diff --git "a/deduped/dedup_0144.jsonl" "b/deduped/dedup_0144.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0144.jsonl"
@@ -0,0 +1,78 @@
+{"text": "Involving patients in decision making on diagnostic procedures requires a basic level of statistical thinking. However, innumeracy is prevalent even among physicians. In medical teaching the 2 \u00d7 2 table is widely used as a visual help for computations whereas in psychology the frequency tree is favoured. We assumed that the 2 \u00d7 2 table is more suitable to support computations of predictive values.184 students without prior statistical training were randomised either to a step-by-step self-learning tutorial using the 2 \u00d7 2 table (n = 94) or the frequency tree (n = 90). During the training session students were instructed by two sample tasks and a total of five positive predictive values had to be computed. During a follow-up session 4 weeks later participants had to compute 5 different tasks of comparable degree of difficulty without having the tutorial instructions at their disposal. The primary outcome was the correct solution of the tasks.There were no statistically significant differences between the two groups. About 58% achieved correct solutions in 4\u20135 tasks following the training session and 26% in the follow-up examination.These findings do not support the hypothesis that the 2 \u00d7 2 table is more valuable to facilitate the calculation of positive predictive values than the frequency tree. Diagnostic procedures are increasingly expected by consumers to ensure their health; \"certainty\" has become a product . AssuminInvolving lay people in decision making on diagnostic procedures requires a basic level of statistical thinking. Help for computing Bayesian inference is needed. Statistical thinking can be enhanced by representing statistical information in terms of natural frequencies rather than probabilities ,7. This In cognitive psychology the frequency tree is used as visual help for the representation of frequencies, a variant of a tree structure often used in decision analysis to teach computing the positive predictive value the simple way Figure  4]. Thi. Thi4]. In contrast, in medical science the 2 \u00d7 2 table is the standard method to teach computing predictive values  Students attending the University of Hamburg , a vocational college  or taking part in an in-service training  were informed about the timing and content procedure of the study during their courses.The study was carried out between October 2000 and July 2001 and consisted of two supervised sessions lasting about 1 h each. The recruited 184 students were randomly assigned either to the frequency tree group (n = 94) or to the 2 \u00d7 2 table group (n = 90) using blocked randomization in blocks of 10. Concealed allocation based on computer-generated random numbers was done by an external person. In addition, the external person prepared sealed envelopes for both sessions including the tutorial with the tasks and a questionnaire for survey of age, gender, years of school, mark in mathematics and social state. The training consisted of a written step-by-step self-learning tutorial , 2, 3. TIn the follow-up examination participants were again asked to solve 5 different diagnostic problems of similar level of difficulty but without having the tutorial instructions at their disposal ,5,6. ParA solution was classified correct, when the documented positive predictive value was equivalent to the correct solution rounding up or down to the next full percentage point. If a participant used the correct computation  but made a calculation error either in the transfer of the numerical information into the visual help or within the division, we ignored calculation errors. Whenever a different computation such as rule of three \u2013 a mechanical method for solving proportions \u2013 was used or the calculation protocol was missing the rounded solutions were classified likewise as correct by congruence. If the protocol indeed showed that a correct rounded solution resulted from an incorrect computation such as positive predictive value = correct positives / false positives the answer was classified as incorrect. Tasks that had not been worked on were also classified incorrect.To evaluate the usefulness of the different visual helps, we evaluated the ability of correct transfer of the numerical information into the charts. A transfer was classified as correct, when the numerical information of the problems was inserted into the gaps provided. It was sufficient to insert the relevant values for the computation, calculation errors were ignored.The computation was classified as correct Bayesian approach when the following computation was used: positive predictive value = correct positives /  or positive predictive value = correct positives / all positives. The computation was classified as Non-Bayesian approach when the computation was used with false values. Other computations were classified as other strategies.Table Analysis is based on the intention-to-participate principle that includes all randomised participants as randomised. Drop outs were considered as having solved none of the positive predictive values correctly.Figure The groups were similar regarding demographic variables Table .Table Within the category 4\u20135 correct answers 27% of participants  (2 \u00d7 2 table) and 26%  (frequency tree) had correct solutions. The differences between the two study groups were not statistically significant neither in the training session (p = 0.95 {0.49 one-sided}) nor in the follow-up examination ; n = 297/450 (2 \u00d7 2 table)] were solved correctly in both groups. The amount of correct solutions decreased to 26% (n = 98/370) and 31% (n = 115/375), respectively, in the follow-up examination. Differences between groups were not statistically significant  and 76% (n = 342/450 2 \u00d7 2 table) of the tasks. In the follow-up examination in 63% (n = 234/370) and 70% (n = 264/375), respectively, the information was correctly transferred into the visual helps (Table The application of the Bayesian computation in the training session was correctly used in 65% (n = 307/470 frequency tree) and in 61% (n = 273/450 2 \u00d7 2 table). In the follow-up examination 21% (n = 76/370) and 22% (n = 83/375), respectively, used correct Bayesian computation . Mathematics literacy was stated to be poor in Germany especially in girls . A high In conclusion, our findings do not support the hypothesis that the 2 \u00d7 2 table is more valuable to facilitate the calculation of positive predictive values than the frequency tree. Regardless which visual help is used there is a need for improvement of teaching methods to approach lay people who want to participate in medical decision making.None declared.AS as the principal investigator planned and performed the study analysed the data and wrote the paper. AB contributed to planning and performance of the study. JB calculated the power of the study and carried out the statistical analysis of data. IM contributed to all parts of the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Original questionnaire used in the 2 \u00d7 2 table group in the 1. session in German language.Click here for fileOriginal questionnaire used in the frequency tree group in the 1. session in German language.Click here for fileTasks used in the questionnaires of the training session in English language.Click here for fileOriginal questionnaire used in the 2 \u00d7 2 table group in the 2. session in German language.Click here for fileOriginal questionnaire used in the frequency tree group in the 2. session in German language.Click here for fileTasks used in the questionnaires of the follow-up examination in English language.Click here for file"}
+{"text": "Elective endotracheal intubations are still commonly performed without premedication in many institutions. The hypothesis tested in this study was that morphine given prior to elective intubations in neonates would decrease fluctuations in vital signs, shorten the duration of intubation and reduce the number of attempts.2<85%), duration of procedure, duration of hypoxemia (Sp02<85%), number of attempts and change in mean blood pressure were compared between groups.From December 1999 to September 2000, infants of all gestations admitted to a level III neonatal intensive care unit and requiring an elective endotracheal intubation were randomly assigned to receive morphine 0.2 mg/kg IV or placebo 5 minutes before intubation. Duration of severe hypoxemia (HR< 90/min and Sp034 infants (median 989 g and 28 weeks gestation) were included. The duration of severe hypoxemia was similar between groups. Duration of procedure, duration of hypoxemia, number of attempts and increases in mean blood pressure were also similar between groups. 94% of infants experienced bradycardia during the procedure.We failed to demonstrate the effectiveness of morphine in reducing the physiological instability or time needed to perform elective intubations. Alternatives, perhaps with more rapid onset of action, should be considered. Endotracheal intubation is a painful and stressful procedure, which is associated with acute increases in blood pressure and intracranial pressure, bradycardia and hypoxemia . These pMost premature infants and many term infants admitted to neonatal intensive care units (NICU) will require one or more endotracheal intubations during their stay. In 1994, 84% of Canadian NICUs, including ours, rarely or never used premedication for elective intubations . In 2000A literature review revealed six randomized controlled trials -14, compWe reviewed our policy, which did not include premedication for elective endotracheal intubations, in light of the current evidence. As morphine has been used for years in neonates with apparent safety and efficacy for pain and as staff in our unit were comfortable with this medication, we aimed to evaluate the efficacy of morphine, in achieving better intubation conditions and success while maintaining vital signs stability.Infants of all gestations, admitted to McMaster University Medical Center level III NICU and considered likely to need an elective oral or nasotracheal intubation during their hospital stay, were candidates for inclusion in this study. Families were approached for consent as soon as possible after birth when an elective intubation during their hospital stay seemed likely: if their infant(s) was less than 30 weeks gestation, already ventilated , was on NCPAP for respiratory distress or was needing an elective surgery. Others were approached when an elective intubation was needed. At the time of this study, our unit was a 33-bed level 3 NICU, caring for both inborn and outborn patients, and the referral center for 25000 annual deliveries, with 900\u20131000 admissions per year.Infants were excluded if they met any of the following conditions: 1) absence of an intravenous access, 2) upper airway anomaly potentially leading to a difficult intubation, 3) cyanotic heart disease, 4) upper gastrointestinal obstruction (which would require a rapid sequence intubation) or 5) concurrent opioid administration.Infants requiring an elective intubation were randomly assigned to receive either morphine 0.2 mg/kg IV or placebo (0.9% NaCl), given over 1 minute, followed 5 minutes later by the intubation. This larger dose of morphine was chosen for the perceived acuity of pain produced by an intubation; a larger dose may be more effective to decrease the struggling by infants during the procedure, which is caused by pain. Infants were randomized according to a computer-generated random number table with random block sizes. Morphine and placebo were supplied in identical unidose vials, labeled PIN Rx, which were prepared by one pharmacist according to the randomization sequence and placed in sealed, consecutively numbered envelopes, which were opened just before intubation. Thus, randomization occurred just prior to intubation.2 and hand-ventilated with a self-inflatable bag for 1\u20132 minutes prior to intubation. Infants having their endotracheal tube replaced were ventilated through their existing tube until it was removed. Vital signs  were captured to a laptop computer from the infant's monitor  every 5 seconds (except blood pressure which was obtained with a self inflating cuff every minute) using Procom Plus Communication Software, from the time the study medication was given (which was considered the baseline) to 5 minutes after the infant's vital signs returned to pre-procedure values. One of three investigators, not involved in the procedure collected the following data manually: duration of the procedure  and the number of intubation attempts (defined as number of times the laryngoscope was inserted in the mouth). If there was more than one attempt, the clock continued between attempts and was stopped only when tube placement was confirmed by auscultation. In our NICU, the preferred method of intubation is via the nasotracheal route if mechanical ventilation is expected for more than a few hours.Three to four minutes after receiving the study medication, infants were preoxygenated with 100% 0a, neonatal fellows b, pediatric residents c, clinical nurse specialists d, clinical nurse specialist students e and transport nurses f. After 2 unsuccessful attempts by a junior team member , a more experienced intubator  was called.All team members performed the intubations: staff neonatologists Institutional ethics committee approval and informed consent from the parents were obtained for this study.2 < 85% with a HR< 90/min. This was felt to be the most undesirable side effect of endotracheal intubation as cerebral blood flow in neonates is highly dependent upon heart rate. Secondary outcomes included: (1) duration of the procedure, (2) duration of hypoxemia (Sp02 < 85%), (3) number of attempts, (4) maximum change in blood pressure from baseline, (5) occurrence of bradycardia (HR<90/min).The study aimed to test the hypothesis that morphine 0.2 mg/kg would decrease fluctuations in vital signs, shorten the duration of the procedure and reduce the number of attempts. The primary outcome was the duration of severe hypoxemia, defined as Sp0The study group's impression was that a majority of infants experience some degree of severe hypoxemia during an elective intubation, which was clinically undesirable. It was estimated to be 30 seconds, based on experience. In order to detect a one standard deviation difference in duration of severe hypoxemia between the 2 groups , 17 patients per group were required.Because the distribution of the main outcome was skewed and groups were small, continuous variables were compared using the Mann-Whitney U test. Dichotomous variables were compared using Fisher's exact test or Chi-square test. A p value < 0.05 (2-sided) was considered significant for the primary outcome; p < 0.01 was considered significant for secondary outcomes to account for multiple analyses in a small sample. Level of experience of the intubator, birth weight and gestational age were separately explored as potential confounders of the primary outcome using ANOVA or linear regression.Patients were recruited from December 1999 to September 2000. Patient flow in the study is depicted in figure Baseline characteristics are presented in Table 2 < 85%) during intubation. The median duration of hypoxemia was 235 sec in the treatment group and 90 sec in the control group (p = 0.04). Because of our small sample and the likelihood of finding a significant result by chance alone when assessing multiple outcomes, it was decided a priori that a p value of 0.01 would be considered significant for secondary outcomes. Nevertheless, this represents an interesting but somewhat worrisome trend. No difference was found in the maximal increase in blood pressure. Ninety-four percent of patients experienced bradycardia (HR<90/min) during the procedure with no difference between groups.All patients in the treatment group and 14/17 in the control group experienced hypoxemia , was similar to controls (median 1); total number of attempts was 38 in the premedicated infants versus 31 in the controls. Success rate at first attempt or need to call a more senior intubator after 2 failed attempts did not differ between groups. Because of the higher than usual dose of morphine that was used, we monitored the need to increase ventilator support over the next 24 h, in infants having their tubes changed, but found no difference between groups.Newborn infants, especially premature ones have adverse physiological responses to routine care procedures ,4. EndotOur hypothesis was that a moderate dose of morphine would facilitate intubation and stabilize vital signs better than placebo. Our data does not support this hypothesis. No significant difference was identified between the treatment and the control group in any prespecified outcome. The choice of severe hypoxemia as the primary outcome, although clinically very important, significantly limited the number of observations and increased the possibility of a type 2 error, as few infants met the criteria defining this outcome. The onset of action of morphine is about 5 minutes in infants, but the peak action occurs only at 15 to 30 minutes , perhapsThe only trend we identified was the duration of hypoxemia, which appeared longer in the treatment group. Most desaturations were in the mid 70's to low 80's range, but this is still a worrisome finding. We were unable to identify if birth weight, gestation or experience level of the intubator were significant contributors. Our sample size likely did not permit to identify such a contributor. Although morphine may not be potent enough to significantly relax infants to permit quicker and easier intubations, it may lead to decreased functional residual capacity in partially sedated infants, which could account for prolonged desaturations. The hypoxemia could have been compounded by the use of self-inflating bag and masks, which cannot provide a positive end-expiratory pressure (PEEP). Also, the larger dose of morphine used in this study could have contributed to this potential problem, by further decreasing the FRC in partially sedated infants. This trend is in keeping with the finding that, although not statistically significant, median duration of the procedure was 3 times as long in the treatment group as in the controls.Ninety four percent of infants experienced bradycardia, mostly vagal, during their intubation. As cerebral blood flow in infants is greatly dependent on heart rate, our data adds to the current knowledge that including atropine in the premedication appears warranted. Although there may be concern that atropine could mask hypoxia-induced bradycardia, the now universal use of oxygen saturation monitors should ensure that hypoxemia is identified.Previous trials have used various combinations of drugs for premedication and overall, they suggest that premedication is effective and safe. Kelly  and BarrOur study has several limitations. First, our sample size is relatively small, which precludes us from eliminating a type 2 error. We began this project with the assumption that severe hypoxemia would occur for about 30 seconds, which was not the case. An observational study would have been useful before making this assumption. Although limited in size, results of this trial should be useful for future investigators and clinicians in their choice of premedication. Second, due to limited resources , as this study was planned as a pilot, to assess feasibility and adequacy of equipment to obtain data, we decided not to stratify for gestational age. This could have been very useful in refining the findings, as more immature infants may respond differently to premedication in general and have less strength to struggle during an unpremedicated or not sufficiently premedicated painful procedure. Third, as we wanted to mimic our actual NICU practices, in view of modifying such practices, we did not restrict the study intubations to very experienced operators. As a result, there was substantial variability in the level of experience between individuals. Given our small number of patients, this might have impacted on the outcomes. Fourth, several eligible infants were not enrolled. This was due to unavailability of either trial investigators or parents, as many intubations occurred at night. The infants enrolled and those not enrolled had similar birth weights, gestation and reason for intubation, which is reassuring, but does not eliminate the potential for enrolment bias.Infants are entitled to effective pain management strategies . It seem2 oxygen saturation, ETT endotracheal tube, IVH intraventricular hemorrhage, PVL periventricular leukomalacia, NICU Neonatal Intensive Care Unit, PEEP positive end-expiratory pressureHR heart rate, BP blood pressure, Sp0The authors declare that they have no competing interests.BL led the study design and manuscript preparation and contributed to data collection. MM contributed to the study design and manuscript preparation. JD contributed to the study design, manuscript preparation and data collection. AK contributed to data gathering and manuscript editing. SG prepared the study medication and contributed her pharmaceutical expertise to the choice of medication dose for the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "S100B belongs to a family of calcium-binding proteins implicated in intracellular and extracellular regulatory activities. This study of serum S100B in primary progressive multiple sclerosis (PPMS) is based on data obtained from a randomized, controlled trial of Interferon \u03b2-1a in subjects with PPMS. The key questions were whether S100B levels were associated with either disability or MRI findings in primary progressive MS and whether Interferon \u03b2-1a has an effect on their S100B levels. Serial serum S100B levels were measured using an ELISA method. The results demonstrated that serum S100B is not related to either disease progression or MRI findings in subjects with primary progressive MS given Interferon \u03b2-1a. Furthermore there is no correlation between S100B levels and the primary and secondary outcome measures. S100B belongs to a family of calcium-binding proteins implicated in intracellular and extracellular regulatory activities . IntraceSeveral studies suggest that S100B has a role in the pathogenesis of multiple sclerosis (MS). Phenotypically and functionally similar T cells specific against S100B can be detected in the peripheral blood of MS patients making S100B a putative candidate auto-antigen in MS . FurtherInterferon-\u03b2 (IFN-\u03b2) is effective in reducing relapse rate in relapsing-remitting ,14,17 anIn this clinically negative phase II study , we asse\u00ae, Biogen) and were assessed three monthly over a study period of 2 years. Fifteen of these patients were treated with IFN\u03b2-1a 30\u03bcg intramuscularly (im) weekly (IFN30), 15 received IFN\u03b2-1a 60\u03bcg im weekly (IFN60) and 20 with placebo. IFN\u03b2-1a was reduced to half dose in 5 subjects receiving 60\u03bcg im weekly, and in 2 subjects receiving IFN\u03b2-1a 30\u03bcg im weekly. Seven subjects withdrew from treatment [Fifty patients with PPMS were recruited in a phase II trial of IFN\u03b2-1a . Progression was defined as a sustained (3 months apart) increase of at least 1.0 on the EDSS scale between 0 to 5 and 0.5 for subjects with EDSS score of 5.5 and above.Fourteen healthy subjects served as controls.All subjects provided informed consent prior to their inclusion in the study. This study was approved by the ethics committee and has therefore been performed with the ethical standards laid down in the 1964 Declaration of Helsinki.MRI was performed at baseline and 6 monthly for 2 years. Only baseline and year 2 data were included in this study. Brain and spinal cord atrophy, ventricular volume, T1 and T2 lesion load were measured as described elsewhere .Serum samples were centrifuged and stored at -20\u00b0C. Serum S100B levels were quantified using a modified ELISA method as previously described by Green et al. . Ninety-Median, interquartile range and significance of group differences (Mann-Whitney U tests) were evaluated. Changes of serum level over time were examined using variance components regression models of serum response variable on time as predictor, with random subject-specific intercepts and fixed common slopes. Curvature was assessed using a quadratic term in time; modification of curve over time by treatment was assessed using additional terms for treatment and treatment by time interaction in the model. Two sets of treatment terms were used: i) indicators of assigned weekly dose ii) average weekly dose over follow-up (including changes to dose regime) as continuous variable. Modification of the curve over time by MRI variable values were similarly examined using terms for MRI variable and MRI variable by time interaction.Direct associations between serum level and MRI/clinical variables were examined by regression models of 24 month serum on 24 month MRI variable, adjusting for baseline serum and MRI values (this type of model takes into account change from baseline), with additional terms for treatment and treatment by MRI variable interaction, the latter to assess possible modifications of the relationship by treatment.Software used were the SPSS software package (version 11.0 for Windows) and Stata 7.0 .The median and interquartile ranges for all subjects are described in Table There was no change over time in the serum S100B levels. The shape of the serum trajectory did not vary between the treatment regimes, i.e. placebo vs. IFN30 vs. IFN60.There was no evidence that the 24-month serum S100B values were associated with either changes in the T1 or T2 loads, or ventricular or cord volumes at 24 months, after adjusting for the baseline values of each subject. There was no correlation with disease progression on the EDSS. There was also no evidence that these relationships were modified by treatment assignment  (Table These results suggest that serum S100B levels in patients with PPMS were not affected by intramuscular IFN\u03b2-1a and that there was no observable change in S100B over time. Furthermore, we did not observe any correlation between S100B levels and clinical disability or between S100B and quantitative MRI measures.This study therefore suggests Although there is evidence that S100B elevation in MS is related to inflammatory activity ,13, thisIt would be valuable to identify surrogate markers of clinical progression in PPMS to aid the development of effective therapeutic intervention, since clinical trials with a disability endpoint are very large and resource consuming. It is possible that such markers would need to be less related to acute inflammation and more dependant on other neuropathology such as axonal loss and regeneneration."}
+{"text": "Cost-effectiveness acceptability curves (CEACs) describe the probability that a new treatment or intervention is cost-effective. The net benefit regression framework (NBRF) allows cost-effectiveness analysis to be done in a simple regression framework. The objective of the paper is to illustrate how net benefit regression can be used to construct a CEAC.One hundred patients referred for ambulatory monitoring with syncope or presyncope were randomized to a one-month external loop recorder (n = 49) or 48-hour Holter monitor (n = 51). The primary endpoint was symptom-rhythm correlation during monitoring. Direct costs were calculated based on the 2003 Ontario Health Insurance Plan (OHIP) fee schedule combined with hospital case costing of labour, materials, service and overhead costs for diagnostic testing and related equipment.In the loop recorder group, 63.27% of patients (31/49) had symptom recurrence and successful activation, compared to 23.53% in the Holter group (12/51). The cost in US dollars for loop recording was $648.50 and $212.92 for Holter monitoring. The incremental cost-effectiveness ratio (ICER) of the loop recorder was $1,096 per extra successful diagnosis. The probability that the loop recorder was cost-effective compared to the Holter monitor was estimated using net benefit regression and plotted on a CEAC. In a sensitivity analysis, bootstrapping was used to examine the effect of distributional assumptions.The NBRF is straightforward to use and interpret. The resulting uncertainty surrounding the regression coefficient relates to the CEAC. When the link from the regression's p-value to the probability of cost-effectiveness is tentative, bootstrapping may be used. Out patient ambulatory monitoring is often performed in patients with syncope  that present in the primary care setting to diagnose or exclude an arrhythmia, a potentially serious etiology -6. This true ICER is \u00a330,000 per QALY, the ICER estimate could be more or less due to sampling variability. In fact, the multiple sclerosis drug with the ICER estimate of \u00a335,000 per QALY could have a true ICER of \u00a330,000 per QALY. It would be a mistake to conclude there is no chance that the drug is cost-effective if \u03bb = \u00a331,000, for example.A new health care treatment, intervention or technology is cost-effective if (1) the extra cost of (2) an extra unit of effect is less than (3) the decision maker's willingness to pay for it. A cost-effectiveness analysis (CEA) can report (1) and (2), representing two of the three pieces of information necessary to determine cost-effectiveness. Specifically, an incremental cost-effectiveness ratio (ICER) is the ratio of extra cost to extra effect . Thus, a CEA generates an estimate of the extra cost for an additional unit of effect, but the merit of the trade-off is typically a matter of opinion. In other words, the data are generally silent on whether the extra effect is worth the extra cost. For example, a new drug for multiple sclerosis may provide an extra quality adjusted life year (QALY) for \u00a335,000. The new drug is cost-effective if the decision maker is willing to pay \u00a335,000 or more for an extra QALY. Thus the verdict of cost-effectiveness depends upon the decision maker's willingness to pay (\u03bb), a value not known from the cost and effect data. There is additional uncertainty beyond the fact that \u03bb is unknown. The uncertainty comes from the fact that the sample ICER is a statistical estimate. For example, if the The cost-effectiveness acceptability curve (CEAC) elegantly handles both uncertainty problems. This paper, building on recent work by Fenwick and colleagues , illustrOne hundred patients referred for ambulatory monitoring with syncope or presyncope (hereafter described as syncope) were randomized to a one-month external loop recorder (n = 49) or 48-hour Holter monitor (n = 51). Patients provided written informed consent, and the protocol was approved by the University of Western Ontario Ethics Review Board. The primary endpoint was symptom-rhythm correlation during monitoring. Direct costs in Canadian dollars were calculated from the Ministry of Health's perspective based on the 2003 Ontario Health Insurance Plan (OHIP) fee schedule for professional fees and on hospital case costing data for the calculation of labour, materials, service and overhead for diagnostic testing and related equipment. Costs were converted to US Dollars using a conversion rate converted on July 20th, 2005 of ($1 USD = $1.21543 CAD) [Loop recorders were both more costly and more effective than Holter monitors. For the loop recorder, the cost in US dollars was $648.50 and for the Holter monitor $212.92 . The extone-sided significance level for testing the null hypothesis that the \"new treatment\" is not cost-effective  [The CEAC has been advocated for summarizing the results of a CEA because it highlights the relationship between the assessment of cost-effectiveness and the unknown \u03bb -27. As ol costs) ,28. Undea Bayesian CEAC requires the specification of the prior distribution of the cost-effectiveness data before the data were collected. Typically as a reference case scenario, it is common and convenient to use a 'non-informative' prior which allows the data to overwhelm prior beliefs. However, except in the simplest of examples there is no agreement about the definition of a reference prior distribution and many so-called non-informative priors are not non-informative at all . When u5.5.1 of . For a m5.5.1 of -33).nbi = \u03bb\u00b7effecti - costi from person-level effect (effecti) and cost (costi) data . When onbi = \u03b20 + \u03b21TX + \u03b5TX is a \"new treatment\" indicator variable , the coefficient estimate of \u03b21, call this b1, equals the difference in mean nb for the loop and Holter groups. It can be shown [1 > 0, then the loop recorder is cost-effective relative to the Holter monitor . The statistical uncertainty involving the cost and effect data is expressed in the p-value for b1. The p-value for b1 can be used to make the y-axis of the CEAC [where be shown  that whethe CEAC ,25; howe1 > 0 as a function of \u03bb. Most statistical packages have regression programs that report a two-sided p-value, but in this case a one-sided probability is indicated. Because the two-sided p-value is twice as much probability as is needed, it is necessary to divide it by two . Figure 1. When b1 < 0, the probability that new treatment is cost-effective equals the one-sided p-value, and when b1 > 0, the probability that new treatment is cost-effective equals one minus the one-sided p-value. Thus when using the p-value from a regression to make a CEAC, one must check that one is using the one-sided p-value and that one is doing the correct calculation given the sign of b1 . Lastly, because the p-value of a parametric analysis is derived from a distributional assumption, non-parametric methods like bootstrapping may offer better alternatives when distributional concerns arise .Using the NBRF and a Bayesian perspective, the CEAC illustrates the probability that a \"new treatment\" is cost-effective by graphing the probability that \u03b2Each study participant who received a loop recorder incurred costs of $648.50 and 31 of the 49 (63.27%) had symptom recurrence and successful activation. In comparison, the Holter monitors cost $212.92 for each study participant and only 12 of the 51 (23.53%) experienced a successful outcome. The NBRF was implemented by estimating with OLS the regressionnbi = \u03b20 + \u03b21LOOP + \u03b5LOOP is an indicator variable equaling one if the patient received a loop recorder and zero if the patient received a Holter monitor. Table nbi) was calculated for each person when \u03bb was set to $1000.where LOOP indicator variable for \u03bb = $500 through $3000  as well as the regression and bootstrap estimates of the probability that the loop recorder is cost-effective . For \u03bb < $1000, the estimate of the incremental net benefit is negative , so the quantity to calculate for the CEAC's vertical axis is simply one half of the two-sided p-value. For \u03bb > $1000, the estimate of the incremental net benefit is positive , so the quantity to calculate for the CEAC's vertical axis is one minus one half of the two-sided p-value. Figure Table A CEAC indicates a 50% chance of cost-effectiveness when \u03bb equals the sample estimate of the ICER . The ICE1), net benefit regression provides an estimate of the mean net benefit of \"usual care\" (\u03b20), the mean net benefit of \"new treatment\" (\u03b20 + \u03b21) and also regression diagnostic information . Thus, the NBRF facilitates using regression diagnostics  to imprThe NBRF provides a way for economic evaluations to use the variety of tools that have been developed for regression. For any value of \u03bb, net benefit regression produces a cost-effectiveness estimate, and the CEAC produces a cost-effectiveness probability. To allow for the fact that the analyst does not know the decision maker's \u03bb, the horizontal axis of a CEAC varies in the style of a sensitivity analysis, and the statistical uncertainty about cost-effectiveness is reflected on the vertical axis. This paper has illustrated how the NBRF can be used to construct a CEAC. When the link from a net benefit regression's p-value to the probability of cost-effectiveness is tentative, bootstrapping provides an alternative.CEACs: cost-effectiveness acceptability curvesICER: incrememtnal cost-effectiveness ratioNBRF: net benefit regression frameworkOHIP: Ontario Health Insurance PlanOLS: ordinary least squaresQALY: quality adjusted life yearThe author(s) declare that they have no competing interests.JSH- 1) made substantial contributions to conception and design, analysis and interpretation of data; 2) was involved in drafting the manuscript and revising the manuscript critically for important intellectual content; and 3) has given final approval of the version to be published.MAR- 1) made substantial contributions to the conception and design, analysis and interpretation of data; 2) was involved in revising the manuscript critically for important intellectual content; and 3) has given final approval of the version to be published.ADK- 1) made substantial contributions to conception and design, analysis and interpretation of data; 2) was involved in revising the manuscript critically for important intellectual content; and 3) has given final approval of the version to be published.bmcFIGS9.doc is Figure bmcFIGS9.doc is Figure The first Figure in The pre-publication history for this paper can be accessed here:"}
+{"text": "Ploidy and cell proliferation determined by flow cytometry were assessed on colorectal cancers from patients admitted to two Italian cancer research centres. A total of 181 patients were followed prospectively for 4 years at the Istituto Regina Elena (IRE) of Rome and at the Istituto Nazionale Tumori (INT) of Milan. Fresh (at the IRE) or frozen (at the INT) tumour material and similar procedures were used for subsequent sample preparation. Similar frequencies of aneuploid tumours (63% vs 66%) and superimposable median DNA indices (1.6) were observed for the two case series. In both series, DNA ploidy was generally unrelated to clinico-pathological factors, except for a higher frequency of aneuploid tumours in Dukes' D (88%) than in Dukes' A stage (33%) in the IRE experience. DNA ploidy was a weak prognostic indicator at 3 years but not at 4 years in the IRE case series, and it never exhibited a clinical relevance in the INT experience. Conversely, multiploidy was an indicator of worse relapse-free and overall survival at 4 years in the IRE and INT case series."}
+{"text": "This study was designed to assess the motivations of senior medical clinicians to teach medical students. This understanding could improve the recruitment and retention of important clinical teachers.The study group was 101 senior medical clinicians registered on a teaching list for a medical school teaching hospital . Their motivations to teach medical students were assessed applying Q methodology.Of the 75 participants, 18 (24%) were female and 57 (76%) were male. The age distribution was as follows: 30\u201340 years = 16 participants (21.3%), 41\u201355 years = 46 participants (61.3%) and >55 years = 13 participants (17.3%). Most participants  were staff specialists and 27 (36%) were visiting medical officers. Half of the participants were internists , 12 (16%) were surgeons, and 24 (32%) were other sub-specialists. Of the 26 senior clinicians that did not participate, two were women; 15 were visiting medical officers and 11 were staff specialists; 16 were internists, 9 were surgeons and there was one other sub-specialist. The majority of these non-participating clinicians fell in the 41\u201355 year age group. The participating clinicians were moderately homogenous in their responses. Factor analysis produced 4 factors: one summarising positive motivations for teaching and three capturing impediments for teaching. The main factors influencing motivation to teach medical students were intrinsic issues such as altruism, intellectual satisfaction, personal skills and truth seeking. The reasons for not teaching included no strong involvement in course design, a heavy clinical load or feeling it was a waste of time.This study provides some insights into factors that may be utilised in the design of teaching programs that meet teacher motivations and ultimately enhance the effectiveness of the medical teaching workforce. Clinical teachers are central to the successful education of medical graduates. They are a precious resource with a range of competing activities like clinical care and research. In order to better recruit and retain clinical teachers, medical schools must be cognisant of the variety of factors that may motivate doctors to teach students. Medical schools have increased expectations of clinical teachers with curriculum development, small group dynamic teaching and assessment responsibilities, yet have little direct line management of clinical teachers. In Australia, universities do not pay their clinical teachers and therefore they do not \"own\" them. Hospitals pay doctors and implicitly expect them to teach as a service to the profession. There is no clearly stated contractual requirement. Substantial resource is put into training clinical teachers and schools are interested in minimising teacher turnover. Initial motivation and any accompanying rewards are central to remaining motivated to teach. Equally medical schools have an incentive to recruit satisfied and effective teachers in order to improve educational outcomes.A motive can be defined as an entity that impels one to action of a particular type. In contemporary psychology, motivation encompasses three areas: drives , goals or purpose  and reinforcers (entities that increase or decrease the probability of a behaviour being replicated such as pleasure/pain or reward/punishment) . MotivatSo what is understood of the motivations of clinical teachers? Clinical supervisors rated predetermined possible motivations to explain their volunteering to teach: personal satisfaction was highest, followed by the opportunity to attract students to one's speciality area. Less important was any sense of prestige or improved standing amongst peers. Despite focusing on an intrinsic motivator, this group still identified a need to be acknowledged by the medical school. Faculty appointments, discounted continuing education, access to computerised information and libraries along with better education as clinical teachers were all valued as suitable rewards. Supervisors in open responses did not suggest monetary compensation . Work foA review of rewards and incentives for non-salaried clinical teachers found that most medical schools offered some incentive such as educational opportunities, academic appointments and special recognition events . MedicalThis study applied Q methodology, an established sorting method, to quantify subjective views on motivation. This method has previously successfully screened aspiring schoolteachers as to why they chose a career in teaching  . Their appearance on the list implied some interest in teaching. Demographic data collected included gender, age group , employment contract , and the speciality of the clinician .This method was chosen as the assessment and statistical method for the study as it combines qualitative and quantitative research traditions   representing different points of view among the clinicians. The clinician's loading on a factor indicated his/her shared viewpoint with other clinicians on the same factor. The clinicians loading on any one factor indicated a shared common viewpoint about their reasons for teaching by the similar rank ordering of their statement rankings. Positive scores indicated agreement, while negative scores indicated disagreement. Decreasing scores reflected less important views. Importantly, these factors were not considered as traits of the group, psychological or otherwise. They represented only common subjective opinions obtained at a single point in time in a cross-sectional survey method i.e. they reflected correlations between people not items. Q methodology yields ipsative rather then normative data in that a person reveals \"individual\" opinions rather than in comparison with another opinion . Each idAll 101 teachers were approached for participation. Of the 75 participants 18 (24%) were female and 57 (76%) were male with the following age distributions: 30\u201340 = 16 (21.3%), 41\u201355 = 46 (61.3%) and greater than 55 = 13 (17.3%). Most were staff specialists  and 27 (36%) were visiting medical officers. Half of the participants were internists , 12 (16%) were surgeons and 24 (32%) were other groups.Of the 26 senior clinicians who did not participate 2 were women, 15 were visiting medical officers and 11 staff specialists, 16 were internists, 9 surgeons and 1 other. All but 2 of these clinicians fell in the 41\u201355 year age group. The participating teachers were seen to not differ significantly from the complete teaching list. Most nonparticipants were on leave during the study period.The data sorted into four factors: Factor 1 Table , 3 sorts\u2022 helping students become good doctors\u2022 enjoying the challenge of effective teaching\u2022 valuing the presentation of one's own specialty\u2022 enjoyment of small group teaching\u2022 inspiration from mentors and past teachers\u2022 liking to be challenged in one's views\u2022 feeling responsible for students\u2022 wanting to understand students.The descending rank reflects less important views. These keen clinical teachers did not agree that they taught to \"perform in front of an audience\" and disagreed that teaching was boring, unsupported or a waste of time.Factors 2, 3 and 4, the \"I struggle to teach because ......\" factor, represented 7 participant views in total, agreeing with a number of negative statements about teaching. Highly ranked negative items included:\u2022 lack of involvement in course design\u2022 lack of enjoyment in teaching\u2022 clinical load deterring involvement in teaching.It appears these 7 sorts are from those not motivated to teach. The software used prevented any further analysis of participants' demographic details and Q sorts.This study shows that most senior medical clinicians, of diverse discipline, are motivated to teach medical students and that the main reason appears altruistic \u2013 a desire to help students become good doctors. A small, but not insignificant group, of senior clinicians do not want to teach, citing lack of involvement in the design in the course and excessive clinical load as negative motivators. Given the participants were taken from supposed active teaching lists this imbalance is not surprising.Our results show that the majority of senior clinicians motivated to teach (factor 1) dwelt on a number of common items: inspiration from senior mentors, the altruistic role in development of junior doctors and the opportunity to highlight a specialty area. These items draw from concepts of goal directed or purposeful drivers of behaviour. Fulkerson highlighted some of these factors in a 1997 study . These aFactors 2 to 4 reflected small numbers of clinicians  apparently disinterested in teaching. They cited issues such as disengagement with course material, lack of pleasure in teaching and excessive clinical load as impediments to teaching. While small in number, their views are worth examination as the dissenting opinion. These items are reinforcers  of teaching behaviours. Schormair et al, 1992  also dreThe limitations of our study include the qualitative nature of the observations, the lack of breadth of sampling , the lack of inter-rater reliability assessments and the forced normalisation of the questions . Each member of the research team may have introduced the study differently . Although deidentified, the fact that each researcher recorded the views of their participants may have biased away from socially undesirable responses. The statements also cannot be considered exhaustive of all the possible reasons that may motivate a clinician to teach. A computerised questionnaire may also have been more efficient and interactive. It also must be remembered that motivation is an inherently complex construct and while Q methodology capture subjective views, it may not net all aspects of motivation.There is also the issue of social desirability bias. Participants were aware that the evaluator was a colleague and would be aware of their results, perhaps skewing answers to those apparently more favourable. This may have contributed to an artificial multi-modal distribution. The questionnaire itself may also have contributed to an information bias. For example, in the heading it was requested to either strongly agree or strongly disagree rather than to give a more open level of agreement assessment. The questions asking why \" I don't teach\" to a group who are all allegedly teachers may lead to confusion, and again an observation bias or a classification bias. The incorrect placement of double negatives and even triple negatives may have led to noise, obscuring real differences and opinion.Clinical teachers are a valuable resource. They are essential to the successful teaching of medical students. Our study identified matters within the \"ownership\" of universities: engagement of clinical teachers in course design. This is an area ripe for action from medical schools and these data suggest that real inclusion would improve clinical teacher motivation. Rather more metaphysically, encouraging teachers to dwell on the inspirational models of their mentors may also enhance recruitment and retention. Opportunities to highlight special interests and to teach effectively would also be sensible strategies. Allowing clinical teachers to engage with small groups of students and to develop some understanding of student needs would meet the teachers' motivation to demonstrate their understanding of student experience. This sample suggests that contracts, money, a sense of duty and peer pressure play little part in motivating teachers. Previous research however, makes clear the important place of modest rewards such as Dean's teaching prizes. These data also underline the negative effect of service burden amongst clinical teachers. While this is not immediately under medical school control, universities can contribute meaningfully to discussions on balance of service and teaching commitments amongst health staff.This method could be replicated amongst more varied clinical teachers such as community practitioners and non-medical teachers to assess consistency of motivation. Further work is required to study the impact on clinical teacher workforce recruitment and retention through meeting these expressed motivations. We plan an intervention study to understand the effectiveness of tailoring teaching experience to these identified motivators. An understanding of intrinsic motivation is only helpful if it leads to higher teacher satisfaction, better quality teaching and retention in the workforce.Our inquiry suggests that promotion of teaching to senior clinicians is likely to have increased success if prospective teachers contribute to course development, sufficient time is allocated to teaching, memories of inspirational teachers are reawakened, the link between strong teaching and junior doctor outcomes is emphasised, and staff are reminded of the opportunity to 'advertise' their specialty. Medical schools face increasing difficulties staffing clinical programs and this study provides avenues to improve recruitment of senior medical staff to the teaching ranks.The author(s) declare that they have no competing interests.All authors contributed to design, data collection and paper preparation. DM and CO also conducted the data analysis.The pre-publication history for this paper can be accessed here:"}
+{"text": "Post thrombotic syndrome (PTS) is a burdensome and costly complication of deep venous thrombosis (DVT) that develops in 20\u201340% of patients within 1\u20132 years after symptomatic DVT. Affected patients have chronic leg pain and swelling and may develop ulcers. Venous valve disruption from the thrombus itself or thrombus-associated mediators of inflammation is considered to be a key initiating event for the development of venous hypertension that often underlies PTS. As existing treatments for PTS are extremely limited, strategies that focus on preventing the development of PTS in patients with DVT are more likely to be effective and cost-effective in reducing its burden. Elastic compression stockings (ECS) could be helpful in preventing PTS; however, data on their effectiveness are scarce and conflicting.The SOX Trial is a randomized, allocation concealed, double-blind multicenter clinical trial. The objective of the study is to evaluate ECS to prevent PTS. A total of 800 patients with proximal DVT will be randomized to one of 2 treatment groups: ECS or placebo (inactive) stockings worn on the DVT-affected leg daily for 2 years. The primary outcome is the incidence of PTS during follow-up. Secondary outcomes are severity of PTS, venous thromboembolism (VTE) recurrence, death from VTE, quality of life and cost-effectiveness. Outcomes will be evaluated during 6 clinic visits and 2 telephone follow ups. At baseline, 1 and 6 months, blood samples will be obtained to evaluate the role of inflammatory mediators and genetic markers of thrombophilia in the development of PTS (Bio-SOX substudy).The SOX Trial will be the largest study and the first with a placebo control to evaluate the effectiveness of ECS to prevent PTS. It is designed to provide definitive data on the effects of ECS on the occurrence and severity of PTS, as well as DVT recurrence, cost-effectiveness and quality of life. This study will also prospectively evaluate the predictive role of biomarkers that are reflective of putative underlying pathophysiological mechanisms in the development of clinical PTS. As such, our results will impact directly on the care of patients with DVT.NCT00143598 and ISRCTN71334751 The post thrombotic syndrome (PTS)  is a chronic condition that develops in 20\u201340% of patients within 1\u20132 years after symptomatic deep venous thrombosis (DVT). A severe form, which can include venous ulcers, affects 1/4 to 1/3 of patients with PTS [Patients with PTS experience pain, heaviness, swelling, or other symptoms in the affected limb, which are typically aggravated by standing or walking and improve with rest and recumbency. Edema, venous ectasia, hyperpigmentation, eczema, and varicose collateral veins may be apparent. In severe cases, ulceration can occur .Since PTS is a direct consequence of DVT, its prevalence is influenced by the incidence of DVT. Despite advances in VTE prevention and treatment, the annual incidence of VTE has not decreased over time, and remains at 1.0\u20131.6 per 1000 persons per year, with a per-person lifetime incidence of 2\u20135% ,4. BecauWhile hereditary and acquired risk factors that predispose to the development of VTE are widely known , factorsWhile the pathophysiology of PTS is incompletely understood, it is likely that the acute thrombus itself, associated mediators of inflammation, and the process of vein recanalization in the weeks following DVT induce damage to venous valves, leading to valvular incompetence (reflux). Valvular incompetence and/or persistent venous obstruction by thrombus cause venous hypertension, which promotes capillary leakage of plasma proteins, erythrocytes and leukocytes and the development of venous ectasia and varicosities. The result is edema, tissue hypoxia, and ultimately, in some cases, skin ulceration -14.Inflammation and thrombosis are closely interrelated -17. It hD-dimer is a degradation product of cross-linked fibrin that reflects fibrinolysis and is an indirect marker of coagulation activation. Recent work performed by our group and by others suggests that D-dimer levels appear to be a significant predictor of first VTE  and of rThrombophilia refers to an inherited or acquired predisposition to VTE. Over 10% of the general population is affected by one or more identifiable inherited thrombophilias which have been shown to underlie at least 1/3 of cases of VTE . The mosWhile results of a few studies to date suggest that thrombophilia does not increase the risk of developing PTS ,8,10, noPTS could be averted by primary prevention of the initial DVT with the judicious use of thromboprophylaxis , and by A significant reduction in the overall burden of PTS is unlikely to be achieved by attempts to prevent the initial DVT or by treatment of established PTS. Rather, strategies that focus on preventing the development of PTS in patients with DVT are more likely to be effective and cost-effective in reducing the patient and societal impact of PTS.Graduated elastic compression stockings (ECS) work by providing graded compression to the leg that is highest at the ankle, which assists the calf muscle pump, reduces venous hypertension and valvular reflux, and consequently reduces edema, improves tissue microcirculation, and prevents skin breakdown ,49. BothIn light of the above, we believe that a large scale, randomized placebo-controlled trial of ECS to prevent PTS is needed to provide definitive evidence of effectiveness, or lack of effectiveness, of ECS. This will allow physicians to make informed, evidence-based decisions regarding their use in DVT patients. Furthermore, such a trial will permit prospective evaluation of the predictive role of markers of inflammation, d-Dimer and thrombophilia in PTS.The SOX Trial is a Canadian, multicenter, randomized double-blind controlled trial in patients with a first episode of proximal DVT.The primary aim of the study is to evaluate whether graduated elastic compression stockings compared to inactive (placebo) stockings, worn daily for 2 years after DVT is diagnosed, decrease the incidence of PTS.Secondary aims are 1) to evaluate whether active compared with inactive stockings reduce the severity of PTS, 2) to compare mean quality of life (QoL) scores during follow-up in the active intervention vs. control groups, 3) to describe the rates of recurrent DVT, death from VTE, venous ulcers, and major bleeding during the 2-year follow-up in the active intervention vs. control groups, 4) to evaluate the cost-effectiveness of ECS for the prevention of PTS, and 5) to determine whether markers of inflammation, D-dimer and thrombophilia influence the development and severity of PTS (Bio-SOX biomarker substudy).The study was initially designed as a factorial design randomized clinical trial whose primary aims were to determine whether (1) elastic compression stockings used for 2 years compared to inactive (placebo) stockings, and (2) celecoxib, a COX-II inhibitor, used for 30 days compared to placebo, were effective in preventing PTS in patients with symptomatic proximal DVT. The rationale for the use of a COX-II inhibitor was to assess whether an anti-inflammatory drug used acutely could limit the extent of venous valvular damage and reduce the frequency of subsequent PTS. However, in December 2004, The National Institutes of Health announced suspension of the use of celecoxib for all participants in a large colorectal cancer prevention clinical trial conducted by the National Cancer Institute, because analysis by an independent Data Safety and Monitoring Board (DSMB) showed a 2.5-fold increased risk of major fatal and non-fatal cardiovascular events for participants taking the drug compared to those on a placebo. As a result of this announcement, the SOX Trial Steering Committee decided on December 21, 2004 to discontinue the Celecoxib intervention of the SOX Trial . This deThe study is a randomized, allocation concealed, double-blind multicenter clinical trial with an intervention allocation ratio of 1:1 , who have no contraindications to standard anticoagulant therapy and who provide informed consent are eligible for the study.Patients are excluded if they 1) have a contraindication to compression stockings e.g. previously documented moderate to severe peripheral arterial disease of the lower extremities, absence of palpable pedal pulses or arterial compromise due to massive venous obstruction; 2) have a limited lifespan (estimated < 6 months); 3) have geographic inaccessibility preventing their return for follow-up visits; 4) demonstrate inability to apply stockings daily ; or 5) were prescribed lytic therapy to treat their acute DVT.Once the patient is recruited and randomized via the SOX Trial's web-based interface, the computer generates a unique treatment code for each patient, according to treatment group and center. The study nurse faxes the patient's leg measurements to the stocking supplier, who then ships the assigned pair of ECS to the patient . ECS are pre-packaged by the manufacturer in a plain box, labeled with the unique stocking code . The same procedure is used to replace the patient's ECS every 6 months during the trial.Several strategies are used to protect against bias, including: randomization with allocation concealment, enrolling consecutive patients, blinding subjects to treatment assignment, blinding investigators, study nurses and outcome assessors  to treatment assignment, strict inclusion and exclusion criteria, and use of validated measures to diagnose PTS, recurrent VTE and to measure QoL. To prevent unblinding of study nurses, patients are instructed not to wear ECS on the day of their study visits. While it is possible that patients may be able to distinguish active from inactive ECS, this is minimized by (1) using inactive ECS, developed by the manufacturer, that appear identical to active ECS, and (2) recruiting patients with a first DVT, i.e. likely to be \"ECS-na\u00efve\". In addition to such pre-trial design features, we will assess the blinding procedures by asking patients, investigators and research nurses at the end of the trial (i.e. at 2 years or at time of study termination) if they were aware of the treatment assignment.Study patients are followed for 2 years after enrollment. The procedures at each visit are shown in Table The primary outcome measure is the incidence of PTS during 2 year follow up. PTS will be diagnosed at the 6 month visit or later if the patient reports pain and swelling of \u2265 1 month's duration that is typical in character , and that is present \u2265 6 months after the acute DVT . PatientSecondary outcomes measures include:\u2022 Reflux: Reflux will be assessed and quantified in a standardized fashion by venous ultrasound ,56.\u2022 Recurrent VTE: Objective tests and validated algorithms will be used to diagnose recurrent DVT and PE, as described previously -59, and \u2022 Bleeding: Clinically suspected bleeding events will be documented by recording the clinical event and results of any objective diagnostic testing performed. Bleeding will be defined as major if it is clinically overt and associated with a fall in hemoglobin of 20 g/L or a need for transfusion of \u2265 2 units of red blood cells; if it was intracranial or retroperitoneal; or if it warranted the permanent discontinuation of anticoagulation. Less severe clinically overt bleeding which is considered abnormal will be classified as minor.\u2022 Markers of inflammation: C-reactive protein will be assayed using a nephelometric assay. IL-6, IL-8 and MCP-1 will be measured using commercial ELISA kits which include plasma controls . At the time of blood draw for markers of inflammation, data will be recorded on time of day, type and duration of heparin use, concomitant medications and medical conditions.\u2022 DNA polymorphisms associated with thrombophilia: QIAGEN kits and standard protocols will be used to extract DNA from peripheral blood leukocytes. Samples will be run on the ABI Prism 3100 Genetic Analyzer to analyze Factor V Leiden, Prothrombin G20210A, PAI-1 4G/4G, TAFI T1053C, TFPI C536T, TFPI T33C and FXIII Val34Leu.\u2022 Coagulation and ELISA-based assays: Factor VIII assays will be performed using the PTT based Diagnostica Stago . D-dimer testing will be performed with the IL-Test Latex Agglutination method . Lupus anticoagulant testing will be performed on an ACL9000 . Standard aPTTs are performed using Alexin HS  and HemosIL APTT-SP  as a screening test. Abnormal results are followed by a 50:50 mix using Cryocheck Normal , followed by Platelet Neutralization Procedure. Additionally, a Dilute Russell Viper Venom test is performed using IL test LAC Screen followed by Confirm . IgG and IgM antiphospholipid antibodies are tested usingapHL-HRP ELISA Kit .\u2022 Quality of life measures: Quality of life will be measured using the SF-36 questionnaire for generic QOL ,61., and\u2022 Cost Effectiveness measures: A decision tree-based cost effectiveness analysis will be used to assess the relative cost-effectiveness of the active stockings in reducing the incidence of PTS, as compared to a strategy of inactive stockings ,65. TreeWe hypothesized that event rates (i.e. PTS at 2 years) will be 30% in the inactive stocking vs. 20% in the active stocking group, i.e. a risk reduction of 33%. Our baseline event rate and effect size for the stocking group were based on a systematic review of available published data . The totFor the biomarker analyses, our sample size provides > 80% power to detect ORs of 0.5 or lower, or 2.0 or higher. Larger alternatives will be associated with increased power. With regard to inflammatory markers, the analysis will be largely exploratory, as this study will be among the first to provide prospective data on levels of markers of inflammation in patients with DVT and PTS. However, the study design provides power of at least 80% to detect differences on the order of 1/3 of a standard deviation or larger between initial values of inflammatory markers in the two allocation groups.An intention-to-treat analytical approach will be used for all outcomes. Descriptive statistics for baseline variables will be calculated to describe the baseline status of the treatment groups. For the primary outcome variable PTS, a logistic regression analysis initially adjusted only for center will be used to compare the incidence rates between the active vs. inactive stockings groups. In secondary analyses, other covariates that will be adjusted for are duration of anticoagulation with warfarin, recurrent ipsilateral DVT during follow-up, temporary use of active stockings, initial type and duration of heparin anticoagulation, co-morbid conditions that could lead to leg symptoms/signs and differences in pertinent baseline variables. The number needed to treat for benefit will be calculated. As an adjunct to the primary analysis, a secondary explanatory (per-protocol) analysis will be performed as well. Subgroup analyses by age, sex, level of compliance, duration of warfarin anticoagulation and recurrent VTE during study follow-up are also planned.th percentile. For binary and nominal data, the appropriate chi-square tests will be used to examine the respective crude associations, and for continuous variables, the unpaired 2-tailed t-test. To examine adjusted associations, multiple logistic regression analyses will be performed in which the dependent variable is the presence of PTS. The independent variables to be tested are markers of thrombophilia, D-dimer, and levels of CRP, IL-6, IL-8 and MCP-1. Other variables of interest (for interaction and/or confounding) are age, sex, ethnicity, comorbid illness, allocation to active ECS, type and duration of heparin and warfarin use, type of DVT , and recurrent DVT during follow-up. The analyses will aim to (1) identify the strength of the association between relevant biomarkers, other relevant explanatory variables and PTS; and (2) explore relevant interactions. Similarly, multiple linear regression will be performed in which the dependent variable is the severity of PTS, as measured by the Villalta scale.For the secondary outcomes valvular reflux, recurrent VTE, death from VTE, venous ulcer, major bleeding, and severity of PTS, rates in the two intervention groups will be described, and between-group differences explored in similar regression procedures. For differences in mean quality of life scores between intervention groups, analysis of variance incorporating treatment and center will be used. A difference of 4\u20135 points between groups is considered to be clinically meaningful. Analysis of covariance with adjustment for age, sex and comorbidity will also be used to compare quality of life between groups. For the biomarker variables, univariate analysis will be used to determine the strength of association between each biomarker variable and the occurrence of PTS. For genetic markers, heterozygotes and homozygotes will be analyzed together, given the rarity of homozygotes. IgG, IgM and lupus anticoagulant results will be dichotomized as normal or abnormal. Factor VIII, D-dimer and markers of inflammation will be analyzed both as continuous data and as proportion of values exceeding the upper 90An interim analysis for efficacy will be performed when half of the subjects have completed 2 years of follow-up. The analysis plans call for a Lan-DeMets alpha spending approach with an O'Brien Fleming boundary .\u00ae . Analysis of the cleaned database will be carried out at the coordinating center under the supervision of study principal investigators.All data are collected using standardized case report forms. Data is entered on-line at study sites using a customized web-based data entry tool, and data quality is maintained via use of validation checks at the time of data entry. Data will be reviewed and cleaned by the database coordinator on an on-going basis by initiating and following up on queries to the sites. Data management is being overseen by TrialStatThe Steering Committee is chaired by the study principal investigator and includes the trial coordinator and all SOX Trial grant co-applicants. The Steering Committee meets regularly and on an as-needed basis to monitor trial progress, assess the need for changes in procedures, and address issues that could affect the integrity or projected timeframe of the trial. The Expert Adjudication Committee for all outcome events is comprised of two thrombosis experts who are not co-investigators or collaborators. Clinical details and diagnostic studies relating to suspected outcome events and deaths are reviewed by the committee, who are blinded to treatment assignment. The Independent Data Safety and Monitoring Committee consists of an experienced thrombosis physician, a biostatistician and an experienced clinical trialist. Episodes of symptomatic recurrent venous thromboembolism, the post-thrombotic syndrome, and death from all causes are reported to the Chair of the Committee on a quarterly basis.Each patient is provided with written information about the trial and written informed consent is obtained prior to study inclusion. The study protocol has been approved by Health Canada and by the local Research Ethics Committees of the participating centres.In this report, we describe the protocol of a multicenter randomized placebo controlled trial of elastic compression stockings for the prevention of post-thrombotic syndrome . This large, methodologically rigorous study is evaluating the effectiveness and cost-effectiveness of ECS to prevent PTS and has been designed to provide definitive data on the role of ECS in the prevention of PTS. As such, our results will impact directly on the care of patients with DVT. This will also be the first study to prospectively evaluate the predictive role of biomarkers that are reflective of putative underlying pathophysiological mechanisms in the development of clinical PTS (Bio-SOX biomarker substudy). Our findings will increase understanding of PTS and could result in the development of novel therapies aimed at candidate biomarkers.The author(s) declare that they have no competing interests.SRK wrote the initial protocol and designed this study. HS is the trial coordinator and co-authored the manuscript. All other co-authors contributed to study design and/or manuscript revisions.The pre-publication history for this paper can be accessed here:"}
+{"text": "PROforma is one of several languages that allow clinical guidelines to be expressed in a computer-interpretable manner. How these languages should be compared, and what requirements they should meet, are questions that are being actively addressed by a community of interested researchers.We have developed a system to allow hypertensive patients to be monitored and assessed without visiting their GPs (except in the most urgent cases). Blood pressure measurements are performed at the patients' pharmacies and a web-based system, created using PROforma, makes recommendations for continued monitoring, and/or changes in medication. The recommendations and measurements are transmitted electronically to a practitioner with authority to issue and change prescriptions.We evaluated the use of PROforma during the knowledge acquisition, analysis, design and implementation of this system. The analysis focuses on the logical adequacy, heuristic power, notational convenience, and explanation support provided by the PROforma language.PROforma proved adequate as a language for the implementation of the clinical reasoning required by this project. However a lack of notational convenience led us to use UML activity diagrams, rather than PROforma process descriptions, to create the models that were used during the knowledge acquisition and analysis phases of the project. These UML diagrams were translated into PROforma during the implementation of the project.structure preserving design, that is to say that the models used in the design and implementation of a knowledge-based system should be structurally similar to those created during knowledge acquisition and analysis. Ideally the same language should be used for all of these models. This means that great importance has to be attached to the notational convenience of these languages, by which we mean the ease with which they can be read, written, and understood by human beings. The importance of notational convenience arises from the fact that a language used during knowledge acquisition and analysis must be intelligible to the potential users of a system, and to the domain experts who provide the knowledge that will be used in its construction.The experience accumulated during this study highlighted the importance of  We have implemented a distributed system for the management of hypertensive patients. The study is one of a number of initiatives in which the management of chronic conditions is addressed by improving the connections between different community-based professionals and, specifically, extending the traditional role of pharmacists in dispensing medicines to allow them to give advice based on measurements of their patients' conditions. This system is being used in a small study in which patients' blood pressures are monitored by their local pharmacists. Six community pharmacies are participating. Initially 250 suitable patients will be identified by the pharmacists from their prescriptions and invited to participate.The project builds on earlier work evaluating a stand-alone computer-based decision support tool . In thisThe system provides potential benefits to patients and healthcare providers in that it should be cheaper and more convenient for patients to visit their pharmacists rather than their GP's surgery.In this paper we present an account of the development of the system. Our account focuses on the formalism used to represent the clinical guideline and is intended as a qualitative evaluation of the appropriateness of the guideline representation language, PROforma, in a practical setting.Systematic reviews of randomised controlled trials have shown that clinical guidelines are an effective tool for improving the quality of care and changing clinical practice . Healthcknowledge representation languages. In the next two sections we consider guideline and process representation languages, concentrating on one in particular, PROforma.Computerised guidelines are an attractive paradigm for clinical decision support tools, since much of the knowledge contained in guidelines has already been rendered explicit. A number of groups have now developed languages that express medical guidelines and processes, with the hope that non-programmers will be able to create computerised clinical guidelines. These are examples of A computer interpretable guideline (CIG) is a representation of the knowledge that is needed in order for a computer system to advise clinicians in a way that adheres to guidelines for clinical practice. A number of knowledge representation languages have been developed specifically for the purpose of representing such knowledge. These languages include Arden Syntax,8, AsbruMedical Logic Modules (MLM), each of which encodes the logic necessary for an individual medical decision. A MLM contains information representing the context in which an individual rule may become relevant, the logical conditions necessary for it to be activated, and the action that is performed when it is activated. Asbru, EON, GLIF, GUIDE, PRODIGY, and PROforma are languages that permit the description of \"Task Network Models\". Such models represent sets of interacting medical decisions and actions that are carried out in sequence or in parallel over a period of time. These six languages have been compared in a recent paper by Peleg et al. [The Arden syntax is a rule-based formalism that is used to create g et al. , who havplans, where a plan can be defined, as in the Merriam-Webster dictionary, to be \"an orderly arrangement of parts of an overall design or objective\". The languages differ slightly as to what they consider the elements of a plan to be, and how its objective is expressed. However all allow plans to contain, among other things, decisions, actions, and nested sub-plans. All contain expression languages that represent criteria which influence decisions and control plan execution (e.g. to express conditions that determine whether a task might be started or terminated).All six languages can be used to describe PROforma is a knowledge representation language that can be used to create descriptions of processes that unfold over time and require the cooperation of various actors, such as clinicians or other medical personnel. The language benefits from an easy-to-use graphical editor, which can be obtained by agreement with the research team developing the language. This, and the fact that the authors had some previous experience with PROforma, led us to choose it as the description language to be evaluated in this study.The use of Process Descriptions is illustrated in. A Process Description is loaded into a software component referred to as the PROforma Engine which maintains a record of the dynamic state of the process, this includes information on which tasks have been performed, which need (or need not) be performed, and the values of any data items associated with the process. The PROforma engine implements a set of operations (the Engine Interface) which allow other components to read or change the state of the guideline in certain predefined ways. In general the execution of the process will require actions to be performed by external actors (e.g. clinicians) who will interact with the engine via some set of user interfaces.A Process Description is composed of objects drawn from the classes set out diagrammatically in figure A Process is defined in PROforma as a set of PROforma Components. A PROforma Component can be, among other things, a Task or a Data item. A Task can be an Action, an Enquiry, a Decision or a Plan. An Action generally represents a request for an external actor to do something . An Enquiry represents a request to an external actor to provide values for data items (the Sources of the Enquiry). A Decision represents a choice between one or more Candidates. The choice of Candidate(s) may be performed by an external actor or it may be made automatically by the system. The engine keeps a record of which Candidate(s) have been chosen in which Decisions and this information can be used to control the subsequent execution of the Process. Each Candidate is associated with one or more Arguments, logical expressions which if evaluated as true influence the recommendation of a Candidate.PROforma includes an expression language that is used to define, among other things, the preconditions that must be true for a task to be activated and the criteria that must be fulfilled for an Argument to be true. The PROforma expression language includes the usual logical, arithmetic, and comparison operators, as well as functions that evaluate the execution states of tasks  as well as the values of data items.The PROforma language has been given a precise syntax and semantics ,22. The PROforma has been used in a variety of research projects and a smaller number of clinical applications. Although publications have arisen from some of these projects, little has been written about the experience of using PROforma in practice. In this paper we present an account of the development of a PROforma guideline for the management of hypertension and evaluate its suitability in a distributed decision aid to be used by pharmacists. First we present a brief discussion of this kind of task, which is to say of knowledge engineering and knowledge representation, in order to identify suitable criteria for the evaluation.what the system does  and those concerned with how it does it .Knowledge engineering involves using computers to perform knowledge-intensive tasks. Implementing a knowledge intensive system requires the co-operation of a number of participants, who can be divided into those who are principally interested in The development of a knowledge intensive system includes three phases:knowledge acquisition in which knowledge engineers and domain experts create a shared model of a domain expert's knowledge,\u2022 design is agreed for a system,\u2022 a process in which a system implementation in which the model is instantiated in the designed software system.\u2022 We argue for a \"model view\"  as opposstructure preserving [We also argue that the development process should be eserving  the modeThis implies that the models constructed during knowledge acquisition should be reused in the implementation of the system. In order to achieve this it is necessary to create models that are intelligible to domain experts and interpretable by computer systems. The same philosophy underpins, for example, the use of objects as a consistent metaphor across both object-oriented software design and object-oriented programming languages. The process of building a representation of the domain expert's knowledge, therefore, straddles different phases of the software development lifecycle. It involves decisions about the system's functionality. The resulting representation may be simply a documentation of a design, but, depending on the development methodology, a key component of the software may also be programmed in the course of building the model. In this evaluation we assess the adequacy of PROforma and the Tallis implementation as a knowledge engineering tool under three headings: knowledge acquisition, system design and implementation, noting that in practice these three phases overlap.logical adequacy can the language to represent all the distinctions that one might want to make? heuristic power does the language allow the system to draw the required inferences and solve problems within its intended domains of application? notational convenience can the language can be read, written, and understood (by humans as well as by computer systems)? explanatory support does the language make it easy for a knowledge based system to explain to a user the chain of reasoning that led it to perform a particular action or to reach a particular conclusion?The knowledge in a knowledge-based system must be described and stored in a computable form. Knowledge representation languages are computer languages that facilitate such descriptions. There are various criteria by which such languages can be assessed : logicalIn this section we briefly describe the development of the software and the evaluation of PROforma. The project can be viewed as having three, somewhat overlapping, phases: knowledge acquisition, system design, and implementation. The suitability of PROforma as a guideline representation formalism for this application will have implications at each stage. In this section we present a short account of each stage of the project, indicating the rationale for the different decisions that were made.The guideline in the computerised system was based on that disseminated by the British Hypertension Society . A custoThe concept of a web-based tool emerged from our experience with an earlier, stand- alone, system, an attempt to provide a stand alone decision tool. The design was refined through a series of meetings in which the first author played the role of a systems analyst with the third author acting as a customer. Use Case diagrams were used to support the dialogue and help establish the precise requirements of the system.The specification of the design has implications for the representation of the clinical guideline. The intended users of the system are pharmacists and GPs. The pharmacists must decide how frequently to monitor patients, when to refer to them to GPs, and under what circumstances such a referral becomes a matter of urgency. The reasoning required for these decisions is essentially that needed to set target blood pressures and to identify when deviations from these target pressures become significant and/or a matter of urgent concern. The advice provided to GPs in our system is somewhat less detailed than that provided by other hypertension systems that have appeared in the literature  as some decisions are left to the discretion of the GPs themselves. For instance, if a patient is to be prescribed more than one anti-hypertensive agent, then the choice of the second agent is left to the GP. The reason for this division of responsibilities is that we felt that it would be easier to gain the confidence of the various stakeholders in the system if the more detailed decisions were delegated to GPs, even though it would in principle be possible to incorporate them in the process description.The guideline was modelled using the Tallis implementation of PROforma. The Web interface was built specifically for this study using Java Servlets/JSP and consists of pages containing nothing other than simple HTML in order to avoid making assumptions about the capabilities of the browsers used by the pharmacists. In order to support this project's requirement for an enduring record of the patient's interaction with the system, an SQL database was designed and implemented and an interface created between this and the Tallis PROforma Engine.advice module interrogates the state of the Process Description to provide advice to the pharmacist and patient, who access the system over the Web. The advice module provides an abstraction of the PROforma process description, exposing certain details and concealing others. The advice module makes certain assumptions about the state of the guideline, for instance it assumes that only one action will be active at any given time.Figure Patient Data represents the step in the process at which data about patient state are acquired from external actors. The three Decisions Urgent Referral Decision, Treatment Decision and Monitoring Decision are points at which choices are made between various candidates. The logic underlying these choices is represented by Candidates and Arguments that are associated with the decisions, but which are not displayed graphically. The choice of Candidates will determine which Actions are performed. The four Actions in the root plan represent instructions that the patient be urgently referred for treatment, or return for further monitoring in two, four, or eight weeks time. The sub-plan FLAP Assessment is invoked when the logic encoded in the Decisions implies that the patient's medication should be altered. The plan contains further Decisions and Actions not described here.PROforma process descriptions can be described graphically using a convention in which squares represent Actions, circles represent Decisions, lozenges represent Enquiries, and round-edged rectangles represent Plans. Using these conventions the root (top-level) plan of the Process definition used in our study can be set out as in figure The Actions in the Process Description have a number of user-defined parameters that express the values of various properties such as whether the action implies a change to the patient's medication, or the amount of time that should elapse until the next visit.scheduling constraints, that prevent one task from being activated until another has finished, for instance, the Action Urgent Referral cannot be activated unless the Decision Urgent Referral Decision has completed. Scheduling constraints express necessary, but not sufficient, conditions for the activation of tasks: the completion of the Urgent Referral Decision does not guarantee that the Action Urgent Referral will take place since each task has a set of logical preconditions that are evaluated after its scheduling constraints are satisfied, and the task is only activated if both its scheduling constraints and its preconditions are satisfied.The arrows between the tasks in the figure represent In this project PROforma was used in conjunction with other modelling tools (UML) and the engine was integrated with other elements of software. The work therefore provides a richer test of the language than previous comparative studies and allows us to examine the advantages of specialised approaches to guideline modelling, such as PROforma, in the context of a realistic software engineering project.The evaluation described here is qualitative, and some of our comments are necessarily subjective. The essential data for the evaluation was generated by the first author, in the form of comments based on his experience as the developer. His comments were discussed with other members of the team and a consensus process used to assess the performance of PROforma against each of the identified desirable characteristics of knowledge representation languages  at each stage of the project. These were operationalised in terms that allowed a range of responses, identifying specific strengths and weaknesses. These are categorised by reference first to the phases of knowledge acquisition, system design and implementation and then to the four characteristics.In this section we present summary conclusions of our assessment of PROforma in each phase of the project. Detailed discussion of the more important points is presented in the next section.We found that most of the logic of the medical process involved could be readily described using the constructs provided by PROforma. The process, although complex when taken as a whole, can be broken down into individual decisions that can be represented using simple arithmetic comparisons and propositional logic. However, we noted the following weaknesses:\u2022 limited support for constraintsThe actions described in the process description used in our system are intended to be mutually exclusive (if one action is performed then the others are not), and the advice module described in assumes that this constraint will be obeyed. However PROforma provides no mechanism by which such a constraint can be expressed, checked, or enforced.\u2022 limited support for structured dataThe value of a data item used in a PROforma process may be atomic (e.g. an integer or string) or it may be an ordered list of atomic values, all of the same type. However the Tallis implementation of PROforma provides no support for record structures or for collections other than ordered lists (The Arezzo implementation has some facilities for representing complex objects but does not place any constraints on the classes of these objects).The term heuristic power is used to describe the extent to which a knowledge representation language allows a knowledge-based system to draw inferences and solve problems within its intended domains of application. The PROforma language proved adequate to encode the reasoning required.Acquiring knowledge from a domain expert involves the construction, validation, and refinement of models. The principle of structure preserving design means that, in an ideal world, these models should be reused during the implementation of the eventual system. If we aim at a structure preserving design then notational convenience, i.e. the ease with which a knowledge representation language can be read, written, and understood, acquires a greater importance than the word \"convenience\" might suggest. If our knowledge representation language does not allow us to create models that can be understood by a domain expert then we will have to use some other formalism to create such models and therefore risk losing the advantages of structure preserving design. We noted the following weaknesses in the PROforma notation:\u2022 graphical representationDuring the knowledge acquisition phase of this project it was frequently necessary to express models on paper. Conventions for expressing models graphically are therefore of great importance. PROforma can be represented as text and also in a graphical form, as illustrated in figure \u2022 duplication of argumentsIt also became apparent during the study that the PROforma notation occasionally requires designers to duplicate elements of a process. As can be seen in figure A knowledge-based system should be capable of explaining to its users the reasons why it has recommended a particular course of action, or drawn a particular inference. We use the term explanatory support to describe the extent to which a knowledge representation language facilitates such explanation.Description and Caption properties, which it inherits from the PROforma Component class. The values of these properties are text descriptions of the Argument, the difference between them lies only in their intended use, the Caption property is intended to provide a short description of a component and the Description a longer one. The value of a Caption or Description can be expressed either as a fixed text string or as a PROforma expression that is evaluated to yield a text string that can vary as the state of the process changes during its execution. The latter option can be used to create descriptions of arguments that vary according to the truth or falsity of the logical conditions associated with the argument.The PROforma Argument and Candidate constructs offer a natural way to present explanations to a user that relates well to the manner in which such explanations are presented in ordinary human dialogue. The Argument class has In the system we consider here, PROforma process descriptions are considered as part of a larger software system. Hence some of the knowledge that the system contains is encoded in PROforma, whereas other parts are encoded in other components of the system, or held by human actors. This raises the question of what knowledge should be represented within a CIG, and what is more appropriately encoded outside of the CIG. For instance, in order to determine appropriate treatment of a patient enrolled in the study, it is necessary to estimate his or her risk of developing cardiovascular disease over a specified period. These risks are calculated using various measurements (e.g cholesterol levels) made at the beginning of the study. Therefore we must decide whether the PROforma process description should take, as input, the risk level itself, or the readings from which the risk level is calculated. If we adopted the latter option then the mathematical process by which one gets from the readings to the risk levels would be encoded within the PROforma process description and available for inspection by domain experts reading that process description. However we felt that setting out the calculation in this way would not be sensible, since it is part of a distinct and separate problem from that of deciding how to treat the patients enrolled in the study. Hence it seems more appropriate to calculate risk levels using another software component. Making these decisions, as part of the process of designing a software tool, is however a matter of judgement and we recognise that although the decision was not justified on the basis of the ease with which the assessment could be done in PROforma, the logical adequacy and heuristic support were factors in the decision since PROforma is designed to model processes and decisions, not inferences based on statistical models.The implementation revealed two weaknesses in PROforma's logical adequacy.\u2022 support for abstraction and information hidingThe PROforma Engine Interface permits inspection of all the data items and tasks in a PROforma Process Description, as well as all the values of all of their properties. It is however frequently useful to conceal some aspects of a Process Description and reveal others in order to distinguish between the essential logic of a process and the information that is required by some particular implementation of that logic. At present this distinction cannot easily be represented in PROforma.\u2022 support for the definition of classes of tasksThe language allows the designer of a process to attach parameters to tasks in order to describe properties of those tasks that are important to the process but which are not built in to the PROforma language. This is important when Process Descriptions are embedded in a larger software system because it allows the other components of the system to query the process in a structured manner by reading the values of these parameters. However it is frequently the case that a Process Description will contain several tasks that have the same parameters and can therefore be regarded as forming a class. For instance tasks that involve altering a patent's medication might be grouped together into a class whose common properties are used to express the modifications needed. PROforma provides some facilities for the definition of task classes, but the expressive power of these facilities is limited  and they are rather awkward to use.As noted above we used activity diagrams in the knowledge acquisition phase and translated these to PROforma in the implementation phase. When performing the translation we became aware of a limitation of PROforma. A transition between two states in a UML Activity Diagram can be given a guard condition and will only occur if that condition is satisfied. In PROforma transitions between tasks can be constrained using scheduling constraints, however it is not possible to attach a guard condition to a scheduling constraint. Instead preconditions are attached to the tasks themselves. It is possible to translate guarded transitions into PROforma by \"migrating\" the guard transition so that it becomes a precondition on a task, however this translation is not always straightforward because a precondition is always evaluated before a task commences whereas a guard is only evaluated when a state is entered via a particular transition.The translation from Activity Diagrams also made it harder to provide usable explanations because the Decisions, Arguments and Candidates in the PROforma process description used did not map directly on to the activity states and choice points identified in the activity diagrams created during analysis.In this section we consider the most significant points indicated above under the four headings of logical adequacy, heuristic power, notational convenience, and explanation support and comment on the value of evaluation.In general we feel that the PROforma meets most of the demands of this application for logical adequacy in all three phases. The most serious shortcomings emerged in implementation and concern the lack of support for information hiding and data abstraction.N weeks\" could be replaced by a single action containing a parameter that varied so as to express the value of N. Similarly the three decisions in the plan could be combined into a single decision with more complex logic. Ideally the Process Description would contain some sort of guarantee that such changes could not \"break\" any component of the system that accessed the process description. In order to do this it would be necessary to prevent \"inessential\" details of the process being revealed to other components of the system so as to provide a guarantee that these details could not affect their behaviour. At present there is no way of incorporating this kind of information hiding into a process description. The significance of this weakness becomes apparent when a complete system is created because the knowledge encoded in a process description often needs to be refined and one needs to know whether consequent changes will affect other components of the system.Consider the top-level plan shown in figure Heuristic power describes the ability to draw inferences and solve problems within the intended application domains of the language. In order to decide whether requirements for heuristic power are met we must first decide what problems we expect to be able to solve and what type of inferences we expect to be able to draw. Such decisions affect the scope of guidelines and resulted in some of the most interesting reflections to emerge in the course of the study. One of the aims of the PROforma language is to describe the logic of processes in a way that allows the computerised form to be examined and validated by domain experts. Furthermore a PROforma Process Description is generally associated with a particular process and its authors envisage it being studied by a particular group of domain experts. Thus, when deciding whether to include knowledge within a Process Description, it is useful to ask whether those particular experts are in a position to validate it and, if so, whether it is sensible for it to be validated as part of a description of that particular process, or whether it should be decoupled and examined separately. The calculations used to derive estimates of cardiovascular risk are routinely used by expert cardiologists but their contents would have to be validated by a statistician or an epidemiologist.Ethical, legal, and organisational considerations may also come into play when deciding whether to incorporate knowledge into a CIG. For instance stakeholders in a system may wish to consider who would be held responsible for any errors in advice provided, or the practicality of refining process descriptions if the knowledge involved was subject to frequent change. These factors had an impact on the advice provided by our system to GPs.Also we observe that the PROforma expression language is not Turing complete. That is to say that there are calculations that could be performed by a Turing Machine  but which cannot be expressed in the PROforma expression language. This is because the PROforma expression language does not provide any way of expressing functions that involve recursion or iteration (i.e. functions that would be expressed using a \"do. .while\" construct). It is possible to express such functions by attaching an expression to a task and then specifying that the task itself be executed in an iterative manner. However the use of such a mechanism to evaluate functions is clumsy, and obscures the logic of the guideline.The most significant weakness was in the lack of a complete graphical notation for the language. This weakness is illustrated by the top-level plan set out in figure By contrast the UML  has a coN weeks' in the diagram correspond to the three actions of that form in the PROforma top level plan, as does the state 'Urgent Referral'. The state 'Flap Assessment' is nested (that is to say it contains a set of sub-states that are not shown in the diagram) and corresponds to the plan of the same name in the PROforma version. The decisions in the PROforma version are represented by choice points in the UML diagram, although there is not a one-to-one correspondence between decisions and choice points. An important advantage of the UML diagram is that there is a convention for expressing the conditions that have to be satisfied in order for a transition to occur between one state and another. They are represented as the 'guards', i.e. the text enclosed in square brackets on the arcs that connect states. In order to represent the same information in PROforma we would need to be able to represent the Candidates and Arguments of Decisions and the preconditions of Tasks in some graphical manner. It should be pointed out that the semantics of PROforma are better defined than those of UML diagrams. The relative imprecision of UML semantics did not prove a great drawback in this particular project. However had the logic of the system been more complex, we might have had to reconsider the use of UML as a modelling language.Figure Hederman et al.  have invWe found the presentation of information in terms of the Arguments for favoured Candidates of Decisions was, broadly, a successful approach for the provision of explanations. However we experienced some difficulty in translating explanatory information from the UML Activity Diagrams to PROforma.This paper uses a case study to investigate the PROforma language. It is perhaps worthwhile to compare and contrast our approach to that of the previous mentioned paper by Peleg et al. , who alsThe most obvious difference between this paper and that of Peleg et al. is that we are only studying one language, PROforma, whereas Peleg et al. compared six languages. However this study embeds the PROforma process definitions in a real, distributed, system to be used in a clinical study, whereas contributors to the Peleg paper created Process Definitions, or guidelines, that were not used in this way and consequently did not have to be embedded in a larger software system. It is hoped that the more realistic demands placed on PROforma by the system studied in this paper will reveal strengths and weaknesses of the PROforma language that would not be apparent in a more theoretical study.In particular we consider that strengths and weaknesses of the PROforma language are revealed by: the need to acquire the knowledge necessary to implement the system and to model this knowledge in a ways that can be both understood by domain experts and also implemented in a distributed computer system; the need to test and validate the knowledge so acquired; and the need to provide interfaces by which other components in a distributed system can access the state of the clinical processes that are modelled.For instance the lack of graphical standards for PROforma emerges as an important issue when modelling knowledge acquired from experts because, at this stage of a project, it is necessary to be able to represent knowledge as diagrams on paper that can be read without the use of software tools. The need to hide information and create abstractions emerges when process descriptions are incorporated into larger systems because they provide a means of decoupling the process description from other components of the system and of limiting the changes to the system that are necessary when the process description is modified due to knowledge refinement.It should be pointed out that the methodology used in this paper cannot be as systematic or as rigorous as that which would be expected when reporting, for example, a controlled clinical study. The criteria used for evaluation, such as notational convenience, have an unavoidable subjective element to them, and cannot be precisely measured.We have implemented a guideline-based decision support tool as a part of a research trial exploring the role community pharmacists could play in the management of hypertension. The development of the system involved a knowledge engineering exercise in which PROforma, a process description language designed specifically for capturing clinical guidelines, was used to represent the trial protocol. Although PROforma was used for knowledge representation, UML diagrams were used in the knowledge acquisition process.The PROforma representation was successfully employed as part of a web-based tool in which the PROforma engine was integrated with other software elements, notably a secure database of patient information.This case study reveals a number of important lessons about guideline representation languages such as PROforma. These include a number of limitations in logical adequacy, but no difficulty with heuristic power. Most importantly, the experience accumulated during this study has highlighted the importance of structure preserving design in the construction of systems that make use of computer interpretable guidelines. A consequence of this is that great importance is attached to the notational convenience of the languages in which these guidelines are expressed. It is particularly important that the languages should allow the construction of complete and unambiguous graphical representations of guidelines.David Sutton was one of the principal designers of the Tallis system and is occasionally employed as a consultant by Cancer Research UK.DS implemented the software used in this study and is the primary author of this paper. PT worked extensively on the background section to the paper and helped to set the other sections in the context of existing research, as well as clarifying and expanding them. KE and PT instigated and designed the hypertension study for which the software was developed. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "A key element of the United Kingdom (UK) health policy reform in relation to chronic disease management is the introduction of a national programme seeking to promote self-care from within the National Health Service (NHS). The mainstay of the Expert Patients Programme (EPP) is a six-week training course that provides the opportunity for anyone with a long-term condition to develop new skills to manage their condition better on a day-to-day basis. The course forms part of the NHS self-care support programme, is administered by Primary Care Trusts (PCTs) and delivered by people who have personal experience of living with a long-term condition.The NHS' official Expert Patients Programme website presently states that, \"Pilot EPP courses began at 26 NHS PCT sites across England in May 2002, and by May 2004 approximately 300 PCTs had either actively implemented pilot courses or had committed to joining. The majority of PCTs are now coming to the end of the pilot phase, with many implementing plans to make EPP sustainable for the long-term.\" The NHS website heralds the pilot \"a success.\"A national, postal survey of PCT EPP Leads was undertaken in order to examine both the evolvement of EPP during its pilot stage and future plans for the programme. A questionnaire was sent out to the 299 PCTs known to have committed to the EPP pilot, and an excellent 100% response rate was obtained over a 3-month period (April-July 2005). One marker of success of the Expert Patients Programme implementation is the actual running of courses by the Primary Care Trusts. This paper explores the extent to which the implementation of the pilot can indeed be viewed as a \"success,\" primarily in terms of the number of courses run, and considers the extent to which PCTs have carried out all that they were committed to do. Findings suggest that the more time an EPP Lead dedicates to the Programme, the more likely it is that EPP has run successfully in the past, and the more likely it is that it will continue to run successfully in the future. Other factors indicating future EPP success include collaborating across PCTs to share co-ordinators, tutors, and funding. The United Kingdom (UK) Labour government has introduced a wide programme of reform for the prevention and management of chronic conditions . One of The mainstay of the NHS EPP is a six-week generic training course that provides the opportunity for anyone with a long-term condition to develop new skills to manage their condition better on a day-to-day basis . The couThe process of embedding the EPP into the NHS has two components; firstly, running the lay-led self-care training courses for patients, and secondly, action-linking this to other practice and policies related to the management of long-term conditions already provided by the NHS and other agencies. During the pilot phase, PCTs received central funding to run four courses and to train two volunteer tutors. Expectations of central health policy makers in making such resources available imply that local agencies will be able to implement the programme as originally intended by the Department of Health. This paper explores the extent to which the implementation of the pilot by PCTs can be viewed as a \"success,\" as the Department of Health have suggested it has been , and const April 2005), which formed the final stage of a full process evaluation of EPP [During the survey period , the greater the number of courses run . Perhaps, not surprisingly, there are also direct correlations between PCT size and the number of courses planned to run in the 2005\u201306 financial year , budget assigned to EPP in this year , and the total number of PCT-affiliated tutors .no relationship between PCT size and the percentage time of a working week that an EPP Lead dedicates to Expert Patients Programme. Partial correlations, controlling for PCT size, show that the greater the percentage of time dedicated to EPP per working week by the Lead, the greater the number of courses that have been run , the fewer courses that had to be cancelled , the more courses they plan to run in the 2005\u201306 financial year , the bigger the budget , the greater the number of tutors in total , and perhaps, more importantly, the greater the number of tutors actively engaged in delivering courses . In other words, the percentage of time that an EPP Lead commits to the Programme has a positive effect on all these variables, irrespective of PCT size.There is, however, in its pilot phase, and, as such, the success of the EPP is interpreted primarily in terms of the numbers of courses run and the anticipated numbers of future programmes.There may be a number of alternative criteria by which the implementation of the EPP could be judged, such as evidence of EPP as a trigger for the development of user-initiated, independent support groups, or changes in health professionals' responses toward self-management, for example, which are explored in more detail in the Process Evaluation Report . HoweverThe results of this national survey of PCT Leads examining the evolvement of EPP during its pilot phase, within England, suggest that irrespective of PCT size, the greater the percentage of time dedicated to EPP by the person leading this initiative \u2013 the more courses that have been run, the fewer the courses that have been cancelled, the more tutors affiliated with the PCT to deliver courses, and the more significant the planning for the future.One limitation of this study is that we are unable to conclude causal relationships given the type of correlational analyses conducted and the data available. It would, however, be interesting to understand the nature of the time allocation , and also which Lead tasks facilitate these factors . AfteralA total of 1305 courses have been planned for the 2005\u201306 financial year, with a total budget of \u00a31,565,085 being assigned to EPP. So, it would seem that the more time an EPP Lead dedicates to EPP, the more likely it is that EPP has run successfully in the past, and the more likely it is that it will continue to run successfully in the future.What does all this mean in terms of the future development of EPP by PCTs? Two-thirds of PCTs have EPP in their Local Development Plan which implies it is certain to be mainstreamed and allocated a budget. The current number of active tutors compounded by the difficulties of recruiting sufficient numbers to make a course viable, suggest that PCTs have the capacity to run a limited number of courses a year (involving about 40 to 50 people). Population size is clearly an issue. We found half the PCTs are actively collaborating with neighbouring PCTs to run courses. Pointers to future success of delivering the programme include appointing a dedicated EPP coordinator; and collaborating across PCTs to share coordinators, tutors and funding.The current limit to most PCTs' capacity to devote to EPP suggests that the aspiration to view the EPP as a public health measure (in terms of population reach) is unlikely to be fulfilled in the short term, if PCTs are viewed as the primary means of delivering EPP. Although EPP in its pilot phase has been primarily PCT-led, voluntary organizations have historically run self-management support programs in the past and could possibly administer EPP in the future. Indeed, some \"successful\"  PCTs are those who have begun to commission licensed voluntary organizations to recruit, administer, and effectively run the course.Our results suggest that the EPP policy can be viewed as a \"success,\" in so far as most PCTs ran a minimum number of training courses. However, our survey also illuminates the extent to which an 'implementation gap'  has arisThe author(s) declare that they have no competing interests.VL contributed substantially to the design, data collection, analysis and interpretation, and drafted the manuscript.AK contributed to the design, analysis and interpretation of data, and revised the manuscript.AR contributed to the design, analysis and interpretation of data, and revised the manuscript.All authors read and approved the final manuscript."}
+{"text": "Elevated blood levels of S100B in schizophrenia have so far been mainly attributed to glial pathology, as S100B is produced by astro- and oligodendroglial cells and is thought to act as a neurotrophic factor with effects on synaptogenesis, dopaminergic and glutamatergic neutrotransmission. However, adipocytes are another important source of S100B since the concentration of S100B in adipose tissue is as high as in nervous tissue. Insulin is downregulating S100B in adipocytes, astrocyte cultures and rat brain. As reviewed in this paper, our recent studies suggest that overweight, visceral obesity, and peripheral/cerebral insulin resistance may be pivotal for at least part of the elevated S100B serum levels in schizophrenia. In the context of this recently identified framework of metabolic disturbances accompanying S100B elevation in schizophrenia, it rather has to be attributed to systemic alterations in glucose metabolism than to be considered a surrogate marker for astrocyte-specific pathologies. Elevated S100B levels were associated with acute exacerbations or deficit symptoms and have frequently been attributed to glial damage and dysfunction or blood-brain barrier leakage [S100B is a secretory protein which is implicated in various intracellular and extracellular functional processes. Previous studies have indicated its involvement in the regulation of protein phosphorylation, cytoskeleton assembly, Ca leakage . S100B i leakage \u20139. Whita leakage , and pos leakage . TherefoA recent analysis of cerebrospinal fluid (CSF) from first onset schizophrenia cases observed increased levels of S100B, without indications for impaired glial or neuronal cell integrity, as assessed by simultaneous measurement of non-secretory glial and neuronal proteins  . This fiIn conclusion, previous findings support the hypothesis that S100B is involved in the pathogenesis of schizophrenia, but elevated levels of this protein may not exclusively reflect brain- or glial-specific pathologies. Recently, Marchi et al. suggested that serum S100B is an ideal marker of blood-brain barrier integrity, because with a molecular weight of 21\u2009kDa (S100B dimer) it may not penetrate through an intact blood-brain barrier . FurtherRecent studies indicate novel interpretations of previous S100B findings in the context of disturbances in energy metabolism in schizophrenia (see below). Therefore, this section is briefly summarizing current knowledge on schizophrenia-related alterations in glucose metabolism.Schizophrenia is characterized by a 20% higher mortality rate compared with the general population. Important contributing factors are an increased risk for type 2 diabetes and metabolic syndrome . Weight gain and impaired glucose tolerance have been mainly attributed to side effects of atypical antipsychotic medication, such as clozapine and olanzapine \u201319. HoweCerebral insulin signaling seems to be likewise affected in schizophrenia , 28, proAdipocytes appear to be an important source of serum S100B since the concentration of S100B in adipose tissue is as high as in nervous tissue \u201349. This2 without a prior history of neuropsychiatric disorders. S100B levels correlated with the BMI , levels of leptin , and adipocyte-type fatty acid-binding protein  , and normal weight subjects , or in overweight higher than in the latter  (P < .001). Correspondingly, new evidence from population studies and experimental animal models indicates that serum A-FABP is a powerful new risk marker for predicting metabolic syndrome and arteriosclerosis [Indeed, a recent study showed a close correlation between body mass index (BMI) and serum S100B levels . This st < .001) . Accordi = 0.65) . A stepwclerosis .d < 0.8) to strong effects (0.9 < d) of BMI on S100B blood levels. This finding may explain previous reports indicating a direct relationship between S100B blood levels with body weight in anorexia nervosa: Effect sizes that were obtained from data given for anorexic subjects by Ehrlich et al. [\u03bcg/l, finally: 0.128 \u00b1 0.063\u2009\u03bcg/l) and by Holtkamp et al. [\u03bcg/l, finally 0.107 \u00b1 0.035\u2009\u03bcg/l) were 0.81 and 1.3, respectively. In conclusion, S100B blood levels are directly related to BMI across an extensive range of nutritional states spanning from starvation to extreme obesity. Importantly, the effect sizes that BMI exerts on S100B blood levels in neuropsychiatrically healthy subjects  are well within the range of effect sizes observed in schizophrenia  [Effect sizes as measured by Cohen's d (see upper paragraph) indicated medium  and high-sensitivity C-reactive protein (hs-CRP). Levels of glucose, triglycerides and C-peptide1 were also assessed.A recent study thus assessed S100B in both medicated and drug free schizophrenic patients along with the BMI, measures of glucose utilization and adipokine levels . The subr = 0.540, P = .001), as in the abovementioned study in 60 subjects without a prior history of neuropsychiatric disorders [r = 0.545, P = .001, HGF: r = 0.441, P = .012, resistin: r = 0.377, P = .033) and C-peptide/glucose ratios  predicted S100B levels. In contrast, circulating S100B levels in schizophrenia subjects were neither correlated with the BMI  nor with levels of leptin, HGF and resistin . MCP-1 is known to be particularly related to the visceral fat mass [In control subjects, circulating S100B concentrations correlated significantly with the BMI (isorders . Moreoveresistin . It has fat mass .P = .012). Indications of insulin resistance were revealed by increased glucose (P < .001), C-peptide levels (P = .002) and C-peptide/glucose ratios (P = .006). S100B and BMI were elevated in medicated schizophrenic patients (P = .041/P < .001), but controls with a BMI \u2265 25 were also found to show increased S100B levels (P = .025) and comparable correlations held true when adipokines were considered as predictors of S100B levels. A disease specific increase of S100B could however be demonstrated for closely BMI-matched drug free patients  , 63, 64.Therefore, altered S100B protein expression in schizophrenia probably indicates systemic disturbances in cellular energy supply  rather than adipocyte- or glia-specific pathologies. Upregulated insulin levels might represent a compensatory effort coming up against these insulin receptor disturbances. Indeed, a better psychopathology profile has been observed in acutely ill schizophrenic patients with higher insulin levels, potentially compensating these insulin receptor disturbances . These chttp://www.americanheart.org/presenter.jhtml?identifier=4756). They include:According to the American Heart Association, the metabolic syndrome is characterized by a group of cardiovascular risk factors in one person ; women\u2014equal to or greater than 35 inches (88\u2009cm).Elevated blood pressure: equal to or greater than 130/85\u2009mm\u2009Hg.Insulin resistance or glucose intolerance: fasting glucose equal to or greater than 100\u2009mg/dL.Atherogenic dyslipidemia: blood fat disorders\u2014high triglycerides (greater than 150\u2009mg/dL), low HDL cholesterol  and high LDL cholesterol\u2014that foster plaque buildups in artery walls.Prothrombotic state: e.g., high fibrinogen or PAI-1 in the blood.Proinflammatory state: e.g., elevated CRP in the blood.Interestingly, we previously observed an upregulation of the S100B/AGE scavenger sRAGE (soluble receptor of advanced glycation end products) during reconvalescence from acute schizophrenia . BenefitAbdominal Obesity: We did not measure waist circumferences in this study, but blood concentrations of MCP-1 were elevated in the schizophrenia group (P = .034), indicating an increased visceral fat mass [r = 0.673, P = .023).fat mass , and corElevated Blood Pressure: This was an exclusion criterion of the study. Therefore, the relation of hypertension to S100B could not be analyzed.Insulin Resistance or Glucose Intolerance: Elevated glucose and C-peptide levels were observed in the schizophrenia cohort. C-peptide/glucose ratios predicted S100B levels .Atherogenic Dyslipidemia: Triglyceride levels were slightly elevated in schizophrenic subjects (P = .020), but were not correlated with S100B concentrations. HDL and LDL cholesterol were not systematically assessed.Prothrombotic State: Schizophrenia cases showed higher PAI-1 levels (P = .006) that were not correlated with S100B.Proinflammatory State: There was a trend towards elevated hs-CRP and TNF-\u03b1 levels in schizophrenia. However, these inflammatory parameters were not related to S100B levels.It remains unclear whether S100B may be considered as a predictor of metabolic syndrome in schizophrenia. This topic has to be elucidated by future studies in drug-na\u00efve and prodromal schizophrenia cases with follow-up blood takes and clinical examinations in larger samples, comparing different standardized treatment regimens. Apart from the measurement of fasting glucose, triglyceride and HDL cholesterol levels in patients and controls, it will be necessary to assess additional clinical parameters such as blood pressure and waist circumference for a clear identification of patients at risk.Several studies reported on elevated blood levels of S100B in schizophrenia, which have been attributed to glial pathology . HoweverGiven the increased prevalence of visceral obesity and insulin resistance in schizophrenia, we recently analyzed the relation of serum S100B levels to the BMI and adipose derived hormones in acute paranoid schizophrenia . The phySchizophrenia-related disturbances in adipose tissue distribution, such as increased visceral fat which is better assessed by the waist-to-hip ratio instead of BMI. Interestingly, blood concentrations of MCP-1 were indeed elevated in the schizophrenia group, indicating an increased visceral fat mass , and corSchizophrenia-related disturbances in adipose tissue metabolism, such as an increased release of S100B, together with triglycerides and free fatty acids due to a predisposition to insulin resistance. Indeed, elevated glucose and C-peptide levels were observed in the schizophrenia cohort and C-peptide/glucose ratios predicted S100B levels (see above).An increased release of S100B from brain tissue, as suggested by histological and CSF studies , 63, 64.Drug effects on cellular S100B production and release.directly affect glial S100B release. Increased amounts of S100B were found in the supernatants of astroglial C6 cells treated with very high doses of risperidone [Glial cell culture experiments have shown that antipsychotic drugs can peridone . In contperidone . Other Sindirect mechanism. Among the second-generation antipsychotics, clozapine and olanzapine are associated with the highest risk of weight gain, as well as changes in insulin sensitivity and lipid metabolism, which increase the risk of diabetes and cardiovascular disease [Alternatively, the potential influence of atypical antipsychotics on S100B via changing metabolic factors should be considered as a more  disease \u201319. 2-correlated S100B levels in untreated acutely ill patients .Adrenaline, noradrenalin or ACTH-enhanced release of S100B from adipose tissue due to a schizophrenia-related activation of the endocrine stress axis \u201353. ThisIn conclusion, there is evidence for a novel link between S100B and disturbances of energy metabolism in schizophrenia, resulting in an increased release of S100B from brain and adipose tissue. Such systemic alterations in glucose metabolism may also affect glial S100B release. An upregulation of S100B may be a compensatory phenomenon, increasing intracellular energy supply by activating glycolysis  and glycogenolysis (phosphoglucomutase) , 80. Fut"}
+{"text": "Bevacizumab is an anti-vascular endothelial growth factor approved in association with paclitaxel or docetaxel as first line in patients (pts) with metastatic breast cancer. Rare cases of nasal septum perforations have been reported. We report our experience of nasal perforation in breast cancer pts receiving bevacizumab and chemotherapy either in the adjuvant or in the metastatic settings.Between 1 January and 31 December 2009, 70 pts received bevacizumab together with chemotherapy. All the pts who had received bevacizumab were referred to the ENT specialist. Symptoms potentially related were looked for. Side effects were graded according to CTCAE.\u22121 3 weekly. Three pts were metastatic. Bevacizumab was associated with docetaxel (100\u2009mg\u2009m\u22122 every 3 weeks) in two pts and with weekly paclitaxel in one. The last two pts received bevacizumab in combination with anthracyclin and then taxanes in the adjuvant setting. In these two cases, nasal septum perforation occurred at the time of docetaxel treatment.Five nasal septum perforations were diagnosed . Bevacizumab dose was 15\u2009mg\u2009kgA high incidence of nasal septum perforation has been shown in pts with breast cancer receiving bevacizumab together with chemotherapy. Several mechanisms could be involved . Angiogenesis is a hallmark of cancer. Among the angiogenesis factors identified, vascular endothelial growth factor (VEGF) is a crucial regulator of angiogenesis in normal and malignant tissues . Bevaciz\u22121 and 3 at 7.5\u2009mg\u2009kg\u22121. In all, 15 pts had bevacizumab alone after the end of chemotherapy. After the observation of the first nasal perforation cases, the clinical files of all the pts who had received bevacizumab were reviewed. All of the pts treated or having been treated with Bevacizumab were referred to the ENT specialist for a nasal examination. Symptoms potentially related like nasal obstruction, rhinorrhea, mucosal crusting and epistaxis were looked for. The clinical characteristics of the pts and the details of the treatments are given in Between 1 January and 31 December 2009, 70 pts received bevacizumab every 3 weeks together with chemotherapy, 67 at a dose of 15\u2009mg\u2009kg\u22121 except for three pts in a clinical study who received 7.5\u2009mg\u2009kg\u22121. Docetaxel was given at a dose of 100\u2009mg\u2009m\u22122 every 3 weeks during 2\u2009h, weekly Paclitaxel (90\u2009mg\u2009m\u22122) administration lasted 1\u2009h. Capecitabine was given at a dose of 1500\u2009mg twice daily, 2 weeks out of 3.The first administration of bevacizumab was a 90\u2009min intravenous infusion, which was followed by the chemotherapy regimen. The second administration of bevacizumab lasted 60\u2009min and the duration of the following ones was 30\u2009min. Bevacizumab dose was 15\u2009mg\u2009kgSide effects were graded according to CTCAE .Before each course, leukopenia, proteinuria and hypertension were monitored and the worst grade observed during the courses was considered, as well as other side effects.All 70 pts received bevacizumab for breast cancer. Median age was 54 years . All pts were female. One pt. had a history of chronic sinusitis before bevacizumab/chemotherapy. In all, 52 (75%) were treated in the metastatic setting . In all, 12 pts were included in an adjuvant clinical study. Six received bevacizumab with a neoadjuvant chemotherapy in a clinical study too. In all, 15 pts received weekly paclitaxel, 36 docetaxel every 21 days, 1 capecitabine. All pts in clinical studies received bevacizumab in combination with anthracyclines and then in association with docetaxel.\u22121 3 weekly in all the pts. The median time between beginning of Bevacizumab treatment and diagnosis of nasal septum perforation was 21 weeks . The median age of affected pts was 42 years . Three pts were metastatic and had received previous chemotherapy in the adjuvant setting . One of them had epistaxis and two of them developed mucosal toxicities (grade1 or 2) in the adjuvant setting. Bevacizumab was associated with docetaxel (100\u2009mg\u2009m\u22122 every 3 weeks) in two pts and with weekly paclitaxel for one pt.Five nasal septum perforations were found in the 70 pts 7.14% . At diagThe last two pts received bevacizumab in combination with anthracyclin and then taxanes in the adjuvant setting. In these two cases, nasal septum perforation occurred at the time of docetaxel association.\u22121, respectively.None of the pts developed hypertension or proteinuria. Related toxicities were mucositis , cutaneous , haematological  and neurological (one dysesthesia grade2). All but one had epistaxis. One pt. described disorders of nasal airflow and wheezing. One had crusting and infection of nasal mucosa. The total dose received at the time of nasal perforation diagnosis was 45, 105, 120, 150 and 225\u2009mg\u2009kgBevacizumab was stopped in four pts after the diagnosis of nasal perforation. In one pt, bevacizumab was continued because of a very good clinical response. Patients with nasal septum perforation were followed by the ENT specialist; up to now, no healing and no extension was observed even in the pt who continued bevacizumab treatment.Among the other pts who received bevacizumab and chemotherapy without nasal septum perforation, 15 pts died, all of progressive disease. Nine of them had epistaxis. Only two had ENT examination and no nasal septum perforation was diagnosed.Among the 50 alive pts without nasal septum perforation, 41 pts (82%) had epistaxis, 11 nasal crusting . Among tA total of 30 pts out of 50 (60%) had mucosal toxicity . In all, 16 experienced cutaneous toxicities , 8 haematological toxicities (1 neutropenia grade3 and 7 grade4), 1 neurological toxicity (neuropathy grade3) and 1 cardiac event (pericarditis). Three pts had proteinuria (max 1.5\u2009g per 24\u2009h). Hypertension appeared at least at one time for 15 pts .Response to treatment could be assessed in pts with metastatic disease and in pts in the neoadjuvant setting. The response rates were in first-line metastatic 7 partial responses (PRs); in second line 2 complete responses (CRs), 15 PRs, 1 stable disease and 1 progression; after the second line, 2 CRs, 5 PRs and 1 progression. In all, two CRs and four PRs were observed in pts receiving a neoadjuvant treatment.This study reports our experience of nasal septum perforations in breast cancer pts receiving bevacizumab and chemotherapy. The incidence rate of nasal septum perforation was 7.14%. To our knowledge, such a high rate has never been reported and might be underestimated.To our knowledge, only eight cases of nasal septum perforation in bevacizumab-treated pts have been reported. The clinical characteristics are summarised in \u22121.Nasal septum perforations with bevacizumab can thus occur independently of the chemotherapy regimen  and sometimes during maintenance therapy with bevacizumab. The total dose exposure before perforation varies from 30 to 150\u2009mg\u2009kgThe management is not clearly defined. In some cases bevacizumab was discontinued. We do not know whether bevacizumab must be stopped or which treatment should be proposed.ENT monitoring and evolution of the perforation  are not detailed. In one case, plastic surgery was performed.Nasal septum consists of an osteochondral skeleton covered with periosteum, perichondrum and mucosa. Its vascularisation depends on several arteries : the sphNasal septum infection weakens the nasal mucosa and then can be responsible for perforation. Various systemic diseases can also cause nasal septal perforation (Wegener's granulomatosis, systemic lupus erythematosus, antiphospholipid syndrom, sarcoidosis\u2026 In our pts receiving antiangiogenic therapy and chemotherapy, several specific mechanisms could be involved. First, mucositis induced by chemotherapy may weaken nasal mucosa. Nasal irritation due to chemotherapy induced mucositis and/or bevacizumab may induce mucosal breaks and ulcerations. These irritations can be increased by frequent nose blowing and mechanical trauma. Neutropenia frequently associated with chemotherapy enhance the risk of local infection. Bevacizumab decreases normal tissue repair. Bleeding could be seen because of the effect of bevacizumab in wound healing. The inhibition of VEGF can induce a loss of capillaries by apoptosis of endothelial cells, which causes tissue necrosis. Cartilage is not vascularised. The trophicity is maintained by factors from capillaries of mucosa via a terminal vascularisation. In the weakened mucosa, the trophicity of the cartilage might no longer be obtained.Finally, in our study, bevacizumab was associated with taxanes in most cases. Several studies have shown the antiangiogenic action of taxanes . This enA high incidence of nasal septum perforation has been shown in pts with breast cancer receiving bevacizumab. Many questions remain about the prevention and the management of nasal septum perforation. A collaboration with ENT specialist is needed. Whether or not bevacizumab should be stopped remains a matter of debate. In the clinical practise, indication of antiangiogenic therapy in breast cancer is increasing and many pts are concerned, and clinicians must be aware of this side effect. ENT examinations must be systematically performed in all pts receiving bevacizumab, at least together with taxanes."}
+{"text": "A connection between lipolysis and S100B release has been proposed but definitive evidence is lacking. Although the biological significance of extracellular S100B from adipose tissue is still unclear, it is likely that this tissue might be an important source of serum S100B in situations related, or not, to brain damage. Current knowledge does not preclude the use of this protein in serum as a marker of brain injury or astroglial activation, but caution is recommended when discussing the significance of changes in serum levels where S100B may function as an adipokine, a neurotrophic cytokine, or an alarmin.Adipocytes contain high levels of S100B and  Searching for peripheral molecular markers for brain damage and/or dysfunction, S100B protein appears to be a promising candidate . In factIt is important to take into consideration some points about adipocytes, which are the target cells of this paper. Adipocytes are the main cell type in adipose tissue, which is distributed in three major anatomical areas: subcutaneous, dermal and intraperitoneal . The popS100B was initially described as a neuron-specific protein . However1 was also present in the preparation. Regardless of this, these studies contribute to consolidate the view that S100B exists in non-nervous tissues [ The first evidence of S100B in adipose tissue was independently obtained by Hidaka and coworkers, in Japan  and by M tissues , 19.  The mRNA expression of S100B was demonstrated later in adipose tissue . It is i\u03bcg of protein), comparable to that of the hippocampal tissue [ Preliminary results from Guaragna in our laboratory indicate that human adipose tissue also expresses high levels of S100B and that this amount varies depending on the anatomical area of adipose tissue. In rats, we found an elevated content of S100B in rat white adipose epididymal tissue  remains a speculation.  Based on protein-binding assays, at least three putative targets of S100B have been implicated in energy metabolism: phosphoglucomutase , fructos Moreover, the cAMP pathway, triggered by adrenaline and glucagon (and attenuated by insulin), which results in lipolysis see , could, Regardless of whether S100B is released, or not, from adipocytes during lipolysis, it is also important to evaluate the extracellular role of this protein, that is, could have this protein an autocrine, a paracrine or an endocrine role? As yet, RAGE\u2014the Receptor for Advanced Glycation End products (AGE)\u2014is the only characterized receptor for S100B , 50 and,in vitro S100B release by adipocytes is even higher than that of astrocytes [ RAGE activation by AGE in cultures of adipocytes inhibited glucose uptake through the overgeneration of intracellular reactive oxygen species  and thistrocytes . Thus, b Locally concentrated extracellular S100B in adipose tissue could exert an effect on neighbor cells. The innate immune response could be induced by S100B, recruiting monocytes  and acti With regard to any endocrine activity of the S100B released from adipocytes, two tissue targets could be proposed: the brain and heart, but weak biochemical bases of these connections can be established. S100B is not normally expressed in the myocardium, but it is induced in the peri-infarct region and potentially modulates myocyte apoptosis  have been considered a damage-associated molecular pattern (DAMP) or alarmin .Generally, serum S100B is interpreted as a reflex of brain damage or astroglial activation. This is based on some properties: (1) brain tissue contains an elevated content of this protein, particularly in the astrocytes in gray matter; (2) astrocytes secrete S100B and, in fact, high levels can be measured in cerebrospinal fluid; (3) S100B is a small and very soluble protein. However, some points should be taken into consideration. Oligodendrocytes, choroid plexus epithelium and ependymal cells contains S100B  and pote Many extracerebral sources of S100B may contribute to the serum content of this protein. Here, we have emphasized adipocytes, but other sources include chondrocytes and cells of the marrow bone (in case of traumatism) , 67 and  Adipose tissue alterations, particularly insulin resistance, appear to be involved (whether preceding or associated) in many diseases, including type 2 diabetes, cardiovascular diseases and dementia , 70. In  Another important aspect to be considered is the ontogeny of the S100B protein. Serum S100B levels are negatively correlated with age . This prin vitro assays indicate a modulated secretion of this protein by hormones that regulate lipolysis, such as glucagon, adrenaline and insulin. Although the biological significance of extracellular S100B from adipose tissue is still unclear, it is likely that this tissue might be an important source of serum S100B in situations related, or not, to brain damage. Current knowledge does not preclude the use of this protein in serum as a marker of brain injury or astroglial activation, but caution is recommended when discussing the significance of changes in its serum levels, where S100B could function as an adipokine, a neurotrophic cytokine or an alarmin. In conclusion, adipocytes contain high levels of S100B and"}
+{"text": "Physical Activity Across the Curriculum (PAAC) is a 3-year elementary school-based intervention to determine if increased amounts of moderate intensity physical activity performed in the classroom will diminish gains in body mass index (BMI). It is a cluster-randomized, controlled trial, involving 4905 children .We collected both qualitative and quantitative process evaluation data from 24 schools (14 intervention and 10 control), which included tracking teacher training issues, challenges and barriers to effective implementation of PAAC lessons, initial and continual use of program specified activities, and potential competing factors, which might contaminate or lessen program effects.Overall teacher attendance at training sessions showed exceptional reach. Teachers incorporated active lessons on most days, resulting in significantly greater student physical activity levels compared to controls (p < 0.0001). Enjoyment ratings for classroom-based lessons were also higher for intervention students. Competing factors, which might influence program results, were not carried out at intervention or control schools or were judged to be minimal.In the first year of the PAAC intervention, process evaluation results were instrumental in identifying successes and challenges faced by teachers when trying to modify existing academic lessons to incorporate physical activity. In the United States, the prevalence of overweight among children increased dramatically between 1986 and 1998 . TherefoPublic schools are an ideal site for interventions designed for the primary prevention of obesity in children. According to the most recent enrollment figures, 98% of children were enrolled in regular schools, representing more than 47 million students in the United States. School Ironically, schools also are a barrier to physical activity. Children are required to sit quietly for the majority of the day to receive academic instruction. A typical school day can be best described as sedentary. Historically, schools have provided physical activity for elementary school children through free play or recess, and through organized physical education classes. However, time allocated for recess has declined or has been eliminated to provide additional time for academic instruction . Further\u00ae It is a classroom-based physical activity program for kindergarten to fifth grade students. TAKE 10!\u00ae provides physical activities that are linked to academic objectives and delivered in 10-minute sessions. This article provides a review of the overall design and first-year process evaluation results of PAAC.In an attempt to diminish childhood obesity, we developed a minimal intervention model to increase physical activity levels, since increased physical activity has shown promise with weight management in children ,8. RegulMonitoring the delivery of services to evaluate the actual implementation of PAAC was undertaken for a number of purposes. A large proportion of programs that fail to show positive results are really failures to deliver the interventions as designed . The proPAAC is a cluster-randomized controlled, elementary school-based trial, involving 4905 children  in 24 schools (14 intervention and 10 control). The study is being carried out in public elementary schools located in the Midwest region of the United States. The primary aim of the intervention is to determine if 90 minutes of moderate intensity physical activity delivered as part of academic instruction will diminish gains in obesity as measured by body mass index (BMI). Secondary outcomes are assessed in a sub-sample of children to provide additional means of evaluating the impact of PAAC, including measures of metabolic fitness, daily physical activity, and academic achievement.The intervention will be delivered across 3 years in elementary school children in grades 2 through 5. Physical activity is accumulated throughout the school day using regular, existing academic lessons taught in a physically active manner. Lessons link physical activity with specific academic learning objectives for language arts, science, mathematics, and social studies.\u00ae program to provide children with a brief, classroom-based activity segment one or more times each school day, integrating physical activity with academic content related to health and movement concepts. For this intervention, we joined with ILSI CHP, providing teachers with TAKE10!\u00ae material kits that included lesson ideas and worksheets targeted for the appropriate grade level, colorful posters for each classroom, and stickers that can be used to chart class progress on TAKE10!\u00ae lessons. For PAAC, we developed and refined classroom-based lesson plans to be delivered through physical activity. All physically active lesson plans were designed to be consistent with the cognitive and motor development of students at each grade level. In addition, we designed examples of physically active lessons to be taught as part of the regular school curriculum, integrated within mathematics, science, language arts, and social studies and delivered by regular classroom teachers. Sample lessons were included in a 3-ring notebook and provided to classroom teachers as a resource. Lesson examples were described in a cookbook format that allowed teachers to identify the concept underlying the suggested physical activity, specific objectives, and materials needed.The International Life Sciences Institute Center for Health Promotion (ILSI CHP) developed the TAKE10!We used evaluation components as described and defined by Linnan and Steckler  and BaraWe arranged one-day workshops (approximately 6 hours) for intervention schoolteachers who taught second through fifth grade, using the traditional in-service training mechanism. Schools or individual teachers, depending on policy, received payment for attending the workshop. An elementary physical education specialist led the sessions. Attendance at the workshop training session was recorded as a measure of reach or the extent to which the teachers received training , and forAt the end of the workshop, teachers completed a 15-item evaluation survey. In addition to demographic information, several items on the survey asked teachers to rate how well organized, appropriate, and relevant the workshop was to their individual classrooms. To gain ideas about enhancing future workshop sessions, we asked teachers to provide advice on how to improve our training sessions and recommendations for additional topics to be covered at future workshops.In order to assure precision and accuracy of process evaluation and outcome measurements, rigorous quality control procedures were employed. All research assistants participated in several training sessions prior to the initiation of data collection. During these training sessions, research assistants reviewed and practiced standardized protocols for height, weight, and circumference measurements. Following training, all research assistants completed reliability testing. Research assistants were also trained to make direct observations of physical activity levels within the classroom and learned how to record them uniformly. Using a time-moment sampling technique called the System for Observing Fitness Instruction Time (SOFIT) , researcIn addition to standardized protocols and reliability testing, investigators and research staff met weekly to discuss issues related to program implementation and monitoring. During the meetings, the study coordinator shared the results of the weekly teacher evaluations and on-site visits so that the investigators could keep apprised of developments affecting PAAC and gain up-to-date information on how many minutes of PAAC activities were performed by individual teachers and their students. With this information, teachers who were not conducting active lessons at the appropriate levels of intensity or amount of time could be identified quickly and PAAC staff could provide on-site follow-up assistance and support in a timely manner. We targeted moderate intensity activity levels during classroom activities, aiming for students to participate in at least two PAAC lessons for 10 or minutes each day.Following completion of baseline assessments, direct observations of individual classrooms were initiated. This timeframe allowed teachers several weeks to incorporate physical activity into their regular lessons with the help of PAAC staff and to gain a sense of mastery with presenting active lessons.We developed a sampling approach that randomly determined the school to be observed and the day of the week to make observations to determine the activity level of the students as measured by SOFIT ratings. The random sampling approach used a 3:1 ratio for intervention and control schools .Three students from each classroom were randomly selected to be observed in both control and intervention schools to provide a measure of how active students were during classroom lessons. In 20-second intervals, for up to 10 minutes, the students' physical activity intensity levels were estimated and recorded using the SOFIT rating scheme . During observations, research assistants also indicated how often teachers participated in active lessons with their students by rating them on a 3-point scale . This particular measure provided an indication of effective role modeling for active lessons. In addition, research assistants rated overall student enjoyment level during both PAAC lessons and regular classroom lessons at intervention and control schools, using a 5-point scale (1 = not very enjoyable to 5 = very enjoyable). All direct observation ratings for classroom teachers as well as enjoyment of lessons were completed in the same manner at both intervention and control schools.On a weekly basis, all intervention teachers were required to log onto a password protected website in order to complete a brief online survey. To complete the survey, teachers indicated in what academic subject(s) physical activity was incorporated and how often they included physical activity into lesson plans for approximately 10 or more minutes. They also reported the number of minutes per day they were using PAAC and estimated the intensity level at which they believed the children were performing  so that we could gauge the extent to which the PAAC program was being implemented as designed. If teachers failed to complete their weekly survey, individual teachers were sent an email reminder or were given a hard copy of the evaluation to complete the following week.At the end of the school year, teachers completed two evaluation forms, which were adapted from the Child and Adolescent Trial for Cardiovascular Health (CATCH) -17. The \u00ae notebook as a resource for active lessons as one measure of exposure [In order to gain additional information that would be helpful in guiding the overall design and implementation of PAAC for the following school year, we asked teachers to complete a 9-item online survey, which was adapted from the CATCH Physical Education Observation Form . As partexposure . ResponsBefore the school year ended, we invited teachers to participate in focus group discussions. We held six sessions with approximately 10 to 15 teachers attending each discussion. A moderator's guide  was deveAt the end of the school year, principals from both intervention and control schools completed a 5-item survey to help us determine if external or competing factors might have influenced PAAC objectives, posing as possible internal validity threats . We askeMeans, standard deviations, and percentages were computed for descriptive data. A mixed linear model analysis was performed to determine differences between intervention and control groups. The model contained group, days since baseline, and group by day interaction as predictor variables and physical activity level as the outcome variable. Teacher was repeated within school. A mixed linear model analysis was used to determine differences between the modeling level of teachers and physical activity intensity levels. This model included teacher participation and days since baseline as predictor variables, with physical activity level as the outcome variable. Again, teacher was repeated within school. This analysis included only intervention schools. All statistical analyses were conducted using SAS version 9.1 . The alpha level was set at 0.05 for all analyses.nd through 5th grade teachers (106 out of 135) with 100% of the cohort teachers  trained. Many resource staff (n = 38) participated in the workshop session in addition to faculty members. Other resource staff included teachers from music, special education, language, and reading, and school principals and graduate student teachers. As noted earlier, for those teachers who were unable to attend the workshop, training was held on an individual basis or conducted in small groups.Each workshop training session was well attended with an overall attendance rate of 81% of 2The results of the workshop evaluation survey indicated that the majority of attendees felt that the workshop training was well organized, appropriate in depth and scope, relevant to their classroom experience and addressed their specific questions about PAAC. Most of the attendees also reported program materials were clear and appropriate for their classrooms, and the training received would be very helpful when incorporating physical activity into their lesson plans. Additionally, more than 90% of attendees specified that they would recommend the workshop training to other elementary school teachers.On a weekly basis, observers made contact with 85% (115 out of 135) of the teachers and observed 70% of the classrooms. On average, PAAC staff conducted SOFIT observations on 260 students each week at intervention schools to determine student activity intensity levels. For control schools, PAAC staff observed approximately 89% of the classrooms and measured physical activity intensity levels using SOFIT on 75 students each week. Reasons for not making contact with a teacher or observing a classroom included the following: (1) school cancellations or field trips (n = 119); (2) substitute teacher (n = 43); (3) standardized testing (n = 43); or (4) unable to set teacher visitation appointment (n = 39).nd through 5th grades . Students in the intervention schools performed significantly greater levels of physical activity in the classroom than students in the control schools; higher scores indicate higher activity intensity levels . Control students were primarily sitting during academic lessons, whereas students in intervention schools were primarily standing during most PAAC lessons.Table During SOFIT observations, staff also indicated the level of participation by teachers during an active lesson. Overall teacher participation was related to SOFIT scores for students in the intervention schools but not the control schools. As shown in Figure In addition, ratings of enjoyment of lessons at control schools indicated that most classroom lessons were perceived as neutral (60%). In contrast, the majority of PAAC lessons were rated as somewhat enjoyable (57%) or very enjoyable (36%) while only 6% of lessons were perceived as neutral.Across the school year, approximately 84% of teachers responded to the weekly on-line survey. If a teacher did not respond by the on-line method, hard copies were distributed the following week and research staff entered the collected data. The majority of teachers indicated that they incorporated physical activity into language arts (73%) and math 22%) while other subjects such as science, social studies, art, and music were used much less often. As shown in Figure 2% while Table A summary of selected items from the end of school year evaluation completed by PAAC teachers (n = 75) are presented in Table At the end of the school year, 79 teachers out of a possible 135 (~58%) participated in the focus group discussions, with approximately 13 participants in each group. Qualitative analysis of the focus group discussion transcripts revealed several common themes. Teachers reported that one of the best features of PAAC lessons are that they provide a \"great teaching strategy\" that helps break up the monotony of the class. Although many teachers voiced concerns at the beginning of the study about the possibility of students getting wild and out of control, teachers stated that just the opposite occurred with PAAC; it helped with behavior management, stopped the fidgeting, and made the students more alert and focused.When asked about the worst features of PAAC, teachers indicated that they need more time to incorporate physical activity into their lesson plans, chiefly because of new requirements set forth by the No Child Left Behind Act, which holds schools accountable for academic achievement. Many teachers also specified the need to develop more lessons for students in fourth and fifth grade, stating that their students perceived the examples provided as too \"babyish\".When asked about challenges and barriers to achieving 90 minutes of active lessons per week, many teachers expressed the need for lessons that could be taught within a small classroom, indicating that the current examples were designed for larger classrooms without space constraints. In addition, teachers wanted more lesson demonstrations by research assistants to gain additional ideas about how to incorporate physical activity into a regular lesson. Similarly, several teachers wanted a forum to share and learn about creative lessons that worked well in other classrooms. Several suggestions included having teachers share lessons at school staff meetings, including examples in a newsletter, or placing creative lessons developed by teachers on a website.When we solicited information about potential benefits, both physically and academically, to students and teachers who actively participated in PAAC teachers indicated that active lessons encouraged them to be more creative, and helped students learn concepts better and improved their memorization skills. For example, one teacher stated, \"it really helped my students remember things, especially spelling. Those who didn't do a PAAC activity with spelling did not do as well.\" With regards to physical improvements, some teachers expressed that they exercise now more than they ever have because they model the lessons with their students. Moreover, many teachers reported that the active lessons are the only physical activity the students get during most days because they stand around during recess talking with their friends, and physical education classes have been reduced to twice per week. As one teacher stated about active lessons, \"This is the most I've seen some of these kids actually physically move.\" Others expressed that they did not think it made a difference in their bodies physically but PAAC changed their thinking about the necessity of movement within the classroom to help their students learn and retain information better.nd grade students in one building while 3rd through 5th grade students attended classes in a different building on the same grounds.Principals from both intervention (n = 14) and control schools (n = 10) completed surveys  and classroom management . Through information gained by focus group discussions, we were able to modify the protocol to address implementation issues conveyed by teachers. For example, for the new academic year, teachers were supplied with several examples of lessons for fourth and fifth grade students designed to be more age appropriate. In addition, we solicited from teachers a number of creative lessons that students found enjoyable and were easily implemented. These particular lessons were placed on the PAAC website, allowing other teachers to gain examples of successful lessons.Another strength of the evaluation was the collection of key process variables in both intervention and control schools. Although research staff costs, the burden of collecting and managing large amounts of data, and the complexity of school schedules were important considerations, tracking key process variables  in both intervention and control schools provided essential information on fidelity, program context, and possible threats to the internal validity of the PAAC program.One of the limitations of the process evaluation data was that it relied upon teachers to self-report weekly data on how much and into what particular subjects was physical activity incorporated into lessons. Although the majority of teachers reported information in a timely manner, several teachers delayed reporting until being reminded by program staff, which could have potentially introduced recall bias. Another limitation was the low response rate for the end-of-year surveys. To ensure a greater response for the next school year, we have planned to administer the survey a week earlier to teachers so it does not interfere with end-of-school year activities and to reduce respondent burden during this particularly busy time of year.One of the goals of the PAAC project was to develop a minimal intervention that increased physical activity during school without reducing time allocated for classroom instruction, given the pressure to meet the No Child Left Behind Act's accountability provisions, in which schools must close the achievement gap, making sure all students achieve academic proficiency, Results from the process evaluation demonstrated that it is possible to incorporate physical activity within the curriculum by modifying existing academic lessons, thereby not competing for instructional time.One of the major advantages of the PAAC project is that it is a minimal intervention that can be easily disseminated, requiring no change to the current curriculum, few additional supplies (if any) and minimal cost to schools. Some of the reasons for the success of PAAC during Year 1 can be attributed to the training provided to teachers and both the teachers' and students' positive responses to the physically active lessons. Further, teachers were given much flexibility and choice on how to integrate the intervention within their classroom .PAAC: Physical activity across the curriculum; ILSI CHP: International life sciences institute center for health promotion; SOFIT: System for observing fitness instruction time; CATCH: Child and adolescent trial for cardiovascular health.The authors declare that they have no competing interests.JD conceived of the study. CG, BS, KD, JG, JR, RW, KS, DS, MM, and JD helped to carry out the PAAC study, participated in the design and coordination, and helped to draft the manuscript. In addition, MM and KS performed the statistical analyses. SW and BB helped to draft the manuscript. All authors read and approved the final manuscript."}
+{"text": "Progestins, high-dose oestrogens, selective oestrogen receptor modulators (SERMs), aromatase inhibitors (AIs), and, most recently, the new type of oestrogen receptor (ER) antagonist fulvestrant (\u2018Faslodex\u2019) have all been used for the treatment of hormone-sensitive advanced breast cancer in postmenopausal women. Tamoxifen was the \u2018gold standard\u2019 hormonal therapy for both pre- and postmenopausal women for many years. Recently, the third-generation nonsteroidal AIs anastrozole and letrozole and the steroidal AI exemestane have been shown to be more effective than tamoxifen as first-line treatment in postmenopausal women with hormone-sensitive advanced disease, leading to approval in this treatment setting. Different types of endocrine treatments are associated with different side effects, which may include nausea, vaginal bleeding and weight gain. SERMs such as tamoxifen have oestrogen agonist effects in a number of tissues including breast and uterus, which can cause \u2018tumour flare\u2019 and may increase the risk of endometrial cancer. Effects on lipid profile may increase the risk of thromboembolic events.Most patients will eventually become resistant to endocrine agents. In an attempt to extend the time window in which well-tolerated treatments may be used, it is common clinical practice to use two or more different endocrine therapies in sequence. For this to be successful, it is necessary to use endocrine agents with different mechanisms of action that do not possess crossresistance with any hormonal therapies previously used. New endocrine therapies with novel mechanisms of action provide opportunities not only for optimising the efficacy of breast cancer treatment, but may also allow a longer time in which endocrine therapies can be used before reliance upon cytotoxic chemotherapy is necessary.Fulvestrant is a new type of endocrine agent for the treatment of hormone-sensitive advanced breast cancer in postmenopausal women who have progressed on prior endocrine therapy. Unlike tamoxifen, fulvestrant has no oestrogen agonist activity. This supplement contains four papers that together provide a comprehensive review of fulvestrant. The first of these, by C Kent Osborne, Robert Nicholson and Alan Wakeling, provides an overview of the current understanding of ER signalling and its effect on breast cancer development. It details how fulvestrant acts to produce downregulation of cellular levels of the ER. Following this, John Robertson and Mike Harrison review the pharmacokinetics and metabolism of fulvestrant. In the third paper, John Robertson and Ignace Vergote report on the clinical data for fulvestrant, from the early efficacy and tolerability studies through to the three randomised phase III trials for fulvestrant that have been conducted in postmenopausal women with hormone-sensitive advanced breast cancer; two of these compared fulvestrant with anastrozole in patients who had progressed on prior endocrine therapy, and the third compared fulvestrant with tamoxifen as first-line endocrine treatment. Finally, Stephen Johnston reviews the evidence suggesting the versatility of fulvestrant in the sequencing of hormonal therapy, and considers the options for optimising the endocrine sequence cascade."}
+{"text": "The aim of this study is to determine the S100B concentration in colostrums of 51 Burkinabe and 30 Sicilian women, still living in their countries, and in case of a difference to search for its explanations, considering also ethnic differences.The concentration of S100B, in colostrums of the first three days from the delivery, was assessed with commercial immunoluminometric assay.The production of colostrums was significantly higher in Burkinabe women, where the colostrums S100B levels in the first day of lactation showed to be at 24 h higher than those of Sicilian mothers (672.21 \u00b1 256.67 ng/ml vs 309.36 \u00b1 65.28 ng/ml) and progressively decreased reaching the values of Sicilian mothers in the second and third day . Correlation was found between the level of S100B and the length of stage II (duration of expulsive phase of delivery), but the correlation with pain was found only in Burkinabe women.The S100B level in colostrums of Burkinabe mothers differs from that of Sicilians only in the first day of lactation, and in consideration that Burkinabe women produce more colostrums, their newborns receive, during the first days of life, an higher amount of S100B. The elevated quantity of S100B ingested by Burkinabe newborn in the first days of life could promote the physiological postnatal brain adaptation and maturation in the precarious delivery condition of African infants. Human milk contains a multitude of substances that guaranty the adaptation of newborns to the extra-uterine life, whose concentrations are regulated by a biological watch modulated by neuroendocrine and immune factors -3.S100B is an acidic vitamin D-dependent calcium-binding protein, involved in the regulation of all aspect of cell function, largely present in the nervous system, being highly concentrated in glial cells ,5. RecenThe role of S100B in the relationship between mother and newborn is complex and continues after delivery through the secretion of this protein in breast milk. S100B is released in relatively large amounts into both the maternal and foetal circulation during labour and a correlation between S100B in cord blood levels and the physiological events related to brain maturation has been documented . RecentlAfter delivery, when the lactation starts, S100B is secreted in human milk at a level 80\u2013100 times that in mother plasma, but the function of S100B content in colostrums is still unknown . No data2+ absorption by buffering Ca2+ in the cytoplasm and increases ATP-dependent Ca2+ transport in duodenal membrane vesicles, involving second messengers, such as cAMP, cGMP, G-proteins, diacylglycerol through a phosphorylation cascade. This type of signalling involves covalent protein modification depending on two enzyme systems, protein kinases and phosphatases, and consequently, operates at a slower time scale than Ca2+ signalling [2+ transport through intestine epithelium is important in the postnatal adaptation of newborn as well as it was demonstrated by our group for the colostrum beta endorphin (EP) content [2+ ions in brain [The S100B increases Cagnalling . This ro content . In factin brain , thus prin brain  and consGazzolo et al , reporteThe aim of the current study was to determine the S100B concentration in human colostrums of Burkinabe and Sicilian mothers in the first three days post-partum and to correlate S100B levels with the anthropologic characteristics of mothers, the modality of delivery, the pain and the psychological involvement.Colostrum samples from 51 Burkinabe women were collected between July and October 2005 at the Maternity Centre Medical Saint Camille (CMSC) in Ouagadougou (Burkina Faso \u2013 Africa), where 25\u201330 deliveries occur daily. Burkina Faso (formerly Upper Volta) was once a French colony, but it gained its independence in 1960 and is currently one of the poorest countries in the West Africa. The population of 11\u201312 million people belongs to several ethnic groups . They are primarily shepherds or non-nomadic farmers and live in sod and thatch huts of small and rural villages. Their socio-economic status is poor and their hygienic-sanitary conditions are defective with a bad water supply. Colostrum samples from 30 Sicilian women were collected between October and November 2005 at the Maternity of St Bambino Hospital of Catania, which is located in East Sicily, Italy.All samples were from mothers who delivered at term vaginally. Ethical approval for the study was received by the institutional review board at the CMSC and St Bambino Hospital.Data on anthropologic characteristics of mothers  were collected from all the participants to the study. Informations on the socioeconomic status were also collected at the admission to the Maternity in Ouagadougou and Catania. The child birth preparation was made only by Sicilian mothers with the help of a midwife, who often was the same during delivery. Sicilian mothers received a single injection of an ergot derivative (0.2 mg), a powerful vasoconstrictor, immediately after delivery.The exclusion criteria included HIV infection, sexual transmitted diseases and mastitis.All individuals participating in the study signed informed consent forms.No epidurals or other types of analgesia were given to mothers of either country.The psychological involvement was quantified by a semi structured interview within the first 24 h from delivery:- Low pain score (1): correspond to moderately mechanical low back pain, which was accepted by mothers as a natural consequence of delivery;- High pain score (2): correspond to pain in all part of abdomen, which determined a suffering psychological status of the mothers.Mother nutrition was in accord to the traditional habits of their countries.Mothers for colostrum donation were chosen in order of presentation at the Maternity Department. Table This operation was repeated for three consecutive days at 24 h intervals.Then, the samples were transferred in dry ice to the Laboratory of Policlinic, University of Catania, Italy. After thawing, colostrum samples were first centrifuged at 680 \u00d7 g for 10 min at 4\u00b0C. The liquid component was removed and re-centrifuged at 10,000 \u00d7 g for 30 min at 4\u00b0C. The floating lipid layer and cellular sediments were removed. After separation, the milk serum fraction of colostrums samples was stored in 1.5 ml Eppendorph tubes and frozen at -80\u00b0C to be used in our assays. The time from the collection of colostrums and the assays was less than 30 days.The S100B protein concentration was measured in all samples using a commercially available immunoluminometric assay -Italy). According the manufacturer's indication this assay is specific for the beta subunit of protein known to be predominant (80\u201390%) in the human brain. The intra-assay variation coefficient (repetitively) was < 5%; the inter-assay variation coefficient (reproducibility) was < 10%. A standard curve was added to each plate; the reported results were the mean of two determinations.Colostrum S100B levels were presented as mean \u00b1 standard deviation. Statistical comparison of S100B concentrations among the samples collected over three consecutive days were performed using non parametric Wilcoxon rank test for paired and unpaired samples. The correlation between S100B and the length of stage II was made through linear regression curve and calculation of r.The power of samples calculated at a significance limit < 0.05 with Statmate 2 program for Windows  was > 60%. A p-value < 0.05 was selected for significance in all the statistical tests.The characteristics of Burkinabe and Sicilian mothers are summarized in Table Results of S100B determinations (ng/ml) are reported in Table Colostrum volumes collected from Burkinabe women were about 2\u20133 times larger than those from Sicilians (see Table The S100B mean concentration in the colostrums of Burkinabe women was 672.21 \u00b1 256.67 ng/ml in the first day and progressively decreased in the second (204.31 \u00b1 63.25 ng/ml) and third days (199.42 \u00b1 45.28 ng/ml). S100B protein concentration in the colostrums of Sicilian women was lower (309.36 \u00b1 65.28 ng/ml) than that observed in Burkinabe during the first day and decreased in the second (205.16 \u00b1 39.15 ng/ml) and third day (190.25 \u00b1 46.23 ng/ml) after delivery  were significantly higher in colostrums of 16 Burkinabe mother who showed a higher pain score (2) vs the mean values (571.65+171.87 ng/ml) of 35 mothers who showed a low pain score (1) (P < 0.0001)  -25 in a The progressive increment of S100B levels from colostrums to transition milk and mature milk demonstrates that this protein is important during the brain maturation of infants feed at breast, while in milk-formulae milks the S100B is at the lowest level reported in human milk , probablThis study demonstrates also that if the S100B levels are comparable in the colostrums of second and third day in Burkinabe and Sicilian mothers, Burkinabe women produce more colostrums (2\u20133 times) and so their newborns receive a higher S100B amount. This could promote the brain maturation in the precarious nutritional condition of Burkinabe mothers, whose colostrums contain lower levels of DHA 22:6n-3 (Docosahexaenoic acid) and LC n-3 PUFA (long-chain n-3 polyunsaturated fatty acids), a risk factor for future infant development (, in presIn Sicilian mothers, the volume of drawn colostrums could be smaller because they received an Ergot derivative injection after delivery. An Ergot derivative is a dopamine receptor agonist which inhibits prolactin secretion, milk production and the initiation of breastfeeding by two to three days . In our Ethnic factors may impact the timing of lacto genesis stage II and it is possible that the Burkinabe mothers secreted milk sooner and in larger quantities than the European women , with thThese could be convincing explanations for volume difference and S100B content between Burkinabe and Sicilian colostrums in the first day of lactation.The S100B level in colostrums of Burkinabe mothers differs from that of Sicilians only in the first day of lactation, and in consideration that Burkinabe women produce more colostrums, their newborns receive, during the first days of life, an higher amount of S100B. The elevated quantity of S100B ingested by Burkinabe newborn in the first days of life could promove the physiological postnatal brain adaptation and maturation in the precarious delivery condition of African infants.MM and PB partecipated in the design and coordination of this study, EM and TI carried out the immunoluminometric assays, JS and SM collected the colostrum samples in Burkina Faso and in Sicily. DMMR performed the statistical analysis, SM conceived the study and wrote the manuscript.All authors read and approved the final manuscript."}
+{"text": "The main clinical feature of HSN I is the reduction of sensation sense mainly distributed to the distal parts of the upper and lower limbs. Variable distal muscle weakness and wasting, and chronic skin ulcers are characteristic. Autonomic features  are invariably observed. Serious and common complications are spontaneous fractures, osteomyelitis and necrosis, as well as neuropathic arthropathy which may even necessitate amputations. Some patients suffer from severe pain attacks. Hypacusis or deafness, or cough and gastrooesophageal reflux have been observed in rare cases. HSN I is a genetically heterogenous condition with three loci and mutations in two genes (SPTLC1 and RAB7) identified so far. Diagnosis is based on the clinical observation and is supported by a family history. Nerve conduction studies confirm a sensory and motor neuropathy predominantly affecting the lower limbs. Radiological studies, including magnetic resonance imaging, are useful when bone infections or necrosis are suspected. Definitive diagnosis is based on the detection of mutations by direct sequencing of the SPTLC1 and RAB7 genes. Correct clinical assessment and genetic confirmation of the diagnosis are important for appropriate genetic counselling and prognosis. Differential diagnosis includes the other hereditary sensory and autonomic neuropathies (HSAN), especially HSAN II, as well as diabetic foot syndrome, alcoholic neuropathy, neuropathies caused by other neurotoxins/drugs, immune mediated neuropathy, amyloidosis, spinal cord diseases, tabes dorsalis, lepra neuropathy, or decaying skin tumours like amelanotic melanoma. Management of HSN I follows the guidelines given for diabetic foot care  and starts with early and accurate counselling of patients about risk factors for developing foot ulcerations. The disorder is slowly progressive and does not influence life expectancy but is often severely disabling after a long duration of the disease.Hereditary sensory neuropathy type I (HSN I) is a slowly progressive neurological disorder characterised by prominent predominantly distal sensory loss, autonomic disturbances, autosomal dominant inheritance, and juvenile or adulthood disease onset. The exact prevalence is unknown, but is estimated as very low. Disease onset varies between the 2 Hereditary sensory neuropathy type I (HSN I)Hereditary sensory and autonomic neuropathy type I (HSAN I)Charcot-Marie Tooth type 2B syndrome (HMSN 2B)Hereditary sensory radicular neuropathy*Ulcero-mutilating neuropathy*Thevenard syndrome*Familial trophoneurosis*Mal perforant du pied*Familial syringomyelia*Hereditary sensory neuropathy type I (HSN I) is a slowly progressive neurological disorder characterised by prominent predominantly distal sensory loss, autonomic disturbances, autosomal dominant inheritance, and juvenile or adulthood disease onset.Hereditary sensory neuropathy type I (HSN I) constitutes a clinically and genetically heterogenous group of disorders of low prevalence. No detailed epidemiological data are currently available. The disease frequency is still reflected by reports of several affected families. Although the impressive clinical features of HSN I are seen by neurologists, general practitioners, orthopaedists and dermatologists, the condition might still be under-recognised. This is particularly true for cases without family history and those HSN I patients who do not exhibit the characteristic clinical features.et al was suggested before the detection of responsible genes and was thus based on the age at onset, the mode of inheritance and the predominant phenotype. It comprises five main subtypes . HSN (HSAN) type I (HSN I) is characterised by autosomal dominant inheritance and juvenile or adulthood disease onset. The congenital and early onset forms of HSN are subcategorised as subtypes HSN II \u2013 V and are transmitted by an autosomal recessive trait [Hereditary sensory neuropathies (HSN), also known as hereditary sensory and autonomic neuropathies (HSAN), belong to the large group of hereditary neuropathies. Typically, the HSNs predominantly affect peripheral sensory and autonomic neurons but there is also variable motor involvement . The claThis review focuses on HSN type I. Molecular genetic studies in the past years have demonstrated genetic heterogeneity between the HSN I subtypes. The summary provided in the next paragraph describes clinical and neurological abnormalities in which the diagnosis HSN I should be considered in a patient or a family.nd and 5th decade of life. At the beginning patients often notice distal sensory loss and/or slow healing of wounds and/or chronic skin ulcers. The latter changes appear due to permanent pressure, i.e. long walks or when patients wear shoes that do not fit well. Minimal wounds or blisters may then lead to deep foot ulcerations. Other patients first recognise that they cannot distinguish warm and cold stimuli, and that they are insensitive to pain. When they get painless burns and injuries they seek medical advice [SPTLC1 mutations and occurs in early stages of the disease [i.e. Charcot-Marie-Tooth syndrome, CMT) [SPLTC1 mutations [A main and consistent feature of HSN I is the reduction of sensation sense which is mainly distributed to the distal parts of the upper and lower limbs Table . Diseasel advice . Neurolo disease . The degme, CMT) ,4. Foot utations . The disutations ,5.et al in the family later shown to carry a SPTLC1 mutation and the study by Dubourg et al also show motor conduction slowing, possibly implying a demyelinating process [RAB7 mutation showed a mixed motor and sensory neuropathy with axonal and sometimes also demyelinating nerve damage [SPTLC1 mutation. In severely affected nerves only a very few myelinated fibres remained but electron microscopy showed a reasonable number of unmyelinated axons although the presence of stacks of flattened Schwann cell processes suggested unmyelinated axon loss. There was also some evidence for primary demyelination [In HSN I there is broad variability of electrophysiological abnormalities within and between families. Primarily axonal nerve damage of both motor and sensory nerves has been shown. Sensory potentials are usually absent in the lower limbs but are often recordable or even normal in the upper limbs, particularly in females ,6. The s process ,8. Neuroe damage ,9. SuralHSN I is a genetically heterogenous condition. In the past two decades the introduction of genome-wide linkage studies enabled genetic testing of several HSN families and resulted in the elucidation of the molecular genetic background of these diseases. Detailed family studies clearly demonstrated clinical and genetic heterogeneity of HSN I and three gene loci and two genes were subsequently identified . Table 2A subdivision into HSN IA, HSN IB, HSN IC, and HSN ID which is based on the different genetic background is proposed here.et al re-examined family members of a previously reported typical HSN I kindred [et al showed that specific missense mutations in the human gene serine palmitoyltransferase long chain (SPTLC1) lead to HSN I. In this study, 11 out of 24 families with HSN were screened and carried a pathogenic mutation in the SPTLC1 gene. This gene is ubiquitously expressed and comprises 15 exons [SPTLC1 coding region resulting in a single amino acid substitution of cysteine to tryptophan (C133W) and was found in eight HSN I families of Australian, English and Canadian origin. Two further less common missense mutations in exons 5 and 6  were identified in an Austrian family and in a family of Australian/English descendent [et al who reported the C133Y and the C133W mutations in two further unrelated families with typical HSN I [SPTLC1 mutations were also confirmed in HSN I families from Czechia and Portugal [et al pointed out that the sensory-motor neuropathy phenotype caused by the c.399T > G point mutation was the same as that reported by Campell and Hoffmann and, possibly, the same as that originally described by Hicks. Haplotype analysis in the families reported by Dawkins demonstrated that three Australian families of English extraction and three English families had the same haplotype on chromosome 9 suggesting a common founder as was the case in six of eight families in an English study [SPTLC1 might be the causative gene in the majority of HSN I patients. However, this was questioned by a large study by Klein et al, in which only one SPTLC1 mutation was identified 25 HSN families tested [Historically, several families with juvenile and adulthood HSN and suggestive autosomal dominant inheritance have been reported. Most of the patients described in these early reports exhibited the typical features of HSN with pronounced distal sensory disturbances and acro-mutilations, and sometimes also distal muscle involvement. These families were diagnosed as HSN I in the classification proposed by Dyck . In 1996 kindred . Blood s kindred . In 200115 exons . The mosptophan C3W and waPortugal ,17. Nichsh study . SubsequSPTLC1 mutations were originally suggested to increase the serine palmitoyltransferase function with higher levels of glycosyl ceramide compared to controls behaving as gain of function mutations [SPTLC1 mutations are dominant inactivating [et al carried out functional studies in order to detect mechanisms leading to the HSN I phenotype. Their tests using cells from HSN I patients with the mutation T399G-(Cys133Trp) in the SPTLC1 gene revealed a reduction of SPT activity in transformed lymphocytes of 44%. Interestingly, this had no effect on various spingolipid associated functions as de novo biosynthesis, cellular sphingolipid content, cell proliferation or death (apoptosis and necrosis). Other tests showed similar results with no effects on viability of cells after removal of extracellular sphingolipids, on permeability to triton X-100 of primary lymphocytes, on viability or in whole blood counts. Thus, the authors concluded a sufficient actitivity of the non mutant allele for adequate sphingolipid biosynthesis and cell viability. The authors speculated that neurodegeneration in HSN1 is due to rather subtle and long term effects like abnormal protein(s) similar to other neurodegenerations.Serine palmitoyltransferase (SPT) is a pyridoxal-5'-phosphate dependent enzyme, which is suggested to be a key enzyme for the regulation of sphingolipid levels in cells. SPT in humans consists of two hetero subunits, SPTLC1 and SPTLC2 , which are both bound to the endoplasmic reticulum (ER) . Regulatutations . Howevertivating ,24. The tivating . RecentlSPTLC2 is the second gene for the SPT protein, is located on the chromosome 14q24.3\u2013q31 and comprises 12 exons [SPTLC1 gene did not reveal any pathogenic mutations in the SPTLC2 gene. The authors therefore concluded that SPTLC2 mutations are not a common cause for hereditary sensory neuropathy [12 exons . Screeniuropathy .et al reported a family with an autosomal dominant hereditary HSN. Patients had distal sensory loss usually without foot ulcerations but adult onset of gastro-oesophageal reflux and cough and no motor symptoms. Cough could be triggered by noxious odours and could lead to syncope. Nerve conduction studies, and sural and skin biopsies revealed a sensory axonal neuropathy. Audiometry showed sensorineural hearing loss in 4 out of 10 affected individuals [In 2002, Spring ividuals . The disividuals . Since tet al carried out a clinical and genetical study in a large American family with autosomal dominant HMSN 2 (CMT2) [RAB7 were detected [RAB7 gene (Asn161Thr) was reported in 2004 in an English family [RAB7 mutations [In 1995, Kwon 2 (CMT2) . In this2 (CMT2) . Due to 2 (CMT2) ,4. With 2 (CMT2) . The dis2 (CMT2) . Finallydetected . The Valdetected ,30. A thh family . The mututations .RAB7 consists of 5 exons and belongs to the Rab family of Ras-related GTP-ases. The Rab proteins are essential for the regulation of intracellular membrane trafficking. They may have a role in linking vesicles and target membranes to the cytoskeleton [RAB7 gene has been localised to late endosomes and has been shown to be important in the late endocytic pathway. Although the function of RAB7 has already been studied in detail, it remains still unknown how mutations in the ubiquitously expressed RAB7 gene cause a CMT2B neuropathy [skeleton ,33. The uropathy .et al could not identify any mutations in the RAB7 gene in the large series of HSN families and in sporadic HSN patients of whom several affected individuals also had marked peroneal muscle wasting. Also, linkage to the known HSN I loci has been excluded in a few further families with autosmal dominant inheritance. Thus, further genetic linkage studies in large families are needed to identify new causative genes of HNS I [Further genetic heterogeneity has been suggested in HSN I ,34,35. Kof HNS I .SPTLC1 and RAB7 genes. Large families in which mutations in SPTLC1 and RAB7 are excluded can be used for genome wide linkage studies to detect a novel HSN I locus or to confirm linkage to the third known HSN I locus (i.e. the HSN IB locus). Such large HSN families will be most helpful to identify further genes which are involved in the pathogenesis of HSN I.In a single patient, the clinical diagnosis of HSN I is based on the observation of signs and symptoms described above, and is supported by a family history suggesting autosomal dominant inheritance. The diagnosis is supported by ancillary tests such as nerve conduction studies which are needed to confirm a sensory and motor neuropathy predominantly affecting the lower limbs. In sporadic cases acquired neuropathies have to be excluded  by use of several laboratory tests. Radiological studies, including magnetic resonance imaging, are useful when bone infections or necrosis are suspected. With the discovery of several distinct HSN loci, and ultimately the deciphering of the underlying gene defects, the definitive diagnosis is now molecular and is based on the detection of mutations by direct sequencing of the HSN I must be distinguished from other forms of hereditary sensory neuropathies (HSN types II-V). The phenotype of HSN II is often similar to that of HSN I. The main differences are the autosomal recessive pattern of inheritance of HSN II, an earlier disease onset, diffuse sensory loss which is sometimes distributed to the whole body, and less or no motor symptoms in HSN II. HSN II patients also often exhibit early-onset of severe acro-mutilations in the fingers. HSN III to HSN V can be easily distinguished from HSN I because of congenital disease onset. Also, these subtypes exhibit typical features such as the predominant autonomic disturbances in HSN III or congenital loss of pain and anhidrosis in HSN IV.Particularly in sporadic patients with an HSN I phenotype it is important to exclude acquired causes of ulcero-mutilating neuropathies. The major differential diagnoses are the diabetic foot syndrome and alcoholic neuropathy. Exclusion of other causes of neuropathies can usually be done by laboratory and radiological studies, and requires interdisciplinary discussion between neurologists, dermatologists, and orthopaedics. Table As the disorder is inherited by an autosomal dominant trait, previous family history is often reported. There is thus a Mendelian risk of 50% for subsequent generations independently from the sex of the affected individual and the child. Genetic counselling is an important tool for preventing new cases if this is wished by at-risk family members. Predictive testing of mutation carriers necessitates accurate genetic counselling but is certainly useful for young people to avoid serious complications of the disease.Molecular genetic diagnosis can be considered in families where the disease causing mutation is known. However, termination of pregnancy is not recommened in HSN1. When a patient is male, artificial insemination with donor sperm is another option that could be discussed with the couple during genetic counselling.pseudodiabetic foot syndrome\". Therefore, treatment of foot ulcers and infections can follow the guidelines given for diabetic foot care which starts with early and accurate counselling of patients about risk factors for developing foot ulcerations. This of course includes orthopaedic care and use of well fitting shoes without pressure points. To date, treatment of foot complications has reached an efficient level allowing treatment on an outpatient basis. Early treatment of foot complications often avoids hospitalisation and, in particular, complications like amputations. Principles of therapy are removal of pressure to the ulcer, eradication of infection and specific protective footwear afterwards.No gene-based therapies are available to date for any variant of autosomal dominant HSN. Yet, accurate diagnosis is important and is requested by patients and at-risk family members. Ulcero-mutilating complications are the most serious, prominent and leading diagnostic feature in HSN I. The painless neuropathic foot ulcerations observed in several subtypes of autosomal dominant HSN often mimic foot ulcers caused by diabetic neuropathy and thus resemble a \"If patients with HSN I receive appropriate counselling and treatment, the prognosis is good. Early treatment of foot infections may avoid serious complications. Also the complications are manageable, allowing an acceptable quality of life. The disease is slowly progressive and does not influence the life expectancy.SPTLC1 and RAB7 genes lead to the phenotype of HSN I. For many families and single HSN cases the genetic background still remains unknown due to the genetic heterogeneity of the autosomal dominant HSN. There is still no causative treatment of HSN. Pharmacological treatment or gene therapy are needed but require a better understanding of the molecular and functional mechanisms underlying the different genetic subtypes of HSN I.It is still unclear how mutations in the"}
+{"text": "However, the ability of S100B inhibitors to prevent/reverse AD histopathology remains controversial. This study examines the effect of S100B ablation on in vivo plaque load, gliosis and dystrophic neurons.Numerous studies have reported that increased expression of S100B, an intracellular Ca-/- line was generated by crossing PSAPP double transgenic males with S100B-/- females and maintained as PSAPP/S100B+/- crosses. Congo red staining was used to quantify plaque load, plaque number and plaque size in 6 month old PSAPP and PSAPP/S100B-/- littermates. The microglial marker Iba1 and astrocytic marker glial fibrillary acidic protein (GFAP) were used to quantify gliosis. Dystrophic neurons were detected with the phospho-tau antibody AT8. S100B immunohistochemistry was used to assess the spatial distribution of S100B in the PSAPP line.Because S100B-specific inhibitors are not available, genetic ablation was used to inhibit S100B function in the PSAPP AD mouse model. The PSAPP/S100B-/- mice exhibited a regionally selective decrease in cortical but not hippocampal plaque load when compared to PSAPP littermates. This regionally selective reduction in plaque load was accompanied by decreases in plaque number, GFAP-positive astrocytes, Iba1-positive microglia and phospho-tau positive dystrophic neurons. These effects were not attributable to regional variability in the distribution of S100B. Hippocampal and cortical S100B immunoreactivity in PSAPP mice was associated with plaques and co-localized with astrocytes and microglia.PSAPP/S100BCollectively, these data support S100B inhibition as a novel strategy for reducing cortical plaque load, gliosis and neuronal dysfunction in AD and suggest that both extracellular as well as intracellular S100B contribute to AD histopathology. The extracellular effects of S100B are concentration dependent; nanomolar S100B levels beneficially promote neuronal survival while micromolar levels detrimentally promote apoptosis [S100B, a member of the S100 protein family, is expressed predominantly in astrocytes and functions as both an intracellular Caopeptide . The teropeptide . S100 pring loop . Upon bi effects ,6. Over poptosis -9. S100Bpoptosis ,8. S100Bpoptosis . Increaspoptosis ,17.2+ homeostasis followed by inflammation, neurodegeneration, senile plaques comprised of aggregated amyloid \u03b2 (A\u03b2) peptide, intracellular neurofibrillary tangles comprised of aggregated hyperphosphorylated tau, and ultimately cognitive dysfunction [Altered S100B function is associated with AD pathobiology. The clinical presentation and pathology of early- and late-onset AD include early disturbances in Cafunction -21. In hfunction ,22,23. Sfunction . In addifunction . While tfunction -28. In tfunction  resultinfunction ,30.In vivo studies in genetically modified mouse models have yielded conflicting results regarding the contribution of increased S100B expression to AD pathology. Transgenic TghuS100B mice express 4-5 fold more S100B protein [ protein  and exhi protein . However protein . The mec protein . Surpris protein . Thus, tin vivo genetic approach which recapitulates the entire spectrum of S100 function  to ascertain the net effect of S100B ablation on AD histopathology in the PSAPP AD mouse line. Although no AD mouse model exhibits all aspects of the human disease, the PSAPP double transgenic (APPK670NM671L/PS-1M146L) line has a rapid disease onset and mimics many facets of the human disease including plaque deposition, dystrophic neurites, glial activation, and memory deficits [While specific inhibitors that block the interaction of S100B with its target proteins are under development, currently available compounds do not cross the blood-brain barrier and cannot be used to inhibit CNS S100B . Therefodeficits -38. PSAPK670N/M671L mutation) with the 6.2 line (PS-1M146L) [-/- line has been described previously [-/- line was generated by crossing PSAPP double transgenic males with S100B-/- females and subsequent interbreeding of the PSAPP/S100B+/- heterozygous offspring (PSAPP/S100B+/- X PSAPP/S100B+/-). To control for changes in genetic background, all experiments used PSAPP/S100B+/+ and PSAPP/S100B-/- littermates. Procedures involving animals were approved by the Texas A & M University Institutional Animal Care and Use Committee and comply with the NIH Guide for the Care and Use of Laboratory Animals.The PSAPP double transgenic line was generated by crossing the Tg2576 line (\"Swedish\" APP-1M146L) -38. The eviously . The PSAFor genotyping, amplification of a 500 bp product using PCR primers for the mouse \u03b2-casein gene (forward primer 5' GAT GTG CTC CAG GCT AAA GTT 3' and reverse primer 5' AGA AAC GGA ATG TTG TGG AGT 3') was used to assess genomic DNA quality. The PS-1 and APP transgenes were detected as previously described . Amplifi2, 0.01% (wt/vol) sodium deoxycholate, 0.02% (vol/vol) Nonidet P-40 in 100 mM sodium phosphate buffer pH 7.5 for 36-48 hours. After post-fixation in 10% buffered formalin for 16 hours, tissues were embedded in paraffin and 5 micron sagittal sections were mounted on glass slides for subsequent staining. This processing procedure, originally developed for visualization of \u03b2-galactosidase reporter gene activity in transgenic mouse tissues, provides optimum S100B antibody specificity/sensitivity without compromising the detection of other antigens.Brains were removed from anesthetized animals, rinsed in phosphate buffered saline (PBS) and fixed in 4% (wt/vol) paraformaldehyde in PBS for 30 minutes. Sagittal slices, 2 mm in thickness, were prepared using an acrylic brain matrix  and post-fixed for an additional 30 minutes. Slices were then permeabilized in 2 mM MgClTo minimize variability, sections from experimental and control groups were processed simultaneously. Consecutive slides  each containing sections at Allen Brain Atlas Sagittal Levels 8 and 17 were depariffinized and rehydrated to distilled water. For Congo red staining, slides were incubated in 0.02 M NaOH in 80% ethanol saturated with NaCl for 20 minutes followed by a 30 minute incubation in 0.2% (wt/vol) Congo Red  in 0.02 M NaOH in 80% ethanol saturated with NaCl, dehydration and mounting. Immunostaining was performed on a DAKO autostainer  using a biotin-free polymer detection kit  and conditions recommended by the primary antibody manufacturer. Primary antibodies for immunohistochemistry included a mouse monoclonal S100B antibody (1-1000 dilution of Z0311 Dako); rabbit polyclonal GFAP antibody ; mouse monoclonal Iba1antibody ; and mouse monoclonal Ser202/Thr205 phosphorylated tau antibody . For immunofluorescence microscopy, the anti-Iba1 antibody was diluted 1-10, the anti-GFAP antibody 1-100, and the anti-S100B antibody 1-50 . Secondary antibodies included an Alexa Fluor 546 donkey anti-rabbit ; Alexa Fluor 488 rabbit anti-mouse ; and Alexa Fluor 546 donkey anti-mouse .-/-). An independent samples t-test  was used to determine the significance (p < 0.05) of measured differences between the two genotypes. Pearson's Correlation Coefficient and scatter plots of the mean hippocampal and cortical GFAP/Iba1 burden versus plaque load for each animal were used to determine the relationship between plaque load and astrocytosis/microgliosis.For quantification, digital images were captured at 10\u00d7 magnification on an Olympus IX70 Imaging System using a single exposure setting as follows: the entire hippocampus (2 images); the visual (1 image), somatosensory (1 image) and somatomotor (1 image) cortex as well as representative areas of the cerebellum and olfactory bulb. Images were converted to gray scale and the threshold intensity was set to the intensity observed in areas without tissue. Image J software  was used to quantify positive pixels, plaque size, plaque number and total area. Plaque load and immunoreactivity were defined as the % area, i.e. the area of positive pixels/total pixels \u00d7 100. The data were expressed as the mean \u00b1 SEM  and colocalization (overlap coefficient) of GFAP/S100B and Iba1/S100B determined using the LSM software.-/- and PSAPP mice  when compared to PSAPP mice (0.168 \u00b1 0.016 percent area)   Figure . This de) Figure  and 1D. -/- mice  ,26,32,33e Figure  and 2B. e Figure . Howevere Figure . In bothe Figure  and olfae Figure . Hippocae Figure  and 3B ae Figure . In addie Figure  and olfae Figure . Collect-/- mice exhibited fewer cortical but similar numbers of hippocampal phospho-tau foci/plaques when compared to PSAPP mice  levels [This study definitively demonstrates that S100B ablation/inhibition reduces AD pathology. PSAPP/S100B knockout mice exhibited a regionally selective decrease in cortical but not hippocampal plaque load that was accompanied by reductions in astrocytosis, microgliosis and dystrophic neurons. These regionally selective effects were not attributable to variations in the S100B distribution; cortical and hippocampal S100B staining patterns were indistinguishable in PSAPP mice. Finally, in PSAPP mice S100B immunoreactivity was associated with plaques and colocalized with astrocytes as well as microglia suggesting that both intracellular and extracellular S100B contribute to AD histopathology. Interestingly, other studies have reported regionally selectively effects of S100B ablation on Ca) levels -47. Asce) levels -50.-/- mice hippocampal plaque load remains unchanged regardless of the mechanism used to induce plaque deposition, i.e. A\u03b2 infusion [These findings clarify inconsistencies in the literature regarding S100B's contribution to AD histopathology. Genetic ablation (this study), pharmacological inhibition  and geneinfusion  or overeinfusion  and overinfusion . These dinfusion , upregul-/- mice will be instrumental in identifying S100B-regulated events that contribute to AD pathology and in discerning the relationship between plaques and inflammation. Behavioral data are not available for any of the S100B/AD mouse models. Strengthened synaptic plasticity and enhanced spatial memory in S100B-/- mice [-/- mice will exhibit improved cognitive function. This hypothesis is supported by the inverse correlation of serum/CSF S100B levels and direct correlation of the rs2300403 SNP in the S100B gene with low cognitive performance, dementia and AD [A consistent finding in this and previous studies is a direct correlation between changes in plaque load and gliosis/inflammation in response to alterations in S100B expression. It is unclear, however, whether changes in plaque load are the cause or the result of changes in gliosis. Furthermore, it is unclear how these histopathological changes impact cognitive function. Microglia are an essential component of the inflammatory response and exist in many forms ,53. They-/- mice  suggest a and AD ,25. Expe2+ handling, synaptic plasticity long-term potentiation, neuronal apoptosis and/or BDNF levels [2+ homeostasis with AD pathobiology and/or serve as a common upstream regulator of both tau phosphorylation/neurofibrillary tangles and A\u03b2 production/plaque deposition [S100B's plaque association and co-localization with cells (microglia/astrocytes) in this and previous studies ,23,33 suF levels -47,57,58F levels ,59-64 coF levels -21. In fposition -21. Whilposition -67. DefiCollectively, these data definitively demonstrate that S100B ablation reduces plaque load, gliosis and dystrophic neurons in the cortex but not the hippocampus. If this reduction in histopathology can be demonstrated to positivity impact cognitive changes related to AD, then additional impetus to the search for new therapeutic interventions targeted at S100B will be provided. The development of effective pharmacological strategies for modulating S100B function in patients will also require quantifying the contribution of extracellular versus intracellular forms, identifying the S100B-regulated target proteins/cellular processes, and ascertaining the contribution of the five other S100 family members implicated in AD, S100A1, S100A6, S100A7, S100A9, and S100A12 -70. FinaThe authors declare that they have no competing interests.LH and KY provided the PSAPP mouse line. AM provided the S100B knockout mouse line. DZ and LH conceived the study and developed the PSAPP/S100B knockout mouse line. ER performed the experiments and participated in the writing of the manuscript as partial fulfillment of the requirements for the PhD degree. DZ supervised the data collection/analyses and drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "Having been in this profession for close to three decades, the last twenty six years as a teacher, I would like to reflect on the changes I have observed, share some of my thoughts, and ask a few questions. \u201cThere is nothing permanent except change\u201d is an often quoted adage. Are all changes for the good is the moot question. Changes like verifiable credit points for continuing to practice is most welcome. But do all changes fit this category? A lot has been done to stem the rot. The mindset of the teachers and students has undergone a tremendous shift \u2013 not necessarily for the good. \u201cTeachers working full time\u201d in institutions a thousand miles away \u2013 is this change welcome? It is said by some that the present day students care less for their teachers. If true, who is responsible? Are the present day younger teachers as dedicated as retired teachers or the seniors of today? Is money becoming the top priority? In India, can we really expect a move in the right direction? To borrow some words from the US President elect Barrack Obama \u2013 Yes, we can. I sign off with the quote from the Mahatma \u201cBe the change you want to see.\u201d"}
+{"text": "S100B promotes development and maturation in the mammalian brain. However, prolonged or extensive exposure can lead to neurodegeneration. Two important functions of S100B in this regard, are its role in the development and plasticity of the serotonergic neurotransmitter system, and its role in the cascade of glial changes associated with neuroinflammation. Both of these processes are therefore accelerated towards degeneration in disease processes wherein S100B is increased, notably, Alzheimer's disease (AD) and Down syndrome (DS). In order to study the role of S100B in this context, we have examined S100B overexpressing transgenic mice. Similar to AD and DS, the transgenic animals show a profound change in serotonin innervation. By 28 weeks of age, there is a significant loss of terminals in the hippocampus. Similarly, the transgenic animals show neuroinflammatory changes analogous with AD and DS. These include decreased numbers of mature, stable astroglial cells, increased numbers of activated microglial cells and increased microglial expression of the cell surface receptor RAGE. Eventually, the S100B transgenic animals show neurodegeneration and the appearance of hyperphosphorylated tau structures, as seen in late stage DS and AD. The role of S100B in these conditions is discussed.  S100B is a member of the EF-hand type of calcium binding S100 protein family which consists of approximately 20 different proteins. S100B is the only member found on chromosome 21, the remaining largely being found in a cluster on chromosome 1. S100B is the principle S100 found in brain, and makes up approximately 0.5% of all brain proteins. Under normal physiological states, S100B is expressed predominantly in astroglial cells of the central nervous system (CNS), and also to a lesser extent, in neurons, microglia, and oligodendrocytes . HoweverDonato has suggested that S100B is important for the progression of cells through the cell cycle , 17. We Serum levels of S100B in humans are age-dependent  being hiThe neurobiological effects of S100B are known to occur intracellularly, in the cells which express the proteins, as well as extracellularly, as the protein can be released, notably in response to serotonin (5-HT) binding to the 5-HT1A receptor , 17, 23.Some of the detrimental extracellular effects of S100B may be mediated via the cell-surface receptor for advanced glycation end-products (RAGE). In the central nervous system, RAGE can be localized to neurons, microglial cells, and astrocytes. The RAGE receptor is a member of the immunoglobulin superfamily and leads to cellular dysfunction in a number of disorders. This receptor was originally identified and characterized for its binding of advanced glycation end-products (AGEs) which accumulate in diseases such as diabetes and renal failure . More reElevated brain S100B expression occurs in various disease states, including Alzheimer's disease (AD) and Down syndrome (DS). The gene for S100B is found on chromosome 21 and is often part of the triplicated chromosome in DS. Interestingly, Down Syndrome almost inevitably leads to an extremely early development of AD and the increase in S100B is thought to contribute to the pathology of both. Although S100B has a variety of cellular effects throughout the body and brain, its role in neuroinflammation, and in the regulation and maintenance of the serotonergic nervous system is highlighted, with a particular focus on the hippocampus. Understanding neuroinflammation and serotonin neuronal plasticity in this brain region may help to explain many findings of changes in learning and memory, as well as the occurrence of depression symptoms. This is especially pertinent when considering co-morbidity in conditions wherein the levels of S100B are altered, such as AD and DS.Numerous human postmortem studies have shown increased S100B in the brain of subjects with AD \u201331. ThisSerum levels of S100B are greatly increased in Down syndrome  and postThe neurons which produce serotonin are amongst the earliest developing neurons in the mammalian brain and serotonin plays a role in the development and maturation of many brain regions . SerotonInterestingly, by twenty years of age, PET studies in normal populations have shown that the serotonin transporter begins to decrease and continues to do so at the approximate rate of 10% per decade up until the 8th decade . A furthIn midgestation DS fetuses, there is a significant (40%) loss of serotonin content in frontal cortex , althougThe increased levels of S100B in Alzheimer's disease may also be associated with a loss of serotonin. Neurofibrillary tangles have been shown to occur in the raphe nuclei, the site of serotonergic cell bodies , 66, andWe have examined the development and maintenance of serotonin terminals in the S100B overexpressing transgenic mouse using an antibody raised against the serotonin transporter (SERT) which stains serotonergic fibers. Our results show increased serotonergic fibers in the dentate gyrus of the hippocampus of 10 week old S100B transgenic mice. Conversely, at 28 weeks, there is an accelerated loss of SERT-stained serotonin fibers as these animals age .Despite the decrease in serotonergic fibers, stereological analysis found no evidence for a decreased number of serotonin neurons in the raphe nucleus, as in the human post-mortem studies of AD . A recenThese findings show that changes in S100B could lead to the changes in serotonin observed in DS and AD. Moreover, since serotonin has long been known to be related to depression, our findings may imply a role for S100B in depression. S100B levels are increased in CSF and serum of patients with depression , 74, andA combination of natural aging and numerous intermittent peaks in inflammatory processes, caused by environmental stressors such as infection, ischemia, or toxins, may ultimately lead to the pathological changes associated with aging. In the brain, these processes are termed neuroinflammation and generally refer to those processes known as \u201creactive gliosis.\u201d That is, the accumulation of enlarged or dystrophic microglial and astroglial cells . NeuroinThe role of S100B in neuroinflammation is becoming increasingly evident , 80. S10In the S100B overexpressing mice, we have looked for effects of S100B on astroglial and microglial cells, in order to confirm the role of S100B in the neuroinflammatory changes seen in DS and AD. Finally, we have looked at markers of degeneration. The results of these studies are described in the following pages.2+ levels and once activated by Ca2+, S100B interacts with intermediate filaments including GFAP and vimentin [Astroglial appearance can generally be characterized by number, cell body size, and type of processes. Chronic overexpression of S100B results in changes to the number and morphology of S100B-labeled astrocytes at early (12 weeks) and later (28 weeks) timepoints. In the S100B overexpressing mice, astroglial cells are rarely observed to have the complex morphology with numerous processes, which are seen in control mice. Within astroglial cells, S100B regulates Cavimentin , 86. Thivimentin \u201389. ThusIt is important to note previous studies showing that at low concentrations, S100B stimulates astroglial proliferation , and at Microglial cells are the primary component of the brain's immune system and are a key part of neuroinflammatory processes . As withMicroglial activation is mediated by numerous substances released by the injured tissue  one of w\u03baB, which regulates cytokines, including interleukin IL-1, IL-6, and tumor necrosis factor [S100B has been shown to have at least two effects on microglial cells, one of which (production of nitric oxide) is RAGE-independent whereas the other (increases in the transcription factor NFkappaB) is dependent on binding to microglial RAGE . When S1s factor , 110.Both control and S100B-overexpressing animals show an increase in microglial cells and RAGE expression with age. However, this effect is more pronounced in the S100B animals,  also se. Thus, SAlthough a role linking S100B directly to cell death in DS and AD has not been established, there is evidence from animal data that this may indeed be the case , 112. S1For example, Vitamin E was examined in the S100B overexpressing mouse to determine if antioxidant treatment had the potential to attenuate neuroinflammatory damage associated with increased S100B. The results show that although Vitamin E decreased microglial activation in the control animals, it actually increased microglial activation and RAGE expression in S100B overexpressing mice . We and In conclusion, the data demonstrate that chronic S-100B overexpression results in serotonergic fiber alterations in the hippocampus, but no alterations to the number of serotonin neurons in the raphe nuclei. The data also show that chronic S100B over-expression results in activated astrocytes and microglia beginning during neonatal development and persisting through adulthood. Such changes are associated with an increase in RAGE expression. Considering the appearance of TAU-immunolabeling as a result of chronic S100B overexpression, future studies are needed to better understand the role of S-100B in mediating serotonergic and glial alterations, and their role in neuropathologies, such as, DS, aging, and AD."}
+{"text": "N-acylhomoserine lactones (AHLs) acting as signal molecules. AHL-acylase is a quorum quenching enzyme and degrades AHLs by removing the fatty acid side chain from the homoserine lactone ring of AHLs. This blocks AHL accumulation and pathogenic phenotypes in quorum sensing bacteria.The infection and virulence functions of diverse plant and animal pathogens that possess quorum sensing systems are regulated by aac gene of undemonstrated function from Ralstonia solanacearum GMI1000 was cloned, expressed in Escherichia coli; it inactivated four AHLs that were tested. The sequence of the 795 amino acid polypeptide was considerably similar to the AHL-acylase from Ralstonia sp. XJ12B with 83% identity match and shared 39% identity with an aculeacin A acylase precursor from the gram-positive actinomycete Actinoplanes utahensis. Aculeacin A is a neutral lipopeptide antibiotic and an antifungal drug. An electrospray ionisation mass spectrometry (ESI-MS) analysis verified that Aac hydrolysed the amide bond of AHL, releasing homoserine lactone and the corresponding fatty acids. However, ESI-MS analysis demonstrated that the Aac could not catalyze the hydrolysis of the palmitoyl moiety of the aculeacin A. Moreover, the results of MIC test of aculeacin A suggest that Aac could not deacylate aculeacin A. The specificity of Aac for AHLs showed a greater preference for long acyl chains than for short acyl chains. Heterologous expression of the aac gene in Chromobacterium violaceum CV026 effectively inhibited violacein and chitinase activity, both of which were regulated by the quorum-sensing mechanism. These results indicated that Aac could control AHL-dependent pathogenicity.An aac gene (NP520668) of R. solanacearum GMI1000 is via AHL-acylase and not via aculeacin A acylase. Since Aac is a therapeutic potential quorum-quenching agent, its further biotechnological applications in agriculture, clinical and bio-industrial fields should be evaluated in the near future.This is the first study to find an AHL-acylase in a phytopathogen. Our data provide direct evidence that the functioning of the  N-acyl-homoserine lactones (AHLs) as quorum-sensing signal molecules by means of LuxI-type AHL synthases  (r2 = 0.99). One unit of the AHL-acylase activity is defined as the released nmol amount of HSL after an AHL is digested by 1 ml of cell suspension  at 30\u00b0C for 1 min.A modified homoserine lactone-activity . Seven Ain vivo expression of the aac gene in C. violaceum, the pS3aac was transformed to C. violaceum CV026 by the heat shock method [C. violaceum CV026 (pS3aac) (OD600 = 0.7) was added into 100 ml of fresh LB broth containing tetracycline and 0.5 mM C7-HSL, and then incubated at 30\u00b0C at 250 rpm for 24 h. At intervals of 2 h, the violacein from 0.5 ml of various interval cells was extracted with 1 ml of 95% ethanol for 1 min. The supernatant containing the violacein was collected by centrifuging at 13,000 rpm for 1 min. The absorbance of the supernatant was measured at a wavelength of 576 nm (OD576) using a U-2000 spectrophotometer (Hitachi).To observe the k method  and a vik method  was perf-1), 0.5 mM C7-HSL, and 0.2% (w/v) chitin from crab shells (Sigma). The plate was incubated at 30\u00b0C for 3 ~5 d to observe whether a clear zone formed around the colonies. The formation of a clear zone indicated a positive reaction.The chitinolytic activity assay was modified from the method for detecting chitinolytic activity on agar plates . Cells w-1 was prepared and inoculated with 100 \u03bcl of 16 h pre-cultured Candida tropicalis F-129 and incubated at 37\u00b0C for 16 h. The growth of the cells was measured at OD600. Serial dilutions of aculeacin A were incubated with 12 \u03bcg of purified Aac in 90 \u03bclof sodium phosphate (pH 7.0) at 30\u00b0C for 1.5 h; subsequently, the dilution susceptibility test was performed.The assay for the determination of MIC values of aculeacin A was modified from the dilution susceptibility test . A serieaiiA [aiiD [R. solanacearumGMI1000 genomic clones containing the aac gene were searched by the GMI1000 clone finder. http://bioinfo.genopole-toulouse.prd.fr/annotation/iANT/bacteria/ralsto/index.html.The first cloned AHL-lactonase gene aiiA  and the iA [aiiD  were utiiA [aiiD ,37 at NCt-test program was used.The Microsoft Excel 2003 R. solanacearumGMI1000 genome sequence (NC 003295) and megaplasmid pGMI1000MP (NC003296) [aac gene (Locus tag RSc2547) with an 83% identity match when interrogated with the AHL-acylase aiiD sequence [aiiA sequence [aac gene encodes a putative protein that was defined as a probable aculeacin A acylase transmembrane protein (NP 520668). Among the function-demonstrating proteins, Aac shared 83%, 39%, 24%, and 24% identities at the peptide level with the AHL-acylase from Ralstonia sp. XJ12B [Actinoplanes utahensis [Brevundimonas diminuta [Providencia rettgeri [BLASTN and BLASTP searches of the annotated C003296)  identifisequence . No signsequence . Howeverp. XJ12B , aculeactahensis , cephalorettgeri , respectaac gene was PCR amplified  and the 2,405 bp product was cloned in pBBR1MCS-3 to yield plasmid pS3aac. To analyse the ability of Aac to degrade AHLs pS3aac was used to transform E. coli DH10B. The cloned aac sequence was confirmed to have no mutations. For examining the degrading activity of the clone E. coli DH10B (pS3aac), C6-, C7-, and C8- HSLs were used as autoinducers in performing a whole cell bioassay described in the Materials and Methods. The results of the whole cell bioassay revealed that E. coli DH10B (pS3aac) cells were inactive against C6-HSL while active against C7- and C8-HSLs  cells exhibit C7- and C8-HSLs degrading activities inrespective of the presence or absence of IPTG induction  exhibited C7-HSL degrading activity   from an inducible promoter. The SDS-PAGE analysis demonstrated that the IPTG-induced total proteins contained a polypeptide with a molecular mass of 88 kDa that was consistent with the 824 residues Aac-fused protein that had a predicted molecular mass of 88,645 Da  cells were first reacted with C7-HSL at 30\u00b0C for 60 min. If the enzyme encoded by the aac gene is an AHL-acylase, we predicted that two free digested products, HSL and heptanoic acid, would be detected. Since ESI+-MS could not detect the carboxylic group (COO-), only HSL was detectable. The fatty acids containing the carboxylic group would have to be detected by ESI--MS. The analytic results showed that C7-HSL (M+H m/z = 214) could be digested into HSL (M+H m/z = 102) and heptanoic acid (M-H m/z = 129) . Thus, our results indicate that the aac gene encodes an AHL-acylase.To demonstrate whether the Aac protein is an AHL-acylase, we performed the ESI-MS analysis.  DH10B pSaac cellsCandida tropicalis F-129 were 0.05 \u03bcg\u00b7ml-1. In addition, the predicted Aac-digested products of aculeacin A, i.e. palmatic acid (M+H m/z = 257), were not found in the ESI-MS analysis (data not shown). These results revealed that Aac is not an aculeacin A acylase.Since Aac was predicted as a probable aculeacin A acylase transmembrane protein, we compared the MICs of aculeacin A and Aac-treated aculeacin A in order to determine whether the Aac protein functioned similar to aculeacin A acylase. As shown in Table E. coli DH10B (pS3aac), a range of AHLs were mixed with cells of E. coli DH10B (pS3aac) to perform the HSL-OPA assay. As shown in Table E. coli DH10B (pS3aac) could not degrade the short-chain AHLs, C4-, C6-, or 3OC6-HSLs; however, E. coli DH10B (pS3aac) exhibited activities against long-chain AHLs, C7-, C8-, 3OC8-, C10-HSLs. The AHLs of more than ten carbon-acyl chains, i.e. C12-HSL and C14-HSL, could not be determined due to the poor solubility of their substrate. These results indicate that the substrate specificity of the AHL-acylase Aac is within the limit of more than six carbon-acyl chain AHLs.To determine the substrate specificity and enzymatic activity of the AHL-acylase Aac in aac gene has the potential of being a quorum-quenching agent, an AHL regulated strain, C. violaceum CV026, was used as a target microorganism. The mutant C. violaceum CV026 cannot produce violacein unless provided with exogenous AHL [C. violaceum CV026 to observe whether violacein production was reduced during culture with exogenous AHL. As shown in Fig. aac gene did not influence the growth of C. violaceum CV026 during the late exponential phase but slightly influenced its growth during the stationary phase. Interestingly, C. violaceum CV026 (pBBR1MCS-3) produced violacein after the late exponential phase, while C. violaceum CV026 (pS3aac) completely failed in producing violacein . C. violaceum CV026 (pBBR1MCS-3) was able to form clear zones on LB agar containing tetracycline, chitin, and C7-HSL. However, no clear zone were observed around the C. violaceum CV026 (pS3aac) colonies  from R. solanacearumGMI1000 as an AHL-acylase that did not degrade aculeacin A, ampicillin, and ceftazidime (data not shown). The amino acid sequence of Aac is similar to that of AHL-acylase from Ralstonia sp. XJ12B  with 83% identity. However, this is the first study to report the presence of an AHL-acylase in a phytopathogen.We successfully subcloned and identified an --MS pattern, wherein the fatty acid was still not detectable (data not shown). In contrast, when 10 mM ammonia acetate was used as a reaction buffer to avoid the phosphate effect, the fatty acid was detected by ESI--MS  and SolR (AAC45947) from R. solanacearumAW1. Because the SolI (O30920) synthesizes C6- and C8-HSLs, the GMI1000 strain might be expected to produce both of them. Although the physiological role of AHL-acylase in R. solanacearum is unclear yet, we consider that R. solanacearum might adopt a unique signal turnover system to control existing signals from a quorum-sensing mode [Agrobacterium tumefaciens [Although the quorum-sensing signal for controlling the virulence factors of  regulon . In our  regulon . There aing mode . The AHLefaciens .Recently, several reports indicated that quorum-quenching enzymes, such as lactonase, AHL-acylase, and oxidoreductase, have potential to be used as peptide drugs. Among them, AHL-lactonase has been applied in genetically engineered procedures to control plant diseases ,44. EvenR. solanacearumGMI1000 with ESI-MS mass spectrometry analysis and whole cell bioassay, together with the analysis of MIC test of aculeacin A. The results showed strong evidence that the Aac in R. solanacearumGMI1000 functions as an AHL-acylase and not an aculeacin A acylase. Thus, we consider that renaming the aac gene of R. solanacearumGMI1000 as \"the alaS gene\" is necessary in further studies for the purpose of clarity. Moreover, this is the first report to find an AHL-acylase in a phytopathogen.This paper describes the identification of AHL-acylase, Aac, from N-acylhomoserine lactones; (C4-HSL): N-(butanoyl)-L-homoserine lactone; (C6-HSL): N-hexanoyl-L-homoserine; (C7-HSL): N-(heptanoyl)-L-homoserine lactone; (C8-HSL): N-(octanoyl)-L-homoserine lactone; (C10-HSL): N-(decanoyl)-L-homoserine lactone; (C12-HSL): N-(dodecanoyl)-L-homoserine lactone; (C14-HSL): N-tetradecanoyl-L-homoserine lactone; (3OC12-HSL): N-(3-oxo-dodecanoyl) -homoserine lactone; (HSL-OPA): Homoserine lactone-o-phthaldialdehyde; (HPLC): High-performance liquid chromatography.(AHLs): CNC conceived of the study, performed gene cloning and expression, MIC test, substrate specificities, statistical analysis, and drafted the manuscript. CJC performed the mass study and the data analyses. CTL prepared the crude proteins and performed the SDS-PAGE analysis. CYL initiated the ideas of the research, was involved in project design and coordination, and prepared the manuscript. All authors read and approved the final manuscript."}
+{"text": "Biomedical research is set to greatly benefit from the use of semantic web technologies in the design of computational infrastructure. However, beyond well defined research initiatives, substantial issues of data heterogeneity, source distribution, and privacy currently stand in the way towards the personalization of Medicine.A computational framework for bioinformatic infrastructure was designed to deal with the heterogeneous data sources and the sensitive mixture of public and private data that characterizes the biomedical domain. This framework consists of a logical model build with semantic web tools, coupled with a Markov process that propagates user operator states. An accompanying open source prototype was developed to meet a series of applications that range from collaborative multi-institution data acquisition efforts to data analysis applications that need to quickly traverse complex data structures. This report describes the two abstractions underlying the S3DB-based infrastructure, logical and numerical, and discusses its generality beyond the immediate confines of existing implementations.The emergence of the \"web as a computer\" requires a formal model for the different functionalities involved in reading and writing to it. The S3DB core model proposed was found to address the design criteria of biomedical computational infrastructure, such as those supporting large scale multi-investigator research, clinical trials, and molecular epidemiology. The increasing adoption of semantic web technologies and formalisms in biomedical and biomolecular areas is often driven by the need to interoperate between ever more complex data stores and between the applications that process them -3. As thBy breaching the same origination restriction of URL calls in the conventional (XML based) AJAX model, JSON-based systems also subvert the client-server equation. Specifically, JSON calls are function calls where the data is passed as the input argument and the function name is specified as a callback parameter in the URL call. This signifies that data and code can be invoked freely from multiple originations and can be made part of arbitrary workflows, as in the node.js project . This ouIn a strict sense, a von Neumann architecture comes with a von Neumann bottleneck  in data The use of server-side only as a standardized representation layer for scientific research applications is not original. It is, for example, at the core of cloud computing based systems such as Google Wave . In suchThe architecture described in this report specifically targets Biomedical applications, which places two requirements on a web-based infrastructure. First, it needs to accommodate the fluidity that is intrinsic to the Biology knowledge domain . Second,The first design criterion of flexible handling of fluid and heterogeneous domains suggests that the Biology domain expert should control the description of the domain that is being experimentally explored. In fact, the results of data analysis often require the redesign of the original data acquisition effort. The redesign happens so patently that, for example, it is now explicitly exploited to speed up target identification and drug discovery through the use of adaptive designs in clinical trials . RedesigThe second design criterion, that of fine grained management of access permission, calls for a generic mechanism to describe the relationship between the user and each data element. That description could then be used by the infrastructure to decide what types of access to the data are authorized for each user. A literal reading of this requirement would be to document that relationship for each element, individually, and for each user. This absurd solution would of course increase the size of the data repository several fold. A more scalable alternative is therefore needed which allows for that relationship to be also defined for the description of the domain, and then propagated to its observational instantiation. Accordingly, the identification of a Markov model that propagates user relationships among the S3DB entities is the second key feature of the core model described in this report.The abstractions described in the Results resort to W3C formalisms, are illustrated by an accompanying library and are partially deployed by a web-service:The description of the core entities of the S3DB core model was pursued with recourse to the World Wide Web's Consortium (W3C) Resource Description Framework (RDF) , includihttp://freemat.sourceforge.net. The three functions were then also coded in javascript to support web browser based applications such that their inner workings can be explored without need for specialized programming environments. These applications, with links to the m and js source code, are made available at http://s3db-operator.googlecode.com. The Markovian process described by them was used in the prototype web service  to calculate the independent propagation of each of the three permission operators supported by that particular implementation - View, Edit and Use - for each of the three permission states considered - none, self and all.S3DB operators describe relationships between users and entities of the core model. Any operator predicated on a user as a subject, and on any of the seven S3DB core entities as an object, will be propagated as a Markov process. The propagation model described in the results section was originally coded as a finite state automata (FSA) using MATLAB (Mathworks Inc) and consists of three functions: merge, migrate and propagate. These m-functions were written to be also executable in less sophisticated open source m-code interpreters such as freemat http://s3db.org project web site and also at http://s3db.googlecode.com. The webservice's API is exposed through a REST protocol, S3QL, documented at http://s3db.org/documentation/s3qlsyntax. A javascript library for cross domain JSON requests is also provided at http://s3dbcall.googlecode.com.The identification of the S3DB core model has been pursued for five years as an iterative exercise where tentative new features in the core model were exposed to communities of biomedical and molecular epidemiologists to collect usage feedback ,23-27. TThe advantages of a \"sloppy\", evolvable, data representation distinguishing between domain and instantiation was first argued in  using a In a nutshell, the use of the S3DB model ultimately consists of declaring all the data elements associated with a given observation as being types of S3DB entities.The separation of domain from instantiation is centered on the pattern described in lower half of Figure s3db:DP and s3db:DU in Figure s3db:PC and s3db:PR). The Collections are used as subjects and as objects of Rules, which represent the domain one wants to instantiate with observations (s3db:Rsubject and s3db:Robject). For example the concept that \"people live in places\" would be represented by a Rule associating the Collection of people with the Collection of locations (see diagram at the bottom of Table s3db:CI). For example, Mary could be an Item of the Collection of people. In some cases the object of the rule is best not confined by a Collection and instead can be left as a Literal, as in, for example, the instantiation of the Rule \"people have names\". Note no cardinality is imposed for any relationship so many-to-many scenarios are allowed. For example, the same Item can be a member, s3db:CI, with multiple Collections. On the contrary, we found it useful to restrict the predicates of the Rules, such as live in and have above, to be Items of Collections  with Users and Projects (Mary) with an Item (Houston) of the Collection place. One could then continue weaving the description with further assertions by first identifying new components of the domain, for example, by creating a Rule to the effect that \"places have addresses\" and then asserting those addresses as Items of the Collection of places. It is important to recall that each non-literal element is identified by a Universal Resource Identifier (URI), necessary to make assertions using RDF. In conclusion, the purpose of the S3DB core model is just to provide a template where to aggregate data elements that may already be available, either as their own pre-existing URIs, or, otherwise, by generating those URIs within S3DB.Data submission to a S3DB service corresponds to instantiating those rules with the observations, through the use of Statements. For example, the Statement \"Mary lives in Houston\" would have a rule like \"people live in places\" as a predicate associating an Item of the Collection of people  and the RDF, RDFS and OWL vocabularies (see Methods), with reference to the list of 12 relationships described in Table P_example, and using notation 3 (N3),We can now return to the example that \"Mary lives in Houston\" and use the S3DB template to generate the triples to be submitted to the S3DB service. Starting with a deployment hosting an instance of a s3db:project, a) Create Collections of people and places::P_example s3db:PC :C_person.:P_example s3db:PC :C_places.b) Insert Mary and Houston as items of the respective collections::C_person s3db:CI :I_Mary.:C_places s3db:CI :I_Houston.c) Describe the domain we are about to instantiate, that people live in places, as as3db:rule::P_example s3db:PR :R_people_in_places.:C_person s3db:Rsubject :R_people_in_places.:C_place s3db:Robject :R_people_in_places.:I_lives_in s3db:Rpredicate :R_people_in_places.I_lives_in comes from just yet).(lets not worry about what collection of Items d) Insert the new data::I_Mary :R_people_in_places :Houston.:I_Mary\", \":C_person\" or \":P_example\" in reality are random or sequential alphanumeric strings such as the unique indexes generated by the S3DB service. Of course :I_Mary has a name, which we will use as an example to illustrate how literal values are asserted through instantiation of a Rule, without the need for, say, mediation by a Collection of names:This example illustrates a very simple mechanism to store descriptions of the domain and the data that instantiates them in such as way that they can be edited as required by the fluidity of the life sciences domain . The act@prefix foaf: <http://xmlns.com/foaf/0.1/>.:P_example s3db:PR :R_people_have_ names.:C_person s3db:Rsubject :R_people_have_names.foaf:firstName s3db:Robject :R_people_have_names.:I_has s3db:Rpredicate :R_people_have_names.which then allows inserting the corresponding literal information,:I_Mary :R_people_have_names \"Mary\".foaf:firstName, nor the object of the Statement, \"Mary\", are s3db entities. As noted in Figure rdfs:Resource) to be associated to either object in the Rule/Statement instantiation. In the implementation followed by the reference S3DB prototype, these two non-s3db entities are simply stored as literals in a variable length string (varchar) database field.Note in this last assertion that neither the object of the Rule, foaf:firstName, it could even be replaced by another literal such as \"name\", that editing does not affect the existing assertion: whatever the new designation is, it is still instantiated in the same Statement, with the same URI, by the same rdfs:Resource, in this case the literal \"Mary\". This is far from being an esoteric scenario. In molecular epidemiology surveillance it is quite common to have, for example, the identity of a microbial isolate, which is an instance of a class, be used as the predicate of the molecular typing methodology. There is of course nothing new here; this modularity is intrinsic to the dyadic predicated nature of the RDF framework. However, what was achieved by tying the submission of new data to the S3DB core model was to restrict the use of RDF such that an explicit distinction of domain and observational instantiation is preserved throughout the process. As will be discussed later, this was achieved purely through the assertion . The numbers between brackets in the transition matrix indicate the logical tests  and (5), respectively.As described in Equation 4, this simplifies the computation of the transition of states between entities as the external product of the corresponding Boolean square matrix and the vertical vector of states assigned to each entity. For example, if a state of a s3db:entity, E, is described as a singular value, say 'a', then 'a' will be passed on for the relationships verified in Equation 4. However, if the state of the operator, f, is described by more than one value, l>1, then the additional expressivity in state propagation can be achieved, as described by Equation 5. That generalization consists of specifying that if a state is singular (l = 1), then it will be passed as is. If, on the other hand, it is plural, then the first state is used as the effective state of the subject entity and only the remaining states are passed on to the entity that is object of the valid relationship, as described in Equation 5. For example, starting with singular migration, if the state of an instance is 'a', and this instance is subject of one or more of the 12 relationships (Table f in Equation 5.The process by which states are passed from one instance of an entity to another before being merged at the end of each iteration (Equation 4) is designated as state migration and is described in Equation 5. The simplest example is the migration of a singular state - if the state of an instance of a migrate procedure which identifies how many operators jf, j = 1,...,m, are having their states migrated simultaneously. Since the states of each operator define m-tupples inside the state of n states, this is equivalent to identifying the migrating states of j fas being j =ff. Accordingly, Equation 6 is equal to Equation 5 when m = 1, that is, when only one operator is being considered.One last generalization of the migration process was also found to increase expressivity. The procedure described in Equation 5 was vectorized to allow simultaneous migration of states of multiple s3db operators. This is achieved by defining a second input argument for the i is not specified, it is borrowed from the operator immediately to the left, position i-1. This implies that the order of the operators can be used to simplify assignments that just span a subset of them, as in migrate being 'bcc'. As always, the behavior and implementation of this functionality can be verified using the accompanying tool.The enhanced expressiveness of the representation of multiple operator states described in Equation 6 is most useful for s3db operators that share the same states. For example, states that identify groups of users could be used as the states of multiple operators such as \"view\" and \"edit\", as is the case for the S3DB prototype (see Methods). As can be verified in the tool accompanying this manuscript, the multiple state migration allows for very short descriptions of states that span multiple operators. For example, migrate = 'aaa', which allows for a single assignment that spans several operators. This is achieved without affecting the migration of individual statements - for example migrate = 'abc'- while at the same time allowing for a sweeping assignment of migrated states as in migrate = 'bbb'. Note also in Equation 6 that when a operator state at position The third and last function used by the state propagation procedure brings together the merge and migration functions to find the steady state solution of Equation 4. That is, when the migration of states, Equation 6, has progressed to the point where the effective state of the operator, for each and every s3db entity, no longer changes:T in Equation 4 is equal to TS3DB in Equation 3, there is no reason not to define, and test using the tool, the percolation of s3db operator states more broadly for arbitrary transitions.In the accompanying web tool this resolution is made available for any Boolean transition matrix. Although for the specific purposes of the S3DB prototype, the transition matrix the use of the S3DB model consists of declaring all the data elements associated with a given observation as being types of S3DB entities. The interoperability with the resulting construct is ideally delivered as a REST web service protocol, which is not covered in this report. For an illustrative implementation see the prototype's documentation for the query language S3QL, to which SPARQL queries can also be mapped http://sparql.s3db.org.The S3DB framework comprises a core model with an embedded Markov process propagating user operator states. The two key properties of the resulting construct are the explicit separation between domain and its experimental instantiation, and the accommodation of a very flexible and fine tuned description of the relationship between the users and its contents. Most features of this framework were put to use in an open source prototype available at s3db.org. They have also been validated with practical applications developing multiple investigator information management infrastructure such as . The pots3db:statements) predicated on triple statements that describe the domain instantiated (s3db:rules). This design pattern was specifically devised to allow domain experts to incubate the description of their own domain of expertise [As described in the box diagram at the bottom of Figure xpertise . As props3db:DP . The generic nature of the S3DB user operators and of the Markov process that propagates its states is apparent in Equations 2,4-7. Similarly, although the S3DB prototype provides an illustrative example using three S3DB operators , each with the same three ordered states , the range of applications is open ended and is not necessarily associated with permission management. For example, an operator could be defined to represent priority in the retrieval of query results, which could differ between users. By using the states of this operator to define the relationship between a user and the model entities one could configure, for that user, that clinical records with a specific outcome would be, for instance, graphically highlighted. Retrieval priorities, or, for that matter, the choice of graphic interface features, could therefore be personalized by associating them to operator states pointed to the appropriate semantic content.s3db:operator that restricts its use to describe the relationship between a user and the entities of the s3db core model. That restriction is described by the construction of the transition matrix which for this core model happens to be the one defined in Equation 3. Therefore, a different core model would just have to identify a different transition matrix of logical tests and the same state propagation mechanism defined in Equations 2,4-7 would be automatically applicable. In summary, the key feature of the user relation propagation component of the S3DB core model is the articulation of the three functions, merge, migrate and percolate, applied to a set of states that can take a dominant or recessive form. That articulation is defined by those equations and is also illustrated by the accompanying browser-based application at http://s3db-operator.googlecode.com.The graphic presentation beyond access control could also include workflow components. For example, it could be used by a quantitatively minded researcher to have statistics tools automatically applied to the construction of a specialized interface. More interestingly, the concept of User could be used more broadly as that of usage. Quite literally, data analysis procedures could be configured as Users. By treating usages and analytical workflows as users, the corresponding procedure would be automatically executed for content with specified semantics. The same line of discussion can also lead to the observation that there is nothing in the definition of an The dyadic predicated nature of Resource Description Framework (RDF) has emerged as the shared representation of a variety of semantic web formalisms and technologies. In this report we describe a core model that mediates the generation and management of the RDF triples by and for domain experts. This model abstraction is the result of five years of bioinformatics infrastructure development in biomedical and molecular epidemiological contexts. The underlying approach/hypothesis is that by explicitly distinguishing description of the domain from its instantiation with observational data, one allows domain experts to freely evolve the former without compromising the actuality of the latter. The other, complementary, critical feature of the S3DB core model is the Markov process that propagates the relationship between users and the entities of a core model. This ability to propagate operators from the description of the domain to its instantiation has already found an immediate application in the management of access permissions. Finally, at the very center of the S3DB abstraction is a two tiered modeling pattern where instances of a class describe the relationship between two classes and, in turn, instances of the resulting triple, which are also triples, host the observed values. This modeling pattern underlies the S3DB schema but may be of more general applicability.JSA identified the S3DB core model and drafted the manuscript. HFD developed the PHP prototype. WM uncovered and analyzed the model's logical patterns. All authors read and approved the final manuscript."}
+{"text": "S100B, established as prevalent protein of the central nervous system, is a peripheral biomarker for blood-brain barrier disruption and often also a marker of brain injury. However, reports of extracranial sources of S100B, especially from adipose tissue, may confound its interpretation in the clinical setting. The objective of this study was to characterize the tissue specificity of S100B and assess how extracranial sources of S100B affect serum levels. The extracranial sources of S100B were determined by analyzing nine different types of human tissues by ELISA and Western blot. In addition, brain and adipose tissue were further analyzed by mass spectrometry. A study of 200 subjects was undertaken to determine the relationship between body mass index (BMI) and S100B serum levels. We also measured the levels of S100B homo- and heterodimers in serum quantitatively after blood-brain barrier disruption. Analysis of human tissues by ELISA and Western blot revealed variable levels of S100B expression. By ELISA, brain tissue expressed the highest S100B levels. Similarly, Western blot measurements revealed that brain tissue expressed high levels of S100B but comparable levels were found in skeletal muscle. Mass spectrometry of brain and adipose tissue confirmed the presence of S100B but also revealed the presence of S100A1. The analysis of 200 subjects revealed no statistically significant relationship between BMI and S100B levels. The main species of S100B released from the brain was the B-B homodimer. Our results show that extracranial sources of S100B do not affect serum levels. Thus, the diagnostic value of S100B and its negative predictive value in neurological diseases in intact subjects (without traumatic brain or bodily injury from accident or surgery) are not compromised in the clinical setting. S100B, a protein produced primarily by brain astrocytes, is an established peripheral biomarker of blood-brain-barrier permeability associated with various CNS  injuries An important application of serum S100B testing is the selection of patients with minor head injury who do not need further neuroradiological evaluation, as studies comparing CT (computerized tomography) scans and S100B levels have demonstrated S100B values below 0.1 ng/mL are associated with low risk of obvious neuroradiological changes  or significant clinical sequelae Recently, controversy has arisen with regards to the brain specificity of this protein. Several lines of evidence suggest that extracerebral sources contribute to S100B serum levels The objective of this current study was to determine if tissue sources, outside the brain, contribute significantly to serum levels of S100B. In this study, we characterized by Western blot the expression of S100B in human tissue using two different antibodies and corroborated this data with mass spectrometry. We then assessed how expression in these tissues affects the current clinical methods for detection of S100 by using the LIAISON\u00ae S100 or LIAMAT systems (Sangtec-Diasorin), and the Elecsys system (Roche Diagnostics). Finally, we analyzed 200 subjects to determine if adiposity or fat S100B affected serum levels.All studies were performed in accordance with the Declaration of Helsinki and written approval by the IRB Committee at the Cleveland Clinic. All samples (blood and tissue) were obtained by written informed consent and given a coded identifier to retain subject anonymity. Tissue samples were obtained as surplus tissue from various medical procedures conducted at the Cleveland Clinic, generously provided by the department of Pathology. For the purpose of this study we analyzed 200 subjects, consisting of 155 patients and 45 controls . Note thThe Cleveland Clinic Brain Tumor Institute provides a treatment called blood-brain barrier disruption for primary CNS lymphomas. All procedures were performed after informed consent was obtained using protocols approved by the Cleveland Clinic Foundation IRB. In this protocol, intra-arterial mannitol (1.4 M) is administered via a carotid or vertebral artery, and BBB disruption was confirmed by contrast CT immediately after chemotherapy. The details are described elsewhere 2, KCl, EDTA, sucrose, glycerol, sodium deoxycholate, NP-40, sodium orthovanadate] and a protease inhibitor cocktail was added to each tissues at 2.5 mL per gram of tissue and put on ice for 5 minutes. The tissue was homogenized for 20 seconds and then put on dry ice for 15 seconds. This cycle was repeated 3 times. The homogenized tissues were rotated at 4\u00b0C for 20 minutes and centrifuged at 11,000 rpm at 4\u00b0C for 20 minutes. The supernatant was collected and stored at \u221280\u00b0C until analyzed further.Proteins were extracted from various tissues using the Millipore Total Protein Extraction Kit . Briefly, tissues were weighed, chopped into small pieces, and kept on dry ice. Then 1X TM buffer [13 mL of HEPES (pH 7.9), MgClProtein concentration was determined by the Bradford assay method . Total proteins (50 \u00b5g/lane) were separated on 10\u201320% polyacrylamide gels with SDS-PAGE at 80 V and transferred onto a polyvinylidene difluoride membrane  by electroblotting at 100 V of constant voltage for 1 hour. After blocking with TBST and milk  for at least 2 hours, the membrane was probed overnight at 4\u00b0C either with the Sangtec-Diasorin or OriGene S100B primary antibody (1\u22361000). The OriGene monoclonal antibody was made by immunizing against a synthetic peptide corresponding to residues on the C-terminus of human S100B. The polyclonal Sangtec antibody was raised against the whole human protein. These antibodies were selected because they target different regions of the S100B protein . The scanned grayscale images were saved in an uncompressed TIFF format and further analyzed using software specifically designed for measuring grayscale image density, developed by Nonlinear USA, Inc.  PhoretixTM ID (Version 2003.01).We used colorimetric immunosorbent assay, Sangtec\u00ae 100 ELISA, by DiaSorin, Inc.  to quantify S100B. The limit of detection is 0.03 ng/mL. We also used the Canag/Fujirebio system by Fujirebio Diagnostics, Inc.  to measure various mono- and hetero- dimers of S100B. The Elecsys system  was used as well for the purpose of measuring S100B.We used a LC-MS system Finnigan LCQ-Deca ion trap mass spectrometer system with a Protana microelectrospray ion source interfaced to a self-packed 10 cm\u00d775 um id Phenomenex Jupiter C18 reversed-phase capillary chromatography column. Data were analyzed by using all CID spectra collected in the experiment to search the National Center of Biotechnology Information (NCBI) non-redundant database with the search program TurboSequest. All matching spectra were verified by manual interpretation. The interpretation process was also aided by using the programs Mascot and Fasta to perform additional searches, as needed.Data are presented as mean \u00b1 standard deviation (SD). JMP\u00ae 8.0  was used for statistical analysis. Correlation plots were produced using statistical software by the Origin Lab Corporation  to calculate correlation coefficients (R) and 95% confidence limits. Significant difference or correlation was assessed by P-values of <0.05, calculated using the Student's t-statistic.We first analyzed S100B protein content in a variety of tissue samples . WesternThe results presented thus far were obtained with two different antibodies directed towards the same antigen, yet these results were not quantitatively consistent. To rule out that the measured signal may be due to protein other than S100B, we analyzed the molecular identity of selected lanes shown in The two antibodies gave comparable but not identical results. While both revealed a strong signal from brain tissue, muscle and fat also exhibited strong levels of expression. The data were quantified to construct the bar graph shown in MS analysis confirmed that the brain tissue signal, consistent by molecular weight with S100B, was indeed this protein . When thMost of the clinical results dealing with the utilization of S100B as a predictor of neurological disorders were obtained with one of several immunoassays that are commercially available . Such discrepancies may pose a significant problem, as they substantially impinge on and alter the conclusions drawn from experiments including those aiming at discoveries of disease treatment modalities or with diagnostic purpose.As stated above, our results are not comforting for the basic scientist. Western blotting is an easy and reproducible technique that enjoys wide popularity. Our concerns are not unique Another practical limitation of this study, due to the diversity and number of patients included, was the use of the BMI calculation to assess individuals' relative body fat. Recent studies on nutrition and metabolism have validated techniques such as ultrasound, air displacement plethysmography and bioelectrical impedance to be superior to BMI for accurately measuring body fat Based on these observations, it may be desirable to incorporate any or all of the following to ascertain that an observed signal is indeed reflective of S100B: 1) Protein levels are generally caused by increased mRNA. Therefore, if release of S100B is due to a pathology initiating active synthesis rather than by passive release from necrotic astroglial cells (as in stroke) quantitative RT-PCR of S100B messenger RNA would be appropriate to further support any observations; 2) Antibody-independent methods such as MS should be included for validation of target recognition; 3) When possible HPLC (high-performance liquid chromatography) should be used in parallel or serial experiments.While the results we present may be disappointing for the bench researcher, we also demonstrated that the clinical detection of S100B is more reproducible and robust. In addition, the type of instrument, or the platform used did not alter the results, nor did it affect the predictive value of the test. The clinical tests all measure total S100B, regardless of it monomeric or dimeric state, nor do they consider whether S100B is bound to S100B or S100A1. Preliminary results with tests detecting only S100B-S100B dimers have demonstrated, as expected, that the ceiling for \u201cnormal values\u201d is significantly lower than the published \u201c0.1 ng/ml\u201d dogma e.g., pediatric controls in We confirm that S100B was not exclusively produced by CNS cells. We found that muscle and fat were chief extracranial expressors, which is consistent with the literature Our results show that extracranial sources of S100B do not significantly affect serum levels. Thus, the reported low sensitivity and positive predictive value  for S100B There are two possible explanations that may account for the discrepancy between previous studies documenting elevated S100B levels from extracranial sources and our present findings. There have been recent reports that serum S100B levels are positively correlated with body mass index without evidence of traumatic brain injuries. Interestingly, obesity has been hypothesized to be a state of heightened systemic oxidative stress and inflammatory response, which is mechanistically linked to other co-morbid conditions such as hypertension and small vessel disease. Therefore, it is not clear whether obesity itself or obesity-associated comorbidities contribute to a rise in serum S100B in the previous studies. In our study, we directly measured the tissue specific expression of S100B in addition to serum S100B, which represents a collective source from multiple disease processes. Our study showed that an increase in fat mass might not in isolation be a major contributor to elevated S100B levels. Rather, obesity-related diseases are likely contributors. For example, small vessel ischemic disease associated with obesity is a source of serum S100B Prior studies have shown that cardiothoracic surgeries resulted in higher serum levels of S100B. However, Fazio et al. demonstrated that S100B antibodies from certain ELISA kits might cross-react with other proteins found in serum"}
+{"text": "The current analyses focus on the need for services from the perspective of individuals considering preventive measures. A new approach imported from social and health psychology is used for assessing subjective need. This indicator is used for predicting actual health behaviour under field conditions and simultaneously other relevant background variables are taken into account.n = 949 respondents were queried about mental distress and their intention to participate in the program. This intention to participate and actual attendance were taken as outcome variables in logistic regression analyses adjusted for relevant background variables.A mail survey was conducted prior to the start of a coaching program for teachers. A sample of Intention and participation in the coaching program three months later were associated with an unadjusted OR of 90.1 (95% CI: 39.2 - 207.0) for male teachers. For female teachers the crude effect was OR = 80.0 (95% CI: 45.7 - 140.1). The positive predictive value (PPV) was 96.4% among males and 94.5% among females. Adjusting for covariates results in higher values. Among female, but not among male teachers, the participation depended on psychological distress as assessed by the General Health Questionnaire (GHQ).There is strong evidence for using subjective need as an additional component in assessing the need for services and for predicting actual health behaviour. But it needs to be confined to intended behaviour which is under behavioural control. A challenging task for providers and policymakers planning health care services and preventive measures lies in determining need for care. Neither a clear-cut definition nor operationalization exists and a variety of meanings grounded in different scientific views and perspectives  affect pAccording to this taxonomy the main focus of current research is on normative need : The casThe definition of need is also in scope of individual professionals (e.g. physician) or professional boards who define subjects in need for care and what kind of care is needed. In this case professionals as well as scientists take the availability of effective and cost-effective treatments or programs in health care into account; cases and non-cases are matched with available counteractive measures and supply in order to detect (un-)met need.Evidence for effectiveness and efficiency of health care services indicates supply producing health gains or a \"capacity to benefit\" . On top externally defined need for care. This definition of need has to be distinguished from individuals' subjective need for care that reflects how individuals perceive their need and how need for care is defined by subjects themselves. If health care is provided the persons concerned might take on a perspective differing from that of experts. Hence, both perspectives may only overlap partially [These opening comments, representing the view of scientific or professional experts, epitomize the artially .Felt need in the terminology of Bradshaw or perceived need actually used in surveys ,12 referintention plays an important role as an antecedent of actual  behaviour. In empirical research intention is usually assessed by one-item questions; nevertheless it works as a powerful predictor for behaviour [Externally defined need, as viewed by experts, takes the form of \"person x or population x needs health service y in order to attain a certain health status level z\". The subjective perspective of need is abbreviated by forms like \"I need professional help\". At this stage the kind of help and the goal might not be well elaborated and the individual's contemplation might be dominated more by a mixture of cognitions representing risk perception, the expectation of positive and negative consequences for different courses of actions or the expected capability to perform them. Asking subjects whether they feel or perceive a need addresses these considerations that precede health behaviour and actual usage of health care. Social and health psychology have a long tradition of dealing with these kinds of motivational factors and their influence on behaviour -18. Baseehaviour ,20. FromThis study is part of a larger prevention program called HEALTH PROMOTION FOR TEACHERS which was initiated and supervised by the Federal Institute of Occupational Safety and Health (FIOSH/BAuA). The program as a whole aimed at reducing stress in teachers through coaching, individualized guidance, and training programs at three different sites in Germany. One of these sites covered three school districts in South Western Germany around the city of Freiburg. Within these districts all 2,484 teachers in 19 grammar schools (Gymnasium) and 70 secondary modern schools (Hauptschule) were informed about a tailored coaching program available free of charge. Envelopes mailed out to teachers contained a covering letter, an application form and a questionnaire that teachers were asked to send back separately. The survey respondents constituted the mixed cohort at baseline t-1. The teachers were informed shortly about the program and procedures by means of a covering letter at baseline and by an informative meeting. The coaching program offered was free of charge but participation at five sessions during leisure time was required. The subset of volunteers applying for the coaching program were randomised to treatment and waiting control condition, and less than three month after the circular mailing the first session was held. The latter marks the starting point t0 of the coaching program or service use. The main focus of our prospective study is on the association between survey data at t-1 (mailing response) and service use at t0 less than three months later.The questionnaire used in the survey at baseline (t-1) comprised questions regarding working conditions, occupational history and self-rating scales. With this questionnaire data on family background  was obtained for reasons of adjustment. Part-time work was arbitrarily defined as working 75% or less of the predetermined workload. On top of this, additional information was given by two scales indexing  health conditions: Psychological distress was assessed using German version of the 12-item General Health Questionnaire (GHQ-12) ,22. The Emotional exhaustion was addressed by a mean value from a 9-item subscale from the Maslach Burnout Inventory (MBI-EE) in its German version (MBI-D) from B\u00fcssing and Perrar .The main focus at baseline assessment was on subjective need. This was addressed by a single question \"Do you intend to participate in a coaching course currently offered by us free of charge (see enclosed registration sheet)?\" offering a \"yes\" or \"no\" answer. Actual behaviour approximately 3 months later (t0) is registered at the start of coaching group or of the waiting control condition.Cross-sectional data from baseline (t-1) were the starting point for the first logistic regression analysis: The key variable \"intention to participate\" was regressed on other covariates at t-1 representing possible barriers or contributing factors. Covariates at t-1 are marital status, children at home and psychological distress, gauged by GHQ-12 and MBI-EE. The quantitative scales were transformed into terciles based on the score distribution of the total sample. Age was dichotomized at a cut-off value of 45 years and over. The logistic regression analysis was performed by testing different models including different subsets of covariates starting with simple models including background variables (abbreviated as M1). In model 2 (M2) \"intention to participate\" was cross-sectionally regressed onto these variables and onto an interaction of two background variables. In model 3 (M3) the outcome variable was regressed onto the background variables, interaction, and psychological distress.After that, a similar modelling strategy was applied for a second regression analysis to predict actual behaviour at the starting point of treatment at t0. Therefore, service use as outcome was regressed in model M1 on the whole set of background variables from (t-1). Psychological distress was added in model M2 and in model M3 the outcome from the first regression analysis at t-1 was used as additional covariate.The last analysis was focused on the association between health factors and participation. This result has to be taken into account for the discussion of intention as a possible mediator between health determinants and participation.N = 2484 included a higher proportion of female teachers  than male teachers . Completed questionnaires were received from n = 949 (38.2%) with a response rates of 38% for female teachers and 37.7% for male teachers. Eight subjects gave no information about gender. Table n = 949 respondents at t-1. The age distribution of both gender showed bimodality and a greater proportion of teachers 45 years or older . Part-time work is more common in female (47.3%) than in male teachers (12.4%) and the disjunction of \"single, divorced, and widowed\" applied to 38.4% of the female teachers and 33.8% of the male teachers.The sampling frame of Table Table In M1 the odds for forming an intention was reduced for older male teachers  compared to the younger male teachers. There were no main effects for marital status or having children at home on forming an intention, but the effect for interaction was near at the significance level . Psychological distress indexed by GHQ-12 and MBI was not associated with the intention to participate.For female teachers age also had a negative effect on intention . There were no effects for marital status, children at home or interaction. But in contrast to male teachers psychological distress assessed by the GHQ-12 was associated with the intention to participate. Changing from the first to the second tercile of the GHQ-12 distribution raised the odd in M3 for an intention by a factor of OR = 1.8 (95% CI: 1.1 - 2.8). For MBI-EE in M3 there was only a statistical significance between the first and third tercile  according intention as outcome variable.Table Psychological distress among female teachers indexed by GHQ-12 was a significant predictor for participation with an OR = 2.1  by comparing the first and second tercile of GHQ-12. According the difference between the first and third tercile of GHQ-12 in model M2 participation was predicted by an OR = 2.9 (95% CI: 1.7 - 4.9). Only the highest tercile of the MBI-EE showed higher odds for participation compared to the lowest tercile . The difference between first and second MBI-EE tercile did not reach significance . Again, there was a strong association between intention and participation when controlled for the other covariates .The cross-tabulation table The results of the last analysis focused on the association between psychological distress at t-1 and participation at t0 controlled for age, marital status and children at home. Compared to the first tercile of MBI-EE (t-1) as reference category the odds for participation of male teachers raised within the third tercile of MBI-EE by a factor of OR = 2.1 (95% CI: 1.0 - 4.1) and for female teachers by an OR = 3.1 (95% CI: 2.0 - 4.8).For male teachers an association between GHQ-12 and participation was found by comparing the first tercile of GHQ-12 as reference category with the third tercile . For female teachers higher odds for participation were found both for the third tercile  and for the second tercile  compared to the first tercile of GHQ-12 as reference category.male teachers revealed that having children at home rather promotes forming an intention. The non-significance in the case of female teachers does not mean that time restrictions and family background have no effects at all. The interpretation is simply hampered by the high proportion of female teachers working part-time because of the family background. This has to be taken into account as a possible counteracting effect masking the effect of family and children at home for female teachers.Increasing age seems to be a barrier for forming an intention, both among female and male teachers. But only for male teachers actual participation in the coaching program is affected by age. Based on our own hypothesis, we expected children at home or marital status to be time constraints working as a barrier, especially for female teachers. But prima facie our results did not support this assumption. A closer inspection of tabulated data for unmarried The coaching program, that was offered to 2,484 teachers aimed at reducing psychological distress or stress reactions. The results showed that an increase in scores for GHQ-12 or MBI-EE tended to go along with an intention to participate. Hence, psychological distress had a positive effect on the motivation to use programs tailored to alleviate it. This was best illustrated by the association between GHQ-12 and intention among the 602 female teachers and for the highest tercile of the MBI-EE. The data from the smaller group of 339 male teachers and the hence less powerful analysis yielded no significant results. The regression analysis based on participation as outcome variable showed a similar pattern of results. Psychological distress among female teachers indicated by GHQ-12 and MBI-EE was associated with participation in the coaching program and this was accompanied by stronger effects for GHQ-12 than for MBI-EE.The regression analysis applied to model 2 and model 3 highlighted the role of intention as a predictor variable. Within the set of covariates in model 3 only intention contributed to predicting actual behaviour three months later. Additionally, the crude association between the single predictor intention and participation as a behavioural indicator showed high values. On top of this, these odds ratios increase after including intention and control variables within the same set of covariates in model 3. This likely indicates a suppressor effect resulting from the combination of intention and other covariates and the elimination of irrelevant variation. Yet, improving the predictive power by using the full set of covariates comprising intention runs into problems of instability. Parameter estimates were characterized by broader confidence intervals while the goodness-of-fit of the model decreased. Thus, for reasons of stability and efficiency there are good reasons for disregarding other covariates and suppressor effects and to rely primarily on intention as the main variable for the purpose of simple prediction.One comment has to be made on the hypothesis of mediation: There might be an effect of psychological distress - measured by MBI or GHQ - on participation which is mediated by intention as intervening or process variable. The final results in the former section show that there is an effect of psychological distress on participation that may be mediated by intention. Table The intention to act in a specific way earmarks a cumulative endpoint of a motivational process that follows from considering one's own health condition, positive and negative consequences for different courses of (non-)action, self-efficacy and the perception of possible barriers. All these important determinants contribute to/enter into a decision to act and hence intention becomes a very powerful tool for need assessment and the prediction of service use. Theories and results of health and social psychology from the last decades -18 pointIn addition to methodological constraints there are other reasons not to rely on intention as the sole indicator of subjective need. These are rooted in restrictions imposed on application: We presume that participation in the coaching program in this study reflects a behaviour which is predominantly under volitional control and that using intention as a predictor is only useful in this kind of setting. We also expected intention to be a weaker predictor of future behaviour in the sense that the behaviour performed is not a product of choice . This is exemplified by subjects who act in a relatively spontaneous or impulsive way, without forming an explicit intention beforehand. Another example is given by severe injuries caused by an accident when the subjective need of the victim is heavily determined by the basic need to survive and therefore the decision to use medical services is not or only partly under volitional control. Some behaviour requires special skills and abilities, support from or cooperation of others, resources  or just the opportunity to act (i.e. a tailored supply and time frame). Asking subjects about their intention to make use of a service when - i.e. monetary - resources required are not available exemplifies a behaviour not being under control.plan to engage in a single behaviour. This might be a very extensive interpretation of intention as a concept. But moving in the continuum from mere wishes to detailed plans and actual behaviour provides a better basis for the prediction of health-relevant demand and usage.A further restriction concerns the conceptualization of intention. In the current study the subjects were not asked for vaguely formulated wishes or broad intentions. Rather, subjects were asked for a clear in addition to the traditional approach. Asking for intention is a very simple and most efficient procedure according to the prediction of health relevant behaviour being under behavioural control. In this context of application the assessment of subjective need of the target population gives the basis for realistically planning and organizing public health services and for optimizing the supply.The restrictions mentioned above are strong arguments against relying solely on intention as an indicator of need. The option recommended here is to use it The authors declare that they have no competing interests.UR participated in the design of the study and performed the statistical analysis. He also drafted the manuscript.LZ participated at the design of the study and at the data acquisition followed by data preparation for the current analysis.RP participated at data acquisition and data preparation for the current analysis.TU participated in the design of the study and at the data preparation.JB participated at the coordination of the current study and helped to draft the manuscript.All authors read and approved the final manuscript."}
+{"text": "Following relapse on endocrine therapy for advanced, hormone receptor-positive breast cancer, it is common for patients to experience responses to alternative endocrine agents. Fulvestrant (\u2018Faslodex\u2019) is a new type of endocrine treatment \u2013 an oestrogen receptor (ER) antagonist with no agonist effects. Fulvestrant downregulates cellular levels of the ER resulting in decreased expression of the progesterone receptor. This unique mode of action means that it is important that fulvestrant is placed optimally within the sequence of endocrine therapies to ensure that patients gain maximum benefit. Fulvestrant has shown efficacy when used after progression on tamoxifen or anastrozole in postmenopausal women with advanced breast cancer. After progression on fulvestrant, subsequent endocrine treatments can produce responses in many patients, demonstrating that fulvestrant does not lead to crossresistance with other endocrine therapies. Responses to fulvestrant have also been observed in patients heavily pretreated with prior endocrine therapy. Fulvestrant is a versatile endocrine agent that may be integrated into the therapeutic sequence prior to, or subsequent to, other hormonal therapies, and represents a valuable additional antioestrogen for the treatment of postmenopausal women with advanced breast cancer. The efficacy and tolerability advantages associated with the use of endocrine agents in the treatment of hormone receptor-positive advanced breast cancer have been clearly established in many clinical studies. However, despite an initial response, many patients will eventually experience disease progression and require further endocrine treatment options. In patients who respond to endocrine treatments, additional responses to further agents are common . This poThe activity of sequential endocrine therapies is dependent upon them possessing different mechanisms of action. In this way, crossresistance between sequential therapies may be avoided. It is therefore important that, as new endocrine therapies with different mechanisms of action become available, they are integrated effectively into the sequential hormonal regimens to allow patients to derive maximum benefit.Fulvestrant (\u2018Faslodex\u2019) is a new type of endocrine treatment \u2013 an oestrogen receptor (ER) antagonist with no agonist effects  anastrozole (\u2018Arimidex\u2019) .In vitro, fulvestrant significantly inhibited the expression of genes such as c-myb and c-myc in cells resistant to long-term oestrogen deprivation +partial response (PR)+stable disease (SD) \u2a7e24 weeks) in seven out of 17 (41%) patients who had received, and had progressed on, prior treatment with tamoxifen and an AI  had progressed on one, two or three prior endocrine agents for advanced disease, fulvestrant produced CB in 40 patients (60%) overall. A total of six patients (9%) derived a PR. Of these, one had received fulvestrant as first-line therapy for advanced disease, two had received fulvestrant as second-line therapy, and three had received it as third-line therapy. No objective responses were seen in patients receiving fourth-line fulvestrant therapy. This might suggest that fulvestrant produces better responses when given earlier in the treatment sequence  and chemotherapy  were treated with fulvestrant; SD \u2a7e24 weeks was achieved in eight out of 42 (19%) patients   trial is to compare progression-free survival in patients who have progressed on a nonsteroidal AI, and who are subsequently treated with either fulvestrant plus continued anastrozole, or with fulvestrant alone. Secondary aims include a comparison of fulvestrant vs exemestane and an examination of biological markers of response. A further trial, the Evaluation of Faslodex vs Exemestane Clinical Trial (EFECT) is currently recruiting patients to assess the efficacy of fulvestrant vs exemestane in patients who have progressed on treatment with nonsteroidal AIs. In addition, two trials (FACT and SWOG 226) will compare the efficacy of a combination of fulvestrant plus anastrozole with anastrozole alone in the first-line setting (To optimise the positioning of fulvestrant in the sequence of endocrine therapies, additional studies will be required to elaborate upon the data so far accrued. New phase II and III clinical trials of fulvestrant in over 3000 patients are either planned or currently in progress (Currently available data therefore indicate that fulvestrant will be a useful therapeutic option that may extend the opportunity for using endocrine therapies before reliance upon cytotoxic chemotherapy is necessary. Fulvestrant is also a versatile endocrine therapy that may be used at a variety of positions in the sequential use of endocrine therapy for postmenopausal women with advanced, hormone-sensitive breast cancer."}
+{"text": "Paclitaxel 175 mg/m2was administered as a 3 h-infusion on days 1 and 22 and cisplatin 50 mg/m2as 1 h infusion on days 8 and 29. Six weeks of therapy  followed by 2 weeks rest were considered one cycle. A median of 3 cycles (range 1\u20134) were administered to 45 pts assessable for response, survival and toxicity. Five pts (11%) obtained a CR and 18 pts (40%) a PR . Responses were achieved in the liver, lymph nodes, lungs and at the site of the primary tumour. Nine pts (20%) had stable disease. Thirteen pts (29%) were considered to have failed treatment, 8 pts (18%) due to progressive disease and 5 pts (11%) who did not receive one complete cycle of therapy due to acute non-haematologic toxicity. The median progression-free and overall survival times were 9 months (range 1\u201336+) and 14 months (range 2\u201336+), respectively. Neutropenia WHO III\u00b0/IV\u00b0 occurred in 7 pts (15%) with only 1 pt having grade IV. Additional non-haematologic WHO III\u00b0/IV\u00b0 toxicities included nausea/vomiting in 5 (11%), alopecia in 22 (49%), and diarrhoea in 1 patient each (2%). Dose reductions or treatment delays were necessary in 8 pts (17%), mainly due to neutropenia. All pts were treated on an outpatient basis. The combination of paclitaxel, cisplatin and continuously infused 5-FU/folinic acid appears to be a highly active regimen for the treatment of pts with advanced gastric cancer. While the overall acceptable toxicity allows its use in the palliative setting, it may also be an attractive option to be tested for neoadjuvant or adjuvant treatment. \u00a9 2000 Cancer Research CampaignTo evaluate the toxicity and efficacy of combination chemotherapy with paclitaxel, cisplatin and 24 h continuous infusion of 5-FU/folinic acid in patients (pts) with unresectable, locally advanced or metastatic gastric adenocarcinoma. Forty-five chemotherapy-naive pts  with a median age of 60 years (range 35\u201374) were enrolled. 5-FU 2 g/m"}
+{"text": "Here, we review studies investigating the glial marker S100B in serum of patients with mood disorders. This protein might act as a growth and differentiation factor. It is located in, and may actively be released by, astro- and oligodendrocytes. Studies consistently show that S100B is elevated in mood disorders; more strongly in major depressive than bipolar disorder. Successful antidepressive treatment reduces S100B in major depression whereas there is no evidence of treatment effects in mania. In contrast to the glial marker S100B, the neuronal marker protein neuron-specific enolase is unaltered. By indicating glial alterations without neuronal changes, serum S100B studies confirm specific glial pathology in mood disorders in vivo. S100B can be regarded as a potential diagnostic biomarker for mood disorders and as a biomarker for successful antidepressive treatment.It has recently been suggested that mood disorders can be characterized by glial pathology as indicated by histopathological  Theto Cohen  as the dP > .05; 2-tailed unpaired Student's t-test) [T = 5.82, = 6.4, df = 3, = 3, P = .01, = .008; 2-tailed one-sample Student's t-test against 0). Effect size was larger in MDD than BD . For mania in BD and depression in MDD, only two studies with drug-free patients were available, each reporting high effect sizes . Since the meta-analysis was conducted, a third study has been published with drug-free patients suffering from MDD  . As illuize 0,96 ).Protein S100B has been detected in numerous other tissues in the human body besides glial cells, for example, in adipocytes, melanocytes, chondrocytes, myocardium, and Schwann cells , 35, 48.T = 4.25, df = 13, P = .001; 2-tailed one-sample Student's t-test against 0), there were no significant differences in comparison with MDD or BD . In sum, results support the hypothesis that S100B is involved in the pathogenesis of mood disorders, particularly MDD.Additionally, we compared results of the meta-analysis for mood disorders with another recent meta-analysis investigating serum S100B with the same method in 420 patients with schizophrenia , 51. Altin vivo, we recently measured S100B simultaneously with neuron-specific enolase (NSE) in the serum of patients with MDD and healthy age- and gender-matched control subjects [To validate the histopathologically generated hypothesis that mood disorders are characterized by specific glial pathology  in vivo,subjects . NSE is subjects , 53. HenIncreased serum levels of S100B may indicate glial alterations in mood disorders either due to brain damage  or due tIt has recently been suggested that a loss of neuroplasticity and cellular resilience may underlie the pathophysiology of mood disorders and that optimum long-term treatment can only be achieved by early neurotrophic and/or neuroprotective intervention , 2. It id) for S100B and the severity of clinical symptoms was calculated for each study according to Cohen [mad) and discharge (mdis) divided by the standard deviation at admission (SDad). Such treatment effect size reveals a measure for relative changes from baseline.To validate the impact of S100B as a marker for pharmacological treatment effects, we subsequently conducted a third systematic, quantitative meta-analysis (see above for search strategy and inclusion criteria) . This meto Cohen  as the dT = 3.3, = 1.7, df = 2, P = .04, = .12; 1-tailed Student's t-test against 0). As illustrated in r = 1.0, N = 3, P < .001; correlation according to Spearman, 2-tailed p). This significant positive correlation between clinical treatment effects (HAMD) and serological treatment effects (S100B) indicates that serum S100B may be a reliable marker for treatment effects in major depression if clinical improvement is sufficient. For mania only one study examined changes of S100B during treatment, but without detecting any significant effects [The mean treatment effect size derived from the three available studies could be calculated for serum S100B in major depression. As expected, it reached a large value for changes on the HAMD scale (3.47 \u00b1 1.80), with a lower impact on serum S100B  studies examining effects of different antidepressive treatment strategies on S100B with regard to the specific signaling pathways of the neurotransmitter system mainly targeted by the antidepressant would be of high interest.However, one has to keep in mind the limitations of the meta-analysis for these treatment studies. All of the clinical studies on serum S100B in mood disorders involved several antidepressive/antimanic drugs or combinations with other psychotropic agents such as neuroleptics when psychotic symptoms were present . LikewisTo summarize findings from the literature supporting the hypothesis of glial pathology in mood disorders , we listSerum concentrations of the glial marker protein S100B are elevated in patients with mood disorder, major depression and mania, when compared with healthy control subjects.Serum S100B is higher in major depressive disorder than bipolar disorder.Successful antidepressive treatment reduces S100B in major depression. While only one study investigated treatment effects in mania, such an effect could not be found.The neuronal marker protein NSE is unaltered in major depression and its treatment. NSE is not increased in mania; the only study in the literature reported mildly reduced serum levels.Data support the hypothesis that elevated serum S100B is related to active secretion by astrocytes and/or oligodendrocytes in acute episodes of mood disorders, particularly major depressive disorder, and that this secretion might decline with successful antidepressive treatment.in vivo studies is consistent with the histopathologically generated hypothesis that mood disorders are characterized by specific glial pathology.In conclusion, these findings strongly support the concept of serum S100B as a reliable and sensitive diagnostic biomarker for mood disorders and the clinical response to antidepressive treatment in unipolar major depressive disorder. Evidence of glial changes without neuronal alterations from"}
+{"text": "Fulvestrant has been shown to significantly reduce cellular levels of the ER and progesterone receptor in both preclinical studies and in clinical trials of postmenopausal women with primary breast cancer. This paper reviews the pharmacokinetics and metabolism of fulvestrant, which support the rationale for drug delivery as a single, once-monthly intramuscular injection, and show that this agent has minimal potential to be the subject, or cause, of significant cytochrome  Fulvestrant (\u2018Faslodex\u2019) is an oestrogen receptor (ER) antagonist with no agonist effects and a novel pharmacological profile, downregulating cellular levels of both the ER and progesterone receptor (PgR) (An intravenous (i.v.) formulation of fulvestrant was developed for use in pharmacokinetic investigations since plasma concentrations of fulvestrant administered by the i.m. route are determined by the rate of release of the drug from the injection site and, therefore, do not accurately reflect the elimination kinetics of the compound. A short-acting i.m. formulation was used to mimic steady-state plasma concentrations obtained using long-acting fulvestrant, and to overcome the difficulties of obtaining pharmacokinetic data with the long-acting formulation.t1/2) of i.v. fulvestrant ranged from 13.5 to 18.5\u2009h. Fulvestrant was subject to extensive and rapid distribution, with estimates of the volume of distribution (Vss) at the steady state ranging from 3.0 to 5.3\u2009l\u2009kg\u22121. Clearance of the compound from the plasma was high, with mean values between 9.3 and 14.3\u2009ml\u2009min\u2009kg\u22121, which is similar to hepatic plasma flow , and suggests that the compound is cleared by the liver and possibly by extrahepatic metabolism. Pharmacokinetic modelling showed that the plasma concentration data fitted a three-compartment infusion model  being achieved at 12\u201324\u2009h postinjection. In contrast, following single i.m. injections of long-acting fulvestrant at doses of up to 250\u2009mg in various trials, the time to Cmax (tmax) varied between 2 and 19 days, indicating prolonged release of fulvestrant from the injection site. After Cmax, plasma concentrations of fulvestrant declined slowly and it was possible to define plasma profiles over at least 28\u00b13 days (i.e. the intended dosing period) in most subjects after a single dose, and profiles were approximately log-linear over this time scale  of the short-acting i.m. fulvestrant formulation in healthy postmenopausal female volunteers indicated slow absorption with maximum plasma concentrations (t1/2 observed in these studies (40 days) was approximately 40 times longer than that of an i.v. injection of fulvestrant . Comparisons of fulvestrant plasma profiles obtained following i.v. or i.m. administration show the marked effects of the i.m. formulations (short-acting or long-acting) on the release of fulvestrant into the circulation compared with i.v. administration ) appeared to increase in a dose-related manner (P=0.1112).An analysis of the single-dose  pharmacokinetics from a trial of long-acting i.m. fulvestrant in postmenopausal women with previously untreated primary breast cancer showed that Cmin), and ratio of geometric means of AUC0\u201328  were observed between the two regimens (ss) were very similar for the two dose regimens . Both regimens were equally effective in maintaining plasma levels for at least 30 months , the mulation . For exast month . In summIn vitro studies have indicated that fulvestrant is extensively metabolised. The metabolism of [14C]-fulvestrant following i.m. administration was initially investigated in animal studies (rats and dogs), which showed that fulvestrant was highly metabolised and mostly excreted in faeces (indicative of biliary metabolism). Little renal excretion was evident. The metabolite profiles were similar in rats and dogs, differing only in the relative proportions of individual components. The major excretory metabolites in these species were fulvestrant and its 17-ketone and/or sulphone analogues  together with material corresponding to sulphate conjugates (up to 16%). These results were consistent with earlier in vitro data .14C]-fulvestrant has been investigated in man. The i.v. trial was an open study in which four male and four postmenopausal female volunteers each received 10\u2009mg [14C]-fulvestrant, as a 1-h i.v. infusion. Following administration, distribution of the drug was rapid, with plasma levels declining soon after the infusion, and, by 2\u2009h, postinfusion geometric mean (gmean) levels of only 15.6 and 12.8\u2009ng\u2009ml\u22121 were detected in male and female volunteers, respectively. At the end of the 1-h infusion, [14C]-fulvestrant accounted for approximately 80% of the total plasma radioactivity, declining to about 30% after 2\u2009h. This suggests that fulvestrant is quickly metabolised when administered intravenously.The metabolism of both i.v. and i.m. [14C]-fulvestrant, in order to minimise the duration of exposure of the volunteers to the radioactive label. Following injection, slow absorption resulted in low levels of [14C]-fulvestrant being maintained for several hours . At 1\u2009h postinjection, [14C]-fulvestrant accounted for approximately 90% of the total plasma radioactivity, thereafter decreasing to about 50% and declining further after 24\u2009h. The majority of fulvestrant and/or its metabolites were associated with the plasma rather than the cellular components of the blood  in both the i.v. and i.m. studies , with less than 1% being excreted in the urine. In general, the faecal metabolite profiles of -fulvestrant, producing HPLC profiles that were qualitatively similar to human liver microsomal profiles. Metabolism was not observed in incubations of [14C]-fulvestrant with expressed CYP 1A2, 2C9, 2C19, 2D6, or flavin mono-oxygenase (FMO-3). Although fulvestrant readily undergoes CYP3A4-mediated metabolism when incubated with human liver microsomes, in vitro studies using human hepatocytes indicated that sulphate conjugation was a more predominant pathway. Therefore, CYP3A4 does not seem likely to have a major role in the overall clearance of the drug, and fulvestrant would not be expected to cause clinically significant drug interactions through inhibition of P450-mediated metabolism of co-administered agents.The marked inhibition of most fulvestrant metabolic pathways by ketoconazole provided further evidence for the involvement of CYP3A4 in the microsomal metabolism of fulvestrant. Selective inhibitors of CYP 1A2, 2C9, 2C19 and 2D6 had no effect on fulvestrant metabolism. This was confirmed by the finding that recombinant CYP3A4 readily metabolises [Two randomised crossover studies have been conducted in healthy volunteers, to confirm that fulvestrant is not subject to CYP3A4 interactions that may potentially affect the safety or efficacy of the drug. These studies demonstrated that the pharmacokinetics of fulvestrant are not significantly affected by co-administration of compounds that induce (e.g. rifampicin) or inhibit (e.g. ketoconazole) CYP3A4 activity. In an additional randomised crossover study, fulvestrant did not significantly affect the pharmacokinetics of an agent (midazolam) that is a model substrate of CYP3A4 . Fulvestrant is highly metabolised and is mainly excreted in the faeces, and pharmacokinetic studies have also suggested that fulvestrant is unlikely to be the subject, or cause, of significant CYP3A4-mediated drug interactions."}
+{"text": "Based on the humoral and cellular changes occurring during strenuous muscular work in humans, the concept of inflammatory response to exercise (IRE) is developed. The main indices of IRE consist of signs of an acute phase response, leucocytosis and leucocyte activation, release of inflammatory mediators, tissue damage and cellular infiltrates, production of free radicals, activation of complement, and coagulation and fibrinolytic pathways. Depending on exercise intensity and duration, it seems likely that muscle and/or associated connective tissue damage, contact system activation due to shear stress on endothelium and endotoxaemia could be the triggering mechanisms of IRE. Although this phenomenon can be considered in most cases as a physiological process associated with tissue repair, exaggerated IRE could have physiopathological consequences. On the other hand, the influence of several factors such as age, sex, training, hormonal status, nutrition, anti-inflammatory drugs, and the extent to which IRE could be a potential risk for subjects undergoing intense physical training require further study."}
+{"text": "Endometrial thickness was measured before and after the 14-day screening period with further measurements predose (to confirm a return to baseline) and on days 14, 28 and 42 post-treatment with fulvestrant. Pharmacokinetic and safety assessments were performed throughout the trial. Fulvestrant at a dose of 250\u2009mg significantly (P=0.0001) inhibited the oestrogen-stimulated thickening of the endometrium compared with placebo. Neither the 125\u2009mg nor 250\u2009mg doses of fulvestrant demonstrated oestrogenic effects on the endometrium over the initial 14-day assessment period. Fulvestrant was well tolerated and reduced the incidence of ethinyloestradiol-related side effects. At the same dose level that is being evaluated in clinical trials of postmenopausal women with advanced breast cancer, fulvestrant (250\u2009mg) is an antioestrogen with no evidence of agonist activity in the endometrium of healthy postmenopausal women.While tamoxifen use is associated with clear benefits in the treatment of hormone-sensitive breast cancer, it also exhibits partial oestrogen agonist activity that is associated with adverse events, including endometrial cancer. Fulvestrant (\u2018Faslodex\u2019) is a new oestrogen receptor antagonist that downregulates the oestrogen receptor and has no known agonist effect. This single-centre, double-blind, randomised, parallel-group trial was conducted to determine the direct effects of fulvestrant on the female endometrium when given alone and in combination with the oestrogen, ethinyloestradiol. Following a 14-day, pretrial screening period, 30 eligible postmenopausal volunteers were randomised to receive fulvestrant 250\u2009mg, fulvestrant 125\u2009mg or matched placebo administered as a single intramuscular injection. Two weeks postinjection, volunteers received 2-weeks concurrent exposure to ethinyloestradiol 20\u2009\u03bcg dayBritish Journal of Cancer (2002) 87, 1354\u20131359. doi:10.1038/sj.bjc.6600644www.bjcancer.com\u00a9 2002 Cancer Research UK Non-steroidal antioestrogens such as tamoxifen (\u2018Nolvadex\u2019) have revolutionised the treatment of breast cancer over the last 30 years. In particular, tamoxifen has become established as the \u2018gold standard\u2019 for the treatment of all stages of breast cancer ; 1998 anIn contrast to tamoxifen, fulvestrant (\u2018Faslodex\u2019) is a new oestrogen receptor (ER) antagonist that downregulates cellular levels of the ER and has no known agonist effects. In preclinical studies, fulvestrant shows no oestrogen-like activity and completely ablates the activity of endogenous oestrogens . The datThere has been no suggestion to date that fulvestrant produces ovarian or endometrial stimulation in postmenopausal women , follicle-stimulating hormone (FSH) and oestradiol levels in the postmenopausal range);had a normal clinical assessment including medical history and resting ECG;had an endometrial thickness at baseline of \u2a7d4\u2009mm, and had at least one ovary and a normal uterus;weighed within 20% of their desired bodyweight;had undergone a normal cervical smear within the last 5 years and had a normal mammogram within the last 3 years.Individuals were excluded if they had a history of:prior HRT;oestrogen-dependent conditions including breast cancer;disease affecting bone or steroid metabolism;any conditions known to increase the risk of thromboembolic events;use of drugs known to affect sex hormone status or steroid metabolism;gastrointestinal, hepatic or renal disease that might interfere with absorption, metabolism and excretion of drugs.-1 (two\u00d710\u2009\u03bcg tablets) at the same time each day for a period of 14 days. Only those volunteers with an endometrial response, defined as an endometrial thickness of \u2a7e8\u2009mm after oestrogen treatment, were allowed to continue on the trial after a \u2018washout period\u2019 of 2\u20136 weeks following the first course of oestrogen. Volunteers were excluded from the randomised phase of the trial if their endometrial thickness did not return to baseline after the \u2018washout period\u2019.Eligible volunteers entered the screening period, during which time they received oral ethinyloestradiol 20\u2009\u03bcg day\u22121. Hence, the first 14-day exposure to fulvestrant (treatment period 1) assessed the effects of fulvestrant alone, while the subsequent 14-day period of exposure (treatment period 2) assessed the combination of fulvestrant 125 or 250\u2009mg plus ethinyloestradiol, and ethinyloestradiol alone. No concomitant medication, other than simple analgesia, was allowed from 72\u2009h before screening, day 1, until completion of the post-trial medical examination, without the prior consent of the investigator.Eligible volunteers were randomised in a 1\u200a:\u200a1\u200a:\u200a1 ratio to receive fulvestrant 250\u2009mg, fulvestrant 125\u2009mg or matched placebo. Randomisation was in balanced blocks. The treatment given to each individual was determined by a random scheme prepared by the Biostatistics Group at AstraZeneca. All treatments were administered into the buttock as a single i.m. injection, which provided continuous exposure to fulvestrant over at least a 28-day period. Two weeks after administration of the randomised trial medication, all volunteers received a further 2-weeks exposure to ethinyloestradiol 20\u2009\u03bcg day\u22121) on day 14 of the screening period. Volunteers whose endometrium had not returned to baseline thickness after the screening period were not randomised. However, a further ultrasound could be performed after a longer \u2018washout\u2019 if the investigator considered it to be appropriate. Subsequent ultrasound scans were performed on days 14 (end of period 1), 28 (end of period 2) and 42 post-treatment with fulvestrant or placebo. The endometrial measurement, defined as the combined thickness of the two endometrial layers lying side by side, was performed through the thickest area of the endometrium. The measurement was performed in the longitudinal plane and then the transverse plane at the same location. The measurement markers were placed at the boundary between the myometrium and endometrium and the measurement recorded.The primary endpoint of this trial was endometrial thickness. All volunteers underwent an ultrasound scan of the endometrium to determine endometrial thickness at the pretrial medical examination and after receiving 14 days of ethinyloestradiol (20\u2009\u03bcg daymax), area under plasma concentration-time curve from zero to day 27 (AUC(0\u201327)) and time to maximum plasma concentration (tmax) were made. The analyses were based on a validated high-performance liquid chromatography method with tandem mass spectrometry  , the results of which have been presented previously (Venous blood was taken prior to dosing with either fulvestrant (125\u2009mg or 250\u2009mg) or placebo (day 1), 2\u2009h after dosing (day 1) and on trial days 3, 7, 11, 14, 21 and 28. Determinations of maximum plasma concentration  classification and body systems. An AE was defined as the development of any medical condition or deterioration of a pre-existing condition. The medical condition did not need to have had a causal relationship with exposure to the trial treatments and could be symptoms (e.g. nausea and chest pain) or abnormal results on investigation .The size of the study was based upon the primary trial endpoint, endometrial thickness. Using data from previous trials, it was considered necessary for the trial to be able to detect a difference in endometrial thickness of 8.0\u2009mm between the fulvestrant and placebo treated groups. Based upon an estimation of between-volunteer variability, it was calculated that nine volunteers per group would be required to allow an 85% chance of detecting an 8.0\u2009mm difference in endometrial thickness between fulvestrant and placebo treated groups. Ten volunteers per group were therefore considered satisfactory to provide sufficient power to determine significant changes in endometrial thickness, while at the same time allowing for the possible withdrawal of one subject per group. As a result, a total of 30 volunteers were required.t-test). Non-compartmental pharmacokinetic analysis was performed on the plasma concentration-time data. Cmax and tmax were determined from the fulvestrant plasma concentration-time profiles, and AUC(0\u201327) was calculated using the linear trapezoidal rule. The data were presented using the following summary statistics: geometric mean (gmean), coefficient of variance (CV), gmean standard deviation (s.d.), arithmetic mean  and s.d.  depending on the parameter. tmax was presented as median, minimum, maximum.Only the data obtained from the measurement of endometrial thickness were subject to formal statistical analysis  for the placebo, fulvestrant 125\u2009mg and fulvestrant 250\u2009mg treated patients being 56.8 years (48\u201364), 55.0 years (49\u201364) and 58.9 years (56\u201363), respectively. Similarly, mean weight and height were comparable between the three groups, with a mean weight (range) of 65.8\u2009kg (54\u201376), 62.7\u2009kg (48\u201376) and 61.1\u2009kg (21\u201371), and a mean height (range) of 162.7\u2009cm (153\u2013169), 163.1\u2009cm (153\u2013171) and 161.1\u2009cm (150\u2013168), for the placebo, fulvestrant 125\u2009mg and fulvestrant 250\u2009mg treated patients, respectively.A total of 30 healthy, postmenopausal, female volunteers were recruited into the trial and received one course of 20\u2009\u03bcg dayThere were no withdrawals or protocol violations during the trial. However, one patient was excluded from statistical analysis due to a protocol deviation. This patient took only one ethinyloestradiol tablet per day during the ethinyloestradiol treatment phase. Ten other volunteers had protocol deviations that did not lead to exclusion from statistical analysis. All 30 volunteers were included in the safety analyses.-1 ethinyloestradiol varied between 8 and 12\u2009mm except for one volunteer whose endometrial thickness had increased to 20\u2009mm.At screening, all 30 volunteers had a normal postmenopausal baseline endometrial thickness of \u2a7d4\u2009mm and responded to the screening oestrogen challenge with an increase in endometrial thickness to \u2a7e8\u2009mm. Endometrial thickness after 14 days of 20\u2009\u03bcg dayIn all groups, the baseline value on day 1 was slightly elevated compared with the screening value, suggesting that the endometrial thickness after 14 days of oestrogen stimulation had not completely returned to preoestrogen levels, however the differences appeared to be within the level of variability observed for endometrial thickness at these time points. For all volunteers the endometrial thickness on day 1 of treatment was \u2a7d4\u2009mm (Table 1P=0.0001) (P=0.0742)  and placebo, the mean endometrial thickness for the three groups was 7.70\u2009mm for fulvestrant 125\u2009mg plus ethinyloestradiol, 4.20\u2009mm for fulvestrant 250\u2009mg plus ethinyloestradiol, and 11.22\u2009mm for placebo plus ethinyloestradiol, respectively . There w=0.0001) . There w-1 approximately 6 days after i.m. injection of 125\u2009mg and 250\u2009mg fulvestrant, respectively  was approximately 2.5 times greater than that derived from the 125\u2009mg dose. Higher plasma concentrations of fulvestrant (assessed on day 28) were associated with greater reductions in endometrial thickness.A summary of the pharmacokinetic parameters is presented in our-fold . ExposurThere were no serious AEs or events leading to volunteer withdrawal during this trial. Twenty-six volunteers reported a total of 77 AEs during the screening phase. During the first 14 days of the trial, 16 volunteers reported 28 AEs across all treatment groups, and during days 15 to 28, 22 volunteers reported 57 AEs across all treatment groups. Overall, the commonly reported AEs (i.e. those occurring in \u2a7e20% volunteers) were headache, leucorrhoea, breast pain and abdominal pain  occurred in volunteers receiving ethinyloestradiol alone either in the screening phase or in combination with placebo. The number of AEs reported during days 15 to 28 of treatment period 2, in the group receiving fulvestrant 250\u2009mg plus ethinyloestradiol was less than half the number reported over the same time period in the group who received ethinyloestradiol plus placebo. Fulvestrant appeared to reduce the incidence of some of the ethinyloestradiol-induced AEs such as breast pain. Most of the AEs reported by volunteers receiving fulvestrant were considered to be treatment related and consisted of flushing, headache and injection-site reaction. There were no dose-related trends in the reporting of AEs.A reduction in oestrogenic stimuli forms the basis of treatment for many benign and malignant diseases of the breast and reproductive tract. This study was conducted to examine the effect of fulvestrant, a new ER antagonist, both alone and in combination with ethinyloestradiol, on the endometrium of healthy postmenopausal women.Compared with volunteers who received unopposed ethinyloestradiol, those women who received the combination of fulvestrant and ethinyloestradiol had reduced endometrial thickening, demonstrating an antioestrogenic effect of fulvestrant on normal postmenopausal endometrium. The difference in endometrial thickening was clinically and statistically significant in volunteers who received the 250\u2009mg dose of fulvestrant, the dose evaluated in the breast cancer setting. Although endometrial thickness was reduced in volunteers receiving fulvestrant 125\u2009mg compared with the placebo group, the mean difference was smaller and failed to reach statistical significance, suggesting the response to fulvestrant was dose related.Fulvestrant also demonstrated no oestrogen agonist effect on the endometrium during the short-term (14 day) period of administration. There were no clinically significant differences in endometrial thickness between the fulvestrant and placebo groups.Overall, fulvestrant at both doses, either alone or in combination with ethinyloestradiol, was well tolerated. Most of the AEs were associated with ethinyloestradiol dosing or were considered not to be drug related. Fulvestrant appeared to reduce the number of ethinyloestradiol-related events providing further evidence for the antioestrogenic effects of this agent. The pharmacokinetic data were consistent with previous studies in patients with breast cancer (In conclusion, the results of this trial demonstrate an antioestrogenic effect of fulvestrant at doses of 125 and 250\u2009mg on the endometrium. In addition, in the absence of oestrogen, fulvestrant demonstrated no oestrogen agonist effects during the 14-day period of administration. These data confirm that fulvestrant 250\u2009mg, a dose known to be active in breast cancer therapy, is a well-tolerated oestrogen antagonist that is devoid of agonist activity on the endometrium in healthy, postmenopausal women."}
+{"text": "More recently, fulvestrant has also been shown to be noninferior to anastrozole in terms of overall survival, with median time to death being 26.4 months in fulvestrant-treated patients and 24.2 months in those treated with anastrozole . In a further randomised phase III trial, fulvestrant was compared with tamoxifen as first-line therapy for advanced disease in postmenopausal women. In the overall population, efficacy differences favoured tamoxifen and noninferiority of fulvestrant could not be ruled out. In the prospectively defined subset of patients with ER-positive and/or progesterone receptor-positive disease, there was no statistically significant difference between fulvestrant and tamoxifen. This paper reviews the efficacy and tolerability results from these trials.Fulvestrant (\u2018Faslodex\u2019) is a new type of endocrine treatment \u2013 an oestrogen receptor (ER) antagonist that downregulates the ER and has no agonist effects. Early efficacy data from phase I/II trials have demonstrated fulvestrant to be effective and well tolerated. Two randomised phase III trials have compared the efficacy of fulvestrant and the aromatase inhibitor, anastrozole, in postmenopausal women with advanced breast cancer progressing on prior endocrine therapy. Fulvestrant (intramuscular injection 250\u2009mg\u2009month Fulvestrant (\u2018Faslodex\u2019) is a new type of endocrine treatment \u2013 an oestrogen receptor (ER) antagonist with no agonist effects  anastrozole. The results from these trials have led to the approval of fulvestrant for the treatment of postmenopausal women with hormone-sensitive advanced breast cancer following progression on prior endocrine therapy. As first-line hormonal therapy, fulvestrant has also been compared with tamoxifen.Initial efficacy data for fulvestrant in 19 postmenopausal patients with tamoxifen-resistant advanced breast cancer demonstrated that fulvestrant produced a clinical benefit  rate of 69% with a median duration of response (DoR) of 25 months (Fulvestrant was well tolerated with no serious drug-related adverse events (AEs) reported and no patients withdrawn due to toxicity. Local injection-site reactions were also uncommon  were conducted to compare the efficacy and tolerability of fulvestrant Trial 0020 was a randomised, open-label trial conducted in Europe, South Africa and Australia. Trial 0021 was a double-blind, double-dummy study conducted in North America. The design of both trials was identical, except for a slight variation in the dosage delivery regimen, which was due to variations in clinical practice at that time between the US and the rest of the world. In trial 0020, fulvestrant 250\u2009mg was administered as a 1 \u00d7 5\u2009ml intramuscular (i.m.) injection and in trial 0021 as 2 \u00d7 2.5\u2009ml i.m. injections.P=0.84) . To obtain more complete information on DoR, further follow-up was performed. At a median follow-up of 22.6 months, the median DoR (from randomisation to progression in responding patients) was 15.0 months for fulvestrant and 14.5 months for anastrozole   was 5.5 months for fulvestrant and 5.1 months for anastrozole  (P=0.96). After an extended median follow-up of 21.3 months, the median DoR was 19.0 months for fulvestrant and 10.8 months for anastrozole  . OR was strozole  (OsborneP=0.48) and OR rates of 19.2 and 16.5% for fulvestrant and anastrozole, respectively  (P<0.01)  and in those with no visceral metastases   patients. After a median follow-up of 15.1 months, OR and CB were similar between fulvestrant and anastrozole in patients with visceral metastases  , asthenia (22.7 vs 27.0%), pain (18.9 vs 20.3%), vasodilatation (17.7 vs 17.3%) and headache (15.4 vs 16.8%). Withdrawals due to drug-related AEs were reported in 0.9% of patients treated with fulvestrant and in 1.2% of those treated with anastrozole . In the combined analysis, the incidences of these predefined AEs were similar for fulvestrant and anastrozole, except joint disorders, the incidence of which was significantly lower for fulvestrant compared with anastrozole  is an important consideration when making treatment choices for patients with advanced breast cancer. In both phase III trials, the QoL was assessed using the Functional Assessment of Cancer Therapy \u2013 Breast (FACT-B) questionnaire. This tool is a sensitive measure for evaluating physical, functional, social and emotional well-being and comprises the FACT-G \u2018general\u2019 QoL tool for cancer patients plus the Breast Cancer Subscale (Fulvestrant 250\u2009mg (delivered as a once-monthly 5\u2009ml i.m. injection) has been compared with tamoxifen 20\u2009mg  in a trial conducted in postmenopausal women with ER-positive and/or PgR-positive or ER/PgR-unknown advanced breast cancer who had not been treated with prior endocrine therapy or chemotherapy for advanced disease. This study was a double-blind, randomised, parallel-group, double-dummy trial conducted at 171 centres in 26 countries throughout the world, including Europe, North and South America, Africa and Australia.Of the 587 patients who were randomised to treatment, 78% of patients in the fulvestrant group and 75.2% of those in the tamoxifen group had received no prior tamoxifen in the adjuvant setting.vs 8.3 months for fulvestrant and tamoxifen, respectively; HR: 1.18; 95% CI, 0.98\u20131.44; P=0.09). However, observed differences in other efficacy end points favoured tamoxifen and noninferiority of fulvestrant could not be demonstrated . The OR rate in this hormone receptor-positive subgroup was 33.2% for fulvestrant and 31.1% for tamoxifen , in the population intended for treatment with endocrine therapy, the TTP was similar between the two treatments (median TTP: 8.2 P=0.31) and OR was significantly higher for fulvestrant compared with tamoxifen . Furthermore, 20 out of 35 patients who responded to first-line treatment with fulvestrant and provided follow-up information on subsequent treatments retained sensitivity to subsequent therapies including anastrozole, letrozole, fadrozole, tamoxifen and megestrol acetate (Previous studies have suggested that patients with ER-positive and PgR-positive breast tumours have a more active ER and have demonstrated that these patients are more likely to benefit from endocrine therapy compared with patients with ER-positive/PgR-negative tumours ( acetate .P=0.0501).Both treatments were well tolerated. The incidence of prospectively defined AEs of gastrointestinal disturbances , vaginitis and thromboembolic disease was similar between fulvestrant and tamoxifen. However, the incidence of hot flushes was lower in patients treated with fulvestrant compared with those treated with tamoxifen (Two pivotal phase III trials have demonstrated that fulvestrant is well tolerated and is at least as effective as the third-generation AI anastrozole in patients with advanced breast cancer who have progressed on prior endocrine therapy. A prospectively planned combined analysis from these trials demonstrated that fulvestrant is at least as effective as anastrozole with respect to TTP, OR and DoR. Although investigations of the 1 \u00d7 5\u2009ml and the 2 \u00d7 2.5\u2009ml injections have demonstrated that the pharmacokinetic profiles of these doses are comparable , recent As first-line treatment of advanced breast cancer in postmenopausal women with ER-positive and/or PgR-positive tumours, fulvestrant appears to have a similar efficacy to tamoxifen. In patients with ER-positive and PgR-positive tumours, a subset likely to be sensitive to the positive benefits of endocrine treatments, a retrospectively derived analysis of the data was suggestive of a possible benefit for fulvestrant compared with tamoxifen in terms of OR. However, these latter findings require further investigation so that the patient population most likely to benefit from fulvestrant in the first-line setting can be established.Fulvestrant is the only ER antagonist that has demonstrated unequivocal efficacy in patients with tamoxifen-resistant advanced breast cancer. Although other antioestrogens, that is, some of the SERM-like compounds, have shown limited efficacy in the first-line treatment of advanced breast cancer, they are relatively ineffective in patients who are resistant to tamoxifen . This prIn summary, as second-line therapy for postmenopausal women with ER-positive and/or PgR-positive advanced breast cancer who have progressed on prior endocrine treatment, fulvestrant is clearly an effective therapy that offers equal efficacy to anastrozole."}
+{"text": "The aim of this study was to measure HrQoL during acute exacerbations of COPD using generic and disease-specific instruments, and to assess completeness, proportion with best or worst health state, sensitivity to change and discriminative ability for each instrument.EQ-5D, SF-12 and SGRQ were obtained from COPD patients with GOLD stage III and IV hospitalized for an acute exacerbation both at admission and discharge. To assess the instruments' properties, utility values were calculated for EQ-5D and SF-12, and a total score was derived from the SGRQ.Mean utilities ranged from 0.54  to 0.62  at admission, and from 0.58  to 0.84  at discharge. Completeness was best for EQ-5D and SGRQ, while no utility value for the SF-12 could be calculated for more than 30%. For SGRQ subscales, the minimal score occurred in up to 11% at admission, while full health was observed for the EQ-5D at discharge in 13%. Sensitivity to change was generally good, whereas discrimination between COPD stages was low for the EQ-5D.Acute exacerbations seriously impair health status and quality of life. The EQ-5D is generally suitable to measure HrQoL in exacerbations of severe COPD, although the high proportion of patients reporting full health at discharge poses a problem. The main issue with the SF-12 is the high proportion of missing values in a self-assessed setting. Properties of the SGRQ were satisfactory. However, since no utility values can be derived from this disease-specific instrument, it is not suitable for cost-utility analyses in health-economic evaluations. Chronic obstructive pulmonary disease (COPD) is a common chronic condition that severely affects patients' health-related quality of life (HrQoL). With a prevalence of more than 13% in those aged 40 years and older in Germany, COPD is one of the most frequent causes of morbidity and mortality . It has A number of studies measure HrQoL in patients with COPD during stable phases of the disease using e.g. the generic EuroQol 5 dimension (EQ-5D) ,5, the SThe most frequently used instruments to measure HrQoL during acute exacerbations are the SGRQ ,10 and tTherefore, the aim of this study was to evaluate HrQoL using the two generic instruments EQ-5D and SF-12 and the disease-specific SGRQ in patients with severe and very severe COPD hospitalized for exacerbations, and to compare their results with regard to completeness, proportion with best and worst health state, sensitivity to change and discrimination between groups of different disease severity.1) of 30-50% of their predicted value were categorized into stage III, patients with a FEV1 below 30% predicted, or with 30-50% predicted and chronic respiratory failure were categorized into stage IV. Patients with a FEV1 of more than 50% predicted were excluded. Patients who were readmitted to hospital during the study were asked to participate again.This prospective, observational study was conducted at the Asklepios Clinics in Gauting, Germany. Inclusion criteria were a minimum age of 45, a prior diagnosis of COPD and sufficient knowledge of the German language. All patients admitted between October 2007 and May 2008 for an exacerbation of COPD who met the inclusion criteria were asked to participate in the study. Participants signed a written consent form and answered a self-administered questionnaire within three days after admission and again within three days of discharge. Taking additional measurements during the hospital stay was not feasible for logistic reasons, nor was contacting patients after discharge for a follow-up. The questionnaire comprised the validated German versions of the EQ-5D, the SF-12 and the SGRQ to measure HrQoL as well as questions on patient's sex, age and smoking status. To assess disease severity, lung function was measured at discharge and categorized according to the GOLD classification : PatientThe EQ-5D is a generic questionnaire that consists of two parts: the descriptive section comprises the 5 dimensions mobility, self-care, usual activities, pain/discomfort and anxiety/depression . Each diThe second part of the EQ-5D is a visual analogue scale (VAS). Respondents value their HrQoL on a rating scale from 0  to 100 .The SF-12 is also a generic instrument, containing 12 items selected from the SF-36. A physical and a mental component score (PCS and MCS) can be calculated. The PCS ranges from 11 to 60, the MCS from 16 to 70, with higher values indicating higher HrQoL. As no German value set was available for the SF-12, an international value set was used to obtain a preference-based health index (SF-6D) .The SGRQ is a disease-specific instrument that consists of 50 items and was specifically developed for patients with chronic airflow limitation. Three component scores for the domains symptoms, activity and impact on daily life can be calculated as well as a total score . Scores 2 tests for differences in percentages.Differences between baseline characteristics were tested using t-tests for continuous variables, and Pearson \u03c7Completeness, proportion with best or worst health state, sensitivity to change and discrimination between the disease stages III and IV were considered to compare the instruments' applicability for COPD patients during acute exacerbations.An instrument was considered complete if a utility or total score could be calculated. For this, in the EQ-5D, all 5 questions needed to be answered. For the SF-12, the items necessary for the calculation of the SF-6D were required. To calculate the SGRQ total score, the subscores symptoms, activity and impact had to be available. On each subscore, 2 to 6 missing items were allowed.For each instrument, the proportion of patients with the best or worst possible health state was reported.sdA): To assess sensitivity to change, standardized differences (sdiff) were calculated for the utility and total scores, respectively . For thir et al.  to accouThe ability of an instrument to discriminate between disease stages was analyzed using linear mixed regression models, adjusting for age, sex, smoking status and time of assessment (admission or discharge). Random effects were employed to account for cluster effects due to multiple admissions. Analyses were rerun univariately using the non-parametric Wilcoxon rank test for clustered data  for thosA total of 117 patients with GOLD stages III and IV participated in the study. Patient characteristics by disease stage are shown in Table Table Mean (sd) values for HrQoL at admission and discharge by disease severity are shown in Table For comparison with studies from other countries, an EQ-5D index based on the UK tariff according to Dolan  was calcFigure Table Table If instead of best health state, the proportion with maximum utility score was considered, this percentage rose from 13% to 23% for the EQ-5D at discharge. The reason for this is that the item 'usual activities' is not included in the weighting scheme of the German tariff (only in the form of a dummy variable indicating if 'extreme problems' were reported on any dimension). Maximum EQ-5D utility scores were more frequent in stage III than in stage IV (35% vs. 18%).All instruments reported higher HrQoL at discharge compared to admission, with absolute standardized differences from 0.13 to 1.17 Table , and excThe results of the mixed linear regression models are shown in Table One disease-specific (SGRQ) and two generic  instruments were used to measure HrQoL at admission and discharge in patients with severe and very severe COPD hospitalized for acute exacerbations. Objectives of the study were to evaluate HrQoL during acute exacerbations and to compare the 3 instruments with regard to completeness, proportion with best or worst health state, sensitivity to change and discrimination between groups of different disease severities.The main problem of the SF-12 in this self-administered setting was the high proportion of missing values. For less than 55% of all patients, a comparison of utility values at admission and at discharge was possible. Half of all missing utilities were due only to 2 items of the SF-6D. As one missing item precludes the calculation of a utility, and since the proportion of missing values increases with age, a high percentage of missing utilities was observed in this relatively old patient group. For the SGRQ on the other hand, subscores and a total score can still be calculated with up to 6 missing items per subscore. Therefore, completeness was best for the SGRQ in spite of its length of 50 items.Worst possible scores were observed for the symptom score of the SGRQ at admission, as well as for the activity subscore at both time points. However, whereas this is tolerable for a disease-specific instrument in this severely ill patient group, the relatively high proportion with full health according to the EQ-5D at discharge poses a more serious problem. Ceiling effects were known to be present in stable phases of less severe COPD stages , but in Sensitivity to change was generally good in all instruments. However, while the SF-12 PCS improved significantly from admission to discharge, the MCS showed only marginal changes. The reason for this might be that it requires more time for patients' mental state to recover from an exacerbation than it does for their physical condition. Differences between the instruments may be due to different reporting periods: the EQ-5D asks for the patient's immediate situation (\"today\"), whereas the reporting periods of the SF-12 and the SGRQ were 4 weeks and 3 months, respectively. In exacerbations, which usually show an acute onset of health status deterioration, a recall time of 4 weeks or more may be too long to detect these rapid changes. On the other hand, it is not clear how much patients pay attention to the respective reporting periods, particularly when answering the 3 instruments consecutively.Differences between disease stages were observed for the MCS, but not for the PCS. While these differences are known to be present in stable phases of the disease , they maAs previous studies ,24, we f1 in General Practitioner notes which might result in less severe COPD stages. However, HrQoL at discharge as measured by the EQ-5D (UK tariff) and the VAS in our study were only slightly below those observed by Rutten-van M\u00f6lken et al. in stable stage III and IV [EQ-5D utilities based on the UK tariff and VAS values at admission in our study were considerably higher compared to those by O'Reilly et al. , and stiI and IV , as wereI and IV , which mI and IV .Doll et al. found SGRQ scores of 40 to 80 during exacerbations . The resOne limitation of our study is that missing values were more frequent in women and in older patients. Especially in the SF-12, this probably resulted in an overestimation of HrQoL, whereas the proportion with worst health state may be underestimated. Sensitivity to change might also be affected, if those more likely to be missing are also more likely to improve from admission to discharge. Furthermore, the most severely ill patients could not be included in the study since they were not able to answer the questionnaire. This is most likely to lead to an overestimation of HrQoL in our study, but the amount of this bias is not known. Also, the time course of patients' health state after discharge was not observed within this study. This information is useful to calculate QALY loss associated with severe exacerbations more precisely. Results from O'Reilly in a subgroup of patients indicate that utility values had dropped 3 months after discharge. However, further research is needed to confirm these findings for other instruments such as the SF-12.Also, no information on patients' comorbidities was available. However, Rutten-van M\u00f6lken et al. found no significant differences in the number of concomitant diagnoses or the Charlson comorbidity index between GOLD stages , so the In all, this study showed that generic instruments as the EQ-5D or the SF-12 are suitable to measure HrQoL during acute exacerbations and show good properties for most criteria.Acute exacerbations have serious effects on health status and quality of life.In all, the EQ-5D appears to be suitable to measure HrQoL in this patient group, although the relatively high proportion with full health poses a problem. Still, completeness was at 92%, sensitivity to change was satisfactory, and this instrument is easy to apply due to its brevity. The SF-12 appears less suitable for a self-assessed setting due to the high proportion of missing values, although complete questionnaires showed good properties in the remaining aspects. Properties of the SGRQ were generally good. However, no utility values can be derived for health-economic evaluations from this disease-specific instrument.The authors declare that they have no competing interests. This work was supported by the \"Kompetenznetz Asthma/COPD (Competence Network Asthma/COPD)\" funded by the Federal Ministry of Education and Research (FKZ 01GI0881-0888).PM participated in the design and the coordination of the study, performed the statistical analysis and wrote the manuscript. NW participated in the design and the coordination of the study. RH supervised the study and assisted in writing the manuscript. All authors read and approved the final manuscript."}
+{"text": "In the crystal, neighboring mol\u00adecules are linked through an N\u2014H\u22efBr hydrogen bond and four weak C\u2014H\u22efBr contacts, forming a three-dimensional network.In the title salt, C For C\u2014Hfrey 1997; Zhang e al. 2003. For gra al. 1995.23H21NOP+\u00b7Br\u2212CMr = 438.29Triclinic, a = 9.5190 (19) \u00c5b = 9.812 (2) \u00c5c = 12.726 (3) \u00c5\u03b1 = 110.30 (3)\u00b0\u03b2 = 104.89 (3)\u00b0\u03b3 = 96.81 (3)\u00b0V = 1048.7 (4) \u00c53Z = 2K\u03b1 radiationMo \u22121\u03bc = 2.05 mmT = 293 K0.20 \u00d7 0.17 \u00d7 0.13 mmSiemens P4 diffractometerSADABS; Sheldrick, 1996Tmin = 0.685, Tmax = 0.777Absorption correction: multi-scan (11498 measured reflections3673 independent reflectionsI > 2\u03c3(I)3213 reflections with Rint = 0.046R[F2 > 2\u03c3(F2)] = 0.038wR(F2) = 0.129S = 1.023673 reflections247 parameters1 restraintH atoms treated by a mixture of independent and constrained refinementmax = 0.32 e \u00c5\u22123\u0394\u03c1min = \u22120.46 e \u00c5\u22123\u0394\u03c1XSCANS  I, global. DOI: Click here for additional data file.10.1107/S1600536812050805/is5227Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536812050805/is5227Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The indole ring system is almost planar [maximum deviation = 0.045\u2005(2)\u2005\u00c5]. In the crystal, O\u2014H\u22efO hydrogen bonds link the mol\u00adecules into zigzag chains along the b-axis direction. There are weak C\u2014H\u22ef\u03c0 inter\u00adactions within the chains and linking neighbouring chains forming sheets lying parallel to (001).In the title compound, C \u00c5b = 5.4554 (3) \u00c5c = 15.0906 (4) \u00c5\u03b2 = 95.453 (4)\u00b0V = 1186.08 (8) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.08 mmT = 296 K0.45 \u00d7 0.36 \u00d7 0.13 mmBruker SMART BREEZE CCD diffractometerSADABS; Bruker, 2007Tmin = 0.965, Tmax = 0.990Absorption correction: multi-scan (11615 measured reflections11615 independent reflectionsI > 2\u03c3(I)9784 reflections with Rint = 0.032R[F2 > 2\u03c3(F2)] = 0.079wR(F2) = 0.214S = 1.1611615 reflections161 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.30 e \u00c5\u22123\u0394\u03c1min = \u22120.27 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  I, global. DOI: 10.1107/S1600536814003845/su2701Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536814003845/su2701Isup3.cmlSupporting information file. DOI: CCDC reference:  crystallographic information; 3D view; checkCIF reportAdditional supporting information:"}
+{"text": "In the crystal, the graph-set motifs of the inter\u00adaction pattern are an R22(16) motif involving dimers through N\u2014H\u22efN hydrogen bonds across centres of inversion and a C(6) motif through C\u2014H\u22efO hydrogen-bond between glide-related mol\u00adecules. Together, these generate [101] ladder-like chains.In the title compound, C \u00c5b = 8.1230 (2) \u00c5c = 17.6160 (4) \u00c5\u03b2 = 110.325 (1)\u00b0V = 2295.55 (9) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.08 mmT = 298 K0.30 \u00d7 0.24 \u00d7 0.18 mmBruker SMART APEXII CCD diffractometerSADABS; Bruker, 2009Tmin = 0.978, Tmax = 0.986Absorption correction: multi-scan (21711 measured reflections4455 independent reflectionsI > 2\u03c3(I)2979 reflections with Rint = 0.031R[F2 > 2\u03c3(F2)] = 0.040wR(F2) = 0.115S = 1.034455 reflections313 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.14 e \u00c5\u22123\u0394\u03c1min = \u22120.15 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  I, global. DOI: Click here for additional data file.10.1107/S1600536812046764/rz5022Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536812046764/rz5022Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "In the crystal, the mol\u00adecules are linked by N\u2014H\u22efN and N\u2014H\u22efS hydrogen bonds into a chain along the b axis.In the title compound, C \u00c5b = 7.199 (2) \u00c5c = 31.913 (10) \u00c5V = 1778.8 (10) \u00c53Z = 8K\u03b1 radiationMo \u22121\u03bc = 0.60 mmT = 298 K0.50 \u00d7 0.43 \u00d7 0.30 mmBruker SMART APEX CCD area-detector diffractometerSADABS; Bruker, 2000Tmin = 0.754, Tmax = 0.841Absorption correction: multi-scan (10422 measured reflections1846 independent reflectionsI > 2\u03c3(I)1628 reflections with Rint = 0.024R[F2 > 2\u03c3(F2)] = 0.039wR(F2) = 0.108S = 1.181846 reflections112 parameters3 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.31 e \u00c5\u22123\u0394\u03c1min = \u22120.19 e \u00c5\u22123\u0394\u03c1SMART  used to solve structure: SHELXS97  global, I. DOI: 10.1107/S160053681202377X/bq2362Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S160053681202377X/bq2362Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The near planarity of the fused-benzene ring is illustrated by the very small deviations of all the atoms from the plane  through O\u2014H\u22efN hydrogen bonds formed between the oxazinic N atom and the solvent water mol\u00adecule. The chains are consolidated by C\u2014H\u22efO inter\u00adactions.The asymmetric unit of the title compound, C \u00c5b = 5.2132 (2) \u00c5c = 11.6058 (4) \u00c5\u03b2 = 91.153 (2)\u00b0V = 1832.87 (11) \u00c53Z = 4K\u03b1 radiationCu \u22121\u03bc = 0.80 mmT = 120 K0.17 \u00d7 0.13 \u00d7 0.13 mmOxford Diffraction Xcalibur Atlas Gemini ultra diffractometerCrysAlis PRO; Agilent, 2012Tmin = 0.104, Tmax = 1Absorption correction: multi-scan (18257 measured reflections1639 independent reflectionsI > 3\u03c3(I)1440 reflections with Rint = 0.033R[F2 > 2\u03c3(F2)] = 0.030wR(F2) = 0.094S = 1.751639 reflections127 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.17 e \u00c5\u22123\u0394\u03c1min = \u22120.14 e \u00c5\u22123\u0394\u03c1CrysAlis PRO  used to solve structure: Superflip  global, I. DOI: 10.1107/S1600536812035519/bx2424Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536812035519/bx2424Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The conformation about each of the N=C [1.290\u2005(3)\u2005\u00c5] and C=C [1.340\u2005(3)\u2005\u00c5] bonds is E. Supra\u00admolecular chains along [1-10] are stabilized by N\u2014H\u22efN(pyridine) hydrogen bonding and these are connected into a double layer that stacks along the c-axis direction by C\u2014H\u22ef\u03c0(pyridine) inter\u00adactions.In the title compound, C \u00c5b = 10.1570 (9) \u00c5c = 14.5488 (17) \u00c5\u03b1 = 77.315 (9)\u00b0\u03b2 = 84.735 (9)\u00b0\u03b3 = 78.193 (8)\u00b0V = 758.06 (13) \u00c53Z = 2K\u03b1 radiationCu \u22121\u03bc = 3.14 mmT = 100 K0.13 \u00d7 0.06 \u00d7 0.01 mmOxford Diffraction Xcaliber Eos Gemini diffractometerCrysAlis PRO; Agilent, 2011Tmin = 0.83, Tmax = 0.97Absorption correction: multi-scan (15664 measured reflections2918 independent reflectionsI > 2\u03c3(I)2469 reflections with Rint = 0.045R[F2 > 2\u03c3(F2)] = 0.042wR(F2) = 0.115S = 1.052918 reflections193 parameters1 restraintH atoms treated by a mixture of independent and constrained refinementmax = 0.42 e \u00c5\u22123\u0394\u03c1min = \u22120.29 e \u00c5\u22123\u0394\u03c1CrysAlis PRO  used to solve structure: SHELXS97  global, I. DOI: Click here for additional data file.10.1107/S1600536812051537/qm2090Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536812051537/qm2090Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "In the crystal, mol\u00adecules form inversion dimers via pairs of O\u2014H\u22efO hydrogen bonds.In the title compound, C \u00c5b = 11.604 (4) \u00c5c = 21.226 (7) \u00c5\u03b2 = 101.777 (5)\u00b0V = 2674.7 (15) \u00c53Z = 8K\u03b1 radiationMo \u22121\u03bc = 0.08 mmT = 153 K0.47 \u00d7 0.34 \u00d7 0.23 mmRigaku AFC10/Saturn724+ diffractometer11602 measured reflections3479 independent reflectionsI > 2\u03c3(I)2673 reflections with Rint = 0.032R[F2 > 2\u03c3(F2)] = 0.042wR(F2) = 0.114S = 1.113479 reflections177 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.21 e \u00c5\u22123\u0394\u03c1min = \u22120.18 e \u00c5\u22123\u0394\u03c1CrystalClear  used to solve structure: SHELXS97  I, global. DOI: 10.1107/S1600536812021575/nr2026Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536812021575/nr2026Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials: interactive version of Fig. 1Enhanced figure: interactive version of Fig. 2Enhanced figure:"}
+{"text": "A short intra\u00admolecular C\u2014H\u22efO generates an S(6) ring. In the crystal, mol\u00adecules related by a twofold screw axis are connected by O\u2014H\u22efN hydrogen bonds, forming [100] chains Within these chains, mol\u00adecules related by a unit translation along [100] show \u03c0\u2013\u03c0 stacking inter\u00adactions between their fluorene ring systems with an inter\u00adplanar distance of 3.347\u2005(2)\u2005\u00c5. The dihedral angle between the fluorene units of adjacent mol\u00adecules along the helix is 88.40\u2005(2)\u00b0. There is a short C\u2014H\u22ef\u03c0 contact between the fluorene groups belonging to neighbouring chains.In the title mol\u00adecule, C \u00c5b = 12.2309 (2) \u00c5c = 16.0247 (3) \u00c5V = 940.96 (3) \u00c53Z = 4K\u03b1 radiationCu \u22121\u03bc = 0.70 mmT = 100 K0.16 \u00d7 0.13 \u00d7 0.13 mmAgilent SuperNova  diffractometerCrysAlis PRO; Agilent, 2013Tmin = 0.890, Tmax = 1.000Absorption correction: multi-scan (7588 measured reflections1942 independent reflectionsI > 2\u03c3(I)1865 reflections with Rint = 0.029R[F2 > 2\u03c3(F2)] = 0.029wR(F2) = 0.075S = 1.051942 reflections140 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.13 e \u00c5\u22123\u0394\u03c1min = \u22120.18 e \u00c5\u22123\u0394\u03c1I+)\u2212(I\u2212)]/[(I+)+(I\u2212)] CrysAlis PRO  used to solve structure: SHELXS97  I. DOI: 10.1107/S1600536814002669/gk2601Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536814002669/gk2601Isup3.cmlSupporting information file. DOI: CCDC reference:  crystallographic information; 3D view; checkCIF reportAdditional supporting information:"}
+{"text": "In the crystal, O\u2014H\u22efO hydrogen bonds link the mol\u00adecules into zigzag chains along the b axis. Weaker additional C\u2014H\u22efO and C\u2014H\u22ef\u03c0 contacts generate a three dimensional network, with mol\u00adecules stacked along the b-axis direction.In the title compound C \u00c5b = 7.1881 (2) \u00c5c = 19.8333 (6) \u00c5V = 2556.28 (13) \u00c53Z = 8K\u03b1 radiationMo \u22121\u03bc = 0.26 mmT = 296 K0.16 \u00d7 0.12 \u00d7 0.10 mmBruker Kappa APEXII CCD diffractometer3124 measured reflections3124 independent reflectionsI > 2\u03c3(I)2343 reflections with R[F2 > 2\u03c3(F2)] = 0.050wR(F2) = 0.161S = 0.993124 reflections161 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.45 e \u00c5\u22123\u0394\u03c1min = \u22120.39 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  I, New_Global_Publ_Block. DOI: Click here for additional data file.10.1107/S1600536812041682/nk2181Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The C=C double bond is in an E conformation and the vinyl\u00adaldehyde groups adopt extended conformations. In the crystal, mol\u00adecules are linked by O\u2014H\u22efO hydrogen bonds, forming infinite chains parallel to [101].The asymmetric unit of the title compound, C \u00c5b = 13.7078 (19) \u00c5c = 10.9891 (15) \u00c5\u03b2 = 102.537 (3)\u00b0V = 1488.0 (4) \u00c53Z = 8K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 200 K0.40 \u00d7 0.34 \u00d7 0.29 mmBruker SMART APEX CCD diffractometer10982 measured reflections3725 independent reflectionsI > 2\u03c3(I)1785 reflections with Rint = 0.041R[F2 > 2\u03c3(F2)] = 0.052wR(F2) = 0.182S = 0.973725 reflections201 parametersH-atom parameters constrainedmax = 0.22 e \u00c5\u22123\u0394\u03c1min = \u22120.27 e \u00c5\u22123\u0394\u03c1SMART  used to solve structure: SHELXTL  I, global. DOI: Click here for additional data file.10.1107/S1600536813006648/fy2086Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536813006648/fy2086Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "P301L mice subjected to controlled cortical injury. These data provide further evidence for the causal effects of moderately severe contusional TBI on acceleration of acute Alzheimer-related abnormalities and the independent relationship between amyloid-\u03b2 and tau in this setting.Traumatic brain injury (TBI) is a major environmental risk factor for Alzheimer's disease. Intracellular accumulations of amyloid-\u03b2 and tau proteins have been observed within hours following severe TBI in humans. Similar abnormalities have been recapitulated in young 3xTg-AD mice subjected to the controlled cortical impact model (CCI) of TBI and sacrificed at 24 h and 7 days post injury. This study investigated the temporal and anatomical distributions of amyloid-\u03b2 and tau abnormalities from 1 h to 24 h post injury in the same model. Intra-axonal amyloid-\u03b2 accumulation in the fimbria was detected as early as 1 hour and increased monotonically over 24 hours following injury. Tau immunoreactivity in the fimbria and amygdala had a biphasic time course with peaks at 1 hour and 24 hours, while tau immunoreactivity in the contralateral CA1 rose in a delayed fashion starting at 12 hours after injury. Furthermore, rapid intra-axonal amyloid-\u03b2 accumulation was similarly observed post controlled cortical injury in APP/PS1 mice, another transgenic Alzheimer's disease mouse model. Acute increases in total and phospho-tau immunoreactivity were also evident in single transgenic Tau P301L transgenic mice Moderate to severe traumatic brain injury (TBI) can accelerate cognitive decline and increases the risk of dementia of the Alzheimer's type Axonal A\u03b2 pathology is a characteristic feature of human traumatic axonal injury 1\u201313 in these studies. To demonstrate that HJ3.4 does not recognize APP, we performed immunoprecipitation followed by a Western blot analysis. Identical aliquots (100 \u00b5g) from brain lysates of a 9 month-old 3xTg-AD mouse were immunoprecipitated with monoclonal HJ3.4, 82E1, 6E10 antibodies, or no primary antibody control. Monoclonal 82E1 has been previously shown to be specific for A\u03b2 We analyzed A\u03b2 axonal pathology with HJ3.4 antibody against A\u03b2When we stained the brains of injured and sham 3xTg-AD mice which were sacrificed at 24 hours post injury with HJ3.4 antibody, we observed that the fimbria/fornix, a white matter region vulnerable to axonal injury, exhibited the most prominent axonal A\u03b2 pathology  mutation of the human APP gene and the human PS1 gene with exon 9 deleted We have previously reported that CCI resulted in tau accumulation at 24 h in several brain regions of injured 3xTg-AD mice Here, we investigated the temporal patterns of tau accumulation in these regions using the same mice used to assess the time course of A\u03b2 described above. We quantitatively characterized the time course of tau immunoreactive changes using stereological methods . This result is not surprising, as the 3xTg-AD mice were homozygous for human mutant tau whereas the TauP301L mice were heterozygous. Furthermore, total tau staining in the ipsilateral amygdala and contralateral CA1 of injured TauP301L was increased relative to sham TauP301L mice, similar to the effects in injured 3xTg-AD mice  transgenic mice , and 6 month old heterozygous TauP301L mice. 3xTg-AD mice have human PS1M146V gene knocked in to the mouse allele, overexpress human APP Swedish gene and tauP301L gene PSEN1 with an exon 9 deletion P301L mice overexpress human tau gene with P301L mutation ad. lib. Mice of both sexes were randomly assigned to experimental groups. All experiments were approved by the animal studies committee at Washington University in St Louis, animal welfare assurance number A-3381-01.We used 6 month old homozygous 3xTg-AD mice, 2 month old heterozygous APPThe experimental TBI methods used in this study were performed as described previously 1\u201313) was a gift from Dr. David Holtzman 15\u201330), and phospho-tau at S199 antibodies were purchased from Invitrogen Corp. Polyclonal total tau antibody was from Pierce. Monoclonal PHF1 antibody (against tau phosphorylated at S396 and S404) was a gift from Dr. Peter Davies, Albert Einstein College of Medicine Monoclonal HJ3.4 antibody (against A\u03b2To verify the specificity of HJ3.4 for A\u03b2 over amyloid precursor protein (APP), an immunodepletion assay was performed on brain homogenate from a 9 month old 3xTg-AD mouse. Whole brain was removed after transcardial perfusion with PBS containing 0.3% heparin and immediately dounce homogenized in RIPA buffer  containing protease inhibitor cocktail (Roche) at a 10\u22361 ratio (RIPA volume/tissue weight) using 25 strokes followed by brief sonication. The resulting homogenate was centrifuged for 20 minutes at 17,000\u00d7g at 4\u00b0C to remove insoluble protein. Total protein was determined using a standard BCA protein assay. Individual aliquots containing 100 \u00b5g of homogenate were immunodepleted using 10 \u00b5g of each antibody . After overnight incubation, complexes were captured using 150 \u00b5g Protein-G Dynabeads\u00ae . The resulting immunodepleted supernatants were assayed by Western blot, as described below, to determine affinity in solution for APP.Samples for Western blot analysis were combined with standard Laemmli buffer and heated to 85\u00b0C to denature for 5 minutes. Protein samples were size separated on NuPAGE\u00ae 12% Bis-Tris gels (Invitrogen) in 2-(N-morpholino)ethanesulfonic acid (MES) SDS running buffer at 150 Volts. SeeBlue\u00ae Plus-2 prestained standard (Invitrogen) was used to visualize and estimate the progression and size of the sample migration. Gels were then transferred to 0.2 \u00b5m nitrocellulose using Towbin buffer  containing 20% methanol at 150 mA for 1 hour. For A\u03b2 western blotting, membranes were incubated at 95\u00b0C for 1 minute in PBS to allow for improved antigen binding and then cooled in room temperature PBS prior to blocking. Membranes were blocked in 2% non-fat dry milk (NFDM) PBS for 1 hour. Between all remaining steps, membranes were washed 3\u00d7 for 10 minutes each with PBS-T (0.05% Tween 20). For detection of APP, the mouse monoclonal 6E10 was used at 1 \u00b5g/mL in 2% NFDM PBS overnight at 4\u00b0C. Bound primary antibodies were detected using a sheep anti-mouse-HRP  at 50 ng/mL in 2% NFDM PBS and then developed with ECL Advance Reagent  followed by exposure to film emulsion.Staining was done on 50 \u00b5m free-floating sections, as described previously All stereological quantifications were done via StereoInvestigator version 8.2 software, as previously described P301L mice, student's t-tests were employed. Values are expressed as means \u00b1 SEM. Statistical significance was set at p<0.05.All data were analyzed using Prism 5.0 . For changes of either A\u03b2 or tau pathology as function of time, one-way ANOVAs with Newman-Keuls post tests were used because there were no prespecified hypotheses about the direction of change. For pairwise comparisons of A\u03b2 immunohistochemical data between injured 3xTg-AD and APP/PS1 mice, and of tau immunohistochemical data between 3xTg-AD and Tau"}
+{"text": "Estimates of the burden of disease caused by a particular agent are used to assist in making policy and prioritizing actions. Most estimations have employed the attributable fraction approach, which estimates the proportion of disease cases or deaths in a specific year which are attributable to past exposure to a particular agent. While this approach has proven extremely useful in quantifying health effects, it requires historical data on exposures which are not always available.We present an alternative method, the future excess fraction method, which is based on the lifetime risk approach, and which requires current rather than historical exposure data. This method estimates the future number of exposure-related disease cases or deaths occurring in the subgroup of the population who were exposed to the particular agent in a specific year. We explain this method and use publically-available data on current asbestos exposure and mesothelioma incidence to demonstrate the use of the method.Our approach to modelling burden of disease is useful when there are no historical measures of exposure and where future disease rates can be projected on person years at risk. Burden of disease estimates are used widely to assist in policy-making and prioritizing of actions . The mosWe have developed an alternative method, based on the lifetime risk approach, which estimates the excess exposure-related disease cases or deaths occurring in the future in the subgroup of the population who were exposed to the agent in a specific year . This meThe FEF approach can be used when no historical exposure data are present and projections of the disease can be made on future person years at tirk. The primary value of the method is that it allows us to look at hypothesized future scenarios in which nothing changes and, in comparison, what would happen with various planned interventions.In this paper we explain the FEF method and demonstrate its use with data on occupational asbestos exposure and mesothelioma.The risk of developing cancer or other conditions is often presented as the probability of developing the disease over a lifetime or the \u2018lifetime risk\u2019. For example, in 2011, the risk for Australian males of being diagnosed with mesothelioma before their 85th birthday was 1 in 130 or 0.8\u00a0% . The \u2018lin chance [There are several ways to calculate lifetime risk. The Cumulative Risk is the probability of developing or dying from a disease up to a specific age. It is calculated by summing the age-specific incidence rates for each year up to an upper age limit and is usually expressed as a 1 in n chance . It may n chance . TherefoA more realistic estimate of the lifetime risk was developed by Goldberg et al.  who incoBender et al.  proposedWe based our FEF model on the PY model  with somWe use the following naming conventions:NP(t) is the number of individuals in population P at time tNe(t= 0) is the number of individuals in population P who are exposed to the agent in the index yearDP(t) is the number of disease cases in population P at time tLRP is the lifetime risk of disease in population PFNP is the total number of disease cases in population P over a lifetimeStep 1.Np(t = 0).Define the index year (t\u2009=\u20090) as the year in which the study population is defined and the exposure categorization is made. Define the population of interest, which may be the current resident population perhaps limited by age, sex or other factors. For simplicity, in the methodological overview we have stratified by age but not sex. The total number of individuals in the population in the index year is denoted by Step 2.Ne(t = 0)). Note that there may be a range of exposures in this group (in both level and duration up to t\u2009=\u20090). Also note that those who have been exposed in the past to the agent but are not exposed in the index year will be classified as unexposed. The number of unexposed individuals is Nu(t = 0).Estimate the number of individuals in the population of interest who are exposed to the agent in the index year (Step 3.Estimate the future Person Years at Risk (PYAR) for the population of interest irrespective of exposure using standard life tables. These tables use national death rates to estimate the probability that an individual of a certain age is alive at each age in the future. Single decrement tables assume that an individual continues to contribute person years to the cohort until they die. Double decrement tables, which take into account the competing probabilities of death from any cause as well as incidence of the disease of interest can be used if the disease of interest is an absorbing state with no possibility of a return transition. Multi-state life tables provide for the possibility of return transitions but increase further the data requirements and complexity of the method.Step 4.Estimate the age-specific death or incidence rates for the disease of interest in each age group at the midpoint in the index year.Step 5.. Projection of future rates usually requires an estimate of historical rates and a projection model and methods will differ according to the disease of interest.Calculate the projected future age-specific rates of disease for each future period of, for example, 10\u00a0years . This estimate is irrespective of exposureStep 6.Dt) at each estimation interval by multiplying the age-specific rate at the midpoint of the estimating interval by the person-years in the relevant cell. Sum these to arrive at the total number of disease cases in the lifetime of the population (FNp).Calculate the estimated number of disease cases (Step 7.LRp) for the disease. This estimate is irrespective of exposure and calculated per individual aged i for each estimation interval j according to the equation:Estimate the lifetime risk in the population (u\u2009=\u2009upper limit and l\u2009=\u2009lower limit of both age and yearWhere Step 8.RR) for each disease-agent pairing from existing literature. This should be an effect measure which corresponds with the definition of exposure used in step 2. It is possible to use multiple effect measures corresponding to multiple levels of exposure, but for simplicity we have assumed there is just one level of exposure.Obtain an effect measure such as a relative risk estimate (Step 9.excess risk (LRx) for an individual exposed to the agent in the index year. Theoretically, this should be calculated as:Calculate the lifetime RR - 1) is the excess risk in the exposed relative to the unexposed and LRu is the baseline risk in the population in the absence of exposure. This assumes that the ratio between the excess risk of disease in the exposed and the risk in the unexposed at baseline equals the ratio of the lifetime risks, as LRx/LRu\u2009=\u2009(Re\u2013 Ru)/Ru\u2009=\u2009Rx/Ru, where RR\u2009=\u2009Re/Ru, Re is the risk of disease in the exposed, Ru is the risk in the unexposed and Rx is the excess risk due to the exposure [LRu is not usually available so LRp (lifetime risk in the whole population) is sometimes used. Because LRp is calculated for the whole population  it is higher than the baseline risk in the absence of exposure (LRu). For agent-disease combinations with low prevalence and/or low relative risk estimates LRu is very similar to LRp. However the difference can be significant for agent-disease combinations with high prevalence and/or high relative risks. We have therefore modified this equation (see where (exposure . This istion see  to arrivRR is greater than 1.0.This equation only holds under the assumption that Step 10.LRx) by an estimate of numbers exposed (Ne(t = 0)). Although it is a similar concept we have not called this the Attributable Number to avoid confusion with the terminology used in the attributable fraction approach.Estimate the Future Excess Number (FEN) of disease cases related to exposure that can be expected to occur over the lifetime of the exposed subcohort in the index year by multiplying the individual lifetime excess risks  of diseases in the exposed population which are due to exposure in the index year by dividing the FEN by the total expected number of disease cases in the population. The total expected number of diseases in the population is equal to the product of the lifetime risk in the population multiplied by the number of individuals in the cohort (exposed and unexposed).The key steps of our FEF approach are outlined below.The index year was 2012. The population of interest  was the 2012 working age population in Australia (18\u201365 years), divided into an initial two year age band (18\u201319 years) and subsequent five-year age bands, and stratified by sex.Ne(t = 2012)) was extrapolated from a national survey [The number of individuals who were occupationally exposed to asbestos in 2012 . The sum of all Dpt is the FNp.The age-specific future mesothelioma rates in each estimation interval were multiplied by the age-specific person-years at risk of the working age population in the same estimation interval and summed to estimate the total number of mesotheliomas in each estimation interval (LRp) was then calculated as FNp divided by Np(t = 2012).The sex-specific lifetime risk of disease  of mesothelioma due to occupational exposure in 2012 for the population aged 18\u201365 years in 2012, as well as the FEN and FEF which are the future excess number and fraction of mesotheliomas in the cohort from 2012 to 2094 which occur in those occupationally exposed to asbestos in 2012 and are attributed to occupational asbestos exposure.The formulae in Steps 9\u201311 were then used to calculate the excess lifetime risk  method. We used the same index year, 2012 working population, proportion exposed in 2012, and relative risk as in the example above . We predicted the AF of mesotheliomas using the formula:We used the same method as above (steps 3 to 6) to calculate the number of mesotheliomas occurring only in the year 2052. The attributable number was equal to the AF multiplied by the number of mesotheliomas in 2052.Table\u00a0Using the AF approach we estimated that there would be 240 mesotheliomas in men occurring in 2052 due to exposure in 2012 with an attributable fraction of 39\u00a0%. In women there would be 1 mesothelioma and the AF would be <1\u00a0%.We undertook sensitivity testing of the models in relation to the outputs in Table\u00a0LRx and subsequently a significant sensitivity change in FEN and FEF. These changes were more prominent in males, as females have a comparatively lower number exposed.In both sexes, when we varied the number of people exposed to asbestos (but not the future incident cases), a flow on effect resulted in a sensitive inverse relationship in the calculation of LRx, FEN, and FEF.When we changed the baseline population numbers used in the lifetime risk model while keeping the number of exposed the same, we saw an inverse relationship between population numbers and LRp, LRx, and FEN . However if the incidence rates of future cancers were altered the changes in the same three outcomes were proportional.Bender\u2019s model  may be mRR resulted in a significant change in LRx, FEN and FEF for both sexes. Changes were larger in females due to the comparative increase in the calculation of LRx.Changes in We have presented a novel approach to calculate the future effect of exposures occurring now. This method can be used for a range of different exposures and diseases for which exposure data are available for an index year and there are appropriate data for predicted future rates of disease. We have written an R program which is available on request for other researchers wishing to use this method.The FEF as calculated with this method is not directly comparable to the attributable risk percent as calculated with the attributable risk approach. As shown in Fig.\u00a0Only one other study has calculated the future burden of mesothelioma due to occupational exposure to asbestos - Hutchings et al. estimated that, by 2060, about 73\u00a0% of mesotheliomas will still be attributable to exposure to asbestos that is occurring at work beteween now and then . The majSeveral previous studies have estimated the proportion of current mesotheliomas due to past occupational exposure to asbestos. A UK study used actual mesothelioma counts and concluded that 97\u00a0% of male mesothelioma deaths and 82\u00a0% of female mesothelioma deaths in 2004 were due to past occupational or environmental exposure to asbestos . In the A major consideration in the use of the FEF method is the definition of the exposed population. In our example we used the prevalence of exposure in the index year. This is similar to the usual way of implementing the attributable fraction approach when a point prevalence of exposure in one historical year is used . An alteWhen using the FEF method it is necessary that the chosen RR matches the definition of exposure used for the estimation of exposure prevalence. In our example, the exposure information was limited to whether there was or was not exposure to asbestos in the index year and we had no information on how long exposure had occurred nor the intensity of that exposure although a level of intensity may be available for other agents. We used a point prevalence estimate of exposure in the index year and implicitly assumed that there was a normal distribution curve with regard to the length of exposure and the level of exposure. There would be people exposed in the index year who had very low exposure for a short period as well as people who had high exposure for a long period. We used a RR from the general working population which would also have included people with a range of durations and levels of exposure. Although this RR is related to \u201cever exposed\u201d it is appropriate to apply to the number of people exposed only in the index year, rather than also including those \u2018ever exposed\u2019 prior to but not in that year. Because the effect measure has a significant impact on the results it is important that the most appropriate and best justified measure is chosen. Meta-analyses and pooled analyses may be the best source for the effect measure if these are available.We did not include a latency period in our estimates of lifetime risk. Similarly to the assumption of previous exposure, we assumed that there was no need for a latent period as some people exposed in the index year had been exposed for a long time and may have developed mesothelioma soon after the index year. An advantage of the LR approach is that it avoids the need to account for latency, as it estimates disease appearing over a lifetime rather than in a specific year, so that timing is not relevant.Life tables were used for estimating the projected future person-years at risk. While mortality rates in the future may change, sensitivity analysis found that the FEN and FEF in the exposed were sensitive to changes in prevalence of exposure, population numbers, and relative risks, but much less sensitive to changes in mortality.A limitation of the FEF method is the accuracy of projections of future disease. The validity of a projection will vary by the disease outcome being modelled. In our example, high quality national cancer registry data were available for the previous 30\u00a0years, but this is not always the case for other diseases or other countries. The future number of cases depends on the change in size and age structure of the population (which is relatively easy to predict), as well as changes in the rates of disease (which are more difficult to predict) . We usedIn the FEF method, exposure can easily be varied to predict the effect of various control measures. For example, in the case of cigarette smoking it is possible to model the effect of policies such as reducing tar content of cigarettes, mandating plain packaging, or increasing cost. Because the estimations are based on changes to current exposure, they are readily understood by policy makers. In addition, the exposures are current, so are of more salience to policy makers than exposures occurring in the past .Researchers with more detailed exposure data may be able to match their exposure categories with several RRs. For example, if there are population data on the prevalence of exposure to cigarette smoking for the index year, it may be possible to use different RRs for the different categories of pack-years. This would allow prediction of the effect of reducing exposures  rather than completely eliminating exposures.Multiple exposures or outcomes can be accounted for using the product of complements method : In thisThe combined FEF can be multiplied by the number of expected outcomes in the population to obtain the combined FEN for one outcome and multiple exposures. Combined FENs for different outcomes can be summed to obtain the overall number of attributable outcomes.In conclusion, the future excess fraction method offers a different way of expressing the burden of disease which is readily understandable by the general public and by those with the ability to influence public health decisions.This manuscript describes a new method, and used publically available data sets for the example therefore no ethics approval was required.No individual or identifiable data were used in this manuscript and therefore no consent was required.All data sources are referenced.This manuscript does not report the results of a controlled health-care intervention and is not a trial."}
+{"text": "In mobile augmented/virtual reality (AR/VR), real-time 6-Degree of Freedom (DoF) motion tracking is essential for the registration between virtual scenes and the real world. However, due to the limited computational capacity of mobile terminals today, the latency between consecutive arriving poses would damage the user experience in mobile AR/VR. Thus, a visual-inertial based real-time motion tracking for mobile AR/VR is proposed in this paper. By means of high frequency and passive outputs from the inertial sensor, the real-time performance of arriving poses for mobile AR/VR is achieved. In addition, to alleviate the jitter phenomenon during the visual-inertial fusion, an adaptive filter framework is established to cope with different motion situations automatically, enabling the real-time 6-DoF motion tracking by balancing the jitter and latency. Besides, the robustness of the traditional visual-only based motion tracking is enhanced, giving rise to a better mobile AR/VR performance when motion blur is encountered. Finally, experiments are carried out to demonstrate the proposed method, and the results show that this work is capable of providing a smooth and robust 6-DoF motion tracking for mobile AR/VR in real-time. Mobile augmented reality (AR) and virtual reality (VR) are cutting technologies nowadays, which could change many aspects of our existing ways of life. The objective of mobile AR is to render the virtual object in a real world context with an accurate posture, thus the system needs to know where the user is and what the user is looking at by mobile computing ,2,3. MobCurrently, motion tracking methods for mobile AR/VR can be classified into three categories: marker-based ,9,10, moBy combining a monocular camera and an inertial sensor, sensor-fusion based 6-DoF motion tracking for mobile AR/VR in real-time is realized.To alleviate the jitter during the visual-inertial fusion, an adaptive filter framework is proposed to balance the jitter and latency phenomenon, enabling a real-time and smooth 6-DoF motion tracking for mobile AR/VR.Given the light weight and power consumption of mobile terminals, a markerless real-time motion tracking method for mobile AR/VR is proposed in this paper. To the best of our knowledge, this is the first paper to address the jitter and latency both for mobile AR and VR in visual-inertial fusion, especially for a higher frame-rate requirements in mobile VR. The main contributions of the paper are as follows: Before a description of the proposed motion tracking approach, we would like to introduce related works in As a typical markerless tracking method, simultaneous localization and mapping (SLAM) can perceive the 6-DoF pose of a moving camera within an unprepared environment, enabling mobile AR/VR applications without fiducial markers. Given the monocular camera-based visual-tracking for our sensor fusion, the publication of PTAM  is grounIn addition, to implement the SLAM technology for mobile AR/VR, real-time performance for camera tracking is crucial. For mobile AR, the frequency of arriving poses should reach the normal video frame-rate (25 Hz), which is usually defined as a standard regulation for a real-time performance. This standard is also considered in this paper for real-time performances other than in mobile VR. Because the real-time performance in mobile VR is superior to conventional scenarios, the arriving frequency of the 6-DoF motion tracking should reach 60 Hz or more. Only in this way, the participant within the VR environment can enjoy a comfortable experience. Otherwise, the delay phenomenon would cause the user disgust in VR environments. However, the direct SLAM method involves the photometric error of the entire image, performing a dense  or a semi-dense (high gradient areas) reconstruction while tracking the camera, and the GPU acceleration is needed for a real-time performance due to the computational cost involved . The comTo achieve real-time motion tracking by the feature-based method, Xu et al.  proposedHowever, these visual-only-based tracking approaches still suffer from poor feature or motion blur, making salient image features untractable. Moreover, to alleviate the dizziness phenomenon in a virtual environment, the frame-rate requirement for mobile VR is much higher than in mobile AR. Thus, the visual-only based tracking methods mentioned above are not appropriate for both mobile AR and VR. In order to improve the robustness and frame-rate of motion tracking for mobile AR/VR, other sensors should be applied to assist. As a primary motion capture sensor, the inertial sensor can provide high-frequency and passive measurements for pose estimation. Some researchers have summarized the 6-DoF motion tracking by visual-inertial fusion ,30.According to different fused frameworks, the sensor fusion solutions can be grouped into tightly coupled and loosely coupled. The tightly coupled approaches ,32 can pThe loosely coupled approaches consist of a standalone visual-based pose estimation module When IMU data (b)Calculate (c)Compute the propagated state covariance matrix according to the Equation (16).Therefore, with the discretized error state propagation and error noise covariance matrices, the state can be propagated as follows: According to the visual-based tracking method discussed in Equation (18) can be linearized as follows:At the same time, the orientation of camera is derived by the error quaternion. The rotation from camera frame to world frame yielded from visual-based tracking is Therefore, the error measurement of orientation is acquired:Finally, the measurements are stacked next:According to the above process, the measurement update can be realized. And the total fusion process is summarized as Algorithm 1.Algorithm 1. Visual-inertial motion tracking process.01.\u2003Initialize for02.\u2003Time update:03.\u2003{ 04.\u2003\u2003\u2003Compute 05.\u2003\u2003\u2003Compute if Pose from visual-based arrived06.\u2003\u2003\u2003\u2003\u2003Measurement update:07.\u2003\u2003\u2003\u2003\u2003\u2003{08.\u2003\u2003\u2003\u2003\u2003\u2003\u2003Compute the residual: 09.\u2003\u2003\u2003\u2003\u2003\u2003\u2003Compute the correction: 10.\u2003\u2003\u2003\u2003\u2003\u2003\u2003Use end11.\u2003\u2003\u2003\u2003\u2003end }12.\u2003With the aforementioned visual-inertial fusion, the frequency of 6-DoF pose estimation can be improved to satisfy the real-time performance for mobile AR/VR. However, due to the fact output poses derived from two heterogeneous sensors have different precisions and frequencies, this results in jitter phenomena during sensor fusion. In order to alleviate the jitter phenomenon for mobile AR/VR, an adaptive filter framework is proposed to smooth the jitter phenomenon without latency in following sections.In 6-DoF posture, the quaternion is used to represent 3D rotation, and the unit quaternion ual zero . This exGiven the high-frequency posture from the visual-inertial fusion, the change between continuous arriving orientations is considered to be small enough. Thus, a linear quaternion interpolation filter is applied in the paper. With the help of Equation (24), the quaternion Given the existed monocular camera and inertial sensor, the frame-rate of arriving images and IMU measurements is constant, leading to a constant time interval between adjacent arriving poses from the visual-inertial fusion. Thus, the location changes of adjacent postures are applied to distinguish different motion situations during the real-time 6-DoF motion tracking. For the Then, in order to evaluate different motion situations generally, a normalized distance If the normalized distance Ideally, the adaptive filter framework should be continuous enough under different motion situations, as the green dotted line shown in (a)Jitter-filtering: When the mobile AR/VR system is almost kept static or moves slowly, the change between adjacent poses can be almost ignored. Thus, the jitter phenomenon plays a dominant role at this scenario, while the latency phenomenon for mobile AR/VR can be neglected for users\u2019 perception, and this stage is defined as jitter-filtering in this paper. At the same time, the real-time distances between successive arriving poses are small enough at this stage, meaning that the normalized distance (b)Moderation-filtering: When the motion situation of the mobile AR/VR system is under moderate motion situations, this stage is defined as moderation-filtering in our work with a moderate distance (c)Latency-filtering: When the mobile AR/VR system is encountered rapid motion, the change between adjacent arriving poses is drastic. The user would perceive the latency obvious when the pose cannot arrive timely. Thus, latency phenomenon plays a dominant role at this scenario for mobile AR/VR, while the jitter phenomenon can be neglected within a fast motion situation. This stage is defined as latency-filtering. Moreover, the real-time distances between successive arriving poses are relative large, meaning that the normalized distance The segmented functions According to the descriptions above, the normalized distance between adjacent postures can be applied to feed the proposed adaptive filter framework. Then, the corresponding filter stage is determined to address different motion situations. The flow diagram of the proposed adaptive filter framework is depicted in To address the jitter and latency phenomenon effectively, quadratic functions are used in the jitter and latency stages to address extreme motion conditions smoothly. Moreover, in order to simplify the computing complexity on mobile terminals, a linear function is defined as the moderation-filtering to bridge the jitter-filtering and latency-filtering stages. The aim of these segmented framework is to approximate an ideal continuous framework, achieving a straightforward and suboptimal solution to balance the jitter and latency for mobile AR/VR.Thus, given the jitter-filtering stage for example, the biquadratic function Then, with another segmented point Based on the segmented filter functions, Equations (29) and (30), a signum function (Equation (31)) is used to define a unified filter framework for different motion situations of the mobile deviceThen, combining Equations (29)\u2013(31), the unified adaptive filter framework In order to evaluate the performance of the proposed real-time motion tracking for mobile AR/VR, a qualitative experiment is carried out. The mobile system is mounted on an operator and moved around the table. The typical images and the IMU measurements during the tracking process are depicted in An enlarged image of the visual-inertial trajectory is depicted in In addition, another quantitative experiment is carried out to evaluate the proposed method further. A common target chessboard pattern is placed in a natural desktop scene, as shown in Then, the multi-sensor system is carried out back and forth around the desktop with the target pattern in the view, the total length of the ground truth trajectory derived from the target pattern is 17.28 m . More detailed illustrations of the error between two computed positions (translation and rotation) can be found in Given the proposed real-time 6-DoF pose estimation in mobile devices, the subsequent transformations between the camera frame and the world frame To verify the proposed real-time motion tracking method for mobile AR, experiments are carried out on a desktop. The original real natural scene is shown in VR allows different ways to interact between the user and virtual world. Thus, the real-time tracking of the user\u2019s postures and actions play an important role for a VR system. Moreover, the frame rate for motion tracking in VR puts forward a higher requirement than AR. Otherwise, the latency phenomena would make the users sick. With the proposed adaptive visual-inertial fusion method, a smooth 6-DoF motion tracking for mobile VR can be achieved in real-time.As shown in Real-time motion tracking is a crucial issue for any AR/VR systems, and there are different methods to realize the tracking performance. In marker-based motion tracking, the system needs to detect and identify the marker, and then calculate the relative pose of the observer. However, the marker need to be stuck on or near the object of interest in advance, and sometimes it is not possible to attach the marker to some certain circumstances. In addition, the marker should remain visible during the mobile AR/VR process, and the tracking is inclined to become corrupt due to the marker being out of view. Similarly, the model-based method is another typical motion tracking method for mobile AR/VR. This tracking method uses a prior model of the environment to be tracked. Usually, this prior knowledge consists of 3D models or 2D templates of the real scene. Nevertheless, the extraction of a robust tracked prior model is not always available, especially in some unorganized natural scenes. With the cost of computer vision decreasing rapidly, the visual-based markerless approach turns out to be a more attractive alternative to perform motion tracking. This method depends on natural features instead of artificial markers or prior models, resulting in a more flexible and effective tracking performance in unprepared environments. However, this markerless tracking method is inclined to collapse when encountering motion blur and fast motion. Moreover, the real-time performance for mobile AR/VR is beyond the traditional video frame-rate, making the visual-based markerless tracking insufficient.Therefore, the proposed visual-inertial tracking method can work well for mobile AR/VR in an unprepared environment, due to a stronger adaptability than either marker-based or model-based methods. Moreover, with high-frequency measurements from an IMU, the frequency of the motion tracking can be improved compared to the traditional visual-based markerless tracking. Besides, with the help of the temporary IMU integration, the tracking loss phenomenon because of blurred images for mobile AR/VR can be alleviated.In addition, due to different frequencies of the monocular and IMU measurements, several predicted poses from IMU exist between every adjacent image during the visual-inertial fusion. If the 6-DoF pose from visual-inertial fusion feeds the mobile AR/VR directly, real-time performance can be achieved at the cost of the jitter derived from the IMU prediction. The jitter phenomenon would damage the user experience in mobile AR/VR, thus an adaptive filter framework is proposed in the paper to balance the jitter and latency. It can adjust the filter parameters according to different motion situations, and balance the jitter and latency automatically for mobile AR/VR. For example, if the mobile system is kept stationary, the jitter phenomenon is more obvious for the user than the latency, thus the filter framework can be adjusted to a jitter-filtering scheme by alleviating the jitter phenomenon for mobile AR/VR. Otherwise, another filter stage would be selected when different motion situations are encountered. Thus, a real-time motion tracking by balancing the jitter and latency for mobile AR/VR is obtained from the proposed adaptive filter framework.Currently, the prototype system of the proposed method is based on an existing smartphone. Thus, the system is more suitable to be installed in a VR/AR headset. Along with the improvement of industrial design and mobile computing capacity in future, this system could be conveniently worn on the user\u2019s body for stronger adaptability.What is more, in order to improve the tracking performance for mobile AR/VR, an external sensor module containing a wide-angle monocular camera and an inertial sensor is applied in this work. Given similar sensors embedded in current mobile devices, the real-time tracking performance can also carried out within the mobile terminal alone, but it is not robust enough to the external sensor module due to the limiting FOV of the perspective camera.It is worth noting that the proposed adaptive filter framework is a universal approach for visual-inertial fusion, or some other heterogeneous sensor fusion. Given different configurations of the visual-inertial system, the detailed values of the adaptive parameters should be adjusted slightly, which can be derived from quantitative contrast tests. Moreover, this process is also considered as a parameter calibration for a specific multi-sensor system, and it can provide long-term usage once the corresponding adaptive filter framework is established.This paper proposes a sensor-fusion based real-time motion tracking approach for mobile AR/VR, which is more powerful than the traditional visual-based markerless tracking ones. Given the real-time and robust posture arriving for mobile AR/VR, a monocular visual-inertial fusion is established in the paper, which can effectively improve the tracking robustness and enhance frame-rate with the help of an inertial sensor. In addition, in order to alleviate the jitter phenomenon within the heterogeneous sensor fusion, an adaptive filter framework is proposed which can adjust the filter weight according to different motion situations, achieving a real-time and smooth motion tracking both for mobile AR and mobile VR. Finally, experiments are carried out in different AR/VR circumstances, the results indicate the robustness and validity of our proposed method.In this paper, a segmented adaptive framework is defined for a simplifying calculation, and a suboptimal performance is obtained for real-time motion tracking for mobile AR/VR. However, in the tracking performance unstable transitions may exist at the segmented point, thus future work will be done dealing with a more continuous filtering framework for visual-inertial fusion."}
+{"text": "Sixty-day-old plants grown under greenhouse conditions were sprayed with different rates  of the commercial glyphosate formulated salt Factor\u00ae 540. Evaluations were performed at 0, 6, 24, 48, and 72 h after herbicide exposure. We established that the herbicide decreases chlorophyll, carotenoid and plastoquinone contents, and promotes changes in the photosynthetic apparatus leading to decreased photochemistry which results in hydrogen peroxide (H2O2) accumulation. H2O2 accumulation triggers proline production which can be associated with oxidative protection, NADP+ recovery and shikimate pathway stimulation. Ascorbate peroxidase and glutathione peroxidase appeared to be the main peroxidases involved in the H2O2 scavenging. In addition to promoting decreases of the activity of the antioxidant enzymes, the herbicide induced decreases in ascorbate pool. For the first time, a glyphosate-based herbicide mode of action interconnecting its effects on shikimate pathway, photosynthetic process and oxidative events in plants were presented.We studied the physiological mechanisms involved in the deleterious effects of a glyphosate-based herbicide (Factor N-(phosphonomethyl)glycine)] is the most broadly used herbicide worldwide since the introduction of glyphosate-resistant (GR) plants (Glyphosate , 0.2 g of frozen tissue were ground in liquid nitrogen in a mortar and pestle and homogenized with 5 ml of 6.5% (w/v) m-phosphoric acid containing 1 mM NaEDTA.To study the antioxidant enzymes, 0.1 g of leaves were macerated in 800 \u03bcl of an extraction buffer containing 100 mM potassium buffer (pH 7.8), 100 mM EDTA, 1 mM F tests for the within-subject effects were valid. In cases of invalid F, the Greenhouse\u2013Geisser test was used to estimate epsilon (\ud835\udf00). Contrast analysis was used when there were significant differences in the variables between treatments . Results were submitted to normality (Shapiro\u2013Wilk) and homogeneity (Bartlett) tests and then statistically evaluated. MANOVA univariate repeated measures, with Time as the within-subject factor and the herbicide concentrations as the main effects, were used to analyze differences in the variables studied during exposure to the treatments. Glyphosate, Time, and the interaction between glyphosate and time were included within the model. The sphericity of the data was tested by the Mauchly\u2019s criteria to determine whether the univariate P > 0.001; Figure 1). The carotenoid concentration was greater in herbicide-treated plants at 6 h for all applied doses ; then, carotenoid concentration was decreased in plants exposed for at least 24 h to herbicide concentrations (P < 0.0001). The stomatal conductance was decreased in herbicide-exposed plants for all the treatment times . Similar effects were observed on the ETRmax, the Ik, and the qP, which were significantly reduced in treated plants . However, for the first evaluation (6 h), ETRmax, Ik, and qP were not decreased in plants treated with 1.4 kg a.e ha-1 . The UQFrel increased in all treated plants . Concomitantly, the NPQ decreased in plants exposed for more than 24 h to the herbicide . The maximal PSII photochemical efficiency (FV/FM) was decreased in herbicide-treated plants (P < 0.0001). Decreased FV/FM was seen in plants treated with 1.4 kg a.e ha-1 only after 72 h of herbicide exposure . Plants exposed to 2.1 kg a.e ha-1 showed decreases in FV/FM at 48 and 72 h of exposure (P < 0.001). In contrast, in all the evaluations, plants exposed to 2.8 kg a.e ha-1 showed decreased FV/FM .Total chlorophyll and plastoquinone concentrations were decreased in leaves of plants by herbicide exposure and by treatment time . In plants exposed to 2.1 and 2.8 kg a.e ha-1, an important shikimate accumulation was found after 72 h of herbicide-treatment (P < 0.0001).The shikimate and proline concentrations in leaves of herbicide-treated plants were always higher than the control , and greatly increased in these plants after 72 h (P < 0.01). Similarly, lipid peroxidation (MDA concentration) was always higher in plants exposed to the herbicide . In all plants, MDA content slightly increased at 24 h (P > 0.05). However, in plants treated with herbicide, a pronounced increase in MDA concentration was observed at 72 h (P < 0.05).Compared to control, HP < 0.05; Figure 4). We found that: (1) SOD and APX activities were higher in herbicide-treated plants up to 24 h (P < 0.0001), and then were reduced for the following exposure times (P < 0.0001); (2) CAT activity was always higher in plants treated with herbicide (P < 0.0001); (3) similar to SOD and APX, GPX activity was also reduced in herbicide treated plants at 48 and 72 h of exposure (P < 0.0001); (4) GR activity was higher in herbicide treated plants up to 48 h of exposure (P < 0.05). Regarding ascorbate pool  we found that, in relation to control: (1) total ascorbate concentrations (AsA + DHA) were higher in herbicide-treated plants up to 24 h of exposure, and then were reduced for the following exposure times (P < 0.0001); (2) the concentrations of the ascorbate reduced form (AsA) were greater in control plants up to 24 h, did not differ between treatments at 48 h and was increased in herbicide treated plants for 72 h (P < 0.0001); (3) the concentrations of oxidized form of ascorbate (DHA) were greater in herbicide treated plants up to 24 h and were reduced for the following exposure duration (P < 0.0001); (4) the AsA/DHA ratio was lower in 6 and 24 h treated plants compared to control, but was higher for the following treatment times (P < 0.0001).Plants treated with herbicide showed higher activity of all evaluated antioxidant enzymes after 6 h in relation to control  affected by exposure to a glyphosate-based herbicide greater than 24 h (48 and 72 h). The various steps of this model are identified throughout the text as Figure 6, #1\u201319.In this study, for the first time, a wide investigation of the impacts of glyphosate-based herbicide on several physiological processes was done. We demonstrated that this type of herbicide affected not only the shikimate pathway, but several physiological processes in willow plants as previously reported by Figure 3) and also reported by Figure 6, #1), the glyphosate-based herbicide may prevent the biosynthesis of several secondary plant compounds . It is known that UQFrel is an indicator of closed PSII reaction centers (RCs) present under continuous illumination  and/or less effective PSI. This may, together with the decrease in the Ik (for doses >1.4 kg a.e ha-1), have contributed to the observed lower ETR in treated plants . Indeed, a lower ability for PSII to deliver electrons to the electron transport chain, leading to PSII saturation at low irradiance, may explain the observed decrease in photosynthesis observed here and in previous studies  could be related to the concomitant increase in H2O2 concentration, since it is known that ROS presence can induce carotenogenic responses (FV/FM) is a proxy of the PSII integrity  indicates that the glyphosate-based herbicide had no effect on the PSII integrity up to 24 h of exposure. Similarly, negative effects of glyphosate in FV/FM of Lolium perenne plants were only observed after 3 days of exposure (1O2) produced by photosynthesis or by enzymatic conversion of other ROS to oxygen singlets . These plants also showed higher lipid peroxidation  indicating oxidative damages . This can be a consequence of the inhibition of the shikimate pathway leading to decreased PQ concentration, since plastoquinone is a co-factor of the phytoene desaturase and \u03b6-carotene desaturase, enzymes involved in the carotenoid biosynthesis pathway . In addition, the decrease in the non-photochemical energy dissipation (NPQ) [one of the mechanisms by which plants can dissipate excess light energy absorbed by PSII light-harvesting complexes in order to minimize the generation of the highly reactive 1O2 responsible for oxidative damages  can be related to the decreased biosynthesis of carotenoids. \u03b2-carotene is known to be the precursor of zeaxanthin, the first compound of xanthophyll cycle (FV/FM) . These decreases in the photosynthetic activity (shown by the decrease in ETR) and in the NPQ may also have contributed to a higher production of ROS .The observed increase in the carotenoid concentration after 6 h in the herbicide-treated plants , increased lipid peroxidation has been previously observed in glyphosate-exposed plants and was related to increased H2O2 content in plants (2O2) has been shown to affect the integrity of the thylakoid membranes . Glyphosate was demonstrated to cause depletion of photosynthetic proteins leading to losses of photosynthetic capacity in plants . Carbon assimilation (and therefore photosynthesis) can also be negatively affected by the decreased stomatal conductance (gs)  in presence of herbicides  and Lolium perenne plants exposed to glyphosate . The observed ETR reduction could also be due to the alteration of the integrity of PSII (lower FV/FM) . In addition, the decrease in total chlorophyll concentration in presence of the glyphosate-based herbicide may be responsible for a lower light interception and thus, the noted lower electron transport rate . Decreased chlorophyll contents when plants are exposed to herbicide application have been demonstrated previously and have been attributed to an increase chlorophyll degradation or to a decrease in chlorophyll synthesis , we investigated the activity of antioxidant system in treated plants. Increases in proline synthesis is a common protective-response of plants to stress conditions . As we also observed, proline biosynthesis is commonly stimulated by increased cellular-ROS concentration conditions . A special function of proline in preventing oxidative damage and enhancing tolerance from abiotic oxidative stress has been proposed recently (D-aravino-heptulosonate-7-phosphate synthase) +/NADPH ratio which stimulates proline biosynthesis, justifying its accumulation during stress . Supporting this hypothesis, + pool. As mentioned previously, under stress conditions, proline is mainly produced from glutamate , a decrease in ALA biosynthesis may be obtained, therefore contributing to the decreased chlorophyll concentration observed in treated plants . As suggested by Figure 6, #15).In order to better understand the processes involved in Hnditions . It is inditions . In the nditions . Althougnditions . Thereforecently  and prolrecently . Due to ynthase) , the herynthase) . As a reby NADPH . During  pathway . The oxig stress . Therefolutamate . Glutamalutamate . TherefoFigure 4) can be related to the increased H2O2 and decreased ETR also observed in these plants. SOD is the first defense enzyme against oxidative stress  can therefore contribute to the herbicide-deleterious effects on photosynthesis in willow plants. We also demonstrated the key role of APX and GPX to prevent H2O2 accumulation in willow plants since: (1) decreased activities of both enzymes were related to increased H2O2 concentration in leaves; (2) even if treated plants shown higher CAT activity, it was not able to prevent H2O2 accumulation. The importance of APX and GR in avoiding oxidative stress has also been observed in metal(loid) treated plants .Even though treated plants showed increased activities of antioxidant enzymes after 6 h exposure, they were not able to prevent both peroxide accumulation and lipid peroxidation, indicating a clear deleterious effect of the glyphosate-based herbicide through oxidative burst. Moreover, the strong inhibition of SOD, APX, and GPX activities observed in plants exposed to herbicide after 48 h . It is known that ascorbate concentration and ETR are closely linked, as the light-dependent stimulation of ascorbate biosynthesis requires photosynthetic electron transport activity . Low ascorbate pool favors the increase in both ROS  and abscisic acid (ABA), leading to an increase in signal transduction through ROS-mediated and ABA-dependent signaling cascades .In addition to being the substrate for APX, ascorbate is an important antioxidant component of the cellular redox potential and its activity is linked to ascorbate-glutathione metabolic cycle . In the activity . Thus, rcascades . Among ocascades . This me\u00ae 540) on willow plants is the shikimate pathway. We demonstrated, for the first time, that on top of the alteration of this primary target site, this herbicide induces a series of interconnected events that leads to decreased photosynthetic activity in willow plants. Furthermore, we showed that the herbicide-deleterious effects on photosynthesis are strongly related to herbicide-induced oxidative stress, and that reduction of photosynthesis may amplify the observed effect by inducing ROS production. Our results evidenced that as for photosynthesis-target herbicides, which trigger ROS production and oxidative stress, glyphosate herbicidal effect may be related to induction of ROS accumulation. The inhibition of shikimate pathway may induce changes in redox status with important consequences in leaf metabolism, mainly on photosynthesis. Glyphosate tolerance in plants, for instance, have been related to the ability of plants to deal with ROS accumulation through the activation of antioxidant systems (As expected, the primary target site of the studied glyphosate-based-herbicide (Factor systems . However systems , 2012, gMG, SL performed the experiments; MG, MLa, and PJ designed the experiments; MG and PJ wrote the paper; LH-E and MLu gave technical support and conceptual advice.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the As\u2010resistant thermophile Thermus thermophilus HB27, genes encoding homologues of these proteins are interspersed in the chromosome. In this article, we show that two adjacent genes, TtsmtB, encoding an ArsR/SmtB transcriptional repressor and, TTC0354, encoding a Zn2+/Cd2+\u2010dependent membrane ATPase are involved in As resistance; differently from characterized ars operons, the two genes are transcribed from dedicated promoters upstream of their respective genes, whose expression is differentially regulated at transcriptional level. Mutants defective in TtsmtB or TTC0354 are more sensitive to As than the wild type, proving their role in arsenic resistance. Recombinant dimeric TtSmtB binds in\u00a0vitro to both promoters, but its binding capability decreases upon interaction with arsenate and, less efficiently, with arsenite. In vivo and in\u00a0vitro experiments also demonstrate that the arsenate reductase (TtArsC) is subjected to regulation by TtSmtB. We propose a model for the regulation of As resistance in T.\u00a0thermophilus in which TtSmtB is the arsenate sensor responsible for the induction of TtArsC which generates arsenite exported by TTC0354 efflux protein to detoxify cells.Arsenic resistance is commonly clustered in  Arsenic (As) is an ubiquitous metalloid naturally present in soil, water and air that adversely affects human and animal health. Because of its abundance and toxicity, monitoring arsenic concentration in the environment and in several foodstuffs used for human consumption is very important.et\u00a0al., et\u00a0al., et\u00a0al., Under reducing conditions, the highly toxic trivalent arsenite, As(III), is the more abundant form, whereas in oxygenated environments, the less\u2010toxic and more stable pentavalent arsenate, As(V), dominates. Arsenite enters the cell through aquaglyceroporins; as it has a high affinity for sulfur, it exerts its toxicity through binding to dithiols in proteins, in glutathione (GSH) and in lipoic acid contributing to protein/enzyme inactivation  to As(III) by arsenate reductase and further extrusion of As(III) by a membrane protein whose expression is regulated by ArsR, a trans\u2010acting repressor of the ArsR/SmtB family  have been described in bacteria, with ArsR/SmtB being the most extensively studied and named after its founding members, et\u00a0al., et\u00a0al., With all of the activities above described, microbes actively participate in the geochemical cycling of arsenic in the environment, promoting or inhibiting arsenic release  in the As\u2010resistance mechanism and hypothesized that arsenic\u2010dependent induction of TtarsC could be mediated by factors such as ArsR/SmtB transcriptional regulators , encoding a putative ArsR/SmtB transcriptional repressor, and TTC0354, encoding a recently described membrane Zn2+/Cd2+ ATPase  with a HTH DNA\u2010binding motif and a conserved ELCVCD metal\u2010binding box located in the \u03b1\u20103/\u03b1\u20104 helices and in the \u03b1\u20104 helix respectively  revealed an organization in six \u03b1\u2010helices and one \u03b2\u2010sheet comparable to that found in ArsR/SmtB regulators  with a heavy\u2010metal\u2010associated (HMA) motif displaying ATPase activity stimulated by cations, whose role in metal tolerance is not clear  and TTC0354 (4\u2010fold and 3\u2010fold).To analyse whether the expression TtsmtB and TTC0354, we first verified whether the two genes were transcribed from independent promoters  matching the consensus of the ArsR/SmtB\u2010binding site  when cells were treated with arsenic, suggesting low expression levels under basal conditions. Furthermore, consensus\u2010like promoter boxes were not found at the appropriate upstream distance from this TSS probably due to the fact that this promoter is intragenic  encoding the putative small subunit of pyridoxal 5\u2032\u2010phosphate (PLP) synthase, an enzyme for de novo biosynthesis of PLP coenzyme, with no obvious functional relation to As resistance.On the other hand, a TSS could be also identified for nic Fig.\u00a0C; in facTtSmtB and TTC0354 in the arsenic resistance, the genes were inactivated by insertion of a gene cassette encoding a thermostable resistance to kanamycin in TtsmtB  plasmid to generate a His\u2010tagged fusion protein that was expressed in E.\u00a0coli BL21\u2010CodonPlus(DE3)\u2010RIL and purified to homogeneity.To better characterize the regulatory role of Far\u2010UV circular dichroism spectra showed a typical circular dichrogram of a helical protein with negative maxima at 208 and 222\u00a0nm and one positive peak at 195\u00a0nm Fig.\u00a0. FurtherTtSmtB is a dimer with three cysteine residues  per subunit, we analysed whether they were involved in intramolecular disulfide bridges or not by treating the protein with iodoacetamide, followed by trypsin (and chymotrypsin) digestion, and MALDI\u2010TOF mass spectrometry peptide analysis (70.5% sequence coverage). The mass of peptides containing the cysteines was increased of 57\u00a0Da indicating that such residues are not involved in disulfide bridges and\u00a0suggesting that they are likely involved in metal coordination.As TtSmtB recognizes the identified regulatory regions, we performed EMSAs. We tested the following: (i) TtsmtB promoter to verify autoregulation; (ii) TTC0354 promoter, the only containing a palindromic sequence matching the consensus of the ArsR/SmtB\u2010binding site in other organisms; (iii) the region upstream of TtarsC (TTC1502), to examine whether arsenate reductase could be a regulatory target of TtSmtB  as well as its own promoter (TtsmtBp)  of unspecific DNA. Titration with increasing concentrations of TtSmtB indicated that the protein binds to this region in a concentration\u2010dependent manner; at saturating concentrations, the protein determined a shift with low mobility, suggesting either that other binding sites with different affinities could exist in the DNA sequence analysed or that multiple dimers could associate with the cognate DNA  of 1.4\u00a0\u00b1\u00a00.07\u00a0\u03bcM, suggesting that DNA binding is cooperative, as reported for other characterized SmtB family members  and lower specificity  Fig.\u00a0. We firsity Fig.\u00a0.TtSmtB\u2010binding site on the TTC0354 promoter, DNase I footprinting was performed using a 143\u00a0bp DNA including sequences \u2212100 to +42 from the mapped transcription start site. As shown in Fig.\u00a0TtSmtB binding at this promoter could hamper RNA polymerase binding.To map the TtSmtB binds arsenic in\u00a0vitro and whether the interaction modifies its DNA\u2010binding ability.The subsequent task was to determine whether TtSmtB in the presence or absence of increasing concentrations of arsenate and arsenite. The results in Fig.\u00a0in\u00a0vitro As determines changes in TtSmtB secondary structure. In more detail, the values of the molar ellipticity per residue at 208\u00a0nm, plotted against arsenate and arsenite concentrations, gave binding curves with an apparent equilibrium dissociation constant Kd of approximately 0.06 and 0.25\u00a0mM respectively (not shown). These values so diverse suggest that arsenate and arsenite cause structural rearrangements with different effect on TtSmtB activity.Circular dichroism was employed to investigate the secondary structure of TtSmtB DNA\u2010binding ability, we performed EMSAs in which DNA\u2010TtSmtB complex formation was tested after pre\u2010incubation of the protein with arsenate and arsenite each at 50\u2010fold and 100\u2010fold molar excess. The results reported in Fig.\u00a0TtSmtB hampers binding to 0354p although at different concentrations; in fact, in the presence of arsenate, complex 2 is disrupted at lower concentration than when arsenite is used , an enzyme capable of reducing pentavalent arsenate to trivalent arsenite, was characterized \u2010binding site at the N\u2010terminus end outside the metal\u2010binding box  was grown aerobically at 70\u00a0\u00b0C in TM medium without or with 8\u00a0mM NaAsO2  or 12\u00a0mM KH2AsO4  as described . Miller,  medium aT.\u00a0thermophilus HB27 and \u0394smtB::kat were grown up to 0.5 OD600\u00a0nm and harvested at 0 and 45\u00a0min after the addition of 8\u00a0mM NaAsO2 or 12\u00a0mM KH2AsO4 and immediately spun down, and pellets were kept at \u221280\u00a0\u00b0C.For qRT\u2010PCR experiments, 50\u00a0ml cultures of 600\u00a0=\u00a00.08 in 24\u2010well plates  in TM medium with increasing concentrations of arsenic (0\u201350\u00a0mM arsenate or 0\u201345\u00a0mM arsenite) as described in the Manual of Antimicrobial Susceptibility Testing , exponentially growing cultures were diluted to ODg Coyle,  and growStrain genotypes and sources are summarized in Table\u00a0Thermus thermophilus HB27 genomic DNA was prepared following reported procedures  in the \u0394smtB strain, qRT\u2010PCRs were performed using the StepONEPlus Real\u2010Time PCR system  and the SYBR Select Master Mix kit (Applied Biosystems). Total RNA extracted from T.\u00a0thermophilus HB27 and \u0394smtB cells was digested with TURBO DNase, RNase\u2010free  and the 16S reverse primer (16Sthrv), used as internal control for normalization. The specific cDNAs synthesized were amplified using the following primers: smtBrealfw and 0353rv; 0354realfw and 0354realrv; arsCrealfw and arsCrealrv; or 16Sthfw and 16Sthrv , and induction folds were calculated by the comparative Ct method. The relative expression ratio of the target gene,  Pfaffl, .TtsmtB and TTC0354, total RNA extracted from T.\u00a0thermophilus HB27 cells was subjected to primer extension analysis as described  rv 2 and 0354rv  and the primers containing the NdeI (smtBfw) and HindIII (smtBrv) sites at the 5\u2032 and 3\u2032 ends respectively. Amplified fragments were purified, digested and cloned into NdeI/HindIII\u2010digested pET28b(+) vector (Novagen). For protein expression, E.\u00a0coli BL21\u2010CodonPlus (DE3)\u2010RIL cells transformed with pET28/TtsmtB were grown in LB medium containing kanamycin (50\u00a0\u03bcg\u00a0ml\u22121), chloramphenicol (33\u00a0\u03bcg\u00a0ml\u22121) and 0.25\u00a0mM ZnSO4. When the culture reached 0.7 OD600\u00a0nm, protein expression was induced by the addition of 0.5\u00a0mM isopropyl\u20101\u2010thio\u2010\u03b2\u2010D\u2010galactopyranoside (IPTG) and the bacterial culture was grown for 16\u00a0h at 22\u00a0\u00b0C. Cells were harvested and lysed by sonication in 50\u00a0mM Tris\u2013HCl, pH 7, as described before  was added at each step. The histidine tag was removed using 10 U of thrombin  for 1\u00a0mg of His\u2010TtSmtB yielding TtSmtB, a protein of 13.5\u00a0kDa. The purified proteins were stored in aliquots at \u221220\u00a0\u00b0C.The gene encoding TtSmtB, the native molecular mass was determined by loading the purified protein to an analytical Superdex PC75 column (0.3\u00a0\u00d7\u00a03.2\u00a0cm) in 50\u00a0mM Tris\u2013HCl, pH 7, and 0.2\u00a0M NaCl. The column was calibrated using a set of gel filtration markers , including\u00a0bovine serum albumin (67.0\u00a0kDa), ovalbumin (43.0\u00a0kDa), chymotrypsinogen A (25.0\u00a0kDa) and RNase A (13.7\u00a0kDa).To determine the quaternary structure of TtSmtB carbamidomethylation with iodoacetamide, and trypsin and chymotrypsin digestion to detect carbamidomethyl\u2010cysteine\u2010containing peptides as described  were fitted in Prism 6.0 using the equation\u00a0for one binding site to determine the dissociation constants.Analysis of secondary structure was performed by registering far\u2010UV circular dichroism spectra in a Jasco J\u2010815 CD spectrometer, equipped with a Peltier\u2010type temperature control system (PTC\u2010423S/15 model) using protein concentration of about 3\u00a0\u03bcM in a 25\u00a0mM Na\u2010phosphate, pH 7.0 buffer. CD spectra were recorded as described  were performed. The promoter regions were amplified by PCR using specific primer pairs (one radiolabelled with \u03b332P dATP and polynucleotide kinase): 0353pr(ext)fw and 0353pr(ext)rv2, 0354footprint fw and 0354footprint rv, ArsCprfw and ArsCprrv ; the complexes were separated, and the gels were processed and analysed by phosphor imaging using Quantity One software (Bio\u2010Rad) as already described .To determine whether arsenite and arsenate were ligands for TTC0354 was produced by PCR using a combination of 0354footprint fw and 0354footprint rv; the latter was 5\u2032 end labelled with T4 polynucleotide kinase and [\u03b3\u201032P] ATP. The labelled PCR product of 143\u00a0bp (about 40\u00a0nM) was incubated with 4\u00a0\u03bcg of pure TtSmtB in binding buffer and digested with three units of DNase I (Roche) for 1\u00a0min at 37\u00a0\u00b0C. Subsequent steps were performed as described  cassette by double homologous recombination. Two regions upstream and downstream of TtsmtB (arm UP and arm DW) were amplified by PCR using T.\u00a0thermophilus HB27 genomic DNA as template. For arm UP, the forward primer (UP fw SmtB EcoRI) and the reverse primer (New UP rv SmtB XbaI) contained EcoRI and XbaI sites respectively (Table\u00a0XbaI) and the reverse primer (DW rv SmtB HindIII) contained XbaI and HindIII sites. The resulting products (909\u00a0bp arm UP and 1014\u00a0bp arm DW) were digested, purified, ligated (in 1:1 molar ratio) and cloned into pUC19, giving the pUC19\u0394smtB vector. The kat cassette, extracted from pUC19\u2010kat after XbaI digestion, was inserted at the XbaI site of pUC19\u0394smtB. The resulting vector was named pUC19\u0394smtB::kat. The orientation of kat cassette was confirmed by restriction analysis. The pUC19\u0394smtB::kat plasmid was HindIII\u2010digested and used in linear form to transform T.\u00a0thermophilus HB27 as described above.To obtain a ly Table\u00a0. For armTtsmtB gene was verified by\u00a0PCR on the genomic DNA of the transformants; three\u00a0primer sets (Table\u00a00351promfw/0351promrv) amplified a region in both deleted and wild\u2010type strains; another one (0352fw/0353rv) amplified a region only in the wild\u2010type strain; the last pair (smtBfw/smtBrv) amplified a fragment of 1125\u00a0bp corresponding to the kat gene in the mutant strain compared to the TtsmtB gene of 372\u00a0bp in the wild type. The kat insertion was further confirmed by DNA sequencing.The replacement of the ts Table\u00a0 were useTTC0354 mutant was obtained by following a single\u2010recombination strategy. For this, a 1407\u00a0bp internal fragment of the TTC0354 gene was amplified with primers 0354Eco and 0354Hind and further digested with EcoRI and HindIII restriction enzymes, which targets were included in the primer's sequence  Multiple sequence alignment by Clustal W of TtSmtB with SmtB/ArsR members. Sequences of the protein used and percentages of identity are: ArsR of T. thermophilus SG0.5JP17\u201016, 87%; ArsR of T.\u00a0oshimai JL\u20102, 81%; SmtB of T.\u00a0scotoductus SA\u201001, 46%; CadC of Clostridium perfrigens, 34%; ZiaR of Synechocystis PCC6803/KAZUSA, 46%; SmtB of Synechococcus PCC7942, 50% and ArsR of E.\u00a0coli, 41%. The ELCVCD motif is highlighted by a red box. HTH domain is indicated. Cys 10 is indicated by a green arrow. Red arrows indicate conserved Cys 62 and Cys 64. Blue arrows indicate residues putatively involved in ligand binding. The secondary structure elements of TtSmtB are depicted above the sequences. (B) Structural model predicted for TtSmtB dimer. (C) Structural model predicted for TTC0354. Modeling of the structures were made on the basis of amino acid sequence by the software I\u2010TASSER.Fig.\u00a0S2. Generation of smtB::kat mutant.Fig.\u00a0S3. Generation of TTC0354 single recombination mutants.Fig.\u00a0S4. TtSmtB interaction with target promoter.Click here for additional data file."}
+{"text": "Pseudomonas aeruginosa is one of the most common causes of keratitis. The current study was done to evaluate the therapeutic effects of antibacterial combinations with Silver nanoparticles (Ag-NPs) and Ciprofloxacin in experimental Pseudomonas keratitis. Sixty four New Zealand rabbits were prepared. All rabbits were randomly categorized into eight groups (each group containing eight rabbits): Control +, Control \u2212, Ciprofloxacin, Ag-NPs, Ciprofloxacin plus Betamethasone, Ag-NPs plus Betamethasone, Ciprofloxacin plus Ag-NPs, and Ciprofloxacin plus Ag-NPs plus Betamethasone. Twelve hours after bacterial inoculation into the cornea, the eyes were examined daily to evaluate the number of days of ocular discharge and blepharospasm. Also, after 108 and 204 h, first grading of corneal opacity was done and then four rabbits of each groups were euthanized for bacterial count. The results showed that the means of days of blepharospasm, ocular discharge, and bacterial counts (log CFU mL-1) were significantly different in the treatment groups at 108 and 204 h . According to Tukey\u2019s test, Ciprofloxacin plus Ag-NPs plus Betamethasone group was significantly less than Control +, Ag-NPs, and Ag-NPs plus Betamethasone groups for these variables (P < 0.05). The mean rank of opacity scores was significantly different between treatment groups . Mann-Whitney U-test revealed that Ciprofloxacin plus Ag-NPs plus Betamethasone group had significantly better score than Control +, Ag-NPs, and Ag-NPs plus Betamethasone groups (P < 0.05). It seems Ag-NPs can be an appropriate adjuvant for Ciprofloxacin, but due to the results they can\u2019t be an alternative for Ciprofloxacin to treat Pseudomonas keratitis.  Staphylococcus sp, Corynebacterium sp, and Streptococcussp . Also, Ciprofloxacin 3%, and Betamethasone 1% in the form of eye drops were purchased from drugstore . Serial dilutions of Silver nanoparticles, Ciprofloxacin, and their combination were done by Muller Hinton broth  with the same mixture in the ratio 1:1 to determine the MIC and MBC. Then, 0.2 mL of bacterial suspension (105 CFU mL-1) was inoculated into the tubes containing different concentration of them . It was administrated orally three consecutive days with 5 mg kg-1 dose and until inoculation bacteria 1 mg kg-1 dose (a maintenance dose) to rabbits. Given that any manipulation of the cornea is painful, in order to comply with ethical principles and rules of animal rights as well as to prevent animal heave during the process of creating keratitis, anesthesia induction was performed with Ketamine hydrochloride  and Xylazine hydrochloride . Also, one drop Lidocaine  was prescribed in each eye in order to numb the cornea. Using an insulin syringe with a needle size 30, ten microliters of bacterial suspension (105 CFU/mL) were inoculated into each cornea. The needle was placed horizontally and tangent in the corneal surface and injected about 0.2 mm into the corneal stroma. Fifteen to 20 minutes late rabbits regained consciousness. The Muller Hinton agar  medium was used for bacterial growth. Treatment groupsThe rabbits were randomly divided into eight equal groups. The medication in each group was as follows: CO \u2212: Negative control group, rabbits without bacterial inoculation; CO +: Positive control group, treated using with saline; C: treated using with Ciprofloxacin; N: treated using with Ag-NPs; C+B: treated using with Ciprofloxacin and Betamethasone; N+B: treated using with Ag-NPs and Betamethasone; C+N: treated using with Ciprofloxacin and Ag-NPs; C+N+B: treated using with Ciprofloxacin, Ag-NPs and Betamethasone.Twelve hours after bacterial inoculation four times daily treatment of groups were done . In fact, the duration of treatment was 108 post infection for four rabbits in each group and 204\u200ch for the rest of the rabbits.Clinical evaluation of experimental Pseudomonas keratitisTwelve h after bacterial inoculation, daily eye exams and evaluating clinical symptoms were done. Three clinical factors were considered in this study: the number of days of ocular discharge, and blepharospasm, and also corneal opacity. Corneal opacity was scored based on 0-3 with a decreasing trend at 12, 108, and 204 h after bacterial inoculation. The rating system used to grade corneal opacity was in this way: grade 0, Lack of corneal opacity; grade 1, faint opacity; grade 2, Iris fade; grade 3, and Lack of pupil . Bacterial count2 at108 and 204\u200ch after inoculation following general anesthesia with Xylazine and Ketamine. The eyes were bugged out with a gap in the middle of the eye by scissors under sterile conditions. Then the corneas were dissected from the eyes with a sterile scalpel blade and homogenized in one mL of 1% protease peptone. After vortexing to determine the number of bacteria (CFU) per milliliter, 10 \u00b5L of the each homogenized cornea were diluted 1:10000 in sterile saline. Then, 100 \u00b5L of each diluted sample was plated in triplicate on Mueller Hinton agar medium and incubated for 24 h at 37 \u00b0C  was performed on the number of days of blepharospasm, ocular discharge, and bacterial counts. Tukey\u2019s test was used to find out the difference between the different groups in the event the (ANOVA) was significant. Also, P value less than 0.05 was significant. MIC and MBC determinationThe results showed that the MIC and MBC of Ag-NPs in combination with Ciprofloxacin were less than each of them alone .Clinical evaluation of experimental Pseudomonas keratitis P > 0.05) (P > 0.05)  . Also, t > 0.05) .P < 0.05)  .Also, the means number of days of blepharospasm and ocular discharge in C+N+B group were significantly less than other groups at the end of treatment period. Of course, at 204 h post infection it wasn\u2019t significant between groups C+N+B and C+B for ocular discharge .Bacterial count P < 0.0005) ((log CFU mL-1) in C+N+B group was less than others except CO \u2212. According to post-hoc test it was significantly different with CO +, N and N+B groups at 108 and 204 h. Also, there were no significant difference between CO \u2212 and C+N+B at 108 h and CO \u2212 with C+N+B and C+N at 204 h post infection (ANOVA showed significant difference among the eight groups at 108 and 204 h ( 0.0005) . The meanfection .Pseudomonas aeruginosa is an opportunistic pathogen which can cause severe corneal infections  in C+N+B and C+N groups were less than others except CO \u2013 and also these groups did not have any significant differences with CO \u2013 group. It can confirm synergistic effect of combination Ag-NPs and Ciprofloxacin against Pseudomonas aeruginosa PAO1 in in-vivo condition. Using of Ag-NPs to treat eye infections less has been done in the past. One reason may be obscurity about the toxic effects of Ag-NPs on mammalian eye. Santoro et al. emphasized that it depends on Ag-NPs diameter size. So that Ag-NPs with a large size (40 nm and larger) did not have significant toxicity on the eye cells and other mammalian cell lines (fections . It can fections . Unlike fections . Any injfections . Hostingrganisms . Due to ratitis\u201d . In our  studies -26. Simi studies -29 the Mruginosa . Also, Mruginosa . The acqruginosa , 32, 33.ll lines . Pseudomonas keratitis treatment. According to corneal opacity scores, the number of days of blepharospasm, and ocular discharge, it seems that keratitis treatment process in C+N+B group was better than traditional treatment method with Ciprofloxacin and Betamethasone. It seems that using combination of them against Pseudomonas aeruginosa has the following advantages: 1. Enhancement of the their antibacterial effects and as a result decrease inthe therapeutic dose of each of them in compared to using either alone. 2. Decrease in the genetic mutations probability in bacteria against antibiotic in combination with Ag-NPs and thus decrease in the emergence of resistant Pseudomonas strains. The results of the present study do not allow any final conclusions. To this aim, more studies of Ag-NPs ocular side effects as an adjutant in keratitis treatment must be done. However, our results confirmed that the combination of Ag-NPs with a specific antibiotic such as Ciprofloxacin have a positive synergistic influence on"}
+{"text": "Extracellular vesicles (EVs) are membrane enclosed micro- and nano-sized vesicles that are secreted from almost every species, ranging from prokaryotes to eukaryotes, and from almost every cell type studied so far. EVs contain repertoire of bioactive molecules such as proteins , lipids, carbohydrates and nucleic acids including DNA, coding and non-coding RNAs. The secreted EVs are taken up by neighboring cells where they release their content in recipient cells, or can sail through body fluids to reach distant organs. Since EVs transport bioactive cargo between cells, they have emerged as novel mediators of extra- and intercellular activities in local microenvironment and inter-organ communications distantly. Herein, we review the activities of EV-associated matrix-remodeling enzymes such as matrix metalloproteinases, heparanases, hyaluronidases, aggrecanases, and their regulators such as extracellular matrix metalloproteinase inducers and tissue inhibitors of metalloproteinases as novel means of matrix remodeling in physiological and pathological conditions. We discuss how such EVs act as novel mediators of extracellular matrix degradation to prepare a permissive environment for various pathological conditions such as cancer, cardiovascular diseases, arthritis and metabolic diseases. Additionally, the roles of EV-mediated matrix remodeling in tissue repair and their potential applications as organ therapies have been reviewed. Collectively, this knowledge could benefit the development of new approaches for tissue engineering. Extracellular matrix (ECM) provides mechanical and chemical support to cells and orchestrates the structural framework and homeostasis of connective tissues where the local components and composition of ECM collectively determine the biochemical properties of the connective tissue ,2,3. TheThe interstitial Cajal-like cells (ICLC), known as telocytes (TCs), have been lately reported as a population of the connective tissue, which are known to make cellular junctions ,8,9, andImportantly, the cellular interactions and communication could also be facilitated by direct contact between cells such as cellular gap junctions and the tuning nanotubules (TNTs) , and by The biogenesis, maturation of various populations of EVs, sorting of molecules and their secretion into extracellular milieu is regulated by several factors . ExoOne of the most profound characteristics of EVs that have been widely reported is their participation in intercellular communication by transporting molecules and transmitting biological messages between cells and play physiological roles . Due to The augmented body of evidence has suggested that intercellular interactions could be disrupted physically and functionally by EV-mediated proteolytic activities, as EVs contain matrix-degrading enzymes such as matrix metalloproteinases (MMPs), heparanases, hyaluronidases, and extracellular matrix metalloproteinase inducer (EMMPRIN), and aggrecanases such as adamalysin metalloproteinases having disintegrin and thrombospondin domains (ADAMTSs) and tissue inhibitors of metalloproteinases (TIMPs), among others. As such, the presence of proteolytic molecules in EVs is one of the newly discovered sources for tissue remodeling through pericellular gelatinolytic activities (proteolysis), which modulate the structural architecture and dynamics of ECM and contribute for both the development of various diseases, tissue regeneration and amelioration of organ functions that will be discussed in this review.The proteases in EVs from different sources are secreted in a context dependent manner . For theAlthough, the reports have demonstrated possible mechanisms by which miRNAs and proteins (other than MMPs) are regulated for their secretion into EVs ,45,46, nIt is important to consider that the production of MMPs and their activities are largely influenced by MMP inducers and regulators such as EMMPRIN and TIMPs respectively. For instance, human uterine epithelial cells secrete EMMPRIN in EVs, which interact with recipient human uterine fibroblasts (HUFs) or uterine epithelial cells and stimulates the production of MMPs in these recipient cells. Such release of EMMPRIN-containing EVs from HUF cells is accelerated by stimulation of G protein-coupled receptor 30 . AdditioWhat comes more is that MMP-mediated cell surface processing could generate functionally active soluble form of transmembrane proteins such as epithelial cell adhesion molecule (EpCAM), TNFR1 and CD46 . LikewisInterestingly, EVs share homologous structures to those with matrix vesicles (MVs), which are characteristic of matrix mineralization  and are secreted from plasma membranes of differentiating growth plate chondrocytes, odontoblasts and osteoblasts. Recently, Karin and colleagues have shown that EVs of late stage of osteogenic differentiation could induce ECM mineralization . HoweverAikawa and colleagues argue that although, much as with MVs, the calcifying EVs in the fibrillar collagen ECM of cardiovascular tissues serve as calcification foci, nevertheless the formed mineral appears different between the tissues . AdditioWhat comes more important is that when EVs interact with other cells, the MMPs present on the surface of EVs promote the cleavage of the recipient cells\u2019 surface proteins, transmembrane proteins and adhesion molecules. Such surface cleavage allows either direct shedding or subsequent packaging of cleaved surface proteins into outer membrane-derived EVs (microvesicles) of these cells ,71,72,73The MMPs presented on the surface of EVs appear to derive diverse proteolytic activities for ECM turnover, and localized degradation of ECM, and thus contribute to matrix remodeling ,75,76,77The selective localization of MMPs such as MMP-9 and \u03b2-1 integrin and their shedding into EVs from tumor cells participate in localized degradation and the proteolysis of ECM during cellular migration and metastasis . The preHead and neck squamous cell carcinoma-derived EVs have been shown to modulate the expression of matrix remodeling proteins e.g. EFEMP1, DDK3, SPAR . MMP-13 In melanoma cells, microtubule-dependent traffic of MMP-2 and MMP-9 containing vesicles and their exocytosis promote cancer cell invasion . Of noteThe components and activities of ECM define the biophysical architect of pre-metastatic niche. It is well known that the localized degradation of ECM may educate cells to move to anatomically new location where they interact with normal resident cells and educate them towards tumor cell phenotypes. The role of EVs in priming pre-metastatic niche was first described by Peinado et al. showing that melanoma-derived EVs educate the bone marrow progenitor cells toward a pro-metastatic phenotype through mesenchymal transition . EVs plaIt has been shown that homing of melanoma-derived EVs to sentinel lymph nodes have a role in priming the lymph node environment, which stimulates proangiogenic program through ECM deposition in the lymph nodes . Thus, EMMPs\u2019 activity results in the loss of cellular adhesion and increased motility, which collectively facilitate homing of tumor cells to new location. Tumor cell-derived EVs are potent stimulators of MMP-9, IL-6, and TGF-\u03b21 and induce the secretion of extracellular EMMPRIN, which play active roles in driving immune evasion, invasion and inflammation in the tumor microenvironment . It has Additional studies demonstrate that tumor-derived EVs could influence the breast cancer cells\u2019 invasion through differential glycosylation of EMMPRIN, associated with p38/MAPK signaling pathway, which is activated by EMMPRIN-containing EVs . It has ECM-associated anomalies may affect cancer progression by promoting cellular transitions. It is well known that matrix degradation minimizes the adherent properties of cancer cells in order to promote their motility and invasion. As, such the motile cells may acquire the elongated forms, and assume novel phenotypes such as mesenchymal mode and the acquisition of fibroblast-like phenotypes that could be associated with distinct amoeboid forms and the shedding of large EVs  into the extracellular space ,134,135.Several studies have clarified that EVs mediate and facilitate the phenotypic switching of cells towards mesenchymal transitions including both EMT and MET ,146,147.Augmented body of evidence has revealed the participation of EV-associated growth factors in angiogenesis however; the role of EV-associated MMPs in neo-angiogenesis has only more recently started being explored. Since endothelial cells (ECs) are more active for vascularization, it has been shown that endothelial progenitor cell-derived EVs activate angiogenic programs in ECs through transferring mRNA . This is+ EVs contain several mRNA transcripts of proangiogenic factors such as VEGF, FGF, angiopoietin1, ephrin A3, MMP-2, and MMP-9 and promote the angiogenic activities in vitro as well as in vivo [Recently, it was shown that CD105 in vivo . Prostat in vivo .The CAFs secrete ADAM10-rich EVs that promote cell motility and activate RhoA and Notch signaling in cancer cells . RhoA siCD147 (EMMPRIN) containing EVs secreted from epithelial ovarian cancer cells may stimulate proangiogenic activities in ECs through CD147-mediated MMP regulatory networks . ImportaIt has been shown that the concentrations of proteolytic content  in human cancer cell-derived EVs are directly correlated with proteolysis-facilitated cell invasion . ImportaIt has been reported that EVs isolated from ascites and sera of ovarian carcinoma patients containing MMP-2, MMP-9 and plasmin are capable of promoting proteinase-dependent metastatic activity in malignant ovarian epithelium, indicating their diagnostic value . In addiSeveral studies have demonstrated that EVs play prominent roles in the pathophysiology of arthritic diseases including osteoarthritis (OA) and rheumatoid arthritis (RA) ,164,165.The platelet-derived EVs promote migration, invasion and adhesion in ECM of RA fibroblast-like synoviocytes (FLSs), which play important roles in the progression of joint destruction. EVs could up-regulate the expression of MMP1 accompanied by increased levels of phosphorylation of p-NF-\u03baB and p-Erk in RA-FLSs . This inMMPs break down the proteoglycans, such as aggrecan and collagen in the ECM and are thought to be a major cause of cartilage destruction in RA. In this context, synovial tissue-derived EVs breakdown the cartilage tissue and result in joint destruction. For example, EVs shed by FLSs contain ADAMTS-5, which degrade aggrecan and facilitate oligodendroglioma and RA-FLSs to invade through aggrecan-rich ECM . EVs relAdditionally, EVs secreted from IL-1\u03b2-stimulated FLSs could trigger the up-regulation of MMP-13 and ADAMTS-5 expression in the articular chondrocytes and induce osteoarthritic changes both in vitro and in ex vivo models . By contThe roles of EVs have been extensively described for cardiovascular diseases and atherosclerosis ,177,178.+ EVs, compared to ST-elevated MI patients. It was shown that CD62+ EVs counts were higher in MI patients with diabetes, and patients with hypertension had increased levels of CD14+ EVs, whereas the higher concentrations of CD62+ EVs early after MI were associated with an increased risk of cardiovascular events during follow up. The levels of platelet-derived EVs, EC-derived EVs and monocyte- derived EVs\u2019 concentrations during long-term follow up after MI seem to reflect the underlying cardiovascular disease rather than the acute MI [It has been shown that during acute myocardial infarction (MI), there is an increase of platelet-derived EVs, EC-derived EVs and monocyte-derived EVs, which show strong association to atherosclerotic burden and risk of cardiovascular events. EVs were evaluated in whole blood from 105 patients with MI during a two-year follow-up . Patientacute MI .Additionally, the parvovirus B19-induced vascular damage occurring in the heart is associated with elevated circulating EC-derived EVs in human samples. However, the EC-derived EV subpopulation patterns were significantly different in B19V+ myocarditis in humans and transgenic B19V mice reflecting vascular damage . This prIt is important to consider that the vascular damage is one of the major factors contributing in cardiac diseases, where EVs are thought to serve as essential mediators of cardiovascular calcification \u2014a major EVs from visceral adipose tissue integrate into liver cells and cause the increased expression of TIMP-1, TIMP-4, and MMP-9 and decreased expression of MMP-7 and plasminogen activator inhibitor-1 in recipient cells. EV-induced expression of these molecules results into the dysregulation of TGF-\u03b2 pathway in hepatocytes allowing the pathogenesis of nonalcoholic fatty (obesity-related) liver disease . AdditioProteolytically active disintegrin and metalloproteinase (ADAMs) such as ADAM10 and ADAM17 carried by EVs are secreted during human abdominal aortic aneurysm (AAA) in smokers. The cultured neutrophils exposed to tobacco smoke extract showed increased ADAM10 and ADAM17 content, active cleavage of these molecules and release into EVs, which provides a novel molecular mechanism for the increased risk of AAA in smokers .Meriones libycus are involved in the seasonal reproductive cycle. In fact, the immunosuppression of MMP-2 and MMP-9 in seminal vesicles has been observed during seasonal cycle of reproduction [The regulation of EV-associated proteolytic activities plays active roles in physiological processes such as reproduction . The geloduction .Recently, it was shown that the content of fibrillar collagens in seminal vesicles was elevated in hyperhomocysteinemic rats. Hyperhomocysteinemia increased the expression of MMP-2, -3, -7 and -9 in seminal vesicles . The accEVs present in synovial fluid and cartilage ECM are involved in joint development and in the regulation of joint homeostasis . The knoThe treatment of OA chondrocytes with human adMSC-EVs inhibits MMPs activity in chondrocytes and have protective effects in OA chondrocytes\u2014raising their potential as new therapeutic approaches in damaged joint conditions . AdditioBesides proteins, several other molecules such as lipids, glycans, and nucleic acids are also players of EV surface interactions , and areOcular hypertension caused by ECM accumulation in the trabecular meshwork is a hallmark of glucocorticoid-induced glaucoma. As such, corticosteroid-induced alterations in adhesion cargo of EVs\u2019 and alterations in adhesion activities could account for the matrix accumulation as seen in glaucoma patients . Action EVs derived from non-pigmented ciliary epithelium were incubated with TM cells in dose dependent manner, which significantly decreased the expression of \u03b2-Catenin, GSK-3\u03b2 in TM cells. Pro-MMP9 and MMP9 activities were significantly enhanced in TM cells treated with high concentrations of EV, indicating that these EVs modulate biological activities in recipient cells and regulate key canonical Wnt proteins expression in the eye model for the human ocular drainage system . LikewisMoreover, EVs secreted by corneal fibroblasts can transport MMP-14 to vascular ECs, as a prerequisite step for the recruitment/packaging of MMP-2 into corneal fibroblast-derived EVs . Such trIt has been shown that ischemic EVs confer protection against oxidative-induced lesion, promote proliferation and sprouting of ECs and stimulate cardiac angiogenesis . IschemiAdditionally, TCs have been reported to secrete EVs into interstitial environment, which serve as mediators of long-distance paracrine activities of the TCs in adult organs ,201,202.Regulation of EV-associated proteolytic activities have been shown to play active role in tissue homeostasis and wound healing processes through the recruitment of wound healing factors at the site of injury ,203. EVsMesoangioblasts are vessel-associated progenitor stem cells endowed with the ability of multipotent mesoderm differentiation and represent a promising tool in the regeneration of injured tissues. EVs released by mesoangioblasts contain Hsp70, which interact with Toll-like receptor 4 and CD91, and regulates MMP-2 and MMP-9 expression to stimulate cell migration. Therefore, mesoangioblast-derived EVs regulate mesoangioblast stem cells\u2019 ability to traverse the ECM .Platelet-derived EVs could stimulate the production of MMPs in human umbilical vein ECs, which favor the angiogenesis . AdditioAdditionally, BM-MSCs secrete hyaluronan-coated EVs, which carry CD44 mRNA. The hyaluronan coat on EVs may regulate their interactions with target cells and participate in ECM remodeling. The secretion of hyaluronan-coated EVs by MSCs is a general process, which contributes to several of the mechanisms of hyaluronan-mediated tissue regeneration . It was The participation of EVs in the development of various diseases and tissue repair has well been elaborated for their nucleic acid and proteomic contents. However, the secretion and biological activities of EV-associated matrix-remodeling enzymes and their regulators are only just beginning to emerge. Nevertheless, there is still limited knowledge on the topological localization of ECM-degrading enzymes in relation to EVs, and futures studies are needed to answer several questions: if the enzymes are soluble or membrane bound; if the membrane bound-enzymes are membrane integral proteins or peripheral proteins; if the peripheral proteins are localized on the inner surface of EVs or on the outer surface; if the catalytic site of the integral proteins are inside the EVs or outside of EVs. This will help better understanding of matrix biology, and tissue remodeling during the progression of several human diseases reviewed in this article such as tumor, cardiovascular and arthritic diseases and could help developing new strategies for tissue repair. However, the available knowledge for understanding the role of EV-mediated matrix remodeling in neurological diseases, metabolic diseases and infectious diseases is scarce in the literature.Finally, the content and concentrations of MMPs in patient-derived EVs could help identifying complimentary biomarkers and may have prognostic values. The most pivotal aspect of EV-mediated matrix remodeling could be harvested for tissue repair and ameliorating organ functions . As such"}
+{"text": "Extracellular vesicles (EVs) are blebs of either plasma membrane or intracellular membranes carrying a cargo of proteins, nucleic acids, and lipids. EVs are produced by eukaryotic cells both under physiological and pathological conditions. Genetic and environmental factors  affecting EV cargo, regulating EV release, and consequences on immunity will be covered. EVs are found in virtually all body fluids such as plasma, saliva, amniotic fluid, and breast milk, suggesting key roles in immune development and function at different life stages from in utero to aging. These will be reviewed here. Under pathological conditions, plasma EV levels are increased and exacerbate immune activation and inflammatory reaction. Sources of EV, cells targeted, and consequences on immune function and disease development will be discussed. Both pathogenic and commensal bacteria release EV, which are classified as outer membrane vesicles when released by Gram-negative bacteria or as membrane vesicles when released by Gram-positive bacteria. Bacteria derived EVs can affect host immunity with pathogenic bacteria derived EVs having pro-inflammatory effects of host immune cells while probiotic derived EVs mostly shape the immune response towards tolerance. Communication between cells and between organs is tightly regulated and its disruption can contribute to disease development. Communication can either occur by cell-to-cell contact or by means of soluble factors. Cytokines are by definition soluble factors produced by cells (beyond immune cells) ensuring cell survival, proliferation, differentiation, and/or activation. These factors can act on the cell involved in their production (autocrine), on cells in their close environment (paracrine), or distally. Hormones are produced by endocrine organs as well as immune cells and have mostly distal effects from their sites of release. Both cytokines and hormones bind specific receptors on target cells, which then trigger a signalling activation cascade that will affect the cell phenotype. Both cytokines and hormones have been studied for decades and are the basis of modern physiology.However, more recently, another process also involved in this type of communication has been highlighted. On top of producing specific factors, cells can send a package of information that is enclosed by cell membrane. This package is also called extracellular vesicles (EVs) and can contain DNA, RNA, proteins, sugars, and lipids. EVs can be produced by any cell type, highlighting their importance throughout evolution from unicellular organisms to metazoans. During the last decade, considerable efforts have been made to investigate the role of EVs in cell communication and disease development. In addition, numerous groups have investigated EVs for their potential as biomarkers and as targeted therapeutic carriers. However, there are major limitations in these areas that need to be addressed in the future. These limitations include a lack of standardized methodology for the isolation and purification of different classes of EVs, inadequate terminology, numerous technical challenges in EV characterization and quantification, and an incomplete identification of the cellular origin of EVs. Historically, most groups have only focused on one or two types of EVs, but have not investigated the respective contribution of all EV subclasses in their model. These are only a few major obstacles that need to be overcome to advance this field. In this review, we discuss the current knowledge on the production and mechanisms of action of EVs in health and disease as well as the impact of commensal and bacteria derived-EVs on cell function and their impact on health and disease.EVs are membrane-enclosed vesicles that are released from all cell types. Their importance lies in a unique characteristic, the ability to transfer information to other cells and influence their function ,2,3,4. DMicrovesicles (MVs) are plasma membrane-derived, 100\u20131000 nm diameter vesicles, released by vesiculation from eukaryotic cells. MVs originate as a consequence of the loss of phospholipid asymmetry associated with cytoskeletal remodelling and an increase in cytosolic calcium. Phosphatidylserine and other negatively charged phospholipids, normally sequestered in the inner leaflet of the plasma membrane, redistribute to the outer leaflet. MVs are distinct from other EVs  by virtue of the expression of phospholipids and proteins on their surface . InitialIn addition, MVs have been shown to transport RNA between cells  as well Exosomes are a nanoscale subtype of EVs with a cholesterol and sphingolipid-rich membrane that is characteristically 30\u2013150 nm in diameter and secreted from all cell types [While different types of mechanisms have been proposed for exosome uptake, it is known that exosomes interact with the recipient cell, and transmit information resulting in changes in surrounding cells via (1) direct stimulation by membrane ligands; (2) receptor transfer between the donor cells and recipient cells; (3) transfer of genetic information; and (4) direct stimulation by endocytically-expressed surface receptors in recipient target cells . RecentlAccumulating evidence suggests that induction of intracellular calcium ,19, overOnce released, exosomes will interact with and are internalized by, recipient target cells via different mechanisms including fusion with the plasma membrane or adhesion to corresponding receptors on the plasma membrane, phagocytosis, micropinocytosis, and lipid raft mediated endocytosis ,24. RegaEVs also include much larger (1\u20135 \u03bcm diameter) vesicles, originating from the shedding of membrane blebs, named apoptotic bodies. Furthermore, oncosomes are EVs produced specifically by malignant cells, and therefore these two groups will not be discussed here ,29.After MVs were found in dramatically elevated numbers in cerebral malaria patients , the finThis array of evidence suggests an interesting parallel with Koch\u2019s postulates , supportMVs can show contrasting effects in disease: they can also be potentially protective in sepsis. On one hand, MVs that are found in high plasma levels in sepsis, may be beneficial in early sepsis, given that activated protein C bound to endothelium-derived MV retains anticoagulant activity, and increased circulating MV are protective against vascular hyporeactivity. Elevated MV levels in early sepsis may therefore compensate for the host\u2019s systemic inflammatory response . AdditioThe characterisation of EVs in clinical settings involves techniques that include flow cytometry, nanoparticle tracking analysis, proteomics, sequencing, lipidomics, and, more recently, various types of vibrational spectroscopy (VS). Compared to traditional omics approaches vs. providing direct information on changes in cells, EVs, and cell medium in one experiment; it avoids complex sampling that can alter molecules unlike proteomics or lipidomic procedures, it detects semi-quantitative changes in lipids, proteins, DNA, RNA, organophosphates, or carbohydrates, and is sensitive to biomolecule conformations .In cerebral malaria patients, the clear association between high MV levels and the occurrence of the neurological syndrome as well as the normalization of these levels at the time of follow up, suggest a potential value of MVs as biomarkers of disease severity . More reA number of diseases including cancer have since been studied along these lines, as reviewed elsewhere ,46. NeurAll types of EVs, in addition to their increasingly recognised roles in pathogenesis, play important roles in homeostasis. One of the first direct demonstrations of a physiological role for MVs was provided by elegant works from Denisa Wagner\u2019s team, indicating that platelet MVs are crucial in initiating clot formation ; the mulEVs crossing the placenta from the maternal to the foetal side have also been implicated in modulating and programming foetal immune responses, but the evidence so far is patchy and indirect. Here, the distinction between microchimerism through maternal cell transfer or by means of EVs remains elusive. It has been shown that maternal alloantigens cross the placenta  and poteFinally, during lactation, the secretion of EVs through breastmilk are believed to influence mucosal immunity and increase the gut microbiome diversity of the offspring . EVs froWhile the release of EVs by human eukaryotic cells has been extensively described in health and disease, recent evidence has shown that at least 50% of cells in humans are in reality bacteria, mostly located in the gut. How EVs from commensal bacteria, and from bacteria at large, impact the host will be discussed in the next section.+ T cells [+ dendritic cells [Bacteroides fragilis was shown to promote Treg differentiation [Myd88\u2212/\u2212 mice from food allergy [Bacteroides fragilis could mimic the benefit of administration of the bacteria itself, both promoting Treg development [Over the last 20 years, extensive research has demonstrated the key role of the gut microbiota on host physiology and immunity . Analyse T cells , macroph T cells ,88, toleic cells ,89, and ic cells . SCFAs mic cells , or by dic cells ,90. Anotntiation . Similar allergy . Mice de allergy , suggestelopment . This fiP. aeruginosa [Like any organisms, bacteria produce EVs as a system of communication with their peers. Contrary to eukaryotic EV, bacterial-derived EV sizes range exclusively below 300 nm in diameter . EVs canruginosa . Most struginosa . Proteomruginosa . OMVs miruginosa .S. aureus when high levels of phenol-soluble modulin are present, increased the release of BMVs [The identification of EVs derived from G+ bacteria called \u201cmembrane vesicles\u201d  was achieved in 1990 , which i of BMVs . Similar of BMVs . As BMVs of BMVs .Moraxella catarrhalis induced B cell activation. Both TLR2 and TLR9 on host B cells, respectively, were activated by the superantigen Moraxella immunoglobulin D binding protein (MID) and by the bacterial motif CpG. As a result, B cell activation markers were increased as well as B cell production of IgM and IL-6. In this context, OMVs were used as a decoy to redirect the immune response [Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia have been shown to be phagocyted by monocytes and macrophages and activate NF-\u03baB downstream of TLR signalling. Interestingly, while the three types of OMVs increased pro-inflammatory cytokines , P. gingivalis also triggered the release of anti-inflammatory cytokine IL-10 [P. aeruginosa that could reduce the inflammatory response of airway epithelial cells as well as neutrophil activation and infiltration in mouse lungs [Bacterial EVs can interact with host cells through three mechanisms: (1) direct activation of host receptors; (2) delivery of bacterial EV content; and (3) full incorporation of EVs into the host cell cytoplasm . Activatresponse . OMVs prne IL-10 , suggestne IL-10 . Both stne IL-10 . Finallyse lungs . The infse lungs .+ T cells directed towards a specific antigen by antigen cross-presentation by dendritic cells [Based on their immunomodulatory properties, the potential use of bacteria derived OMVs as therapy is more and more investigated, particularly in the context of vaccination. The results are promising as OMVs can boost the generation of CD8ic cells .S. aureus were shown to initiate inflammation by increasing the expression of adhesion molecules  and of IL-6 on skin dermal endothelial cells, increasing the recruitment of monocytes in vitro. Interestingly, this effect was specific for S. aureus BMVs and not of G+ BMVs in general, as BMVs derived Propionibacterium acnes did not have such an effect [Streptococcus pneumoniae were shown to increase activation markers such as CD86 on human monocyte-derived dendritic cells as well as promote their release of both pro-inflammatory cytokines  and IL-10 [While less studied, BMVs can also affect immune cell function. EVs derived from n effect . BMVs prnd IL-10 . To concE. coli Nissle were shown to increase PBMC production of both pro- and anti-inflammatory cytokines, but interestingly these OMVs triggered more IL-10 than OMVs from E. coli with no probiotic traits [L. rhamnosus promote tolerogenic dendritic cells and Treg development in vivo in mice. These tolerogenic effects were linked to the interaction of OMVs on C-type lectin receptors (Dectin-1 and SIGNR1) and TLR (TLR2 and TLR9) on dendritic cells [Bifidobacterium bifidum induce the maturation of monocyte derived dendritic cells and their coculture with na\u00efve T cells favoured their differentiation into Treg [B. longum and from Enterococcus faecalis are both internalised by mast cells in a temperature insensitive manner, however, only B. longum triggered mast cell apoptosis [B. longum EVs is mediated by the protein ESBP, which once administered intraperitoneally into mice decreases the proportion of mast cells in the small intestine. BMVs from S. aureus stimulate the release of IL-6 from keratinocytes and macrophages in vitro while their pre-treatment with BMVs derived from Lactobacillus plantarum counteracted this effect, suggesting potential benefits of probiotic derived EVs during infection. Interestingly, probiotic derived BMVs had this effect only in a preventive context as they had no effect in a context of co-stimulation with S. aureus MVs [L. planturum can also potentially increase host immune defence towards pathogens by increasing the expression of anti-microbial peptides cathepsin B and RegIII\u03b3 in colonic epithelial cell line Caco-2 [Lactobacilli decrease the release of IL-8 of colonic epithelial cells Caco-2 stimulated with TNF. Interestingly, the BMVs were added after the treatment with TNF, suggesting the therapeutic potential of EVs in inflammatory bowel diseases [Bacteroides fragilis has been shown to promote Treg cells through the interaction of PSA with TLR2 [S. aureus, commensal bacteria Ruminococcus gnavus also encoded protein superantigens on their surface, which are potent IgA inducers. In turn, these bacteria were particularly highly coated with IgA in the gut lumen [R. gnavus, which has been linked to colorectal cancer [Like pathogenic bacteria, EVs derived from gut commensal bacteria can also modulate host immunity. Probiotics are defined as live bacteria with health benefits and some commensal bacteria have probiotic traits promoting host health . While Ec traits , suggestic cells . BMVs dento Treg . BMVs depoptosis . This inreus MVs . BMVs fre Caco-2 . BMVs frdiseases . Bacteroith TLR2 . Recentlith TLR2 . A recenut lumen . Whetherl cancer .Akkermansia muciniphila is considered as a beneficial bacterium living in the mucus layer. A. muciniphila has been shown to be beneficial in human reducing fat mass and glycemia in patients with type 2 diabetes. The benefits involved the interaction of A. muciniphila outer membrane protein Amuc_1100 on host cell TLR2 [A. muciniphila in plasma compared to healthy controls [Proteobacteria derived OMVs, suggesting that dysbiosis is also associated with the increased activity of pathobionts [Lactobacillus rhamnosus GG having cytotoxic effects on the hepatic cancer cell line HepG2 in vitro [Human studies have shown a link between both infectious, non-communicable diseases and changes in the circulating levels of gut bacteria derived EVs. Patients with an altered intestinal barrier have systemic increase of bacteria derived EVs . In thisell TLR2 . Interescontrols , suggesthobionts . Finallyin vitro .A. muciniphila decreasing gut permeability in a mouse model of diet-induced obesity [A. muciniphila OMVs had decreased body weight as well as improved glucose tolerance. These metabolic benefits were likely to be linked to the beneficial effect of A. muciniphila OMVs on the gut barrier integrity, as 6 h post administration, A. muciniphila MVs were only detected in the colon and not in the liver, muscle, fat, pancreas, and spleen [Proteobacteria panacis OMVs. Mice treated orally with P. panacis OMVs developed insulin resistance under normal chow feeding conditions. The authors identified that P. panacis OMVs could directly impair insulin signalling in adipocytes and myotubes in vitro. The biodistribution analysis of these OMVs by live imaging revealed that 12 h post-gavage P. panacis OMVs were detectable in liver, white adipose tissue, and skeletal muscles, suggesting direct effects of OMVs on insulin sensitive tissues [The therapeutic potential of probiotic-derived EVs has been tested in preclinical models exclusively. Most non-communicable diseases have been linked to increased gut permeability, which is thought to contribute to low-grade systemic inflammation and thus potentially to pathologies such as insulin resistance . Commens obesity . In parad spleen . Other b tissues . It is iLactobacillus planturum shown to prevent atopic dermatitis development. Of note, administration of 100 \u03bcg of L. planturum BMVs was as potent as dexamethasone in the prevention of epidermal thickening [B. longum in food allergy through their pro-apoptotic effects on mast cells [B. fragilis protecting them from trinitrobenzene sulphonic acid (TNBS) induced colitis [Lactobacillus kefir, Lactobacillus kefiranofaciens, and Lactobacillus kefirgranum protected mice from TNBS induced colitis by primarily targeting enterocytes [Effects of bacteria-derived EVs have also been observed in atopic diseases, with oral administration of MVs from ickening . Benefitst cells . Finally colitis . Inductierocytes . AltogetProduction of EVs by both eukaryotic and prokaryotic cells is linked to changes in both plasma and intracellular membrane homeostasis, showing that similar mechanisms for the EVs released are highly preserved throughout evolution.Due to the fact that EVs are difficult to investigate, considerably fewer studies have focused on EVs compared to other soluble factors such as cytokines and hormones. The fact that they are important soluble factors in cell communication in both health and disease, as summarized in Despite significant advances towards understanding the biology of EVs including their formation, secretion, molecular composition, and influence on the recipient cells over the past decade, the field would enormously benefit from novel protocols to more efficiently isolate the different subtypes of EVs.EVs have recently garnered attention as communication vesicles, intelligently transporting diverse messenger molecules including RNA, DNA, lipids, and proteins and play a critical role in physiology for intra-host\u2013cell communications as well as inter-kingdom communication. The presence and function of EVs should now be taken into account due to their key role on target cells and impact on physiology."}
+{"text": "Extracellular vesicles (EVs) contain proteins, microRNAs, mRNAs, long non-coding RNAs, and phospholipids, and are a novel mechanism of intercellular communication. It has been proposed that the immunomodulatory and regenerative effects of mesenchymal stem/stromal cells (MSCs) are mainly mediated by soluble paracrine factors and MSC-derived EVs (MSC-EVs). Recent studies suggest that MSC-EVs may serve as a novel and cell-free alternative to whole-cell therapies. The focus of this review is to discuss the functional proteins which facilitate the effects of MSC-EVs. The first section of the review discusses the general functions of EV proteins. Next, we describe the proteomics of MSC-EVs as compared with their parental cells. Then, the review presents the current knowledge that protein contents of MSC-EVs play an essential role in immunomodulation and treatment of various diseases. In summary, functional protein components are at least partially responsible for disease-modulating capacity of MSC-EVs. Mesenchymal stem/stromal cells (MSCs) are obtainable from various human tissues and have multipotent differentiation aptitude. Due to their angiogenic, anti-apoptotic, and immunomodulatory capacities, MSCs may serve as a good candidate for regenerative medicine. Many studies including the work from our group  have exaAccording to the position statement of the International Society for Extracellular Vesicles (ISEV), EVs are particles, with a lipid bilayer, that are naturally released from the cells and cannot replicate . The ISEAlmost all organisms and cells are capable of producing EVs. MSC-derived EVs (MSC-EVs) bear not only the markers that are characteristic of MSCs such as CD29, CD73, CD90, CD44, and CD105, but also EV markers such as CD63, CD9, and CD81 . DiffereMSC-EVs exert their functions via the transfer of their contents, such as proteins, mRNAs, and microRNAs (miRNAs), to target cells. There was a horizontal transfer of insulin-like growth factor-1 receptor mRNA from EVs to cisplatin-damaged proximal tubular cells, which increased the proliferation of proximal tubular epithelial cells . In miceEV proteins participate in EV biogenesis, sort EV cargo, control EV release, and facilitate interactions between EVs and recipient cells. EV biogenesis can be categorized into endosomal sorting complex required for transport (ESCRT)-dependent and ESCRT-independent pathways. ESCRT consists of 4 protein complexes, ESCRT-0, I, II, and III, with over 20 ESCRT and accessory proteins such as CHMP4C, VPS4B, VTA1, and ALIX. In HeLa-CIITA cells, silencing of ESCRT-0 subunit Hrs, ESCRT-I protein STAM1, or ESCRT-I protein TSG101 altered the size and/or protein contents of secreted EVs. The depletion of VPS4B did not affect the size and composition of EVs while elevated the secretion . Biogene1 via a YPX3L motif [Sorting of EV cargo is also regulated by both ESCRT-dependent and ESCRT-independent pathways. The three early-acting ESCRT complexes  harbored ubiquitin-binding domains and could interact with ubiquitinated cargo, sorting ubiquitinated proteins into EVs . Protein3L motif , 28. ESC3L motif . However3L motif . Sorting3L motif . Sortili3L motif .N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) [It is well known that EV fusion and release are facilitated by soluble (SNAREs) . EV rele(SNAREs) . Rab7 an(SNAREs) . Hsu et (SNAREs) . Rab27a (SNAREs) .6\u03b24- and \u03b16\u03b21-enriched EVs from tumors co-localized with fibroblasts and epithelial cells in laminin-rich lung microenvironments. Integrin \u03b1v\u03b25-expressing EVs from tumors fused with Kupffer cells in the fibronectin-rich liver. Meanwhile, integrin \u03b23-abundant EVs interacted primarily with CD31+ brain endothelial cells [The interactions between EVs and recipient cells involve surface proteins of EVs such as integrins, tetraspanins, and ICAMs, which interact with the target cells via receptor-ligand binding. When intravenously injected, integrin \u03b1al cells . EVs conal cells . ICAM-1 al cells . Other Eal cells .An increasing number of studies have reported the proteomic signature of MSC-EVs. A summary of the data is presented in Table\u00a0Like their parental cells, MSC-EVs have also been investigated for their potent immunomodulatory capacity. A list of functional proteins of MSC-EVs involved in immunoregulation and pathophysiology of human diseases is summarized in Table\u00a02 receptor 4 (EP4) antagonist, promoted the release of MSC-EVs. The GW627368X-induced MSC-EVs had elevated levels of anti-inflammatory cytokines and neuron-supporting proteins including IL-2, IL-10, RANTES, vascular endothelial growth factor (VEGF), and brain-derived neurotrophic factor (BDNF). In a mouse model for inducible hippocampal CA1 neuron damage, GW627368X-elicited MSC-EVs improved memory and learning deficiencies triggered by hippocampus damage. Furthermore, the induced MSC-EVs elevated the expression of genes implicated in astrocyte differentiation, blood-brain barrier, and anti-inflammation [Chen et al. reported that the treatment of MSCs with GW627368X, a prostaglandin Eammation . In an iammation . In anotammation .Results from clinical trials have shown that MSCs were effective in the treatment of epidermolysis bullosa, a genetic skin condition resulting from a lack of type VII collagen production, by improving the reconstruction of the basement membrane and healing of cutaneous wound . In vitrAhn et al. demonstrated that MSC-EVs were as effective as MSCs in alleviating neonatal hyperoxic lung injury in a rat model. The protective effects were lost in MSC-EVs with VEGF-knockdown, indicating the protection was mediated by the transfer of VEGF . In an iIn a pig model of renal artery stenosis, treatment with MSC-EVs restored renal blood flow and alleviated renal inflammation and fibrosis. Fragments of EVs co-localized with kidney tubular cells and macrophages, suggesting internalization of EVs. The protective effects were abrogated in pigs treated with IL-10-depleted MSC-EVs . In a moIn a rat model of acute myocardial infarction, EVs derived from MSCs with AKT overexpression improved cardiac function through the promotion of angiogenesis. The MSC-EVs with AKT overexpression displayed a higher level of platelet-derived growth factor D (PDGF-D) compared with control MSC-EVs. Transfection of PDGF-D-siRNA into MSCs abolished the angiogenesis effect of MSC-EV in endothelial cells . GonzaleCystinosis is a rare disease caused by homozygous mutations of the cystinosin gene, resulting in the accumulation of intralysosomal cystine in the body. MSC-EVs alleviated the accumulation of cystine in skin fibroblasts from cystinosis patients in vitro. MSC-EVs also transferred wild-type cystinosin to the skin fibroblasts . Mao et -cell therapy for the treatment of a myriad of diseases. The therapeutic effects of MSC-EVs are at least partially mediated by delivering functional proteins to the recipient cells. MSC-EVs obtained from different origins and preparation methodologies have similar beneficial effects, indicating similar protein compositions of MSC-EVs. Proteomic analysis in MSC-EVs has identified hundreds of proteins in key biological processes such as EV biogenesis, cellular structure, tissue repair and regeneration, and inflammatory response. Approximately 40 of the functional proteins responsible for the protective effects of MSC-EVs are listed in the present review. However, research in functional proteins of MSC-EVs faces several challenges. Foremost, the sorting mechanisms of proteins into MSC-EVs are not clear. The existing sorting pathways apply mainly to proteins with post-translational modifications. Secondly, there is a lack of methodology to efficiently target MSC-EVs to specific tissue types, although targeting attempts have been made by altering EVs via chemical modification and manipulating parental cells via genetic modification. Lastly, it is unknown whether functional miRNAs and proteins work independently or synergistically, giving that miRNAs are also transferred from MSC-EVs to target cells. Further studies are warranted to evaluate MSC-EV therapeutics based on the delivery of functional proteins.It has been well established that MSC-EVs have the same immunomodulatory and anti-inflammatory effects as their parental cells. Compared with MSCs, MSC-EVs offer several advantages including lower immunogenicity and an improved safety profile. Therefore, MSC-EVs may serve as an alternative to whole"}
+{"text": "Extracellular vesicles (EVs) are circulating vesicles secreted by various cell types. EVs are classified into three groups according to size, structural components, and generation process of vesicles: exosomes, microvesicles, and apoptotic bodies. Recently, EVs have been considered to be crucial for cell-to-cell communications and homeostasis because they contain intracellular proteins and nucleic acids. Epithelial cells from mice suffering from bronchial asthma (BA) secrete more EVs and suppress inflammation-induced EV production. Moreover, microarray analyses of bronchoalveolar lavage fluid have revealed that several microRNAs are useful novel biomarkers of BA. Mesenchymal stromal cell-derived EVs are possible candidates of novel BA therapy. In this review, we highlight the biologic roles of EVs in BA and review novel EV-targeted therapy to help understanding by clinicians and biologists. Extracellular vesicles (EVs) were first described as \u201cplatelet products\u201d in human plasma in 1967 . EVs havhttp://www.isev.org) also recommends use of the term \u201cEVs\u201d. Therefore, in this review, we use \u201cEVs\u201d to avoid confusion or ambiguity. The basic features of exosomes, microvesicles, and apoptotic bodies have been covered recently in numerous review articles . BrieflyEVs contain intracellular proteins  and nucleic acids including DNA, messenger RNA (mRNA), microRNA (miRNA), and noncoding RNA. They serve as mediators of intercellular communication and have a crucial role in cell-to-cell communications and homeostasis ,21. EVs EV-secreting cells are summarized in Macrophages are also major sources of pulmonary EVs . MacrophEndothelial cells also secrete various types of EVs, including endothelial microparticles, which contain platelet endothelial cell adhesion molecule-1, vascular endothelial cadherin, and E-selectin, and have roles in coagulation, inflammation, endothelial function, and angiogenesis . ActivatBesides the cells mentioned above, it has been reported that B cells secrete EVs and have roles as immune-system activators . Also, dMDFIC, POU3F1, and NRIP1, and genes involved in angiogenesis including HGF, HES1, and TCF4 and genes involved in adipogenesis including CEBPA and KLF7 [Mesenchymal stromal cells (MSCs) are recruited to inflammation sites , stimulaand KLF7 .H2) cells [H2 cells produce IL-4 and IL-13, which stimulate plasma B cells to secrete allergen-specific immunoglobulin E (IgE). Secreted IgE binds to the high-affinity receptor for IgE on tissue-resident mast cells in a process known as \u201csensitization\u201d. Thereafter, mast cells release three classes of biologically active product when they are re-exposed to the allergen: cytoplasmic granules  in a process known as \u201cdegranulation\u201d, lipid-derived mediators , and cytokines, chemokines, and growth factors. Finally, these events cause vasodilation, increased vascular permeability, bronchoconstriction, and mucus secretion from airways [H2 cells produce IL-5, which has a crucial role in the differentiation, activation, and survival of eosinophils [H17 also contributes to the recruitment of neutrophils to the inflammation site. Allergic inflammation is initiated with DC activation by allergens . Activat2) cells . TH2 cel airways . Lipid-d airways . Ceramid airways ,60,61,62inophils . Eosinopinophils . BA is oinophils . When alreg) in BA development. Indeed, induced Treg cells suppress production of group-2 innate lymphoid cell-driven IL-5 and IL-13 [H9 cells, is critically involved in the immune-pathogenesis of inflammatory diseases including BA and in guarding immune tolerance [A recent study clarified the important role of regulatory T cells  [EVs have a role in development, recruitment, activation, and suppression of the immune system ,72,73,74 (LFA-1) . Moreove (LFA-1) . Another (LFA-1) . These f (LFA-1) . EV production of monocyte-derived macrophages is modulated by transforming growth factor (TGF)-\u03b2, IL-1\u03b2, and interferon (IFN)-\u03b3 from airway smooth muscle. These cytokines affect the rate of exosome generation and delivery by peripheral blood monocytes or alveolar macrophages ,38,91. DCCL26, TNF, and POSTN in epithelial cells and CCR3 and VEGFA in primary bronchial smooth muscle cells [Eosinophils purified from peripheral blood can secrete EVs by IFN-\u03b3 stimulation . These Ele cells . Neutrople cells . These Ele cells .H2 cytokines can stimulate BEC production of EVs and induce monocyte proliferation. Moreover, monocytes which are treated with BEC-derived EVs enhance their migration in the presence of MCP-1 [EVs from pulmonary epithelial cells metabolize myeloid cell-derived leukotriene C4 to leukotriene D4 . Furtherof MCP-1 . In addiof MCP-1 ,108,109.H2 cell-mediated inflammation [H2 cells, and antagonism of miR-126 suppresses allergic airway inflammation [H2 response [H17 [EVs can package miRNAs which have important roles in BA. miRNAs are small, noncoding RNAs, 20 to 23 nucleotides in length, packed within secreted EVs, and which regulate gene expression by destabilizing and degrading mRNAs ,113,114.ammation . miR-126ammation ,121. miRresponse . On the nse [H17 . miR-221nse [H17  and miR-nse [H17 . FurtherRecent studies revealed that EVs have a role in transferring mitochondria, besides transferring bioactive materials ,128,129.+ and ICAM-1+ EVs also increase in BALF from BA patients [EVs in BALF from BA patients contain miRNAs and could be biomarkers of BA . EV concpatients ,88,130. patients . ICAM-1 patients . Lipidompatients . Commercpatients . Tetrasppatients ,136,137.patients . Endosompatients ,139. Surpatients ,141. Howpatients . H2 cytokine production, and airway inflammation [reg cells by upregulating expression of IL-10 and transforming growth factor-\u03b21 from peripheral blood mononuclear cells [EVs in the BALF of patients with BA increased IL-4 and leukotriene C4 in BECs . Adminisammation . EV secrammation ,151,152.ammation . HDM indammation ,153. Sysammation . EVs secar cells . Two safEVs are useful in drug delivery, since EVs can reduce toxicity, carry both lipophilic and hydrophilic drugs to target cells, and preserve drugs\u2019 therapeutic activity ,157. In Another strategy for loading therapeutically active cargo molecules into EVs uses hydrophobic agents, which are incubated with EVs or donor cells . InteresThe technologies for EV isolation are critical for future applications of EVs as drug delivery vehicles. The differential centrifugations followed by ultracentrifugation are commonly used to remove cells and large cell debris and precipitate EVs ,171. AnoIn the respiratory system, EVs are secreted from all types of hematopoietic cells and lung structural cells and have a role in intercellular communication, modulating antigen presentation and immune activation, suppression, and surveillance. BA is a chronic inflammatory disease of the airways with a complex pathophysiology that involves hematopoietic cells, including DCs, T and B cells, monocytes, and eosinophils, and lung structural cells. Several studies revealed EVs in BALF and EBC from BA patients could be biomarkers of BA. EVs are potential therapeutic targets for BA and two safety studies of MSCs and their trophic factors in BA patients are in progress. Although EVs are biologically well studied and are promising biomarkers and therapeutic targets for asthma, several clinical trials are required for clinical application."}
+{"text": "M. tuberculosis infection and TB progression, such as hyperglycemia, increase of 1AC levels, increase of triglycerides levels, reduction of HDL-cholesterol levels, increased concentration of lipoproteins, and modification of the activity of some hormones related to the control of metabolic homeostasis. Finally, we recognize possible advantages of metabolic management of immunity to develop new strategies for treatment, diagnosis, and prevention of tuberculosis.Tuberculosis (TB) remains as the first cause of death among infectious diseases worldwide. Global incidence of tuberculosis is in part coincident with incidence of type 2 diabetes (T2D). Incidence of T2D is recognized as a high-risk factor that may contribute to tuberculosis dissemination. However, mechanisms which favor infection under T2D are just starting to emerge. Here, we first discuss the evidences that are available to support a metabolic connection between TB and T2D. Then, we analyze the evidences of metabolic changes which occur during T2D gathered thus far for its influence on susceptibility to  Mycobacterium tuberculosis, which in susceptible people leads to either active or latent tuberculosis (TB), remains as a high-burden health problem globally. It is calculated that in 2017, TB caused 1.3 millions deaths, and 10.0 million new cases were reported  values between 100 and 125 mg/dL or 2 h oral glucose tolerance test (OGTT) between 140 and 199 mg/dL or Hemoglobin 1AC between 5.7 and 6.4%  and also had higher concentrations of IL-5, IL-10, and TGF-\u03b2 (cytokines related to regulation of cytokine response) than TB patients without prediabetes . C1qTNF3 is a cytokine produced by macrophages and adipocytes that reduces inflammation generated by adipocytes , some additional disorders in metabolism may occur, such as hyperglycemia, dyslipidemia, changes in lipoprotein concentrations, and changes in hormonal profiles , known as hyperglycemia, and higher proportions of 1AC in blood (>6.5%)  between glucose intolerance and the development of TB  in plasma of TB, T2D, T2D, and healthy controls  in plasma samples from TB, T2D, and TB-T2D patients showed that TB-T2D comorbidity displays characteristics of both diseases, such as reduced concentration of amino acids (indicator of waste) and lower dyslipidemia than expected only in T2D  with T2D, OR = 1.18  in serum than healthy controls  to SCFA  and measuring cytokines that participate in the proinflammatory and anti-inflammatory response against a stimulus with M. tuberculosis H37Rv lysates in vitro. Treatment with SCFA decreased induction of TNF-\u03b1, IL-1\u03b2, and IL-17, while it did not modify the induction of IL-6, IFN-\u03b3, or IL-22   were infected with M. tuberculosis is controversial.According to ADA, metformin is the preferred initial treatment for hyperglycemia in T2D patients , and increased M2 markers (CD14+ CD16+) in these cells independently of infection with BCG. Moreover, when PBMC obtained from subjects who were treated with oral glibenclamide were infected with M. tuberculosis infection. Treatment of dyslipidemia has been shown to influence the capability to respond to M. tuberculosis infection. Lee and collaborators identified in a retrospective study that Taiwanese individuals with T2D and treated with statins had a lower risk of developing active TB , than individuals with T2D and no treatment with statins (Lee et al., M. tuberculosis depending on the stage of TB, before activation of infection, or when infection is established.As we described above, some metabolic changes associated with diabetic dyslipidemia can be actively implicated in the susceptibility of the host to M. tuberculosis H37Rv than accumulation observed in unvaccinated guinea pigs (Parish et al., Vaccination with BCG produces changes on parameters related to diabetic dyslipidemia. An study where guinea pigs were vaccinated or not with BCG, showed that vaccination produces a lower accumulation of Ox-LDL at the site of infection after challenge with Recently, a systematic review showed that more than 70% of new drug efficacy trials have not considered the T2D population in their protocols (Lutfiana et al., As a mathematical modeling of TB-T2D shows, control of T2D may lead to a significant reduction in TB incidence, and the uncontrolled raise of T2D should have the opposite effect (Pan et al., M. tuberculosis infection. Since the onset of a prediabetic stage, the metabolic environment compromises the host response and produces changes that allows infection and favors disease progression and its worsening. In this sense, identification of biomarkers of progression to TB in prediabetic patients is needed to better understand the transition point between progression or not to TB. Recent efforts to elucidate a metabolic signature of progression to TB revealed that some metabolic networks may be related to progression to TB (Duffy et al., CTP1A, which codes for carnitine palmitoyltransferase 1A was downregulated in obesity (Orellana-Gavalda et al., SLC25A20, which codes for carnitine acyl-carnitine translocase and has been observed to contribute to insulin secretion in mouse models of obesity (Soni et al., PDK4, which codes for pyruvate dehydrogenase kinase, a key enzyme that participates in control of blood glucose in an insuline-dependent manner (Lee, T2D patients undergo some metabolic modifications that may facilitate the establishment, maintenance, and progression of ner Lee, , and is ner Lee, .M. tuberculosis from infected cells.During T2D and TB comorbidity, the basal levels of glucose, 1AC, triglycerides, HDL-cholesterol, lipoproteins, and hormones related to the control of metabolic parameters creates an environment that supports bacterial survival and their spread . FinallyCS-C and MF-V extensively discussed the manuscript. All authors wrote the manuscript, reviewed drafts, and approved submission of this work.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "III, AsV, CrVI, SbIII, and SbV analysis and (2) arsenic speciation procedure for AsB, AsIII, DMA, MMA, and AsV quantification, was extended to the analysis of a new sample type in terms of bespoke speciation analysis. As for the non-targeted speciation, analysis size exclusion chromatography was used with ICP-MS and a complementary technique, ESI-MS/MS, was used for the organic species of As, Sb, and Cr screening. Full validation of procedures 1 and 2 was conducted. Procedure 1 and 2 were characterized with precision values in the range from 2.5% to 5.5% and from 3.6% to 7.2%, respectively. Obtained recoveries ranged from 97% to 106% and from 99% to 106% for procedures 1 and 2, respectively. Expanded uncertainties calculated for procedures 1 and 2 ranged from 6.1% to 9.4% and from 7.4% to 9.9%, respectively. The applicability of the proposed procedures was tested on bottled drinking water samples. Results for the real samples in procedure 1 were in the range from 0.286 \u00b1 0.027 [\u03bcg L\u22121] to 0.414 \u00b1 0.039 [\u03bcg L\u22121] for AsIII, from 0.900 \u00b1 0.083 [\u03bcg L\u22121] to 3.26 \u00b1 0.30 [\u03bcg L\u22121] for AsV, and from 0.201 \u00b1 0.012 [\u03bcg L\u22121] to 0.524 \u00b1 0.032 [\u03bcg L\u22121] for SbV. CrVI and SbIII were not detected in any sample. As for procedure 2, results were in the range from 0.0541 \u00b1 0.0053 [\u03bcg L\u22121] to 0.554 \u00b1 0.054 [\u03bcg L\u22121] for AsB. Results for AsIII and AsV obtained with procedure 2 were in good accordance with results obtained with procedure 1. DMA and MMA were not detected in any sample.The main aim of the research was to develop a complementary analytical approach consisting of bespoke speciation analysis and non-targeted speciation analysis of As, Sb, and Cr in flavored bottled drinking water samples using HPLC/ICP-DRC-MS and ESI-MS/MS. The scope of two previously developed analytical procedures, (1) multielemental speciation procedure for As III and SbV complexes with citric acid [\u22121] to 4.5 [\u03bcg L\u22121], from 0.012 [\u03bcg L\u22121] to 21.6 [\u03bcg L\u22121], and from 0.02 [\u03bcg L\u22121] to 28.9 [\u03bcg L\u22121] respectively , 50 [\u03bcg L\u22121], and 5 [\u03bcg L\u22121], respectively  was estimated using analyte spiked bottled drinking water samples (0.5 \u00b5g L\u22121 for procedure 1 and 1 \u00b5g L\u22121 for procedure 2) and was found to range from 2.5% to 5.5% for procedure 1 and from 3.6% to 7.2% for procedure 2. Trueness expressed as recovery was estimated using the analyte spiked bottled drinking water samples (0.5 \u00b5g L\u22121 for procedure 1 and 1 \u00b5g L\u22121 for procedure 2) and ranged from 97% to 109% for procedure 1 and from 99% to 106% for procedure 2. The Student\u2019s t-test was performed to verify if the obtained mean recoveries were significantly different from 100% and confirmed that the calculated values were in good agreement with theoretical reference values. Detailed validation results are shown in Full validation was conducted for procedure 1 and 2 in which the following parameters were evaluated: Calibration curve linearity, limit of detection (LOD), precision, and trueness. Measurement traceability was provided by the standard addition method to the real samples. Linearity of the calibration curves was confirmed with RIII, 9.2% for AsV, 6.1% for CrVI, 6.6% for SbIII, and 6.2% for SbV. For procedure 2, the expanded uncertainty values were: 9.8% for AsB, 9.9% for AsIII, 8.7% for DMA, 9.0% for MMA, and 7.4% for AsV. The precision component has a greater influence on the combined standard uncertainty than the trueness component for all analytes in procedures 1 and 2. The contributions of the individual components of uncertainty in the overall uncertainty of the AsB concentration are shown in The measurement uncertainty budget was estimated using the single laboratory validation approach, expanded uncertainty (U) was calculated using k = 2 and expressed as a percentage of the analyte concentration. The calculated expanded uncertainty values for procedure 1 were as follows: 9.4% for AsV, MMA, and DMA) were analyzed in order to identify some characteristic fragment ions for potential organic As compounds. Detailed results are described below.All four developed analytical procedures were applied to the analysis of real samples. Five bottled drinking water samples (three brands) were analyzed. Prior to speciation analysis, total concentrations of As, Cr, and Sb were measured using ICP-DRC-MS. Obtained total concentration values were compared with the results of procedure 1 and 2. Based on the differences between the found total As, Cr, and Sb concentrations and the species of those elements determined using procedures 1 and 2, the samples were chosen for analysis using procedures 3 and 4. Two samples (B.1 and C.2) in which the total concentration of As, Cr, and Sb were not in accordance with the concentration of species determined using procedures 1 and 2 were analyzed using procedures 3 and 4. In Procedure 3, the chromatographic peaks for the As, Cr, and Sb compounds eluting from the SEC column were recorded. Procedure 4 was applied to the same samples that were analyzed using procedure 3, which did not provide analytical signals suggesting the presence of organic connections of As, Cr, or Sb. In addition, standard solutions for As  using procedure 4, the characteristic fragment ions of arsenic compounds were found. During AsIII standard solution analysis, no molecular ion or any characteristic fragment ions were found. In AsV fragmentation spectra, a molecular ion of arsenic acid [H2AsO3]\u2212 was observed with an m/z value of 140.9163. The most abundant fragment ion found on AsV fragmentation spectra with an m/z value of 122.9048 was assigned to the [AsO3]\u2212 ion. Another characteristic fragment with an m/z value of 106.9109 was found and identified as the [AsO2]\u2212 ion. This fragment ion showed a very low relative abundance although it was characterized by a delta m/z value equal to \u22126.054 ppm. In the MMA standard solution fragmentation spectra, a molecular ion with an m/z value of 138.9366 was found and identified as [CH3AsO3]\u2212. Fragment ions observed on the MMA fragmentation spectra were [H3AsO]\u2212 with an m/z value of 123.9125, [CH2AsO2]\u2212 with an m/z value 120.9258, and [AsO2]\u2212 with an m/z value 106.9103. A molecular ion of DMA [(CH3)2AsO2]\u2212 with an m/z value of 136.9574 was found along with characteristic fragments of [CH3AsO2]\u2212 with an m/z value 121.9344 and [AsO2]\u2212 with an m/z value of 106.9109.During the analysis of As standard solutions  ,17,40. DDetailed results obtained from procedures 3 and 4 are collected in An Elan DRC II ICP-DRC-MS instrument , was used in the course of the experiments. The DRC with oxygen as a reaction gas was used to remove spectral interferences.Chromatographic separation was achieved in an HPLC system consisting of a PE Series 200 pump, a column oven, a PE Series 225 auto sampler equipped with a Peltier Cooling Tray, and a PE Series 200 UV/VIS detector . HPLC and ICP-DRC-MS operating conditions are presented in In the course of the ESI-MS/MS experiments, a high resolution mass spectrometer Q-Exactive Orbitrap  with a heated electrospray source II (HESI-II) was used.The experiment described in the present paper comprised three steps (i) Total concentration of As, Cr, and Sb quantification, (ii) bespoke speciation analysis for the determination of the target species of As, Cr, and Sb, (iii) non-targeted speciation analysis for the searching of new species of examined elements in the sample and identification of those species. Prior to step (iii), a mass balance, based on the difference in the total concentrations of the target elements and results obtained with procedures 1 and 2, was estimated to decide which of the samples should be analyzed with procedures 3 and 4. Complete analytical strategy was shown as a scheme on Three analytical procedures for speciation analysis were employed to study the speciation of As, Cr, and Sb in bottled flavored drinking water samples in terms of both inorganic and organic connections of those elements. In addition, an analytical procedure for the identification of organic As, Cr, and Sb species in bottled flavored drinking water samples using the ESI-MS/MS technique was developed. The total amount of As, Cr, and Sb in all samples was analyzed using ICP-DRC-MS. All analytical procedures are described in detail below.III, AsV, CrVI, SbIII, and SbV analysis using ion-exchange chromatography was used in the analysis of the real samples   .\u22121 for procedure 1 and 1 \u00b5g L\u22121 for procedure 2) and analyzed using the presented analytical procedures (with three replicates for each sample). The recovery was calculated according to guidelines recommended by IUPAC based on the measured signal area for each of the analytes [The standard addition method was employed to assess the trueness of both analytical procedures. Similarly to the precision evaluation, a series of 9 independent bottled drinking water samples with analyte addition for each procedure were employed. Each of the samples was spiked with authentic standards  denotes the standard uncertainty of precision and u In the presented paper, the uncertainty budget estimation was conducted using the single laboratory validation approach. The single laboratory validation method for uncertainty estimation is based on the data obtained during the validation process. To estimate the uncertainty budget, parameters influencing the measurement uncertainty of the analytical result were grouped into precision and trueness components. The overall analytical method precision was estimated using intermediate precision values. The use of intermediate precision conditions allows all sources of uncertainty related to volumetric measuring equipment, influences of environmental conditions, repeatability, and the drift of an analytical instrument to be considered. The standard uncertainty of the precision of the method was calculated using relative standard deviation values. The trueness of the method was estimated based on the spiked samples of drinking water as mentioned before. The Student\u2019s t-test, performed to verify if the obtained mean recoveries were significantly different from 100%, confirmed that the calculated recoveries were in good agreement with the theoretical reference. The combined standard uncertainty of an analyte concentration was calculated according to the Equation:recovery ,51.In the present work, we developed a complementary analytical approach consisting of bespoke speciation analysis and non-targeted speciation analysis of As, Sb, and Cr in bottled drinking water samples using HPLC/ICP-DRC-MS and ESI-MS/MS.III, AsV, SbIII, SbV, CrIII, and CrVI) as well as organic  species in bottled drinking water samples were employed. Arsenic was detected in tested samples with the highest concentration. Also, arsenic species were the most prevalent in the analyzed samples. AsV was detected in higher concentrations than AsIII in all samples. AsB was only detected in flavored water samples. SbIII was not detected in any of the samples and SbV was only detected in unflavored water samples and one flavored water sample. CrVI was not detected in any of the samples; however, CrIII and an unidentified Cr species were detected in flavored water samples. Results obtained for real samples analyzed during this experiment do not exceed permissible concentrations in accordance to the Drinking Water Directive .In terms of bespoke speciation analysis, two analytical procedures for the determination of various inorganic (AsThe reliability of the developed analytical procedures was assessed through traceability assurance and validation of the analytical procedures. The uncertainty budget was estimated using the single laboratory validation approach. Obtained validation parameters confirmed the applicability of the presented procedures for their intended purpose.V, MMA, and DMA standard solutions. Identified fragment ions may be used in the future for organic compounds of arsenic identification in real samples.In terms of the non-targeted speciation analysis, analytical procedures meant for the detection of complex organic compounds and confirming that they contain arsenic were developed. No complex organic compounds of arsenic were detected in real samples. Characteristic fragment ions containing arsenic were found in the fragmentation spectra of As"}
+{"text": "Introduction: Steroid-resistant nephrotic syndrome (SRNS) is one of the most frequent causes for chronic kidney disease in childhood. In ~30% of these cases a genetic cause can be identified. The histological finding in SRNS is often focal segmental glomerulosclerosis (FSGS). In rare cases, however, pathogenic variants in genes associated with Alport syndrome can be identified in patients with the histological finding of FSGS.Materials and Methods: Clinical information was collected out of clinical reports and medical history. Focused molecular genetic analysis included sequencing of COL4A5 and COL4A3 in the index patient. Segregation analysis of identified variants was performed in the parents and children of the index patient.Results: The female index patient developed mild proteinuria and microscopic hematuria in childhood (12 years of age). The histological examination of the kidney biopsies performed at the age of 21, 28, and 32 years showed findings partly compatible with FSGS. However, immunosuppressive treatment of the index patient did not lead to a sufficient reduction of in part nephrotic-range proteinuria. After the patient developed hearing impairment at the age of 34 years and her daughter was diagnosed with microscopic hematuria at the age of 6 years, re-examination of the index's kidney biopsies by electron microscopy revealed textural changes of glomerular basement membrane compatible with Alport syndrome. Molecular genetic analysis identified two missense variants in COL4A3 in a compound heterozygous state with maternal and paternal inheritance. One of them is a novel variant that was also found in the 6 year old daughter of the index patient who presented with microscopic hematuria.Discussion: We were able to show that a novel variant combined with a previously described variant in compound heterozygous state resulted in a phenotype that was histologically associated with FSGS. Molecular genetic analysis therefore can be essential to solve difficult cases that show an unusual appearance and therefore improve diagnostic accuracy. Additionally, unnecessary and inefficient treatment with multiple side effects can be avoided. Steroid-resistant nephrotic syndrome (SRNS) is one of the most frequent causes for chronic kidney disease especially in young adulthood , 2. In aCOL4A3 and COL4A4, both genes associated with Alport syndrome (AS)  . AS typiome (AS) . In AS tome (AS) .COL4A5 are the most frequent causes involved in the pathogenesis of AS and account for about 85% of cases  or autosomal dominant (1% of cases) AS (Variants in of cases . Due to ases) AS , 12. MalDue to mainly economic reasons, genetic testing is often reluctantly used in clinical routine. Molecular genetic diagnosis can improve accuracy of disease classification, especially in phenotypes with multiple symptoms and unusual appearance and help to create personalized treatment options.COL4A3 variant in a compound heterozygous state in a 34 year old woman with hematuria and proteinuria who presented initially with histological findings compatible with FSGS. Only after hearing impairment occurred later in life, genetic testing of AS associated genes was initiated and the correct diagnosis was made.Here we report one novel The study was approved by the local Ethics Committee of the Technical University of Munich and performed according to the standard of the Helsinki Declaration of 1975. Written informed consent was obtained from the index patient and their relatives for publication. Clinical and phenotype information was gathered out of clinical reports and medical history.Histological examinations of the kidney biopsies at the age of 28 and 32 years were performed with light microscopy of sections stained with Periodic acid-Schiff (PAS) reaction and hematoxylin and eosin staining, immunohistochemistry and electron microscopy. Immunohistochemistry of the latest biopsy was performed with antibodies specific for IgA, IgG, IgM, C1q, and C3c  after digestion with PronaseE for 45 min. For detection Envision Kit (Dako) was applied and DAB was used as a chromogen. For electron microscopy fixed renal biopsies were dehydrated and embedded in Epon. Semithin and ultrathin sections were prepared and stained with methylene blue or uranyl acetate/lead citrate, respectively. Ultrathin sections were then analyzed with a Zeiss electron microscope LEO EM 910 or LEO EM 912  at various magnifications. Histological and electron microscopic images were only available from the latest kidney biopsy.COL4A5 were examined followed by exon 1 to 52 of COL4A3 using direct DNA sequencing on both strands applying the dideoxy chain termination method on an ABI capillary sequencer 3730 . Primers were designed by Primer3 program (http://frodo.wi.mit.edu/primer3/input.htm). For segregation analysis, subsequent targeted sequencing was performed in both parents and children of the index patient in exon 26 and 52 of the COL4A3 gene. DNA alignment and sequence variant analysis were carried out using the Sequence PilotCE software  and compared to EMBL (European Molecular Biology Laboratory) and GenBank databases as well as our in-house database. All variants were validated in a second independent DNA sample. Scaled gene structure was created with the Gene Structure Display Server version 2.0  according to manufacturer's instructions. In the index patient exon 1 to 51 of sion 2.0 .A 34 year old Caucasian woman of German ancestry presented in our department Figure , II-2. AAt the age of 21 years, the index patient had, for the first-time, increased proteinuria (>1 g per day) and mild hypertension. The histology of a kidney biopsy showed, besides minimal mesangial cell proliferation, uncharacteristic findings. Therefore, no specific therapy was initiated. Unfortunately, no detailed report of the first kidney biopsy was available.2 re-biopsy of the kidney was performed at the age of 28 years. The diagnosis at that time was chronic kidney disease due to FSGS with secondary hypertension and proteinuria. The clinical presentation was normal, besides a slightly increased weight (body mass index 24.7 kg/m2) possibly due to the discrete lower leg edema. Especially, there was no report of hearing impairment. Further laboratory work-up is shown in Table In the presence of persistent proteinuria of >1 g/d and a decrease of creatinine clearance from 83 to 65 mL/min/1.73 mFour years later, at the age of 32 years, the patient experienced nephrotic range proteinuria (4.5 g per day). In the beginning, the patient responded well to immunosuppressive treatment with prednisolone  and mycophenolate mofetil (MMF) (250 mg twice daily) with a reduction of the proteinuria to 1.7 g per day. To further reduce the proteinuria, MMF was increased to 500 mg twice daily. Nonetheless, proteinuria increased again to 4.3 g/d. Therefore, MMF was discontinued and the patient was admitted to our hospital for a kidney biopsy. Clinical presentation at that time was age-appropriate, besides discrete lower leg edema. Abnormal laboratory values are shown in Table Light microscopy of the third kidney biopsy revealed renal parenchyma with 11 glomeruli of which four were obliterated Figure . In one Two years later, at the age of 34 years, the patient developed moderate inner ear hearing impairment. Additionally, the 6 year old daughter of the index patient was diagnosed with microscopic hematuria. This new clinical symptomatology combined with a conspicuous family history led to a re-examination of electron microscopy of the kidney biopsy performed at the age of 32 years. In further electron microscopic analyses, segments with thinning and thickening of the GBM (170\u2013700 nm) were found. Moreover, changes in the texture of the GBM were seen in some segments with mild lamellation and basket-woven texture. Moderate effacement of the foot processes was present  kidney disease until the age of 54 and 58 years, respectively.COL4A5 could not be identified. The sequencing of COL4A3 (NM_000091.4) revealed two missense variants in a compound heterozygous state in the index patient: c.1892G>T, p.Gly631Val  and c.4981C>T, p.Arg1661Cys   Figure . Each pa) Figure . The ami) Figure . The var) Figure , 14. The) Figure . The dau) Figure , III-2. ) Figure , I-1. Th) Figure , III-1.COL4A3 combined with a previously described variant in a compound heterozygous state. In the context of the progressive proteinuria and the young age of the index patient the initial diagnosis was erroneously considered to be hereditary FSGS as it was the most probable differential diagnosis. The present study highlights the importance of including AS in the differential diagnosis of FSGS, especially when disease onset is early in life (<25 years of age). In these cases, it would be helpful to start a molecular genetic analysis promptly .We identified a novel variant in COL4A3 and COL4A4 to patients with nephrotic-range proteinuria and the histological findings of FSGS  and MutationTaster (http://www.mutationtaster.org) to predict possible functional effects, the variant was classified as probably damaging (PolyPhen-2) and disease-causing (MutationTaster). The variant was not found in our in-house database and in the genome Aggregation Database (gnomAD).Using molecular diagnostics, we identified a novel missense variant in The daughter of the index patient, who is a heterozygous carrier of the variant, already demonstrated microscopic hematuria in early childhood (6 years of age). This can be a first sign of thin basement membrane nephropathy (TBMN). However, the father of the index patient, who also carried this variant, showed no signs of (chronic) kidney disease going in line with the wide range of clinical phenotypes reported in individuals with single heterozygous variants , 12, 16.The second variant, p.Arg1661Cys, has been identified both in a heterozygous and compound-heterozygous state in patients with autosomal recessive AS mostly at an early age at diagnosis of 10\u201318 years (in one case 44 years of age). In one case ESRD was reached at 19 years of age . PreviouCOL4A3, COL4A4 an increased risk of progression to chronic renal failure was observed in up to 38% and a progression to ESRD was observed in up to 20%  nephrologist if hypertension, proteinuria, or renal impairment is present . In thisp to 20% . Age of COL4A3 (p.Glu131fs*151 and p.Gln936*) and nephrotic range proteinuria and hematuria with ESRD at 8 to 12 years of age described by Malone et al. is comparable to our family  (The rapid course of disease in one family (DUK6696) with compound heterozygous variants in 0 years) . The unuCOL4A3 as compared to COL4A4  affection with microscopic hematuria and TBMN warrants a restrained selection as kidney donor. This is especially important if blood pressure is high or proteinuria is present . TherefoIn patients with AS and TBMN ACE inhibitors are recommended by the expert guidelines for the treatment of hypertension and proteinuria especially in individuals with genetic variants . AngioteCOL4A3 and COL4A5 as this study was already performed several years ago. Examination of disease modifiers for collagen IV that could explain the high variability of phenotypes described before were not performed (Some limitations of the present study have to be stated. We performed only targeted sequencing of erformed . Today pCOL4A3 in compound heterozygous state can lead to a phenotype that was erroneously associated with hereditary FSGS. Finally, our study exemplifies the importance of molecular examination in the diagnosis of the renal phenotype to improve diagnostic accuracy and avoid unnecessary inefficient treatment with immunosuppression.We were able to show that a novel variant combined with a previously described variant in MB and JH, analyzed and interpreted the patient data regarding the genetic and clinical findings and wrote the manuscript. MB-H conducted the histological examination of the third kidney biopsy, compiled histological, and electron microscopy figures and contributed to the writing of the manuscript. H-GK, DW, and JH performed the molecular diagnostics. CK, LR, UH, and CS conducted in-patient treatment. RG, RS, KR, P-MH, CK, LR, UH, and CS contributed important intellectual content during manuscript drafting and revision. All authors accept accountability for the overall work by ensuring that questions pertaining to the accuracy or integrity of any portion of the work are appropriately investigated and resolved. Text revision was performed by all authors. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "To the best of our knowledge, there have been no reports on linkage map construction and their integration in multi-parent populations of rice.The construction of genetic maps based on molecular markers is a crucial step in rice genetic and genomic studies. Pure lines derived from multiple parents provide more abundant genetic variation than those from bi-parent populations. Two four-parent pure-line populations (4PL1 and 4PL2) and one eight-parent pure-line population (8PL) were developed from eight homozygous We constructed linkage maps for the three multi-parent populations and conducted quantitative trait locus (QTL) mapping for heading date (HD) and plant height (PH) based on the three maps by inclusive composite interval mapping (ICIM). An integrated map was built from the three individual maps and used for QTL projection and meta-analysis. QTL mapping of the three populations was also conducted based on the integrated map, and the mapping results were compared with those from meta-analysis. The three linkage maps developed for 8PL, 4PL1 and 4PL2 had 5905, 4354 and 5464 bins and were 1290.16, 1720.01 and 1560.30\u2009cM in length, respectively. The integrated map was 3022.08\u2009cM in length and contained 10,033 bins. Based on the three linkage maps, 3, 7 and 9 QTLs were detected for HD while 6, 9 and 10 QTLs were detected for PH in 8PL, 4PL1 and 4PL2, respectively. In contrast, 19 and 25 QTLs were identified for HD and PH by meta-analysis using the integrated map, respectively. Based on the integrated map, 5, 9, and 10 QTLs were detected for HD while 3, 10, and 12 QTLs were detected for PH in 8PL, 4PL1 and 4PL2, respectively. Eleven of these 49 QTLs coincided with those from the meta-analysis.In this study, we reported the first rice linkage map constructed from one eight-parent recombinant inbred line (RIL) population and the first integrated map from three multi-parent populations, which provide essential information for QTL linkage mapping, meta-analysis, and map-based cloning in rice genetics and breeding. Rice is an important staple-food crop for nearly half of the world\u2019s population. According to the International Grain Council (IGC), global rice production is projected to reach 505 million tons in 2019\u20132020, approximately 90% of which will be produced and consumed by Asians . De Leon et al.  and provides chromosomal information for gene cloning and marker-assisted breeding  populations have become increasingly popular and have been developed in various plant species , HHZ5-SAL9-Y3-Y1 (B), BP1976B-2-3-7-TB-1-1 (C), PR33282-B-8-1-1-1-1-1 (D), FFZ1 (E), CT16658\u20135-2-2SR-2-3-6MP (F), IR68 (G) and IR02A127 (H), have been selected with genetic diversity to develop the three multi-parent RIL populations at the IRRI since 2008 \u2009\u00d7\u2009(C\u2009\u00d7\u2009D) and (E\u2009\u00d7\u2009F)\u2009\u00d7\u2009(G\u2009\u00d7\u2009H), and advanced separately by single-seed descent (SSD) to produce two four-parent RIL populations (denoted 4PL1 and 4PL2). An eight-way cross was made by intercrossing 100 F1 plants of the four-way cross ABCD and 100 F1 plants of the four-way cross EFGH, denoted [(A\u2009\u00d7\u2009B)\u2009\u00d7\u2009(C\u2009\u00d7\u2009D)]\u2009\u00d7\u2009[(E\u2009\u00d7\u2009F)\u2009\u00d7\u2009(G\u2009\u00d7\u2009H)] .Eight elite Field trials were conducted at the Pingxiang Experimental Station  in Jiangxi Province  function in GAPL. First, SNPs with a known chromosome ID on a physical map were anchored. The unanchored SNP markers were grouped based on a minimum logarithm of odds (LOD) score of 3. Second, the nearest-neighbour algorithm and two-opt algorithm from the travelling salesman problem  function in GAPL. The scanning step was set at 0.1\u2009cM. Probabilities of adding and removing variables in stepwise regression were set at 0.001 and 0.002, respectively. The LOD threshold was determined by a permutation test with 1000 runs, and the type-I error was set to 0.05. Mapping results from 8PL were compared with the results obtained by GWAS in Shen et al. , where 0BioMercator V4.2 was used to project the detected HD and PH QTLs onto the integrated map and perform QTL meta-analysis  was 0.9867, 0.9346 and 0.9736 for HD and 0.7766, 0.7711 and 0.9217 for PH in 8PL, 4PL1 and 4PL2, respectively.The phenotypic variation in the eight parents and the three RILs populations are shown in Additional\u00a0files\u00a0The distribution of SNPs and linkage map information for the three populations are shown in Table\u00a0Contribution of each parent can be quantified by the proportion of the parental genome in the progeny , located from 2,940,004 to 2,942,452\u2009bp , from 4,334,739 to 4,333,846\u2009bp  that was located from 31,508,811 to 31,514,460\u2009bp and responsible for a delay in HD in long day conditions , located from 38,381,423 to 38,384,165\u2009bp , located from 35,129,858 to 35,130,917\u2009bp  are given in Table\u00a0To the best of our knowledge, this study provided the first linkage map from an eight-parent RIL population in rice and the first integrated map constructed from a number of multi-parent populations in rice. Three linkage maps were first constructed from three multi-parent populations, and an integrated map was then built from the three individual maps. Among the three individual maps, the 8PL map had a larger number of bins, shorter genome length, and shorter average bin size than the 4PL1 and 4PL2 maps Table  and 4. AFor each linkage map, over ten thousand markers were selected after the first step of filtering, but only half of them were retained after binning. Bin number is much smaller than marker number in linkage mapping populations with limited crossovers, especially when high density markers are used for genotyping. For example, in an actual cowpea population consisting of 305 RILs from an eight-way cross reported by Huynh et al. , 32,114 We also tried to construct the integrated map using all markers before binning, i.e., 13,254, 10,825 and 13,479 SNPs in 8PL, 4PL1 and 4PL2. The results showed that the inclusion of all useful markers before binning did not always improve the bin density of the integrated map. For example, for chromosome 12 in the integrated map, the bin number was 674 when using markers before binning, which was smaller than that (677) when using markers after binning. The average bin distance was 0.29\u2009cM, which was larger than that (0.25) observed when using markers after binning.Hd3a was detected in both 8PL and 4PL1; Ghd8 was detected in both 8PL and 4PL2; and sd1 was detected in both 8PL and 4PL1 populations.ICIM detected 3, 7 and 9 QTLs for HD and 6, 9 and 10 QTLs for PH in 8PL, 4PL1 and 4PL2 using the three individual maps, respectively. It was not easy to compare the positions of the detected QTLs between maps because of inconsistent marker orders and positions. However, some QTLs had similar physical positions. For example, assuming the length of the confidence interval was 0.5\u2009Mb, the gene qHD6.2, qHD8, qPH1.1, qPH1.2 and qPH12. In addition, ICIM detected one other QTL affecting HD on chromosome 6 and three other QTLs affecting PH on chromosomes 2, 8 and 11, whose PVE were equal to 5.15, 2.13, 1.42 and 1.28%, respectively. In 4PL1, ICIM also detected all QTLs that were detected by the GWAS, i.e., qHD6 and qPH1. In addition, six other QTLs affecting HD and eight other QTLs affecting PH were identified on various chromosomes. Largest and smallest PVE of these QTL were 11.08 and 1.69%, and average PVE was 3.62%. In 4PL2, two HD and two PH QTLs were identified by the GWAS, one of which was coincident with those identified by ICIM, i.e., qHD8. ICIM detected eight other HD QTLs and ten other PH QTLs. Largest and smallest PVE of these QTL were 34.85 and 0.41%, and average PVE was 4.06%. In summary, GWAS missed some strong signals as well as some weak signals in QTL mapping. The reason may be that GWAS is lack of background control leading to a larger sampling error. The selection of GWAS methods also affects the accuracy of QTL detection. ICIM detected more QTLs, and the detected QTLs explained more phenotypic variance than those detected by GWAS, indicating ICIM has more power in QTL detection than GWAS analysis.In a previous study, Shen et al.  applied Hd3a, Ghd8 and HD6) and PH , both GWAS and ICIM detected them for nine times (Additional\u00a0file\u00a0Hd3a and sd1 was detected by GWAS in 4PL2, but not found by ICIM; HD6 and d61 were detected by ICIM in 4PL2, but not found by GWAS. For the seven times of common genes detected by both methods, the distance of significant SNPs to the gene was smaller by GWAS for five times, and smaller by ICIM for two times. But for most times, the difference between the two methods was small. The reason may be that the most significant SNPs to the gene were deleted by quality control before linkage map construction and QTL mapping. For example, the most significant SNP marker associated with Psd1 in GWAS was not existed in linkage mapping for 8PL.For the six cloned genes for HD (i.e. qPH1.1 in 8PL and qPH1 in 4PL1 were close to the gene sd1 on the rice physical map, corresponding to MqPH1.7 and MqPH1.6 on the integrated map, respectively. The distance between MqPH1.7 and MqPH1.6 was 1.95\u2009cM. Similar results were observed for qHD8 in 8PL and qHD8 in 4PL2. However, some exceptions were detected. For example, both qHD6.2 in 8PL and qHD6 in 4PL1 were close to the gene Hd3a on the physical map, corresponding to MqHD6.2 and MqHD6.4 on the integrated map, respectively. The distance between MqHD6.2 and MqHD6.4 was 31.24\u2009cM. This phenomenon may have been caused by the difference in marker order between linkage and physical maps.Meta-analysis was used to project QTLs detected in the three populations onto the integrated map. In total, 19 MQTLs affecting HD and 25 MQTLs affecting PH were detected by meta-analysis. Some QTLs with similar physical positions across populations were still projected to similar linkage positions on the integrated map. For example, both MqHD6.1 was located at 10.17\u2009cM on chromosome 6, and IqHD6.1 in 8PL was located at 8.10\u2009cM on the same chromosome. The distance between the two QTLs was 2.07\u2009cM. Whether MQTLs or IQTLs are more reliable requires further investigation. Currently, we are developing a combined analysis in which QTL mapping will be conducted by all individuals from each population and a common genetic map constructed using the combined population.QTL mapping of the three populations based on an integrated map revealed a total of 24 IQTLs affecting HD and 25 IQTLs affecting PH. Compared with the results from the meta-analysis, the numbers of QTLs were similar. Assuming that the length of the confidence interval was 10\u2009cM, 11 QTLs were coincident between MQTLs and IQTLs. For example, In this study, the number of QTLs detected in 8PL was lower than that in 4PL1 and 4PL2, along with lower PVE. The reason may be as follows. Degree of freedom of the LOD test statistic in 8PL is higher than that in 4PL. LOD threshold from permutation tests in 8PL is always higher than that in 4PL. Some QTLs detected in 4PL may not reach the threshold level in 8PL, and therefore were not reported when 8PL was used. This may explain why more QTL were detected in 4PL in this study. However, when four parents carry same alleles, this locus cannot be detected in the pure-line population derived from the four parents. When other four parents carry different alleles, this locus could be detected in the 8PL population. In this situation, more QTL may be detected in 8PL.Therefore, it is more likely a special case that fewer QTLs were detected in 8PL in this study.Genetic variance at one locus depends on both allele frequencies and genotypic values. PVE is the proportion of genetic variance to phenotypic variance. PVE in 8PL could be higher or lower than that in 4PL in terms of the same locus. For example, given that there are only two genotypic values at one locus, i.e., 10 and 8, and each genotype have equal frequency. In 4PL, if three genotypic values are 10 and one is 8, the genetic variance is equal to 0.75. For the same locus in 8PL, if four genotypic values are 10 and the other four are 8, the genetic variance is equal to 1, which is higher than that in 4PL. If seven genotypic values are 10 and the other one is 8, the genetic variance is equal to 0.4375, which is lower than that in 4PL. In addition, background genetic variance and random error variance could also be different between 4PL and 8PL. Therefore, it is more likely a special case that lower PVE was detected in 8PL in this study. We understand that further studies are needed to make perspective comparison on QTL detection using populations derived from different number of parents.a2 and a3 of qHD6.1, a1 and a2 of qHD6.2, a4 and a5 of qHD8 and so on. On the other hand, even if we acquired similar estimated effects, it is still hard to determine whether they are the same alleles or not. Instead, biological information is needed to further determine the number of alleles at each QTL, such as DNA sequence and functional analysis.From the mapping results, it seems that each parent has unique allele and effect in multi-parent populations. In fact, some parents may share same alleles, i.e. the number of unique effect value may be less than the number of parents. However, due to sampling error, the estimated genotypic values are seldom the same even for same alleles; the estimated genotypic values could be similar for genetically different alleles. Therefore, we doubt the exact number of alleles in 4PL or 8PL can be well determined statistically. For convenience, our QTL mapping method assumes different genotypic values for different parents. Despite this, similar effects among parents were observed in many QTLs, which may represent same alleles, for example in Table Compared with bi-parent populations, MAGIC populations contain more alleles and greater genetic diversity. Genetic loci that have no variations in bi-parent populations may have variation in multiple-parent populations because of more alleles are involved. More parents will increase the number of recombination events and improve mapping precision (Huang et al. In summary, individual linkage maps were constructed from three multi-parent rice populations, and an integrated map was built based on the three individual maps. This study produced the first linkage map of an eight-parent RIL population and the first integrated map constructed from multi-parent populations in rice. These maps are necessary for efficient QTL linkage mapping of quantitatively inherited traits. The integrated map supported the comparison and integration of QTLs detected in individual population. QTLs for the traits HD and PH obtained using ICIM based on the three linkage maps were largely coincident with the QTLs detected by a previous GWAS. In addition, ICIM detected more QTLs and explained more phenotypic variance than did the GWAS. The HD and PH QTLs detected by meta-analysis and ICIM based on the integrated map partly overlapped.Additional file 1: Table S1. Phenotypic mean of the eight parentsAdditional file 2: Table S2. Information on the individual mapping population data used for linkage maps and QTL analysisAdditional file 3: Table S3. QTLs for heading date and plant height in the 4PL1 population based on the linkage mapAdditional file 4: Table S4. QTLs for heading date and plant height in the 4PL2 population based on the linkage mapAdditional file 5: Table S5. QTLs for heading date and plant height in the 4PL1 population based on the integrated mapAdditional file 6: Table S6. QTLs for heading date and plant height in the 4PL2 population based on the integrated mapAdditional file 7: Table S7. Physical position of significant SNPs associated with cloned genes detected by GWAS and ICIMAdditional file 8: Figure S1. General information on the markers in the three multi-parent populationsAdditional file 9: Figure S2. Projection of QTLs detected in the three multi-parent populations on the integrated mapAdditional file 10: Figure S3. LOD scores across the genome from QTL mapping based on the integrated map"}
+{"text": "Wolbachia, cytoplasmically inherited endosymbionts of arthropods, are known to hijack their host reproduction in various ways to increase their own vertical transmission. This may lead to the selective sweep of associated mitochondria, which can have a large impact on the evolution of mitochondrial lineages. In Japan, two different Wolbacahia strains (wCI and wFem) are found in two sister species of pierid butterflies, Eurema mandarina and Eurema hecabe. In both species, females infected with wCI  produce offspring with a nearly 1:1 sex ratio, while females infected with both wCI and wFem  produce all\u2010female offspring. Previous studies have suggested the historical occurrence of hybrid introgression in C individuals between the two species. Furthermore, hybrid introgression in CF individuals is suggested by the distinct mitochondrial lineages between C females and CF females of E.\u00a0mandarina. In this study, we performed phylogenetic analyses based on nuclear DNA and mitochondrial DNA markers of E.\u00a0hecabe with previously published data on E.\u00a0mandarina. We found that the nuclear DNA of this species significantly diverged from that of E.\u00a0mandarina. By contrast, mitochondrial DNA haplotypes comprised two clades, mostly reflecting Wolbachia infection status rather than the individual species. Collectively, our results support the previously suggested occurrence of two independent historical events wherein the cytoplasms of CF females and C females moved between E.\u00a0hecabe and E.\u00a0mandarina through hybrid introgression. Eurema mandarina and E. hecabe, are distinct by nuclear gene sequences. The comparison of mitochondrial gene sequence variations revealed two independent occurrences of Wolbachia\u2010associated hybrid introgression. Two sister species of butterflies,  CI is the most common phenotype occurring widely in terrestrial arthropods, wherein uninfected females are reproductively incompatible with infected males due to developmental arrest in their offspring at early embryogenesis, while infected females are compatible with both infected and uninfected males, allowing them to spread rapidly in host populations  , is widely distributed over the Japanese archipelago. Eurema hecabe , a sister species of E.\u00a0mandarina is found to be widely distributed in Asia, Africa, Australia, Okinawa\u2010jima Island and other islands south of it  and wFem (ST40)  exhibit CI, whereas individuals infected with both wCI and wFem  produce only daughters  E.\u00a0mandarina and the other of Wolbachia\u2010infected E.\u00a0mandarina and E.\u00a0hecabe  clearly discriminated E.\u00a0hecabe collected on Ishigaki\u2010jima Island and subjected them to phylogenetic analyses and haplotype network analyses, together with the previously published sequence data of E.\u00a0mandarina How did the two Wolbachia strains (wCI and wFem) move between E.\u00a0mandarina and E.\u00a0hecabe?To verify this possibility, we sequenced ncDNA and mtDNA fragments of 22.1E.\u00a0hecabe were collected on Ishigaki\u2010jima Island  .In total, 61 adult females of 2.2wsp gene to detect either wCI or wFem strains of Wolbachia      were directly sequenced using a BigDye Terminator version 3.1 Cycle Sequencing Kit (Thermo Fisher Scientific K.K.) and analyzed with an ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems Inc.).For the characterization of 2.3Tpi) gene, we used the following primers: 5\u2032\u2013GGTCACTCTGAAAGGAGAACCACTTT\u20133\u2032 and 5\u2032\u2010CACAACATTTGCCCAGTTGTTGCAA\u20133\u2032, located in coding regions  gene was amplified using C1\u2013J\u20131718 (5\u2032\u2013GGGGGGTTTGGAAATTGATTAGTGCC\u20133\u2032) and TL2\u2013N\u20133014 (5\u2032\u2013TCCATTGCACTAATCTGCCATATTA\u20133\u2032)  and the adjacent t\u2010RNA gene were amplified using COX3\u2013F2 (5\u2032\u2013TCAGCTGTTGCTATAATTCAA\u20133\u2032) and COX3\u2013R2 (5\u2032\u2013TATGATTGGAAGTCAAATATA\u20133\u2032) (designed by Naoto Haruyama). The PCR conditions were 94\u00b0C for 5\u00a0min, followed by 35 cycles of denaturation at 94\u00b0C for 30\u00a0s, annealing at X\u00b0C for 30\u00a0s and extension at 72\u00b0C for 30\u00a0s, and final extension at 72\u00b0C for 7\u00a0min, where X was 42.6 for COI, 44.4 for COIII and adjacent t\u2010RNA and 48.7 for Tpi. The PCR products purified by ExoSAP\u2010IT were subjected to a sequencing reaction using a BigDye Terminator v3.1 Cycle Sequencing Kit. The results were then analyzed by an ABI PRISM 3130xl Genetic Analyzer. For those samples that failed to sequence COI, PCR products were gel\u2010excised and purified using a QIAquick Gel Extraction Kit (Qiagen) before the sequencing reaction.To amplify the highly variable intron of the Z\u2010linked triosephosphate isomerase  , partial sequences of the intronic region (413\u00a0bp) of the nuclear Tpi gene were polymorphic in 27 nucleotide sites, constituting 15 haplotypes. Based on these sequences and the E.\u00a0mandarina Tpi dataset published previously \u00a0=\u00a0\u22121,906.27 according to the Tamura 3\u2010parameter model with gamma distribution) was constructed. The tree was topologically split into two clades; one composed of E.\u00a0hecabe, the other of E.\u00a0mandarina  and E.\u00a0mandarina (19 CF and 6 C), concatenated sequences of COI and COIII, including adjacent t\u2010RNA , were polymorphic in 27 nucleotide sites, constituting 12 haplotypes. E.\u00a0mandarina fell into four haplotypes \u00a0=\u00a0\u22123,097.08 according to the Hasegawa\u2013Kishino\u2013Yano model with gamma distribution), the monophyly of C haplotypes (haplotypes 1\u20137) was supported by a bootstrap value of 74%, while that of CF\u2010containing haplotypes (haplotypes 8\u201312) was supported by a bootstrap value of 66% , which was distinct from E.\u00a0mandarina (haplotype 7). On the other hand, the CF\u2010containing clade (haplotype 8\u201312) was divided into two clades: one consisting of E.\u00a0hecabe (haplotypes 8 and 9) and the other of E.\u00a0mandarina (haplotypes 10\u201312). Although estimates of Tajima's D did not imply significant deviation from neutral expectation in any of the categories, estimates of Fu and Li's F and D statistics implied a recent selective sweep in E.\u00a0hecabe CF individuals  . Higher bootstrap support may be obtained by using more informative mtDNA sites with a larger sample size. Alternatively, a more complex evolutionary history might be hidden in these butterflies such as involvement with other species not endemic to Japan.Wolbachia\u2010mediated hybrid introgression has been described in various insect species , which independently induced hybrid introgression between the same butterfly species E.\u00a0mandarina and E.\u00a0hecabe.The occurrence of E.\u00a0mandarina female and an E.\u00a0hecabe male possessed immature ovaries; in the reciprocal cross , however, F1 females possessed fully developed ovaries, even in young adults  and mtDNA haplotypes in E.\u00a0hecabe collected in Southeast Asia. We aligned our sequences together with the published sequences of Narita, Nomura, Kato, et al. ; Data curation (lead); Formal analysis (lead); Funding acquisition (lead); Investigation (lead); Methodology (lead); Visualization ; Writing\u2010original draft (lead); Writing\u2010review & editing . Masashi Nomura: Conceptualization ; Investigation (supporting); Methodology (supporting); Project administration (lead); Writing\u2010review & editing . Daisuke Kageyama: Conceptualization ; Data curation (supporting); Formal analysis (supporting); Investigation (supporting); Methodology (supporting); Project administration (supporting); Writing\u2010review & editing (lead).https://osf.io/537gq/?view_only=6924c0a843af4f8aba167626a7111df7.This article has earned an Open Data Badge for making publicly available the digitally\u2010shareable data necessary to reproduce the reported results. The data is available at Additional file 1Click here for additional data file."}
+{"text": "N robotic agents operating in a workspace which contains regions of interest (RoI), in which atomic propositions for each robot are assigned. The main goal is to design decentralized and robust control laws so that each robot meets an individual high-level specification given as a metric interval temporal logic (MITL), while using only local information based on a limited sensing radius. Furthermore, the robots need to fulfill certain desired transient constraints such as collision avoidance between them. The controllers, which guarantee the transition between regions, consist of two terms: a nominal control input, which is computed online and is the solution of a decentralized finite-horizon optimal control problem (DFHOCP); and an additive state feedback law which is computed offline and guarantees that the real trajectories of the system will belong to a hyper-tube centered along the nominal trajectory. The controllers serve as actions for the individual weighted transition system (WTS) of each robot, and the time duration required for the transition between regions is modeled by a weight. The DFHOCP is solved at every sampling time by each robot and then necessary information is exchanged between neighboring robots. The proposed approach is scalable since it does not require a product computation among the WTS of the robots. The proposed framework is experimentally tested and the results show that the proposed framework is promising for solving real-life robotic as well as industrial applications.This paper presents a scalable procedure for time-constrained planning of a class of uncertain nonlinear multi-robot systems. In particular, we consider  Over the last few years, the field of control of multi-robot systems under high-level specifications has been gaining significant attention . MITL has been originally proposed in Alur and Dill  and has Controller synthesis for multi-robot systems under MITL specifications has been investigated in Nikou et\u00a0al. , KaramanFrazzoli  have addMotivated by the aforementioned, in this work, we aim to address the latter issues. In particular, we deal with nonlinear dynamics in mentclass2pt{minimThe idea of avoiding the global product between the agents lies in the fact that we address the multi-agent coupling with the low-level continuous time control design. More specifically, we exploit the inherent advantage of NMPC with reference to other control techniques: we capture the coupling constraints through the hard constraints of each agent by assuming communication capabilities between the agents. In the same context, all the algorithmic computations are performed offline and the robots are executing online only a sequence of a control actions that are the outcome of the planner. Thus, the latter leads to a framework that is scalable with the number of agents. Our contribution is thus a fully automated framework for a general class of uncertain multi-robot systems consisting of both constructing purely decentralized abstractions and conducting timed temporal logic planning with transient constraints in a scalable way.This paper is structured as follows. In Sect. In this section, the notation that will be used hereafter as well as the necessary mathematical background for nonlinear control systems and formal verification are provided.S, we denote by n-fold Cartesian product, and by M is said to be positive semidefinite  for a fixed r, the mapping s; and it holds that: Khalil  A continRobust Control Invariant (RCI) set for the system, if there exists a feedback control law x(t).Yu et\u00a0al.  ConsiderInput-to-State Stable (ISS) with respect to x(t) exists for all  w(1) (Alur and Dill WTS) is a tuple S is a finite set of states; Act is a set of actions; A weighted transition system (timed run of a WTS is an infinite sequence r(l), time stampstimed wordr(l).A Metric\u00a0Interval\u00a0Temporal\u00a0Logic (MITL) over a set of atomic propositions The syntax of l in the timed word, the satisfaction relation l) is inductively defined as follows:(Souza and Prabhakar Timed B\u00fcchi Automata (TBA) were originally introduced in Alur and Dill  aro aro\\docuThere exist strictly positive constants Assumption entclass1pt{minimai is occupying a ball j that are within the sensing range of agent i at time t as:In the given workspace, there exist unsafe regions, i.e., the robot is required to avoid visiting them (safety specifications).The goal of this paper is to design decentralized feedback control laws that steers the robots with dynamics as in \u20131b) bet bet1b) bassociated with a timed runas soon as its entire volume is strictly contained in the corresponding RoI;A trajectory satisfies an MITL formula A trajectory mentclasspt{minimaWe assume that the volume of each robot is covered by a ball. We further assume that the obstacles can be modeled by RoI that are also balls. Even if the volume of an agent and/or an obstacle is not a ball, it can be over-approximated by a ball.The problem considered in this paper is stated as follows:N robots governed by dynamics (Consider dynamics \u20131b), co, coN robfined in . The wormentclasspt{minimaNote that Problem In Sects. Then, by using the outcome of Sect. By invoking ideas from our previous work  occ occi witDefine the sets that capture the state constraints of each robot as:It is assumed that:More specifically,  states tT stands for the finite prediction horizon. It holds that T are multiples of h. At every discrete sampling time Consider a sequence of sampling times Hereafter, the sets e DFHOCP \u201312d) is is\\docume DFHOCP \u20139b), th, th\\docugiven in , 16b), , \\documeFor each agent n system \u20138b) and and\\docun system \u20139b) wit wit\\docuThe state feedback laws designed by:dynamics , 13b), , 14\\docuA backstepping control methodology will be used  is is\\documtisfying . Then, iame with  and compame with  we get:\\entclass1pt{minimaThus, The aforementioned result states that real trajectories entclass1pt{minimaIt should be noted that the volume of the hyper-tubes depends on the upper bound of the disturbances \u03c1i as in , 17) ap ap\\documBy using , the cloN]. After each sampling time i solves its own DFHOCP and obtains the estimated open-loop trajectory i, i.e., N], solves its own DFHOCP , we , we \\docT time units. These pieces of information are required, as each agent\u2019s trajectory is constrained not by constant values, but by the trajectories of its associated agents through time: at each solution time T time units, an agent\u2019s predicted configuration at time always available, accurate and can be exchanged without delay. We will show thereafter that by adopting the aforementioned sequential communication procedure, and given that at In other words, each time an agent solves its own individual optimization problem, it knows the (open-loop) state predictions that have been generated by the solution of the optimization problem of all agents within its sensing range at that time, for the next e DFHOCP \u201312d) of ofT timeIt should be noted that the constraint sets i\u2208[N] in  depend oBy considering a real-time scenario where the state vector The following theorem guarantees the navigation of the agents between RoI and thereafter we will propose algorithms computing the corresponding transition times.Suppose that Assumptions e DFHOCP \u201312d) se se\\documtrol law , 14), r, r\\documtrol law \u201319b) of of\\documThe proof of the theorem consists of two parts:Feasibility Analysis: It can be shown that recursive feasibility is established and it implies subsequent feasibility. The proof of this part is similar to the feasibility proof of , , ConvergSince only the nominal system dynamics \u20139b) are are9b) ae DFHOCP \u201312d), b, b\\docume DFHOCP , it can ombining \u201320b) wi wi\\documi will be included strictly within the RoI i from RoI Theorem cs as in , 1b), s, s\\documntroller  towards bserving  and takie DFHOCP \u201312d) wi wi\\documi in the workspace i between RoI;trollers  which cati as in  which cagiven in  and it iand mentclass2pt{minimThe motion of robot The aforementioned WTS of each robot allows us to work directly at the discrete level and design a sequence of feedback controllers as in  that sole system \u20131b), as, as\\documentclasspt{minimaFigure In view of Algorithm 3,  and the i needs to follow in order to satisfy the formula. The function a,\u00a0b], More specifically, the input to Algorithm 4 is the transition times of each agent and the output is the updated realistic transition times denoted by The solution that it is obtained from the controller synthesis procedure provides a sequence of feedback control laws i) as in  that guacs as in \u20131b), th, th\\docuC1: the computational complexity of the offline construction of WTS C2: Algorithm 2 is an offline computer simulation and the computational complexity is the same with the complexity of a nominal NMPC algorithm;C3: Algorithm 3 is an offline computer simulation of collision detection which scales with the number of agents;C4: the DFHOCP (e DFHOCP \u201312d) is isC4: thBy taking into account that C1 is standard in timed verification, and the fact that C2, C4 have the same complexity with nominal NMPC, and C3 is a computer simulation that scales with the number of agents, the proposed approach is scalable with the number of agents.The proposed framework consists of the computational complexity of the following steps:In this section the efficacy of the proposed framework via a real-time experiment employing mentclass2pt{minimsee Fig. . Moreovesee Fig. .the RoI the RoI The control input constraints of each robot are set to:The state of each robot is mentclass2pt{minimThe desired MITL tasks are set to:nd _{10,2} \\{ \\texond _{60,5} \\{ \\teVideo: A video demonstrating the experiment of this section can be found in the following link: https://www.youtube.com/watch?v=9ZNVlEjKZ9g.N robots operating in a bounded workspace which contains RoI, assigned with tasks given in MITL, a framework for efficiently designing decentralized feedback control laws that guarantee the satisfaction of the corresponding tasks has been provided. The controllers are the outcome of DFHOCP solved by each robot at each sampling time and form the actions of the WTS. By proposing high-level controller synthesis algorithms, a sequence of feedback laws for each robot can be designed. The approach is scalable since the local products are computed offline and only the DFHOCP of each robot is computed online which has complexity similar with the nominal NMPC framework. Future research directions will be devoted towards incorporating event-triggered strategies between he robots in order to save valuable actuation and sensing resources.In this paper, a scalable framework for time-constrained planning of multi-robot systems has been proposed. Considering"}
+{"text": "Metastasis directed therapy (MDT) for patients with oligometastatic disease is associated with improvements in progression free survival (PFS) and overall survival (OS) compared to systemic therapy alone. Additionally, within a prostate-cancer-specific cohort, MDT is able to forestall initiation of androgen deprivation therapy (ADT) in men with hormone-sensitive, oligometastatic prostate cancer (HSOPCa) compared to observation. While MDT appears to be safe and effective in HSOPCa, a large percentage of men will eventually have disease recurrence. Patterns of failure in HSOPCa demonstrate patients tend to have recurrence in the bone following MDT, raising the question of sub-clinically-apparent osseous disease. Radium-223 dichloride is a radiopharmaceutical with structural similarity to calcium, allowing it to be taken up by bone where it emits alpha particles, and therefore might have utility in the treatment of micrometastatic osseous disease. Therefore, the primary goal of the phase II RAVENS trial is to evaluate the efficacy of MDT\u2009+\u2009radium-223 dichloride in prolonging progression free survival in men with HSOPCa.Patients with HSOPCa and 3 or less metastases with at least 1 bone metastasis will be randomized 1:1 to stereotactic ablative radiation ) alone vs SABR + radium-223 dichloride with a minimization algorithm to balance assignment by institution, primary intervention, prior hormonal therapy, and PSA doubling time. SABR is delivered in one to five fractions and patients in the SABR + radium-223 dichloride arm will receive six infusions of radium-223 dichloride at four-week intervals. The primary end point is progression free survival. The secondary clinical endpoints include toxicity and quality of life assessments, local control at 12\u2009months, locoregional progression, time to distant progression, time to new metastasis, and duration of response.The RAVENS trial will be the first described phase II, non-blinded, randomized study to compare SABR +/\u2212 radium-223 dichloride in patients with HSOPCa and 3 or less metastases with at least one bone metastasis. The primary hypothesis is that SABR + radium-223 dichloride will increase median progression-free survival from 10\u2009months in the SABR arm to 20\u2009months in the SABR + radium-223 dichloride arm.NCT04037358. Date of Registration: July 30, 2019. Date of First Participant Enrolled: August 9, 2019. Date of Last Approved Amendment: October 16, 2019. Protocol Version: Version 5.Clinicaltrials.gov. Identifier:  Cancer is currently the second leading cause of death annually in the United States, often times due to the development of metastatic disease. Systemic therapies are first line treatments in these instances and they improve survival in patients with metastatic disease. However, they are generally not considered curative for patients with solid metastatic tumors. While systemic therapies improve outcomes, that improvement can come at the expense of side effects that negatively impact patients\u2019 quality of life . Thus, tAs the experience treating metastatic disease has evolved, so too has our understanding of the natural history and biology of metastatic cancer. Metastatic disease appears to act along a spectrum that ranges from a single macroscopic metastatic deposit to widespread metastatic disease . Cases wThe feasibility of MDT has been aided by the development of stereotactic ablative radiation (SABR), a precise form of radiation therapy that allows delivery of high doses of radiation in a small number of treatment sessions. The high lesional control rates seen with SABR, in conjunction with its modest side effect profile, have since resulted in an increasing trend to treat oligometastatic lesions in an attempt to improve overall survival (OS) and progression free survival (PFS), delay initiation of systemic therapies with unfavorable toxicity profiles, and offer treatment breaks for individuals amassing toxicity from systemic therapy .There is now a reasonable body of literature demonstrating the importance of local therapy in patients with oligometastatic disease. Initial evidence came from trials of non-small cell lung cancer (NSCLC) that randomized patients with de novo oligometastatic disease without progression on systemic therapy to continued maintenance systemic therapy/observation or consolidative local therapy and demonstrated improved PFS and OS with local therapy , 9. FurtWithin the prostate cancer literature, numerous retrospective reports have documented the safety and feasibility of using SABR to treat oligometastatic lesions. However, the STOMP trial represented the first reported prospectively randomized trial of MDT for a prostate cancer cohort and investigated the ability of SABR to forestall initiation of androgen deprivation therapy (ADT) in men with HSOPCa with three or fewer detectable metastases. The primary endpoint was ADT-free survival, which was lengthened in men randomized to MDT versus observation 21 vs 13\u2009months) , 12. Our\u2009months ,223Ra]RaCl2, is a radiopharmaceutical approved by the US FDA for use in the treatment of castration-resistant prostate cancer (CRPC) with osseous metastases [223Ra]RaCl2. However, the short range of alpha particles relative to the size of marrow cavities (19) allows 223Ra to treat osseous metastases while sparing normal tissue including bone marrow, leading to minimal side effects [223Ra]RaCl2 in the treatment of osseous metastases in CRPC was demonstrated in a phase III randomized trial, the ALSYMPCA study, in which 921 patients were randomly assigned in a 2:1 ratio to receive six injections of [223Ra]RaCl2 every 4\u2009weeks or matching placebo. Those receiving [223Ra]RaCl2 experienced a survival benefit  and an improvement in quality of life [223Ra]RaCl2 in men with HSOPCa and at least one osseous metastasis.While MDT appears to be associated with favorable outcomes in HSOPCa, a large percentage of men will eventually have disease recurrence. Patterns of failure in HSOPCa treated with MDT demonstrate that patients tend to have recurrence in an osseous site following MDT regardless of the site of the initial treated lesion , 15. Thitastases , may weltastases . Traditi effects \u201320. The  of life . TherefoThis study was approved by the Institutional Review Board (IRB) of Johns Hopkins University (IRB00188450). The RAVENS trial is registered at the US National Institutes of Health  #NCT04037358.Primary Objective223Ra]RaCl2.To assess progression-free survival of men who have HSOPCa after randomization to SABR versus SABR and [Secondary Objectives223Ra]RaCl2 in patients with HSOPCaTo assess the toxicity of SABR + [223Ra]RaCl2 in patients with HSOPCaTo determine local control at 12-months following SABR versus SABR + [223Ra]RaCl2.To assess time to locoregional progression, time to distant progression, time to new metastasis, and duration of response following SABR versus SABR + [223Ra]RaCl2.To assess ADT-free survival following SABR versus SABR + [223Ra]RaCl2.To assess quality of life following SABR versus SABR + RaCl2 defined as: the absolute neutrophil count (ANC) should be \u2265\u20091.5\u2009\u00d7\u2009109/L, the platelet count \u2265\u2009100\u2009\u00d7\u2009109/L and hemoglobin \u2265\u200910\u2009g/dL.Patients must have normal organ and marrow function before the first administration of RaCl2 arm  with differential, LDH, serum chemistry, and testosterone will be obtained within 6\u2009months prior to enrollment.Demographics, medical history, concomitant medications, physical exam, performance status, height and weight will be obtained within 30\u2009days prior to enrollment.The following will need to be completed prior to enrollment:Vital signs and weight.LDH, serum chemistry, PSA, CAPP-seq, EPIC-HD-CTC, Immuno-SEQ, immunophenotyping, and rectal swab.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091.5 * 109/L and platelets \u2265\u2009100 * 109/L)CBC with differential (prior to [Brief pain inventory (short form) and common terminology criteria for adverse events (CTCAE) v4 adverse event evaluation.The following will need to be completed on Day 1:223Ra]RaCl2 arm only):Vital signs and weight.The following will need to be completed between Day 1 and Day 15 .The following will need to be completed between Day 1 and Day 61, during the patient\u2019s SABR visit:Invitae Multi-Cancer PanelThe following will need to be completed between Day 1 and Day 361:223Ra]RaCl2 arm only)Vital signs and weight.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091 * 109/L and platelets \u2265\u200950 * 109/L)CBC with differential (prior to [The following will need to be completed between Day 29 and Day 43 (SABR + [223Ra]RaCl2 arm only)Vital signs and weight.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091 * 109 / L and platelets \u2265\u200950 * 109 / L)CBC with differential (prior to [The following will need to be completed between Day 57 and Day 71 (SABR + [223Ra]RaCl2 arm only)Vital signs and weight.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091 * 109 / L and platelets \u2265\u200950 * 109 / L)CBC with differential .CBC with differential, LDH, serum chemistry, testosterone, PSA, CAPP-seq, Immuno-SEQ, immunophenotyping, and rectal swab.The following will need to be completed on Day 91:223Ra]RaCl2 arm only)Vital signs and weight.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091 * 109 / L and platelets \u2265\u200950 * 109 / L)CBC with differential (prior to [The following will need to be completed between Day 113 and Day 127 (SABR + [223Ra]RaCl2 arm only)Vital signs and weight.223Ra]RaCl2 infusion, patients must meet ANC\u2009\u2265\u20091 * 109 / L and platelets \u2265\u200950 * 109 / L)CBC with differential .CBC with differential, LDH, serum chemistry, testosterone, PSA, CAPP-seq, immunophenotyping, and EPIC HD-CTC.Bone scan and CT of the abdomen and pelvis or MRI of the pelvis..The following will need to be completed on Day 181:Interval medical history, interval concomitant medications, limited physical exam, performance status, CTCAE v4 adverse event evaluation, and the Brief Pain Inventory (short form).CBC with differential, LDH, serum chemistry, testosterone, PSA, CAPP-seq, and immunophenotyping.Bone Scan and CT of the abdomen and pelvis or MRI of the pelvis.The following will need to be completed on Day 361:SABR Treatment PlanningCT- and/or MRI-simulation will be performed with fabrication of a radiation therapy immobilization device (such as the Alpha Cradle) which will be custom made for each patient. The treating radiation oncologist will identify the location of the tumor. Gross tumor volume (GTV) delineation will be performed with a diagnostic radiologist on sequential axial computed tomography images. A radiosurgical treatment plan will be developed based on tumor geometry and location. The clinical tumor volume (CTV) will equal the GTV. The dose will be prescribed to the minimal isodose line that completely covers the planning target volume (PTV) which is equal to CTV plus a 3\u20135\u2009mm margin). Adjacent normal structures including but not limited to the heart, esophagus, aorta, spinal cord, kidneys, rectum, bowel, liver, and stomach within 5\u2009cm of the CTV will be identified for the purpose of limiting incidental radiation to these structures.In addition, prior to treatment delivery, a four-dimensional cone beam CT study will be performed on individual patients to assess respiration in these patients and to determine tumor targeting accuracy for those tumors that may be subject to respiratory motion such as those in the bones of the thorax. If tumor motion is greater than 5\u2009mm, PTV will be expanded to account for respiration.SABR will be delivered in 1 to 5 fractions, and the dose and fractionation schedule will depend on the size and location of the lesion and the surrounding normal tissue constraints in accordance with AAPM Task Group 101 recommendations. Typical doses include 16\u201324\u2009Gy in 1 fraction, 48\u201350\u2009Gy in 4 fractions, and 40\u201360\u2009Gy in 5 fractions.223Ra in [223Ra]RaCl2 is based on the US National Institute of Standards and Technology\u2019s (NIST) primary standardization. The US NIST prepares the standard reference material (SRM) using an official dial setting (primary standardization) as published RaCl2 is available in single-use vials containing 6\u2009mL of solution at a concentration of 1100\u2009kBq/mL (29.7\u2009\u03bcCi/mL)  before implementation of the NIST quantification update) at the reference date with a total activity of 6600\u2009kBq/vial   before implementation of the NIST quantification update) at the reference date.[223Ra]RaCl2, the ANC will be \u22651.5\u2009\u00d7\u2009109/L, the platelet count \u2265100\u2009\u00d7\u2009109/L and hemoglobin \u226510\u2009g/dL. Before subsequent administrations of [223Ra]RaCl2, the ANC should be \u22651\u2009\u00d7\u2009109/L and the platelet count \u226550\u2009\u00d7\u2009109/L. If there is no recovery to these values within 6 to 8\u2009weeks after the last administration of [223Ra]RaCl2, despite receiving supportive care, further treatment with [223Ra]RaCl2 will be discontinued. Patients with evidence of compromised bone marrow reserve will be monitored closely and provided with supportive care measures when clinically indicated. [223Ra]RaCl2 will be discontinued in patients who experience life-threatening complications despite supportive care for bone marrow failure.Before the first administration of [223Ra]RaCl2 is 55\u2009kBq (1.49\u2009\u03bcCi)  before implementation of the NIST quantification update) per kg body weight, given at 4-week intervals for 6 injections [The dose regimen of [jections .223Ra]RaCl2 arm. If it becomes evident that the proportion of grade 4/5 toxicity at specific sites convincingly exceeds 20%, the study will be halted for a safety consultation RaCl2 in HSOPCa patients. The minimization approach RaCl2 in men with HSOPCa will also be determined by measuring local control of each lesion at 12-months.The efficacy of SABR + [Quality of life will be assessed using the Brief Pain Inventory form. An overall score will be calculated pre-treatment and at the time of the 2nd radiologic reassessment. The change in score will be evaluated with a paired t-test.Sample Size223Ra]RaCl2 will be able to reduce the risk of progression by 50%. A sample size using a 1:1 randomization scheme of 30 patients per arm will provide 80% power to detect an increase of median PFS from 10\u2009months to 20\u2009months (corresponding to hazard ratio 0.5) with type I error\u2009=\u20090.1, using a one-sided log-rank test. The calculation assumes 18\u2009months of accrual time with an additional follow-up of 12\u2009months after the last patient is randomized. To account for 5% early drop out, we will randomize a total of 64 patients (32 per arm).The primary endpoint will be PFS. Data from STOMP  on this Secondary objectives will be analyzed as follows:Historically, aggressive local therapy has not been used in the management of patients with metastatic disease. However, with improvements in local and systemic therapy options there has recently been great interest in integrating local therapies into the management of patients with metastatic disease. This is especially the case in patients with \u201coligo,\u201d or few sites of metastases, who may benefit with aggressive consolidation of all macroscopic disease , 30\u201342.223Ra]RaCl2 might be suited for integration into the treatment of these patients given its systemic distribution. The ALSYMPCA trial, which enrolled men with metastatic CRPC, randomized men to [223Ra]RaCl2 or placebo and demonstrated a survival benefit for those treated with [223Ra]RaCl2. Of these patients, 85% had >\u20096 bone lesions at treatment, so [223Ra]RaCl2 is capable of treating high volume disease RaCl2 a powerful tool in forestalling disease recurrence given reported patterns of failure. Several other methods of treatment intensification are currently being investigated within the oligometastatic PCa realm, the most logical of which would be to add additional systemic therapies to MDT. Evidence suggests that the addition of a course of ADT to SABR is associated with promising outcomes. For example, a cohort of 28 men with HSOPCa at Johns Hopkins Hospital treated with a median of 4.3\u2009months of ADT after MDT experienced a 24-month biochemical PFS of 77%, with only 18% of men having restarted ADT at that time RaCl2 for patients with oligometastatic prostate cancer with 3 or less metastases and at least one bone metastasis with the primary goal of achieving improved PFS to 20\u2009months for the patients in the SABR + [223Ra]RaCl2.The clinical results of MDT in HSOPCa are promising but would benefit from continued novel therapeutic strategies to continue to improve outcomes. Therefore, the RAVENS trial aims to compare MDT alone to MDT plus [A Data Monitoring Committee is in place to monitor the trial. Data and safety monitoring oversight is conducted by the Sidney Kimmel Comprehensive Cancer Center (SKCCC) at Johns Hopkins Safety Monitoring Committee. Per the SKCCC at Johns Hopkins Safety Monitoring plan, the CRO AQ will forward summaries of all monitoring reports to the Safety Monitoring Committee for review."}
+{"text": "Cholesterol is responsible for the plasticity of plasma membranes and is involved in physiological and pathophysiological responses. Cholesterol homeostasis is regulated by oxysterols, such as 25-hydroxycholesterol. The presence of 25-hydroxycholesterol at the membrane level has been shown to interfere with several viruses\u2019 entry into their target cells. We used atomic force microscopy to assess the effect of 25-hydroxycholesterol on different properties of supported lipid bilayers with controlled lipid compositions. In particular, we showed that 25-hydroxycholesterol inhibits the lipid-condensing effects of cholesterol, rendering the bilayers less rigid. This study indicates that the inclusion of 25-hydroxycholesterol in plasma membranes or the conversion of part of their cholesterol content into 25-hydroxycholesterol leads to morphological alterations of the sphingomyelin (SM)-enriched domains and promotes lipid packing inhomogeneities. These changes culminate in membrane stiffness variations. Lipid membranes are composed of a plethora of phospholipids, sphingolipids and sterols. Usually, mammalian cell membranes have higher proportions of phospholipids, such as phosphatidylcholine and phosphatidylethanolamine, and lower percentages of sphingolipids and sterols, namely, sphingomyelin (SM) and cholesterol (Chol) . Lipid bo) phase in coexistence with a liquid-disordered (Ld) phase [The specificity of membrane lipid organization guides cellular pathways and functionalities, such as cell polarization and trafficking, signal transduction, cell growth, migration and the entry of viruses, bacteria and nanoparticles . Lipid rd) phase ,7. Compad) phase .Cholesterol homeostasis is regulated by itself as well as by oxysterols . 25-HydrMolecular dynamic simulations were also used to evaluate how 25HC interferes with lipid membranes. It was shown that it facilitates membrane bending when compared to cholesterol. Additionally, 25HC adopts a tilted orientation in membranes, with the isooctyl tail bent upwards and the 25-hydroxyl group facing polar head groups .Early studies on 25HC effects were related to atherosclerosis disease progression due to the deregulation of its levels ,16. HoweIn this work, we used atomic force microscopy (AFM) and AFM-based force spectroscopy to assess the membrane modulation effects of 25HC. The experimental method proposed enables the imaging of the supported lipid bilayer (SLB) structure and the quantification of membrane mechanical resistance, allowing us to evaluate the effects of 25HC in different domains of the same lipid bilayer. sn-glycero-3-phosphocholine (DOPC), SM and Chol  yielded differences in height (or thickness) between the Lo and Ld phases of 0.6 \u00b1 0.1 nm  background of the DOPC-enriched Ld phase . These bilayers presented a phase separation with a height difference of 1.0 \u00b1 0.1 nm D and a fo phase in the equimolar DOPC:SM:Chol SLBs occupied 45 \u00b1 5% of the entire membrane area . As shown in The SM and Chol-enriched LDespite the observation of SLB morphology shed some light on the membrane-level effects of 25HC, it does not reveal quantitative lipid bilayer mechanical properties. Thus, to further evaluate the effects of 25HC, we used AFM-based force spectroscopy to quantify the force necessary to disrupt the lipid bilayer packing.2. The breakthrough force is the maximum force load that a bilayer can hold until its rupture, which allows the measurement of the bilayer mechanical stability. \u22121. The lower loading rate allows the softer bilayer sample to be indented by the AFM probe until it cannot hold the force anymore. When the membrane can no longer stand the force applied by the AFM tip, it breaks through the lipid bilayer down to the mica substrate, where it keeps on bending until the selected loading force of 10\u201315 nN is reached. o domains of the ternary mixture of DOPC:SM:Chol (1:1:1) collapse at higher forces than the Ld domains . The values obtained are near those measured by others at the same loading rate [We performed force spectroscopy maps on several areas of the SLBs, selected in a low-resolution images of 16 \u00d7 16 pixels  or 32 \u00d7 32 pixels (1024 force curves), in a membrane area of 4 \u00b5ming rate .o domains, which is reflected by a higher variability of the breakthrough force values of rupture events in different areas of the domains. In some SLB areas, the presence of 25HC softens the SM-enriched Lo domains to lower values, with breakthrough values of 0.7 \u00b1 0.4 nN. These results have a statistically significant variation relative to the breakthrough values obtained for the Lo domains of DOPC:SM:Chol (2:2:1) and DOPC:SM:Chol (1:1:1) SLBs: 5.2 \u00b1 1.9 nN and 5.8 \u00b1 2.5 nN, respectively. In other bilayer areas, 25HC incorporation in the domains yielded higher breakthrough forces  led to a marked effect on the mechanical properties B. 25HC io phase of SM-enriched domains was not detectable at the maximum load used in these studies (10\u201315 nN).To prove that we are evaluating the breakthrough of such SM-rich domains, we conducted the same type of experiments in DOPC:SM (1:1) bilayers B. The brd domains of all the bilayers studied, the membranes with 25HC showed a tendency to have decreased breakthrough forces of 2.5 \u00b1 1.0 nN  bilayers, one can find a heterogeneous height distribution . We coulo) areas, as seen by others in binary equimolar mixtures of DOPC with SM [o domains of the DOPC:SM (1:1) bilayers at the maximum payload used in the studies supports our hypothesis (d matrix of DOPC:SM:25HC (1:1:1) mixtures, suggesting a homogenous distribution of 25HC in this phase. The tendency towards lower values of breakthrough force of the Ld matrix on 25HC bilayers, when compared to the Ld matrices of the other studied bilayers , egg sphingomyelin (SM) and 25-hydroxycholesterol (25HC) were purchased from Avanti Polar Lipids . Cholesterol (Chol) was from Sigma-Aldrich . The working buffer used throughout the studies was HEPES 10 mM pH7.4 in NaCl 150 mM, prepared using Milli-Q water, unless otherwise stated.1,2-Dioleoyl-g to remove titanium particles, large vesicles and debris. Phospholipids and Chol were dissolved in chloroform in 5 mM stock solutions. 25HC was dissolved in ethanol, yielding 24.8 mM stock solutions. SLBs were formed by the vesicle fusion rupture method ,36. Lipi2 in a custom-built well. The sample was incubated in a humidity chamber at 60 \u00b0C, above all lipids\u2019 main transition temperature, for 40 min. This procedure allows small unilamellar vesicles (SUVs) to adsorb and rupture on the surface of the mica, forming a flat continuous bilayer [After this, 500 \u00b5L of 10\u00d7 diluted lipid suspension was pipetted onto freshly cleaved mica along with a 3 mM final concentration of CaCl bilayer ,36.After incubation, the bilayer was washed 10\u201325 times with 100 \u00b5L of warm (60 \u00b0C) HEPES buffer or Milli-Q water using a pipette. The washing procedure was performed parallel to the bilayer surface. This ensures that unfused vesicles, either in suspension or deposited on the bilayer surface, are removed. In all samples, the hydrated bilayers were cooled down at room temperature, enabling phase separation to occur.Atomic force microscopy was performed using a JPK Nanowizard IV . Bilayers were imaged in contact mode and quantitative imaging (QI) mode, a recent innovation in which the apparatus modulates the z-piezo to perform a fast force curve on each pixel of the image ,38. This2 and 20 \u03bcm2 from at least 3 bilayers, prepared on different days, from different lipid stocks, were imaged to obtain representative data and assure the reproducibility of the measurements.Before measurements, cantilever spring constants were quantified by the thermal noise method , and canTopographical images were analyzed with first or second level flattening, using the JPK data-processing software. A custom written code in Python was used to obtain the image\u2019s height difference between the immiscible and fluid phases and their domain area ratios on the whole SLB. Open source ImageJ software codes were used for imaging analysis to obtain quantitative data of domain areas and corroborate the weights of the domain area ratio calculated from the Gaussian fit.2 (16 \u00d7 16 or 32 \u00d7 32 pixels) bilayer areas using the same OMCL-TR400PSA AFM probes. Typically, an applied load of up to 10\u201315 nN and a piezo loading rate of 200 nm.s\u22121 were used. The collected force curves were batch-analyzed using a self-developed Python program. Briefly, for each approach curve, the program looks for a negative difference between two consecutive force values within a range of 1\u20134 nm piezo displacement. Upon finding this negative difference, the program stores the force value corresponding to the approach curve of that pixel. A force map is then built based on the measured breakthrough force for each pixel.Force mapping experiments were conducted over 4 \u03bcmIn summary, we show that 25HC modulates the membrane structure by reverting the lipid condensing effects typical of the presence of cholesterol, rendering the bilayers less rigid. Furthermore, the distribution of 25HC in lipid membranes seems dispersed in both liquid-disordered and liquid-ordered phases. By the methodologies applied in this study, we could dissect the effect of 25HC in each phase. The structural effects of 25HC observed on lipid membranes should be translated with caution to biological systems. Several physiological mechanisms require cholesterol-induced lipid condensing effects, the so-called lipid raft formation, for receptor clustering, such as T-cell receptor clustering and/or signaling activation pathways . From th"}
+{"text": "NFHS-4 stated high unmet need for family planning (FP) among married women in Uttar Pradesh. Unmet need is highest among age groups: 15\u201319 and 20\u201324\u2009years. Currently few data is available about unmet need for FP among vulnerable section of the community, i.e.15\u201324\u2009year\u2019s age group living in the urban slums. Therefore this study was conducted to assess the unmet need for FP services and its determinants among this under-privileged and under-served section of society residing in urban slums of Uttar Pradesh, India.Cross sectional study was conducted in the slums of Lucknow, India. One Urban-Primary Health Centre (U-PHC) was randomly selected from each of the eight Municipal Corporation zones in Lucknow and two notified slums were randomly selected from each U-PHC. All the households in the selected slums were visited for interviewing 33 young married women (YMW) in each slum, with a pre-structured and pre tested questionnaire, to achieve the sample size of 535. Analysis of the data was done using logistic regression.The unmet need for family planning services among YMW was 55.3%. About 40.9% of the unmet need was for spacing methods and 14.4% for limiting methods. Important reasons cited for unmet need for family planning services were negligent attitude of the women towards family planning, opposition by husband or others, embarrassment / hesitation / shyness for contraceptive use, poor knowledge of the FP method or availability of family planning services. Among method related reasons health concerns and fear of side effects were frequently cited reasons. On multiple logistic regression: age, educational status, duration of marriage, number of pregnancies, knowledge of contraceptive methods, opposition to contraceptive use and contact with Auxiliary Nurse Midwife (ANM) showed independently significant association with unmet need for family planning services.Unmet need for family planning services is very high among the YMW of urban slums. The findings stress that program managers should take into cognizance these determinants of high level of unmet need for family planning among YMW and make intense efforts for addressing these issues in a holistic manner. United Nations Population Division states that by 2050, approximately 66% of the globe\u2019s population will live in urban areas . The urbThe unmet need for family planning among all ages (15\u201345\u2009years) married women in India is 12.9%  with unmLarge population with relatively high fertility due to low use of contraceptives by this age group (15\u201324\u2009years) and living in suboptimal conditions makes them the most preponderate group for family planning services from public health perspective . To catcTo assess the unmet need for family planning services among the young married women living in urban slums of Lucknow, India.To explore the facttors influencing the unmet need of family planning services among the young married women.Cross sectional study.The study was conducted in the catchment slums of Urban-Primary Health Centres (UPHCs) of Lucknow. Lucknow, the capital of Uttar Pradesh is situated 123\u2009m above sea level. It is situated between 26.30 and 27.10 North Latitude and 80.10 and 80.30 East Longitude. Lucknow has a population of 2,817,105, of which around 12.95% resides in slums with substandard living conditions . Health The study was conducted from August 2015 to July 2016.All the Young married women (15\u201324) living in urban slums.Currently married young women in the age group of 15\u201324\u2009years. .Young married women (15\u201324) living in the urban slums of Lucknow.Young married woman (15\u201324) currently living in the urban slums of Lucknow for at least 6 months. However, women who were currently pregnant or had undergone hysterectomy/ bilateral oophorectomy or were divorced / separated / disserted from their husband were excluded from the study.2*p*(1-p)/ d2. Taking the unmet need of family planning services in Uttar Pradesh (p) as 14.6% (AHS 2012\u201313) [3% and the value of the standard normal variable at 0.05 (two sided) level of significance (z) as 1.96, the sample size was calculated to be 533.Sample size was calculated by the following formula, n\u2009=\u2009z2012\u201313) , an allo586. Excluding 37 non responding women; a sample of 535 was analyzed  to improve the health status of the urban poor particularly the slum dwellers and other disadvantaged groups by provisioning access to quality primary health care services along with strengthening the existing capacity of health delivery systems leading to improved health status and quality of life. A U-PHC caters to a population of 50,000. Currently, there are 52\u2009U-PHCs in Lucknow.It includes services that enable individuals to determine freely the number and spacing of their children and to select the means by which this may be achieved.Include contraceptive pills, condoms, injectables, intrauterine devices (IUDs / PPIUDs) and emergency contraception.Include male and female sterilization.The percentage of women of reproductive age who are not using any modern method of family planning but who would like to postpone the next pregnancy (unmet need for spacing) or do not want any more children (unmet need for limiting). The sum of the unmet need for limiting and the unmet need for spacing is the total unmet need for family planning.It includes fecund women who are neither pregnant nor amenorrhoeic, who are not using any modern spacing method of family planning, and say they want to wait two or more years for their next birth. Also included in unmet need for spacing are fecund women who are not using any modern method of family planning and say they are unsure whether they want another child or who want another child but are unsure when to have the birth.It refers to fecund women who are neither pregnant nor amenorrhoeic, who are not using any modern limiting method of family planning, and who want no more children.Refers to those currently married women who want to space births or limit the number of children and are using modern contraceptive methods to avoid unwanted or mistimed pregnancies.The total demand for family planning is the sum of unmet need and met need.Government of India to classify castes which are educationally or socially disadvantaged [A pre-designed and pre-tested interview schedule [see Additional\u00a0file\u00a0vantaged . Schedulvantaged . YMW abovantaged . Modifievantaged . Autonomvantaged  of the wDuring the visits to the slums, the investigator approached the young married women fulfilling the inclusion criteria and after explaining then about the study; an informed consent was sought from them for their participation in the study. Complete confidentiality and anonymity of the respondents was maintained. Written and informed consent was taken. The study included 535 YMW who met the inclusion/exclusion criteria for the study.p value <\u20090.05 was considered statistically significant.Descriptive summary using frequencies, percentages, graphs and cross tabs were used to present study results. Univariate analysis was performed using binary logistic regression and the factors which were found significant during univariate analysis were forwarded to multiple logistic regression model in a step wise manner for calculation of Adjusted Odds Ratio. A The total demand for family planning among the young married women living in urban slums of Lucknow was 87.6% (68.2% for spacing and 19.4% for limiting). Findings  and about 48.2% of them belonged to other backward classes (OBCs)  of the women in the age group of 15\u201319\u2009years were nulliparous as compared to older age group (15.7%). About half (54%) of the older women had \u22652 children (Table Knowledge of contraceptives was significantly low 9.1%) in the younger women as compared to women in the older age group (90.9%) (Table % in the More than two-third 69.2%) of the women in the study cited embarrassment / hesitancy / shyness to be a reason for unmet need for contraception. Knowledge of family planning methods and place where FP services are available was significantly low in 15\u201319\u2009years age group in comparison to older age group (Table % of the Majority (90.9%) of the women in the age group of 15\u201319 had an unmet need for family planning services. The increase in age group was found to be significantly associated with decrease in unmet need. Women of the 15\u201319\u2009year age group were about 3 times more likely to have an unmet need than women of the age group (20\u201324\u2009years) (Table Religion was found to be significantly associated with unmet need for family planning services. More unmet need was observed among Hindus 83.4%) as compared to Muslims (69.8%)  (Table .4% as coMajority (87.6%) of the women of scheduled caste\u00a0/ scheduled tribe (SC/ST) category had an unmet need for family planning services. Women belonging to the other categories were significantly less likely to have an unmet need than those belonging to SC / ST category  Table .The unmet need of family planning services was found to be significantly higher among the illiterate women (92.9%). Women who were literate were less likely of having unmet need for family planning services as compared to illiterate women . Also women whose husband was educated were less likely of having unmet need as compared to those having uneducated husband  Table .Unmet need was high (81.1%) among the unemployed women. It was only 18.9% in the employed women. No statistically significant association was observed between working status of women and unmet need for family planning. Unmet need for family planning services was also found to be high (84.2%) among women from lower and upper lower socio-economic class in comparison to the women belonging to middle and upper middle class (74.2%) Table .Women who were residing for more than a year in the slums were less likely (78.7%) to have an unmet need than those residing in the slum for less than a year (89.0%) and the association was statistically significant\u00a0 , in comparison to women who were married for more than a year Table .Table 4Parous women were 2.22 times more likely to have an unmet need than nulliparous women and this association was found to be statistically significant Table . Women w) high unmet need (90.3%) for family planning services. Majority (83.1%) of the women who did not have any knowledge of place where family planning services are available near their slum had an unmet need. Women who had knowledge of availability of family planning services at the U-PHC were significantly less likely to have an unmet need than women with no knowledge   of the young married women were exposed to family planning message on TV/ radio. The association between media exposure and unmet need for family planning services was found to be statistically insignificant Table .Association between contact of ANM (Auxiliary Nurse Midwife) during household visits in the slums or during HNDs  and unmet need for family planning services was found to be statistically significant. Women who did not have a contact with ANM were about 3 times more likely to have an unmet need than women who had a contact Table .Women who had \u201cno autonomy\u201d in their family had a higher (89.2%) unmet need for family planning services. Women who had \u201csome autonomy\u201d and those who had \u201cautonomy\u201d were less likely to have an unmet need than women with \u201cno autonomy\u201d  (Table Women whose husbands had an unfavorable attitude towards family planning had a high (83.9%) unmet need. Women with husbands having a favorable attitude were found to be less likely to have an unmet need as compared to women whose husband had an unfavorable attitude  Table . Also thp value <\u20090.05) in bivariate analysis were subjected to conditional multiple logistic regression for adjustment and controlling the effect of confounding variables. Several factors that were found to be statistically significant on bivariate analysis lost their significant on multivariate analysis which could be partly explained due to co-linearity and possible confounding observed between predictor variable. Age of the women, educational status of the women, duration of marriage, number of pregnancies, knowledge of contraceptive methods, opposition to contraceptive use and contact with ANM showed independently significant association with unmet need for family planning. Women of 20\u201324\u2009year age group were significantly less likely to have an unmet need than women of the lower age group . Women who were literate were significantly less likely to have an unmet need for family planning as compared to illiterate women   Table . Women tMore than half (55.3%) of the young married women living in the slums were having an unmet need for family planning, of which 40.9% was for spacing and 14.4% for limiting. Almost all 95.6%) women in the younger age group (15-19\u2009years) had an unmet need for spacing methods as compared to older age group (64.6%). This is much higher than the unmet need for family planning as reported by NFHS-IV % women i in urbanet. al., [et. al., [Age of the women was found to be a significant predictor for unmet need of family planning. In the present study the unmet need for family planning was found to be significantly higher in the age group of 15\u201319\u2009years (90.9%). Women of the younger age group (15\u201319\u2009years) are more likely to have an unmet need as women of the age group 20\u201324\u2009years are more educated and have more knowledge and experience of contraception . They teet. al.,  perceiveet. al.,  also repet. al., [et. al., [Education level of the women emerged out as one of the strong predictor for unmet need for FP services in the urban slums. Majority (92.9%) of the women in the present study with lower level of education were found to have an unmet need for family planning services and unmet need was found to decrease with increase in level of education with only 79.1% among those who were literate having an unmet need for family planning services. Similar findings were reported by Sherin, R., , Wulifanet. al.,  and Hamset. al.,  who alsoet. al., [et. al., [et. al., [et. al., [In our study, majority of both the multiparous (86.5%) and nulliparous (72.8%) women expressed no desire for childbirth at present but were still not using any of the contraceptive methods. Almost all of the nulliparous and primiparous women had an unmet need for spacing whereas two-third of the multiparous women (61.8%) had an unmet need for limiting methods. Unmet need for family planning services was significantly higher in women with more number of pregnancies but nulliparous women also constituted the major bulk of those having an unmet need. This is in accordance to the findings of studies done in developing and developed nations around the world , 27, 28,et. al.,  and Shuket. al.,  found unet. al.,  found thet. al., .Unmet need was also found to be significantly associated with the number of children that are desired by a woman, which is in concurrence with study done by Bhattathiry, MM., and Ethirajan, N., .In concurrence with Mosha, I.,  and Wold., et. al., [et. al., [Chafo, K.,  attributet. al.,  and Hallet. al., , the preet. al., . Approxiet. al., . The patet. al., .Similar to that reported by other studies , 31, 33,et. al., [Role of frontline workers is crucial in uptake of family planning services by the community. Researchers in various parts of the world , 38, 39 et. al.,  stated tet. al.,  and it iet. al., [et. al., [et. al., [The main reasons for unmet need for family planning services among the young married women in the present study were found to be shyness / embarrassment / hesitancy followed by lack of knowledge regarding family planning method as well as their accessibility. About 40% of the women had a negligent attitude towards family planning. Opposition for contraceptive use was faced by one third of the women. In concurrence to the resent study, Sultana, B., et. al.,  in the set. al.,  in theirThe coverage of a large slum population and use of a strong methodology enhances the internal and external validity of the research work. However considering the important role men play in the dynamics of family planning, their non inclusion in the present study may not reflect the overall perspective of the couple with regard to the use of family planning services. Therefore further studies can be done for in-depth exploration of these factors.Unmet need for family planning was found to be very high among the young married women of urban slums. The study identifies the focus areas which have to be addressed to achieve reduction in unmet need and there by attainment of the desired goal of population stabilization and better reproductive and maternal health.Molding the minds of young generation at an early stage by inculcating reproductive and sexual education as a part of routine school health services could go a long way in motivating them to adopt contraceptive use in future and subsequently follow a healthy fertility behavior. Formation of community based peer system will provide an opportunity for holistic discussion about family planning methods. These community based peer groups will help the young women to overcome embarrassment, shyness, or hesitation and will also give them autonomy to avail FP services. A comprehensive approach should be used by the health worker working in these slums to provide counseling services not only to the young married woman but to all stakeholders. Training should be imparted to health workers to improve their interpersonal behavior change communication skills to tackle the myths, misconceptions, embarrassment / hesitancy / shyness and fears regarding contraceptive use among this young population. Apart from training it is also importance to sensitize the health workers that within this age group there are various vulnerable sub sections with their diverse need for FP services; newlywed, recently settled in urban part, nulliparous, less educated, woman with no autonomy and with opposition from partners and families, warranting a combined and coordinated approach directed towards each subgroup.Additional file 1. Final questionnaire. Questionnaire."}
+{"text": "Malawi is a low-income country with a high maternal mortality rate. This study aimed to investigate the use of contraception and factors associated with unmet need of family planning among fertile women in selected health facilities in southern Malawi. A cross-sectional study design was employed using a validated questionnaire to investigate the unmet need. A total of 419 pregnant women, who attended antenatal clinics at a central hospital and two district hospitals, voluntarily participated in the study. Logistic regression analysis was used to identify possible factors associated with unmet needs. Amongst the participants, 15.1% reported unmet need, 27.0% had never used a contraceptive method, and 27.2% had an unwanted pregnancy. Being married, 20\u201324 years of age, living in a rural area, and high parity were protective factors against having unmet need regarding family planning. Malawi, a country with a young population and a high fertility rate, has a high level of unmet family planning need. Barriers and facilitators need to be identified and addressed at different levels by the health care system, society, and the government of Malawi. Maternal mortality is still a big problem globally, but especially in low-income countries. Malawi is a low-income country with a population of 18 million  and a maOne way to reduce the MMR could by improving access to family planning. A systematic review regarding the usage of contraceptives in Sub-Saharan Africa found major barriers preventing the uptake of family planning services, such as cultural and societal pressure on women, socioeconomic status, financial barriers, and lack of access to services . An UganWe used a cross-sectional survey design to investigate the unmet need of contraceptives among women in Malawi. The study was conducted at the Queen Elizabeth Central Hospital (QECH) in Blantyre, and at the district hospitals of Chikwawa and Chiradzulu. We aimed to include as many women of reproductive age as possible during the study period of five weeks. A convenience sampling method was used to target pregnant women aged 16 to 49 years attending the antenatal clinic (ANC) at the selected health facilities. All women attending the ANCs were invited for voluntary participation.A validated, 18 question questionnaire, based on \u201cQuestions and Filters for unmet need Definition\u201d from the WHO, was used in the data collection . We addeThe dependent variable unmet need was constructed from three different parts: (1) women who did not want to get pregnant and did not use anything to avoid pregnancy; (2) women who wanted to have another child later, but would not use anything to space pregnancies; and (3) women who did not want any more children and would not use anything to limit childbearing.Age was categorized into five-year groups , area of living was divided into urban (Blantyre) or rural (Chikwawa or Chiradzulu), achieved level of education in three categories , and marital status was married or non-married .Data from the questionnaires were entered manually into a statistical software package SPSS 20.0. Descriptive statistics were computed for all variables used in the analysis. Logistic regression analysis was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs) to identify possible factors associated with unmet need. We calculated one model including area of living (Model I) and a second model adjusting for possible confounding factors (Model II).The number of women visiting the ANCs at the approached three health facilities amounted on average to 420 every week, and the response rate was 40%. During four weeks in October\u2013November 2017, 419 women were included in the study. Most women were aged 25\u201329 years and almost everyone was married (92.1%). The average number of children was 1.5 child (range 0\u20138) per woman and 33.7% were pregnant with their first child .The total unmet need in our study was 15.1% and the age group 20\u201324 years had the lowest odds of unmet need. Women attending the antenatal clinic at the QECH in Blantyre had a higher unmet need (20.1%). These women were also older and had higher educational levels. In the district areas the unmet need was lower; Chiradzulu (15.1%) and Chikwawa (7.3%) . As indicated in Close to a third of the women (27.2%) did not want or did not plan their current pregnancy. However, 65.0% wanted another child, but the current pregnancy was mistimed, and 78.4% wished to be able to space the interval between pregnancies by at least two years. The most frequent choices the women considered for spacing pregnancies were injections (46.4%) or implants (26.3%) .Only sixteen women did not want to use contraceptives for spacing or preventing a pregnancy. This was due to various reasons, such as, the husband opposed the use of contraceptives, experiences of side effects, inconvenience, lack of access, or the belief that the occurrence of pregnancy is decided by God.Women living in the district of Chikwawa had a statistically significantly lower OR, 0.30 (95% CI 0.13\u20130.68), of unmet need compared to women living in Blantyre . MoreoveIn this study we found that three quarters of the included Malawian women have used contraceptives, but 15.1% reported a current unmet need. Almost a third of the participants had an unwanted pregnancy. Malawi has a young population, with an average age of 17.2 years in 2015 . The medUnmet need tends to be higher among women with a lower educational level, living in rural areas, or those who have a low income, compared to women who are more educated and living in urban areas . HoweverThe age group 20\u201324 years had the lowest odds of unmet need, and reasons for this may be that women in this age group often are newly married and want to start families. The literacy rate among women in Malawi is about 55% . The youOther studies have named further reasons for the high risk of unmet need among unmarried women in addition to age and education such as infrequent sex, and the shame associated with asking for, or buying, contraceptives whilst not married . A qualiUnplanned or unwanted pregnancies occur due to a number of reasons, such as lack of knowledge, accessibility, availability, affordability, contraceptive failure, and poverty . The chaSix out of ten women in our study reported that they had used injectable contraceptives, but still there were many barriers in access to family planning. Some women also revealed that their partners opposed the use of contraceptives. How males influence the use of contraceptives has been described in other studies ,25. MaleThe unmet need and the high fertility rate, together with the identified barriers, need to be addressed at different levels in society. One way is to adhere and implement the recommendations from the Ministry of Health. The aim is to strengthen the family planning programme through education and counselling of sexual and reproductive health, reducing the unmet need of young Malawians, and strengthening the important post abortion care services. It will also be critical to review the country\u2019s restrictive abortion laws, a process already ongoing in other African countries ,29.We collected data from more than 400 women in a short period, from three hospitals of various sizes, and from urban and rural areas. Additionally, we included unmarried women in contrast to the other reports . There mWe did not include men in our survey, as it was conducted at an antenatal clinic where men are not usually present, and we consider this as a limitation. Men play an important role and may influence women\u2019s choice of using contraceptives or not. The International Conference on Reproductive Health, Mumbai (India), arranged by UNFPA/WHO/World Bank, stated already in 1998 that men and women shall have \u201cthe same rights to decide freely and responsibly on the number and spacing of their children, and to have access to the information, education and means to enable them to exercise these rights\u201d .Our results show that there is still high unmet need among women at reproductive age in Malawi. Unmet need was more pronounced among teenagers (16\u201320 years) and older women (\u226535 years), unmarried women, and women living in urban areas. The high fertility rate in combination with unmet need should be addressed by Malawian politicians and policymakers in order to improve women\u2019s lives and empower women to make their own decisions about their future. Reducing unmet need will ultimately reduce unsafe abortions and subsequently maternal mortality, as per the requirements of the UN Sustainable Developing Goals for all countries."}
+{"text": "Acquired third nerve palsies are infrequently seen in children, but are often associated with serious pathologies. This article presents a pediatric case of tumor-associated, isolated third nerve palsy, which took two years to diagnose. The patient initially presented with an isolated, dilated pupil and progressed over several months to a complete third nerve palsy. In this case, high-resolution neuroimaging eventually led to the diagnosis of a presumed schwannoma as the cause of her third nerve palsy. We review her case, the importance of high-resolution imaging, and management options. Third nerve palsy, Oculomotor nerve palsy, Cranial nerve tumor, Schwannoma, Pediatric. This allows elevation, depression, and adduction of the eye. The third nerve also aids in constricting the pupil, focusing the lens, and the ability to retract the eyelid. A complete third nerve palsy then features eye deviation in a \u201cdown and out\u201d position, a dilated pupil, diplopia, and ptosis.Localization of a lesion within the course of the third nerve can determine its cause . The nerUpon exiting the brainstem, the third nerve travels lateral to the basilar artery and between the superior cerebellar (SCA) and posterior cerebral arteries (PCA). This is a common location for a compressive lesion, such as an aneurysm or uncal herniation. Compressive lesions cause pressure first on the parasympathetic fibers, which lie in the periphery of the nerve. The parasympathetic preganglionic fibers originate in the Edinger-Westphal nucleus in the midbrain. They then course in the periphery of the third nerve until synapsing in the orbital ciliary ganglion. The postganglionic fibers then travel to the sphincter pupillae, causing constriction of the pupil. Therefore, an isolated, dilated pupil is an indication of direct compression of the third nerve and can be the first sign of an aneurysm, tumor, or herniation. Pupil-sparing third nerve palsy is rare in children. In adults, it is largely secondary to microvascular ischemia in the setting of risk factors such as diabetes, hypertension, and smoking .After passing between the SCA and PCA, the third nerve continues to course distally along the posterior communicating artery (PCOM) before entering the cavernous sinus. The PCOM is the most common location for an aneurysm to result in a third nerve palsy. The nerve then enters the cavernous sinus and travels along the superior aspect of the lateral wall. The trochlear nerve and the ophthalmic V1) and maxillary (V2) divisions of the trigeminal nerve also travel along the lateral wall. Since the third nerve lies close to V1, a cavernous sinus lesion can sometimes present as painful ophthalmoplegia [ and maxiExiting the cavernous sinus, the third nerve divides into superior and inferior branches. The branches then travel through the superior orbital fissure along with the trochlear nerve, abducens nerve, V1, and ophthalmic veins. A superior orbital fissure lesion, often caused by trauma, typically presents as a painful ophthalmoplegia with a dilated pupil, ptosis, and periorbital edema due to poor venous drainage [We report a new case of pediatric third nerve palsy, the cause of which eluded us for two years. Only after repeated imaging using high-resolution MRI was the cause determined: cavernous sinus tumor. Management of such tumors, often determined to be schwannomas, is discussed.2A 3-year-old girl developed a painless left third nerve palsy. The onset of symptoms was staggered over several months, starting with dilation of the left pupil, followed by ptosis, and then limited movement of the left eye. Her initial ophthalmic examination yielded acuity of 20/20 in the right eye and 20/30 in the left eye. Her right pupil measured 3\u00a0\u200bmm and her left measured 5\u00a0\u200bmm, both reactive to light with no afferent pupillary defect. Her dilated funduscopic examination was unremarkable.The patient's first MRI was completed when she initially presented with an isolated, dilated left pupil. The MRI was performed on a 1.5 T scanner with 3\u00a0\u200bmm thickness orbital cuts. There was no evidence of a lesion to account for her symptoms. Four months later she developed left eyelid ptosis and the MRI was repeated, but on a 3 T scanner with 2.5\u00a0\u200bmm thickness orbital cuts. Again, imaging was normal. Six months after initial presentation, she developed restricted elevation, depression, and adduction in the left eye. There was also a large left-sided exotropia and hypotropia on alignment testing and the pupil was no longer reactive to light. She had a complete third nerve palsy. The MRI was repeated again on the 3 T scanners, with orbital cuts at 2.5 mm thickness, but no lesions were detected. MR angiography and venography were also normal. Sedimentation rate, C-reactive protein, and lupus antibodies were unremarkable. CSF studies showed no evidence of an infectious, inflammatory, or demyelinating process.Empiric treatment throughout the first year of her course included one month of oral steroids and four days of intravenous immunoglobulin. For two weeks, she was trialed on pyridostigmine for potential ocular myasthenia gravis. The patient had a persistent third nerve palsy which did not improve with any treatments.At the age of five, nearly two years after her initial presentation, an MRI was repeated on a 3 T scanner with 2.5\u00a0\u200bmm thickness cuts along the pathway of the oculomotor nerve. In addition, T2-weighted 3D-images were obtained with 1\u00a0\u200bmm thickness cuts of the orbits and oculomotor pathway. The cisternal portion of the nerves was normal in size, measuring 1.9 mm in diameter on the right and 1.8 mm on the left. However, on further tracing distally, there was a small nodular expansion of the left oculomotor nerve noted in the superior and lateral aspect of the left cavernous sinus. It was T1 hypoenhancing, when compared to the surrounding venous blood on post-contrast imaging, and measured 1.9 \u00d7 2.1 \u00d7 2.0\u00a0\u200bmm in transverse, anterior-posterior, and craniocaudal dimensions, respectively. It was best seen on axial fat-saturated, post-contrast T1 imaging  and was The patient is now six-years-old and the tumor has remained stable in size on repeat imaging. Her case has been discussed with multiple specialists who agree that intervention is not indicated at this time. She has undergone two strabismus surgeries with some improvement and is schedule for a third surgery soon.3This is a case of a young girl who initially presented with an isolated, dilated left pupil, that gradually progressed to a complete third nerve palsy. This was most suggestive of a progressive compressive lesion affecting the peripheral third nerve. Since it was painless, it could be further localized to a lesion proximal to the superior orbital fissure and small enough in size to avoid impingement of V1. MRI utilizing high-resolution imaging of the oculomotor nerve on a 3 T scanner eventually led to the diagnosis of a presumed schwannoma in the left cavernous sinus. This highlights the importance of a dedicated, high-resolution MRI protocol for the detection of small cranial nerve tumors.Schwannomas are peripheral nerve sheath tumors that grow very slowly. Pediatric cases of schwannoma in association with a third nerve palsy are rare and treatment is unfortunately limited . LargelyAll authors listed have significantly contributed to the investigation, development and writing of this article.This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.Data will be made available on request.The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "Primary data are manually assessed and converted into an easily processed format. Our processed data will be advantageous to the research community and enable accelerated research in this domain. For example, the data can be utilised to discern trends in disengagement, observe the distribution of disengagement causes, and investigate the contributory factors of the crashes. Such investigations can subsequently improve the reporting protocols and make policies and laws for the smooth deployment of this disruptive technology.Autonomous Vehicles (AVs) are being widely tested on public roads in several countries such as the USA, Canada, France, Germany, and Australia. For the transparent deployment of AVs in California, the California Department of Motor Vehicles (CA DMV) commissioned AV manufacturers to draft and publish reports on disengagements and crashes. These reports must be processed before any statistical analysis, which is cumbersome and time-consuming. Our dataset presents the processed disengagement data from 2014 to 2019, crash data till the 10 Machine-accessible metadata file describing the reported data: 10.6084/m9.figshare.15049227 Currently, there are two major categories of \u201cfield\u201d datasets that are publicly available; the crash and disengagement reports by the California Department of Motor Vehicles (CA DMV) and the extensive sensor (lidar and camera) datasets like KITTI2, Waymo3, etc. The latter category of datasets is proficient for accelerating research in computer vision, localisation, and behaviour cloning but lacks information about the critical instances (crash and disengagements). On the other hand, CA DMV disengagement and crash reports are the foremost publicly available datasets containing information about the critical instances. These critical events data are beneficial for laying a roadmap for the deployment of AVs, which includes reporting protocols, legal frameworks, and infrastructure maintenance plans. Table\u00a0Autonomous Vehicles (AVs) are being widely tested on public roads in several countries around the world. Although AVs are becoming more competent due to advancements in sensing and navigation technologies, safety stands as the biggest challenge in adopting this disruptive technology9. Recently, a few studies have used these reports for developing statistical models. For example, one such study developed a nested logit model using three distinct outcomes: (1) no disengagement, (2) disengagement with no crash, and (3) disengagement with a crash10. The study also estimated endogenous switching models and deduced that disengagements lessen over time, and factors related to AV systems and other roadway participants elevate the tendency of disengagement without a crash. In another study, driving mode , collision location, roadside parking protocol, rear-end collision, and one-way road were found to be significantly influencing crash severity11.For the transparent deployment of AVs in California, the CA DMV commissioned AV manufacturers to draft and publish reports on disengagements and crashes. As a result, several researchers used the CA DMV reports to evaluate AVs\u2019 safety-critical events. Most of the earlier studies focussed on discerning the trends in disengagements and crashes involving AVs12. The study emphasised that unfitting interpretations are possible if the random parameter approach is not used. Significant variables included location (highway or street), maturity of testing (months of testing), and cause . The study also found that as the maturity of the testing increases by a month, the probability of automated disengagement increases by 0.014. Another study developed a Bayesian latent class model that identified six classes of collision patterns13. The authors pointed out the necessity of more advanced and robust collision narrative reporting for better analysis of the critical events. More recently, machine learning techniques were used to evaluate the crash severity of AVs14.Another study developed fixed and random parameters binary logistic regression models to evaluate disengagement initiation7 and require constant scrutiny. Additionally, the advancement of this technology may change the currently observed trends15. Since the crash data are considered over a prolonged period, the time-varying explanatory variables may vary significantly. Neglecting latent within period variation may result in the loss of crucial explanatory variables. This loss of information by using discrete-time intervals can institute error in model estimation because of unobserved heterogeneity17, and hence studies using this data are required to be updated in the light of new information available.As evident, more complex models are being developed lately based on the CA DMV reports. However, these reports must be processed before conducting any statistical analysis, which is cumbersome and time-consuming. Furthermore, new crashes and disengagements are happening with more test vehicles on the road, and new data are appended regularly to the CA DMV dataset. The exclusion of the latest data used in the previous studies can result in premature findings11, preparing guidelines and governance for AV deployment on public roads.In this context, we present the processed disengagement data from 2014 to 2019, crash data till the 10th of March 2020 and supplementary road network and land-use data of the AV testing locations in California. For the preparation of the current dataset, primary data in the form of crash and disengagement reports were requested from CA DMV. The primary data are extracted and organised into the processable format for potential reuse. Furthermore, OpenStreetMap and Google maps were used to extract supplementary data, which could be utilised to expand the research around AVs\u2019 safety like in a previous study4, which stated to include the categories of disengagements in the reporting protocol by analysing the categorisation of disengagements into proposed macro and micro categories. Macro-level and spatial models of AV crashes can also be estimated using the supplementary data provided by our spatial database. They can be utilised to assess the hotspot crash/disengagement locations. Furthermore, the rate of disengagements can be affected by expanding the testing area as new and unfamiliar roads can generate new challenges for the AV brain. It is recommended to include testing area details in the reports. Also, new studies are advised to take into account the effect of spatial features. Eventually, managing a database that can be directly used without further processing or organisation could help accelerate the research and promote consistent terminologies, which is the contribution of this dataset. The processed data can bring consistency in the studies since different authors might use different appellations and can be readily imported to modelling and analysis software, thereby facilitating reproducible research.Specifically, the research community, government organisations, and public forums active in AV-related safety studies can benefit from this processed dataset. A comprehensive reporting protocol is necessary for the well-ordered deployment of AVs on public roads in any area. Henceforth, research can be conducted using our dataset towards identifying the shortcomings and fallibility of the reporting protocols used by CA DMV and assist government organisations around the world to devise better protocol systems for transparent deployment of AVs on public roads. For example, a limitation of the current CA DMV reports was pointed out by a previous studyth of March 2020. The disengagement primary data are reported by CA DMV at the end of every year, and the crash primary data are continuously updated. There are four kinds of data in our repository, viz. disengagement data, crash data, street network data and land use data. The procedure of their extraction is presented in the following sections.Our processed dataset contains disengagement data from 2014 to 2019 and crash data until the 1018. The reports are in pdf files and scanned copies of handwritten text. Authors manually scrutinised each report and converted them into excel and comma-separated files that can be processed by statistical tools like Stata, Nlogit and can be imported directly using scripting languages like Python or R for further analysis. A consistent data entry convention was discussed and developed considering different tools and scripting languages. The process of converting the reports into a processable format was time-consuming and cumbersome. More than three months was invested in going through reports and processing them. Automation of extraction of data from reports was infeasible since some manufacturers are submitting handwritten reports.Primary data, i.e. disengagement and crash reports, were requested from CA DMVAdditionally, some reports have subjective responses and hence required manual data entry and an expert\u2019s elucidation. As a result, the data preparation required extensive manual hours investment. Furthermore, an extensive discussion was required to deduce the features that are not explicitly reported but can affect the crash, such as location characteristics  and vehicle type. The latitude and longitude of every crash location were extracted from Google maps, and the \u201cstreet view\u201d feature of Google maps was used to discern location characteristics. The car model of the non-AVs involved in the crash mentioned in the reports was used to discern the \u201cvehicle type\u201d and resources like Wikipedia and manufacturers\u2019 websites were used. Some of the key descriptive statistics of the crash data are presented in Table\u00a019, OSMnx20, and Pandas21 modules were used to assist with data manipulation. The geographical coordinates specified by the user (geocoded from crash data) are used to extract the road network (edges and nodes) using the OSMnx module. Custom filters are used as additional arguments to limit the results of the process . Any missing features (due to incomplete data from OpenStreetMap) are assigned default values as appropriate (such as speed limits). Edges with multiple classifications are assigned only the highest classification . Any non-one-way roads are adjusted so that there are two edges for each of those roads (one for each travel direction). The street network data is in the form of shapefiles which can be opened using any geographic information system (GIS) tool such as QGIS or ArcGIS. Finally, the land-use data, in the form of points of interest (POI) such as restaurants, clinics, banks, etc. are also extracted from OpenStreetMap using OSMnx, by specifying the same coordinates as were used for network extraction. Extraction of spatial information took additional 20\u2009hours.Python was used in the extraction of both street network and land use data. GeoPandasfigshare repository22. Table\u00a0This section discusses the organisation of the processed data in the Crash datasheet contains the processed information from the original reports of CA DMV (primary data) and is manually inputted into this excel file. README sheet contains the variable definitions, and the Variable sheet contains the summary of the data.The folder includes a Microsoft Excel file \u201cDMV Crash Data.xlsx\u201d, which contains three sheets. The \u25cb2014_DISENGAGEMENT, 2015_DISENGAGEMENT, 2016_DISENGAGEMENT, 2017_DISENGAGEMENT, 2018_DISENGAGEMENT and, 2019_DISENGAGEMENTThese excel files contain the yearly disengagement data extracted from the CA DMV reports (primary data) in the years 2014\u20132019. In each of these files, there are several tabs, of which the first one is a \u201cREADME\u201d tab that provides a brief description of the corresponding excel file and the data layout. The second tab in these files provides the summary of disengagement data within each year, including the miles driven and the number of manual and automatic disengagements by each company in each month of that year. The rest of the tabs in the Excel files provide individual disengagement records , including the reason for disengagement and in some cases, the reaction time to take over after disengagement. For example, the 2016_DISENGAGEMENT file has six other tabs where the manufacturers have recorded individual disengagements. Similarly, 2017_DISENGAGEMENT and 2019_DISENGAGEMENT files have eight and thirty-five additional tabs, respectively, that have information for individual manufacturers. The 2018_DISENGAGEMENT file has 35 additional tabs containing information of individual manufacturers  has 2, due to their large dataset).\u25cbCOMBINED_DISENGAGEMENT_SUMMARYThe DMV Disengagement Report folder contains seven Microsoft Excel files, and their description is provided below.This excel file is a combined summary of all the aforementioned excel files, where the file displays the monthly miles driven, number of automatic and manual disengagements reported by each company from 2014 to 2019.This folder contains two comma-separated value (CSV) files; poi_List Area 1(San Francisco) and poi_List Area2 (San Jose), consisting of the information about the points of interest of these two areas, including the spatial coordinates. Figure\u00a0Area1(San Francisco), Area2(San Jose) and Crash Data, which include the street network shapefiles (in the form of nodes and edges) for Area 1 and Area 2, respectively. The shapefile format is a geospatial vector data format for storing geometric location and associated attribute information relevant for geographic information system (GIS) software. Edges represent the physical streets, and the attribute table of edges includes information on the number of lanes, speed limit (in mph), the street name, type of road , and edge length. Nodes represent the intersection of edges, and their attribute table includes information on whether the node is a signalised or a priority sign intersection. Most of the crash records in the primary data provided by CA DMV did not include the spatial coordinates of the crash location. Instead, they include a description of the streets where the crash happened. Google Maps was used to geocode the text and convert it into spatial coordinates. The crash report provides a brief description of the crash. This includes the direction in which the vehicle is moving, approaching the intersection or placed at the intersection. Vehicle 1 movement provided information about the state of car . The exact location of the crash was discerned using street information and a brief description. In case the report mentions \u201capproaching intersection\u201d or \u201cat the intersection\u201d, the geocode of intersection is provided. Otherwise, the midpoint of the street is geocoded. Figures\u00a0This folder contains two sub-folders: The reports are manually processed, annotated, and verified by the expertise. For instance, the reports have some subjective information, such as the seriousness of the injury and the location of the crash. First, one of the authors extracted the relevant data manually. Then the same task was performed by another author independently. It is important to note that these two authors did not have any direct connection with each other during the data extraction process. Once both the datasets were obtained, it was found that they were mostly consistent and had less than 2% contradicting data entries. Such records were then finally checked and corrected by a discussion among all the authors. At each of these steps, authors avoided using automated pipelines and used expert human intervention to register the implicit data.14. The disengagement trends with appended data presented in our recently published study14 are coherent with a previous study4. The crash typology distribution and imbalance in injury outcome in our study14 are also coherent with another previous study11. These validation methods are discussed in detail below.For the automated validation, data were imported to different software and scripting languages. The spatial data were imported to QGIS software and the csv files were imported to Stata and Python. Frequently used operations such as filtering, summarising, and grouping were performed. The importing and operation databases have been successful, and there are no missing data. Further, the ranges of each variable column were checked. For instance, there are four categories of \u201cVehicle type\u201d defined. The summarisation of \u201cVehicle type\u201d column was found to be consistent with the protocol used.A further validation was explicitly done for spatial data. Spatial data points were plotted on the maps to verify that the spatial information/points fall within the test area. Figures\u00a0Percentage of rear-end crashes6 reported that around 62% of crashes were rear-ended. Another study11 which analysed data until the year 2018, reported 63% of crashes as rear-ended. A more recently published study14 that used our dataset reported 61.78% (160 out of 259) rear-ended crashes. Consistent numbers reported corroborates validation of our dataset, as shown in Fig.\u00a06 .A previous studyDistribution of crash severityTo validate our data, we compared our results with those from previous studies:11 reported 89% CAV involved crashes are property damage only (PDO) crashes. PDO crashes translate to no injury crashes. A similar percentage (85%) was reported with extended data (our dataset) in our recently published study14.A previous study6  were compared with our dataset. Table\u00a022 reported the Status of vehicles and relative direction\u2009=\u2009Moving/Moving. Furthermore, there are minor discrepancies in subjective columns, such as \u2018injury reporting\u2019 caused by the ambiguity of reporting protocol. Nevertheless, the interpretation of data was mostly consistent and thus, substantiate the validation of our dataset.Lastly, the crash records reported by a previous studyAdditionally, previously published studies were replicated with our processed crash and disengagement data, and the results were found to be consistent. The replicated results can be found in a recent study published by the authors23 but are not available in the reports. A previous study proposed a distinction between exogenous  and endogenous (factors can be acted upon) contributory factors of disengagement as an additional mandatory category in the reporting protocol4. However, this data lacks the difference within possible controllability of the factor, which can be crucial in discerning trends. Lastly, there is no data about conflicts. Authors believe that for a better understanding of the development of AVs, sensor data along with driver\u2019s and road characteristics at the time of the crash should be made available to the government and researchers.CA DMV reports are the best publicly available data containing information about critical events (crashes and disengagements) involving AVs. Nevertheless, the reports  have few limitations. The reports (primary data) consist of a few fields like \u2018damage severity\u2019, which are assessed subjectively and may vary based on the assessor. Furthermore, the information of safety operation drivers is missing in the reports. Psychological attributes such as the risk attitude of the drivers could play a crucial part in discerning the details of safety operationThe excel sheets can be opened using any spreadsheet or workbook software. The shapefiles can be opened using any geographic information system tool such as QGIS or ArcGIS. The data can be directly imported to statistical or programming tools such as Stata, Nlogit and Python for performing analysis. We recommend that users review the sample reports in the database for further clarification.8. Manufacturer-specific information like reaction time can be used for investigation as presented in a previous study5. The crash data can be utilised in two significant ways. First, descriptive statistics and identification of trends as done by some past studies6. Second, crash data can be used for exploratory investigation as performed by a few studies13. New fields are appended in the reports, and auxiliary data  can be utilised to develop more comprehensive models.The disengagement data can be utilised to discern the trends as performed in some previous studies"}
+{"text": "P < 0.05), and twelve studies reported a significant effect on reducing infarct volume (P < 0.05). Moreover, two and three studies showed that quercetin could alleviate blood-brain barrier (BBB) permeability and brain water content, respectively. The mechanisms of quercetin against focal cerebral ischemia are diverse, involving antioxidation, antiapoptotic, anti-inflammation, and calcium overload reduction. On the whole, the present study suggested that quercetin can exert a protective effect on experimental ischemic stroke. Although the effect size may be overestimated because of the quality of studies and possible publication bias, these results indicated that quercetin might be a promising neuroprotective agent for human ischemic stroke. This study is registered with PROSPERO, number CRD 42021275656.Quercetin, a naturally occurring flavonoid, is mainly extracted from tea, onions, and apples. It has the underlying neuroprotective effect on experimental ischemic stroke. A systematic review and meta-analysis were used to assess quercetin's efficacy and possible mechanisms in treating focal cerebral ischemia. Compared with the control group, twelve studies reported a remarkable function of quercetin in improving the neurological function score (NFS) ( Stroke is recognized as one of the significant causes of death and disability, of which ischemic stroke is the primary type . AccordiFlavonoids are widely found in plant and vegetable diets. They are reported to have antiviral, anti-inflammatory, heart protection, antidiabetes, anticancer, antiaging, and other biological activities \u20139. QuercThe systematic review is a type of secondary research that gathers all primary research that meets prespecified qualification criteria for solving a specific research problem, minimizing bias . It can This systematic review and meta-analysis were carried out according to the methods of Wang et al. .The following databases were searched: PubMed, Web of Science, Chinese Biomedical Literature Database (SinoMed), China National Knowledge Infrastructure (CNKI), WanFang Database, and VIP Database. We collected all studies from inception to Aug 2021. Our search terms were as follows: \u201cQuercetin AND ischemic(a) stroke OR cerebral ischemic(a) injury OR cerebral ischemic(a) reperfusion OR cerebral infarct OR middle cerebral artery occlusion (MCAO).\u201d There are no restrictions on the country or language of publication.All animal experiments assessing the effect of quercetin on focal cerebral ischemia were chosen, regardless of animal species, age, and sex. The following screening criteria should be satisfied: (1) quercetin was administered to an animal model of focal cerebral ischemia, regardless of the dosage, route, method, and treatment schedule; (2) animal models of focal cerebral ischemia involved temporary or permanent middle cerebral artery occlusion (MCAO); (3) the intervention group only used quercetin treatment; and (4) control animals received no treatment or vehicle. The primary outcome indicators included NFS and infarct volume; the second outcome indicators were BBB permeability and brain water content.The following were exclusion criteria: (1) the study was a viewpoint, review, case report, abstract, in vitro experiment, ex vivo study, or human study; (2) nonfocal cerebral ischemia models such as chronic cerebral ischemia, global cerebral ischemia, traumatic models, or hypoxia-ischemia; (3) non-quercetin-based interventions, quercetin modifications, and combinations with other compounds and treatments; (4) no control group; and (5) no statement of sample size.The detailed information from included studies was extracted by two independent reviewers, as outlined below: (1) first author, publication year, focal cerebral ischemia model, and anesthesia method; (2) animal species, sex, and weight; (3) the dose, strategy, and frequency of administration of quercetin and the control groups; (4) the data of mean value and standard deviation of NFS, infarct volume, BBB permeability, and/or brain water content; and (5) the timing and sample size for outcome assessments were also extracted. The highest dose data were extracted when the treatment group contained various dose subgroups. If data are derived from different time points, the result at the peak time point is extracted. When data is only displayed as a graph, we contact the author for detailed information. If no response is received, we will use the graphic digitizer software to measure the value or exclude it.Two independent reviewers assessed the quality of included studies according to a 10-item modified checklist : (1) pubP \u2265 0.1, I2 \u2264 50%). The random-effects (RE) model is applied with statistical heterogeneity . The statistical significance is P < 0.05, and the 95% confidence interval for all results is computed. The publication bias was evaluated by the funnel plot and the Egger test.The Review Manager (version 5.3) software was used for statistical analysis. The estimate of the pooled effect sizes is calculated by the standardized mean difference (SMD) using a fixed-effects model without statistical evidence of heterogeneity  in vitro studies; (2) not focal cerebral ischemia model; (3) administration of modification of quercetin; (4) combination with other compounds; (5) lack of outcome indicators; (6) no statement of sample size; and (7) no statistical outcome. Finally, 14 studies were selected for quantitative analysis after excluding two articles for which no available data can be obtained. Between 2011 and 2021, twelve studies were published in English, and two were published in Chinese. The fourteen studies included Wistar rats , 20 and A 10-point scoring method was used to evaluate the quality of studies . The stunQ/nC = 53/53, SMD: -2.31, 95% CI , P < 0.00001; heterogeneity: Chi2 = 5.40, df = 5 (P = 0.37); I2\u2009=\u20097%) ; I2 = 0%) ; I2\u2009=\u200994%). One study , P < 0.00001; heterogeneity: Chi2 = 0.19, df = 1 (P = 0.66); I2 = 0%)  . A meta-I2 = 0%) . In addiI2 = 0%) .nQ/nC = 46/46, SMD: -1.99, 95% CI , P < 0.00001; heterogeneity: Chi2 = 8.38, df = 9 (P = 0.50); I2 = 0%) (3) as the outcome measurement, and their meta-analysis showed that quercetin has a significant effect on reducing infarct volume during cerebral ischemic injury ; I2\u2009=\u200920%)  . Two stu2\u2009=\u200920%) .nQ/nC = 14/14, SMD: -2.02, 95% CI , P = 0.03; heterogeneity: Tau2 = 1.63, Chi2 = 5.73, df = 2 (P = 0.06); \ud835\udc3c2\u2009=\u200965%). Because of considerable heterogeneity, we deleted the outlier study. The meta-analysis of the remaining two studies showed there is no heterogeneity ; \ud835\udc3c2\u2009=\u20090%)  .P < 0.05).Two studies reported BBB permeability based on the Evans blue assay. It failed for pool analysis because one study measured the content of EB in the ischemic hemisphere, and another measured Evans blue's content in the ischemic cortex. However, they all confirmed the outstanding effects of quercetin for meliorating the BBB permeability induced by focal cerebral ischemia (P = 0.14), whereas there may have publication bias in infarct volume (P = 0.009).The Egger test and funnel plot were used to assess publication bias for NFS (Bederson criterion) and infarct volume (%). As shown in A total of fourteen studies were included, and the period of included studies is from 2011 to 2021. The main findings of the present systematic review showed that quercetin could improve NFS, reduce the infarct volume, and protect BBB integrity during focal cerebral ischaemia, suggesting that quercetin exerted the neuroprotection for acute ischemic stroke. The neuroprotective mechanisms of quercetin are mainly mediated by its antioxidant, anti-inflammatory, antiapoptosis properties, and resistance to calcium overload.The strength of the present study is that this is the first meta-analysis to evaluate the effects of quercetin against focal cerebral ischemia. In this meta-analysis, we use six databases with many terms and keywords to increase the number of searches and ensure the extensive retrieval of published articles. Moreover, we clearly defined animal models and outcome indicators before the meta-analysis, which reduced bias in selecting the included studies. Our results provide the practical value for the evidence-based transformation of animal data from the laboratory to the bedside.The present study also has some limitations. First of all, all the databases we searched are in English or Chinese, which might lead to selection bias because studies published in other languages may be excluded. Second, no studies reported the negative effect of quercetin on infarct volume, which may be a pivotal contributor to publication bias, as positive results and large sample sizes are always easier to publish than negative results and small sample sizes. The effective method for avoiding publication bias is to include unpublished studies and trial registries . Third, High-quality methodologies of studies are the elements of drugs translating from animal research into clinical trials for human disease . The met\u03b1, IL-1\u03b2, and IL-6 [The neuroprotective mechanisms of quercetin against ischemic stroke are summarized as follows: (1) Oxidative stress plays a vital role in the pathogenesis of ischemic stroke . The excand IL-6 , 28 and and IL-6 . (3) Apoand IL-6 . Quercetand IL-6 , 25, 28 and IL-6 . (4) Caland IL-6 . Parvalband IL-6 . Quercetand IL-6 , 32 and and IL-6 . (5) Queand IL-6 . (6) Queand IL-6 . (7) Queand IL-6 , 27, 29.and IL-6 . (9) Queand IL-6 . (10) Quand IL-6 , 27. AltQuercetin can reduce cerebral infarction volume, nerve function deficit, BBB permeability, and brain edema and protect cerebral ischemia injury through various signaling pathways. Other undisclosed molecular mechanisms deserve further study."}
+{"text": "Mn-doped ZnS quantum dots (QDs) with excellent optical properties have been explored in a wide range of fields. Their potential adverse effects on biological systems and human health should be evaluated before biological application. In the present study, we investigated the effect of Mn-doped ZnS QDs on the intestinal tract and gut microbiota structures at 2 h and 14 days (d) after 14 d repeated oral exposure in mice. Flame atomic absorption spectrophotometry (FAAS), histopathological examination, and transmission electron microscopy (TEM) were used to assess the absorption and toxicity of Mn-doped ZnS QDs on the intestinal tract. The 16S rRNA gene sequencing was used to evaluate the gut microbial communities. Mn-doped ZnS QDs did not accumulate in the duodenum, jejunum, ileum, or colon. The Zn content of feces was not significantly higher than in the control group. No major histological changes were found in these tissues. The intestinal microvilli remained regular, but swelling of mitochondria and endoplasmic reticulum was detected by TEM at 14 d after the last gavage. A total of 2,712 operational taxonomic units (OTUs) were generated. Mn-doped ZnS QDs treatment did not significantly change the \u03b1-diversity of Richness, Chao1, Shannon, and Simpson indexes. According to principal component analysis (PCA), Mn-doped ZnS QDs had no effect on the overall structure of the gut microbiota. No significant change occurred at the phylum level, while three genera were downregulated at 2 h and seven changed at 14 d after the last gavage. Our findings revealed that Mn-doped ZnS QDs had a little stimulation of the intestinal tract and gut microbiota, and oral administration may be a safe route for biological application (such as bioimaging and drug delivery). Quantum dots (QDs) are semiconductor nanomaterials with unique optical properties, such as broad excitation and narrow emission spectra . The fluThe preferred route for clinical compliance of nanoparticles is oral administration . NanoparThe intestinal tract comprises structurally and functionally distinct regions, including digestive, absorptive, secretory, and protective functions . More thThe aim of the present study was to investigate the effect of Mn-doped ZnS QDs on the intestinal tract and gut microbiota structures after 14 days repeated oral exposure in mice. We observed the effects at 2 h and 14 d after the end of exposure. Flame atomic absorption spectrophotometry (FAAS) was used to assess intestinal absorption of Mn-doped ZnS QDs. Histopathological examination and transmission electron microscopy (TEM) were used to investigate the intestinal toxicity. Non-culture-based, next-generation sequencing techniques were used to further evaluate gut microbial communities.ad libitum. The study and protocol were approved by the Committee of Medical Ethics and Welfare for Experimental Animals of Henan University School of Medicine.Male Kunming mice aged 6\u20138 weeks (23 \u00b1 1 g) were provided by the Animal Center of Henan Province . The mice were housed (4 or 5/cage) in a controlled environment, 12 h light\u2013dark cycle, 22 \u00b1 1\u00b0C, 50\u201360% relative humidity, and food and water Mn-doped ZnS QDs were synthesized as described in our previous study . The aveThe collected duodenum, jejunum, ileum, colon, and fecal samples (\u223c50 mg) were digested in 1 ml of 70% nitric acid for 3 h at 90\u00b0C, 0.1 ml of perchloric acid was added, and samples were heated for a further 30 min. The digested solution was diluted to 5 ml with deionized water, and Zn content was detected using AA-6800 FAAS .After 24 h fixation in 10% neutral buffered formalin, tissue pieces were dehydrated progressively in ethanol, cleaned in xylene, embedded in paraffin blocks, sliced into 5-\u03bcm sections, and stained with hematoxylin and eosin (HE). The morphology of the tissue was observed using the NI-U optical microscope .After 48 h fixation in 3% glutaraldehyde at 4\u00b0C, tissues were transferred into 1% osmium tetroxide for 1 h post-fixation and then dehydrated in concentrated ethanol, embedded in Epon 812, cut into ultrathin sections, stained with uranyl acetate and lead citrate, and observed using a JEM-2000EX transmission electron microscope  with Amt V601 CCD.Total genomic DNA was extracted using QIAamp 96 PowerFecal QIAcube HT kit . Quality and quantity of the extracted DNA were verified by agarose gel electrophoresis and NanoDrop 2000 UV-Vis Spectrophotometer . DNA samples were diluted with sterile water to 1 ng/\u03bcl. Universal primers 343F (5\u2032-TACGGRAGGCAGCAG-3\u2032) and 798R (5\u2032-AGGGTATCTAATCCT-3\u2032) were used to amplify the V3\u2013V4 variable regions of 16S rRNA genes by polymerase chain reaction (PCR). Amplicon quality was detected by gel electrophoresis, purified with AMPure XP beads (Agencourt), and amplified for another round of PCR. After purification, the final amplicon was quantified using Qubit dsDNA assay kit . Equal amounts of purified amplicon were pooled, and sequencing on the Illumina MiSeq platform .Raw sequence data were processed using Trimmomatic software  to detect-test was used to test the difference between the two groups. The differences in bacteria between the groups were assessed by Kruskal\u2013Wallis test. A value of p < 0.05 was considered statistically significant.The data of Zn content of the intestinal tract and feces are presented as the mean \u00b1 SEM. The unpaired p < 0.05, The Zn content of the intestinal tract and fecal samples from the control group and mice gavaged for 14 d with Mn-doped ZnS QDs gavaged for 14 d mice were measured using FAAS . The Zn The histopathology of intestinal tract tissues at 2 h and 14 d after Mn-doped ZnS QDs treatment are shown in To further determine the toxicity of Mn-doped ZnS QDs on the intestinal tract, the ultrastructure of the duodenum, jejunum, ileum, and colon was visualized by TEM. The microvilli of tissues remained regular in height, diameter, and spacing after oral administration of Mn-doped ZnS QDs . At 14 dAfter oral administration of 5 mg/kg Mn-doped ZnS QDs for 14 d, fresh feces were collected from each mouse at 2 h and 14 d after the last gavage, and microbial community profiles were constructed by 16S rRNA gene sequencing. We obtained 17,847\u201345,226 valid tags per sample, and sequences were subsampled to 14,277 for analysis. On the basis of 97% similarity, a total of 2,712 OTUs were generated, including 384\u2013889 OTUs per sample. A summary of the sample tags and OTUs is shown in Firmicutes, Bacteroidetes, Proteobacteria, Tenericutes, and Deferribacteres, and >99% of the sequences were within the top three phyla , Family XIII AD3011 group (p < 0.05), and Bilophila (p < 0.05) at 2 h after the last gavage (Prevotellaceae UCG 003 (p < 0.01) and Romboutsia (p < 0.05) were decreased, while Clostridium sensu stricto 1 (p < 0.05), Enterococcus (p < 0.05), Jeotgalicoccus (p < 0.05), Atopostipes (p < 0.05), and Lachnospiraceae NK4A136 group (p < 0.05) were increased compared with the control group. It should be pointed out that the Lachnospiraceae NK4A136 group was the most abundant genus.According to taxonomic assignment, the structure and composition of the gut microbiota communities at phylum and genus levels are shown in ee phyla . There wequences . Mn-dopet gavage . The chat gavage : PrevoteThe community composition of gut microbiota at the level of class, order, and family is shown in 2O3 nanoparticles did not accumulate in the duodenum, and the feces were the main excretion route  and long-rod MSNs (AR = 5) did not induce obvious change of Si content in the intestine at 2 h after administration . Loeschnon route . Our preon route . Howeverin vitro  and Chao1 (based on the rare OTUs) are used to determine the richness in a community, while Shannon and Simpson indexes detect the richness and evenness of a community . Mn-dopeC. Stoquefichus, Family XIII AD3011 group, and Bilophila. The Family XIII AD3011 group genus was detected in other studies, but is still poorly characterized . Prevotellaceae UCG-003 belongs to a new bacterial family, and the increase in its abundance may exacerbate inflammation , and absence of branched-chain fatty acids, dimethyl acetals, and aldehydes, but their function is scarce. The genus Clostridium sensu stricto is characterized by a wide biogeography and ability to inhabit anaerobic environments. Some Clostridium sensu stricto cause disease, while others produce added-value chemicals .The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: BioProject .YY, SL, and SJ designed the experiments and made data analysis. YY and RX performed the main experiments. XZ, XW, YZ, HW, and YF took part in part of the experiments. YY wrote the draft of the manuscript. SL and SJ contributed to revise the writing. All authors read and discussed part sections of the manuscript, and endorsed the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The main objective of this study was to review the clinicopathologic characteristics and outcome of patients with oncocytic papillary thyroid carcinoma (PTC) and oncocytic poorly differentiated thyroid carcinoma (PDTC). The secondary objective was to evaluate the prevalence and outcomes of RAI use in this population.Patients with oncocytic PTC and PDTC who were treated at a quaternary cancer centre between 2002 and 2017 were retrospectively identified from an institutional database. All patients had an expert pathology review to ensure consistent reporting and definition. The cumulative incidence function was used to analyse locoregional failure (LRF) and distant metastasis (DM) rates. Univariable analysis (UVA) was used to assess clinical predictors of outcome.In total, 263 patients were included  with a median follow up of 4.4 years (range: 0 = 26.7 years). Patients with oncocytic PTC had a 5/10-year incidence of LRF and DM, respectively, of 2.7%/5.6% and 3.4%/4.5%. On UVA, there was an increased risk of DM in PTC tumors with widely invasive growth , extra-thyroidal extension , angioinvasion , focal dedifferentiation , and focal hobnail cell change . There was additionally an increased risk of DM seen in male PTC patients .The use of RAI was more common in patients with larger tumors, angioinvasion, and widely invasive disease. RAI was also used in the management of DM and 43% of patients with oncocytic PTC had RAI-avid metastatic disease. Patients with oncocytic PDTC had a higher rate of 5/10-year incidence of LRF and DM . Patients with extra-thyroidal extension had an increased risk of DM  as did those with angioinvasion. Of the patients with oncocytic PDTC who received RAI for the treatment of DM, 40% had RAI-avid disease.We present a large homogenous cohort of patients with oncocytic PTC and PDTC, with consistent pathologic reporting and definition. Patients with oncocytic PTC have excellent clinical outcomes and similar risk factors for recurrence as their non-oncocytic counterparts . Compared with oncocytic PTCs, the adverse biology of oncocytic PDTCs is supported with increased frequency of DM and lower uptake of RAI. Oncocytic thyroid carcinomas, previously known as \u201cH\u00fcrthle cell\u201d carcinomas, are thought to represent a category of thyroid tumors with genetic and clinical characteristics that differ from non-oncocytic thyroid cancers \u20133. It haMost of the published literature on oncocytic thyroid carcinomas comprises a heterogeneous group of thyroid cancers with oncocytic cytomorphology grouped together as \u201cH\u00fcrthle cell\u201d carcinomas. The heterogeneity of these populations of tumors may explain the lack of consistency in RAI response , 8, 9. AWe postulate that rather than oncocytic cytomorphology and its related molecular alterations, accurate tumor classification and pathological risk factors  play a central role in the prognosis of these tumors. The Princess Margaret Cancer Center is a large quaternary cancer centre in Toronto, Ontario, Canada where all patients with endocrine malignancies have had their pathology reviewed by experienced endocrine pathologists  and classified according to a uniform definition and detailed diagnostic workup , 15, 16.This study was initiated following institutional Research Ethics Board approval. It is a retrospective cohort study and the \u201cStrengthening the Reporting of Observational Studies in Epidemiology\u201d (STROBE) statement was used as a guide for reporting of this study .Patients with oncocytic PTCs and oncocytic PDTCs who were seen at a quaternary cancer center between 2002 and 2017 were identified from an institutional database and assessed for inclusion. All patients had a pathology review completed by at least one of two experts with consistent reporting and definition , 15, 16.Oncocytic PTCs are defined as follicular cell-derived thyroid neoplasms with more than 75% oncocytic change and nuclear features of PTC in the absence of tumor necrosis or increased mitotic activity (>3 per 2mm2). These tumors are further subtyped based on their growth patterns into oncocytic classical  and/or necrosis  times were defined from the date of treatment completion to the date of local and/or regional recurrence. This was defined by physical examination or radiographic imaging, whichever came first. Time of diagnosis of distant metastases (DM) was defined from the date of diagnosis to date of distant disease identification. DM was based on follow-up radiographic imaging; this was performed on the basis of rising thyroglobulin, new indicative symptoms, or additional imaging following the diagnosis of local and/or regional failure. Biopsies were obtained in the setting of DM only if there was a concern about a different diagnosis. All data were retrospectively abstracted from paper and electronic medical records. Data were recorded similarly for all patients treated at our institution over time. There was no blinding in the assessment of the outcome. Overall survival (OS) was calculated from the date of diagnosis to the date of last follow-up or death. Progression-free survival (PFS) was calculated from the date of diagnosis to the date of any outcome (LRF or DM) or death, censored at the date of last follow-up.The total study size was determined by including all patients who met inclusion criteria for oncocytic PTC and oncocytic PDTC during the study period. Descriptive statistics were used for patient demographics and treatment details. Patients with oncocytic PTC  and oncocytic PDTC were analyzed separately. The cumulative incidence function with death as competing risk was used to analyze local failure (LF), regional failure (RF) and distant metastasis (DM) rates for this cohort of patients. Univariable Fine and Gray competing risk regression models were fitted to assess clinical predictors of outcome for patients with oncocytic PTC and oncocytic PDTC. Variables with unknown values were treated as missing and no imputation for missing data was used. The Kaplan-Meier method was used to estimate OS and PFS. P values <0.05 were considered statistically significant. Due to the low number of events, multivariate analyses were not able to be performed. All analyses were conducted using R version 4.0.2 .In total, 371 cases of oncocytic PTC and oncocytic PDTC were identified from an institutional database. Of these, 108 patients were excluded from analyses due to lack of available records or follow-up data , other significant tumor pathology (n=3), or less than 75% oncocytic change (n=6). In total, 263 patients were included in the final analysis Figure\u00a04The median age in this cohort of 218 patients was 55.3 years (range: 19.4 to 85 years) and there was a predominance of female patients (78%). Primary treatment was total thyroidectomy . Forty-eight patients (22%) had a hemithyroidectomy only (41 \u2013 follicular variant PTC and 7 classic variant PTC). In total, 112 (51%) patients received postoperative RAI. Overall, 52 patients (24%) had a dominant lesion >4cm and 31 patients (14%) had widely invasive tumors. With regards to adverse histologic features, ten patients (5%) had focal dedifferentiation , 15 patients (7%) had focal tall cell change, and 5 patients (2%) had focal hobnail cell change. The pathologic features at baseline for the whole cohort as well as for the subgroups of patients with oncocytic follicular variant and oncocytic classic variant PTC are summarized in At the end of the study follow-up, 11 patients (5%) developed a locoregional recurrence. The corresponding 5- and 10-year cumulative incidence of LRF was 2.7% (95% CI: 0.9-6.5%) and 5.6% (95%CI: 2.1-11.8%) Figure\u00a05Seven patients presented with DM and two additional patients developed DM during the study follow up; the latest recurrence occurred 5.24 years after the initial diagnosis. Four of these patients had oncocytic classic variant PTC and five had oncocytic follicular variant PTC. The 5- and 10-year cumulative incidence of DM was 3.4% (95%CI: 1.3-7.0%) and 4.5% (95%CI: 1.8-9.0%) Figure\u00a05Finally, the 5- and 10-year cumulative incidence of any recurrence  was 5.2% (95%CI: 2.5-9.3%) and 8.0% (95%CI: 3.9-14.1%).In the group of 218 patients with oncocytic PTCs, larger tumour size (> 4cm), widely invasive disease, and angioinvasion were associated with the use of postoperative RAI. Cox proportional hazards model was performed for OS and PFS. There was no difference in OS  for patients who received RAI compared with those who did not. Similarly, there was no difference in PFS for patients who received RAI .The patients who presented with DM  were initially treated with total thyroidectomy and postoperative RAI. Only three of 7 (42.8%) patients had metastatic disease that showed RAI uptake; two patients had focal dedifferentiation on their initial pathology. Two additional patients developed DM during the study follow up time and were treated with palliative EBRT.In total, 45 patients with oncocytic PDTC were included in the analysis. There was a slight predominance of male patients (53%). The median age of presentation was older than for patients with oncocytic PTC . RAI use was frequent and used in the management of 39 patients (86%). Four patients (8%) received EBRT alone or in addition to RAI.The 5- and 10-year cumulative incidence of LRF was 21.40% (95% CI: 9.1-37.1%) and 45.4% (95%CI: 24.2-64.4%). Within the cohort of patients with oncocytic PDTCs, 16 (36%) had distant metastatic disease (DM). The corresponding 5- and 10-year cumulative incidence of DM was 11.4% (95%CI: 3.5-24.4%) and 40.4% (95%CI: 17.5-62.4%). The 5- and 10-year cumulative incidence of any recurrence  was 24.4% (95%CI: 11.1-40.3%) and 53.7% (95%CI: 30.5-72.2%) Figure\u00a05The demographics, pathologic features, and management of DM are summarized in Oncocytic PTCs are part of the differentiated thyroid carcinoma spectrum and there remains significant controversy about their biological behavior and optimal management. We reviewed the management and outcomes of a cohort of patients with oncocytic PTCs and PDTCs as defined in a uniform manner according to specific pathological criteria.A wide range of outcomes has been reported for patients with oncocytic PTC, likely secondary to the lack of distinction between various types of oncocytic PTC and heterogenous grouping into \u201cH\u00fcrthle cell\u201d thyroid carcinomas. Some authors report that patients with oncocytic PTCs generally have an excellent prognosis with reported 5- and 10-year disease-free survival of 93% and 81%, respectively, and less than 10% of patients developing local or distant recurrence , 14. SimRAI use in the setting of oncocytic PTC is variable due to the suggestion that there is limited uptake of RAI and therefore limited benefit. Approximately half of the patients with oncocytic PTC received RAI in our cohort \u2013 the clinical factors predictive of RAI use were similar to non-oncocytic PTCs and included: large lesions (>4cm), widely invasive disease, and angioinvasion. This is similar to previous reports that suggest that RAI is more commonly used in the setting of larger tumors, extrathyroidal extension, and presence of distant metastases , 24. TheIn our study, nine patients with oncocytic PTC had DM (seven at diagnosis and two during study follow-up). Among these, four had also focal dedifferentiation characterized by a focal tumor component (less than 30% of the tumor volume) with solid growth, increased mitotic activity and/or necrosis. Focal dedifferentiation has been shown to alter the prognosis of patients with PTCs in former series , 29. HowCompared with patients with oncocytic PTCs, patients with oncocytic PDTCs were older, more likely to be male and had worse outcomes in terms of any recurrence . Two additional retrospective studies confirm these results and suggest oncocytic PDTCs follow a more aggressive course , 33. BaiThe main limitations of the present study are those inherent to its retrospective cohort design and relatively short follow-up time (median 4.4 years). Although 5- and 10-year outcome data are reported, there are relatively small numbers of patients remaining in the cohort at these times and thus these numbers should be interpreted with caution. The findings, however, are strengthened by both the sample size and the rigorous and consistent endocrine pathology workup throughout the study period. The total number of events is small in the cohort of differentiated thyroid carcinoma patients for in depth statistical analyses of predictors of RAI-avidity and outcome. In addition, the small number of events in the context of small numbers of certain prognostic factors in this cohort  led to very high hazard ratios and corresponding confidence intervals; these should be interpreted with caution. This, however, implies that this well-defined oncocytic PTC cohort has excellent clinical outcomes and oncocytic PTCs may be managed similarly to their non-oncocytic counterparts. Within the limitation of the small number of patients with metastatic disease, it may appear as though oncocytic PTCs have reduced RAI uptake in the setting of DM compared with their non-oncocytic counterparts. Given that we do not have a good way of predicting which patients in this cohort may benefit from RAI and that the side-effect profile of RAI is favorable, it may be a consideration for patients with high risk features after careful discussion.In conclusion, we present a large cohort of patients with oncocytic PTC and oncocytic PDTC. We demonstrated that patients with oncocytic PTC have excellent clinical outcomes and low rates of recurrence. Similar to their non-oncocytic counterparts, the status of angioinvasion, large tumor size (>4\u00a0cm), extrathyroidal extension, and focal dedifferentiation stand out as dynamic risk factors for patients with oncocytic PTCs. Compared to their non-oncocytic counterparts, however, it appears that a smaller proportion of patients who develop metastatic disease demonstrate RAI uptake; although the absolute numbers of patients in our cohort are small. Finally, compared with differentiated PTCs, the adverse biology of oncocytic PDTCs is also supported with increased frequency of distant metastases and decreased survival. Further prospective studies are required to better define the optimal use of RAI in this population.The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.The studies involving human participants were reviewed and approved by the University Health Network - Research Ethics Board (Retrospective Study). Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.JL, SLA, and OM contributed to the conception and design of the work, acquisition/analysis/interpretation of the data; drafting of the work and revising it critically for important intellectual content; final approval of the version to be published and are in agreement to be accountable for all aspects of the work including the accuracy and integrity of the work. IP and SMA contributed to the acquisition and interpretation of the data; drafting of the work and revising it critically for important intellectual content; final approval of the version to be published and are in agreement to be accountable for all aspects of the work including the accuracy and integrity of the work. ZL and AL contributed to the analysis and interpretation of the data; drafting of the work and revising it critically for important intellectual content; final approval of the version to be published and is in agreement to be accountable for all aspects of the work including the accuracy and integrity of the work. JB, RT, JP, and KG-H contributed to the conception and design of the work, interpretation of the data; drafting of the work and revising it critically for important intellectual content; final approval of the version to be published and are in agreement to be accountable for all aspects of the work including the accuracy and integrity of the work. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Periodontitis is attributed to the dental biofilm formation. Red complex organisms are a group of organisms linked with periodontal diseases. Therefore, it is of interest to identify potential targets from the red complex organisms to bind with the herbalcompound resveratrol (E - 5 - (4 - hydroxy styryl) benzene 1,3 diol). We report a list of potential proteins having optimal drug like binding features with the herbal agent Resveratrol for further consideration. We used the STITCH v.5 pipeline VICMPred andVirulentPred tools to identify such targets as potential virulent factors in the red complex organisms. We considered the strains of Porphyromonas gingivalis ATCC 33277, Treponema denticola ATCC 35405 and Tannerella forsythia ATCC 43037 in the red complexpathogens for this analysis. Protein targets in the red complex organisms with optimal binding features with the herbal compound resveratrol were thus identified and reported for further consideration. Dental biofilm or plaque can be expressed as the community of a range of microorganisms, which are found, on a tooth surface . The denThere are various treatment modalities that can be used for tackling gingival and periodontal diseases . A few rThe present study follows the planning of an observational study, which primarily aims to screen for those proteins or virulence factors of red complex pathogens, which could possibly interact with resveratrol. The reaction as well as interaction of the compoundwith protein of bacteria was analyzed using STITCH v.5 pipeline  Figure  and therSTITCH database  is an extensive platform for various predicted or known interactions. It provides a comprehensive platform for known and predicted interactions between various compounds and proteins. The interactions between the compound andthe organism could vary from direct or physical and indirect or functional associations, which primarily arise from computational prediction and from interactions aggregated from various other (primary) databases .The repVICMpred  and ViruThe prediction of localisation of proteins at a sub cellular level helps in designing unique drug targets or for substantiating the role of an antimicrobial agent, which targets the virulent protein. Cell surface proteins are considered to be of great interest,as they will be used as vaccine targets. PSORTb V3.0 is an algorithm, which assigns a probable local site to a protein from an aminoalkanoic acid sequence that's provided .The STITCH pipeline was used to identify the protein interaction between red complex bacteria and compound, resveratrol . FurtherEvaluation of a particular compound is of utmost importance before the same has been tested for clinical practice. In helps us to acquire an accurate prediction of the results, which could be encountered while using the particular compound. It is particularlymore cost effective when compared to in vitro evaluation. This method also provides more knowledge about the micro level activities such as pathways of actions and thus the compound can be better understood  There haP. gingivalis is one of the most common bacteria associated with periodontitis [27] and the absolute elimination of the same as well as other red complex pathogens is rather difficult. The proteins from P. gingivalis that react with reseveratrol include, carboxynorspermidinedecarboxylase and Superoxide dismutase. Carboxynorspermidine decarboxylase is found virulent in both P. gingivalis and T. forsythia hence targeted therapy will help to eliminate both the organisms. The present study is a one of its kind, which reveals several proteins,which reacts with resveratrol. Similar studies have also reported the effectiveness of phytocompounds against red complex pathogens . More nuWe report a list of potential proteins from the red complex organisms having optimal drug like binding features with the herbal agent resveratrol for further consideration."}
+{"text": "To explore the clinical characteristics and prognosis of autonomic dysfunction and paroxysmal sympathetic hyperactivity (PSH), and evaluate the efficacy of drugs used to suppress PSH episode in anti-NMDAR encephalitis patients.Patients who met the diagnostic criteria of anti-NMDAR encephalitis were enrolled from January 2012 to August 2018 and followed up for 2 years. PSH was diagnosed according to the PSH-Assessment Measure. The demographics data, clinical features, auxiliary tests results, treatments, and outcomes were prospective collected and analyzed.A total of 132 anti-NMDAR encephalitis patients were enrolled, of which 27.3% and 9.1% experienced autonomic dysfunction and probable PSH respectively. Cardiac autonomic dysfunction was the most common subtype (77.8%). Patients with a higher incidence of ovarian teratoma, mechanical ventilation, neurological intensive care unit admission, and elevated glucose and NMDAR antibody titer in the CSF were more likely to exhibit autonomic dysfunction or PSH. Episodes of PSH can be suppressed by monotherapy in patients without prior sedative drug use with an efficacy of 90%. No significant difference was observed between the prognosis of patients with or without autonomic dysfunction, or between the PSH versus non-PSH groups after 6 months and even during long-term follow-up. However, patients with cardiac autonomic dysfunction had poor prognosis at 6 months.PSH is a common clinical condition in patients with anti-NMDAR encephalitis, especially in severe cases, and can be effectively managed by several drug monotherapies. Despite necessitating longer hospital stay, autonomic dysfunction or PSH do not seem to compromise the neurological recovery of patients. Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is an autoimmune disorder characterized by the generation of autoantibodies against neuronal or synaptic antigens . AlthougThe autonomic nervous system (ANS) controls all unconscious and involuntary functions in response to external stimuli in order to maintain homeostasis, and any disruption in one or more its branches affect daily life functions, and worsens the prognosis of several diseases. Severe dysfunction of the ANS may even lead to disability , 8. ApprParoxysmal sympathetic hyperactivity (PSH), also known as paroxysmal autonomic instability with dystonia, is characterized by hypertension, tachycardia, tachypnea, diaphoresis, agitation and dystonic posturing. It is caused by severe brain injury and associated with higher morbidity, longer hospital stays and worse outcomes , 13. PSHThis is a prospective analysis of Anti-NMDAR encephalitis patients recruited at the Department of Neurology of Xuanwu Hospital, Capital Medical University between January 2012 and August 2018 based on the following inclusion criteria , clinical characteristics, time of admission, medical history, CSF analysis , brain magnetic resonance imaging (MRI) and electroencephalography (EEG) findings, treatment details and follow-up data. Serum and CSF antibodies were measured using indirect immunofluorescence test (IIFT) kits  according to the manufacturer\u2019s instructions. Samples were classified as strong positive (1:100 and above), positive (1:32), weak positive (1:10) and negative according to the antibody titers in serum and CSF. EEGs performed during the peak stage of the disease (14\u201360 days after the onset of symptoms) were analyzed for epileptic discharges, slow activity and other symptoms (including polymorphic delta rhythm and diffuse beta activities).All patients were screened for tumors, symptomatic support and immunotherapy. Patients with cancer, such as ovarian teratoma, underwent surgical resection. Immunotherapies included intravenous glucocorticoid , intravenous gamma immunoglobulin , plasma exchange  or immunosuppressants . For each probable PSH episode requiring intravenous pharmacological treatment, the drugs  and their respective doses were selected based on the physician\u2019s experience rather than objective evidence. Each drug administration was classified as fully effective or ineffective  based on whether the PSH episode was suppressed or not within 30 minutes.The patients were followed-up 6, 12 and 24 months after admission. Treatment efficacy and long-term outcomes were assessed using the modified Rankin Scale (mRS). Recurrence was defined as worsening of previous symptoms or the occurrence of new symptoms after two months of stabilization . Good anStatistical analyses were performed using SPSS 20.0 . Quantitative data with normal distributions are presented as mean \u00b1 SD, whereas data with non-normal distributions are presented as median with the interquartile range (IQR). Student\u2019s t test was used to compare data with normal distribution and homogeneous variance, and Mann\u2013Whitney U test was used to evaluate differences in ranked data. Categorical data were summarized as counts (percentages), and compared by Pearson chi-square test or Fisher exact test. Multiple imputation by chained equations was used to address missing data. P values < 0.05 were considered statistically significant.A total of 153 patients met the inclusion and exclusion criteria of our study (The median age at onset was 25 (IQR 19\u201334) years, and 59 (44.7%) patients were females.The overall incidence of autonomic dysfunction was 27.3% (36/132), with more than half of the patients  exhibiting both sympathetic and parasympathetic dysfunction. The incidence of pure sympathetic and parasympathetic dysfunction were 25% and 22.2% respectively. Cardiac autonomic dysfunction, gastrointestinal dysfunction and sudomotor dysfunction were most common, with respective incidence rates of 77.8%, 41.7% and 38.9%  patients were diagnosed with probable PSH, of which 11 were admitted to the NCU. As shown in As shown in There were 57 probable PSH episodes requiring intravenous pharmacological treatment, of which 18 (31.6%) were related to stimuli, such as turning, back-patting and suctioning. Diazepam and phenobarbitone were commonly administered to control PSH in patients without previous sedative use, and the overall efficacy was 90%. However, the efficacy of monotherapy dropped to 69.6% in patients with previous sedative use, and approximately half of the episodes needed a combination of drugs to control the symptoms : 38.5(21.3 to 72.3) days vs. 16.0 (12.0 to 21.0) days, P<0.000; 63.5(36.8 to 81.5) days vs.18.0(13.0 to 27.9) days, P<0.000]. There was no significant difference between the recurrence and functional outcomes at 6, 12 and 24 months across all groups  and by the Beijing Municipal Administration of Hospitals Incubating Program (PX2020035).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "However, significant uncertainties, and important knowledge gaps, remain concerning the functional roles in SAN spontaneous pacing of many of the individual ion channel- or exchanger-mediated transmembrane current changes. We report results from patch clamp studies and mathematical modeling of the hyperpolarization-activated current, If, in the generation/modulation of the diastolic depolarization, or pacemaker potential, produced by individual myocytes that were enzymatically isolated from the adult mouse sinoatrial node (SAN). Amphotericin-mediated patch microelectrode recordings at 35 \u00b0C were made under control conditions and in the presence of 5 or 10 nM isoproterenol (ISO). These sets of results were complemented and integrated with mathematical modeling of the current changes that take place in the range of membrane potentials (\u221270 to \u221250 mV), which corresponds to the \u2018pacemaker depolarization\u2019 in the adult mouse SAN. Our results reveal a very small, but functionally important, approximately steady-state or time-independent current generated by residual activation of If channels that are expressed in these pacemaker myocytes. Recordings of the pacemaker depolarization and action potential, combined with measurements of changes in If, and the well-known increases in the L-type Ca2+ current, ICaL, demonstrated that ICaL activation, is essential for myogenic pacing. Moreover, after being enhanced (approximately 3-fold) by 5 or 10 nM ISO, ICaL contributes significantly to the positive chronotropic effect. Our mathematical model has been developed in an attempt to better understand the underlying mechanisms for the pacemaker depolarization and action potential in adult mouse SAN myocytes. After being updated with our new experimental data describing If, our simulations reveal a novel functional component of If in adult mouse SAN. Computational work carried out with this model also confirms that in the presence of ISO the residual activation of If and opening of ICaL channels combine to generate a net current change during the slow diastolic depolarization phase that is essential for the observed accelerated pacemaking rate of these SAN myocytes. A number of distinct electrophysiological mechanisms that modulate the myogenic spontaneous pacemaker activity in the sinoatrial node (SAN) of the mammalian heart have been investigated extensively. There is agreement that several (3 or 4) different transmembrane ionic current changes (referred to as the voltage clock) are involved; and that the resulting net current interacts with direct and indirect effects of changes in intracellular Ca In the experiments illustrated in f always develops in the presence of: (i) a larger deactivation of outward current carried by IKr [CaL that is evident in the last one third of the pacemaker depolarization.The final two sets of experiments were carried out in an attempt to obtain sets of current changes due to Id by IKr ; and alsAn additional analysis of the transmembrane current changes responsible for the SAN pacemaker depolarization is illustrated by the averaged results shown in CaL, although a small contribution from the late or slowly inactivating component of Na+ current cannot be excluded [Kr, although contributions from IKs cannot be ruled out in this experiment protocol [During the 600 ms triangular voltage stimulus, a transient inward current developed, although this is not well resolved in these recordings. Following this, a time- and voltage-dependent outward current was activated. It peaked and then declined in response to the slow repolarizing voltage command. After the membrane voltage was returned to approximately the maximum diastolic potential; a slow ramp depolarization was applied to mimic some aspects of the pacemaker depolarization. This resulted in a small decrease in this outward current as we have described previously . This fiexcluded . In addiprotocol . f that are produced by the relatively low concentrations of ISO (1\u201310 nM). The results in CaL. (ii) In addition, between the membrane potentials of approximately \u221220 and \u221260 mV , the ISO-induced difference current was net outward, but also was very small compared to the preceding ISO-induced inward current change. (iii) Finally, in response to the imposed slow depolarization from the \u2018maximum diastolic potential\u2019 (\u221260 mV) to the \u2018threshold\u2019 (approximately \u221240 mV) for initiation of a SAN action potential, this ISO-induced difference current switched from being net outward to net inward. However, this change proved challenging to resolve even with the assistance of signal averaging of the raw current records. As illustrated in The final part of our experimental study attempted to bring out the changes in If in generating the pacemaker potential in a myocyte from the adult mouse SAN was based on mathematical modeling of the pacemaker depolarization and action potential. As described in the Methods and documented in the + current, IKr [f that we obtained  and the updated (HZ-2) models. In all cases these comparisons were based on computations carried out under steady-state conditions. Inspection of these results reveal that there are detectable changes in If, as well as changes in ICaL and IKr arising from secondary effects of altered pacemaking action potentials. In particular inspection of If records showed that changes in this current during the action potential occur simultaneously with a steady inward current of about 0.15 pA/pF. An important component of our analysis of the role(s) of Ient, IKr ). Represent, IKr  model  are provided in the After gaining these insights into the behaviour of our modified model at baseline (or in control settings) the electrophysiological characteristics of a spontaneously active adult mouse SAN myocyte, in response to application of 10 nM ISO were explored. Our approach for obtaining this information involved exploring the dose-dependent modulations by ISO on the maximal conductance parameters and/or the position of the steady-state activation curves for I+ current  that generate If in mammalian hearts [f. Instead, this quasi-instantaneous current change includes significant contributions from the inwardly rectifying background K+ current, IK1, as judged from the reduction of this component by BaCl2. Slowly inactivating or non-inactivating inward currents contributed by either L-type Ca2+ channels or Na+ currents may also contribute to the quasi-instantaneous current changes [In fact, most previous recordings of I If c.f. ,15,16,17n hearts ,42. We n changes ,43,44, p+ current, IK1, in myocytes from the adult rat SAN [A more complete understanding of the basis for this quasi-instantaneous hyperpolarization-activation inward current will require additional experiments, including careful delineation of the central vs. the peripheral, or primary vs. follower pacemaker region, of the anatomical SAN. This type of analysis and important differences in spontaneous pacemaker activity and underlying transmembrane currents have been reported for myocytes isolated from the entire or anatomical, rabbit SAN ,44,45. F rat SAN  and with rat SAN ,48.+ current, IKr, [f were modified based on our experimental findings shown in We have attempted to integrate our experimental findings and analyze their main implications by modifying and making use of a mathematical model of the electrophysiological activity of spontaneously active adult mouse SAN myocytes. This \u2018parent model\u2019 was originally developed by Kharche et al. . It was nt, IKr, . Before f in isolated myocytes from mouse SAN in the presence of 5 nM ISO.Mathematical modeling can provide a basis for detailed inspection of the net ionic current changes that underlie development of the pacemaker potential. In fact, in the mammalian SAN mathematical simulations are essential for this type of analysis since the net current change generating a pacemaker depolarization (having a dV/dt of only approximately 0.1 V/s) is expected to be only in the 0.5 to 2.0 pA per myocyte range. A requirement for this high resolution presents a significant experimental challenge, even when methods such as signal averaging are employed to improve the signal-to-noise ratio c.f. . As mentCaL, IKr, and If) change substantially and interact to result in the small net inward current that drives the slow diastolic depolarization. The experimental data sets in f, ICaL, and/or IKr. We acknowledge also, that in the mouse SAN changes in both T-type Ca2+ current [+ current [In mammalian SAN at least three different currents  that are characteristic of those in the adult mouse heart, either under control conditions or in the setting of adrenergic tone c.f. [f based on our experimental data  of the SAN action potential in various translational contexts. This is because even very small alterations in the MDP, and/or +/\u22125 mV shifts in the midpoint of the steady-state activation relationship for If are likely to result in functionally important changes in the extent to which If is preactivated. Situations in which this residual activation of If is known to occur include: (a) changes in autonomic tone and related alterations in protein kinase A-mediated phosphorylation of If channels [f open probability [f due to it being a target for circadian clock signaling [Determining the exact position of the channels ,60,61;  ignaling ,68 or prignaling .2+ can act as a physiological stimulant. These changes can alter both components of If [2+ fluxes screening surface charges near If channels and/or altering intracellular signaling domains [2+ release or buffering [Revisiting and gaining an improved understanding of the ways in which changes in either extracellular or intracellular Cats of If , or cont domains  or distuuffering .Inspection of f have been studied in detail and catalogued comprehensively [f activation, their functional consequences may need to be reconsidered in terms of specific effects on either the steady component of If or the component regulated by activation or deactivation kinetics. Similarly, when molecular pharmacological approaches are being considered or developed that target If it may be possible to selectively modulate the component due to the residual activation of this channel [Site-specific mutations in well-defined regions of the integral membrane protein complex that is responsible for generating Iensively ,74,75,76 channel . f may be expected to exhibit larger and rapidly changing current components than are present in the rabbit SAN (300 bpm) or in human SAN (60\u201380 bpm). This has been recognized in a recent paper from the Boyett group [f to adult mouse SAN pacemaker activity will also need to be carefully considered in relation to the stimulus or pacing paradigm imposed on the experimental tissue or isolated myocyte preparations that are used for physiological, pharmacological or biophysical analyses [+ [+/Ca2+ exchange or G-protein-mediated K+ channel function have been reported [+ fluxes through activated If channels could also contribute significantly to intracellular Na+ homeostasis [+ fluxes through If can significantly change intracellular Na+ levels.When considering the translational significance of this work, it is important to place our results in a species-dependent context by recognizing that the exceptionally high heart rate of the adult mouse (550\u2013600 bpm) has the consequence that in this species Itt group . Contribanalyses . This malyses [+  and subsn SAN 60\u2013 bpm. Thireported . In addieostasis . This pof. Considerations such as this may provide a translational context as basic scientists and clinical investigators continue to seek improved mechanistic understanding of \u2018cardiac automaticity\u2019 [f (such as ivabradine) to manage the global ischaemia associated with coronary artery disease or heart failure [Our results also should be considered in relation to important features of the classical concept of \u2018induced pacemaker activity\u2019 ,82. In taticity\u2019 , or cons failure .The methods that we have used to: (i) dissect the sinoatrial node (SAN) tissue, (ii) locate the leading or primary pacemaker site, (iii) enzymatically isolate spontaneously active myocytes and place aliquots of them in a superfusion chamber, and (iv) make amphotericin-mediated patch clamp recordings at 35 \u00b0C +/\u2212 1 \u00b0C have been described in detail in our previous publications ,23. All Kr, and related changes in the pacemaker potential and action potential in adult mouse SAN myocytes [f, during spontaneous pacemaker depolarization in the adult mouse SAN. The Kharche et al. model [Kr that we have recently published [The mathematical model originally developed by Kharche et al.  and recemyocytes , was usel. model  was chosublished  were utif. The experimental data in the present paper provides much more detailed information concerning the voltage dependence and kinetics of If at 35 \u00b0C. As reported recently [f are somewhat complex. Both its onset and decay time courses are best described by an expression consisting of the sum of two exponential processes  and the sustained inward current (Ist); as well as the maximal channel conductances of the K+ currents  were scaled as specified in Kr were also modified as illustrated in the 2+ handling were also made. Details of the ISO actions on the membrane ion channel currents and on the Ca2+ handling can be found in our previous paper [Our original model for the mouse SAN myocyte  includedrecently  in mouseand also ). For thn et al. . Detaileus paper  and in t\u22123 ms. This was sufficiently small to ensure stable numerical solutions. Each simulation epoch consisted of computing a 20 s train of action potentials and pacemaker depolarizations together with continuous time records of the selected underlying ion channel-mediated currents. The last 1 s section of the data generated by each computational epoch was selected for presentation and analysis in each figure in this paper. The sets of equations that are the basis for the updated model were solved using a fixed time step of 1 \u00d7 10"}
+{"text": "Furthermore, PEGDA/DAFM/TGF-\u03b21 hydrogels supported the adhesion, proliferation, and increased ECM production of AF cells. In vivo repair performance of the hydrogels was assessed using a rat AF defect model. The results showed that the implantation of PEGDA/DAFM/TGF-\u03b21 hydrogels effectively sealed the AF defect, prevented nucleus pulposus atrophy, retained disc height, and partially restored the biomechanical properties of disc. In addition, the implanted hydrogel was infiltrated by cells resembling AF cells and well integrated with adjacent AF tissue. In summary, findings from this study indicate that TGF-\u03b21-supplemented DAFM hydrogels hold promise for AF repair.Annulus fibrosus (AF) repair remains a challenge because of its limited self-healing ability. Endogenous repair strategies combining scaffolds and growth factors show great promise in AF repair. Although the unique and beneficial characteristics of decellularized extracellular matrix (ECM) in tissue repair have been demonstrated, the poor mechanical property of ECM hydrogels largely hinders their applications in tissue regeneration. In the present study, we combined polyethylene glycol diacrylate (PEGDA) and decellularized annulus fibrosus matrix (DAFM) to develop an injectable, photocurable hydrogel for AF repair. We found that the addition of PEGDA markedly improved the mechanical strength of DAFM hydrogels while maintaining their porous structure. Transforming growth factor-\u03b21 (TGF-\u03b21) was further incorporated into PEGDA/DAFM hydrogels, and it could be continuously released from the hydrogel. The   \u2022Injectable DAFM derived hydrogel with mechanical property matching natural AF and sustained TGF-\u03b21 release was developed.\u2022DAFM derived hydrogels promote AF cell proliferation, migration and ECM production.\u2022DAFM derived hydrogels display good integration with host AF tissue.\u2022DAFM derived hydrogels facilitate AF repair and restore intervertebral disc biomechanics. InterveMany strategies have been proposed for the repair of AF defect. Although traditional AF repair devices can help restore mechanical stability, fixation of the device can cause damage to surrounding structures such as the cartilage endplate, and the long-term efficacy of the device is uncertain because of the absence of biological repair . Recent Transforming growth factor-\u03b21 (TGF-\u03b21) is a potent growth factor (GF) that regulates cell proliferation, differentiation, and matrix production and acts a pivotal part in tissue repair and regeneration ,19. For In addition to GFs, suitable biomaterials are essential for AF repair. The ideal repair material should possess good cytocompatibility, support cell migration, proliferation, ECM production, and be well integrated with surrounding tissues after implantation ,24. Manyin vitro. After the hydrogel was implanted into AF defect, its reparative effect was evaluated on the basis of gross, imaging, histological, and biomechanical findings , which has excellent mechanical stability. TGF-\u03b21 was incorporated into the hydrogel to promote AF repair. The effects of the composite hydrogel, PEGDA/DAFM/TGF-\u03b21, on the proliferation, migration, and ECM synthesis of AF cells were investigated findings .Scheme 122.1Lithium phenyl  phosphinate (LAP) was obtained from TCI Company, Japan. Triton X-100, pepsin and Collagen I were obtained from Sigma-Aldrich, USA. PEGDA was purchased from Alfa Aesar, USA. Collagenase was obtained from Yeasen Co., Ltd. (China). Ethanol, sodium hydroxide and acetic acid were obtained from Aladdin Co., Ltd. (China). The details of other reagents are given in the experimental methods.2.2The DAFM was prepared following a previously reported protocol . Briefly2.3To evaluate the decellularization efficiency, the histological sections of native AF and DAFM were stained with hematoxylin and eosin  and DAPI  and the residual DNA was quantitatively measured with a Hoechst assay as previously described . The mai2.4The DAFM powder was digested with pepsin acetic acid solution by stirring for 48\u00a0h to obtain 1% (w/v) DAFM solution. Undigested particles were removed by centrifugation. Then the digested solution was neutralized using NaOH solution at 4\u00a0\u00b0C. DAFM hydrogels were prepared by incubating the pre-gel solution at 37\u00a0\u00b0C for 30\u00a0min. For PEGDA/DAFM hydrogel preparation, the DAFM solution was homogeneously mixed with PEGDA and LAP. The final weight fractions of the LAP, DAFM and PEGDA in the solution were 0.25%, 1% and 15% (w/v), respectively. Then the PEGDA/DAFM pre-gel solution was crosslinked with blue light treatment . Similarly, the PEGDA/Collagen hydrogel was prepared as the control. PEGDA/DAFM hydrogels were prepared by adding TGF-\u03b21  into the PEGDA/DAFM pre-gel solution at the concentration of 1 \u03bcg/mL.2.5DAFM and PEGDA/DAFM hydrogels were lyophilized with a vacuum freeze dryer. Then the microstructure of the lyophilized hydrogel was visualized by scanning electron microscopy (SEM) after spray coating with a thin layer of Au.2.6The mechanical properties of DAFM and PEGDA/DAFM hydrogels were determined by compressive tests using a universal testing instrument . All samples were prepared as standard cylinders of a height of 10\u00a0mm and a diameter of 4.5\u00a0mm. Four duplicates were set in each group. Stress-strain curves were generated by gradually applying compression load to the hydrogels (1\u00a0mm/min). The compressive modulus of all samples was calculated from the curves.2.7To study the release profile of TGF-\u03b21, the PEGDA/DAFM/TGF-\u03b21 hydrogel was placed in PBS and kept shaking at 37\u00a0\u00b0C. The release of TGF-\u03b21 at specific time points  was detected with an ELISA kit .2.8All animal experiments followed the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of Soochow University. AF tissues were collected from rat tail IVDs. The tissue was trimmed and digested in collagenase solution . The digestion solution was filtered and centrifuged to collect cell pellets. The cells were cultured using DMEM/F12 complete medium after resuspension. All experiments were performed with AF cells at passage 2.2.94 per well of 24-well plate. The bottom chamber contained DMEM essential medium with different concentration of TGF-\u03b21. After culture for 12\u00a0h, cells were fixed using 4% paraformaldehyde. Cells within the insert were removed, while those on the bottom surface were photographed and counted after crystal violet  staining.The chemotactic effect of TGF-\u03b21 was evaluated using a Transwell chamber . Briefly, the cells were starved overnight and treated with trypsin solution . Then the cells were seeded onto Transwell inserts at a density of 5\u00a0\u00d7\u00a0102.103 per well. Three duplicates were set in each group. The viability of AF cells was estimated using a Calcein-AM/Ethidium homodimer-1 LIVE-DEAD cell staining kit . The cell images were captured using a fluorescence microscope. The proliferation of AF cells at 1, 4 and 7 days was determined by Cell Counting Kit-8  following the manufacturer's protocols.The PEGDA/Collagen hydrogels (PC group), PEGDA/DAFM hydrogels (PD group), and PEGDA/DAFM/TGF-\u03b21 hydrogels (PDT group) with a diameter of 1.5\u00a0cm and a thickness of 0.5\u00a0cm were placed in a 24-well plate. AF cells were seeded on the surface of hydrogels at a density of 5\u00a0\u00d7\u00a0102.114 per well. Three duplicates were set in each group. To evaluate the morphology of AF cells on hydrogels, the cells were fixed by paraformaldehyde. For SEM analysis, the constructs were dehydrated with gradient concentrations of ethanol and then treated with critical point drying. Finally, the samples treated with gold spraying were observed by SEM. For cytoskeleton staining, the samples were co-stained with a TRITC labeled probe  and DAPI. The samples were washed with PBS before being photographed with a fluorescence microscope .After crosslinking, three groups of hydrogels  with a diameter of 1.5\u00a0cm and a thickness of 0.5\u00a0cm were placed in a 24-well plate. AF cells were seeded on the surface of hydrogels at a density of 1\u00a0\u00d7\u00a0102.125 per well. Three duplicates were set in each group. After 14 days of culture on hydrogels, cells were collected. The extraction of total RNA was performed using a commercial kit  following instructions. The concentration and purity of RNA was determined using Nano Drop and then the RNA was reverse transcribed into cDNA using RT Master Mix . Finally, qRT-PCR was conducted to quantify the relative transcription levels of target genes . The primers and genes are listed in Three groups of hydrogels  with a diameter of 3.4\u00a0cm and a thickness of 0.5\u00a0cm were placed in a 6-well plate. AF cells were seeded on the surface of hydrogels at a density of 2\u00a0\u00d7\u00a0102.135 per well. Three duplicates were set in each group. Total protein of each sample was extracted using RIPA lysed buffer . Protein concentration of all samples was determined by a BCA Protein Assay Kit . The extracted proteins were separated by 10% SDS-PAGE gels before transfer to nitrocellulose membranes . Then the membranes were probed with primary antibodies  after being blocked with skim milk. The next day, the membranes were incubated with the respective peroxidase-conjugated secondary antibody for 1\u00a0h. Finally, the proteins were visualized using a FluorChem imaging system.Three groups of hydrogels  with a diameter of 3.4\u00a0cm and a thickness of 0.5\u00a0cm were placed in a 6-well plate. AF cells were seeded on the surface of hydrogels at a density of 2\u00a0\u00d7\u00a0102.14In the study, SD rats  were divided into five groups: normal group, defect group, PEGDA/Collagen hydrogel injection group (PC group), PEGDA/DAFM hydrogel injection group (PD group) and PEGDA/DAFM/TGF-\u03b21 hydrogel injection group (PDT group), respectively. Surgeries were carried out as previously described with minor modifications . In brie2.15Disc samples were collected and fixed with 10% formalin . After softening with decalcified fluid, samples were dissected with a blade along the line between the center of the disc and the initial site of puncture. The degree of disc degeneration was evaluated using Thompson score system based on the gross appearance .2.16The disc height of each sample was measured using Image J software from digital radiographs. The disc height was normalized to the average height of adjacent vertebrae to calculate the disc height index (DHI). The %DHI was defined as the ratio of the DHI in the operative groups to the DHI in the normal group.2.17The rat tail was examined by MRI at 4 and 8 weeks postoperatively. The water content of the operated disc was normalized to that of the normal disc to estimate the relative water content of NP according to the T2-weighted images. The modified Pfirrmann grading was used to evaluate disc degeneration.2.18Rat tail samples obtained were fixed with 10% formalin. After decalcification and dehydration, the samples were embedded in paraffin. The paraffin sections were stained with H&E and safranin O-fast green (S&O) following instructions. Anti-COL I and Anti-COL II antibodies  were used for immunohistochemical staining according to our previous study .2.19An axial compression test was used to assess the biomechanical properties of the IVD as previously described . Briefly2.20p is less than 0.05.All date shown were mean\u00a0\u00b1\u00a0standard deviation (SD). Statistical analyses were performed using ANOVA followed by Tukey's post hoc analysis . A statistically significant difference is considered if 33.1Porcine AF tissue was decellularized by trypsin digestion followed by nuclease and Triton X-100 treatment. After decellularization, DAFM became a white and slightly loose substance A. H&E st3.2Although DAFM hydrogels well supported cellular activity, they could not provide stable structure due to lack of mechanical strength. To overcome this limitation, PEGDA was added into DAFM to prepare a photocrosslinkable hydrogel with good mechanical properties. After freeze drying, the morphological characteristics of DAFM and PEGDA/DAFM hydrogels were observed by SEM. The DAFM hydrogel presented a porous structure, with pore size roughly in the range of 10\u2013600\u00a0\u03bcm A. Compar3.3Next, the chemotactic effect of TGF-\u03b21 on AF cells was examined using a Transwell experiment. Compared with that in the control group , there was a significant increase in the migration of AF cells through the Transwell membrane following the addition of TGF-\u03b21 . The num3.4The cytotoxicity of PEGDA/Collagen, PEGDA/DAFM, and PEGDA/DAFM/TGF-\u03b21  hydrogels was assessed using live/dead staining A. There 3.5Col1a1, Col2a1, and Acan, was detected to evaluate the effect of three hydrogels on matrix production of AF cells  showed a slightly increased trend compared with that in the PC group (1.00\u00a0\u00b1\u00a00.05). Among the three groups, the PDT group presented the highest expression level of matrix synthesis-related genes. Western blot analysis further confirmed that the production of COL I, COL II, and ACAN proteins was significantly enhanced in the PDT group compared with other two groups . However, none of the existing animal models is ideal because the IVDs of animals are not loaded exactly the same way as human IVDs do . The ratDespite the exciting results, there are limitations in this study. Because of the lack of specific markers for AF cells , the inf5In this study, a photocrosslinkable and TGF-\u03b21-supplemented DAFM-derived hydrogel has been successfully developed for AF repair. This hydrogel provided desired injectability and structural and mechanical stability, and the tissue-specific microenvironment that could promote cellular activities and tissue regeneration of AF. Further, the sustained release of TGF-\u03b21 from the hydrogel promoted the migration of AF cells, which facilitated the integration of hydrogels with host AF tissue, prevented NP atrophy, retained disc height, and restored the disc biomechanics. Together, findings from this study indicate that the TGF-\u03b21-supplemented DAFM hydrogel might be an ideal candidate of scaffolds for AF tissue engineering applications.Qiang Wei: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Data curation, Writing \u2013 original draft, Writing \u2013 review & editing, Visualization. Dachuan Liu: Validation, Formal analysis, Investigation, Writing \u2013 review & editing. Genglei Chu: Conceptualization, Methodology, Writing \u2013 review & editing. Qifan Yu: Validation, Formal analysis, Investigation. Zhao Liu: Visualization. Jiaying Li: Methodology, Investigation. Qingchen Meng: Formal analysis, Investigation. Weishan Wang: Methodology, Formal analysis, Writing \u2013 review & editing. Fengxuan Han: Conceptualization, Formal analysis, Funding acquisition, Writing \u2013 review & editing. Bin Li: Conceptualization, Writing \u2013 review & editing, Visualization, Supervision, Project administration, Funding acquisition.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "The current study aims to investigate the combined association of walking pace and grip strength with incident type 2 diabetes (T2D). A total of 205\u2009738 participants  without diagnosed or unknown diabetes at baseline from the UK Biobank study were included in this prospective study. Walking pace was self\u2010reported as slow, average, or brisk. Grip strength was measured using a dynamometer and classified as weak, average, and strong. The combined association of walking pace and grip strength with incident T2D was investigated using Cox\u2010proportional hazards models with a 2\u2010year landmark analysis. The additive interaction was conducted by estimating relative excess risk due to interaction (RERI). After the median follow\u2010up period of 5.4\u2009years (interquartile range: 4.8\u20136.5), 5082 (2.5%) participants were diagnosed with T2D. Compared to brisk\u2010strong individuals (reference group), people who were slow\u2010weak had a higher risk of T2D  after adjusting for all covariates. There were dose\u2013response gradients across both walking pace and grip strength variables. There was a modest amount of negative additive interaction (RERI; \u22120.06 . To conclude, slower pace and weaker grip strength were associated with a higher risk of developing T2D, independent of sociodemographics, lifestyle, and adiposity. Combining walking pace and grip strength might be a practical approach to screening people who are at increased risk of developing T2D. For example, walking pace and grip strength have both been associated with all\u2010cause mortality, cardiovascular disease (CVD), and cancer incidence and mortality.From a physiological point of view, walking pace and grip strength reflect different underlying physiological processes, grip strength is a simple contraction measuring strength whereas walking pace integrates strength with other processes such as balance and coordination, and so it is possible that the combination of both will result in a stronger association with health outcomes than individually. Indeed, previously we have demonstrated the additive effects of walking pace and grip strength for CVD risk prediction22.1n\u00a0=\u00a0273\u2009991), participants who had diabetes (n\u00a0=\u00a012\u2009967) or unknown diabetes (n\u00a0=\u00a01589) at baseline, and missing exposure or covariates (n\u00a0=\u00a08173).The UK Biobank study recruited approximately 502\u2009000 participants between 2006 and 2010  from the general population.2.2http://biobank.ndph.ox.ac.uk/showcase/showcase/docs/primary_care_data.pdf. We defined incident T2D as primary care diagnosed with ICD\u201010  code E11. READ codes used in the primary care data were converted into ICD\u201010 codes using UK Biobank's look\u2010up table.Incident T2D was derived from linkage to primary care data in the UK Biobank. Records were extracted for 45% of the UK Biobank cohort (228\u2009467 participants). The end of coverage (extract date) was May 2017 for Scotland, September 2017 for Wales, and August 2017 for England. Detailed linkage procedures are available at 2.3Participants self\u2010reported their usual walking pace on a touch\u2010screen questionnaire at the baseline assessment visit. The question asked was \u201cHow would you describe your usual walking pace?\u201d and they could select one of the three following options: brisk (>4\u00a0miles/h), average (3\u20134\u00a0miles/h), and slow walking pace (<3\u00a0miles/h), as described elsewhere.2.4The covariates included age, fruit and vegetable intake, red meat intake, processed meat intake, body mass index (BMI), as well as categorical variables sex, ethnicity, deprivation index, smoking status, alcohol intake, total sedentary time, sleep duration, and multimorbidity.2), normal weight (18.5\u201324.9\u00a0kg/m2), overweight (25\u201329.9\u00a0kg/m2), and obese (\u226530\u2009kg/m2). Multimorbidity was derived from participants who self\u2010reported chronic illnesses at baseline that included 43 medically diagnosed diseases. This covariate was categorized as a binary variable that as having no, or have 1, or more chronic illnesses. Additional details about these measurements can be found in the UK Biobank online protocol.Age was calculated from birth and baseline assessment dates; sex was self\u2010reported; ethnicity was self\u2010reported and categorized as white, South Asian, Black, Chinese, and mixed. The deprivation index, an area\u2010based measure of socioeconomic status, was derived from the postal code of residence using the Townsend deprivation score.2.5Continuous variables are expressed as mean with SD and categorical variables are expressed as frequency and percentage. Cox\u2010proportional hazard models were used to investigate the associations of walking pace, grip strength, and the combination of walking pace and grip strength with incident T2D with follow\u2010up as the timeline variable. The results were reported as hazard ratios (HR) together with 95% confidence intervals (CI). The analyses were conducted within a 2\u2010year landmark period, which excludes any incident T2D occurring in the first 2\u2009years of the follow\u2010up period and excluded all participants with prevalent diabetes (type 1 or type 2) or undiagnosed diabetes (HbA1c\u2009\u2265\u200948\u2009mmol/mol), as well as those with missing data on walking pace, grip strength, and covariates.The associations between walking pace, grip strength, and the combination of walking pace and grip strength and T2D incidence were adjusted for confounders with three models that included an increasing number of covariates. Model 1  was adjusted for age, sex, deprivation index, and ethnicity. Model 2 (lifestyle model) was adjusted for all variables in model 1 plus, fruit and vegetable intake, red meat intake, processed meat intake, smoking status, alcohol intake, total sedentary time, sleep time, and multimorbidity. Model 3 (adiposity model) was adjusted for all variables in model 2 plus BMI.The additive interaction was conducted to test the interaction between walking pace and grip strength with incident T2D. The analyses were adjusted for confounders with three models as mentioned above. Relative excess risk due to interaction (RERI) was estimated to measure the additivity of the associations.p\u2010values <0.05 were regarded as statistically significant.The proportional hazard assumption was tested by Schoenfeld residuals. Statistical analyses were performed using the statistical software STATA 17 (StataCorp LP) and R v4.0.2. 2.6http://www.ukbiobank.ac.uk/). This research has been conducted using the UK Biobank resource under application number 7155.The UK Biobank study was approved by the North West Multi\u2010Centre Research Ethics Committee  and all participants provided written informed consent to participate in the UK Biobank study. The study protocol is available online .Of the 502\u2009458 participants, 205\u2009738 participants who had full data available for incident T2D, walking pace, grip strength, and covariates were included in this study Figure\u00a0. The medTable\u00a0Table\u00a0The combined associations between walking pace and grip strength and T2D incidence are shown in Table\u00a04The main finding of this study is that the combination of slow walking pace and weak grip strength were associated with a higher risk of T2D, independently of sociodemographics, lifestyles, and adiposity, than either walking pace or grip strength alone. Additive interaction analysis showed only a slight overlap for the association between grip strength and walking pace, reassuring the importance of considering both markers. These findings have important public health relevance as both walking pace and grip strength are easy to measure and are inexpensive,Our findings agree with and extend the findings of previous studies on this topic. In the latest prospective cohort study investigating walking pace and T2D risk, conducted in Japan with a 3\u2010year follow\u2010up, data indicated that a fast walking pace was associated with a lower risk of T2D after adjusting for sociodemographic and lifestyle factors including BMI and systolic blood pressure.A prospective cohort study, with 1085 older Japanese aged 65\u201389\u2009years who were followed up for 10\u2009years, investigated the combination of walking pace, grip strength, and standing balance to predict CVD, cancer, and all\u2010cause mortality. They indicated that adding grip strength to walking pace increased the ability to predict all\u2010cause mortality.To the best of our knowledge, our study was the first study that provided the additive interaction of the joint effect of two exposures between walking pace and grip strength on incident T2D. The results showed that the joint association was slightly lower (\u22126%) than the sum of their independent associations.The strengths of the present study are that a large number of participants provided a sufficient sample size to undertake the analysis. We were also able to show that the associations were independent of various lifestyle factors and adiposity. Walking pace and grip strength are low cost, easy to administer, and, therefore, relatively simple to implement into clinical practice. Even though our study derived 45% of incident T2D linked to primary care data in the UK Biobank, these data have\u00a0external validity for studying the prevalence and incidence of T2D.To conclude, this is the first study to report the combined association of walking pace and grip strength and T2D incidence. The findings provide evidence that the combination of walking pace and grip strength are associated with T2D incidence, more than either alone, and this might be a practical approach to screening people who are at high risk of developing diabetes.5Physical activity is a crucial component of care in people with T2D,J.B., F.K.H., C.C\u2010M., and S.R.G. contributed to the study conception and design, advised on all statistical aspects, and interpreted the data. J.B., F.K.H., C.C\u2010M., and S.R.G. performed the statistical analyses. J.B., F.K.H., C.C\u2010M., and S.R.G. drafted the manuscript. J.B., S.P\u2010S., F.P\u2010R., F.K.H., C.C\u2010M., and S.R.G. reviewed the manuscript and approved the final version to be published. J.B., F.K.H., C.C\u2010M., and S.R.G. are the guarantors of this work and, as such, had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.The authors report no conflict of interest.Appendix S1Click here for additional data file."}
+{"text": "Gait analysis may serve various purposes related to health care, such as the estimation of elderly people\u2019s risk of falling. This paper is devoted to gait analysis based on data from depth sensors which are suitable for use both at healthcare facilities and in monitoring systems dedicated to household environments. This paper is focused on the comparison of three methods for spatiotemporal gait analysis based on data from depth sensors, involving the analysis of the movement trajectories of the knees, feet, and centre of mass. The accuracy of the results obtained using those methods was assessed for different depth sensors\u2019 viewing angles and different types of subject clothing. Data were collected using a Kinect v2 device. Five people took part in the experiments. Data from a Zebris FDM platform were used as a reference. The obtained results indicate that the viewing angle and the subject\u2019s clothing affect the uncertainty of the estimates of spatiotemporal gait parameters, and that the method based on the trajectories of the feet yields the most information, while the method based on the trajectory of the centre of mass is the most robust. The typical gait requires proper functioning of the musculoskeletal and central nervous systems, which involves the ability to perform complex movement patterns and to rapidly process sensory input . Thus, tGait disorders typically accompany ageing-related decline in the general health status and the loss of functional mobility. The accidental falls of the elderly\u2014of which a substantial proportion occurs during walking \u2014are one Enabling elderly people to live independently in their households\u2014rather than admitting them to nursing care facilities\u2014might not only improve their quality of life but also relieve public health care institutions of some of their workloads and thus provide savings on health care expenditures . MonitorVarious techniques for clinical gait analysis have been developed, including optoelectronic motion-capture systems and platforms and treadmills equipped with force sensors . WearablDepth sensors are much cheaper and smaller than optoelectronic motion-capture systems and tensometric platforms. They do not require any devices or markers to be worn on the body or clothes of the examined person. A functional gait analysis system may be composed of a depth sensor connected to a computer, so it can be easily installed in various spatial configurations. If the person being monitored in the home is concerned, depth sensors do not violate that person\u2019s privacy as much as video cameras. Gait analysis systems based on depth sensors are often considered suitable for screening patients before more detailed diagnostic procedures . The posestimates of the positions of anatomical landmarks obtainable using depth sensors are corrupted by non-negligible measurement uncertainty\u2014in particular, estimates of the positions of feet ;during walking, the lower limbs may occlude each other from time to time, making it difficult to accurately track the movement of both of them simultaneously;estimates of positions of anatomical landmarks can usually be obtained only in part of the depth sensor\u2019s field of view, typically covering no more than 1 or 2 strides;the angle between the walking direction and the depth sensor\u2019s line of sight, as well as the subject\u2019s clothing, may affect the accuracy of localisation of anatomical landmarks.Despite the practical advantages of depth sensors, their application for gait analysis remains a technical challenge because of the following facts:The last point is irrelevant in the case of diagnostic procedures carried out in health care facilities where the patients can be advised to wear standard clothes and asked to walk in a specified direction. It is, nevertheless, relevant in the case of in-home monitoring systems expected to provide reliable information regardless of the monitored person\u2019s walking direction and clothing.Various methods for spatiotemporal gait analysis based on data from depth sensors have been proposed during the last several years. Ferraris et al. considered analysing the antero-posterior velocity of the ankles using a Kinect v2 device placed in front of the walking person . Dubois The accuracy of most of the aforementioned data-processing methods has been assessed using reference equipment such as optoelectronic motion capture systems: Vicon ,23,28,33viz.:a method based on the analysis of the anteroposterior distance between the examined person\u2019s knees, being a variant of the method described in ;a method based on the analysis of the vertical oscillations of the examined person\u2019s centre of mass, being a variant of the method described in ;a method based on the analysis of the horizontal velocity of the examined person\u2019s feet, being a variant of the method described in .This paper is devoted to a comparison of three methods for the estimation of selected spatiotemporal gait parameters based on data from a depth sensor, The uncertainty of the estimates of selected spatiotemporal gait parameters obtained using these methods was assessed for different depth sensors\u2019 viewing angles and various types of subjects\u2019 clothing.The data acquired using a depth sensor represent estimates of the three-dimensional position in a coordinate system relative to the sensor\u2019s internal structure. On the other hand, the studied methods for estimation of spatiotemporal gait parameters, described in subsequent sections of this study, involve processing estimates of the positions of body parts\u2014such as the knees or feet\u2014either along the body\u2019s antero-posterior axis or its vertical axis. Therefore, before further processing, two rotations of the depth sensor\u2019s coordinate system are necessary: a rotation that places one of the coordinate axes parallel to the examined person\u2019s vertical axis and a rotation that places one of the remaining coordinate axes parallel to the person\u2019s walking direction .\u03d1 between the sensor\u2019s ys axis and the examined person\u2019s yp axis  is based on the observation that during walking, the local maxima of the distance between the knees, measured along the anteroposterior axis, approximately coincide with the foot contact (FC) moments  .The coordinates of the positions of the examined person\u2019s knees can be estimated from depth images using a general-purpose algorithm for locating anatomical landmarks. Such algorithms are implemented in the Microsoft Kinect devices. Similar algorithms, applicable to other devices comprising depth sensors, are available commercially. Alternatively, these coordinates can be estimated using a dedicated algorithm for locating knees. Such an algorithm may involve extracting human silhouettes from depth images and identifying the parts of these silhouettes which correspond to the knees. That identification can be based on the observation that the knees are located at about 0.26 body height .The estimation of spatiotemporal gait parameters using the KD method involves the following sequence of operations:1.smoothing of the sequences of knee position coordinates, e.g., using a Savitzky-Golay filter a;2.computation of the anteroposterior distance between the knees according to the following formula:N is the number of depth images contained in the data set under analysis;3.detection of the left and right FC moments by identifying the local minima and maxima, respectively, of the sequence d1,\u2026,dN b;4.estimation of the step and stride times based on the detected FC moments;5.estimation of the step and stride lengths and widths based on estimates of positions of feet at the detected FC moments.d1, \u2026, Nd correspond to the time intervals when the right knee is ahead of the left one. Its negative values, on the other hand, correspond to the time intervals when the left knee is ahead of the right one.The positive values of the elements of the sequence d1, \u2026, Nd to its subsequent local maximum. The right step time\u2014defined analogously for the right foot\u2014can be estimated as the average time from a local maximum of that sequence to its subsequent local minimum. Stride time is the average time which elapses between two consecutive FC moments of the same foot [The left step time is defined as the average time which elapses from a right FC moment to the next left FC moment . It can ame foot . It can The positions of the feet, estimated at the FC moments detected according to the above-described procedure, can be used to estimate the left and right stride length, step length, stride width and step width according to standard definitions .The data-processing method, called the CH method (referring to the acronym of \u201ccentre height\u201d) is based on the observation that during gait, the local minima of the height of the centre of mass approximately coincide with the FC moments . On the 1smoothing of the sequences of coordinates of the height of the examined person\u2019s centre of mass, e.g., using a Savitzky-Golay filter a;2identification of the local minima and maxima of that height b;3estimation of the mean step and stride time based on the detected FC moments;4estimation of the mean step and stride length based on the detected MS moments.The estimation of spatiotemporal gait parameters using the CH method involves the following sequence of operations:cf.\u00a0In addition to the oscillations expected, the exemplary estimates of the height of the examined person\u2019s centre of mass, shown in The analysis of the vertical oscillations of the centre of mass does not allow for distinguishing left FC moments from right ones. The mean step time, irrespective of the side, can be estimated as the average time between consecutive local minima of the height of the centre of mass. The stride time can be estimated as the average time between every second local minimum of the height of the centre of mass. The mean step length, irrespective of the side, can be estimated as the average distance between the positions of the centre of mass along the antero-posterior axis at consecutive maxima of its height. The stride length can be estimated as the average distance between the positions of the centre of mass along the antero-posterior axis at every second maximum of its height.smoothing of the coordinates of the positions of feet, e.g., using a Savitzky-Golay filter a;estimation of the horizontal velocity of the feet by numerical differentiation of the sequences of position estimates;comparison of that velocity with an empirically selected threshold value;detection of the FC moments and the foot-off (FO) moments  by identifying the moments when velocity falls below or rises above\u2014respectively\u2014the aforementioned threshold value b;estimation of selected spatiotemporal gait parameters based on the detected FC and FO moments and the estimates of positions of feet.The data processing method called the FV method (referring to the acronym of \u201cfoot velocity\u201d) is based on the observation that during walking, the horizontal speed of a foot is close to zero during the stance phase and larger during the swing phase. The coordinates of the positions of the examined person\u2019s feet can be estimated from depth images using a general-purpose algorithm locating anatomical landmarks. The estimation of spatiotemporal gait parameters using the FV method involves the following sequence of operations:left and right step time,left and right step length,stride time,stride length,left and right swing time,left and right stance time,double-support time,step width.The results of the detection of the left and right FO and FC moments, together with the corresponding estimates of the positions of feet, allow for estimating the following spatiotemporal gait parameters according to their standard definitions :left andcf. the review of literature in Two sets of data were collected in order to assess the uncertainty of the estimates of spatiotemporal gait parameters obtainable using the three data processing methods described in The spatiotemporal parameters were estimated for 5 subjects: 3 women and 2 men, aged 22\u201345, free from gait disturbances. Subjects #1\u2013#3 wore typical trousers, Subject #4\u2014wide-leg trousers, and Subject #5 wore a skirt. Some anthropometric information about the subjects is collected in \u03c6 \u2245 180\u00b0);depth sensor\u2019s line of sight parallel to the walking direction (\u03c6 \u2245 135\u00b0);depth sensor\u2019s line of sight diagonal to the walking direction (\u03c6 \u2245 90\u00b0).depth sensor\u2019s line of sight perpendicular to the walking direction ;those obtained only for Subjects #1\u2013#3  and only in the experiments in which \u03c6 between the walking direction and the depth sensor\u2019s line of sight: 90\u00b0, 135\u00b0 and 180\u00b0).those obtained for all subjects in all experiments . On the other hand, the step time estimates are significantly less accurate when the depth sensor\u2019s line of sight is perpendicular to the walking direction (\u03c6 = 90\u00b0). The step length estimates obtained using the KD method are also much less accurate for \u03c6 = 90\u00b0. Those obtained using the CH and FV methods are only slightly less accurate in that case.It can be seen in MARE of the estimates of the step time and length for all three values of the angle \u03c6 = 90\u00b0, 135\u00b0, 180\u00b0.It can be seen in Among the three studied data-processing methods, the FV method allows for the most detailed characterisation of the gait. It enables the determination of the initial-contact moments and the toe-off moments, thus making possible the estimation of the durations of the phases of the gait cycle. The CH method, on the other hand, provides the least information: the left and right steps cannot be distinguished based on the vertical oscillations of the examined person\u2019s centre of mass. It seems that the informativity of the CH method could be increased by supplementing it with the analysis of the lateral  position, velocity or acceleration of the centre of mass, but this possibility has not been considered in the study reported herein. The KD method provides more information than the CH method, but less than the FV method.\u03c6 = 180\u00b0), all three studied data-processing methods yield quite satisfactory results: the bias of the estimates of spatiotemporal gait parameters is small, and their dispersion is similar to that of the reference values obtained using the Zebris FDM platform , the errors corrupting the estimates of spatiotemporal gait parameters, obtained using the KD method and the FV method, are significantly larger  and very large when he or she is observed from the side . These large errors are probably caused by the fact that the antero-posterior position of the knees is easier to estimate when the front of the subject\u2019s silhouette is visible in the depth images. When the subject is observed from the side, one of his or her knees is occluded from time to time. Perhaps, better results could be obtained for \u03c6 = 90\u00b0 if the position of the knees were estimated using a dedicated algorithm for processing depth images, instead of a general-purpose algorithm for localisation of anatomical landmarks, but this possibility was not considered in the study reported herein. The originators of this data-processing method considered placing the depth sensor behind a treadmill  [The depth sensor\u2019s viewing angle has a non-negligible influence on the results of gait analysis, obtainable using the studied data-processing methods. This influence is most pronounced in the case of the KD method : the rel \u03c6 = 0\u00b0) .\u03c6 = 90\u00b0 than for other viewing angles , so further research is needed to develop a method useful in that setting. The implementation of a dedicated algorithm for processing raw depth images, instead of using a general-purpose algorithm for localisation of anatomical landmarks, seems a good starting point for such research.The experimental results described above indicate that, in certain conditions, reliable results of spatiotemporal gait analysis can be obtained using the Kinect v2 depth sensor. The CH method can be recommended for the analysis of gait of persons wearing different types of clothing, but if detailed characterisation of gait is sought, then further research is required to develop a data-processing method which would combine the robustness of the CH method and the informativeness of the FV method. None of the studied data-processing methods is capable of providing accurate estimates of spatiotemporal gait parameters of subjects observed from the side (\u03c6 = 180\u00b0 and \u03c6 = 135\u00b0, and only two subjects\u2014for \u03c6 = 90\u00b0. Furthermore, all the subjects were persons of working age, free from gait disorders. The presented experimental findings need, therefore, to be validated using more data in order to corroborate the usefulness of the studied methods for the analysis of gait of elderly people and people suffering from gait disorders.The experiments reported herein were subject to certain limitations. Five subjects took part in these experiments for The development of more sophisticated data processing methods\u2014in particular, methods based on a fusion of information obtained using the three methods studied in this paper\u2014may allow for obtaining more accurate and robust estimates of various useful spatiotemporal gait parameters independently of the subject\u2019s clothing and walking direction. The development of reliable gait analysis systems based on depth sensors\u2014in particular, those dedicated to in-home monitoring settings\u2014seems desirable because such systems have certain advantages over the currently available gait analysis systems based on other technological solutions. The optoelectronic motion-capture systems are much more expensive than depth sensors and they need to be installed in quite large rooms, which makes their application for in-home monitoring impractical. Platforms and treadmills equipped with force sensors, relatively common in clinical facilities and laboratories, are also more expensive and less convenient for in-home use than depth sensors, and they cannot serve for estimating the angles in the ankle, knee and hip joints\u2014which is reportedly feasible using depth sensors . Gait anThe results of gait analysis based on data from a Kinect v2 device can be comparable in accuracy to those based on data from a Zebris FDM platform if the subject is wearing typical trousers and walking toward that device. In such a case, the FV method allows for the most detailed characterisation of human gait.The angle between the walking direction and the depth sensor\u2019s line of sight significantly affects the accuracy of the estimates of the spatiotemporal gait parameters, obtained using all three studied data-processing methods.The subject\u2019s clothing significantly affects the accuracy of the gait analysis results obtained using the FV method and the KD method, but not the CH method.The practical advantages and disadvantages of the studied data processing methods, identified based on experimental results described above, may serve as a basis for further research aimed at developing more versatile methods for spatiotemporal gait analysis, dedicated to in-home monitoring systems.The findings of this study can be summarised as follows:the development and testing of other methods for processing data from depth sensors, aimed at obtaining more accurate and robust estimates of spatiotemporal gait parameters;conducting more experiments aimed at testing the usefulness of gait analysis systems based on depth sensors in clinical practice and in systems for in-home monitoring of the elderly.The authors\u2019 plans for future research include:"}
+{"text": "This work aims to improve the information dissemination atmosphere of rural live broadcasting and ensure its long-term development. First, it studies and analyzes the current situation and characteristics of rural live broadcasting. Then, it discusses the blockchain (BC) technology and information dissemination mode in the era of artificial intelligence (AI). Finally, the characteristics of BC technology (BT) and the information dissemination model are discussed. A BT-optimized susceptible exposed infected recovered (SEIR) information dissemination model is proposed. The results show that the BT-optimized SEIR model has no effect on the traditional information transmission characteristics and can ensure the conventional transmission of all information. Additionally, BT can effectively improve the overall transmission efficiency of the SEIR model for false information and accurate information and effectively shorten the duration. Specifically, the BT-optimized SEIR model's maximum false information transmission proportion is reduced by about 13%. The duration is reduced by 15 days over the traditional model. By comparison, in positive information dissemination, the maximum transmission proportion of the proposed BT-optimized SEIR model is about 19% higher than the traditional model. The duration is about 30 days longer. The research provides technical support for controlling and improving the current situation and atmosphere of rural live broadcasting information dissemination. Artificial intelligence (AI) technology has become the mainstream science and technology in today's society. For example, many intelligent network technologies are widely used in human life and daily activities. AI studies and develops theories, methods, technologies, and application systems to simulate, regenerate, and expand human intelligence. AI aims to empower machines to listen (speech recognition (SR) and machine translation (MT)) and see (image recognition (IR) and character recognition (CR)). It also teaches computers to speak  and think (man-machine game and theorem proving). Ultimately, machines can learn (machine learning (ML) and knowledge representation (KR)) and act (robots and autonomous driving (AD)). In particular, blockchain (BC) technology excels among many network technologies. It has many advantages, such as decentralization, distrust, security, reliability, and traceability. Thus, BC technology (BT) has been popularized in the social environment . MeanwhiWang and Su (2020)  pointed Actually, nonprofessionals can also set up live streaming because of relatively low requirements on skills. This kind of live streaming provides an easy-communicative environment and receives a large variety of public with fair distribution. However, the absence of industry norms and supervision means that some problems are inevitable, causing excessive entertainment, consumption, and vulgar content. Therefore, it is necessary to improve the conditions for disseminating information. Kudchadkar and Coroll  claimed According to the above literature review, this work first analyzes the current situation and characteristics of rural live broadcasting to provide a theoretical basis for the subsequent research. Then, BT and information dissemination are discussed, which provides a technical basis for the research. Finally, an information dissemination optimization model for rural live broadcasting based on BT is proposed, and the model is comprehensively evaluated. The innovation of this work is to combine network information dissemination technology with BT to provide a better and safer technical means and environment for rural live broadcasting. The research results provide technical support for optimizing information dissemination based on rural live broadcasting and help improve society's overall live broadcasting atmosphere.The development of the Internet and various network technologies brings countless benefits to human society and also poses many threats. Social networks provide a broad communication platform for humankind and change people's communication methods. Traditional face-to-face communication is changed into the current information exchange, video exchange, and live communication with the help of social networks. However, some criminals take advantage of the communication mode to earn ill-gotten money . In viewBased on social networks, the information in both cities and rural areas is spread rapidly through live broadcasting. However, many people in rural areas do not receive much education. They have little knowledge of social networks, resulting in disclosing important personal information and being cheated by some false information. Live broadcasting is originally a sociable way to improve the communication efficiency of culture, knowledge, and positive energy. However, the current live broadcasting network has caused significant damage to audiences' interests due to inadequate supervision in information dissemination and transactions . RewardiBT originates from bitcoins, a digital currency. It is the process of packaging data in chronological order through BC, connecting them according to the packaged blocks. Then, it forms a BC for data transmission and storage, achieving data security through passwords and preventing data tampering and embezzlement . It has The information dissemination model includes an influence model and an infectious disease model based on the game theory. The infectious disease model classifies the population according to their infection states, namely, vulnerability to infection, immunity, and infection . Based o\u03bb is the probability of information transmission, and S(t) and I(t) represent the proportions of susceptible and infected persons at time t. The SIS model includes the infected and the susceptible population, but their transmission modes are different. In the SIS model, the transmission is performed from the infected to the susceptible. There is also a situation where the infected are cured of the susceptible [In equations  and 2),,2), \u03bb isceptible . The cal\u03b2 is the probability of the infected becoming susceptible. The SIR model includes the infected, susceptible, and immune populations. It shows the process from the susceptible to the infection to the immune, which will no longer be infected [In equations  and 4),,4), \u03b2 isinfected . The cal\u03bc is the probability that the infected person will become immune. In equations \u20137), \u03bc i, \u03bc i7), SI, SIS, and SIR models described in The information dissemination model implemented under BT can help establish a more secure, reliable, and orderly storage technology for information dissemination. Users can review their communication information and its preciseness in information dissemination on the social network platform. Because BT's social network platform mechanism is reliable, it has become promptly popular . The BT As shown in \u03bb is the probability of changing from the susceptible to the exposed. \u03b4 is the probability of changing from the exposed subject to the infected. \u03bc is the state from the infected to the immune. This model evaluates the implemented BT model, and its development process of rural live broadcasting under BT is verified.In equations \u201311), \u03bb , \u03bb 11), With the development of rural networks, live broadcasting has been popularized in rural areas. Selling rural characteristic agricultural products is the main task in rural living broadcasting. However, in information transmission, their responses are different from those in urban areas when they promote their products in live broadcasting. Sometimes, what they do or say violates the current social values, which greatly impacts information dissemination. The infectious disease model describes the traditional rural live broadcasting. The impact of information dissemination can be indirect. That is, it cannot intuitively describe the harm of information dissemination to the population. Therefore, it is necessary to comprehensively evaluate the impact of information dissemination on the population through factor analysis. The analysis of the effects of the SEIR model on information dissemination is more comprehensive than other models. Its specific impact on the information dissemination of the SEIR model needs to be considered under BT. As shown in In With the continuous promotion of the digital economy in recent years, AI has developed rapidly and is deeply integrated with various application scenarios. AI has gradually become an important technology to promote the development of economic innovation. In order to use AI to promote rural economic development and ensure the stable development of rural areas, this work discusses the information dissemination mode of rural live broadcasting under BT. The results are as follows: first, among the infectious disease models selected in this work, the proposed BT-optimized SEIR model can evaluate the overall impact of information dissemination on the population more accurately than SI, SIS, and SIR models. Therefore, this work designs the BT-optimized SEIR model to reflect the basic form of information dissemination through different types of people. Second, the proposed BT-optimized SEIR model does not affect the propagation process of the traditional SEIR model. BT optimization will not affect SEIR model basic information dissemination factors and dissemination process. Finally, an experiment is designed to compare the transmission data between the BT-optimized SEIR model, the SEIR model with a reward and punishment system, and the traditional SEIR model. As a result, the proposed BT-optimized SEIR model is much better than the other two information transmission models in controlling false information, positive information transmission efficiency, and duration. Therefore, using BT to optimize the information dissemination model does not affect the fundamental factors of information dissemination and controls the dissemination efficiency and duration of false information and positive information through its reward and punishment system and reputation system. The proposed BT-optimized SEIR model can comprehensively rectify the deterioration of information dissemination in rural live broadcasting. Additionally, this work helps create a more positive atmosphere for live information dissemination in rural areas. Compared with traditional information dissemination technology, the BT-optimized SEIR model has strong advantages in information dissemination speed. It safeguards information dissemination and comprehensively improves the current situation of network information dissemination. Finally, the research limitation is that too few factors are involved in the overall model evaluation. Future work will increase the research on the information dissemination model under more evaluation factors."}
+{"text": "Metformin, the first-line oral antidiabetic medicine, has shown great antineoplastic potential in various cancer types, despite an unclear mechanism. This study aimed to elucidate the possible mechanism of metformin as a chemotherapy agent with less reproductive and genetic toxicity in human endometrial cancer. The type I endometrial carcinoma cell lines Ishikawa and RL95-2 were treated with metformin. Cell functions, such as proliferation, migration, and invasion, were analyzed. Flow cytometry was performed for cell cycle and apoptosis analyses. Simultaneously, RT-qPCR and western blotting were performed to explore the possible mechanism. Moreover, YAP1 knockout Ishikawa cells were established via lentivirus to demonstrate the underlying mechanism. The results showed that metformin mediated Ishikawa and RL95-2 cell growth inhibition in a dose- and time-dependent manner. The IC50 values of metformin in Ishikawa and RL95-2 cells were 10\u2009mM and 8\u2009mM, respectively. The migration and invasion abilities were also inhibited in the metformin-treated group using wound healing assays and transwell migration and invasion assays, and Ishikawa and RL95-2 cells were arrested in the G1 or G2 phase, respectively. Moreover, the cell proportions of cells in both early and late apoptosis stages were dramatically elevated when treated with metformin, as was the ratio of Bax/Bcl-2 expression. Additionally, the expression levels of YAP1 mRNA and protein in the treatment group were much lower than those in the control group. The cellular behaviors of YAP1 knockout Ishikawa cells were similar to those in the metformin-treated group. Our results demonstrated that it is an attractive alternative to cytotoxic chemotherapy in human endometrial cancer, and YAP of the Hippo pathway may be a potential molecular target. This study provides novel ideas for the adjuvant therapy of endometrial cancer patients, especially for women with strong fertility desires and demands. Endometrial cancer is the most frequently occurring gynecologic malignancy in Western countries. It has been reported that since 2008, the incidence of endometrial cancer has increased by 21% in the United States, as well as doubling the death rate over the past two decades , chemothThe Hippo signaling pathway is an evolutionarily conserved signaling transduction and regulator involved in cell differentiation, tissue regeneration, organ development, and immune modulation . The corMetformin, the most widely used antidiabetic drug , has beein vitro and the role of the Hippo signaling pathway in the process.The present study aims to explore the antineoplastic effect of metformin on endometrial cancer v/v) fetal bovine serum , 100\u2009U/mL penicillin , and 100\u2009\u03bcg/mL streptomycin  at 37\u00b0C in a humidified atmosphere with 5% CO2 in an incubator . Metformin  was dissolved in ddH2O and then diluted to a suitable concentration. YAP1-knockout (YAP1-KO) lentivirus (LV-YAP1-KO) based on the CRISPR/Cas9  system was purchased from Genechem, China. Ishikawa cells were transfected with LV-YAP-KO using HitransG P . Following selection with 5\u2009\u03bcg/ml puromycin  for 72\u2009h, single-cell clones were sorted, expanded, and validated as YAP1-KO Ishikawa cells by western blotting and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis.Human type I endometrial carcinoma Ishikawa and RL95-2 cells were previously donated by the Cancer Biology Research Center of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Cells were cultured in Dulbecco's modified Eagle medium (DMEM)-high glucose  containing 10% .Cell function assays included cell viability assays, flow cytometry analysis, wound healing assays, transwell migration assays, and The cell cycle was analyzed using flow cytometry. Cell pellets were resuspended in precooled 90% ethanol and then incubated at \u221220\u00b0C overnight. After washing and incubating in a water bath, the cells were stained with propidium iodide  for 20\u2009min in the dark before flow cytometry analysis. Dual staining was performed for the apoptosis assay using an Annexin V-FITC/PI kit . Cells stained with FITC-conjugated Annexin V and PI were measured by flow cytometry.Well-spread cells in 24-well plates were scratched by a pipette tip after FBS starvation for 12\u2009h and then observed every 24\u2009h using an inverted microscope . The relative wound areas were quantified and calculated by ImageJ .\u03bcL FBS-free medium were seeded in the top chambers of transwells  and Matrigel-coated transwells , and the medium on the bottom was supplemented with 20% FBS. After 48\u2009h of culture, cells in the chambers were fixed with 4% paraformaldehyde, stained with crystal violet , and then counted under a 20\u00d7 microscope .For the transwell migration and invasion assays, 10,000/mL cells in 100\u2009\u03b2-actin (66099-1-Ig) were purchased from Proteintech, China. Anti-YAP1 (#14074) and anti-phospho-YAP1 (#13008) were purchased from CST, United States. The secondary antibodies (1\u2009:\u20092000) were purchased from Servicebio, China. The antibodies mentioned above were diluted at a ratio of 1\u2009:\u20091000 unless stated otherwise.The concentrations of total protein extracted from the cells were quantified using a BCA assay . After separation using 10% SDS-PAGE, the proteins were transferred to PVDF membranes  and then incubated with the corresponding primary antibody and horseradish peroxidase-conjugated secondary antibody according to the manufacturer's instructions. Protein visualization was performed using an ECL kit . Protein expression was quantified using ImageJ software . Anti-LAST1 (17049-1-AP), anti-Bcl-2 (12789-1-AP), anti-Bax , anti-GAPDH (10494-1-AP), and anti-Premix Ex Taq  following the manufacturer's instructions. The mRNA expression was calculated using the 2\u2212\u0394\u0394Ct method and normalized to GAPDH. The sequences of the primers were as follows: YAP1, 5\u2032-ACTGGCTACGCAGGGCTA-3\u2032 (F), 5\u2032-TTTGAGTCCCACCATCCTGCTCCAG-3\u2032 (R), GAPDH: 5\u2032-TGAGTCCTTCCACGATACCAA-3\u2032 (F), 5\u2032-AGTCTTCTGGGTGGCAGTGA-3\u2032 (R).Total RNA was isolated from the cells using NucleoZol reagent . Then, 500\u2009ng of total RNA was used to synthesize cDNA using a reverse transcription kit , and qPCR was performed using TB Green t-test was used for comparisons between two groups, and analysis of variance (ANOVA) was used for comparisons among three groups. Two-tailed hypothesis tests were performed. P < 0.05 was considered significant. Each experiment was performed in triplicate and repeated at least three times independently.Statistical analyses were performed by using SPSS version 26.0 , and data visualization was carried out using GraphPad Prism 8.0 . All data are presented as the mean\u2009\u00b1\u2009standard deviation (SD). Student's independent Ishikawa and RL95-2 cells were incubated with metformin at different concentrations , and the cell proliferation ability was detected using CCK-8 assays. As shown in Cell apoptosis rates were examined in Ishikawa and RL95-2 cells after 48\u2009h metformin treatment  by Annexin V-FITC/PI flow cytometry. FITC\u2009+\u2009PI- cells were regarded to be in the early stage of apoptosis, and FITC\u2009+\u2009PI\u2009+\u2009cells were in the late stage of apoptosis. As shown in Figures P < 0.01), demonstrating that metformin inhibited Ishikawa in vitro migration in a dose-dependent pattern , the number of penetrating cells was much lower than that in the 10\u2009mM metformin group (55.7\u2009\u00b1\u200933.3) and the 20\u2009mM metformin group (20.6\u2009\u00b1\u200914.0) (P < 0.01)  to investigate cell migration and invasion. Since confluence growth was absent in RL95-2 cells, the wound healing assay was only performed in Ishikawa cells. The relative areas between the scratches in the control group were positively correlated with exposure time, and the wound was almost healed after 48\u2009h of treatment. In the metformin treatment group, the speed of wound healing was significantly slower, especially with a higher concentration of metformin, which indicated an inhibitory effect of metformin on Ishikawa cell migration Figures . The res Figures . A more  Figures . Then, t Figures . Similar Figures .The Hippo signaling pathway may be an antitumor target of metformin in endometrial carcinoma cells.in vitro invasion in Ishikawa cells, and the results demonstrated the obvious inhibition of invasion in YAP1-KO Ishikawa cells  for 48\u2009h to explore the possible mechanism of the antitumor effect of metformin. The mRNA and protein expression of YAP1 and LATS in Ishikawa cells were detected using qRT-PCR and western blotting. The relative protein level of p-YAP1/YAP1 increased obviously in the metformin-treated group Figures . Additio Figures . Equally Figures .In the current study, we found that metformin was able to inhibit cell proliferation, migration, and invasion, as well as induce cell cycle arrest and apoptosis in human endometrial cancer cells. Moreover, YAP, the core of the Hippo signaling pathway, might be a potential target for the antineoplastic therapy with metformin in endometrial cancer .in vitro.First, Ishikawa and RL95-2 cells were treated with various concentrations of metformin at different times and analyzed by CCK-8 assay to seek a suitable treatment concentration and time. Cell cycle arrest in G1 and G2 phases can be observed by flow cytometry, and metformin is likely to interfere with the process of DNA replication. The results of Annexin V/PI dual staining flow cytometry also proved that metformin induced both early and late stages of apoptosis, which was further reinforced by western blotting. Moreover, the decrease in Bcl-2/Bax in the metformin-treated group suggested the possible participation of the mitochondrial pathway. In addition, more cell functions were investigated through wound healing tests and transwell analysis, and significant inhibition of cell migration and invasion was observed. The above results indicated the significant suppression effects of metformin on endometrial cancer cells Metformin has shown great potential for antidiabetic, antiphlogistic, antilipemic, and antineoplastic properties. It has been reported that metformin reduces the incidence and death rate and improves the prognosis of multiple malignancies, including hepatocellular , pancreaThe Ishikawa and RL95-2 cell lines both originated from type I endometrial cancers, which are hormone-dependent and caused by cumulated estrogen with the lack of the antagonism of progesterone. Type I endometrial cancer is usually well-differentiated adenocarcinoma, normally accompanied by obesity, diabetes, and infertility, and secondary to atypical hyperplasia of the endometrium . Interesin vitro studies, with an IC50 of 8 to 10\u2009mM, were much higher than those in animals, which were between 40 and 70\u2009\u03bcM of the plasma concentration in veins after the administration of a therapeutic dose [Drug safety is always the focal concern of health care providers. Metformin has been proposed to improve the clinical outcomes of fertility in females suffering from polycystic ovary syndrome (PCOS) with insulin resistance . Comparetic dose . A similtic dose , but it in vitro cell experiments, and more animal studies are needed to reinforce our current results and conclusions. Moreover, the functional routes of metformin in endometrial cancer are complicated and cross-linked, and the Hippo signaling pathway may not be unique. The exact signaling pathway network remains to be explored. The lack of comparison of metformin and traditional antitumor drugs such as paclitaxel can be another limitation. Whether metformin can achieve a similar antitumor effect as other drugs is still unclear. More mechanistic studies with a better design are needed to investigate the anticancer effect of metformin on endometrial cancer in the future.There were still limitations in this study. We only detected the expression of a few proteins and mRNAs involved in apoptosis and the Hippo pathway, and the exploration of the mechanism was not comprehensive and deep enough. In addition, our conclusions were based on In conclusion, metformin treatment in human type I endometrial carcinoma Ishikawa cells and RL95-2 cells can inhibit proliferation, migration, and invasion, block the cell cycle, and promote apoptosis, demonstrating that metformin is an attractive alternative to cytotoxic chemotherapy in human endometrial cancer and that YAP of the Hippo pathway may be a potential molecular target. This study provides novel ideas for the adjuvant therapy of endometrial cancer patients, especially for women with strong fertility desires and demands."}
+{"text": "B-acute lymphoblastic leukemia (B-ALL) recovery rates exceed 90% in children; however, the relapse rate is around 20% among treated patients, and 10% of these are still incurable. This review highlights the biological and clinical relevance of telomerase for B-ALL and the implications of its canonical and non-canonical action on signaling pathways in the context of disease and treatment. The physiological role of telomerase in lymphocytes makes the study of its biomarker potential a great challenge. Nevertheless, many works have demonstrated that high telomerase activity or hTERT expression, as well as short telomeres, correlate with poor prognosis in B-ALL. Telomerase and related proteins have been proven to be promising pharmacological targets. Likewise, combined therapy with telomerase inhibitors may turn out to be an alternative strategy for B-ALL.Telomeres and telomerase are closely linked to uncontrolled cellular proliferation, immortalization and carcinogenesis. Telomerase has been largely studied in the context of cancer, including leukemias. Deregulation of human telomerase gene  Leukemia is characterized by the production of abnormal leukocytes based on cytogenetic alterations, molecular modifications, clinical features and, notably, high proliferation . AlthoughTERT\u201d) AND (\u201cAcute lymphoblastic leukemia\u201d OR \u201cB-ALL\u201d OR \u201cALL-B\u201d OR \u201cALL\u201d) and (\u201ctelomerase\u201d OR \u201chTERT\u201d) AND (\u201cAcute lymphoblastic leukemia\u201d) AND \u201ctreatment\u201d. Additional references were obtained from cross-referencing bibliographies.We conducted a literature search using the NCBI database (PubMed) in September 2022 using the following combinations of keywords: , consisting of the rearrangement of the lysine methyltransferase 2A encoding gene to a highly diverse range of partner genes . Al. Al54]. Shelterin are also involved in the establishment of heterochromatin and telomeric silencing. The recruitment of these proteins is apparently related to enriching methyltransferases into the sub-telomere regions for gene silencing, which allows telomere lengthening .The composition of white blood cells depends on different exposures to stress factors . DiffereThe telomerase consists of the catalytic telomerase reverse transcriptase subunit, known as TERT, and an RNA component (hTR) that works as a template for telomere extension ,63,64. TTelomerase acts on TL maintenance during the fetal phase of life, and its presence in adult tissues is infrequent. In leukocytes, TL is stabilized around age 20, and a slow rate of attrition occurs during adulthood . MoreoveTelomerase is present in tumor cells from over 85% of cancer types, while about 15% of them continue the telomere lengthening through homologous recombination processes collectively known as alternative lengthening of telomeres (ALT), which is not a telomerase-dependent mechanism ,71,72.hTERT transcription, which also determines in which type of cell telomerase will be expressed [hTERT mutation itself has been shown to be insufficient for telomere maintenance [The regulation of telomerase activity is crucial and occurs mainly through the control of xpressed . The regxpressed . Moreovexpressed . Howeverntenance .hTERT promoter represent frequent somatic genetic alterations that cause telomerase reactivation [hTERT controllers that are associated with transcription activators such as c-myc, MZF-2, and WT-1. Hypermethylation prevents binding of the repressors to the promoter, which leads to hTERT upregulation and telomerase activation [Mutations in the tivation ,76. Epigtivation ,78.NF-kB mediated inflammation, and cancer progression in general  in which its level is associated with high TA [The  high TA ,171. The high TA . The synDespite the fact that up-regulation of telomerase in human B lymphocytes may occur independently of cellular proliferation, with expression of telomerase catalytic subunits , it has Telomerase is virtually absent in most adult tissues and detectable in most tumors, but the physiological role of this enzyme in lymphocytes represents an important challenge for approaching it as biological marker in leukemia. However, the straight relationship between telomerase activity and proliferation, as well as its anti-apoptotic role , make ithTERT methylation status as a promising prognostic biomarkers in B-ALL , and more precisely for maintenance and disease persistence, also reinforcing the potential of telomerase as therapeutical target, mainly due to its multiple non-canonical actions [Both high telomerase activity and shortened telomeres are correlated with disease progression, resistance to therapy and bad prognosis in ALL . Telomer actions ,47,179.In Ph+ B-ALL, the p16INK4A/pRb pathway with a high TA determines a group of adult ALL associated with poor prognosis . FurtherhTERT mRNA expression and hematological parameters in B-ALL. Nevertheless, these same studies have showed that telomere attrition is linked to childhood ALL. On the other hand, Borss\u00e9n et al. have demonstrated that B-cell precursor group cases had a higher hTERT methylation than diploid ALL. In addition, hTERT mRNA levels were negatively associated with methylation status, but curiously, in low-risk B-cell precursor patients, long telomeres indicated a worse prognosis [However, controversial results can be found in the literature. In the work of Ozgur et al.  and Eskarognosis .Monitoring minimal residual disease (MRD) is one of the most important strategies to follow up B-ALL patients due the capacity to identify lower cell levels. In this sense, it was demonstrated that quantification of telomerase expression along with monitoring MRD by qPCR can strengthen the follow up of patients with B-ALL. This would not only improve treatment follow up but also help to identify post-therapy remission .hTERT promoter methylation is infrequent in B-ALL cases with remission, and there is no association with TL. However, hTERT RNA expression is reduced when methylation occurs [P300-Sp1 in order to regulate hTERT transcription. In that case, hTERT is a major factor due to the regulation stimulated on the \u03b2-Arrestin pathway, rising p300-sp1 expression [Finally, a large number of studies propose that pathogenesis and the phenotypic characteristics of B-acute lymphoblastic leukemia are connected with the conjunction of specific targets and DNA variations promoted by epigenetic alterations such as methylation ,185,186.n occurs . Methylan occurs . It has pression .TRF2 expression was shown to be increasing in acute leukemias and also higher in lymphocytes of B-ALL patients, particularly in those with an abnormal karyotype [The role of the shelterin complex in B-ALL has also been studied. aryotype . Recentlaryotype . Nonethearyotype .CTC1 and OBFC1 (they are part of CST complex which works with the shelterin complex to lengthen telomeres); however, only CTC1 was associated with leukemia [Beyond hTERT, B-ALL patients also show high expression of leukemia .hTERT polymorphisms and their implications in oncology, but just few works approach it in the context of B-ALL. The hTERT polymorphisms rs2735940 and rs2736100, for example, were defined as risk factor for ALL and turned out to be functional; they were implicated in TA, TL and homeostasis. The same authors showed that a variant near hTR, as well as high TL, are markers for risk of acute lymphoblastic leukemia in Chinese children [There is, currently, a vast field literature on children .hTERT may have a different influence on B-ALL with regard to different populations; nonetheless, large-scale studies need to be done to verify this hypothesis.Another study demonstrated that the survival rate of children with B-ALL was higher in European American children (EA) than in African American children (AA), which appeared to be due to the different canonical pathways affected in each case. Telomerase signaling is related to AA pathways, while chromosome aberrations in EA more frequently affect genes involved with homologous recombination . This suDifferent approaches for telomerase inhibition have been under development for more than a decade, aiming at more effective treatment strategies. Telomerase activity can be inhibited by different strategies, such as disrupting biosynthesis, maturation, assembly, or correct interaction between the telomerase complex and the substrate . In TablDoxorubicin (DOX) is a chemotherapy drug used in different cancer treatment protocols. This molecule promotes cell death through disruption of DNA repair by inhibiting topoisomerase II, and provokes oxidative stress by generating free radicals ,206. HowZataria multiflora extract (ZME) is a plant extract oil that exhibited a synergistic effect in association with doxorubicin, increasing its toxicity in all tested B-ALL cell lines. Despite this combination raising the levels of anti-apoptotic Bcl-2, it downregulated expression of c-Myc and hTERT, showing ZME as a potential adjuvant for treatment of pre-B-acute lymphoblastic leukemia [Bax/Bcl-2 ratio aligned to down-regulation of c-Myc and hTERT [The leukemia . Additiond hTERT . It is ind hTERT .hTERT and c-Myc expression. Besides, high doses of BIBR1532 can induce p73, up-regulate Bax and activate caspase-3 [Bax. Furthermore, it raised p21 levels, which promoted G1 cell cycle arrest and downregulation of p73-mediated c-Myc and hTERT expression [BIBR1532 is one of the most powerful telomerase inhibitors. This synthetic non-nucleoside compound binds to telomerase and acts as a chain terminator during nucleotide polymerization, inhibiting TA in a dose-dependent way ,210. BIBaspase-3 . Associapression .To summarise, the combination of DOX with BIBR1532, ZME or MST-312 increases its therapeutic effect. A synergistic mechanism, if confirmed, could lead to therapeutical protocols with a lower dose of doxorubicin, thereby decreasing the risk of DOX-induced cardiotoxicity.It is important to mention that there are a vast number of works showing the antitumor effects of telomerase inhibitors in a variety of in vitro and in vivo models of different cancer types , includiIn any case, further investigation is deeply required, including clinical trials, which could determine the safety of these compounds alone or as combined therapies for B-ALL patients. However, the greatest challenge that must be overcome in order to take studies with telomerase inhibition to the next level is the development of compounds targeting inhibition of non-canonical functions, which have been demonstrated to be crucial for cancer maintenance.hTERT expression, as well as short lymphocytes\u2019 telomeres, are frequently correlated with poor prognosis or even higher risk for B-ALL. However, there are still some apparent conflicting data in the literature, associating long telomeres with worse prognosis. We emphasize the word \u201capparent\u201d since it also became clear that there is no single pattern concerning telomere and telomerase functions in leukemia, especially considering all possibilities of non-canonical actions of TERT. Additionally, the influence of telomerase on B-ALL seems to be divergent in different ethnic groups, which needs further investigation to be better elucidated. Finally, this pool of results shows a promising future for telomere and telomerase targeted therapy as new or combined treatments, but most data are too preliminary for short-term clinical use, especially in ALL.The physiological functions of telomerase in lymphocytes represent a challenge to determine the role of this enzyme in B-ALL. However, clearly reviewed data showed evidence of the potential of telomerase and other telomere-related proteins as clinical biomarkers and pharmacological targets. Briefly, high telomerase activity or"}
+{"text": "In this paper, we propose a bit depth compression (BDC) technique, which performs bit packing by dynamically determining the pack size based on the pattern of the bit depth level of the sensor data, thereby maximally reducing the space wastage that may occur during the bit packing process. The proposed technique can dynamically perform bit packing according to the data\u2019s characteristics, which may have many outliers or several multidimensional variations, and therefore has a high compression ratio. Furthermore, the proposed method is a lossless compression technique, which is especially useful as training data in the field of artificial intelligence or in the predictive analysis of data science. The proposed method effectively addresses the spatial inefficiency caused by unpredictable outliers during time-series data compression. Additionally, it offers high compression efficiency, allowing for storage space savings and optimizing network bandwidth utilization while transmitting large volumes of data. In the experiment, the BDC method demonstrated an improvement in the compression ratio of up to 247%, with 30% on average, compared with other compression algorithms. In terms of energy consumption, the proposed BDC also improves data transmission using Bluetooth up to 34%, with 18% on average, compared with other compression algorithms. Sensors are used in various fields, such as in autonomous vehicles, wearable devices, smart farms, and smart factories, for collecting sensing data in real time ,2,3,4. TConnecting to the virtual environment will require the use of multiple sensors in the real world, and the amount of data collected by these sensors will cause considerable communication load when transmitting to a data server, such as cloud data centers. According to Intel Corporation, for example, cameras and light detection and ranging (LiDAR) sensors currently installed in autonomous vehicles generate 4 TB of data every 90 min. To transmit and manage the enormous amount of time-series data generated by these sensors, many studies on time-series data compression have recently been conducted ,33,34,35Generally, sensors collect data including various types of noise, which is caused by their inherent inaccuracies or environmental factors. To address this situation, lossy compression techniques are frequently utilized to control noise and maximize the compression ratio within an allowable range of data similarity. In general, lossy compression algorithms have a higher compression ratio than lossless ones. Although lossy compression algorithms also have a significant advantage in data transmission owing to their high compression ratios, they can lead to a loss of important information, such as the subtle differences used to distinguish data classes. To address this issue, several studies on lossless techniques have been conducted ,19,20,22We propose a time-series data compression technique based on bit packing by dynamically determining the size of the bit pack based on the pattern of the bit depth level of the sensor data.Our proposal effectively addresses the spatial inefficiency caused by unpredictable outliers during time-series data compression, and BDC offers high compression efficiency, allowing for storage space savings and optimizing network bandwidth utilization while transmitting large volumes of data.To resolve this problem and increase compression efficiency, this study proposes a bit depth compression (BDC) technique. The BDC algorithm performs bit packing by dynamically determining the size of the bit pack based on the pattern of the bit depth level of the sensor data, thereby reducing the amount of space that may be wasted during its bit packing. Furthermore, the proposed technique is a lossless compression that can be used to compress time-series data that have many outliers or several multidimensional variations. Therefore, the proposed technique can more efficiently perform dynamic bit packing based on the data robustness, resulting in a high compression ratio. Our contributions are summarized as follows:The remainder of this paper is organized as follows: Data compression has two types: lossy compression, which results in information loss during encoding; and lossless compression, which does not result in information loss . Lossy cLossless compression methods are more suitable for applications that require the fine control of sensor data ,20,21,22Recent works have focused on utilizing some models such as AR and recurrent neural network (RNN) to improve the forecasting accuracy of time-series data with forecasting algorithms. These models can help achieve a relatively high compression ratio compared with delta coding schemes due to the high prediction accuracy of time-series data, but they are difficult to utilize for terminal end devices that are sensitive to energy consumption due to their increased computational complexity .Among the lossless compression techniques used for time-series data, the GORILLA algorithm was designed for the time-series database of Facebook . This GOIdrees et al. proposed the lossless electroencephalography (EEG) data compression (LEDaC) technique based on the Internet of medical things (IoMT) for fog computing networks . This teThe Sprintz algorithm was proposed by Davis Blalock et al. as a method for compressing integer time series data . The SprIn this section, we propose a bit depth compression (BDC) algorithm that dynamically performs bit packing for time-series data compression. We first show the structure of the BDC and then explain how the BDC works with example scenarios.The proposed BDC is a bit packing algorithm that dynamically performs compression according to the bit depth of a value extracted from a forecasting algorithm such as delta or RNN. As shown in We explain the procedure and algorithm of BDC with example scenarios. To explain the operations and contributions of the BDC algorithm, we first show the operation of the previous algorithm.n, with fixed k-bit integers, is defined as When we consider Sensor 1 in Equation  is used A is the space benefit obtained when the split position is unchanged, and B is the benefit of space obtained when the split position is changed. Therefore, the BDC changes the split position when B is larger than or equal to A; otherwise, it is not changed. The relationship between A and B can be expressed as Equation , as shown in Case 3 in Equation .(2)if\u00a0An represents the length of the total entry of the S denotes the estimated size of the sampled packs. The BDC calculates S using the simple moving average (SMA) or exponential moving average (EMA), as shown in Equation  Equation .(3)SMAkm is the number of sampled packs at the start point, and k is the number of sampled packs at the end point. Therefore, In Equation , Si is tEquation , EMA conWhen the split position is set, the BDC uses Equation  to checkFinally, In this section, we evaluate the compression efficiency of the proposed BDC method on well-known time-series datasets. We first introduce the datasets used in this study, then show the compression results, and finally discuss the efficiency of our proposals in terms of compression ratio and energy consumption.We used the UCI repository as the main dataset for our performance evaluation. The UCI repository contains various types of data, such as multivariate, univariate, sequential, text, including time-series data, for artificial intelligence and data science. We used the following UCI time-series datasets, and these datasets consist of integers and real numbers. We quantized them to 16-bit integers based on the minimum and maximum values.Appliances energy prediction dataset: This dataset includes data from the Zigbee wireless sensors used to monitor temperature and humidity at home. The stored data are 10 min averages of sensor data collected over a period of 4.5 months .Air quality dataset: This dataset contains air quality data collected on Italian roads from March 2004 to February 2005. The dataset includes CO, non-metallic hydro-carbons, benzene, total nitrogen oxides (NOx), and nitrogen dioxide  and the basic power of 61 \u00b5A shown in , the aveSecond, the energy used for writing to memory is as follows: The C2650 device consisted of 128 KB of flash memory area to store code and data and 4 KB + 2 \u00d7 6 KB of SRAM space. The proposed system used the entire 128 KB flash memory space for data storage. Finally, the energy required for transmission was as follows: The maximum Bluetooth data payload per packet was 251 bytes. According to Equation , the avet (second) and data size d (byte).Based on this analysis, the total energy consumption can be determined using Equation , for opeWith technologies such as smart factories, smart farms, autonomous vehicles, and digital twins becoming increasingly pervasive across various industries, the amount of data generated by sensors has also increased. These data can be transmitted to edge computers and cloud servers for data analysis or model generation in the field of artificial intelligence or data science.In this study, we developed a BDC technique to compress the time-series data generated by sensors. The BDC algorithm performs bit packing by dynamically determining the pack size based on the pattern of the bit depth level of sensor data, thereby maximally reducing the space wastage that may occur during the bit packing process. The BDC technique compresses time-series data transmitted from an end device to an edge device or from an edge device to a cloud data center. Because the BDC is a lossless compression technique, there is no loss of information in the collected sensor data, which is especially useful as training data in the field of artificial intelligence or predictive analysis of data science. The lossless feature of the BDC can more accurately reflect outliers or variations, that is, the data robustness. In the experiment, the BDC demonstrated an improvement in the compression ratio of up to 247% and 30% on average, and a reduction in power consumption of up to 34%, with an average of 18%, compared with the other algorithms. This implies that the proposed BDC has high utility value for compressing sensor data transmitted from a wireless terminal device to an edge computer or a cloud data center.As future research, we plan to study an enhanced forecasting model to further improve the compression ratio of time-series data. In addition, we are planning a study on the reduction in computation overhead in edge nodes for lossless compression."}
+{"text": "Anastrepha ludens (Loew), the combined application of the SIT and ABC was evaluated in mango orchards. The release of parasitoids alone increased parasitism percentages from 0.59 to 19.38%, and the application of the SIT reduced the FTD index (Flies per Trap per Day) by 30%. The concurrent application of both techniques resulted in about 98% suppression in the fly population. These results justify the use of both techniques in fruit fly area-wide pest management programs.The integrated use of the Sterile Insect Technique (SIT) and Augmentative Biological Control (ABC) in the management of fruit fly pest populations has been theoretically proposed to generate a synergistic effect. In a control program against the Mexican fruit fly, Anastrepha ludens (Loew), coupled with Augmentative Biological Control (ABC), by releasing the parasitoid Diachasmimorpha longicaudata (Ashmead), was evaluated in a commercial mango production area for one year. The obtained results were compared with mean fruit fly population values from two previous years without the combined use of both techniques. The treatments were: SIT + ABC, SIT, ABC, and Control, and each treatment was established in blocks of 5000 Ha separated by distances of 5\u201310 km. The evaluations were carried out through fruit sampling to assess percent parasitism and trapping of adult flies to obtain Flies per Trap per Day (FTD) values. The mean percentage of parasitism increased from 0.59% in the control treatment to 19.38% in the block with ABC. The FTD values decreased from ~0.129 and ~0.012 in the control block to 0.0021 in the block with SIT and ABC, representing a 98% suppression. The difference between the two periods in the control block was not significant. We conclude that the integration of both techniques resulted in an additive suppression of the pest population, supporting the use of both control techniques in an area-wide pest management context.The Sterile Insect Technique (SIT), by means of sterile male releases of  Cochliomyia hominivorax (Coquerel)  in North and Central America [The sterile insect technique (SIT) has been used successfully in different pest control programs . The fir America ,2. The S America ,4,5.The use of the SIT for fruit fly suppression, containment, or eradication of populations  has beenThe SIT consists of the massive releases of sterile insects, which, when mating with the wild ones, induce sterility in the wild population, reducing its growth rate. In the ABC, adult parasitoids are massively released to parasitize their hosts. In tephritid fruit flies, the two techniques control two different stages of flies\u2019 populations. Theoretical models have proposed the combined use of both techniques, since it is argued that a synergistic effect may be obtained, achieving thus a greater suppression of the pest population ,17. BecaIn the case of fruit flies, the theoretical models proposed by Barclay  and KnipAnastrepha ludens (Loew), the main pest of mango Ataulfo cultivar [In the coast of the state of Chiapas, located in Mexico Southeast, the local mango producers\u2019 association carries out an area-wide integrated pest management (AW-IPM) program to suppress cultivar . The AW-cultivar ,21,22. Tcultivar .A. ludens sterile flies of a bisexual strain, 50 million of a genetic sexing strain (Tapachula-7) [D. longicaudata parasitoids, per week [A. ludens populations.The mass-rearing facility, Moscafrut (SENASICA-SADER), in Metapa, Chiapas, is located in this region, which implicates an important advantage for the evaluation of sterile flies and parasitoid releases. This facility has the capacity to produce up to 300 million chula-7)  and 50 mper week ,24. In aper week ,26. ThesOur objective here was to compare the effect of ABC plus SIT with the effect of each control method alone upon open field conditions.A. ludens Tapachula-7 (genetic sexing strain) males and D. longicaudata parasitoids, both alone and in combination, by analyzing data on parasitism and adult fly trapping. Furthermore, these data were compared with results obtained in the two previous years from the same areas and with the control without releases.Here, we report the results obtained in the 2014 season releasing sterile Anastrepha fly population and parasitism levels were carried out in 2014 in four different blocks, where a specific treatment was applied during this period. The evaluation was carried out in blocks of approximately 5000 ha separated by distances between 5 and 10 km. The blocks were distributed throughout the mango-growing area of the Soconusco Region, Chiapas, which mainly includes the municipalities of Huehuet\u00e1n, Mazat\u00e1n, Tapachula, and Tuxtla Chico. The working area was basically established in the coastal plain of the Soconusco Region, which has an Am climate type according to K\u00f6pen and Geiger, with a mean temperature of 24.8 \u00b0C and a mean annual rainfall of 3843 mm. Sterile flies and parasitoids have been released weekly in the region since 2013. The evaluations of Anastrepha spp., such as chicozapote, mamey, orange, guava, and creole mango. Control activities are carried out to suppress Anastrepha pest populations in this \u201cmarginal zone\u201d, minimizing thus the invasion of neighboring commercial mango production areas [D. longicaudata parasitoids and sterile A. ludens flies (Tapachula-7) were released weekly (ABC + SIT). The monitoring of adult flies was carried out by the weekly inspection of 16 traps.Area with abundant and diverse secondary vegetation corresponding to high evergreen forest but altered by the presence of different small crops of cocoa, flowers, corn, papaya, and a high diversity of fruit trees that host on areas . During Anastrepha such as creole mango and guava, which are found in lower numbers and at a lower density than in the previous area. Control activities in this area are more regular and are applied for the specific purpose of reducing Anastrepha spp. fly populations. The release of sterile A. ludens (Tapachula-7) males was applied in this area (SIT). Twenty-three traps were placed for the sampling of adult flies.The mango cultivar Ataulfo is dominant in this area, which is surrounded by extensive banana and soybean crop areas. There are also small areas of wild vegetation classified as middle tropical rainforest combined with small crops and the presence of fruits that are alternate hosts of Anastrepha flies. There are also small mango commercial orchards. The work program for the control of fruit flies places great emphasis on using biological control and exclusively applies the release of parasitoids. Therefore, this block was selected for the ABC treatment. In this area, 20 traps were placed to monitor pest fly populations.This block is characterized by the presence of small areas with the production of cocoa, annual crops such as corn, sesame, sorghum, etc., combined with areas of other crops  and fruit trees, some of which are alternate hosts of Anastrepha flies. However, there was no regular control program for fruit fly populations at an area-wide level, and thus control activities were conducted only in specific areas, mainly by applying bait sprays. This area was used as a control without the release of parasitoids or sterile flies, and 22 traps were placed to sample fly populations.In this block, Ataulfo mango orchards are dominant, but there is also a high density of other fruit trees that are hosts of Anastrepha larvae were sampled weekly to determine the parasitism percentage.In the whole region, since 2012 a trapping network was maintained, which included the four described blocks. This allowed us to have a reference of the Flies per Trap per Day (FTD) values as an indicator of fly population levels. Fruit sampling for parasitism evaluation also was constant in this period. However, fruits were randomly collected throughout the entire region; there were no specific data for these four blocks. In the period of 2012\u20132013, the FTD data corresponded to fly populations without the application of any treatment in any of the blocks. The data obtained in 2014 corresponded to the results of the application of the described treatments in each block. The number of traps per block varied (16\u201322 traps) depending on the accessibility or importance of the zone for obtaining the indicators of fly population levels. Fruits presumed infested with Diachasmimorpha longicaudata parasitoids and sterile A. ludens male flies of the genetic sexing strain Tapachula-7 were released into the experimental blocks of the corresponding treatments. The insects were provided by the Moscafrut facility located in Metapa de Dominguez, Chiapas, Mexico. The parasitoids were produced using irradiated (45 Gy) 9-day-old A. ludens larvae to prevent the emergence of non-parasitized hosts. In the case of sterile A. ludens adults, 13-day-old and pupae marked with dye-glo powder were subjected to 80 Gy radiation using a GB-127 gamma radiator  with a Cobalt-60 source [0 source .D. longicaudata were placed in an \u201cArturito\u201d type container  with three circular windows of 30 cm in diameter covered with 1.5 mm mesh [Anastrepha larvae.Ten thousand 14-day-old pupae (one day before emergence) of the parasitoid  mm mesh . About 8A. ludens (Tapachula-7) pupae were placed inside a plastic container (50 cm \u00d7 15 cm \u00d7 5 cm) with longitudinal perforations through which emerged flies were able to exit. The container was placed inside a cage with an aluminum frame measuring 80 cm \u00d7 70 cm \u00d7 10 cm covered with mesh. Each cage is stackable and an accumulation of 16 levels forms a \u201cMexico\u201d Tower. The flies were fed with a mixture of hydrolyzed yeast and sugar (1:24) placed in a tray (60 cm \u00d7 6 cm \u00d7 2.5 cm) and hydrated with a water-saturated sponge covered with a cloth bag [Thirty thousand loth bag ,30. A 11loth bag . Once thAnastrepha spp. host trees with larval infestation. An average of 3.5 million parasitoids were released per week with a density of ~1500 parasitoids per ha. The flies were released at a density of ~850 males/ha [The sterile flies were aerial released to get a homogeneous distribution throughout the 5000 ha of each block. In the case of parasitoids, the ground releases were carried out early in the morning using a pickup and were focused to reservoir zones with high density of males/ha .To measure the effect of parasitoid releases, samples of likely infested fruits were collected, while traps were used to measure the effect of sterile male releases on the adult population. Both activities were carried out preferably in the central part of each block to minimize the border effect.Anastrepha spp. Based on fruit size, samples of 1\u20132 kg were collected for small fruits , of 3\u20134 kg for medium size fruits , and of 5 kg or more for large fruits , as in Montoya et al. [Anastrepha larvae was counted. The larvae were placed in plastic containers (7.5 cm in diameter \u00d7 4.3 cm in height) with vermiculite and kept for 15 days at 26 \u00b0C and 60\u201380% RH until adult emergence. The emerged flies [Fruit sampling included various fruits infested with 2nd and 3rd instar larvae of a et al. . The frued flies  and paraed flies  were ideed flies .\u00ae Better World, Fresno, CA, USA) baited with Biolure\u00ae Suterra LLC, Inc., Bend, OR, USA (a mixture of ammonium acetate and putrescine) and propylene glycol was used to retain the attracted flies. The traps were checked weekly and captured adult A. ludens flies were removed with entomological forceps and identified based on morphological characters using taxonomic keys [A. ludens flies and released (marked) sterile flies were differentiated by the head dye glo marking previously described. Only the number of wild flies was used to calculate the FTD index as follows: FTD = Captured wild flies/(Number of traps) \u00d7 (exposure days).The FTD index was obtained through the trapping net, based on the number of flies captured. Traps were placed in continuous routes in each block. Multilure traps .The mean larvae/fruit values and parasitism percentages obtained from the fruit sampling in each experimental block were analyzed by means of a non-parametric Kruskal\u2013Wallis test. Parasitism means were compared with a paired test using the Wilcoxon method. The FTD data were analyzed using a bifactorial design with period (2012\u201313 vs. 2014) and block as factors. A GLM with a logit link function was used for this analysis, and the mean FTD values of each block were compared between periods with Student\u2019s D. longicaudata in the ABC and ABC + SIT treatments showed notable parasitism levels in the different fruits sampled . Diachasmimorpha longicaudata was present in all experimental blocks and was the dominant parasitoid species. In the case of fruits with higher parasitoid diversity, D. longicaudata shared parasitism (~70%) with other native species, with a mean parasitism percentage of less than 10%. There was no relationship between parasitism level and fruit infestation level (larvae/fruit), which did not decrease in the areas where sterile males were released .The releases of  sampled . In mediA. ludens, the Zapotaceae by A. serpentina (Wiedd.), the Anacardiaceae (mango and hog plum) by A. obliqua, and the Myrtaceae (guava) by A. striata (Loew). The parasitoid D. longicaudata showed higher parasitism percentages in introduced exotic fruits, while parasitism was generally shared with native parasitoids species in native fruits .The fly species that emerged from the infested fruits could be grouped according to the taxonomic family of the fruits: the Rutaceae (citrus) were infested by Anastrepha ludens populations were the second most dominant according to the FTD index derived from the trapping system. More than 90% of the flies trapped corresponded to A. obliqua, a species that rarely infests the mango cultivar Ataulfo  [A. ludens, where the lowest values were observed when sterile flies were released, followed by the block with releases of sterile flies and parasitoids, and the block where only parasitoids were released had higher values. However, the highest values were obtained in the control block, where no releases were made. The analysis of the FTD data showed significant differences between blocks , no significant differences between periods , and no significant interaction between the two factors . et al.) . Figure p = 0.03). In the area where only sterile flies were released, there was a decrease of about 30% (from 0.0033 to 0.0023), although it was not significant . In the block where only parasitoids were released, there was a reduction of 18% (from 0.028 to 0.023) but the difference was not significant .When comparing the years 2011 and 2012 (without releases) with the year 2014 (with insect releases) different results were observed in each block. The mean FTD value decreased in the areas with the release of parasitoids and sterile flies. The FTD index decreased by 82.5% (from 0.012 to 0.0021) in 2014 in the block where both parasitoids and sterile flies were released, where the difference in FTD between the two years without releases and the year with releases was significant , although without statistical differences   . The FTDol block .The data obtained in 2014, when parasitoids and sterile flies were released weekly, showed a stronger suppressive effect when both techniques were concurrently applied, where there was an 82.5% decrease in FTD compared to when the techniques were applied separately. The suppressive effect on the FTD index was higher with the release of sterile flies, while parasitism percentage increased significantly with the exclusive release of parasitoids.A. ludens, there are data that support the effect of sterile fly releases causing a significant reduction in wild populations [Regarding the use of the SIT, different studies have shown results of pest population suppression levels that are considered sufficient to achieve eradication in a region ,21. Althulations , especiaulations ,40,41.D. longicaudata releases, different studies have reported successful fly population suppression [D. longicaudata achieved effective suppression of Anastrepha spp. populations in mango orchards in the coastal zone of Chiapas, Mexico. In addition, Montoya et al. [D. longicaudata increase parasitism levels in \u201cmarginal areas\u201d with high fruit infestation rates by Anastrepha larvae in the same geographical region. The same study also showed that D. longicaudata prefers free hosts, apparently to avoid competition with native parasitoids, which can be explained under the concept of taking advantage of \u201cfree spaces\u201d [Anastrepha larvae with native parasitoid species remained at values that are normally reported independently of the release of D. longicaudata in different regions [Diachasmimorpha longicaudata can thus be considered a species that has a complementary effect on the parasitism of Anastrepha larvae, reinforcing the coexistence with native species of the region.In the case of pression ,42,43,44pression  demonstra et al.  showed t spaces\u201d ,47. In t regions ,48,49. DCeratitis capitata (Wiedemann) that infest coffee plants in Maui, Hawaii were suppressed by releasing sterile flies and the parasitoid Diachasmimorpha tryoni (Cameron). Similar results were reported by Sivinski et al. [C. capitata in Guatemala.Different studies have proposed that ABC and SIT can be complementary and synergistic techniques, which implies that the simultaneous use of both techniques would result in a greater reduction in pest populations ,18,19. Ai et al.  in areasOur results show that releases of parasitoid and sterile fly suppressed the fly population significantly when compared with the application of any of the two techniques separately. This finding supports the assumption that the concurrent use of these techniques has a desirable complementary effect, suggesting that this strategy could be used advantageously in efforts to suppress, contain, or eradicate populations of fruit fly pests. This proposal is supported by data obtained from an experiment in field cage conditions . In addiD. longicaudata has shown a wide adaptation to search for and develop in larvae of different Anastrepha species, mainly those infesting exotic fruits such as mango and citrus. However, the response of this parasitoid has not always been efficient in more specific conditions such as in native fruits of Neotropical origin [C. cainito), which is a native fruit of small size highly infested by A. serpentina, where D. longicaudata has not been reported to reach high parasitism levels [Among the multiple factors that can affect each technique, there are some of higher priority that require greater attention for a better use and management. In the case of parasitism as an indicator of parasitoid effectiveness, it is influenced by the host-fruit larva\u2013parasitoid relationship. As has been mentioned in previous studies, a first challenge is the size or shape of the fruit ,54,55, sl origin . One exam levels ,59.In the case of fly trapping, the FTD index is a more specific and direct measure of pest suppression. Although Multilure traps can catch different species of fruit flies, the obtained values are more direct and influenced by less factors than parasitism indicators. This allows having a more accurate indicator of fly populations. Our results indicate that the decrease in the fly population measured by the FTD index was caused by the application of the SIT but not by ABC, since the suppression by the parasitoids was not significant when applied alone, but it was when combined with the SIT.Open field evaluation of area-wide pest management strategies represents difficulties from perspective of experimental design and the logistic of experimentation. The two main problems in the present work were: (1) the lack of homogeneity in the management of fly populations between the experimental blocks, and (2) the lack of consistency in the ecological conditions of these areas. The main problem associated with these issues in each working area was the specific agricultural production interests related to mango production ,22. Desp"}
+{"text": "We developed an in silico prenatal vaccine testbed by combining a computational model of maternal vaccination with this placental transfer model using the tetanus, diphtheria, and acellular pertussis (Tdap) vaccine as a case study. Model simulations unveiled precision prenatal immunization opportunities that account for a patient\u2019s anticipated gestational length, placental size, and FcR expression by modulating vaccine timing, dosage, and adjuvant. This computational approach provides new perspectives on the dynamics of maternal-fetal antibody transfer in humans and potential avenues to optimize prenatal vaccinations that promote neonatal immunity.Transplacental antibody transfer is crucially important in shaping neonatal immunity. Recently, prenatal maternal immunization has been employed to boost pathogen-specific immunoglobulin G (IgG) transfer to the fetus. Multiple factors have been implicated in antibody transfer, but how these key regulators work together to elicit selective transfer is pertinent to engineering vaccines for mothers to optimally immunize their newborns. Here, we present the first quantitative mechanistic model to uncover the determinants of placental antibody transfer and inform personalized immunization approaches. We identified placental Fc\u03b3RIIb expressed by endothelial cells as a limiting factor in receptor-mediated transfer, which plays a key role in promoting preferential transport of subclasses IgG1, IgG3, and IgG4, but not IgG2. Integrated computational modeling and  in silico immunization optimization experiments, revealing two key insights: (1) second trimester vaccination may be an effective population-level strategy for all neonates and (2) vaccination programs can be optimized in a vaccine- and patient-specific manner to maximize transfer of vaccine-induced antibodies. Ultimately, this model will expedite translation of novel immunization strategies from bench to bedside.Newborns are vulnerable to infections due to their na\u00efve immune system. Maternal antibodies transferred through the placenta protect the newborn while their own immune system acclimates to the environment outside of the womb. As the dampened immune response in early life presents a challenge to newborn vaccination, maternal vaccines are used to boost pathogen-specific antibody transfer. Despite the exciting therapeutic potential of this approach, few maternal vaccines are currently in use and experimental limitations pose a challenge to optimizing maternal vaccine strategies. To uncover mechanistic insights into this process and inform vaccine design, we developed the first computational model of placental antibody transfer. Model simulations revealed antibody abundance and placental Fc receptor expression determine transfer efficiency. We use this computational model to perform  Not only do these maternal antibodies confer neonates with passive early life immunity against infectious diseases, but also they shape the trajectory of neonatal immune development by priming the cellular immune response  + [IgG4apical] > 0.33 mg/ml. In agreement with our computational model prediction, increasing IgG1 caused IgG4 transcytosis to decrease only when the total IgG concentration exceeded the FcRn saturation point  . To recal system . To quanon point . IgG subin silico immunization testbed by layering simulated kinetics of the maternal antibody response post-immunization into the placental antibody transfer model (vax) of 10, 20, and 30 weeks to stimulate antibody secreting cell proliferation and anti-pertussis toxin IgG (\u03b1-PT IgG) secretion and transfer to the fetus  regardless of preterm birth status, which is earlier than the window recommended by the Center for Disease Control and Prevention (CDC) (28\u201334 weeks) and in agreement with studies reporting higher titer of pertussis antibodies in the fetus following maternal vaccination during second trimester as opposed to third trimester  and [C4] are the concentration of bound IgG-FcRn complexes, on is the forward rate of reaction, and koff is the reverse rate of reaction   . To simpormation :C4=FcRet al in the context of malaria  A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Rustom AntiaAcademic EditorPLOS Computational BiologyKiran PatilSection EditorPLOS Computational Biology***********************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1:\u00a0Erdogan and Dolatshahi explored how maternal antibodies are transferred to the fetus in utero using a mechanistic model. Specifically, they constructed a model for FcRn- and FcgRIIb-mediated IgG transport on STBs and ECs and analyzed the sensitivity of each parameter. They also explored the role of FcgRIIb in IgG transfer across fetal ECs as well as evidence of subclass competition. Finally, they applied the model to identify techniques for optimizing vaccination scheduling. Studying placental antibody transfer is highly relevant to maternal health, and this study has the potential to impact vaccine design and timing. However, I have several concerns, about assumptions from the model and questions regarding what kind of actionable insights can be derived from it, that would need to be addressed before publication.Major issues:The authors need to clearly define which observations are insights derived from the present study versus prior literature. For example, the propensity for transfer of each subclass is derived from previous studies, and so steering vaccine subclass production, as discussed at length in the discussion, does not seem like an implication of this work. The dynamical nature of the model does seem like a unique contribution that the authors could emphasize more.The practical implications of this model should be clarified. This work pointed out the factors that are positively or negatively associated with earlier or later optimal vaccination time, but many of them are not actionable. E.g., one can\u2019t change their endosomal volume, FcR expression in specific cells, etc. Similarly, this work suggests that the model can be used for personalized medicine. What measurements would be made to calibrate the model for specific individuals?What is the rationale for only including FcgRIIb on ECs in the model? The authors have pointed out in Fig. 3 that the ECs express a mixture of FcRn and FcgRIIb, and the possible involvement of other FcgR (such as RIIIa). It seems strange that the FcRn/FcgRIIb model was only proposed in Fig. 3 but not the original model. Given these other possibilities are not ruled out as inconsistent with the data, it is not possible to determine whether the resulting model is the only one consistent with the evidence.Observing a distinct optimum in vaccination timing seems very dependent on vaccination leading to a highly transient spike in antibodies which is, in turn, dependent on the proportion of short-lived ASCs. 96% was used in this study, but the cited study observes 68%\u201395%. Given the importance of this parameter, it should be discussed.The authors treat FcgRIIb and FcRn identically aside from their differing affinities at neutral pH. However, FcRn is highly pH-dependent, leading to its unique role in endosomal transport. Is there evidence to justify handling the endosomal trafficking for each of these receptors in the same way?Minor issues:In Fig. 1A, is k_trans the same as k_t in the table? Keep the notation consistent.Whether the model used in Fig. 4 for HUVEC is the same or different from the original one should be clearly stated.In Fig. 5/Table 3, are decay rates d or \u03b4? Keep the notation consistent.In Table 1, K_D were listed as parameters, while the equations used k_on and k_off. How were the latter derived?Fig. 3 caption, line 211, did you mean \u201cStatistical significance in (A-B)\u201d?Fig. S3 is an interesting result. Consider including it in Fig. 3.Fig. 4A, I wouldn\u2019t say the effect is \u201cproportional\u201d in line 221. It is hard to say there is a specific relation like this with just two examples.Is Fig. 4A the same as Fig. S4A except only showing IgG1 and IgG4? What is the composition of subclasses in \u201cCompetition\u201d? Is the competition among two subclasses or four?In Fig. 4D, it\u2019d be helpful to mark where [IgG4_apical] > 0.33 is.Fig. 6C: would it make more sense to draw the thicker line (cyan or blue) on the x-axes?In Fig. 1B, data were overlaid on the simulated levels. Don\u2019t see a description or a citation on the details of the data used.Did Fig. 3a and 3b use the same data? If so, why was \u201c< 16 weeks\u201d not included in Fig. 3a?In Fig. 3b, are \u201c< 12 weeks\u201d samples in line 174 the same as \u201c< 16 weeks\u201d in the figure? Are the \u201c38 weeks\u201d samples in line 176 the same as \u201c> 37 weeks\u201d?In lines 224-226, the rationale for choosing IgG1 and IgG4 should have citations.For HUVEC in the Transwell assays, are the \u201cthree independent replicates\u201d biological or technical?Reviewer #2:\u00a0In this manuscript, the authors have modelled transplacental antibody transfer to optimize immunization of newborns via vaccination of mothers. The authors have identified expression of Fc\u03b3RIIb on the endothelial cells to be a key limiting factor shaping the observed selectivity of different IgG subclasses. Combining this model with a vaccination model, the authors have identified an optimal gestational age range for vaccination of mothers to maximize neonatal immunity. Overall, I found this manuscript very well-written. Below are some minor comments, which should be addressed before publication.Minor comments:How can the values of FcRn and Fc\u03b3RIIb expression be optimized as reported in Table 1, I thought they are variables in the model? According to the complete model equations in the SI, parameters a,b, and c needs to be estimated for the expression of FcRn and Fc\u03b3RIIb.In table 1, for the parameters taken from published research, mainly from references 29 and 31, it will be good to know how these parameter values were calculated. If the values were directly taken from these references, please describe how they calculated the values. I suggest describing this in the Methods section.Please mention how many parameters were estimated and how many parameters were taken from literature in total.In Fig 2, it is not clear how to interpret different points in fig A and C. Please explain briefly how OPLSR works.**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example in PLOS Biology see here: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at  15 Sep 2023Attachmentresponse to reviewers Erdogan Dolatshahi.pdfSubmitted filename: Click here for additional data file. 12 Oct 2023Dear Dr. Dolatshahi,We are pleased to inform you that your manuscript 'Quantitative mechanistic model reveals key determinants of placental IgG transfer and informs prenatal immunization strategies' has been provisionally accepted for publication in PLOS Computational Biology.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Computational Biology.\u00a0Best regards,Rustom AntiaAcademic EditorPLOS Computational BiologyKiran PatilSection EditorPLOS Computational Biology***********************************************************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2:\u00a0All the comments have been addressed properly.**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #2:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  1223-442824 | ploscompbiol.org | @PLOSCompBiolPLOS Computational Biology | Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom"
\ No newline at end of file