140\u00a0mmHg, and/or measured diastolic blood pressure (DBP)\u2009\u2265\u200990\u00a0mmHg; (2) previous doctor-diagnosed hypertension; or (3) use of antihypertensive medication .Frequency of dairy product consumption was assessed through the question \u201cDuring the past 12\u00a0months, about how often did you eat dairy products ?\u201d. Answer options included: \u201cDaily\u201d, \u201c4\u20136\u00a0days/week\u201d, \u201c1\u20133\u00a0days/week\u201d, \u201cMonthly\u201d, and \u201cNever/rarely\u201d . In analyses, those who chose \u201cDaily\u201d, \u201c4\u20136\u00a0days/week\u201d or \u201c1\u20133\u00a0days/week\u201d were combined into one group .A study comparing the CKB dietary questionnaire with a 12-day 24-h dietary recall (the gold standard) among 432 CKB participants estimated adjusted Spearman coefficients and weighted kappa coefficients for dairy product consumption of 0.47 and 0.75, respectively. The reproducibility of dairy product consumption was tested twice, and the corresponding figures were 0.39 and 0.82, respectively .A laptop-based questionnaire collected data on socio-demographic characteristics , behavioral lifestyle factors , personal and family medical history, and menopause status in women.Participants were categorized into four groups based on their smoking  behaviors: non-smokers (or non-drinkers), former smokers (or former drinkers), occasional smokers , and current smokers (or current drinkers) , 30. Tot2 [Physical measurements were conducted using calibrated instruments by qualified health workers. Standing height was measured to the nearest 0.1\u00a0cm with the participant standing erect in bare feet. Weight was measured to the nearest 0.1\u00a0kg using the TBF-300 body composition analyzer . Body mass index (BMI) was calculated as weight in kilograms divided by the square of standing height in meters, and obesity was defined as BMI\u2009\u2265\u200925.0\u00a0kg/m2 . WC was 2 . A non-fS) were adjusted for age (continuous) and sex. Model 2 included additional adjustment for educational attainment  and income . Model 3 included additional adjustment for smoking status , drinking status , physical activity (continuous), meat and fruit intake (daily and non-daily), BMI (continuous), WC (continuous), snoring  and sleep duration (continuous). Multiple linear regression analyses were conducted to evaluate the associations of frequency of dairy product consumption with SBP and DBP. In sensitivity analyses, 6 868 participants with self-reported physician-diagnosed hypertension were excluded from the analyses. Stratified analyses by age , educational attainment , household income , physical activity , smoking status , alcohol status , meat consumption , fruit consumption , BMI , WC , sleep duration , or menopause status  were also performed. In addition, since the prevalence of hypertension was high among the current study population, Poisson regression models with robust variance were fitted to assess the associations of frequency of dairy product consumption with hypertension, yielding prevalence ratios (PRs) instead of ORs. Statistical significance was set at P\u2009=\u20090.05.SAS version 9.4 was used for all statistical analyses. To ascertain the association between frequency of dairy product consumption and odds of prevalent hypertension, univariate and multivariable logistic regression analyses were utilized. Participants who never consumed dairy products comprised the reference group. Potential confounding factors, including socio-demographic status and lifestyle factors were adjusted for in different models. In model 1, odds ratios (OR2 and a mean WC of 76.5 (SD 9.1) cm. Around 58% were women, 28% were current smokers, 17% were current drinkers, 15% consumed meat daily, 7% consumed fruit daily, and 24% were habitual snorers. Those with higher frequency of dairy product consumption were more likely to be young, female, well-educated, wealthy, to consume meat and fresh fruit frequently, and to sleep for a longer duration. They were less likely to smoke cigarettes, be physically active, or be habitual snorers. There were no significant differences in BMI (P\u2009=\u20090.081), WC (P\u2009=\u20090.26) or drinking status (P\u2009=\u20090.05) according to frequency of dairy product consumption. Among the 53,916 participants, 44.4%  had prevalent hypertension, and the separate corresponding figures for men and women were 47.3%  and 42.2% , respectively. Overall, 94.1%, 3.3%, and 2.6% of participants consumed dairy products never, monthly, and weekly, respectively  years and had a mean BMI of 22.9 SD 3.1) kg/m kg/m2 anPtrend\u2009=\u20090.001), and for women were 0.88 (0.76\u20131.01), and 0.77 (0.65\u20130.91), respectively (Ptrend\u2009<\u20090.001)  for hypertension among individuals consuming dairy products less than once per week, and\u2009\u2265\u20091 time per week were 0.83 0.75\u20130.92), and 0.70 (0.62\u20130.78), respectively. After further adjustment for other covariates, including education level, household income, cigarette smoking, alcohol drinking, physical activity, meat and fruit intake, BMI, WC, snoring, and sleep duration, ORs (95% CI) for hypertension among individuals consuming dairy products less than once per week, and\u2009\u2265\u20091 time per week were 0.85 (0.77\u20130.95) and 0.74 (0.65\u20130.84), respectively. The corresponding ORs (95% CI) for men were 0.85 (0.71\u20131.02) and 0.75 (0.61\u20130.92), respectively . The corresponding figures for men were\u2009\u2212\u20092.12 , and \u2212\u20092.25 , respectively (Ptrend\u2009<\u20090.001). A similar association was observed among women (Ptrend\u2009<\u20090.001) (Table Ptrend\u2009<\u20090.001) , higher consumption of dairy products was associated with lower SBP. Compared with non-consumers, the adjusted \u03b2 coefficients (95% CI) for SBP associated with consumption of dairy products\u2009<\u20091 time/week and weekly were\u2009\u2212\u20091.62 \u2212\u20092.54,\u2009\u2212\u20090.69), and\u2009\u2212\u20092.63 , respectively . The corresponding figures for DBP were\u2009\u2212\u20091.27 , and\u2009\u2212\u20091.25 , respectively (Ptrend\u2009<\u20090.001)   for SBP associated with consumption of dairy products\u2009<\u20091 time/week, and weekly were\u2009\u2212\u20092.02 , and\u2009\u2212\u20092.62 , respectively (Pheterogeneity\u2009>\u20090.05) , limiting further exploration of the observed associations. Third, sodium has been proven to be a well-known risk factor for the development of hypertension. In theory, sodium intake should be adjusted for in the current study. However, in practice, the most accurate measurement technique\u2014average sodium excretion from multiple 24-h urine collections\u2014is impractical in large-scale population surveys such as CKB. Fourth, despite adjustment for multiple established and potential risk factors, residual confounding by other unmeasured or unknown factors could not be ruled out.In summary, the present study indicates that higher frequency of dairy product consumption is significantly associated with lower odds of hypertension among Chinese adults. These findings have important public health implications and provide evidence in support of current dietary guidelines recommending dairy product consumption.Additional file 1. Table S1. Unadjusted and adjusted \u03b2 coefficients for SBP and DBP associated with frequency of dairy product consumption among adults without self-reported physician-diagnosed hypertension in Zhejiang. Table S2. Unadjusted and adjusted prevalence ratios for hypertension associated with frequency of dairy product consumption among adults in Zhejiang. Table S3. Adjusted odds ratios for hypertension associated with consuming dairy products weekly vs. never according to participant characteristics."}
+{"text": "Background: Patients\u2019 loyalty to visit and use the services provided by the primary health centers (PHCs) is an important requirement of a patient referral system in many countries. The aim of this study was to examine the influence of internal service factors  on service quality and behavioural loyalty of patients in Indonesian PHCs.Methods: A cross-sectional study was conducted in 14 districts in Aceh Province, Indonesia between September and December 2020. Data were collected in 102 PHCs that were selected randomly from 137 PHCs that have an Inpatient Unit in the province. A proportional number of patients were recruited from each PHC and 389 patients were included. The demographic data, three components of internal service factors , the service quality and behavioural loyalty were assessed using a validated questionnaire. Hypothesis testing was conducted by using the structural equation model (SEM).Results: Our data suggested that two elements of internal service factors (service provider and service environment) had a positive and significant influence on service quality of the PHCs with p<0.001 and p=0.021, respectively. Service quality had a positive and significant influence of behavioural loyalty of patients to the PHCs (p=0.003). Service quality however did not serve as an intervening variable between internal service factors  and behavioural loyalty of patients, with p=0.091, p=0.230 and p=0.260, respectively.\u00a0Conclusions: Service provider and service environment are two main factors that influence the service quality and the service quality directly influence the behavioural loyalty on PHC users. Therefore, to increase the patients\u2019 loyalty to use the PHC services, the quality of the services should be improved by levelling up the quality of providers and both physical and social environments in the PHCs. Patient intention to visit primary health centers (PHCs) is an important requirement of a patient referral system. In many countries, for instance Indonesia, individuals are encouraged to visit their local PHCs first and when it is required, they will be referred to public hospitals. As a gatekeeper to hospitals, facility of PHCs in Indonesia have already improved particularly after the implementation of universal coverage  and dissPrevious studies have documented a significant role of service quality on user loyalty. In health care setting, service quality is a crucial factor of an effective health care system . ServiceDefining and measuring health service quality are challenging tasks as service quality is intangible and related to patient perception and expectation . From thAlthough the literature on the impact of internal service factors, for instance, physician characters and hospital environment, regarding service quality is growing, studies on the relationship between service quality and behavioural loyalty are still limited, particularly in the context of primary health care and a developing country  on service quality and behavioural loyalty in Indonesian primary health centres. Further, the SERVQUAL dimensions have been validated in the Western world, and there is a possibility that the cultural differences of consumers will affect its applicability, particularly in the context of a public health care system .As an emerging economy, Indonesia has a unique setting for its health care system, that reflects the important role of social insurance and a relatively strict patient referral system  and, secPuskesmas in Bahasa Indonesia, as the frontline of the health care sector in most developing countries. Besides, this study tested the mediating role of service quality on the relationship between internal service factors and behavioural loyalty. The role of service quality as an intervening variable of the relations between internal factor services and behavioural loyalty is still unexplored.This study contributes to the literature of service quality and behavioural loyalty in health care industries. Prior studies have mostly been conducted in hospital settings in developed countries, for instance the United States (US), the United Kingdom (UK), and Australia . There aPatients develop perceptions during the process of health care delivery and compare them to their expectations . The resPrevious studies classified quality dimensions into two parts, namely, technical quality and functional quality . The patients provided written consent prior to being included in this study. Due to the COVID-19 pandemic, some patients provided verbal consent only, and the interview was conducted in a social distancing manner. In such conditions, the investigators wrote the notes stating that the patients agreed to participate and signed the consent sheet. Such an approach was approved by the Indonesian ethical committee due to force majeure to avoid the transmission of the virus between patients and investigators.Puskesmas) that have Inpatient Unit in Aceh Province. The number of PHCs included in this study was determined using the Slovin minimum sample formula: .Using purposive sampling method, 14 out of 23 districts in Aceh Province were selected based on regionalisation namely, the Central, South, West, and East region. In total, there are 137 PHCs  and mediating variable. In this study, exogeneous variables are also called internal service factors since all the variables are part of the PHCs. The exogeneous variable has three main components: service provider, service process, and service environment. Detailed operational definition of each variable are provided inExtended data (The questionnaire was developed based on previous literature (ed data ). For exThe convergent validity and discriminant validity tests were conducted to ensure the validity of the questionnaire. Based on previous literature, the validity of the questionnaires is confirmed if the loading factor at convergent validity is higher than 0.5 . DiscrimIBM SPSS Amos version 23.The multicollinearity possibility was assessed by using Tolerance dan Variance Inflation Factor (VIF). We found that the VIF value was smaller than 10 indicating no multicollinearity between the domains. To examine the data normality, critical ratio of skewness and kurtosis \u00b1 2.58 were used. Hypothesis testing was carried out by using the structural equation model (SEM). This model was used because this model has several advantages. Firstly, SEM analysis is able to carry out complicated tests of decision-making processes in various public sector management and accounting sciences, and others. Secondly, SEM can be used to address both regressive and dimensional research questions, and it can measure the influence of theoretically existing relationships, including mediating relationships . ThirdlyDuring the study, 402 questionnaires were distributed and all of them were returned. However only 389 respondents answered all the questions completely and were included in the final analysis . The chaOur assessment of criteria measurement of SEM indicated that the data were normal and there were no outliers indicating the data could be used to test our SEM structural model and the hypotheses. An evaluation of the goodness of fit criteria of a model with several index suitability criteria and a cut off value was conducted in order to ensure whether a model can be accepted or rejected. Our SEM model had a p-value > 0.05, chi-square fit statistics/degree of freedom was less than 2 goodness-of-fit index (GFI), root mean square error of approximation < 0.08, Tucker Lewis index and normed fit index were both > 0.90, parsimonious goodness-of-fit index <1.0 and GFI > 0.90. These suggested that our SEM model was acceptable.The SEM test was assessed the influence between variables; if the variable has a probability value p < 0.05, the hypothesis is accepted. The results of the SEM analysis are provided inWe also assessed the intervening role of service quality. Here, we assessed its role as mediator variable that influences the relationship between the independent variable  and the dependent variable . Our data suggested that service quality did not serve as an intervening variable between internal service factors  and behavioural loyalty of the patients, with p = 0.091, p = 0.230 and 0.260, respectively .This study confirms the influence of two internal service factors (service provider and service environment) on service quality. This is consistent with the study conducted in Iranian hospitals . Those aFurthermore, the result of this study confirms a positive and significant impact of quality service on patient behavioural loyalty. This is consistent with prior studies, for instance,However, the present study does not confirm the relationship between internal service factors and patient behaviour loyalty through service quality. Thus, the results are not in line with some previous research, for example,The present study suggests that management of PHCs should focus on the improvement of internal service factors, particularly service provider and service environment, as these factors contribute positively to service quality. In doing so, management can ensure that doctors, nurses, and other supporting staff are having good interpersonal skills, motivation, and professionalism in order to provide the best health service to patients. PHCs management should focus on recruiting good personality of service providers. Moreover, PHCs need to maintain both a physical and social environment that shape good perceptions of patients on the service provided by the PHCs. PHCs should invest in improving both medical and supporting facilities, as well as creating a caring social environment. Finally, this study confirms the influence of service quality in behavioural loyalty of patients. Thus, each PHC needs to improve service quality to attract more patients and motivate existing patient to re-visit the PHC. As a result of improved patient loyalty, patients will follow the referral system properly and, thus, public hospitals in Indonesia can have ideal patient numbers. Behavioural loyalty is crucial in the health system because it could represent trust in health care providers and recommendations they provide, willingness to engage within the system and adherence to treatments. In addition, in the context of COVID-19 pandemic the loyalty in the health system might crucial to increase the trust to health care providers that could improve the acceptance of COVID-19 vaccine which is still a main problem in many countries .Data are available under the terms of the The manuscript is acceptable in this matter. Cheers.Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?YesAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:Health policyI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. No further comments Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?YesAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?YesReviewer Expertise:Epidemiology, public health, vaccination servicesI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Dear respectable authors,Please include \"internal service factors\" and \"service quality\" in your title to make it clearer and more complete.Abstract: Please add the sample size in the methods section. It is not clear enough to me.What is the basis for developing the hypotheses of this study? Give a brief explanation.How is the informed consent form obtained from the patients?Are the samples selected in equal proportions from all regions? Otherwise, there is a possibility of sampling error/selection bias.Please remove the lines 1- 5 at the start of the results section. These details are not related to the results. Please add these details in the methods section and also in the limitations of the study. Cheers. Thank you for considering a great area of research related to determinants of patient behavioral loyalty on primary health centers in Indonesia. The focus of this cross-sectional study is investigating the effects of internal service factors on service quality and behavioral loyalty of patients in\u00a0PHCs in Indonesia. Based on the results, the service provider and service environment are two main factors that influence the service quality, and service quality directly influences the behavioral loyalty of PHC users. Your manuscript is well-written but needs some minor revisions as follows:Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?YesAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:Health policyI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. We would like to thank you for the suggestion for the change of the title but we prefer our current title since this would be clearer for the readers rather than \"internal service factors\" which might less common.\u00a0We have provided the information on the sampling of the respondents and the sample size used in the present study in the abstract.\u00a0Thank you for the suggestion. We have provided an explanation of how each hypothesis was developed. Please read the text under the subheading of each hypothesis where the basis for developing the hypothesis is provided.\u00a0We have provided the information on how the informed consent was obtained. It could be seen under the Research design. We wrote: \u201cThe questionnaire-assisted interviews were conducted by the authors after receiving the consent from the patients. \u2026The patients provided written consent prior to being included in this study. Due to the coronavirus disease 2019 (COVID-19) pandemic, some patients provided verbal consent only, and the interview was conducted in a social distancing manner. In such conditions, the investigators wrote the notes stating that the patients agreed to participate and signed the consent sheet. Such an approach was approved by the Indonesian ethical committee due to force majeure to avoid the transmission of the virus between patients and investigators.\"Thank you for your suggestion. We have removed some texts about the issue that we faced during the data collection due to the COVID-19 pandemic and moved them to methods and limitations. The relationship between patients\u00a0and health care workers is key to working in medicine and public health. Physicians and other health care workers provide direct clinical care and make recommendations about behavioral changes. Within Indonesia, health care workers within primary health centers, or Puskesmas, are also available to refer patients\u00a0to specialists, within the Indonesian system of health care coverage.et al. examines this relationship within the dimension of loyalty. They developed a model of how service providers, service\u00a0processes, and service environments can lead to behavioral loyalty through the intermediate variable of service quality. How the patient-physician relationship operates is key. A stable relationship can lead to better and more sustained health outcomes in the individual and community. The study by Mardaletaet al., 2019). Overall, this was a well-written and well-analyzed study. My one major contention that I would want the authors to respond to would be about treating health care as a business. I think there are certain analogies between health care and business, so discussing loyalty is relevant. However, health care isn't a business in the sense that patients are not consumers exactly. Health care providers have larger ethical and professional obligations beyond a typical commercial business. This doesn't negate the analysis, but the introduction or discussion could contextualize what is or isn't transferable from businesses. For example, there is literature on how you can be concerned about providing good patient-centered care but also not treat patients as consumers Supriyanto\u00a0\u00a0studied the influence of service quality on bank customer loyalty in Indonesia. They found that service quality had no significant effects on customer loyalty.\" - I understand the reason for it, but I think health care is generally different enough from other industries that making cross-industry comparisons could be problematic.I would remove the sentence, \"Likewise, I would delete, \"The service process can be defined as the nature and characteristic of the process of delivering service.\" - it's a bit of a tautology.I believe Slovin's minimum sample formula is sort of a back-of-the-envelope calculation for figuring out how many people to sample into a study, whereas you are using it to sample the cluster. I would just state that explicitly.You mention that you selected the number of inpatient patients in each Puskesmas proportionally - can you provide a range in the methods or results?When you mention SEM analyses, you state, \"Thirdly, SEM can analyse down to the level of indicators, or find the root of the problem, because it is not limited to latent variables.\" - I believe here you mean \"not limited to observed variables\" because isn't the benefit of SEM that you can measure latent constructs?Could you better explain the importance of behavioral loyalty? I see that it could represent trust in health care providers and recommendations they provide, willingness to engage within the system, adherence to treatments or willingness to get screened/get vaccinated, etc. Minor issues:Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?YesAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?YesReviewer Expertise:Epidemiology, public health, vaccination servicesI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. et al. (2021) studied the influence of service quality on bank customer loyalty in Indonesia. They found that service quality had no significant effects on customer loyalty\u201d.We have removed the sentence: \u201cSupriyantoWe have removed the sentence: \u201cThe service process can be defined as the nature and characteristic of the process of delivering service\u201d from the literature review.Thank you for your suggestion. We have provided a brief explanation of the use of Slovin's formula.\u00a0The range of the included patients from each PHC has been added in the \u201cSample and sampling method\u201d section.Thank you for catching this error. We have revised this. We have corrected an error on the third advantage of the SEM analysis.We have provided more explanation of the important of the\u00a0behavioral loyalty at the end of the discussion including its importance in the context of the COVID-19 pandemic.Thank you for reviewing our manuscript. We believe the comments and suggestions improve the quality of our current manuscript"}
+{"text": "Opioid withdrawal involves the manifestation of motivational and somatic symptoms. However, the brain structures that are involved in the expression of different opioid withdrawal signs remain unclear. We induced opioid dependence by repeatedly injecting escalating heroin doses in male and female C57BL/6J mice. We assessed hyperalgesia during spontaneous heroin withdrawal and somatic signs of withdrawal that was precipitated by the preferential \u03bc-opioid receptor antagonist naloxone. Heroin-treated mice exhibited significantly higher hyperalgesia and somatic signs than saline-treated mice. Following behavioral assessment, we measured regional changes in brain activity by automated the counting of c-Fos expression (a marker of cellular activity). Using Principal Component Analysis, we determined the association between behavior  and c-Fos expression in different brain regions. Hyperalgesia was associated with c-Fos expression in the lateral hypothalamus, central nucleus of the amygdala, ventral tegmental area, parabrachial nucleus, dorsal raphe (DR), and locus coeruleus (LC). Somatic withdrawal was associated with c-Fos expression in the paraventricular nucleus of the thalamus, lateral habenula, DR, and LC. Thus, hyperalgesia and somatic withdrawal signs were each associated with c-Fos expression in unique sets of brain areas. The expression of c-Fos in the DR and LC was associated with both hyperalgesia and somatic withdrawal. Understanding common neurobiological mechanisms of acute and protracted opioid withdrawal may help identify new targets for treating this salient aspect of opioid use disorder. The public impact of the opioid crisis has prompted an effort to understand the neurobiological mechanisms of opioid use disorder (OUD). The need to avoid withdrawal symptoms is hypothesized to drive compulsive drug-taking and drug-seeking in OUD. Thus, understanding the mechanisms of acute and protracted opioid withdrawal may help identify new targets for treating this salient aspect of OUD. We reported brain structures that are associated with the expression of hyperalgesia and somatic signs of opioid withdrawal in male and female heroin-dependent mice. Hyperalgesia during spontaneous opioid withdrawal and somatic withdrawal resulted in c-Fos expression in autonomic and limbic brain regions. The expression of c-Fos in the dorsal raphe (DR) and locus coeruleus (LC) were associated with both hyperalgesia and somatic withdrawal.Opioid use disorder (OUD) is a global burden with the highest estimated prevalence observed in the United States . The higNeuroimaging studies provide evidence of functional changes in brain regions during opioid withdrawal. Functional magnetic resonance imaging (fMRI) studies demonstrate that male OUD patients exhibit higher blood oxygen level-dependent (BOLD) signals in several brain regions, including the nucleus accumbens (NAc), caudate putamen, amygdala, hippocampus, prefrontal cortex (PFC), orbitofrontal cortex (OFC), medial frontal gyrus, thalamus, cingulate cortex, and subcallosal gyrus , during fos mRNA expression in the hippocampus, lateral septal nucleus, periaqueductal gray (PAG), ventral tegmental area (VTA), locus coeruleus (LC), caudate putamen, NAc, bed nucleus of the stria terminalis (BNST), central nucleus of the amygdala (CeA), paraventricular nucleus of the hypothalamus (PVN), and lateral hypothalamus . The mice were group-housed (three per cage) with the same sex and treatment condition  in a temperature-controlled (23\u00b0C) vivarium with a 12/12 h light/dark cycle (lights on at 6:30 A.M.). We provided food and water We dissolved diamorphine hydrochloride , dispensed by the National Institute on Drug Abuse, Intramural Research Program Pharmacy, in sterile saline  at concentrations of 0.5\u20135\u2009mg/ml. Heroin was administered subcutaneously in a volume of 10 ml/kg. We dissolved naloxone hydrochloride  in sterile saline at a concentration of 0.1\u2009mg/ml. Naloxone was administered intraperitoneally in a volume of 10 ml/kg. We weighed the mice immediately before each injection with saline, heroin, or naloxone.We assessed hyperalgesia by evaluating mechanical sensitivity using an electronic von Frey device (Ugo Basile). We habituated the mice to the testing room for at least 30\u2009min. For acclimatization, we placed the mice in the testing apparatus for at least 1 h and started testing when exploratory behaviors ceased. The testing apparatus consisted of an elevated platform (92\u2009cm in length\u2009\u00d7\u200928\u2009cm in width\u2009\u00d7\u200971\u2009cm in height) with a stainless-steel mesh floor (0.4 \u00d7\u20090.4\u2009cm) and rectangular transparent compartments (10\u2009\u00d7\u200910\u2009\u00d7\u200913\u2009cm) on top. For baseline measurements, we assessed mechanical sensitivity by applying a single unbending filament perpendicularly to the mid-plantar surface of either the left or right hind paw. The force at which the mouse retracted its paw in response to the stimulation  was recorded automatically by the von Frey device. We continued measuring the withdrawal threshold of the mice in adjacent boxes until we assessed withdrawal thresholds of each mouse at least once. We then repeated the process five times, alternating between the left and right hind paws until a total of six measurements for each mouse (three per paw) were collected. We calculated the average of the six measurements of paw withdrawal thresholds of each mouse and considered it as a measure of mechanical sensitivity.After obtaining baseline measurements, we randomly assigned the mice to the experimental groups. One group received injections of saline , and the other groups received increasing doses of heroin  twice daily (7 A.M. and 7 P.M.) for four consecutive days. Around 16 h after the last saline or heroin injection, we assessed paw withdrawal thresholds by von Frey testing as described above A. To cor10.1523/ENEURO.0106-22.2022.f1-1Extended Data Figure 1-1t test showed that heroin-treated mice  weighed significantly less than saline-treated mice (****p\u2009<\u20090.0001). The data are expressed as mean \u00b1 SEM. N\u2009=\u200912/group. Download Figure 1-1, TIF file.Repeated heroin injections caused bodyweight loss in male and female mice. Percent of bodyweight change in mice that were used for the c-Fos expression experiment following the assessment of hyperalgesia during spontaneous heroin withdrawal. The Student\u2019s As an index of general opioid effects, we weighed the male and female mice daily across treatment. We calculated the total percentage of bodyweight loss by dividing the weight lost by the weight before the first injection multiplied by 100.We injected mice with saline  or increasing doses of heroin  twice daily (7 A.M. and 7 P.M.) for five consecutive days. On the day of the test  weighed significantly less than saline mice (****p\u2009<\u20090.0001). The data are expressed as mean \u00b1 SEM. N\u2009=\u200912/group. Download Figure 2-1, TIF file.Repeated heroin injections caused bodyweight loss in male and female mice. Percent of bodyweight change in mice used for the c-Fos expression experiment following the assessment of naloxone-precipitated somatic signs of opioid withdrawal. The Student\u2019s m phosphate buffer (PB). We kept the brains in 4% PFA for 2 h, then kept them in 18% sucrose solution overnight at 4\u00b0C. We collected free-floating coronal serial cryosections (16\u2009\u03bcm thick) from the entire brain of each mouse with a cryostat . To reduce c-Fos staining variability that can be caused by extraneous factors, we performed parallel immunohistological staining of a set of sections from mice of each behavioral cohort .We perfused mice 1 h after the end of behavioral testing to detect the expression of c-Fos protein B, 2B. We2O2 for 15\u2009min to quench endogenous peroxidase activity. Next, we rinsed and placed the sections for 1 h in blocking solution . We incubated the sections overnight at 4\u00b0C with rabbit anti-phospho-c-Fos  in blocking solution. After rinsing with PB three times for 10\u2009min each, we incubated the sections for 1 h at room temperature with biotinylated goat anti-rabbit antibody  in blocking solution. We incubated the sections for 1 h at room temperature in avidin-biotinylated horseradish peroxidase . We developed the peroxidase reaction with 0.05% 3,30-diaminobenzidine (DAB) and 0.003% H2O2, rinsed the sections with PB three times for 10\u2009min each, and mounted the sections on gelatin-coated slides. After drying overnight at room temperature, we dehydrated the sections through a series of graded alcohols, cleared the sections with Histoclear, and coverslipped the sections with Permount mounting medium . Using an Olympus VS120 microscope (Olympus), we took brightfield images of whole sections that were magnified with a 20\u00d7 objective.We rinsed the cryosections with PB three times for 10\u2009min each. We incubated the cryosections in 0.3% HFor the automatic cell detection and counting of labeled c-Fos protein, we wrote two macros (available as n) that were used in each group or condition is described in each figure legend. We analyzed paw withdrawal thresholds using three-way repeated-measures ANOVA, with sex and treatment  as between-subjects factors and time (test day) as the within-subjects factor. Because we found no significant group or time \u00d7 sex interaction, we combined the male and female data and analyzed paw withdrawal thresholds using two-way ANOVA, with time and treatment as factors. We analyzed the \u0394 of paw withdrawal thresholds using Student\u2019s t test. We analyzed somatic signs of withdrawal using two-way ANOVA, with sex and treatment as between-subjects factors. For opioid withdrawal scores, because we did not observe a significant sex \u00d7 treatment interaction, we combined male and female data to present the main effect of treatment. We analyzed c-Fos expression after the assessment of hyperalgesia or somatic signs of withdrawal using two-way ANOVA, with sex and treatment as between-subjects factors. We present the combined data in the main manuscript and separate sex data in the The number of mice , which standardizes and transforms data to comparable scales, with an orthogonal normalized Varimax to search for associations between c-Fos expression and the behavioral results. We retained factors with eigenvalues\u2009>1 and considered factor loadings\u2009\u22650.7 to represent variance that was explained by the factors. We used Pearson\u2019s correlation test to analyze c-Fos expression among brain regions. We analyzed the data using Prism 9.2 software (GraphPad) or Statistica software (Statsoft).F = 149.9, p\u2009<\u20090.0001) and time  = 312.6, p\u2009<\u20090.0001), a significant treatment \u00d7 time interaction  = 288.2, p\u2009<\u20090.0001), no effect of sex  = 0.04,084, p\u2009=\u20090.8406), no sex \u00d7 treatment interaction  = 2.516, p\u2009=\u20090.1188), and no sex \u00d7 treatment \u00d7 time interaction  = 2.610, p\u2009=\u20090.1122; F = 215.5, p\u2009<\u20090.0001) and test day  = 268.9, p\u2009<\u20090.0001) on paw withdrawal thresholds and a significant treatment \u00d7 test day interaction  = 252.5, p\u2009<\u20090.0001; Post hoc comparisons indicated that heroin-treated mice had significantly lower paw withdrawal thresholds compared with saline-treated mice (p\u2009<\u20090.0001) and compared with paw withdrawal thresholds during baseline (p\u2009<\u20090.0001). Student\u2019s t test of the \u0394 of paw withdrawal thresholds indicated that heroin-treated mice exhibited significantly higher mechanical sensitivity compared with saline-treated mice (t(53) = 16.78, p\u2009< 0.0001; To model opioid dependence and produce hyperalgesia during spontaneous heroin withdrawal in male and female mice, we used a 4-d schedule of repeated subcutaneous administration of escalating heroin doses (5\u201340\u2009mg/kg). We measured paw withdrawal thresholds 1\u2009d before initiating the heroin injections (baseline) and after repeated heroin injections at 16 h into withdrawal A. The tht test showed that heroin-treated mice weighed significantly less than saline-treated mice (t(22) = 10.13, p\u2009<\u20090.0001; Extended Data We measured bodyweight in mice that were subsequently used to detect c-Fos expression after the assessment of hyperalgesia. Student\u2019s F = 23.58, p\u2009<\u20090.0001; heroin > saline), regardless of sex  = 0.3612, p\u2009=\u20090.5512; sex \u00d7 treatment interaction: F = 0.1053, p\u2009=\u20090.7473; F = 10.75, p\u2009=\u20090.0022; heroin > saline), regardless of sex  = 1.195, p\u2009=\u20090.2809; sex \u00d7 treatment interaction: F = 0.01,720, p\u2009=\u20090.8963). The ANOVA showed significant effects of treatment  = 196.6, p\u2009<\u20090.0001; heroin > saline) and sex  = 27.97, p\u2009<\u20090.0001) on the number of jumps and a significant sex \u00d7 treatment interaction  = 27.07, p\u2009<\u20090.0001). Post hoc comparisons indicated that female heroin-treated mice exhibited a higher number of jumps compared with male heroin-treated mice (p\u2009<\u20090.0001).To test somatic signs of heroin withdrawal, we used a 5-d schedule of intermittent injections of escalating heroin doses  and precipitated withdrawal by a single intraperitoneal injection of naloxone 1\u2009mg/kg; A 2 h aftF = 62.10, p\u2009<\u20090.0001), regardless of sex  = 2.685, p\u2009=\u20090.1092; sex \u00d7 treatment interaction: F = 1.602, p\u2009=\u20090.2129; The two-way ANOVA revealed that heroin-treated mice had a significantly higher opioid withdrawal score compared with saline-treated mice  = 8.945, p\u2009<\u20090.0001; Extended Data We measured bodyweight in mice that were subsequently used to detect c-Fos expression after the assessment of somatic signs of withdrawal. Student\u2019s To investigate brain region-specific activity that is associated with hyperalgesia during spontaneous withdrawal, we quantified c-Fos expression in brains that were collected 17 h after the last heroin injection  = 16.93, p\u2009<\u20090.001; sex effect: F = 5.546, p\u2009=\u20090.0294; sex \u00d7 treatment interaction: F = 0.1327, p\u2009=\u20090.7197), LHb  = 40.80, p\u2009<\u20090.0001; sex effect: F = 8.195, p\u2009=\u20090.0100; sex \u00d7 treatment interaction: F = 0.9071, p\u2009=\u20090.3528), VTA  = 27.39, p\u2009<\u20090.0001; sex effect: F = 5.773, p\u2009=\u20090.0267; sex \u00d7 treatment interaction: F = 0.1231, p\u2009=\u20090.2810), PVN  = 30.16, p\u2009<\u20090.0001; sex effect: F = 8.964, p\u2009=\u20090.0075; sex \u00d7 treatment interaction: F = 0.2445, p\u2009=\u20090.1344), and SUM  = 4.195, p\u2009=\u20090.0546; sex effect: F = 14.44, p\u2009=\u20090.0012; sex \u00d7 treatment interaction: F = 0.007174, p\u2009=\u20090.9334). We found significant treatment effect but no sex effect in the following brain regions: CeA  = 26.37, p\u2009<\u20090.0001; sex effect: F = 1.876, p\u2009=\u20090.1867; sex \u00d7 treatment interaction: F = 0.09373, p\u2009=\u20090.7628), DR  = 11.70, p\u2009<\u20090.01; sex effect: F = 1.803, p\u2009=\u20090.1952; sex \u00d7 treatment interaction: F = 0.08641, p\u2009=\u20090.3642), PBN  = 26.15, p\u2009<\u20090.0001; sex effect: F = 0.2822, p\u2009=\u20090.6014; sex \u00d7 treatment interaction: F = 0.1759, p\u2009=\u20090.6796), and LC  = 17.91, p\u2009<\u20090.001; sex effect: F = 0.5460, p\u2009=\u20090.4695; sex \u00d7 treatment interaction: F = 0.5909, p\u2009=\u20090.4520). We did not find significant treatment effects, but we found main sex effects on the number of c-Fos-expressing neurons in three brain regions: NAc shell  = 0.8349, p\u2009=\u20090.3723; sex effect: F = 10.41, p\u2009=\u20090.0044; sex \u00d7 treatment interaction: F = 0.05892, p\u2009=\u20090.8108), BNST  = 1.926, p\u2009=\u20090.1813; sex effect: F = 4.275, p\u2009=\u20090.0526; sex \u00d7 treatment interaction: F = 0.4395, p\u2009=\u20090.5153), and PAG  = 1.136, p\u2009=\u20090.2998; sex effect: F = 8.589, p\u2009=\u20090.0086; sex \u00d7 treatment interaction: F = 0.005, p\u2009=\u20090.9441). We did not find a main treatment effect nor sex effect in the PVT  = 0.1164, p\u2009=\u20090.7367; sex effect: F = 2.544, p\u2009=\u20090.1272; sex \u00d7 treatment interaction: F = 0.2627, p\u2009=\u20090.6142). Download Figure 3-1, TIF file.C-Fos expression in neurons distributed in distinct brain regions in male and female mice following the assessment of hyperalgesia during spontaneous heroin withdrawal. Two-way ANOVAs showed no sex \u00d7 treatment interactions for any of the analyzed brain regions. We found main treatment effect and main sex effect on the number c-Fos-expressing neurons in several brain regions: LH .post hoc comparisons did not reveal significant differences  = 33.96, p\u2009<\u20090.0001; sex effect: F = 1.128, p\u2009=\u20090.0245; sex \u00d7 treatment interaction: F = 6.029, p\u2009=\u20090.0245), but the post hoc comparisons did not detect meaningful differences . We found main treatment effect and main sex effect on the number of c-Fos-expressing neurons in several brain regions: NAc shell  = 15.91, p\u2009<\u20090.001; sex effect: F = 40.50, p\u2009<\u20090.0001; sex \u00d7 treatment interaction: F = 1.781, p\u2009=\u20090.1986), BNST  = 29.53, p\u2009<\u20090.0001; sex effect: F = 14.97, p\u2009=\u20090.0011; sex \u00d7 treatment interaction: F = 1.470, p\u2009=\u20090.2411), PVT  = 5.069, p\u2009<\u20090.05; sex effect: F = 4.738, p\u2009=\u20090.0431; sex \u00d7 treatment interaction: F = 1.023, p\u2009=\u20090.3253), CeA  = 17.40, p\u2009<\u20090.001; sex effect: F = 23.89, p\u2009=\u20090.0001; sex \u00d7 treatment interaction: F = 3.703, p\u2009=\u20090.0703), LHb  = 18.28, p\u2009<\u20090.001; sex effect: F = 8.314, p\u2009=\u20090.0099; sex \u00d7 treatment interaction: F = 1.297, p\u2009=\u20090.2697), DR  = 14.54, p\u2009<\u20090.01; sex effect: F = 12.91, p\u2009=\u20090.0021; sex \u00d7 treatment interaction: F = 0.116, p\u2009=\u20090.7422), PBN  = 27.17, p\u2009<\u20090.0001; sex effect: F = 18.16, p\u2009=\u20090.0005; sex \u00d7 treatment interaction: F = 0.1257, p\u2009=\u20090.7271), and LC  = 88.91, p\u2009<\u20090.0001; sex effect: F = 29.03, p\u2009<\u20090.0001; sex \u00d7 treatment interaction: F = 2.218, p\u2009=\u20090.1537). We found significant treatment effect but no sex effect in the following brain regions: PVN  = 43.11, p\u2009<\u20090.0001; sex effect: F = 1.915, p\u2009=\u20090.1833; sex \u00d7 treatment interaction: F = 0.1469, p\u2009=\u20090.7060), LH  = 30.28, p\u2009<\u20090.001; sex effect: F = 0.3534, p\u2009=\u20090.5436; sex \u00d7 treatment interaction: F = 0.04941, p\u2009=\u20090.8266), SUM  = 33.96, p\u2009<\u20090.0001; sex effect: F = 1.128, p\u2009=\u20090.3023; sex \u00d7 treatment interaction: F = 6.029, p\u2009=\u20090.0245), and VTA  = 24.40, p\u2009<\u20090.0001; sex effect: F = 2.406, p\u2009=\u20090.1383; sex \u00d7 treatment interaction: F = 1.791, p\u2009=\u20090.1975), We did not find a main treatment effect nor sex effect in the in the PAG  = 3.855, p\u2009=\u20090.0652; sex effect: F = 0.02565, p\u2009=\u20090.8746; sex \u00d7 treatment interaction: F = 0.3041, p\u2009=\u20090.5881). Download Figure 4-1, TIF file.C-Fos expression in neurons distributed in distinct brain regions in male and female mice following the assessment of naloxone-precipitated somatic signs of heroin withdrawal. To determine the relationship between neuronal activity and hyperalgesia during spontaneous heroin withdrawal, we performed PCA to reduce dimensionality of the data from heroin-treated mice. The PCA with an orthogonal normalized varimax rotation included the average number of c-Fos-expressing neurons of each brain region and \u0394 of paw withdrawal thresholds of male and female heroin-treated mice A. The anThe PCA with an orthogonal normalized varimax rotation included the average number of c-Fos-expressing neurons of each brain region and somatic opioid withdrawal scores of male and female heroin-treated mice B. The anr\u2009=\u20090.67, p\u2009<\u20090.05, and r\u2009=\u20090.69, p\u2009<\u20090.05, respectively), and the PBN only correlated with the DR . Across brain regions, we observed the strongest correlations of c-Fos expression between the LH and CeA , between the LH and VTA , between the LH and DR , between the DR and VTA , and between the DR and CeA .We used Pearson\u2019s correlation tests to correlate the average number of c-Fos-expressing neurons among the analyzed brain regions for male and female heroin-treated mice C. Among r\u2009=\u20090.91, p\u2009<\u20090.001), between the DR and PVT , and between the DR and LC  receptors, and corticotropin-releasing factor 1 (CRF1) receptors attenuated both somatic withdrawal . Microinjections of a \u03b2-adrenergic receptor blocker and \u03b1the BNST  and an Athe BNST  prevente2-adrenergic receptor agonists that suppress the adrenergic system, are used to treat somatic withdrawal symptoms during the acute phase of opioid withdrawal in humans, but they are ineffective for the long-term treatment of OUD  that are associated with opioid withdrawal. Understanding alterations of neuronal activity and identifying potential neuronal networks that are associated with opioid withdrawal-related behaviors will also guide efforts to identify biomarkers of OUD and relapse.10.1523/ENEURO.0106-22.2022.edExtended DataExtended Data 1, DOCX file.Macros used for preprocessing and for morphological segmentation of images using Image-Pro 10.0 software. Download"}
+{"text": "Little is known about rural-urban differences in the treatment and outcomes in patients with atrial fibrillation (AF). We aimed to assess whether the initiation of oral anticoagulant (OAC) therapy in patients with AF differs between those with rural and urban residence.The registry-based FinACAF cohort covers all patients with AF from all levels of care in Finland. Patients were divided into rural and urban categories and into urbanization degree tertiles based on their municipality of residence at the time of AF diagnosis. The outcome was the first redeemed OAC prescription.We identified 222 419 patients  years) with incident AF during 2007\u20132018. Urban residence was associated with a lower rate of OAC therapy initiation (adjusted subdistribution hazard ratio (SHR) (95% CI) 0.96 (0.95\u20130.97)). Correspondingly, an inverse graded dose-response relationship was observed between higher urbanization degree tertile and OAC initiation rate (highest tertile compared to lowest: adjusted SHR (95% CI) 0.94 (0.93\u20130.95)). The adoption of direct oral anticoagulants for stroke prevention was faster among patients with urban residence.This nationwide cohort study documented that urban residence is associated with a slightly lower rate of OAC therapy initiation in patients with incident AF, but faster adoption of direct oral anticoagulant use. Atrial fibrillation (AF), the most common sustained arrhythmia with a prevalence as high as 4.1%, is associated with increased risk of ischemic stroke and mortality . FortunaPrevious studies have indicated that populations in rural areas have higher all-cause mortality and worse outcomes in cardiovascular diseases \u201314. Likest 2018 and age <18 years at AF diagnosis. Owing to the linkage of the national registries and universal coverage of public health insurance in Finland, the data has virtually no loss to follow-up. Follow-up continued until death or 31st December 2018, whichever occurred first. The current substudy was conducted within a cohort of patients with incident AF between 2007 and 2018, established in previous studies of the FinACAF cohort [2DS2-VASc score \u2265 1 and women with CHA2DS2-VASc score \u2265 2; high stroke risk: men with CHA2DS2-VASc score \u2265 2 and women with CHA2DS2-VASc score \u2265 3) [The Finnish AntiCoagulation in Atrial Fibrillation (FinACAF) Study  is a nationwide retrospective cohort study including all patients with an AF diagnosis in Finland during 2004\u20132018 [F cohort . In thisThe patients\u2019 were categorized to rural and urban groups according to Finland\u2019s Environmental Administration\u2019s rural-urban classification system and patients\u2019 municipality of residence at cohort entry. In this classification, several variables, such as population, labour, building and road network data, are used to define areas rural-urban status, and urban municipalities have a center with more than 15 000 residents . AdditioThe primary outcome was the initiation of OAC therapy, which was considered to occur on the date of the first fulfilled OAC  prescription after the cohort entry.The study protocol was approved by the Ethics Committee of the Medical Faculty of Helsinki University, Helsinki, Finland (nr. 15/2017) and granted research permission from the Helsinki University Hospital (HUS/46/2018). Respective permissions were obtained from the Finnish register holders . The patients\u2019 identification numbers were pseudonymized, and the research group received individualized, but unidentifiable data. Informed consent was waived due to the retrospective registry nature of the study. The study conforms to the Declaration of Helsinki as revised in 2013.https://www.R-project.org). The chi-square test was used to compare differences between proportions, and the independent samples t-test and analysis of variance to analyze continuous variables. Poisson regression was used to estimate the incidence rates, incidence rate ratios, and adjusted rate differences of OAC initiation. Observation of OAC initiation may be hindered by mortality occurring during study period, and therefore, the Fine-Gray regression with all-cause death as competing event was used to estimate the unadjusted and adjusted subdistribution hazard ratios (SHRs) of OAC initiation. Furthermore, as sensitivity analysis we treated death as informative censoring by estimating stabilized inverse probability of censoring weights for death. These weights were computed by Cox regression according to the following baseline variables: age, gender, calendar year of AF diagnosis, hypertension, heart failure, coronary artery disease, diabetes, prior stroke or transient ischemic attack, abnormal liver function, abnormal kidney function, prior bleeding episodes, dementia, cancer, alcohol use disorder, psychiatric disorders, income, and educational attainment . Thereafter, we calculated adjusted hazard ratios of OAC initiation with inverse probability weighted Cox regression. Additionally, to determine the factors associated with choosing DOAC over VKA as the initial anticoagulant, binary logistic regression model was used with DOAC initiation as dependent variable including only patients initiating OAC therapy after 2011 when the first DOAC was approved for stroke prevention in patients with AF. The Fine-Gray, Poisson, Cox and binary logistic regression models were adjusted for age, gender, calendar year of AF diagnosis, stroke and bleeding risk factors , dementia, cancer, alcohol use disorder, psychiatric disorders, income quartiles  and educational attainment. The definitions of the comorbidities are displayed in Statistical analyses were performed with the IBM SPSS Statistics software  and R  years) with incident AF during 2007\u20132018. Patients with urban residence had higher educational and income levels, lower prevalence of cardiovascular comorbidities and higher prevalence of psychiatric disorders and alcohol abuse than patients with rural residence . The meaOAC therapy was initiated in altogether 72.0% patients with rural residence and 69.9% patients with urban residence. When compared to patients with rural residence, the unadjusted and adjusted rates of OAC initiation were lower among patients with urban residence both in the Fine-Gray and Poisson regression models , and this exclusion is unlikely to impact our results significantly. Also, OACs may have been prescribed for indications other than AF during follow-up, although a vast majority of OACs are used for AF . FinallyIn conclusion, this nationwide retrospective cohort study showed that urban residence is associated with a slightly lower rate of OAC therapy initiation, highlighting potential missed opportunities in stroke prevention among patients with AF and urban residence. On the other hand, the broad adoption of DOACs for prevention of AF-related stroke has been faster in urban areas.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file.S1 Fig(PDF)Click here for additional data file."}
+{"text": "Additionally, background noise impacts estimated vocal communication space and may limit the ability of vocal-mediated mother-calf cohesion. Altogether, a manatee\u2019s ability to detect acoustic signals of interest is expected to vary greatly spatially and temporally.A manatee\u2019s primary modality to detect a vessel on a possible collision course is hearing as underwater visibility is limited in many manatee habitats and their visual acuity is poor. We estimate a Florida manatee\u2019s ability to detect the sound of an approaching boat and vocalizations in four different soundscapes in Sarasota Bay, FL. Background noise samples were collected every 5 minutes for a two-week period during winter and summer at each location (2019 or 2020). Sound levels in third octave bands  were measured and compared to manatee auditory hearing thresholds and to sound levels of an approaching boat traveling at a slow, medium, or fast speed. Background sound levels in a wider band (1\u201320 kHz) were calculated to model vocal communication space at each location. We found that a manatee\u2019s estimated ability to detect an approaching boat differs greatly among locations, with time of day, and by season, and that fast boats are predicted to be detected later than slow boats. Latency of boat noise detection is estimated to sharply increase when considering unusually loud background noise levels. We suggest that such uncommonly loud conditions (e.g. 95 Trichechus manatus latirostris) inhabit shallow, coastal and inland waters that are shared with boat traffic and elevated ambient background noise can mask important signals such as the sound of an approaching boat and manatee vocalizations (\u201cmanatee\u201d refers to Florida manatees unless otherwise stated) . Th. ThBG) iin plots .BOAT) was calculated every second in the same third-octave bands used for background noise measurements . A . A BG dBThe current study uses a simple practical spreading loss model because measurements of transmission loss in similar environments have been found to generally be greater than would be predicted by a cylindrical spreading model, but less than a spherical spreading model , 23, 37.BG differed among locations across the third octave bands calculated  (BG in each third octave band was higher during the summer than during winter (BG in each third octave band was higher in the day than at night (TOLd 8 kHz) . The Tidg winter . TOLBG iat night .th percentile background noise level. The 500 Hz detection threshold was higher than the 95th percentile background noise level across all four stations (pooled). TOLBOAT was lower across third octave bands when recorded at a depth of 15 cm versus 1 m depth (BOAT is expected to correspond to a delay in a manatee\u2019s ability to detect an approaching boat (TOLBOAT rises above TOLBG and the detection threshold later relative to the boat\u2019s closest point of approach).Manatee detection thresholds in quiet controlled laboratory conditions were below median background noise levels across all four stations (pooled) for the 2, 4, and 8 kHz third octave bands . The det m depth . The lowBOAT rises above TOLBG and the detection threshold) until much later at locations with higher background noise (PCM) than quieter locations (Tidy)  Figs  and 7. Ady) Figs .BG) varied among the four locations with PCM being the loudest location followed by Hillview, Bayou Hammock, and then Tidy (BG), environmental features, and vocalization source level.Background noise in the 1\u201320 kHz band  and over time (season and time of day). The most striking difference is between a consistently quiet location away from boat traffic (Tidy) and the comparably louder locations near boat traffic. The higher background noise during the day and summer when more boats are on the water also suggests that boat noise is an important contributing factor to the increased background noise at Hillview and PCM, and to a lesser extent Bayou Hammock.th percentile) background noise  conditions, but would be detectable only 5 seconds in advance with elevated (95nd noise . In bothth percentile background noise level) while a fast boat may be detected only 15 seconds in advance with a typical (median) background noise level (5 seconds with a 95th percentile background noise level). The sharp difference in estimated detectability of a slow versus a fast boat relates to its distance to the manatee. A slow-traveling boat would be detectable earlier because it is closer to the manatee. For example, 15 seconds before a boat traveling 7 mph reaches a manatee it is 47 m away, whereas a boat traveling 26.2 mph is 176 m away. Therefore, the slow boat that is producing lower amplitude sound is estimated to be louder at the manatee\u2019s location because of its proximity. Field observations confirm that manatees change their behavior earlier when a boat is traveling slowly [In addition to background noise level, boat speed greatly impacts the estimated time window a manatee has to respond to an approaching boat. For example, at the PCM location, a slow boat may be detectable more than 30 seconds in advance with a typical (median) background noise level  . The secThe detection of sounds received against background noise, such as broadband sounds produced by boat engines, is complex. Physical factors , sensory factors , and other cognitive factors (attention and learning history) affect manatee perception and response to boat noise .BG, such as the 95th percentile examples used, likely represent periods with boat noise. Therefore, predicted detection of our boat noise measurements with high background noise represents the ability to detect the sound of an approaching boat when other boats are in the area. In psychophysical studies this would typically be done by measuring a just-noticeable difference in sound levels. This scenario is important to consider as manatees are commonly exposed to the sound of overlapping boat noise [Our measurements of background noise include sound produced by boats in the area to capture realistic conditions. High TOLat noise . A manatat noise . HoweverTrichechus manatus manatus) in a comparatively quiet location with less boat traffic (Belize) found manatees responded earlier and in a more pronounced manner to approaching boats compared to subsequent studies with Florida manatees where boats are more prevalent [In the wild, reports of manatee responsiveness to the sound of an approaching boat varies greatly. How often manatees change their behavior when there is the sound of an approaching boat includes reports of 6%, 49%, 64%, and 89% of the time , 52, 53.revalent , 54.Manatee vocalization detection distance estimates were found to be limited by background noise based on a practical spreading loss model. Background noise in a frequency range (1\u201320 kHz) that overlaps with manatee vocalizations, which includes the range of greatest hearing sensitivity , 17, varDugong dugon) increase the source level of their vocalizations when a speaker playing dugong vocalizations is farther away [Previously reported sound levels of Florida manatee vocalizations may be underestimates of source levels. First, manatees may naturally produce quiet vocalizations in quiet locations. Indeed, the quietest source level estimates of vocalizations were obtained in freshwater areas that likely had low ambient noise compared to marine environments , 56. Mikher away . Anotherher away . Attenuaher away , 59. Theher away , 61. Souher away . The larControlled laboratory recordings of manatee vocalizations from differing axes and in varying levels of background noise would complement the previously collected field measurements. Another consideration is the type of measurement used to characterize the sound level of manatee vocalizations. Typically, it is reported as rms sound level for a wide bandwidth. However, manatee vocalizations are commonly organized as a series of harmonic narrow bands. There could be significant energy in each narrowband for a manatee to detect but this would be diluted by calculating a rms sound level for a wide range of frequencies. Regardless of the source level estimates, communication space is expected to vary greatly with background noise level, and therefore, vary temporally and spatially.The ability of background noise to mask manatee vocalizations may be partially mitigated by compensation mechanisms. Other marine mammal species have been found to compensate for elevated background noise by increasing the amplitude of their vocalizations (Lombard effect), shifting the frequency of their vocalization, changing vocalization structure, increasing duration of vocalizations, and vocalizing more often , 63\u201369. Vocal communication is important for manatees to convey motivational state and maintain contact, especially for mothers and calves , 13. Manth percentile) strongly decrease a manatee\u2019s estimated ability to detect boat noise, and we suggest considering not just typical conditions (median) but also high levels of background noise when evaluating a manatee\u2019s ability to respond to an approaching boat. Boat speed is estimated to strongly influence the time a manatee has to respond to an approaching boat such that manatees are expected to detect the sound of an approaching boat earlier if the boat is traveling slowly. High background noise levels, created in part by boats, are predicted to limit a manatee\u2019s ability to communicate vocally by decreasing the distance vocalizations can travel.In conclusion, temporal and spatial variations in background noise impacts a manatee\u2019s estimated ability to detect boat noise and vocalizations. In particular, high levels of background noise (95S1 Data(CSV)Click here for additional data file."}
+{"text": "Health-related misinformation on social media is a key challenge to effective and timely public health responses. Existing mitigation measures include flagging misinformation or providing links to correct information, but they have not yet targeted social processes. Current approaches focus on increasing scrutiny, providing corrections to misinformation (debunking), or alerting users prospectively about future misinformation (prebunking and inoculation). Here, we provide a test of a complementary strategy that focuses on the social processes inherent in social media use, in particular, social reinforcement, social identity, and injunctive norms.not sharing specific content) in addition to flagging COVID-19\u2013related misinformation leads to reductions in sharing behavior and improvement in overall sharing quality.This study aimed to examine whether providing balanced social reference cues . Participants\u2019 feed was augmented to include misleading and control information, resulting in 4 groups: no-information control, Twitter\u2019s own misinformation warning (misinformation flag), social cue only, and combined misinformation flag and social cue. We tracked the content shared or liked by participants. Participants were provided with social information by referencing either their A total of 1424 Twitter users participated in 3 studies . Across all 3 studies, we found that social cues that reference users\u2019 personal network combined with a misinformation flag reduced the sharing of misleading but not control information and improved overall sharing quality. We show that this improvement could be driven by a change in injunctive social norms (study 2) but not social identity (study 3).Social reference cues combined with misinformation flags can significantly and meaningfully reduce the amount of COVID-19\u2013related misinformation shared and improve overall sharing quality. They are a feasible and scalable way to effectively curb the sharing of COVID-19\u2013related misinformation on social media. Misleading or false health-related information on social media poses a substantial challenge for both public institutions and individuals alike . During To date, most research efforts to combat the spread of misinformation have focused primarily on information processing. The underlying assumption is that social media users operate in an information-rich and attention-demanding environment with limited time, often lacking the cognitive resources or knowledge to assess the accuracy of the information they encounter . This asdescriptive normative information, whereas perceptions of whether others would approve or disapprove of behavior constitute injunctive social norms [Every piece of information shared on social media also carries social cues shaping users\u2019 perceptions, attitudes, and behaviors . This soal norms ,19. Injual norms ; their ral norms ; and theal norms . Third, al norms , that isal norms  describeal norms . Recent al norms .Despite all these implications, platforms provide social cues as very 1-sided endorsements to strengthen user engagement, resulting in an underrepresentation of dissenting views. This imbalance deprives the users of critical normative information and can influence their perceptions, decision-making, and the algorithms that determine the content displayed in users\u2019 feeds. Targeting social processes could thus be an important additional building block to design interventions and environments that effectively reduce the sharing of misinformation on social media and empower its users, especially when cognitive and attentional resources are scarce  or when not share. We combined these social cues with 1 of the existing countermeasures of Twitter, namely, misinformation labels :Hypothesis 1A: Participants across all intervention groups share less tweets containing health-related misinformation than participants in the control group.Hypothesis 1B: Participants across all intervention groups do not share less tweets containing health-related control information than participants in the control group.discernment  than participants in the control group.Hypothesis 1C: Participants across all intervention groups show better Hypothesis 2A: Participants who see a balanced social cue share less tweets containing health-related misinformation than participants in the control group.Hypothesis 2B: Participants who see a balanced social cue do not share less tweets containing health-related control than participants in the control group.Hypothesis 2C: Participants who see a balanced social cue show a smaller ratio of shared misinformation and control tweets than participants in the control group (indicating improved discernment).Hypothesis 3A: Participants in the social reference cues group and those in the combined group report less approval of sharing misleading information than participants in the control group (injunctive norms).Hypothesis 3B: Participants in the social reference cues group and those in the combined group perceive that others share less misleading information than participants in the control group (descriptive norms).Hypothesis 3C: Participants in the social reference cues group and those in the combined group report stronger intergroup bias than participants in the control group.In 3 intervention studies, we tested whether balanced social cues can (1) reduce users\u2019 sharing of misleading content, (2) reduce their sharing of control stimuli, (3) improve their overall discernment (difference between shared misinformation and control information); (4) whether there are differences between different social reference groups ; and (5) which social processes might drive these processes. As we aimed to compare our social cues intervention with Twitter\u2019s existing countermeasure, namely, their misinformation label, but also examine potential synergetic effects, we randomly assigned participants to 1 of 4 experimental groups. Thus, participants either saw (1) only balanced social cues; (2) only Twitter\u2019s misinformation flag; or (3) both cues and flag when liking, retweeting, or replying to a tweet. The participants in the fourth group were displayed no intervention (control). In 2 subsequent studies, we examined different social reference groups  for social cues and the contribution of 2 hypothesized mechanisms behind the social cues, namely, changes in social norms and social identity. In total, we conducted 3 separate experimental studies that shared the same overall paradigm and similar procedures. We created an open-source browser extension to access and augment Twitter users\u2019 social media feed with Twitter\u2019s standard misinformation flags, balanced social cues, or both .1=2 and \u03bc2=3) with a power of 0.90 and an \u03b1 level of .05, a total sample size of n=800 was deemed sufficient (n=200 per group). For studies 2 and 3, based on simulation studies, we targeted a minimum sample size of n=260 to detect a growth condition between the last and the first measurements of Cohen d=0.20 with 3 repeated measurements, an \u03b1 level of .05, and a power of 0.90 [We conducted an a priori power analysis to determine the sample size. For study 1, the sample size to be able to detect small differences in the expected rate of events .The participants provided informed consent before data collection. As we initially deceived the participants about the study aims, they were debriefed about the true aims after data collection. All data were collected using the web-based crowdsourcing platform Prolific and the German survey platform SoSci Survey. Respondents were paid a fee deemed appropriate by Prolific, equivalent to \u00a37.50 (US $ 9.93) per hour.The crowdsourcing platform Prolific Academic was used to recruit participants. We invited 900 English-speaking participants with a minimum age of 18 years and >100 posts submitted on Twitter in the last 12 months. We collected all the data for study 1 on September 3, 2021. As several participants dropped out before installing the browser extension, our final sample consisted of 824 individuals aged between 18 and 65 years . Participants were either unemployed , in full-time employment , or in part-time employment . A total of 51.3% (423/824) of the participants had at least an undergraduate degree, whereas only 1.1% (9/824) of the participants reported having no formal education. Most participants reported the following countries as their current place of residence: the United Kingdom , South Africa , Portugal , and the United States . We did not exclude participants who provided full consent.To avoid expectation effects, the participants were briefed to test a tweet recommendation system. After providing consent, they then answered all prestudy questionnaires and were randomly assigned to one of four conditions: (1) social reference cues, (2) standard social media (Twitter) misinformation flag, (3) combined , and (4) control (no flag or cues).After being redirected to Twitter, the participants were instructed to browse and interact with their personal Twitter feed as usual for 30 minutes. During this period, participants in all groups had approximately 50% of their Twitter feed replaced with misinformation randomly drawn from a pool of 40 verified misinformation tweets and 10 control tweets. All other content of the participants\u2019 \u201creal\u201d feed remained unchanged. This means that participants who read more tweets overall were exposed to more misinformation and intervention content, but the proportion of misinformation and intervention content was identical across participants. If participants had been exposed to all misinformation items from the pool in the 30 minutes, the same set of items would be shown again in a randomized order. This methodology is consistent with that of previous studies . After 3digital health literacy with 4 items asking about their subjective ability to browse, search, and find as well as assess the quality and trustworthiness of digital health\u2013related content .We obtained demographic data  from Prolific. Participants also completed prestudy self-report measures on education and on different potential mediators of the relationship between intervention and sharing behavior. We assessed political orientation on a continuum (ranging from 1 \u201cleft\u201d to 10 \u201cright\u201d): \u201cMany people use the terms \u2018left\u2019 and \u2018right\u2019 when they want to describe different political views. Thinking of your own political views, where would you place these on this scale?\u201d The distribution of the participants\u2019 answers was skewed toward politically more left-leaning views .In addition, we asked participants to rate their likes and retweets of misinformation and control tweets were collected through the browser extension. Note that the actual liking, sharing, or retweeting was intercepted through the browser extension.The primary outcomes discernment as the number of shared control tweets subtracted from the number of shared misinformation tweets.We operationalized Chrome browser extension to augment participants\u2019 actual Twitter feed. This browser extension enabled us to add manipulated tweets to participants\u2019 natural feed , record all manipulated content they viewed, and record all interactions with manipulated content. We stored all the interaction data  on a Google Firebase server. To protect the participants from spreading misleading information, the browser extension intercepted all likes, replies, and retweets. We will share all codes for this browser extension upon publication of this manuscript on GitHub (dan91/tweet-recommender). The extension is written in JavaScript and published on the Google Chrome Web Store but is only accessible via a direct link to prevent dissemination outside the study context.We developed a study-specific control stimuli. Misinformation tweets were actual misinformation tweets collected through the Google Fact Check application programming interface. Through the application programming interface, we accessed claims that had been fact-checked by platforms such as PolitiFact or Vera Files, which are mostly not-for-profit organizations. We included tweets with the keyword \u201cCOVID\u201d that were rated as \u201cfalse.\u201d A full list of the stimuli used can be found on the Open Science Framework. A total of 6 of these tweets cited newspapers or scientific articles.In total, we fed up to 50 manipulated tweets into the users\u2019 timelines. A total of 40 of the manipulated tweets contained false claims and 10 contained short vaccine positive\u2013, entertainment-, and sports-related information and served as balanced social cue, users were provided with the number of users within their own personal network and within the entirety of Twitter that saw but did not interact with the content . Importantly, we did not calculate the size of participants\u2019 actual Twitter network. Instead, the proportion of participants\u2019 personal Twitter network and the total number of Twitter users not reacting to the tweet were calculated based on the number of retweets of the actual misinformation content. For the personal network, the retweet count was multiplied by 10 and for the complete Twitter network by 500. The proportion of users in a person\u2019s network who had seen but ignored a tweet was then randomized between 95% and 99%. For example, if the original misinformation tweet had been retweeted 10 times, the social reference message could read \u201c...95 of the people in your personal network saw but did not share...On Twitter, 4950 other users saw but did not share...\u201dFor the primary outcome variable was the number of shared misinformation tweets (sum of liked and retweeted misinformation tweets per participant). To account for the high number of participants sharing no tweets and thus a highly skewed outcome distribution , we estimated the following negative binomial regression model to test hypothesis 1A:The 1, \u03b22, and \u03b23). The control group served as reference. In addition, all models controlled for participants\u2019 age, education, digital health literacy, and political orientation. We report regression coefficients, SEs, and incidence rate ratios as changes in Y per 1-unit increase in a predictor as effect size. The analyses were preregistered and can be retrieved from AsPredicted (preregistration ID: ju2c7). We then predicted the number of shared control tweets (the sum of liked and retweeted control tweets per participant). Again, we had to account for a highly skewed outcome distribution , and we estimated a negative binomial regression model to test hypothesis 1B. This model included the same predictors as the model described regarding hypothesis 1A. For correlational information on the predictors included in these models, please see Table S1 in The model was estimated using maximum likelihood estimation, and we included a dummy-coded predictor for each intervention group in the model . Here, we estimated a linear regression model to test hypothesis 1C. This model included the same predictors as the model described regarding hypothesis 1A.The Next, we describe 2 sets of post hoc analyses in studies 2 and 3 to explore the potential mechanisms underlying the observed intervention effects.changes, we slightly changed the experimental paradigm and repeatedly assessed the target constructs after each of the several short experimental trials for each participant.In studies 2 and 3, we examined whether providing users with a reference to their personal network, Twitter users overall, or both differentially impacts their sharing behavior. In addition, we explored 2 potential mechanisms behind the intervention effects by examining whether repeated exposure to balanced social information induces changes in social norms (study 2) or changes in social identity (study 3) might drive the reported intervention effects. To accurately track these The crowdsourcing platform Prolific Academic was used to recruit all participants for studies 2 and 3. In total, 650 English-speaking participants were invited. We collected all data for studies 2 and 3 on November 25, 2021. As several participants had to be dropped from the final sample because they did not provide consent after being briefed about the true study aims, we reported a final sample size of n=322 for study 2 and n=278 for study 3. We did not exclude participants who provided full consent. Again, the minimum age was 18 years, and we only invited users with >100 posts submitted on Twitter in the last 12 months. Participants were aged between 18 and 76 years  and either unemployed , in full-time employment , or in part-time employment .The procedure for studies 2 and 3 was similar to that of study 1. Again, participants were briefed that they were testing a tweet recommendation system, and after providing consent, they were randomly assigned to 1 of 4 experimental conditions. Each of the 3 intervention groups was shown Twitter\u2019s misinformation flag and 1 of 3 different social cues that either referenced only the user\u2019s personal network, all Twitter users, or combined both. Thus, the four conditions were as follows: (1) social reference cues  and misinformation flag, (2) social reference cues  and misinformation flag, (3) combined , and (4) control (no flag or frame).After being redirected to Chrome, participants were instructed to browse and interact with their personal Twitter feed as usual for three 5-minute trials. Again, participants in all groups had approximately 50% of their Twitter feed replaced with augmented tweets . All other parameters remained unchanged. If participants had seen all pieces of augmented tweets, they would repeat in a randomized order (see study 1). After each trial, the participants were redirected to the survey platform and asked to answer questions on social norms (study 2) or intergroup bias\u2013related traits (study 3). After 3 trials, the participants were debriefed about the true study aims, and consent was provided again. In addition, the participants in study 3 answered the postassessment measures on in-group identification. As described in the section regarding our experimental procedures, we ensured that misperceptions did not spread among participants after they were exposed to misinformation by providing them with screenshots of all misinformation tweets at the end of the study.For both studies, we again obtained demographic data  from Prolific.In study 2, we assessed subjective descriptive and injunctive norms using 1 item each after each trial. Regarding injunctive norms, we asked participants to rate the following statement: \u201cThe people I care about in my personal Twitter network approve of me sharing Covid-19-related information such as the ones I just saw\u201d . Regarding descriptive norms, the statement to be completed with the fitting assessment read: \u201cThe people I care about in my personal Twitter network...share Covid-19-related information such as the ones I just saw\u201d .In study 3, we assessed the intergroup bias on positive and negative traits after each trial. Intergroup bias\u2013related traits were, for example, \u201cintelligent,\u201d \u201ctrustworthy,\u201d or \u201cgullible,\u201d and participants rated how well those described their personal Twitter network and others with similar or different opinions on COVID-19 (range 1-7). All answers were used to compute an average score for each participant, with higher values indicating stronger bias. After completing all trials, participants answered 3 questions about their in-group identification regarding other users sharing their personal views on COVID-19 .To test hypotheses 2A, 2B, and 2C, we pooled the experimental data of study 2 and study 3. We not only had to account for the high number of participants sharing no tweets, and thus highly skewed outcome distributions (2A and 2B), but also for the nonindependence of repeated assessments across experimental trials within participants. Thus, we estimated negative binomial generalized linear mixed-effects models to examine hypotheses 2A and 2B and a linear mixed-effects model to examine hypothesis 2C.1, \u03b22, and \u03b23), with the control group serving as reference.The models were estimated using maximum likelihood estimation and, in the case of the 2 negative binomial mixed-effects models, with the bound optimization by quadratic approximation optimizer. The models again included a dummy-coded predictor for each intervention group in the model . However, none of these variables contributed significantly as a predictor, and all other estimates also remained unchanged across both models. For the results of all other estimated models described in the preregistration, please see Tables S2 to S5 in We begin by presenting the results regarding the effects of social reference cues  on sharing misinformation tweets, control tweets, and discernment , whereas only participants who saw the combined social cue and misinformation flag showed an improved discernment of shared misinformation and control information . As the thin tail of the model-based prediction distribution in Participants in the combined intervention group shared, on average, only half of the amount of misinformation compared with the control group , whereas 1 additional year of age was associated with an average 2% decrease in sharing .Beyond the intervention group, age and self-reported political orientation were significantly associated with the amount of misinformation shared. A 1-point stronger right-wing political orientation was associated with an average 9% increase in sharing  when provided with a cue referencing their personal network or their personal network and all Twitter users . We found that participants in the personal network group reported a significantly negative slope of injunctive norms across the experimental trials, suggesting that their perceived approval of sharing misinformation declined. In contrast, this was not observed in any of the other experimental groups. This indicates that changes in social norms might contribute to the effects of social cues on participants\u2019 sharing behaviors , whereas descriptive norms, perceptions of the frequency of a specific behavior within a social reference group, did not. This suggests that our social reference cue can provide a reference point on which behaviors are socially acceptable within users\u2019 personal networks. Previous research suggests that the approval of important others in personal networks is of key importance for processing misinformation [Our findings in studies 2 and 3 show that the social reference cues in combination with the social network misinformation flags change users\u2019 subjective ormation . The socormation . Interesormation . The facormation ,39. Simiormation . This alecho chambers, adding social cues with low frequencies of not sharing or liking tweets  might actually reinforce negative sharing patterns and the overall spread within these networks. Examining such potential negative effects is crucial before evaluating the overall effectiveness of social approaches in intervention development. Second, the significant results in study 2 fall just under the arbitrary \u03b1 level of .05. Thus, we only interpreted them as the first indication of a potential mechanism and not sufficient evidence to rest major claims on. Third, the time frame within our paradigm was very short in relation to the usually vast amount of information read before sharing and a usually lower percentage of fake news in users\u2019 feeds [Our findings are to be considered in the light of some substantial limitations. First, as our paradigm had no access to and thus could not analyze the actual amount of misinformation shared within participants\u2019 personal networks, the social reference cues  were a priori set by us. It remains to be seen whether basing the reference cues on actual shares has similar effects. It is especially important to test how lower rates of nonshares affect users\u2019 behavior. Considering the well-documented negative effects of so-called s\u2019 feeds . Thus, wIn contrast, our experimental paradigm has good external validity; by embedding our social reference cues within the general platform of a social media network, we used the actual user interface that the general population is exposed to. This allowed us to generalize our observed effects beyond those generated in laboratory settings . At the Our results suggest that it is possible to implement balanced social reference cues within the general user interface of social media platforms and that these social reference cues, together with the standard platform misinformation flags, can lead to reduced sharing of web-based misinformation and improved quality of overall sharing. In the context of major challenges to public health and public trust caused by excessive and strategically placed misinformation on social media, such building blocks to effective mitigation measures have the potential to reduce the sharing of misinformation with all its associated negative consequences."}
+{"text": "We develop an analytical statistical-mechanical modelto studythe dynamic properties of liquid water. In this two-dimensional model,neighboring waters can interact through a hydrogen bond, a van derWaals contact, or an ice-like cage structure or have no interaction.We calculate the diffusion coefficient, viscosity, and thermal conductivityversus temperature and pressure. The trends follow those seen in thewater experiments. The model explains that in warm water, heatingdrives faster diffusion but less interaction, so the viscosity andconductivity decrease. Cooling cold water causes poorer energy exchangebecause water\u2019s ice-like cages are big and immobile and collideinfrequently. The main antagonism in water dynamics is not betweenvdW and H bonds, but it is an interplay between both those pair interactions,multibody cages, and no interaction. The value of this simple modelis that it is analytical, so calculations are immediate, and it givesinterpretations based on molecular physics. This has poseda challenge for statistical-mechanical theories of its liquid properties.14 We have recently developed such a statistical-mechanical theoryfor water\u2019s equilibrium properties that treats H bonding andvdW interactions together. Herein, we use that approach to study water\u2019sdynamic properties. Some of the anomalous dynamic properties includethe breakdown of the Stokes\u2013Einstein relation16 and the non-Arrhenius to Arrhenius dynamic crossover at low temperatures.21Liquid water has anomalous aspects ofits energetic, volumetric,and dynamic properties relative to simpler liquids like argon.24 to study the dynamicproperties of pure water. The model was introduced in the 1970s byBen-Naim.28 The MB models of water are toy models but have the advantage thatcan explain in a simple way the interplay of thermodynamic propertiesand angle-dependent potential. The analytical theories for MB-likemodels allow the inclusion of orientation-dependent hydrogen bondingwithin a framework that is simple and nearly analytical. Accordingto the 2D MB model, each water molecule is a Lennard\u2013Jonesdisk with three arms, oriented as in the Mercedes-Benz logo, to mimicthe formation of hydrogen bonds. In a statistical-mechanical model,which is based on 2D Urbic and Dill\u2019s (UD) model22 being directly descendant from a treatment ofTruskett and Dill (TD), who developed a nearly analytical versionof the 2D MB model,30 each water molecule interactswith its neighboring waters through a van der Waals interaction andan orientation-dependent interaction that models hydrogen bonds. Herein,we extended the theory to calculate dynamics properties like diffusivity,viscosity, thermal conductivity, etc. The new version of the theorycan be used in all liquid regions of the 2D MB model, including supercooledwhere computer simulations cannot obtain dynamics properties due tocrystallization and convergence problems.Herein, we adopt a Mercedes-Benz-like model of water, whichhaspreviously been studied in 2D and 3D22 A partition function for a water molecule inthe bulk of different states of the water molecule  is written and static properties ofthe bulk water are calculated, and the details are provided in thesection on Results and DiscussionIn this article, westart from an analytical 2D UD theory of water.22 The system ofwater consists of N molecules. The theory is madefor a single water molecule in the hexagon and the relationship ofthat water to its clockwise neighbor  is the Boltzmann factor for the cooperativityenergy \u03f5c that applies only whensix water molecules all collect together into a full hexagonal cage.\u0394c is the Boltzmann factor for a cooperative hexagonalcage. It differs from \u0394HB only in that the formeruses the hexagonal cage volume per molecule, vc, while the latter uses the liquid water hydrogen-bondingvolume per molecule, vHB. We combine theBoltzmann factors for the individual water molecules to get the partitionfunction Q for the whole system of N particles.N/6 accountsfor the three possible interaction sites per water molecule and correctsfor double counting the hydrogen bonds. The populations of the states i = 1 (HB), 2 (LJ), 3(0), and 4(c) can be calculated asHerein, the test water has nointeraction with its clockwise neighbor.30 and given in the SI. For all of the modelcalculations, we used the following parameters: \u03f5HB = 1, rHB = 1, vdW: \u03f5LJ = 0.1, \u03c3LJ = 0.7 (unchanged from Truskett and Dill31 and the MB model32), ks = 10, and \u03f5c = 0.03.From the partition function, all otherthermodynamic properties below are obtained as described previouslyDi = \u03bbi2\u03bdi are thediffusion coefficients for HB, c, LJ, and 0 state of water.Diffusion processesoccur in fluid or gas whenever a property is transported in a mannerresembling a random walk. If we assume that the water molecules aredoing random walk, we can approximate the diffusion of our moleculesin 2D withC is the constant takingcare of the units only. The average bonding energies for each stateareThe different bond components have different step sizes. For HB andc states, we approximate it as the distance of HB interaction, forLJ state as LJ contact, and for 0 state to average distance betweenmolecules in 0 state.D, wecan readily calculate the viscosity of this model of water as33T and averagediameter d of water,dHB = dLJ = d0 = rHB while for state swaters form hexagons and the diameter of hexagon state we use equalto dc = 2rHB.From the computed diffusion coefficient 34We then also computed the thermal conductivity and thermaldiffusivityfrom this model. For this, we require the speed of sound, which isgiven by24 we present our results below in dimensionless units,normalized to the strength of the optimal HB, \u03f5HB, and HB separation, rHB . Our objective hereis to explain qualitatively the trends in experimental data basedon the model physics. We cannot compare quantitatively because themodel is 2D, while the data is in 3D, meaning that the geometriesof the molecules and the units of their properties are different.In this section, we give theorypredictions for how the dynamicproperties depend on temperature, pressure, and density. As has beendone previously,D = D(T) on temperature for liquid water acrossits liquid range with experiments. Not surprisingly, water\u2019sdiffusion gets faster at higher temperatures because more moleculessurmount the kinetic barrier to breaking water\u2013water bonding.In cold water, the bond-breaking is mostly of H-bonds; in hotter water,the steeper slope of D(T) comesfrom the lower barrier to breaking Lennard-Jones water\u2013watercontacts. See different contributions of different populations inthe SI.38Herein, we give the predictions and physical interpretations fromthe model. D = D(p), predicted versus experiments, for different temperatures.Higher-temperature water (green curves) is much like a normal Lennard-Jonesliquid\u2014the effect of pressure is mainly to squeeze moleculestogether, reducing their water\u2019s diffusion speed. In contrast,cold water has two pressure regimes. At low pressures, increasingthe pressure increases the water\u2019s diffusion rate because itbreaks H-bonded cage structures, freeing up waters from those constraintsand increasing 0 population. At higher pressures, water\u2019s cageshave largely been crunched into a dense LJ liquid as well as nonbondedstates and diffusion gets slower with further pressure.T) on temperature,from theory and experiment .The physics is the same as that described above for D(T), to which \u03b7(T) is inverselyrelated (see ated see 17.In thp), theory, and experiments. Again, the explanation is the same asfor D, becauseof the simple inverse relationship, SI, we have plottedthe water\u2019sdiffusivity versus \u03b7/T plot. This shows thedifference in comparison to Stokes\u2019 law. Normal Lennard-Jonesfluids have one line because the Stokes\u2019 law is valid in thewhole range. For water and its HB and cage states, we no longer haveone line, but different regions.In the The investigation discernsthat the primary contributions to thetotal diffusion arise from two distinct populations: free particlesand LJ particles. By analyzing the temperature and pressure dependenciesof these different populations, a more profound understanding of thediffusion process emerges. By analyzing the data, we can still inferwhich population serves as the primary contributor. Despite the complexity,it is possible to identify the dominant population influencing viscositythrough careful examination of the average water particle size, whichis intricately linked to all four quantities. Likewise, when thermalconductivity is scrutinized, the main influencing factors are densityand isothermal compressibility, both of which are intricately intertwinedwith all four population parameters.T) versustemperature, theory, and experiment . \u03bais the rate at which a material transports heat. The high-temperaturedecrease of \u03ba is the standard behavior of normal liquids. Asthe liquid density decreases, it is less effective in transportingheat through collisions. What is more remarkable is water\u2019sdecrease in \u03ba with reduced temperature in cold water. The modelshows this behavior too for high pressures. We attribute it to thepoor ability of water cages, which are relatively large and immobileto collide efficiently to transport heat. At lower pressures, we haveonly monotonic behavior in our model, but we do not have experimentaldata to compare. We believe that our model predicts monotonic behaviorbecause there are populations of other states that transport the heat.We attempted to establish a connection betweenthe roles of cooperativelyrearranging regions in anomalous diffusion within the model. However,our efforts were unsuccessful across the range of temperatures andpressures that were explored. Additionally, we did not observe theoccurrence of a dynamic crossover.In this work, we have developed a theoryfor the dynamic propertiesof bulk water within a 2D MB-like model of water. The model assumesthree states for each water\u2013water interaction, hydrogen bonded,van der Waals bonded, and nonbonded, and calculations are nearly analytical.The results for diffusivity, viscosity, thermal conductivity, andthermal diffusivity obtained by the analytical theory give the correctgeneral trends as for real water. Theory can easily calculate dynamicproperties in the supercooled region of the phase space since we donot have problems with crystallization."}
+{"text": "Tandem of P domains in a weak inwardly rectifying K+ channel (TWIK)-related acid sensitive +K-1 channel (TASK-1) is activated under extracellular alkaline conditions (pH 7.2\u20138.2), which are upregulated in astrocytes (particularly in the CA1 region) of the hippocampi of patients with temporal lobe epilepsy and chronic epilepsy rats. Perampanel (PER) is a non-competitive \u03b1-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) antagonist used for the treatment of focal seizures and primary generalized tonic\u2013clonic seizures. Since AMPAR activation leads to extracellular alkaline shifts, it is likely that the responsiveness to PER in the epileptic hippocampus may be relevant to astroglial TASK-1 regulation, which has been unreported. In the present study, we found that PER ameliorated astroglial TASK-1 upregulation in responders (whose seizure activities were responsive to PER), but not non-responders (whose seizure activities were not responsive to PER), in chronic epilepsy rats. ML365 (a selective TASK-1 inhibitor) diminished astroglial TASK-1 expression and seizure duration in non-responders to PER. ML365 co-treatment with PER decreased spontaneous seizure activities in non-responders to PER. These findings suggest that deregulation of astroglial TASK-1 upregulation may participate in the responsiveness to PER, and that this may be a potential target to improve the efficacies of PER. Epilepsy is clinically characterized by the periodic and unpredictable occurrence of seizures, which are initiated by the synchronous and rhythmic firing of populations of neurons in the brain. Multifactorial events are involved in seizure generation, such as an aberrant inflammatory response, deregulations of voltage-gated ion channel and ion/neurotransmitter transporters and abnormal neuronal circuits. In particular, the imbalance between \u03b3-aminobutyric acid (GABA)-ergic inhibition and glutamatergic excitatory transmissions has received focus as a potential factor for ictogenesis (seizure generation) ,2,3,4. TSince glutamatergic hyperexcitation causes the pathogenesis of epilepsy and the seizure-induced secondary neuronal damage, the abrogation of presynaptic glutamate release and/or postsynaptic glutamate receptor functions are therapeutic targets to inhibit ictogenesis. Perampanel benzonitrile) is an AED acting as a non-competitive \u03b1-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) antagonist . HoweverA) receptor-mediated inhibition [+ concentration ([K+]o), which leads to hyperexcitability of neurons by inhibiting K+ efflux from neurons during repolarization o under pathophysiological conditions [+ conductance in astrocytes is significantly lower in the hippocampus of TLE patients [tes them ,33. TASKnditions ,35. Indenditions ,37,38. Fpatients , and AEDpatients . In partHere, we demonstrate that PER reduced the increased TASK-1 expression in CA1 astrocytes of responders (whose seizure activities were responsive to PER), but not non-responders (whose seizure activities were not responsive to PER). In addition, ML365 co-treatment with PER diminished seizure activity in non-responders, concomitant with the TASK-1 downregulation. To the best of our knowledge, our findings suggest, for the first time, that dysregulation of AMPAR-TASK-1 interactions may be relevant to refractory seizures in response to PER, and TASK-1 inhibition may improve the responsiveness to PER.n = 7), total seizure frequency (number of seizures), total electroencephalographic (EEG) seizure duration and average seizure severity  were 12.7 \u00b1 1.9, 586 \u00b1 86 s and 3.2 \u00b1 0.3 over the 1-week period, respectively (n = 7) showed a gradual decreases in seizure frequency (\u03c72(7) = 27, p < 0.001, Friedman test), seizure duration  = 13.473, p < 0.001, repeated measures ANOVA) and seizure severity (\u03c72(7) = 30, p < 0.001, Friedman test) over the 1-week period (\u03c72(2) = 13.4, p = 0.001, Kruskal\u2013Wallis test with Tukey post hoc test), 300 \u00b1 52 s  = 28.2, p < 0.001, one-way ANOVA with Bonferroni\u2019s post hoc test) and 2.2 \u00b1 0.4 (\u03c72(2) = 12.6, p = 0.002, Kruskal\u2013Wallis test with Tukey post hoc test) over the 1-week period, respectively . TASK-1 expression was also detected in astrocytes in the molecular layer and the hilus of the dentate gyrus of control rats (n = 7), TASK-1 expression was clearly detected in most reactive CA1 astrocytes (hypertrophy and hyperplasia of cell bodies and processes of astrocytes). However, TASK-1 expression was rarely observed in reactive astrocytes within the dentate gyrus , PER reduced TASK-1 fluorescence intensity to 1.21-fold of control level  = 32.7, p < 0.001, one-way ANOVA with Bonferroni\u2019s post hoc test), but not non-responders  = 55.1, p < 0.001, one-way ANOVA with Bonferroni\u2019s post hoc test), but not non-responders , total seizure frequency, total EEG seizure duration and average seizure severity were 13.4 \u00b1 1.1, 535 \u00b1 79 s and 3.4 \u00b1 0.2 over the 1-week period, respectively  = 3.8, p = 0.005, repeated measures ANOVA, n = 5), but not seizure frequency and seizure severity over the 1-week period (t(8) = 4.9, p = 0.001, Student\u2019s t-test; t(8) = 4.7, p = 0.002, n = 5, respectively, Student\u2019s t-test) and 0.69-fold of vehicle levels (t(8) = 6.5, p < 0.001, n = 5, respectively, Student\u2019s t-test; To investigate the role of TASK-1 in intractable seizure activity, we examined whether TASK-1 inhibition by ML365 (a selective TASK-1 inhibitor ) affectsectively A\u2013C. ML36k period A,B. Thusn = 5), total seizure frequency, total EEG seizure duration and average seizure severity were 16.6 \u00b1 2.1, 616 \u00b1 51 s and 3.3 \u00b1 0.2 over the 1-week period, respectively (\u03c72(7) = 17.5, p = 0.014, n = 5, Friedman test), seizure duration  = 4.5, p = 0.002, n = 5, repeated measures ANOVA) and seizure severity (\u03c72(7) = 16, p = 0.025, n = 5, Friedman test) in non-responders over the 1-week period , total seizure duration to 334 \u00b1 38 s (t(8) = 9.9, p < 0.001, Student\u2019s t-test), and average seizure severity to 2.7 \u00b1 0.2  over the 1-week period (t(8) = 4.5, p = 0.002, n = 5, respectively, Student\u2019s t-test) and 0.68-fold of PER levels (t(8) = 6.6, p < 0.001, n = 5, respectively, Student\u2019s t-test) in non-responders  reduce astroglial TASK-1 expression in the epileptic hippocampus ,40. The The limitations of the present study are the small sample size of the animal numbers in each group and the large error bars (SD) in the effect of ML365 co-treatment on refractory seizures in non-responders to PER. Since SD represents the variability of the observation, the large error bars may be due to the small sample size in each group. Furthermore, we cannot exclude that the broad spectrum of the responsiveness of ML365 in non-responders would also lead to these results. Further studies are needed to overcome these limitations.This study utilized the progeny of male Sprague Dawley (SD) rats (7 weeks old). This is because estrous cycle affects the function of the hippocampus and seizure activity ,61,62. TRats were given LiCl  24 h before the pilocarpine treatment. Animals were intraperitoneally (i.p.) treated with pilocarpine (30 mg/kg) 20 min prior to atropine methylbromide  treatment. Diazepam  was administered 2 h after onset of SE and repeated as needed. Control animals received saline in place of pilocarpine. The volume of each solution administered was 0.2 mL. Thereafter, rats were video-monitored 8 h a day for general behavior and occurrence of spontaneous seizures for 4 weeks after SE ,15,38,412O:O2). Some rats were also implanted with an infusion needle  into the right lateral ventricle . Throughout surgery, the core temperature of each rat was maintained at 37\u201338 \u00b0C. The electrode was secured to the exposed skull with dental acrylic [Control and epilepsy rats were implanted with monopolar electrodes  in the right hippocampus  under isoflurane anesthesia  were also used as controls. After recording (18 h after the last drug treatment), animals were used for Western blot . Other rats were used for immunofluorescence study .After baseline seizure activity was determined over 3 days, PER  or saline (vehicle) was administered daily at 6:00 p.m. over a 1-week period ,15,38,41n = 10; ML365-infused rats, n = 10, respectively). Other animals  were also given daily vehicle or PER by the aforementioned method . The volume of each solution administered was 0.2 mL. After recording (18 h after the last drug treatment), animals were used for Western blot or immunofluorescence studies (n = 5 in each group).Non-responders in experiment I were given saline (i.p.) over a 7-day period. Thereafter, rats were connected to an Alzet 1007D osmotic pump  to infuse with vehicle or ML365 . Thereafter, total protein concentration was calibrated using a Micro BCA Protein Assay Kit . Western blot was performed by the standard protocol: Sample proteins (10\u2009\u03bcg) were separated on a Bis-Tris sodium dodecyl sulfate\u2013polyacrylamide (SDS\u2013PAGE) gel and transferred to membranes. Membranes were incubated with 2% bovine serum albumin (BSA) in Tris-buffered saline , and then incubated with primary antibodies  buffer  containing protease inhibitor cocktail  and phosphatase inhibitor cocktail . Rats were perfused with 4% paraformaldehyde via the ascending aorta. The brains were then removed, immersed in the same fixative overnight and cryoprotected in 30% sucrose in phosphate buffer (PB). Coronal sections (30 \u03bcm) of the brain samples were cut using a cryostat. After rinses with phosphate-buffered saline (PBS) over 10 min and subsequent blocking with 10% goat serum  for 30 min at room temperature, tissues were reacted with primary antibodies overnight at 4 \u00b0C . Section5 \u03bcm2) were selected from the CA1 region. Thereafter, fluorescence intensity was measured using AxioVision Rel. 4.8 and ImageJ software (1.53t). The investigators were blinded to experimental groups when performing morphological analysis and immunofluorescence experiments [For quantification, five hippocampal sections from each animal were randomly captured and areas of interest  were assessed by different investigators who were blind to the classification of animal groups and treatments. Shapiro\u2013Wilk W test was used to evaluate the values on normality. Student\u2019s In the present study, we demonstrated, for the first time, that that TASK-1 inhibition improved the efficacy of PER in non-responders, and that the upregulated TASK-1 expression in CA1 astrocytes prolonged seizure duration, although it did not affect the generation of seizure activity. Therefore, our findings suggest that dysregulation of astroglial TASK-1 function may be involved in intractable seizures to PER, and TASK-1 inhibition may be one of the therapeutic targets for refractory TLE medications ."
\ No newline at end of file