diff --git "a/deduped/dedup_0039.jsonl" "b/deduped/dedup_0039.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0039.jsonl"
@@ -0,0 +1,66 @@
+{"text": "Creating a new species is a bit like climbing a greased flagpole\u2014it's hard to get started and even harder to keep going. Random genetic variations may introduce slight differences between two groups but, without some means to keep them apart, sexual interbreeding will quickly remix the genes and obliterate the differences. Accidents of geography\u2014the rising of mountains or a course-changing river, for instance\u2014can provide physical isolation, which then enables genetic divergence through the accumulation of mutations, either through natural selection or genetic drift.In contrast, speciation without geographic separation relies on the direct action of natural selection to complete the speciation process by strengthening behavioral differences, a process called reinforcement. One of the most powerful means of completing speciation is through the evolution of mate discrimination.Drosophila. They identify two loci that influence the likelihood that a female will choose to mate with a conspecific male, rather than one of a closely related species.A study by Daniel Ortiz-Barrientos and colleagues focuses on the genetic underpinnings of mate discrimination in Drosophila pseudoobscura and D. persimilis exist together along the west coast of the United States (sympatry), but separately elsewhere . When together, they hybridize and produce sterile males. While D. pseudoobscura males will court females of both species, females prefer conspecific males. This female preference is stronger in sympatric females, an enhancement that presumably evolved by the direct action of natural selection to prevent females from wasting their reproductive efforts producing sterile sons. This variation allowed the authors to conduct a series of genetic crosses among flies of the same species but from different locations. Because the daughters of discriminating D. pseudoobscura females were just as discriminating as their mothers, Ortiz-Barrientos and colleagues concluded that female mating discrimination was inherited as a dominant trait. Further crosses showed that genes responsible for female preference were on the X and fourth chromosomes, and high-resolution mapping refined their locations sufficiently to allow the identification of likely candidate genes. While more work remains to be done, the most promising genes in both regions appear to be involved with olfaction. The fact that one of them, CG13982, is known to up-regulate the other, bru-3, strengthens the case that these are indeed promising candidates.D. pseudoobscura based on the combined response to auditory and olfactory cues. The first of these two layers, weak, or \u201cbasal\u201d mating discrimination, has previously been associated with a set of traits for acoustic recognition and mapped to chromosomal regions that are inverted between the two species. Such inversions prevent recombination from purging alleles, thereby contributing to hybrid male sterility. As a consequence, when these species interbreed, they inexorably produce sterile males. The second layer, elucidated in the current study, is \u201creinforced\u201d mating discrimination, which appears to be related to olfactory cues. This additional system of discrimination helps the first layer to fully eliminate the inevitable cost of producing sterile males. Once the nascent species have started up that slippery pole, reinforced discrimination could provide the traction needed to reach its top.According to their findings, the authors propose a novel model of mating discrimination in"}
+{"text": "Caenorhabditis briggsae, strain-specific variation in ray pattern has provided an entr\u00e9e into the evolution of ray pattern. Some strains were fixed for a derived pattern. Other strains were more plastic and exhibited derived and ancestral patterns at equal frequencies.How does intraspecific variation relate to macroevolutionary change in morphology? This question can be addressed in species in which derived characters are present but not fixed. In rhabditid nematodes, the arrangement of the nine bilateral pairs of peripheral sense organs (rays) in tails of males is often the most highly divergent character between species. The development of ray pattern involves inputs from hometic gene expression patterns, TGF\u03b2 signalling, Wnt signalling, and other genetic pathways. In C. briggsae AF16 and HK104 strains exhibited a wide range of phenotypes including some that were more extreme than either parental strain. Transgressive segregation was significantly associated with allelic variation in the C. briggsae homolog of abdominal B, Cb-egl-5. At least two genes that affected different elements of ray pattern, ray position and ray fusion, were linked to a second gene, mip-1. Consistent with this, the segregation of ray position and ray fusion phenotypes were only partially correlated in the RILs.Recombinant inbred lines (RILs) constructed from crosses between the variant The evolution of ray pattern has involved allelic variation at multiple loci. Some of these loci impact the specification of ray identities and simultaneously affect multiple ray pattern elements. Others impact individual characters and are not constrained by covariance with other ray pattern elements. Among the genetic pathways that may be involved in ray pattern evolution is specification of anteroposterior positional information by homeotic genes. Caenorhabditis elegans and Oscheius tipulae, cells in the vulval equivalence group that do not participate in vulval development are eliminated through fusion with the multinucleated syncytial epidermis . In C. elegans, unc-22 is located on chromosome IV and is linked to several genes known to regulate homeotic gene expression patterns, e.g. lin-49 which encodes a bromodomain protein thought to be involved in chromatin remodeling . These modeling . mip-1 mC. briggsae strains were constructed in which HK104 DNA, in the region of mip-1, has been introgressed into an otherwise AF16 background. This was accomplished through a series of backcrosses that were initiated by mating HK104 males to mip-1 (AF16) hermaphrodites. For each introgressed strain, F1 through F6 males were crossed to mip-1 (AF16) hermaphrodites. Wild-type F7 hermaphrodites were selected and propagated by self-fertilization. From each F7 hermaphrodite, multiple wild-type F8 hermaphrodites were picked. Homozygous strains were established from F8 hermaphrodites that segregated only wild-type progeny. From each set of backcrosses, a single introgressed strain was retained. These introgressed strains were scored for the position of ray 3 and for ray 3\u20134 fusions . Moreover, evidence for a gene affecting only ray fusion was obtained from comparisons of ray patterns exhibited by the mip-1 introgressed strains. Hence, variation in ray pattern evolution is not wholey constrained by the specification of ray identities and other ray pattern elements, such as neurotransmitter usage, also may vary independently. A similar pattern of partial constraint and flexibility has been observed for variation in eyespots size in the butterfly Bicyclus anynana [Ray pattern in  fusions . Derivedentities ,22-25,30 anynana .C. briggsae have been described [C. briggsae-like ray pattern also has been reported for C. clavopapillata [C. clavopapillata has not been observed since its first description and some authors have considered it and C. briggsae to be synonymous [C. clavopapillata is distinct from C. briggsae, the posterior position of ray 3 and its frequent fusion with ray 4 may be ancestral for these two species. This would make the C. elegans-like ray pattern in haplotype 2 an atavistic character. It should be possible to discriminate between these two models either through the characterization of additional C. briggsae strains or through the redescription and molecular characterization of C. clavopapillata.Two haplotypes of escribed  and variescribed . Strainsapillata , anothernonymous . If C. cC. briggsae. The relatively slight difference between the AF16 and HK104 phenotypes hid a wealth of genetic variation. This was evident in the nearly continuous variation exhibited in RILs for both the position of ray 3 and its fusion with ray 4. This variation included many RILs with phenotypes more extreme than either parental strain. Such transgressive segregation is common in both plants and animals and is thought to arise through fluctuating selection and/or through stabilizing selection at minor QTL when directional selection at major QTL overshoots a phenotypic optimum [C. elegans, ray 3 precursor cells are born at the junction of the mab-5 and egl-5 expression domains [C. elegans ray pattern to phenocopy that of C. briggsae [Cb-egl-5 and variation in ray pattern. As Cb-egl-5 and Cb-mab-5 are closely linked, variation in either or both of these genes may be responsible for the observed association. Alternatively, linkage to Cb-egl-5 may be coincidental, and ray pattern variation in C. briggsae may not result from variation in homeotic gene expression patterns. The best test of these alternative models will be the high resolution mapping of the allelic variants responsible for ray pattern variation.Regardless of their evolutionary history, haplotypes 1 and 2 provided an entr\u00e9e to the genetics of morphological variation of ray pattern in  optimum . The tra domains ,47. Thes domains  and somebriggsae ,26. We hmip-1 marker assisted introgression studies. The C. elegans homolog of mip-1, unc-22, is not linked to the the homeotic gene cluster and linkage of mip-1 to Cb-egl-5 and Cb-mab-5 is unlikely. There appear to be at least two loci that affect ray pattern linked to mip-1. One of these affected both the placement of ray 3 and its fusion with ray 4. The other affected only ray fusion. These associations were not transgressive, i.e. the allelic variants linked to mip-1 antagonized the allelic variants linked to Cb-egl-5. If the transgressive segregation linked to Cb-egl-5 does result from allelic variation in one or more homeotic genes, then the antagonistic variation linked to mip-1 may be in genes that regulate homeotic gene expression patterns. A direct test of this hypothesis is possible. Several genes required for proper regulation of homeotic gene expression patterns have been identified in C. elegans [C. briggsae homologs of these genes could be tested for association with ray pattern variation in the RILs. Ideally, these tests would be integrated into a genome wide screen for variant loci with effects on ray pattern. This will require the enhancement of genetic resources available for C. briggsae.Loci not linked to the homeotic gene cluster also must be involved in ray pattern variation. Direct evidence for this was obtained from the  elegans ,37,38,49Caenorhabditis provides a powerful model for the study of morphological evolution. Macroevolutionary comparisons between species and microevolutionary analyses of variation within species are possible. Augmenting these approaches is a detailed understanding of the genetic and cellular basis of ray pattern development in C. elegans. In C. briggsae, intraspecific variants have been characterized that affect the expression of ancestral and derived ray patterns. These variants have a complex genetic basis involving multiple genes. Some of these genes exhibit transgenic segregation, some affect all of elements of ray pattern, and some that affect only a subset of ray pattern elements. At least one gene that affects ray pattern variation in C. briggsae is linked to the homeotic gene cluster. Thus, ray pattern variation may result from altered expression patterns of homeotic genes. Further characterizations of the genetics of ray pattern variation will test this model and will address interactions between different genes that impact ray pattern in C. briggsae.Ray pattern in C. briggsae strains AF16, and HK104 are available from the Caenorhabditis Genetics Center [E. coli strain OP50. Recombinant inbred lines (RIL) were constructed starting with HK104 males mated to sperm-depleted AF16 hermaphrodites [s Center . These shrodites . Each RIRay pattern phenotypes were scored using differential interference contrast optics at a magnification of 400\u00d7 . Right aCb-egl-5, CAGGGAGCGGACAACTTCAAAGG and GGACACAGCCCAGGATTAGCGAC, respectively, were designed based on genome sequence data from C. briggsae strain AF16 [Forward and reverse primers for PCR amplifications ain AF16 . AmplifiCb-egl-5 allelic variation with ray pattern variation were determined online at [mip-1 introgressed strains were compared using reciprocal chi-squared tests using Excel v10.1.0 .Pearson's product moment correlation cofficients between ray pattern elements in RILs and Wilcoxon nonparametric tests of the association between nline at . Frequennline at . Ray patdll = distalless; en = engrailed; sal = spaltRIL = recombinant inbred line; QTL = quantitative trait loci; SEB: Planned and supervised all research activities. Participated in construction and genotyping of RILs. Reviewed all statistical analyses. Wrote manuscript.CRD: Constructed, genotyped, and characterized ray pattern phenotypes of RILs. Statistical analyses of the segregation of ray pattern phenotypes and association of Cb-egl-5 variation with ray pattern variation. Reviewed manuscript.JCB: Constructed and characterized phenotypes of mip-1-assisted introgressed lines. Statistical analyses of ray pattern phenotypes of mip-1 introgressed lines. Reviewed manuscript.Cb-egl-5 genotypes and ray pattern phenotypes of RIL derived from AF16 \u00d7 HK104.AF16 \u00d7 HK104 RIL ray pattern data. Click here for file"}
+{"text": "Drosophila, the endemic Hawaiian species offer some of the most dramatic examples of morphological and behavioral evolution. The advent of the Drosophila grimshawi genome sequence permits genes of interest to be readily cloned from any of the hundreds of species of Hawaiian Drosophila, offering a powerful comparative approach to defining molecular mechanisms of species evolution. A key step in this process is to survey the Hawaiian flies for characters whose variation can be associated with specific candidate genes. The wings provide an attractive target for such studies: Wings are essentially two dimensional, and genes controlling wing shape, vein specification, pigment production, and pigment pattern evolution have all been identified in Drosophila.Within genus Drosophila. The image collection, available at FlyBase.org, includes 53 of the 112 known species of \u201cpicture wing\u201d Drosophila, and several species from each of the other major Hawaiian groups, including the modified mouthparts, modified tarsus, antopocerus, and haleakalae (fungus feeder) groups. Direct image comparisons show that major wing shape changes can occur even between closely related species, and that pigment pattern elements can vary independently of each other. Among the 30 species closest to grimshawi, diverse visual effects are achieved by altering a basic pattern of seven wing spots. Finally, we document major pattern variations within species, which appear to result from reduced diffusion of pigment precursors through the wing blade.We present a photographic database of over 180 mounted, adult wings from 73 species of Hawaiian Drosophila, despite their generally low levels of DNA sequence divergence. In several independent lineages, highly complex patterns are derived from simple ones. These lineages offer a promising model system to study the evolution of complexity.The database highlights the striking variation in size, shape, venation, and pigmentation in Hawaiian  Drosophila are endemic to Hawaii, yet current evidence suggests they arose from a single introduction to the Hawaiian Island chain roughly 26 million years ago Drosophila an important model system for analysis of evolutionary processes at the species level.Nearly 1000 species of Drosophila grimshawi genome has been sequenced grimshawi sequence should permit the amplification of nearly any gene of interest from a range Hawaiian species. Identified sequence differences can then be correlated with phenotypic variations among the species, providing insights into molecular mechanisms of evolution. To make the most of this opportunity, it is important for researchers to have access to uniformly collected phenotypic data from numerous species. The data can be used to identify characters that show interesting patterns of variation, and for which candidate genes can be hypothesized. The Drosophila wing is an attractive target for such candidate-based studies, since wing development has been analyzed in great detail in D. melanogasterThe grimshawi, the prepattern is faintly visible upon eclosion, marked by an arrangement of dark versus light wing hairs. In the first day or two after eclosion, pigment precursors travel through the wing veins and diffuse into the intervein regions, allowing further darkening of the cuticle into clearly visible spots. In this model, the spots must contain localized enzymes that are waiting to convert the precursors to melanins. This enzyme prepattern is most likely formed by localized expression of pigmentation genes in response to the wing's basic patterning machinery. Wing spot evolution would then involve changes in either the upstream patterning genes, or the downstream pigmentation genes. Changes in patterning genes would tend to be pleiotropic, altering other features of the wing, so this explanation is unlikely when only pigment changes are observed. Thus, the favored explanation is that mutations occur in the cis-regulatory regions of the pigmentation genes, bringing them under control of existing, region-specific activators or repressors Wing pigment spots occur in highly reproducible, species-specific, two-dimensional patterns, and their genetics and development are beginning to be understood. True et al. yellow locus have provided multiple examples of regulatory mutations controlling the evolution of wing spots. The Yellow protein is required to pigment the cuticle, and ectopic Yellow causes dark pigmentation in a wild type background. This Yellow-dependent pigmentation is strongly enhanced by removal of Ebony protein  yellow and ebony genes have been co-opted during evolution to produce wing spots: a male-specific wing spot in D. biarmipes is presaged by increased Yellow and decreased Ebony protein levels, and the extent of the spot is controlled in part by engrailed regulation of yellow via a novel cis-regulatory element Drosophila, and yellow has at least two distinct regulatory elements that can be co-opted to produce spots Studies of the Drosophila. Unfortunately, these pigment patterns have not been photographically documented in the literature, apart from a few sporadic examples .These studies provide the framework required to understand the evolution of complex pigment patterns in the Hawaiian Drosophila species. Mounted wings were digitally photographed under uniform conditions to allow for comparisons between specimens, and the photos have been made available for download at FlyBase grimshawi genome to gain further molecular insights into morphological evolution.Here we present a photo database documenting the wings of 73 Hawaiian Drosophila arose from an introduction of a continental species to an island (now subsided) that predates Kauai, the oldest of the current high islands The endemic Hawaiian Drosophila. The original photographs and the montages are available in the Hawaiian Drosophila Wing Database at FlyBase adiastola subgroup of picture wing species . Each box represents a unique inversion genotype or karyotype present in the designated species (abbreviated to 3 letters). Circles represent inversion genotypes that do not match any species in the database; these are only included when they constitute nodes in the tree. The actual inversion names have been omitted for simplicity; see Carson grimshawi subgroup lacks these inversions (since D. grimshawi is the standard); the glabriapex subgroup has 4b, the planitibia subgroup has Xik and 4b, and the adiastola and primaeva subgroups have Xo 2c, Xik, and 4b. Relationships among the four subgroups can be obtained by connecting the trees at these points, as summarized in primaeva based on DNA and biogeographic evidence The picture wing group is divided into four major subgroups named for representative species: diastola , planitianitibia , glabriaabriapex  and grimrimshawi . A nearlrimshawi \u20135. D. adiastola subgroup. These species are particularly notable for the intricate and subtly graded pigment patterns of the wings. In addition, much of this group shows pronounced sexual dimorphism, and so clavisetae , likely as an adaptation that provides mechanical support for larger wings. This adaptation arose independently in the planitibia subgroup (below)spectabilis, the pigment spots are expanded and fused, giving the appearance of a black wing with light spots. The most extreme wing shape change in this collection (and perhaps in the genus) is seen in truncipenna, in which the male wings are blunted at the tips giving a nearly rectangular appearance. The female wing is slightly blunted as well, but the selection pressure on this phenotype appears to be focused on the males. The hamifera wing is perhaps the most divergent overall, with an exceptional combination of large size, distorted shape, and complex, dimorphic pigmentation. The males and females share a dark spot over the proximal part of longitudinal veins L2\u20134, but the rest of their patterns appear to be almost completely unrelated.primaeva/attigua specimen; these two species are considered to form their own subgroup at the base of the picture wing clade . The wings may be dimorphic in shape (longiseta) and pigmentation (stigma). The stigma wing pattern closely matches those of the Asian species D. biarmipes and elegans, which have been recently analyzed by Gompel et al. The  species  are sexuhaleakalae group  can \u201cslide\u201d to different positions along the proximodistal axis, generating a rainbow-like pattern in the overlay; the other spots remain largely fixed. The proximal and distal borders of this spot can vary independently, as shown by the aligned close-ups of L2 . The overlay shows that the posterior compartment also differs, with L4 and L5 diverging strongly in tanythrix.Species within one group can vary substantially in shape, as noted above for cilifera wings shows that sexual dimorphism is achieved by varying only a subset of pattern elements . The wing pattern in hamifera can become altered in an even more complex manner. Compared to the typical pattern . Thus, comparisons among these species could provide insights into the evolution of complexity.We show several examples in which, along a known lineage, species exhibit increasing pigment pattern complexity or gain/loss of discrete pattern elements. It will be extremely informative to sequence candidate loci such as is group . The commplexity . These tadiastola subgroup. Evidence suggests the basal primaeva wing gave rise to the simple, wave-like pattern of ornata, and the more derived species have extensively modified this pattern along different branches of the adiastola subgroup  availability of genomic DNA for comparative sequence analysis; (2) ability to grow larvae for studies of gene expression and developmental biology; (3) ability to make transgenic flies; (4) ease of performing transmission and quantitative genetics D. melanogaster. DNA is available from most of the species pictured here, and cloning genes of interest will be greatly facilitated by the high sequence identity levels among the Hawaiian species. Carson's chromosome phylogeny was derived by analysis of larval chromosomes, indicating that larvae can be cultured from nearly every picture wing species D. melanogaster proteins (not shown). Transgenic Hawaiian Drosophila have been produced by injecting P element DNA into D. hawaiiensis embryos mimica) and ornate  wing patterns, although grimshawi lay eggs at a greater rate than mimica. For optimal egg collection, specialized substrates are required  Stocks of mimica, grimshawi, and several other endemic Hawaiian species are available at the Tucson Drosophila Species Stock Center. Genetic markers are not currently available, although we have demonstrated that visible mutations can be isolated and maintained in grimshawisilvestris vs. heteroneura coloration and head shape D. grimshawi, for example, can hybridize with balioptera, bostrycha, crucigera, disjuncta, pilimana, and others Each of these milestones has been reached in the picture wing flies, albeit with more effort than required for Flies were collected from banana or mushroom baits, or by netting, at previously described locations on Kauai, Oahu, Molokai, Maui, and Hawaii (Big Island) disjuncta, grimshawi, hemipeza, heteroneura, planitibia, and silvestris, specimens were taken from laboratory stocks maintained at the Univ. of Hawaii at Manoa instead of from the field. Picture wing stocks are cultured at 18\u00b0C. Oviposition occurs in vials of Wheeler-Clayton medium Clermontia . Once larval activity is observed, cornmeal-molasses-agar medium is added to the vials. Vials with third instar larvae are placed in a gallon jar half filled with damp, coarse sand. Larvae tunnel into the sand to pupate, and adults crawl back out upon eclosion. Newly eclosed adults require 2\u20133 weeks to reach sexual maturity; females especially require 3\u20134 weeks before mating and egg laying begins. Temperature and humidity regulation, culture media specific to larval and adult nutritional requirements, sterile sand as the pupation medium, etc., make laboratory husbandry of the Hawaiian Drosophila species significantly more complex than D. melanogaster. However, a number of laboratories in the U.S. as well as internationally have been successful in maintaining laboratory stocks of Hawaiian Drosophila and have been able to conduct genetic and behavioral studies on these species.For algaia, cyrtoloma, clydonia, differens, diminuens, hamifera female, hirtipalpus, truncipenna, and virgulata, the flies were recently dead when the wings were removed. Older, pinned specimens were found to be rather unsuitable for the project since their pigmentation had faded. The wings were permanently mounted in Euparal  between a slide and coverslip, taking care to avoid damage and folding. Slides were incubated overnight at 37\u00b0C to allow bubbles to dissipate, and stored in the dark. The wings were all photographed in one session under uniform conditions, using a digital camera mounted on a dissecting scope and illuminated with an overhead ring light. Raw images were adjusted in Photoshop using the \u201cWarming Filter 81\u201d command to neutralize the background toward gray, and contrast was restored using \u201cCurves\u201d. All adjustments were performed to make the backgrounds uniform across images, so that the wings are as directly comparable as possible. In Drosophila system is used here for simplicity and longitudinal veins L1\u20135 are defined in In most cases wings were removed from live flies; for"}
+{"text": "Study of Darwin's unpublished works, freely available on-line through the American Natural History Museum, reveals the origins of his thoughts on evolution. Journal of Researches [The Voyage of the Beagle was his most famous\u2014until Darwin, pressured by the arrival in 1858 of A. R. Wallace's manuscript on evolution through natural selection, stopped working on his \u201cBig Species Book,\u201d [On the Origin of Species by Means of Natural Selection. Or the Preservation of Favoured Races in the Struggle for Life [Origin of Species that changed the world, establishing Darwin as one of the great thinkers in Western cultural history.Depending on how you count them up, Charles Darwin published just over twenty books in his lifetime. His first\u2014the searches , also kns Book,\u201d  and wrotfor Life . In betwOrigin of Species. All have been subsequently published, and are now freely available online, constituting the initial components of the Darwin manuscript project page of the American Museum of Natural History Digital Library of Evolution. The Darwin manuscript project complements the museum's exhibition, Darwin, opening 19 November 2005; further analysis of these works can be found in my companion volume to the exhibition [So much is well-known. Far less appreciated is the fact that Darwin wrote several other books, all on evolution, none of which were published in his lifetime. Together, they form a series that preserves the \u201cevolutionary\u201d history of Darwin's ideas from their very inception to their most mature form\u2014while also revealing the more prosaic development of Darwin's written rhetoric of the hibition .Origin of Species are found in the pages of these notebooks\u2014maddeningly interspersed in near-chaotic fashion with all manner of geological and biological observations and notations gleaned from the literature, and Darwin's already burgeoning correspondence and conversations. Indeed, only the \u201cprinciple of divergence\u201d came along later to add to Darwin's themes and arguments.The first of these books is actually a series of notebooks. I include them because they are the foundational writings for all Darwin's later, more discursive, discussions of evolution. Many of the themes\u2014and, indeed, some of the original language\u2014of the familiar passages of the Beagle in 1836\u2014recording various latitude, longitude, and depth soundings\u2014the last third of the notebook seems to have been filled out after Darwin returned to England in late 1836, early 1837. Historians still disagree whether or not\u2014or the degree to which\u2014Darwin had tumbled to the idea of evolution while still on the Beagle. I fully agree with Kohn et al. [Ornithological Notes, discussing the differentiation of \u201cvarieties\u201d of mockingbirds and tortoises on various islands in the Galapagos and concluding that \u201cif there is the slightest foundation for these remarks to zoology of Archipelagoes\u2014will be well worth examining; for such facts would undermine the stability of Species\u201d [Beagle arrived home. But nothing else unambiguously written while still aboard ship has as yet turned up to support this view.The \u201cRed Notebook\u201d  is the fOrigin of Species, Darwin had been greatly struck by \u201ccertain facts of the distribution of the inhabitants of South America\u201d that \u201cthrow some light on the origin of species.\u201d [Darwin was a fully committed evolutionist by the time the evolutionary passages of the \u201cRed Notebook\u201d were written. As he would subsequently write in the topic sentence of the pecies.\u201d . ElsewheOrigin of Species, is unexpectedly a saltationist in the \u201cRed Notebook.\u201d He thinks, given the lack of intergradations between fossil forms, or his rheas, that new species must arise suddenly from ancestral species. He maintains this view to some degree in Notebook B, first of the four famous \u201cTransmutation Notebooks\u201d [Darwin, famous for his views of gradual evolution through natural selection in the tebooks\u201d , begun iThere is grandeur in this view of life.Systema Naturae [2, he writes  \u201cI think,\u201d [First of these new expected patterns is the nested set of taxa already recognized and embodied in Linnaeus's  Naturae . We now  think,\u201d  and sketOrigin of Species), he formulated \u201cnatural selection.\u201d As David Kohn [But Darwin wanted more: he was constantly searching for a mechanism. Finally, in Notebook D, after having read Thomas Malthus and learned for the first time that more organisms are born to each species each generation than can possibly survive and reproduce . Darwin had been using the expression \u201cmy theory\u201d to mean \u201cevolution.\u201d But now, the expression \u201cmy theory\u201d more specifically means \u201cevolution by natural selection.\u201d It is in 1839, toward the end of the series of \u201cTransmutation Notebooks,\u201d that Darwin takes his next logical, if not fateful, step: in page 118 of Notebook E, he exhorts himself to rederive his original patterns in terms of his ideas on how natural selection works to produce evolutionary change. He is by now far beyond his initial attraction to saltational evolution: rather natural selection must produce finely gradational change. This puts him at odds with his very first evolutionary pattern, as Darwin is aware that paleontologists see little evidence of such change in their collections of fossilized plants and animals. He writes : \u201cMy very theory requires each form to have lasted for its time: but we ought in same bed if very thick to find some change in upper & lower layers.\u2014good objection to Origin of Species.After discovering natural selection in Notebooks D and E, Darwin turns renewed attention to both variation and the process of artificial selection in embryonic form\u2014 the analogy to what he would soon call \u201cnatural selection\u201d by this time clear. The theme that varieties are incipient species\u2014perhaps the most pervasive of Darwinian argumentative themes\u2014is found in these notebooks , as are Particularly striking is Darwin's invocation of the travails of astronomers who labored so hard  to establish the laws of gravitation governing the behavior of celestial bodies. Darwin was not only fearful of attack on religious grounds, he also knew all too well that the only competing theory to explain the origin and diversity of life was in fact Judeo\u2013Christian creationism. In Notebook B (page 101) , Darwin Origin of Species some 21 years later. Here we have not only the analogy with scientific law replacing creationist belief in astronomy, but also the origin of the famous phrase \u201cthere is grandeur in this view of life\u201d [This passage is \u201cancestral\u201d to Darwin's most famous passage\u2014concluding the of life\u201d ,11,12. WFoundations of the Origin of Species [In 1909, Francis Darwin (Charles and Emma's seventh child), on the 100th anniversary of his father's birth, published  Species . The boo Species  and the  Species .The \u201cSketch\u201d is Darwin's earliest known  attempt to write out his evolutionary theory in essay form. The fact that it was never intended for publication, but rather served as a first-shot \u201cdry-run\u201d in setting out his views, is amply demonstrated by the sometimes elliptical, almost notebook-like passages with incomplete sentences and occasional reminders to himself on how to develop his arguments further. .The 1842 \u201cSketch\u201d is an exciting read. Darwin is effectively organizing his thoughts and putting them in more coherent form for the first time. He adopts a two-part structure  a succinct statement of his theory of the mechanisms of evolution, and a longer part 2 (seven chapters) the application of his ideas of evolution through natural selection to the, by now, familiar patterns of the biological world \u2014and the persistent problems with the fossil record).It is in the second chapter of part 1 that we see the fateful two words \u201cnatural selection\u201d as a subhead of a section that lays out by far his most coherent description of the process to date: \u201cDeCandolle's war of nature\u2014seeing contented face of nature\u2014may be well at first doubted; we see it on borders of perpetual cold. But considering the enormous geometrical increase in every organism and as every country, in ordinary cases, must be stocked to full extent, reflection will show that this is the case. Malthus on man\u2014in animals no moral restraint\u2014they breed in time of year when provision most abundant, or season most favourable\u2026.The unavoidable effect of this is that many of every species are destroyed either in egg or young or mature\u2026.In the course of a thousand generations infinitesimally small differences must inevitably tell\u2026.Nature's variation far less, but such selection far more rigid and scrutinizing\u201d .The bulk of Darwin's 1842 text integrates all he has read in books, monographs, and correspondence about variation, artificial selection, patterns of geographic distribution of animals and plants, and gradation between varieties and distinct species\u2014the main topics of his notebooks. He continues the hypothetico-deductive theme begun in Notebook B\u2014showing that such patterns should be expected as the natural outcome of the evolutionary process.Origin of Species itself: \u201cThere is a simple grandeur in the view of life with its powers of growth, assimilation, and reproduction, being originally breathed into matter under one or a few forms, and that whilst this our planet has gone circling on according to fixed laws, and land and water, in a cycle of change, have gone on replacing each other, that from so simple an origin, through the process of gradual selection of infinitesimal changes, endless forms most beautiful and most wonderful have been evolved\u201d [His \u201cRecapitulation and Conclusion\u201d in the 1842 \u201cSketch\u201d is a brilliant, impassioned summary of his ideas. It ends with the passage, already adumbrated in Notebook D, that remains virtually identical, not only in 1844 but in the evolved\u201d .For the most part, Darwin's fervent intellectual search is over with the conclusion of the 1842 \u201cSketch.\u201d The 1844 \u201cEssay,\u201d at 198 pages, is a much longer manuscript; with exactly the same structure and sequence of topics, it is essentially a smoothed out version of its predecessor\u2014written completely in essay form now, all sentences complete, with no personal notes and queries to interrupt the flow of ideas. The bulk of it, for the most part, consists of vastly more examples bolstering Darwin's points throughout.That said, the 1844 version of his ideas is far less exciting to read than the 1842 manuscript. It is very much as if the excitement is muted by the sheer bulk of the material reviewed\u2014and probably as much by the fact that the ideas are no longer so novel to Darwin himself. Freshness is lost to familiarity and the sheer weightiness of his verbiage.The Origin of Species. This, his most famous book, was fresh and new to its readers in 1859, so successful had Darwin been in keeping his views private. But to anyone who has had the privilege of reading the 1830s notebooks, and the early manuscripts , the Origin of Species reads like a mature work in both the best and worst sense of the term. He has honed his arguments beautifully, but the ideas, no longer fresh in his own mind, are just not as enthrallingly expressed as when he was younger and much closer to their inception.Much the same can be said of Darwin's so-called abstract of his views\u2014Natural Selection [Origin of Species, it is true that, at least as far as the discussion of the Principle of Divergence is concerned, the discussion in this last of Darwin's unpublished-in-his-lifetime books is more cogent and complete than the Origin of Species itself. The Origin of Species, one is tempted to conclude, written as it was in such haste, relied heavily on the earlier manuscripts.  In many ways, the unpublished versions hold more rewards than what the Origin of Species\u2014the book that shook the world\u2014offers the modern reader.Darwin's Principle of Divergence\u2014poorly understood by modern scholars\u2014melds nascent ecological theory with various models of the origination of new species. Darwin was developing those ideas around the time he started writing his \u201cBig Species Book,\u201d eventually published (second part only) as election . And thoother books to pick themes and trace their development over time. Seldom has the history of ideas, so important as Darwin's evolution by natural selection, been so faithfully preserved as it has in this virtual \u201cfossil record\u201d preserved in this magnificent series of Darwin's other books.There is much more that can be said. Darwin's thoughts about the relative importance of isolation, for example, changed over the years. It is possible with this treasure trove of Darwin's Natural Selection (1856-1858) are freely available online at http://darwinlibrary.amnh.orgThe \"Red\" and \"Transmutation\" notebooks (1836-1839), the \"Sketch\" (1842), the \"Essay\" (1844), and"}
+{"text": "Butterfly and moth eyespots can share a similar appearance, involving multiple concentric rings of colored scales, but usually occuring in non-homologous positions on the wing. Within the butterflies, on the other hand, spots that share the same homologous position may not share the concentric ring structure; and, in butterfly species that have eyespots with concentric rings, ectopic eyespots with a similar ring structure can be induced by means of a simple epidermal wound. The extent to which all these eyespots, natural or induced, share similar genes and developmental mechanisms is investigated here by means of protein in-situ localizations in selected butterfly and moth species. In addition to looking at some of the transcription factors previously identified as being involved in eyespot formation, we also tested the involvement of candidate genes from the Wingless and TGF-\u03b2 signaling pathways as putative morphogens for eyespot development.Distal-less, engrailed and spalt in subsets of cells around the wounding site, mimicking concentric eyespot development.Saturniid moth and nymphalid butterfly eyespots with concentric rings of color express at least two transcription factors, Distal-less and Engrailed, in the center of the future pattern. Nymphalid eyespots centers also express the ligand Wingless and an activated signal transducer, a phosphorylated Smad protein, but neither these proteins nor the previous two proteins are found in pierid spot centers, which consist of a single patch of color. Both butterfly wing patterns, however, express a third transcription factor, Spalt, a portion of whose expression domain maps to the black scales on the adult wing. Wounding a nymphalid wing, on the other hand, leads to upregulation of Wingless and TGF-\u03b2 ligands are both candidate morphogens involved in nymphalid butterfly eyespot formation. These eyespots, as well as saturniid moth eyespots with concentric circles, share two genes that are associated with the differentiation of the signaling cells in nymphalid eyespots. This commonality suggests that they may be produced via the same developmental mechanism despite their non-homologous location. By contrast, pierid butterfly spots of a single color share some of the same genes but appear to be produced by a different mechanism. Eyespots with concentric rings may have co-opted a wound healing genetic network during their evolution. The wings of butterflies and moths display a wealth of color patterns that provide excellent material for investigating the evolution of pattern formation in a simple, two-dimensional system. Pattern elements consisting of one or more concentric rings of colored scales, the eyespots, can occur at different positions in the wing in different lineages and also display different morphologies and, thus, make intriguing subjects for investigating questions of homology . When eyIdeally, tests of homology should include not only comparisons at the level of the phenotype but also of the genes and developmental processes underlying that phenotype ,5. This Research on eyespot developmental mechanisms has mostly focused on the border eyespots of nymphalid butterflies. Two and a half decades ago, Nijhout proposed that a group of signaling cells, the focus, organizes the differentiation of butterfly eyespot patterns by producing a long range diffusible morphogen that is interpreted in a threshold-like fashion by the surrounding epidermal cells . When thBicyclus anynana , ectopic eyespots consisting of a ring of gold scales, sometimes containing a black central disc, appear on the adult wing following pupal wing wounding [The sink model, in particular, is derived from the observation that eyespot mimics, containing rings of differently colored scales but no central white pupil, can differentiate on the wing following pupal epidermal wounding -9. The wwounding . The genDistal-less (Dll), Notch (N), engrailed (en), hedgehog (hh), cubitus interruptus (ci), patched (patch), spalt   appear to be involved in the differentiation of the central signaling cells [A series of genes have been associated with nymphalid eyespot development. In the larval stage, ng cells -19. Lateng cells ,21. The B. anynana. We also follow the expression of these proteins around wound sites in the pupal wing to determine the extent to which ectopic eyespots share developmental pathways with normal eyespots. Finally, we compare gene expression patterns in the discal-cell eyespots of the moth species Antheraea polyphemus and Saturnia pavonia  and in the uniformly-colored, non-pupilated, spots of the cabbage white butterfly Pieris rapae, from a more basal butterfly family , to determine to what extent they are sharing similar developmental pathways.Here we investigate whether the Wingless (Wg) and Transforming Growth Factor-beta (TGF-\u03b2) signaling pathways are involved in differentiating the border eyespots, as the ligands in these pathways are known morphogens in other systems (reviewed in ). Using en-expressing scale-building cells is visible around the eyespot focus  and present until 16 h after pupation , whereas Dll was expressed in the intervenous stripes  after wounding . Also, wg and decapentaplegic (dpp), a ligand from the TGF-\u03b2 family, in the nymphalid butterfly Precis coenia using in situ hybridizations [B. anynana eyespot centers from the early pupa until around 16\u201322 h after pupation, a critical developmental period when pupil transplants and ablation experiments were originally shown to affect the eyespot phenotype [Until functional data is collected for Wg and TGF-\u03b2 family members, these ligands remain excellent candidates for association with focal signaling and eyespot differentiation due to their temporal and spatial localization. The presence of Wg and pSmad along the wing margin and their absence from the eyespot foci during the larval stage is in agreement with previous reports for the expression of izations . Both Wghenotype . The genDll, en, and sal was only observed in scale-building cells around the wound site from 12 h onwards after the wounding operation. These patterns of gene expression mimic the temporal and spatial patterns of genes expressed around the natural eyespot centers where Dll, En and Sal only appear in scale-building cells at least 12 h after pupation  in the larval wing stage, and they do not have pSmad or wg expression at their centers during the early pupal stage. These spots, however, share the expression of the transcription factor, Sal, which is associated in both B. anynana and P. rapae with the area of black scales in the adult wing. In addition, in the late larval wings of both species, pSmad is first visible along the wing margin  may be simultaneously needed to activate one or more sal cis-regulatory modules along a continuous stripe on the wing.The restriction of Sal in the he veins ,34 may bhe veins . These gsal, and perhaps two of the same pre-existing and thus, homologous, gene circuits, e.g. pSmad being upstream of sal activation, and sal being upstream of black scale differentiation. These two circuits may also be ancestral to the butterfly-moth lineage split but our current lack of data for the expression of these genes in the saturniids does not allow us to examine this proposition. In any event, because the mechanism of how sal is eventually activated in the pupal stage in Pieris and Bicyclus scale-building cells is proposed to be different for each system , that could lead to a similar focus signaling mechanism, but whether the systems have independently evolved in their non-homologous positions by the co-option of an ancestral focus gene circuit into a novel position , display these discal-cell eyespots, making their appearance at the base of the tree more parsimonious. Second, it was previously shown that Dll is also expressed at a discal-cell location in a nymphalid butterfly [Our mapping of the co-option of a ree Fig. , rather utterfly . Denser Dll, en and sal) may, at least in part, have been co-opted from the wound repair genetic circuitry, as the two developmental processes share many temporal and genetic similarities. Future work on wound healing across a broader range of species should help verify this hypothesis.The genetic circuitry involved in nymphalid eyespot production, with its putative signaling ligands (Wg and TGF-\u03b2s) and several response genes . Pupation times for P. rapae and B. anynana were scored by means of time-lapse photography with a Kodak 290 digital camera, inside the 27\u00b0C and 80% humidity environmental chamber. The time-lapse was set to take pictures every 30 minutes with a time stamp on each photo. We dissected roughly 200 pairs of pupal wings and 100 larval wings from B. anynana, 60 pairs of pupal forewings and 50 larval forewings from Pieris, 12 larval wings from S. pavonia and 80 larval wings from A. polyphemus. Larval and pupal wings were fixed and stained following the protocol in reference [Drosophila., thus serving as an indicator of TGF-\u03b2 activity on the butterfly wing. The Wg polyclonal antibody was developed against a conserved epitope in the region between amino acids 25\u201375 of the Human Wnt-1 protein . The epitope is proprietary and therefore only a range of amino acids was provided for where the epitope is located. In this 50 a.a. region there is 35.3% identity among amino acids when compared to Bombyx mori, the closest species with a fully sequenced wg gene. Within the same region there is a smaller group of 12 amino acids (#64\u201375) that have 75% identity with the Bombyx sequence. We used Alexa Fluor 488 anti-mouse with either Alexa Fluor 594 anti-goat or Texas-Red anti-rabbit secondary antibodies . Wings were mounted on glass slides in Slow Fade medium , covered with a glass coverslip, sealed with clear nail polish, and stored at -20\u00b0C until observation under FITC and Texas Red filters on a Leica DMIRE II microscope at 50X, 100X and 200X magnifications.eference . We usedeference ) for alleference ), rabbiteference ) named heference ) and goaIn order to induce a wound and healing response we pierced individual pupal wings at one or two of three different sites with a fine tungsten needle . Operations were performed between 5 h and 20 h after pupation (AP), covering the time period where most ectopic eyespots are produced, between 12 h and 18 h AP . Pupae wPieris and Bicyclus using combinations of secondary antibodies only. These stainings, apart from the ones mentioned explicitly in the text in the context of the wound healing experiments, yielded very dark preparations with no particular patterns of fluorescence.Images shown represent the best specimens for each treatment but similar patterns were observed in at least 3 other specimens of each species, and often many more. Control stainings were also performed for all the developmental stages of P. rapae and the wounding experiments, and drafted the final manuscript. GG collected the Wingless data, part of the pSmad data for B. anynana and P. rapae, and put together the first draft of the manuscript. SS collected part of the data for pSmad in B. anynana and, together with NG, collected part of the data for the wound healing experiments. DR helped draft the manuscript. All authors read and approved the final manuscript.AM conceived the study, collected the data for the moths, part of the data for"}
+{"text": "Sphenodon), archaic reptiles of enormous zoological significance as the sole representatives of a once widespread reptilian order.The sex of many reptiles is determined by the temperature an embryo experiences during its development. Three patterns of temperature-dependent sex determination (TSD) have been defined, but one pattern where only males are produced above an upper temperature threshold (Type IB) is controversial. Here we report new data on the relationship between constant temperature incubation and sexual phenotype in two species of tuatara , males were produced above a pivotal temperature of 22.0\u00b0C. The pivotal temperatures and scaling parameters differed between species (p < 0.001). The thermosensitive period (TSP), where temperature influences gonad morphogenesis, occurs between 0.25 and 0.55 of embryonic development. While it is possible that the more common female\u2192male\u2192female (FMF or Type II) pattern exists, with a second pivotal temperature above 23\u201324\u00b0C, we review several lines of evidence to the contrary. Most notably, we show that in S. punctatus, the warmest natural nests during the TSP produce predominantly males.In both species, the pattern observed with constant incubation temperatures from 18 to 23\u00b0C (or 24\u00b0C) supported a female\u2192male (FM or Type IB) pattern of TSD: in S. guntheri because current patterns of global warming could exacerbate the male bias already present in the relic population.An FM pattern of TSD could be currently adaptive in promoting sexual size dimorphism in tuatara. However, an FM pattern has particularly serious consequences for  The re1 - l))] The authors declare that they have no competing interests.S. guntheri and drafted the manuscript; NJN conducted the laparoscopies, and helped to draft the manuscript. AC conducted experiments on S. punctatus that provided additional support for the FM TSD pattern. SP performed the statistical analysis, SNK coordinated fieldwork and assisted with husbandry of juvenile tuatara, and CHD conceived the study at Victoria University of Wellington. All authors read, commented on, and approved the final manuscript.NJM carried out the work on"}
+{"text": "While studying the local flora and fauna of the Amazon jungle in the 1860s, Henry Walter Bates made a striking discovery. Butterflies inhabiting a particular geographic region sported the same wing patterns\u2014even though they were unrelated species. Bates proposed that nonpoisonous species had mimicked the patterns of noxious species that predators avoided, thus gaining a selective advantage. Today, scientists can use the tools of genomics and genetics to investigate the mechanism of convergent evolution\u2014the emergence of similar physical traits (or phenotypes) in unrelated species. Such empirical studies have provided insight into a longstanding controversy spawned by evolutionary theorists over the origin of mimicry: does it arise gradually through the accumulation of random mutations by selection or in \u201cphenotypic leaps\u201d through the constraining influence of shared developmental pathways with a bias toward a particular phenotype?Heliconius butterflies allowed the researchers to test the possibility that mimetic convergence results from constraints in the regulation of butterfly color patterns.Recent molecular studies found evidence that regulation or recruitment of the same genes or gene variants may explain convergent evolution. In a new study, Mathieu Joron, Chris Jiggins, and colleagues took a different approach by investigating the molecular basis of both convergent and divergent phenotypes. The involvement of the same genomic loci in convergent phenotypes suggests that developmental constraints give rise to these shared phenotypes. The presence of a multitude of convergent and divergent phenotypes in the wing patterns of Heliconius butterflies, including M\u00fcllerian mimics . Two species, H. melpomene and H. erato, are distantly related yet have identical wing patterns. Both species radiated into over 30 races (or subspecies) in parallel, with the two species (\u201cco-mimics) displaying a single pattern locally. The third species, H. numata, is closely related to H. melpomene but has radically different wing patterns, with up to seven different variations in a single region. Each of these variations mimics a different species of another butterfly genus, Melinaea.The researchers worked with three species of H. melpomene, variation in white and yellow patterns is controlled by at least three genomic loci\u2014N, Yb, and Sb\u2014that are tightly linked, or inherited together. Red pattern elements are controlled by another linked loci pair\u2014B and D. In H. erato, the Cr locus produces patterning effects similar to the interaction of N, Yb, and Sb in H. melpomene, while an unlinked locus, D, appears to control red pattern variation much like the B\u2013D pair does in H. melpomene. In polymorphic H. numata, all the mimicked color patterns derive from a single locus, P, thought to be a \u201csupergene\u201d .In H. melpomene from different regions in Ecuador were crossed with an H. melpomene subspecies stock from French Guiana to produce second-generation offspring. Offspring were then genotyped to identify genes responsible for the resulting color patterns and to map the relevant major color-patterning loci\u2014N, Yb, and Sb loci for H. melpomene crosses, Cr for H. erato, and P for H. numata\u2014in individual offspring.The researchers crossed different races of each of the three species to explore the genetic basis of the variations. For example, two different subspecies of H. melpomene  and H. erato(Cr) are tightly linked to genetic markers that occupy the same position in both species. Similarly, the locus P, which controls whole-wing variation in H. numata, is also linked to the same series of markers.Using molecular markers developed in the region of the pattern genes, they found that the three loci controlling color pattern variation for each species inhabit the same genomic location. Indeed, the elements controlling white and yellow pattern variation in Heliconius butterflies. Rather than a constraining role, this locus provides what the researchers call a \u201cjack-of-all-trades flexibility.\u201d It presumably functions as a \u201cdevelopmental switching mechanism\u201d for natural selection, they explain, by responding to a wide range of mimetic pressures to produce radically divergent, locally adapted wing patterns. Now researchers can begin to identify and determine the modus operandi of the genes at the center of what has been called a \u201cdevelopmental hotspot\u201d to better understand how they drive the adaptive evolution of mimetic color pattern shifts. For more on the evolution of mimicry in butterflies, see the Primer .These results, Joron et al. conclude, suggest that a single conserved locus is responsible for producing wing pattern diversity in"}
+{"text": "Axel Meyer discusses how evolution frequently converges on similar mimetic patterns in different species. Fascination with flora and fauna usually starts early in life as an all-encompassing childhood pastime. Growing up in Germany in the 1960s and 1970s, I developed an affinity for natural history as a child, inspired by famous television naturalists, such as Jacques Cousteau and Bernhard Grzimek, as well as by role models closer to home. As a child, it seemed quite natural to observe, experiment with, and collect all kinds of animals, dead or alive, and their parts  for my private \u201cWunderkammer,\u201d or cabinet of curiosities.Lolita, was also a distinguished lepidopterist who specialized in the systematics of the butterfly family Lycaenidae. Nabokov's obsession with butterflies also started early in life and arguably influenced his thinking and writing for the rest of it. He published numerous scholarly papers in recognized entomology journals, mostly on species from Europe and North America, and he was inordinately proud that a species of butterfly (Cyllopsis pyracmon nabokovi) was named after him. Nabokov was particularly fascinated by the mapping of spots on butterfly wings.Literature Nobel laureate Vladimir Nabokov, probably most famous for his notorious novel The diversity of life, both within and between species, often lights the fire of childhood fascination, fostering a na\u00efve juvenile obsession and the desire to collect. But as one becomes more familiar with the natural world, one also notices curious similarities between organisms. This similarity might simply, and rather uninterestingly, be a reflection of close evolutionary relationships. But more intriguing evolutionary questions and lessons emerge when the similarity exists between distantly related species. Convergence, the term used to describe this type of similarity, is arguably more interesting than plain diversity. The paleontologist Simon Conway Morris  has madeConvergence teaches us that the seemingly unbounded creativity of evolution through natural selection and the diversity it produces are not without limits but sometimes seem to follow predictable patterns verging on rules. This is also evident in one of the prime examples of diversity in vertebrates, the species flocks of cichlid fishes of Eastern Africa. Although each of the three large East African Lakes contains hundreds of endemic species of cichlids ,3, the oRedundancy in the outcome of natural selection is most evident in the beautiful examples of mimicry in butterflies . MimicryDrosophila developmental genetics\u2014paved the way and has led to a deeper understanding of both the genetic underpinnings and the evolutionary implications of butterfly color evolution. The Bicyclus system from Africa analyzed by Paul Brakefield from Leiden University  and Sean Carroll from the University of Wisconsin Madison  [Papilio mimicry system investigated by Frederik Nijhout from Duke University [Evolution clearly repeats itself in mimicry. The \u201cwhy\u201d and \u201chow\u201d is at the center of a field of research that combines comparative genomics and evolutionary developmental approaches. Through a variety of technical approaches in comparative developmental genetics and the construction of genetic linkage maps that can identify chromosome regions and sometimes even specific genes that control phenotypic traits, it has now become possible to bridge the wide gap between natural history and developmental biology. During the past decade, the development and evolution of color patterns in butterfly wings has become one of the best-studied examples in which knowledge from molecular developmental biology\u2014with lessons and tools from  States) , and theiversity   yielded very interesting new results. The crosses, genomic analyses of bacterial artificial chromosome clones, and genetic maps demonstrate that color pattern divergence has a relatively simple genetic basis\u2014few regions of the genome control most of the dramatic color-pattern differences between races. That the same genetic region is used across species boundaries to create similar (mimetic) colors in some and divergent patterns in other species demonstrates that phenotypic similarity (and divergence) can be potentially controlled by the same set of genes.Two species of butterflies, n et al.  in this Heliconius butterflies that show that a locus, Yb, controls the presence of a yellow wing band in H. melpomene. Interestingly, the Yb locus maps to the same genomic location as the Cr locus in its congener and co-mimic H. erato, which also sports a yellow band on its wings. Evolution appears to have recruited the same gene region repeatedly and in parallel, resulting in the similar phenotypes of these M\u00fcllerian mimics. Natural selection apparently pushed for similar phenotypes, yet the conservative nature of the underlying developmental genetic mechanisms constrained (in the sense that the same genes and pathways are used) the outcome of selection as well.Joron et al.  present H. numata\u2014in which some morphs can look quite different from both H. melpomene and H. erato\u2014the same genetic locus appears to be involved in bringing about a phenotype that mimics that of the distantly related butterflies of the genus Melinaea. So, although this gene locus is involved in similar wing color patterns in H. melpomene and its co-mimic H. erato, it acts as a \u201csupergene\u201d in conjunction with other unlinked color-pattern loci to control the development of quite different wing color patterns in different populations of H. numata. It is remarkable and warrants further investigation that the same genomic region is controlling not only convergent wing color patterns in H. erato and H. melpomene, but also divergent patterns in H. numata. So, genomic conservatism at an upstream supergene and seemingly unconstrained downstream genes combined to simultaneously produce mimetic similarity and novel color patterns across species of butterflies.What makes this study  even morHeliconius species, could be used to identify the expected downstream target genes of this supergene. These approaches might reveal how the genetic architecture of downstream genetic pathways, which are involved in the expression of similar or divergent color patterns during wing development, might have diverged and whether some of their components show signatures of Darwinian selection. As Joron and co-workers' investigation [Future comparative genomic work, for example on expressed sequence tags and DNA microarrays of the developing wings of different tigation  beautifu"}
+{"text": "Heliconius is gaining the attention of an ever-widening audience  has long been the subject of genetic analysis audience .Heliconius erato and Heliconius melpomene groupings and noted repeated mimetic convergence between them. However, within those groupings, he failed to distinguish species, races, and hybrids. In the mid 1950s, William Beebe and associates initiated studies of life history, behavior, systematics, and genetics of Heliconius at Simla in Trinidad. There, Michael Emsley elucidated biogeographic details of the system erato and melpomene each generate similar arrays of hybrid phenotypes, many of which would be sufficiently distinct to warrant separate species status when viewed out of context.Early in the 20th century, Oxford's pre-eminent evolutionist and student of insect color patterns, Edward B. Poulton, urged Harry Eltringham to study taxonomic relationships of a spectacularly colorful, mimetic, and diverse set of specimens pouring into European museums from field collectors across the Neotropics. Eltringham H. erato and H. melpomene at Simla established the framework of classification of pattern loci in general use today erato and melpomene. Thus, if viewed only through the lens of structural genes not manifest in the visible phenotype, few of the many races described for these species would be delimited. Later research in Peru on selection and gene flow in parallel interracial hybrid zones by James Mallet In the 1960s, genetic studies of B/D locus, which controls the presence/absence of red patterns, and the Yb/Cr locus, which controls the presence/absence of a yellow bar, respectively map to homologous linkage groups between the co-mimics H. melpomene and H. erato, although co-mimetic phenotypes evolved independently. In other words, convergent evolution in wing patterning between species involved the same genetic intervals, and, since synteny between distantly related Lepidoptera is conserved cis-regulatory or trans-regulatory changes responsible for these polymorphisms Several teams have been busy in recent years trying to relate underlying allelic variation in color pattern observed in laboratory crosses and in natural hybrid zones to changes occurring in the genome. Classic genetic mapping previously showed that these adaptive polymorphisms in four different radiations were linked to homologous intervals Heliconius system forms a unique replicated natural experiment to study the genetics of adaptive traits: allowing comparison between parapatric races of different phenotypes, between geographically distant races of similar phenotypes, and finally, between different species (co-mimics) across parallel inter-racial hybrid zones. The papers in this issue exploit this system by seeking signatures of selection across previously identified genetic intervals B/D and Yb/Cr in hybrid zones where populations of different phenotypes are admixed. Indeed, in these species mimicry ring structure on both sides of a hybrid zone imposes a strong positive frequent-dependent selection favoring common wing patterns H. melpomene and H. erato wing pattern loci, whereas unlinked regions of the genome showed no deviation from neutrality. Also, both studies form a consistent set of observations at a finer genomic scale by looking for haplotypes statistically associated with a certain phenotype. They found a rapid decay in linkage disequilibrium in these species, yet they did not identify completely fixed differences that would pinpoint wing pattern genes with confidence. However, both studies implicated a kinesin-motor gene (kinesin) as a B/D candidate gene, since it was close to a hotspot of genotype-by-phenotype association and also showed a higher expression level correlating with red pattern phenotypes. Similarly, both studies identified a \u201cparallel\u201d peak of genotype-to-phenotype association between polymorphism in a Leucine-Rich Repeat gene (LRR) and the Yb/Cr phenotypes. Finally, although the two studies are somewhat complementary in their design, they do not always converge in their results. For instance, while Baxter et al. sampled three geographically distant pairs of admixing populations, Counterman et al. focused their geographical sampling on a narrow area with a sharp transition in wing phenotypes where numerous generations of recombination have had the opportunity to break down variation around causative switch genes. In this latter study , several hotspots of pattern association were observed in addition to kinesin and LRR. This raises the possibility that loci involved in pattern variation in each zone of a wing consist of several functional sites, whether they are coding or regulatory changes. While puzzling at first sight, this observation is consistent with the notion that these loci are supergenes with multiple wing patterning effects Drosophila that tightly linked mutations of small effect participate in shaping an allele of major effect Heliconius wing patches and bands The Heliconius butterflies are clearly emerging as a premier model system for such integrative research (e.g., Heliconius wing patterns still seem like a rainforest under a shroud of fog. Only a few canopy trees are visible as we fly over. It should be exciting when the clouds lift.Understanding the evolution of diversity will surely involve better integration of ecology, behavior, population genetics, and developmental biology, leading to new models of species diversification that incorporate well-characterized selective environments, adaptive peaks, and how networks of genes determine important phenotypes. ch e.g., . The stu"}
+{"text": "Heliconius butterflies is a longstanding example of both M\u00fcllerian mimicry and phenotypic radiation under strong natural selection. The loci controlling such patterns are \u201chotspots\u201d for adaptive evolution with great allelic diversity across different species in the genus. We characterise nucleotide variation, genotype-by-phenotype associations, linkage disequilibrium, and candidate gene expression at two loci and across multiple hybrid zones in Heliconius melpomene and relatives. Alleles at HmB control the presence or absence of the red forewing band, while alleles at HmYb control the yellow hindwing bar. Across HmYb two regions, separated by \u223c100 kb, show significant genotype-by-phenotype associations that are replicated across independent hybrid zones. In contrast, at HmB a single peak of association indicates the likely position of functional sites at three genes, encoding a kinesin, a G-protein coupled receptor, and an mRNA splicing factor. At both HmYb and HmB there is evidence for enhanced linkage disequilibrium (LD) between associated sites separated by up to 14 kb, suggesting that multiple sites are under selection. However, there was no evidence for reduced variation or deviations from neutrality that might indicate a recent selective sweep, consistent with these alleles being relatively old. Of the three genes showing an association with the HmB locus, the kinesin shows differences in wing disc expression between races that are replicated in the co-mimic, Heliconius erato, providing striking evidence for parallel changes in gene expression between M\u00fcllerian co-mimics. Wing patterning loci in Heliconius melpomene therefore show a haplotype structure maintained by selection, but no evidence for a recent selective sweep. The complex genetic pattern contrasts with the simple genetic basis of many adaptive traits studied previously, but may provide a better model for most adaptation in natural populations that has arisen over millions rather than tens of years.Wing patterning in  Heliconius butterflies is a longstanding example of both M\u00fcllerian mimicry and adaptive radiation. The genetic regions controlling such patterns are \u201chotspots\u201d for adaptive evolution, with small regions of the genome controlling major changes in wing pattern. Across multiple hybrid zones in Heliconius melpomene and related species, we no find no strong population signal of recent selection. Nonetheless, we find significant associations between genetic variation and wing pattern at multiple sites. This suggests patterning alleles are relatively old, and might be a better model for most natural adaptation, in contrast to the simple genetic basis of recent human-induced selection such as pesticide resistance. Strikingly, across the region controlling the red forewing band, a very strong association with phenotype implicates three genes as potentially being involved in control of wing pattern. One of these, a kinesin gene, shows parallel differences in expression levels between divergent forms in the two mimetic species, making it a strong candidate for control of wing pattern. These results show that mimicry involves parallel changes in gene expression and strongly suggest a role for this gene in control of wing pattern.The diversity of wing patterns in  One of the central outstanding questions in evolutionary biology concerns the predictability of evolution. Specifically, can we predict the number and effect size of genes involved in evolution, and the types of genetic changes that underlie particular kinds of evolution? Striking empirical examples of repeated use of the same genes in similar evolutionary changes suggest that common patterns may emerge even across distantly related taxa Heliconius butterflies offer an excellent model system in which to address these questions as their wing patterns are under simple Mendelian genetic control and subject to strong natural selection Heliconius melpomene and between closely related species H. melpomene and Heliconius erato, and a third species, Heliconius numata, with entirely different wing patterns Heliconius butterflies. However, the specific genetic changes underlying phenotypic diversity in Heliconius remain unknown.Heliconius mimicry as a system to study the population genetic patterns around loci involved in parallel phenotypic changes. Patterns of genetic variation in natural populations are commonly used to identify genes under selection, either through association studies that correlate genetic and phenotypic variation Here and in a companion paper Heliconius, however, we can take advantage of natural hybrid zones, where admixture occurs between divergent geographic races, to carry out analysis of genotype-by-phenotype association. In particular, studies of a parallel hybrid zone in Peru between races of the co-mimics H. erato and H. melpomene have estimated that selection is extremely strong, on the order of a 20\u201350% reduced survival of foreign colour pattern morphs Heliconius races typically differ at just two or three loci with major phenotypic effect on wing pattern Heliconius offers an unusual opportunity to study populations that are strongly morphologically differentiated but nonetheless free to exchange genes across most of the genome. Previous demographic studies of Heliconius have demonstrated genetic differentiation on a regional scale, for example between the Guiana Shield, Amazon basin and Pacific slopes, but extensive gene flow between local populations , protein binding , splicing (slu7), protein-protein interactions (leucine rich repeats or LRR), transport , basic cell function  and a transcription factor (six/sine) , and a similar pattern is seen at HmYb where sequence is available for H. erato.We characterised the ix/sine) . In addi20 genes . Overallelpomene . A direcHmYb markers for three pairwise population comparisons, two involving races of H. melpomene (amaryllis vs aglaope and melpomene vs rosina) and one pair of hybridizing species (H. pachinus vs. H. cydno) . Such a pattern was not seen at any of 16 unlinked loci studied previously for this species pair We estimated population structure at . cydno) . In all ed genes . In tota10 genes . Second,24 genes . This waH. melpomene, that differ in presence of the HmB red forewing band, were also studied for HmB linked markers H. melpomene amaryllis has a red forewing band, controlled by the dominant HmB allele, which is absent in H. melpomene aglaope  in H. m. aglaope. The lack of completely fixed differences between any of the comparisons suggests that we have not yet sampled causative sites, or that there is epistasis between the variable sites with phenotype determined by allelic combinations.The two races of  aglaope . H. m. a 5391 bp . Again, ed genes . In totaed genes . The peaCR genes . SeveralH. m. aglaope population that showed a significantly negative Tajima's D . When LD was plotted against genetic distance, there was strong LD (0.5>r2>0.9) between sites separated by a distance of up to 14 kb , or as being a nearby candidate locus for pattern specification (Mad). The same populations studied above were not available as live material, so we instead used two forms available from commercial suppliers, H. melpomene malleti and H. melpomene cythera, which have yellow and red forewing bands respectively, providing a similar comparison as that between H. m. aglaope and H. m. amaryllis. First, forewings were removed from three pupal developmental stages of H. melpomene cythera, and dissected into three wing segments, to examine spatial gene expression between proximal, medial (HmB) and distal regions . Second, whole forewings and hindwings were separately dissected from 5th instar larvae and early pupae of H. melpomene malleti and H. melpomene cythera for expression analysis \u2018between races\u2019.For the kinesin gene, with H. m. malleti having an overall higher expression than H. m. cythera  stage but no differences between different segments of the wing, consequently developmental stage made a strong contribution to gene expression prediction (Pr(\u03b2\u22600)\u200a=\u200a89.6; The most striking result was a strong contribution to the prediction of gene expression by race at the  cythera . AnalysiSlu 7 showed higher expression in later developmental stages (highest in the ommochrome only stage [OO]), but no differences between segments of the wing \u200a=\u200a100). Race made a contribution to the prediction of gene expression in the \u2018between races\u2019 experiment (Pr(\u03b2\u22600)\u200a=\u200a86.5), with H. m. cythera having a 1.52-fold overall higher expression than H. m. malleti \u200a=\u200a94), but no differences between races or wing segments  shows a very marked peak in both the H. pachinus vs. H. cydno and the H. m. amaryllis vs H. m. aglaope hybrid zones, and is also highlighted in H. eratoHmYb. In addition however, another peak around HM00008 and HM00010 is shared between the two H. melpomene inter-racial comparisons, but not with H. erato. The repeatability of these patterns across independent hybrid zones suggests that multiple associations are not merely the stochastic results of selection at a single causative site, but rather imply a role for multiple functional sites underlying wing pattern differences. This is supported by the observation of increased linkage disequilibrium between associated sites at the HmYb locus as compared to background levels, suggesting that selection is maintaining particular allelic combinations across this region , where regions of differentiation are limited to a few hundred base pairs Heliconius.Overall, the stronger signal of both haplotype structure and genotype-by-phenotype association in hedgehog and wingless signalling pathways are involved in wing eyespot formation Drosophila wing pigmentation have implicated cis-regulatory regions of shared pigment biosynthesis genes in regulating inter-specific differences HmB region, similar to the pattern already found in HmYba priori assumptions regarding the identity of the wing patterning genes. Instead we have cloned the genetic region controlling natural variation in a striking phenotype, and in doing so ruled out a role for any of the wing pattern \u2018toolkit\u2019 genes described previously. Of course, these two approaches may be complementary, and the locus that is controlling the wing phenotype may be an upstream regulator of classic \u2018toolkit\u2019 genes. Indeed, the intriguing observation that the \u2018Bigeye\u2019 pattern mutant of Bicyclus anynana maps to the homologous chromosome of HmYb might indicate that the gene networks uncovered in Heliconius may have a general role in butterfly wing patterning The development of scale-covered wings, pigmentation and an elaborate patterning system are evolutionary innovations of the Lepidoptera and have been cited as an example of the redeployment of conserved gene networks HmYb locus, two regions are implicated, first around the genes HM00007, HM00008 and HM00010. These genes have putative orthologues in Drosophila  about which little is known, except that HM00010 contains WD40 repeats that are likely to be involved in protein-protein interaction. More striking is the association found around HM00024 (LRR-3), which was replicated in two of the comparisons studied here and in H. erato. This gene shows similarity to Sur-8 in Drosophila, consistent with a possible role in signal transduction, and is also adjacent to HM00023, a probable non-coding transcript with complex patterns of alternative splicing that may have a regulatory function HmYb suggested by sequence similarity was the transcription factor Unkempt which, unlike in H. erato, showed no significant association with wing pattern in H. melpomene.At the HmB gene. In both H. melpomene and H. erato when yellow and red forewing band forms are compared, the former showed much higher expression levels of the putative kinesin, HM01018, in late larval and early pupal stages, suggesting a role for this locus in wing pattern specification. Members of the kinesin superfamily play diverse roles in cellular organization, using a catalytic motor to move along microtubules and transport organelles and molecules H. melpomene kinesin contains an N-terminal motor domain, yet has no sequence similarity to other eukaryotes in the C-terminal cargo domain, making it difficult to speculate regarding the function of this gene. In Drosophila, kinesin proteins can function to determine cell polarity and RNA localisation during embryogenesis, and are therefore known to play a role in pattern specification at a cellular level kinesin expression across the whole wing regulate either scale cell fate or pigment localization, and thus ultimately specify pattern formation.Against a background of multiple associated sites, and extensive LD across three genes, there is one strong candidate for the Heliconius are clustered in the genome across multiple independent hybrid zones. This adds to what is already known from crossing experiments, showing that two patterning loci, HmB and HmD, controlling the red forewing band and orange hindwing rays respectively, are tightly linked, as are HmYb and HmSb that similarly control the yellow hindwing bar and white margin Heliconius genome that play a disproportionately large role in pattern specification and indeed, in speciation. The population data described here offer novel insights into the genetic architecture of these regions. First, there is significant association of both genetic variation and long distance haplotype structure with wing pattern at both loci, indicating the influence of strong mimicry selection on the genome. Nonetheless, consistent with previous estimates of the age of H. melpomene  with the ReRep pipeline BAC clones in the H. cydno galanthus (n\u200a=\u200a33) and H. pachinus (n\u200a=\u200a22) were collected from Costa Rica; H. melpoomene melpomene (n\u200a=\u200a16) and H. melpomene rosina (n\u200a=\u200a19) were collected from Panama and Venezuela; H. melpomene aglaope (n\u200a=\u200a30) and H. melpomene amaryllis (n\u200a=\u200a30) were collected from Peru . rom Peru . Two admllis see . The Per2, 0.1 mM dNTP, 50 pmol of each primer, 0.25 units of Taq polymerase (Bio-Line). Thermal cycling conditions were 94\u00b0C 1 min, 35 cycles of 94\u00b0C 15 sec, annealing 30 sec, 72\u00b0C 60 sec, and a final extension of 72\u00b0C. Prior to sequencing, products were incubated with 2 units of Exonuclease 1 (NEB) and 1 unit of Shrimp Alkaline Phosphatase (Fermentas) for 40 minutes at 37\u00b0C then 80\u00b0C for 20 minutes. Sequencing was performed in 10 \u00b5l reactions using 1\u20133 \u00b5l of template, 1\u00d7 reaction buffer, 1\u00b5l BigDye terminator v3.1 (Applied Biosystems) and 0.32 pmol primer and run in a thermal cycler for 25 cycles of 95\u00b0C 30 seconds, 50\u00b0C 20 seconds, 60\u00b0C 4 minutes. Products were then sequenced using an ABI3730 capillary sequencer, analyzed using CodonCode Aligner software and single nucleotide polymorphisms identified manually. Genes contained insertion/deletion (IN/DEL) variation were trimmed to exclude such regions from analysis, or cloned using Promega pGEM-T Easy kit before sequencing , were sequenced, along with three control genes unlinked to wing colour patterning loci  and unlinked markers were carried out for each pair of populations using a Mann-Whitney U test implemented in Minitab v15.1 (Minitab Inc.). For the H. cydno/H. pachinus comparison background levels of differentiation were obtained from 16 previously published genes Haplotypes were inferred using Phase/Unphase implemented in DnaSP HmYb in H. melpomene, 127 in H. cydno/pachinus, 40 variable sites for HmB between H. m. aglaope and H. m. amaryllis and 20 sites at unlinked loci. Colour pattern genotypes at the HmYb and HmB loci were scored as 0.0 or 1.0 representing alternative homozygotes, and 0.5 for heterozygotes. Although HmB is dominant, two hybrid individuals with the dominant red forewing HmB allele and orange rayed HmD alleles were scored as heterozygotes, as recombinants between HmB and HmD are rare. A stringent significance cut-off was calculated using a Bonferroni correction applied to all 866 sites tested (\u2212Log10(0.05/866)\u200a=\u200a4.24).We determined if any SNPs were associated with a colour pattern phenotype using a chi-squared linear trend test HmYb and HmB was calculated for all population samples with a sample size \u226520. This restricted the analysis to the H. m. aglaope and H. m. amaryllis populations, and gave a total of 40 sites for HmB, 24 for HmYb and 20 for unlinked loci with a rare allele frequency greater than 0.05 that were considered informative for LD analysis. Multi-allelic sites that had a minor allele with a frequency less than 0.05 were condensed to bi-allelic SNPs by merging the minor allele genotypes. LD was estimated using the commonly used composite estimate of LD method described by Weir H. m. aglaope and H. m. amaryllis populations.Linkage disequilibrium across Mad, slu7, kinesin and GPCR. RNA was extracted from forewings of H. m. cythera pupae at three developmental stages; EP , PO (Pre-Ommochrome \u2013 well developed wings with veins but no pigmentation) and OO (Only-Ommochrome \u2013 red band visible but no melanin present) HmB band and D\u200a=\u200adistal) totalling 27 samples .Quantitative real time PCR (qPCR) was used to determine the relative transcript levels of H. m. cythera and H. m. malleti individuals. The former has a red forewing band, which is absent in the latter. RNA was collected from whole forewings and hindwings of three individuals from two developmental stages (late 5th instar larvae and EP), totalling 24 samples .To compare pattern races we used SensiMix, Quantace). The reactions were subjected to 40 cycles of amplification in an Opticon 2 DNA engine (MJ Research) under the following conditions: 95\u00b0C for 15 min and then 40 cycles of 94\u00b0C for 15 sec, 55.4\u00b0\u201360\u00b0C for 30 sec, 72\u00b0C for 30 sec followed by a final incubation at 72\u00b0C for 10 min. Melting curves were generated between 55\u00b0 and 90\u00b0 with readings taken every 0.2\u00b0 for each of the products to check that only a single product was generated. We sequenced at least one product from each set of primers to confirm identity and size. For most loci, the amplified fragments spanned at least one intron, ensuring that genomic DNA contamination could be identified. We used two housekeeping control genes for normalization in the \u2018between wing segments\u2019 experiment; EF1-\u03b1 and RpS3A. However, as results of these two genes were consistent, only EF1-\u03b1 was used in the \u2018between race\u2019 experiment. qPCRs on target and control loci were always assayed using product from the same cDNA synthesis reaction. Furthermore all samples were assayed 3 times but, because differences in gene expression between replicates were always <0.05\u00d7 (see below), we report only the average value for each sample. Statistical methods for qPCR experiments are given in Total RNA (500 ng) was reverse transcribed with random hexamers and 1 \u00b5l of the resulting cDNA template (25ng) was combined with 200 nM of each primer in 25 \u00b5l of total reaction volume containing 1\u00d7 SYBR Green master mix  was used to compare three sequences; Bombyx mori nscaf3026 1161033.1269872 (http://silkworm.genomics.org.cn), H. melpomene BAC clone 28L23 (CU467808) and H. erato BAC clone 31N19 (accession). Comparisons were performed using tBLASTx, limited to 200 HSPs and an expect value 1.0e-10. B. mori genes displayed are BGIBMGA011292-TA (bves), BGIBMGA011315-TA , BGIBMGA011316-TA (Slu7), BGIBMGA011317-TA (Sorting Nexin), BGIBMGA011291-TA (phosphodiesterase 10A), BGIBMGA011289-TA and BGIBMGA011290-TA (predicted Kinesin), BGIBMGA011318-TA (GPCR), BGIBMGA011288-TA , BGIBMGA011287-TA (Epoxide Hydrolase).Alignment of (0.15 MB PDF)Click here for additional data file.Figure S2HmB (red circles) and HmYb (green triangles) for combined H. m. amaryllis and H. m. aglaope populations, both for all sites (A) and with sites showing a significant association with phenotype removed (B). The only remaining comparisons showing long-range LD after removal of associated sites are also between the Slu7 and GPCR genes, in the region associated with the HmB phenotye.Decay of linkage disequilibrium with distance across the two regions. Data are shown for (0.54 MB PDF)Click here for additional data file.Figure S3H. m. amaryllis and H. m. aglaope populations, both for coding and non-coding markers in regions linked and unlinked to colour pattern.Decay of linkage disequilibrium with distance within gene markers. Data are shown for combined (0.22 MB PDF)Click here for additional data file.Figure S4H. m. amaryllis, but with expression of the dominant HmD allele from the Amazonian race controlling the red hindwing rays and basal red patch on the forewing.Phenotypes of two hybrid individuals sampled in the Peruvian hybrid zone. Both individuals are phenotypically most similar to (1.62 MB PDF)Click here for additional data file.Table S1HmB region.Annotation of genes in the (0.12 MB DOC)Click here for additional data file.Table S2Gene sequencing and quantitative PCR primers.(0.40 MB DOC)Click here for additional data file.Table S3Summary of gene regions sequenced for population genetic analysis.(0.12 MB DOC)Click here for additional data file.Table S4HmYb SNP data. Details of all sites significantly associated with phenotype at the HmYb locus.(0.05 MB XLS)Click here for additional data file.Table S5HmB and unlinked gene SNP data. All variable SNPs used in the analysis for the aglaope/amaryllis comparison at the HmB locus and at unlinked loci.(0.05 MB XLS)Click here for additional data file.Table S6Estimates of Tajima's D and nucleotide diversity estimates for each locus by population.(0.28 MB DOC)Click here for additional data file.Text S1Supplementary methods.(0.03 MB DOC)Click here for additional data file."}
+{"text": "In the last decade, PPAR\u03b3 agonists\u2014besides their known action and clinical use as insulin sensitizers\u2014have proved to display a wide range of antineoplastic effects in cells and tissues expressing PPAR\u03b3, leading to intensive preclinical research in oncology. PPAR\u03b3 and activators affect tumours by different mechanisms, involving cell proliferation and differentiation, apoptosis, antiinflammatory, and antiangiogenic effects. We recently provided evidence that PPAR\u03b3 and agonists inhibit IR by non canonical, DNA-independent mechanisms affecting IR gene transcription. We conclude that IR may be considered a new PPAR\u03b3 \u201ctarget\u201d gene, supporting a potential use of PPAR\u03b3 agonists as antiproliferative agents in selected neoplastic tissues that overexpress the IR.The insulin receptor (IR) plays a crucial role in mediating the metabolic and proliferative functions triggered by the peptide hormone insulin. There is considerable evidence that abnormalities in both IR expression and function may account for malignant transformation and tumour progression in some human neoplasias, including breast cancer. PPAR S6k is also stimulated by TOR, which induces the translation of cell-cycle regulators, such as cyclin D, mediating progression through the G1 phase. Cyclin D is also a target for the Ras/ERK cascade induced by insulin, leading to a synergistic effects on cell proliferation [The peptide hormone insulin regulates the metabolism and growth of most cells . In targferation \u201312  system  implicat\u03b1 (activator protein 2-\u03b1) accounted for increased IR expression in neoplastic breast tissue [\u03b1 represented a fundamental prerequisite for AP-2\u03b1 to activate IR gene transcription in neoplastic breast tissue. Similarly, a functional link between IR, and cyclin D1 has been recently described in pancreatic cancer [Dysfunctional IR signaling is implicated in certain common dysmetabolic disorders, including obesity, type 2 diabetes, the dysmetabolic syndrome X, and the polycystic ovary syndrome \u201319. Alsot tissue . In thesc cancer . Thus, ac cancer , 33.\u03b2. By potentiating the recruitment and binding of Sp1 and C/EBP\u03b2 to the IR promoter, HMGA1 greatly enhances the transcriptional activities of these factors in the context of the IR gene [\u03b2 requires the assembly and cooperation among these various nuclear factors at the levels of the two AT-rich sequences of the IR gene promoter, C2 and E3, which have a significant ability to drive transcription when introduced into mammalian cells [In target cells the IR has been shown to be under the regulation of hormones, metabolites, and differentiation . To furt IR gene , 36. Traan cells , 35, 36.an cells . Overexp\u03b3 is a nuclear hormone receptor [\u03b3 plays a number of pleiotropic effects, that include a critical role in placental vascularization, myocardial health, and embryonic development [\u03b3 generally exterts its biological function as heterodimer with the retinoid-X-receptor through binding to a specific cis-acting sequence on DNA\u2014a peroxisome proliferator response element (PPRE)\u2014to initiate transcription [\u03b3 requires activation by binding its ligand. The PPAR\u03b3 activators identified so far include naturally occurring compounds, as some unsaturated fatty acids, some anti-inflammatory molecules\u2014such as a prostaglandin J2 metabolite \u2014, oxidized low-density lipoprotein (LDL) particles 9-and 13-HODE  [\u03b3 belong to the pathway of metabolism and transport of lipids [\u03b3 may also repress gene transcription. In monocytes and macrophages, for example, it reduces IL-4 (interleukin-4) expression. Also, it reduces proinflammatory proteins, like (tumor necrosis factor \u03b1) TNF-\u03b1, (interleukin-1) IL-1, (inducible nitric oxide synthetase) iNOS, and proinflammatory transcription factors such as (activator protein-1) AP-1,  STAT, and (nuclear factor-kB) NF-kB [\u03b3 can form weak interactions with (nuclear receptor corepressor) NcOR and (silencing mediator of retinoid and thyroid hormone receptors) SMRT to repress target gene expression [\u03b3 are still largely undefined and can be related to a wide range of processes including tumour cell differentiation, apoptosis, anti-proliferative effects, and modulation of angiogenic phenotype of the tumour microenvironment.PPARreceptor \u201339 highlreceptor \u201342. It ireceptor \u201346. Besielopment , 48. It elopment \u201351. PPARcription , 50. To ic acid) , 49, andic acid) , a classic acid) , 53. MosB) NF-kB \u201356. The pression . Target \u03b3 have been performed in several cultured cell lines expressing variable amounts of PPAR\u03b3. In HepG2 human hepatoma cells IRs are relatively abundant, while endogenous PPAR\u03b3 is barely detectable. Protein expression studies showed that IR protein content was considerably reduced in HepG2 cells overexpressing PPAR\u03b3 (~50% less than control cells), and this reduction was more pronounced in PPAR\u03b3-overexpressing cells exposed to TZDs. It has been postulated that PPAR\u03b3 could affect IR content by blunting IR gene transcription. To this end, reporter gene studies have been performed using the pIR-CAT recombinant vector that contains the entire 5\u2019-flanking region of the human IR gene [\u03b3 in HepG2 cells transfected with pIR-CAT determined a ~50% reduction in CAT activity that was similar to the reduction observed in cells exposed to rosiglitazone alone, and resulted more marked in PPAR\u03b3-overexpressing cells simultaneously treated with TZD rosiglitazone. These findings were confirmed in PPAR\u03b3 overexpressing MCF-7 human breast cancer cells, a cell line naturally expressing only detectable levels of PPAR\u03b3 [\u03b3 [\u03b3, and TZDs, either alone or in combination, inhibited pCAT-C2 activity to the same extent than they did in HepG2 cells transfected with the full-length pCAT-IR promoter, indicating that interference of PPAR\u03b3 and agonists with IR gene-transcription machinery occurs at the level of the proximal promoter region, C2. This conclusion was supported by the observation that in experiments using the pCAT-E3 reporter vector, containing the more distant E3 sequence of the IR gene, no effects on CAT activity were observed in cells exposed to PPAR\u03b3 and/or TZDs. However, no PPRE have been identified on the promoter region of the IR gene. A similar observation has been previously provided by us for the transcription factor AP-2\u03b1, for which DNA-binding activity was undetectable within the IR gene promoter, and transactivation of the IR gene by AP-2\u03b1 occurred indirectly through physical and functional cooperation with HMGA1 and Sp1 [\u03b3 could perturb IR gene transcription via noncanonical mechanisms interfering with the \u201cenhanceosome\u201d complex formation implicated in transcriptional activation of the IR gene. This hypothesis was confirmed by GST-pull-down studies, followed by electrophoresis mobility shift assay and chromatin immunoprecipitation analyses, demonstrating that PPAR\u03b3 physically interacted with Sp1, AP-2\u03b1 (in selected cell lines) and, to a lesser extent, with C/EBP\u03b2 and prevented binding of AP-2\u03b1 to Sp1 protein, as well as of Sp1 and C/EBP\u03b2 to their DNA consensus sites within the IR gene locus [Studies aimed at understanding whether IR could constitute a target gene for PPAR IR gene . Forced of PPAR\u03b3 , and 3T3PPAR\u03b3 [\u03b3 . ExposurPPAR\u03b3 [\u03b3 . When th and Sp1 . Therefone locus .\u03b3 may adversely affect IR gene transcription in the absence of PPRE on the IR gene promoter. By causing a displacement of Sp1, AP-2\u03b1, and C/EBP\u03b2, PPAR\u03b3 may play significant molecular roles in the transcriptional activities of these factors in the context of the IR gene, both in physiology and pathology  tumor suppressor gene [\u03b3 and its agonists may induce their antiproliferative effects is not fully understood yet. Recently, non-genomic cross-talks between PPAR\u03b3 and cytoplasmic proteins, like  ERK 1/2, and (mitogen-activated protein kinase) MAPK kinases, have been reported in cancer cells and functional importance has been given to the subcellular localization of PPAR\u03b3 [We showed that PPARin genes \u201367. The ng genes . Many posor gene \u201370. Howeof PPAR\u03b3 , 72. In of PPAR\u03b3 . Therefo\u03b3 agonists inhibit cyclin D1 [\u03b3 support the conclusion that PPAR\u03b3 and TZDs may interfere with the hormonal control of the cell cycle, at least in part, through the inhibition of the IR. Over the last decade, PPAR\u03b3 has emerged as an important drug target in type 2 diabetes mellitus [\u03b3, providing further evidence for the use of TZDs as anti-proliferative agents in selected tumours overexpressing the IR.The last three decades of medical research examining the molecular pathogenesis of cancers have provided compelling evidence for the universal disruption of the cell cycle in human tumours, and recent studies have demonstrated a critical interface between hormonal signaling and the cell cycle . In thisyclin D1 . Our finmellitus , and TZDmellitus , a possimellitus . Thus it"}
+{"text": "Thaumetopoea pityocampa sensu lato) as an example, these needs were met by combining species niche modelling, dispersal modelling, host impact and economic modelling. Within its native range (the Mediterranean Basin and adjacent areas), T. pityocampa causes significant defoliation of pines and serious urticating injuries to humans. Such severe impacts overseas have fuelled concerns about its potential impacts, should it be introduced to New Zealand. A stochastic bioeconomic model was used to estimate the impact of PPM invasion in terms of pine production value lost due to a hypothetical invasion of New Zealand by T. pityocampa. The bioeconomic model combines a semi-mechanistic niche model to develop a climate-related damage function, a climate-related forest growth model, and a stochastic spread model to estimate the present value (PV) of an invasion. Simulated invasions indicate that Thaumetopoea pityocampa could reduce New Zealand\u2019s merchantable and total pine stem volume production by 30%, reducing forest production by between NZ$1,550 M to NZ$2,560 M if left untreated. Where T. pityocampa is controlled using aerial application of an insecticide, projected losses in PV were reduced, but still significant . The PV estimates were more sensitive to the efficacy of the spray program than the potential rate of spread of the moth. Our novel bioeconomic method provides a refined means of estimating potential impacts of invasive alien species, taking into account climatic effects on asset values, the potential for pest impacts, and pest spread rates.Biosecurity agencies need robust bioeconomic tools to help inform policy and allocate scarce management resources. They need to estimate the potential for each invasive alien species (IAS) to create negative impacts, so that relative and absolute comparisons can be made. Using pine processionary moth ( Invasive alien species (IAS) are a major problem worldwide. Despite the efforts of biosecurity agencies and an international phytosanitary legal framework for the management of invasion pathways, the rate at which these species are invading new territories appears to be increasing rapidly The rate of biological invasions has fuelled demands from biosecurity agencies for information on the potential distribution and impacts of IAS in terms of economics, human health and biodiversity. Climate has long been recognised as an important environmental determinant of the distribution of pests could establish within its jurisdiction, but another to be able and willing to respond to it should an incursion eventuate. IAS incursion responses are costly, and agencies have a finite capacity to respond. When faced with an incursion, they must decide whether to 1) attempt an eradication, 2) develop a campaign to slow the spread of the organism, 3) attempt to contain it, 4) allow the organism to spread without a coordinated response, and let land managers and local authorities manage the organism to reduce impacts to acceptable levels, or 5) allow the organism to spread, but mobilise a coordinated response such as a biological control programme It is one thing for a biosecurity agency to know that a pest Despite their common use in pest risk assessment, the potential of process-based niche models to inform these responses has not yet been fully realised. Although potential distribution is a useful input to pest risk assessment, in that it delineates an area in which the pest could potentially be problematical Thaumetopoea pityocampa and T. wilkinsoni (Lepidoptera: Thaumetopoeidae) T. pityocampa) to refer to the species complex, T. pityocampa sensu lato. Thaumetopoea pityocampa cause major defoliation of pines across southern Europe and around the Mediterranean Sea. Previous research has described the climatic requirements of T. pityocampaIt has been proposed recently that pine processionary moths are a species complex that consists of two species: T. pityocampa than natural woodlands Pinus radiata appears more susceptible to attack by T. pityocampa than native European Pinus spp. Artificial woodlands appear more susceptible to attack by T. pityocampa has been shown to result in growth reductions of up to 83% T. pityocampa be accidentally introduced into the southern hemisphere where its preferred host P. radiata is the most widely planted of all plantation species T. pityocampa as it has a significant plantation resource (1.8 million ha), of which approximately 90% comprises P. radiataAlthough the relationship between climate and host damage has not yet been quantified, defoliation of pines by T. pityocampa on volume and present value of the plantation estate under current climate, assuming control or no control of T. pityocampa using insecticide. Finally, we discuss the utility of this case study as a generic approach for quantifying economic impacts of pests on important crop species.In this contribution we demonstrate a novel analytical framework combining ecological and economic modelling, to estimate the economic impacts of an invasive organism as a basis for informing policy-level decision-making. We use New Zealand as a case study, and simulate the impact of an invasion by T. pityocampa, 3) a climate-based host damage function, 4) a spread model and 5) a partial budget economic model.The analytical framework consists of five components, 1) a climate based host productivity model, 2) a niche model describing the climate suitability for the pest species, P. radiata at age 30 years with a reference stem density of 300 stems ha\u22121  for ems ha\u22121  [32], , and 3) Good control: invasion by T. pityocampa that is managed effectively (mr reduced by 95%). For the three scenarios in which Btk is applied it is assumed that the insecticide completely negates the negative impact of T. pityocampa on growth over the area occupied by the moth.In total, five scenarios were examined. The first two assumed that et al.mr (the maximum rate of population growth) and \u03bc (the rate at which satellite populations are generated each year) were then sampled from uniform distributions described in For each invasion scenario a set of simulations were run using the spread model of Waage T. pityocampa to fly 20 km T. pityocampa over 32 years in the comparatively flat Paris Basin indicated an average annual radial rate of spread of 2.7 km yr\u22121, though more recently rates of 5.6 km year\u22121 have been observed T. pityocampa larvae were able to survive conditions colder than presently occupied, which indicates that the observed spread could be limited by the dispersal rates of the female moths, and the present range is lagged behind the retreating climatic limits. The diffusion coefficient in D is the diffusion coefficient (ha yr\u22121), and MDD is the average radial rate of spread (5.6 km year\u22121), which yields a value of 1 996 ha year\u22121.Whilst it is possible for male moths of et al.Pieris rapae exhibited significant acceleration in its range expansion that indicated that long-distance jump dispersal was likely to be a significant factor in its invasion. In that survey, observed rates of radial range expansion were predominantly less than 10 km yr\u22121, which agrees with the estimate from Battisti et al In a survey of spread rates for 27 Lepidoptera, Waage et al.T. pityocampa. They found that the fecundity of a winter population of T. pityocampa was 197.4\u00b145.4, with 98.4\u00b11% viability. Whilst Pimentel et al.T. pityocampa. Predation resulted in approximately 5% of nests having no survivors, with survival of larvae in other nests of 32.2\u00b122.8%. Taken together, these results indicate an average value for the net reproductive rate, r of approximately 1.47 year\u22121, derived using F is average fecundity of each egg batch (197) FR is the (assumed) female sex ratio for eggs (0.5), V is average egg viability (0.98) NestPredationS is the assumed average fraction of nests with at least one survivor (0.95), LarvalPredationS is the average fraction of larvae surviving predation (0.32) M is the assumed mating success rate (0.05). The value of M for the No Control scenario was selected after consideration of the observed mating success rate for gypsy moth (Lymantria dispar L.) under low density conditions such as those experienced in the region of the invasion front L. dispar studied by Robinet et al. shares with T, pityocampa the qualities of highly mobile males and sessile females T. pityocampa, the females lay a single batch of eggs; colonies are formed from one or several batches of eggs mr included in the model of Waage et al.r \u20131 as it is included within a difference equation framework, hence a value of 1.45 for r is equivalent to a value of 0.45 for mr. The carrying capacity of pine forests for T. pityocampa is estimated to be 0.95 nests per tree\u00d71 000 trees ha\u22121\u00d71 adult female per nest. It was assumed that only one female reaches the adult stage.Pimentel T. pityocampa (\u03bc) was very low  planted to forest in each cell and iMAI is the area-weighted average 300 Index value in m3 ha\u22121 yr\u22121, and FO is the outbreak or attack frequency reported by Laurent-Hervouet T. pityocampa (0.5 yr\u22121), and n is the total number of 10\u2032 cells in New Zealand that are climatically suitable for T. pityocampa under historical conditions.The total potential loss to pine plantations from LGVP, was calculated as,SV is the stumpage value (presently NZ$55.00).The present gross value of this production loss \u22121 (ca. 60 \u20ac ha\u22121) T. pityocampa on crop volume growth.We assumed that Btk was applied aerially to infested forests throughout the 30 year period, at a cost of NZ$120 haT. pityocampa on the tree growth rates across the New Zealand plantation estate was then estimated using discounted cashflow analysis. Analyses were undertaken to estimate discounted annual losses over a 30 year period from 2010 to 2040 (the invasion was assumed to start in 2010). In this analysis, it was assumed that forest rotations and harvests would occur on a rolling basis and so the forest age class would have a stable distribution. The discount rate used was 7% per annum.Under each scenario, the impact of T. pityocampa, the CLIMEX Ecoclimatic Index was compared with the reported distribution in Europe and North Africa  losses ranged from NZ$1,550 M to NZ$2,560 M . Under tffective .T. pityocampa compared with doing nothing  scenarios with a low rate of spread due to effective control  and gum leaf skeletoniser (Uraba lugens). Even if T. pityocampa did not become established in New Zealand in the near future, the rate of defoliator introductions in New Zealand and overseas indicates that there is a high risk of such an invasion. Ultimately, this study should serve as a case study of a potentially invasive insect pest of pines.Accidental shipments of T. pityocampa is extensive . These mostly sub-tropical regions experience climates that have less extreme seasonality than that of the Mediterranean basin. This curiosity may be explained by the fact that the native range of T. pityocampa is geographically isolated from areas with a sub-tropical climate, and should it invade such a region with a less extreme climate than its native range, it may indeed thrive. However, whilst suitable hosts are grown in these regions , indicating some degree of likely climate suitability, it is prudent to treat climate suitability projections in these areas with some added caution as there may be some negative life-history factor associated with warm-wet conditions that have not been taken into account in the niche model.The niche model indicates that the global potential distribution of xtensive , and incT. pityocampa, and to construct the climate-based growth impact function. Combining the 300 Index values, the CLIMEX niche model and the growth impact function allowed us to quantify potential tree growth rate impacts in a spatially-explicit and defensible manner, and to identify regions of highest priority for protection. The growth impact function is a relatively simple technique that captures climatic variability in pest suitability without resorting to the complicated and expensive method of modelling the pest population dynamics directly. By including consideration of the rate of spread of the pest, the potential costs were discounted appropriately, and the different control strategies that affect the spread rate could be evaluated.Compared with traditional economic pest risk assessments, the method demonstrated here offers significant enhancements. Traditional cost-benefit approaches ignore variability in pest population dynamics due to differences in climate throughout the area in which the vulnerable crops are grown. Typically, these analyses do not even use a species niche model for the pest to estimate which cropping regions are vulnerable to pest impacts. The CLIMEX model allowed us to identify which forests were vulnerable to attack from www.mapspam.info , Eurostat , and Cropscape (USA)]. The spatial resolution of the crop productivity maps are typically coarser than the 300 Index surface, though they appear adequate for combining with niche models for the type of analysis described here.The data requirements for this project were significant, and it is unlikely that this type of analysis would be undertaken routinely for pest risk assessments. Of the different information components required to undertake this analysis, the CLIMEX analysis could be considered the most practiced and available. Whilst high quality fine resolution modelled productivity surfaces such as the 300 Index dataset are likely to remain rare, crop productivity maps based on crop production statistics are becoming more commonplace [e.g., The climate-impact function is an attractive compromise between expensive detailed process-based population dynamics modelling on the one hand, and using a simplistic estimate of average pest impacts on the other. For relatively little effort, it provides a means of spatially matching pest impacts with productivity. As with the niche model, having generated the model once, it is able to be applied to pest risk assessments in any jurisdiction. However, for this type of analysis to become more commonplace, reporting of pest impact would be best studied and reported using standardised methods and measures.Discounting the costs throughout the simulated invasion had a significant impact on the cost estimates, so it is clearly desirable to include plausible estimates of the rate of spread of invaders throughout pest risk areas. To do this routinely, the potential rates of spread of pests across landscapes may need to be better studied and documented. Whilst it is inconceivable that there would ever be a useful library of documented pest spread rates for every pest of economic concern, it is possible that a study of spread rates for different organisms could be used to develop a useful trait-based means of estimating useful rates of spread classes for invasive species.The method of linking climate suitability, spread rates and host-impact demonstrated here appears useful and practical for estimating the potential costs of invasive pests. Whilst it has been applied to a case where impacts are considered for a single host crop, it can be easily extended to accommodate multiple hosts, so long as the impact functions can be calibrated for each crop, and the abundance of each crop is known throughout the pest risk area. The method described here can also be readily applied to pests threatening non-productive assets such as natural ecosystems using appropriate pricing mechanisms such as the hedonic pricing technique or the valuation of ecosystem services. Linking the niche modelling and economic analytical tools together as we have done in this paper provides an open and transparent means by which different pest threats can be gauged in terms of their likely economic impacts, and allows different pest threats to be compared."}
+{"text": "Approximately 20%\u201325% of patients with breast cancer demonstrate amplification of the human epidermal receptor type 2 (HER2) gene, resulting in an overexpression of the HER2 receptor. This overexpression is associated with aggressive disease, relatively poor prognosis, and worse clinical outcomes. Neoadjuvant therapy is the standard treatment in patients with locally advanced, inflammatory, or inoperable primary breast cancer. It is generally used to downstage the tumors and therefore to improve surgical options including breast-conserving surgery rather than mastectomy. It has been confirmed that patients with pathological complete response (pCR) to neoadjuvant treatment have better disease-free survival (DFS) and overall survival (OS). Neoadjuvant treatment can also serve as in vivo test of sensitivity to the used therapeutic regimen. The preferred neoadjuvant approach to patients with HER2-positive breast cancer is a sequential anthracycline-taxane-based chemotherapy in combination with trastuzumab. Addition of other anti-HER2 agents has increased pCR rate up to 75% and will probably become a new therapeutic direction. In the first part of this paper, we summarize the information about HER2-positive breast cancer, the various treatment possibilities, and the results of the major neoadjuvant trials. The second part focuses on the data concerning the importance of pCR and the potential risk of cardiotoxicity associated with this treatment. HER2 belongs to the epidermal growth factor receptor (EGFR/ErbB) family of receptor tyrosine kinases. This family consists of four receptors\u2014HER1, HER2, HER3, and HER4\u2014which are involved in regulating cell growth, survival, and differentiation. HER receptors are inactive monomers, and to activate signaling pathways, they have to undergo dimerization. Pairing among the molecules of the same HER receptor is called homodimerization; pairing of different HER receptor subtypes is called heterodimerization. HER dimerization leads to activation of two important signaling pathways\u2014PI3K/Akt and Ras/Raf/MEK/MAPK . Other important parameters identified as predictors for pCR were HER2-positive disease, higher grade, younger age, non-lobular-type tumors, and smaller tumor size.The integrated meta-analysis  on data More recent pooled analysis of German neoadjuvant studies has also revealed different prognostic value of pCR . In patiIt has been shown that the estrogen receptor pathway might be a relevant escape mechanism in \u201ctriple-positive\u201d tumors . AccordiIn the case of HER2-positive/ER-negative tumors, the gene expression analysis of 114 samples from the NOAH study revealed that the high expression of the plasma cell metagene and the 8q22 amplicon, and low expression of the insulin-like growth factor metagene, were associated with higher pCR rates in this group of patients treated with trastuzumab and chemotherapy .HER2 overexpression induces an activation of signaling pathways including the PI3K/Akt. Some studies have shown that patients with a low expression of PTEN or PI3K mutations have poorer response and worse clinical outcome with trastuzumab-containing therapy \u201349. The GeparQuattro and GeparQuinto trials showed a positive association between pCR rates and serum HER2 levels [The extracellular domain of the HER2 protein can be detected in peripheral blood as serum HER2, which can be measured by ELISA. 2 levels , 51. But\u03b3 receptor polymorphisms [Other biomarkers such as circulating miR-210 levels , fragmenorphisms , and genorphisms  have beeIntensive studies have also been done on the markers potentially associated with resistance to trastuzumab. One is p95HER2 (truncated form of HER2 receptor), which was thought to be associated with resistance to trastuzumab but responsiveness to lapatinib, but the results from the studies are controversial. In the CHER-LOB study, the pCR rate was not different for patients with p95HER2-positive or -negative tumors . On the Other potential markers of resistance to trastuzumab as p-4EBP1\u2014an activator of the mTOR pathways and ALDH1\u2014a stem cell marker, were investigated in patients included in the GeparQuattro study, but their further validation is needed .Cardiac toxicity is an important side effect of trastuzumab treatment and has been observed in patients who received trastuzumab as a single agent or in combination with chemotherapy for metastatic disease and in primary breast cancer , 59.The data concerning cardiac events differ from one clinical study to the next. This is a result of different variables such as applied therapy regimens, inclusion and exclusion criteria, and time interval between anthracycline-based chemotherapy and trastuzumab treatment.In the two randomized neoadjuvant trials , 33, traIt has been proved that administration of trastuzumab concurrent with anthracyclines is associated with an increased risk of cardiac toxicity, but this risk can be manageable if the cumulative dose of anthracycline is kept low and/or less-cardiotoxic anthracyclines are used , 60\u201362.It is well known that the cardiotoxity of anthracyclines and trastuzumab differs in many ways. Trastuzumab can cause cardiac dysfunction identified as type II, which seems not to be dose related; it is higher when trastuzumab is given concurrently with anthracyclines, it seems to be reversible when trastuzumab is discontinued, and it is mostly medically manageable with regular medication for heart failure.On the other hand, anthracyclines produce a cardiotoxicity identified as type I, which is dose dependent, not reversible, and results in ultrastructural abnormalities, as observed in myocardial biopsies.It is very important to consider the risk of cardiac toxicity and reduce it by close monitoring of patients. We should avoid using trastuzumab in patients with a baseline LVEF lower than 50%. Extreme caution should be taken with patients older than 65 and in patients with baseline LVEF 50%\u201355%. We do not know exactly whether typical cardiac risk factors  are also risk factors for trastuzumab-related cardiotoxicity. Seidman et al.  performeResults of retrospective clinical experience studies suggest that advanced age, hypertension, radiation therapy to the left chest wall, or previous exposure to anthracyclines did not result in a higher risk for trastuzumab-related cardiotoxicity . On the These results have to be applied with caution as, in another study, smoking, family history, hypercholesterolemia and diabetes, and radiation to the left side of the chest were not identified as risk factors . ConditiFor identification of trastuzumab-related cardiotoxicity, all patients treated with this agent should, a part from a clinical examination with electrocardiogram, undergo the measurement of LVEF at baseline of trastuzumab treatment. Furthermore, it is recommended that LVEF be monitored every 3 months during trastuzumab treatment.Biomarkers such as NT-proBNP and troponin I are being intensively studied as potential parameters for trastuzumab-induced cardiotoxicity, but more evidence is needed before their application in the routine practice.HER2-positive breast cancer presents a heterogeneous group of diseases with various biological characteristics and clinical outcomes . The manThe neoadjuvant approach offers the possibility to reach operability in an initially inoperable disease and, in some cases, breast conservation instead of mastectomy. It also has prognostic value as patients who achieve pCR have favorable long-term outcome. The response to neoadjuvant treatment informs us of the efficacy of the used therapeutic regimen and, therefore, helps us to choose an appropriate treatment strategy. Neoadjuvant treatment requires a multidisciplinary approach, and close cooperation between surgeon, medical oncologist, radiation oncologist, and pathologist is needed.Nowadays, sequential anthracycline-taxane-based chemotherapy in combination with trastuzumab is considered the preferred therapy for HER2-positive breast cancer in a neoadjuvant setting. However, based on the results of these trials, the dual blockage of HER2 receptor has revealed significant efficacy and presents a new therapeutic approach. Other anti-HER2 agents are under intensive investigation.HER2 can stimulate angiogenesis through vascular endothelial growth factor upregulation. Therefore, HER2 blockage, together with inhibition of angiogenesis, could be another treatment option. In phase II study, neoadjuvant therapy with nab-paclitaxel, carboplatin and bevacizumab led to a pCR rate comparable to that found in chemotherapy/trastuzumab combinations .There are many questions to be answered, for example, what is the best combination of anti-HER2 agents and with which cytostatic agents; can dual-blockage of HER2 replace the chemotherapy in some cases; and what are the reliable biomarkers for anti-HER2 therapy? Much is still to be done and other large studies are needed."}
+{"text": "The area of HER2-positive breast cancer is a rapidly changing field. The use of the humanized monoclonal antibody, trastuzumab, significantly improved the prognosis for patients with HER2-positive breast cancer, however, increasing knowledge regarding mechanisms of resistance to trastuzumab have come to light, prompting research into additional methods to target the HER2 protein. The purpose of this article is to discuss evidence for why continued blockade of the HER2 pathway continues to be important despite progression on trastuzumab, as well as to review additional HER2-targeted therapies and progression in the central nervous system. With the availability of new drugs comes the need to determine the appropriate therapeutic combinations and optimal order in which to deliver these therapies. This review summarizes the practice-changing phase III trials and some supporting phase II data regarding the various targeted HER2 therapies available for patients with advanced HER2-positive breast cancer, proposes order for anti-HER2 therapy in the advanced HER2-positive breast cancer patient, and includes information on future strategies. While other reviews on HER2-targeted therapy are available, this review specifically aims at addressing treatment options after trastuzumab failure in the patient with advanced HER2-positive breast cancer. The Human Epidermal Growth Factor Receptor 2 (HER2) oncogene is responsible for encoding a transmembrane tyrosine kinase which is over expressed in 20\u201325% of breast cancers and is associated with a worse prognosis ,2. The uRecent evidence suggests that activation of the HER2 signaling pathway continues to be the primary driver of tumor growth and survival, even after prolonged exposure to trastuzumab. Multiple resistance mechanisms have been proposed, and include up-regulation of ligand-induced receptor activation, increased signaling from other HER family receptors, and activation of the phosphatidylinositol triphosphate kinase (PI3K) pathway with loss of phosphatase and tensin homolog (PTEN) \u20138. GivenTrastuzumab is a humanized monoclonal antibody which binds to the extracellular domain of the HER2 molecule . ProposeThe German Breast Group 26/Breast International Group 03\u201305 trial was the first and only randomized, prospective trial to evaluate the efficacy of use of trastuzumab beyond progression on a previous trastuzumab-containing regimen . Patientpost-hoc analysis of this study was performed comparing continued HER2-targeted therapy as second or third line therapy in the form of trastuzumab or lapatinib versus chemotherapy alone [An additional py alone . In thisThe first HER2-targeted therapy to receive FDA approval after trastuzumab was lapatinib. Lapatinib is a small molecule, oral tyrosine kinase inhibitor of both HER2 and Epidermal Growth Factor Receptor (EGFR), and was initially shown in pre-clinical models to be effective in tumors resistant to trastuzumab ,16. A phLapatinib is also FDA-approved in combination with letrozole as first-line treatment for post-menopausal patients with metastatic HER2-positive, estrogen receptor positive breast cancer based on a phase III randomized placebo-control trial . Over 12p=0.008) [Additional studies performed with lapatinib in combination with trastuzumab in the metastatic setting after progression on trastuzumab have been performed. Blackwell et al. performed a phase III randomized international trial comparing lapatinib alone to the combination of lapatinib and trastuzumab in 296 patients . Patientp=0.008) . Additiop=0.008) . There wp=0.008) . With rep=0.008) . Rash wap=0.008) . It is ip=0.008) .Lapatinib is an active agent in patients with evidence of progression on trastuzumab, and is a safe and tolerable second-line anti-HER2 drug. It is important to note that it is unknown what \u2013 if any \u2013 activity lapatinib will have after progression on other next-generation HER2-targeted therapies such as pertuzumab and T-DM1, and further clinical trials to determine the correct timing of lapatinib therapy are warranted.The next agent approved for metastatic HER2-positive breast cancer was pertuzumab. Pertuzumab is a humanized monoclonal antibody which binds to the dimerization domain of HER2, thereby inhibiting dimerization with the other members of the HER family of receptors. In the international, randomized, double-blind, phase III CLEOPATRA trial, the addition of pertuzumab to trastuzumab plus docetaxel was studied in patients with newly metastatic HER2-positive breast cancer, 40\u201347% of who received previous trastuzumab . The addPertuzumab was also studied in combination with trastuzumab, without the addition of chemotherapy. A phase II study evaluated the combination of pertuzumab and trastuzumab in HER2-positive breast cancer patients after progression on a trastuzumab-based therapy in the metastatic setting. An overall response rate of 24.2% and a clinical benefit rate of 50% were observed . All 29 N-maleimidomethyl Cyclohexane-1-Carboxylate (MCC). This linker is thought to help isolate exposure of DM1 to the target cells and spare normal tissue from the toxicity associated with cytotoxic chemotherapy. DM1 is a derivative of maytansine 1, and works by binding to tubulin and inhibiting microtubule assembly [T-DM1 is the most recent anti-HER2 agent found to have considerable activity in patients with trastuzumab-resistant disease. T-DM1 is an antibody-drug conjugate which links trastuzumab to DM1 via a thioether linker called assembly ,27. In aassembly . Hypokalassembly . An addiassembly . The EMIassembly . At a foassembly . ImportaThese questions are becoming increasingly important as treatment for metastatic breast cancer may include multiple years of therapy. A small single institution study retrospectively analyzed HER2-positive metastatic breast cancer patients who had received T-DM1 and were subsequently administered additional anti-HER2 targeted agents after T-DM1 use . The invStandard anti-HER2 therapy with trastuzumab results in a failure to adequately treat and prevent CNS progression, resulting in a growing population of HER2-positive patients with limited therapeutic options . CNS metAlthough trastuzumab has poor blood-brain barrier penetrance, there is evidence to suggest that alteration of this barrier with whole brain radiation allows for increased concentrations of the drug . There iLapatinib shows promising activity in patients with CNS progression. In a phase 3 randomized trial of capecitabine versus capecitabine plus lapatinib in patients with locally advanced or metastatic HER2-positive breast cancer, there was a trend toward decreased CNS metastasis in the group that received lapatinib, although the difference was not statistically significant . While tTwo oral small molecule inhibitors of the HER family of receptors are in early study. Neratinib is an inhibitor of HER1, HER2 and HER4. A small phase II study evaluated neratinib in two cohorts of patients with advanced HER2-positive breast cancer, one of which had received prior trastuzumab, and the other which had not received trastuzumab . At 16 wInhibition of enzymes in the phosphatidylinositol-3-kinase (PI3K) pathway, specifically the class I enzymes, is also being heavily studied, as this pathway is involved in regulation of cell proliferation, survival and apoptosis . The panWhile patients with HER2-positive breast cancer previously had poor outcomes, the use of trastuzumab has significantly improved their survival. As resistance mechanisms to trastuzumab have come to light, many additional targeted agents as well as drug combinations have been developed and shown to have efficacy in both disease free and overall survival."}
+{"text": "Since 2005, major progresses have been made in the neoadjuvant treatment of HER2-positive breast cancer. Trastuzumab introduction associated with chemotherapy has been the first major step leading to the improvement of the complete pathological response rate and, like in the adjuvant studies, better survivals. Dual HER2 blockade has been the next step and trastuzumab is associated now with other anti-HER2 therapies like lapatinib or pertuzumab, the latter being much more easy to use in combination with chemotherapy. Additional knowledge is necessary to better define within the HER2 tumor subgroup which patients could benefit more from targeted therapies. Different biomarkers have been studied to predict the response after anti-HER2 neoadjuvant therapies but until now none has been validated. Neoadjuvant chemotherapy in breast cancer treatment is now recognized as a standard care to increase conservative surgery , 2. Its In HER2-positive breast cancer, randomized studies with and without anthracyclines have demonstrated the essential role of anti-HER2 therapies in obtaining increased pathological complete response rates and good long-term results.P = 0.036). In the HER2-positive subgroup (n = 90), the addition of trastuzumab to the chemotherapy increased the pCR rate (40% versus 26.7%) but this result was not statistically significant (P = 0.37). Authors suggested it might be due to the unexpectedly high rate of pCR achieved in the ED/EDC group . The lowest pCR rate is reported by Pierga et al. [Several randomized trials have evaluated, in the neoadjuvant setting, the role of trastuzumab , a recombinant humanized monoclonal antibody that targets HER2 receptor. The first randomized trial in patients with operable noninflammatory disease was stopped early when the pathological complete response (pCR) rate in the trastuzumab group was more than twice as high as that of the control group (65% versus 26%) , 5. The roup n = 0, the adIn the GeparQuattro study, 445 patients with HER2-positive tumors were scheduled to receive 4 cycles of epirubicin plus cyclophosphamide and then were randomly assigned to either 4 cycles of docetaxel or 4 cycles of docetaxel plus capecitabine or 4 cycles of docetaxel followed by 4 cycles of capecitabine . All patDespite improvement of pCR rates, all patients do not equally benefit from trastuzumab therapy. Indeed multiple pathways can contribute to acquired or intrinsic resistance to trastuzumab , 22. LapTrastuzumab and lapatinib have well-characterized synergistic interaction in HER2-positive breast cancer models \u201327, due Lapatinib leads also to an accumulation of HER2 at the surface of the cell, enhancing trastuzumab-dependent ADCC , 28. TheThe direct comparison in the GeparQuinto trial showed that pCR rate with chemotherapy and lapatinib (30%) was significantly lower than that with chemotherapy and trastuzumab (44%) . The resP = 0.01) [In the NeoALTTO study, pCR rate was significantly higher in the group given lapatinib and trastuzumab (47%) than in the group given trastuzumab alone (28%) . The res = 0.01) .P < 0.001) [P = 0.0141; 16.8% (arm C) and 24% (arm D). The superiority of the pertuzumab-trastuzumab arm either in first-line metastatic setting or in the neoadjuvant setting leads to the initiation of the ongoing adjuvant trial with pertuzumab (NCT01358877). Pertuzumab  is a humanized monoclonal antibody directed at the dimerization domain of HER2. Pertuzumab and trastuzumab have complementary mechanisms of action due to their distinct binding sites. Pertuzumab inhibits ligand-dependent signaling particularly between HER2 and HER3 which is known to activate a proliferation pathway . Pertuzu< 0.001) . NeoSphe< 0.001) . Three hP = 0.82) [In a recent meta-analysis, Valachis et al. studied the overall effect of neoadjuvant trastuzumab on BCS . Breast- = 0.82) . This co = 0.82) . In another meta-analysis, Valachis et al. reported the effect of lapatinib versus trastuzumab or the combination (lapatinib plus trastuzumab) versus trastuzumab on the BCS rate . They foMoreover, other criteria can influence the BCS rate and must be taken into account like the tumor size, the presence of in situ carcinoma, the multifocality of the lesion, and the preference of the patient. Unfortunately, these data were not reported in the different studies. P = 0.013), although 19 (16%) patients with HER2-positive disease assigned to chemotherapy alone crossed over to receive adjuvant trastuzumab [P = 0.114) [Most of the studies in this review did not report data of survival. In the NOAH trial, the primary end point was the event-free survival (EFS) . Adjuvanstuzumab . Benefit= 0.114) .P = 0.041) after a median followup of 36.1 months [Buzdar et al. reported a better disease-free survival (DFS) among patients randomized to chemotherapy plus trastuzumab compared to patients with chemotherapy alone , after an anthracycline- and taxane-based therapy without trastuzumab [Estrogen-receptor- (ER-) negative tumors are usually associated with a higher pCR rate compared to ER-positive tumors \u201339 inclustuzumab .In neoadjuvant trials with trastuzumab or others anti-HER2 therapies, similar results are described. The pCR rates in HR+ and HR\u2212 subgroups are summarized in It has been suggested that ER/HER2 crosstalk may be implicated in the escape from HER2-directed therapy. Wang et al. described an increase of ER and its downstream products in 80% of ER+/HER2+ cell lines after a treatment with trastuzumab and lapatinib. Moreover, acquisition of resistance after trastuzumab and lapatinib could require the activation of the ER pathway via Bcl2 family members . P = 0.015) [P = 0.007) [HER2 overexpression leads to an activation of multiple signaling pathways including the PI3K/Akt pathway that result in the modification of cell growth, differentiation, and survival. In a recent study of Dave et al, after neoadjuvant trastuzumab 18.2% (4/22) of patients with low expression of PTEN (IHC) or PI3K mutations achieved pCR whereas 66.7% (6/9) of patients without low PTEN or PI3K mutations achieved pCR (= 0.015) . These f= 0.015)  who used= 0.015) . With la= 0.015) . PI3K mu= 0.007) . Hence, These results are discussed in other studies: in a retrospective study of 129 patients with HER2+ tumors including 26 cases treated with neoadjuvant trastuzumab and 48 metastatic breast cancer receiving a combination of taxane and trastuzumab, any relationship was found between PTEN loss and/or PI3K mutations and response to trastuzumab . A lowerAnother potential mechanism of resistance to trastuzumab is the accumulation of truncated forms of the HER2 receptor that lack the extracellular trastuzumab-binding domain. Amino terminally truncated carboxyl terminal fragments of HER2, collectively known as p95HER2, are frequently found in HER2+ breast cancer cell lines and tumors . The truP = 0.009). The resistance rate in the p95-positive group was 25.8% versus 48.7% in the p95-negative group (P = 0.014) [In preclinical models and in 46 metastatic patients treated with trastuzumab, the expression of p95HER2 was correlated with the lack of response to trastuzumab . Loibl e= 0.014) . Results= 0.014) .In the CHER-LOB trial the expression of p95HER2 was determined by immunohistochemical assay and was found to be present in 30.7% of cases. However, pCR rates were not different for p95HER2-positive and p95HER2-negative tumors in any treatment group . P = 0.045) and a decrease of sHER2 levels during neoadjuvant therapy (P = 0.02) which was also significant in multivariate analysis  [P = 0.043) [P = 0.031) [The extracellular domain of the HER2 protein can be cleaved from the surface by metalloproteases and detected in the peripheral blood as serum HER2 (sHER2). The remaining cleaved receptor is constitutively activated, suggesting that the presence of sHER2 also reflects a biological process leading to a more aggressive tumor behavior . Trastuz= 0.049) . In 210 = 0.043) . Moreove= 0.031) .Nonetheless, the biological relevance of elevated sHER2 is still unknown and other studies have reported a limited predictive utility of baseline sHER2 .P = 0.0359) [Before neoadjuvant chemotherapy with trastuzumab, circulating miR-210 levels were significantly higher in 11 patients who had residual disease than in 18 patients who achieved a pCR ( 0.0359) . \u03b3 receptor (Fc\u03b3R) polymorphism has an effect on ADCC, which is one of the mechanisms of action of the trastuzumab. Tamura et al. observed in the tumors of 15 patients that the Ff\u03b3R2A-131 H/H polymorphism predicts the pathological response to trastuzumab-based neoadjuvant chemotherapy in early-stage breast cancer [Some data suggested that the fragment C t cancer .Esteva et al. suggested that in 45 patients with HER2+ tumors who received concomitant trastuzumab and paclitaxel followed by FEC, a lower expression of genes involved with CD40 signaling was associated with a greater risk of residual disease .In the NOAH trial, in 171 patients with available biopsies, negative progesterone receptor and c-Myc amplification were associated with higher pCR rates after addition of trastuzumab compared to chemotherapy alone. Overexpression of membranous IGF1R was associated with higher likelihood of residual disease after trastuzumab-based chemotherapy .In the exploratory study presented by Holmes et al. at the 2011 ASCO meeting, 100 patients with stage II/III HER2+ breast cancer were randomized to trastuzumab, lapatinib, or trastuzumab plus lapatinib . Before P < 0.03). To identify an optimal threshold for the prediction of the pathological response, receiver operating characteristics (ROC) analysis gave an optimal cut-off value of \u221270% for \u0394SUV. At this cut-off value, \u0394SUV had a sensitivity of 89% while the specificity was 87%. From these results, an SUV decrease greater than 70% allowed for the early identification of the highly responsive tumors, which will be completely eradicated by trastuzumab-based neoadjuvant therapy, with an accuracy of 76% [In HER2-negative and HER2-positive tumors, the standard uptake value (SUV) decrease, studied with positron emission tomography (PET), is a strong predictor of pCR after only one course of chemotherapy . Other sy of 76% . These dy of 76% . This stTrastuzumab (Herceptin) has been a breakthrough in the treatment of HER2-positive breast cancer. Trastuzumab combined with chemotherapy has improved response rates, pathological complete response, progression free survival and survival in the neoadjuvant setting of these cancers. With the emergence of new anti HER2 therapies like lapatinib (Tyverb), pertuzumab (Tarjeta) and TDM1 (Kacyla), dual HER2 blockade, still associated with chemotherapy, has proven to be superior. In order to better individualize targeted therapies in specific tumor subgroups, additional knowledge is necessary. Different biomarkers have been studied to predict the response to anti-HER2 neoadjuvant therapies but until now, except the HER2 positivity, none has been validated. PET oriented strategy could be used to separate the most responsive tumors from the less responsive ones. Further studies are necessary to define robust, reliable, and reproducible biomarkers."}
+{"text": "Human epidermal growth factor receptor 2 (HER2) is overexpressed in around 20\u201330% of breast cancer tumors. It is associated with a more aggressive disease, higher recurrence rate, and increased mortality. Trastuzumab is a HER2 receptor blocker that has become the standard of care for the treatment of HER2 positive breast cancer. The effectiveness of Trastuzumab has been well validated in research as well as in clinical practice. The addition of Trastuzumab to standard of care chemotherapy in clinical trials has been shown to improve outcomes for early stage as well as metastatic HER2 positive breast cancer. The most clinically significant side effect of Trastuzumab is the risk of cardiac myocyte injury, leading to the development of congestive heart failure. The emergence of patterns of resistance to Trastuzumab has led to the discovery of new monoclonal antibodies and other targeted agents aimed at overcoming Trastuzumab resistance and improving survival in patients diagnosed with HER2 positive breast cancers. Human epidermal growth factor receptor HER2 overexpression is present in approximately 20\u201330% of breast cancer tumors. HER2 overexpression is associated with a more aggressive disease, higher recurrence rate, and shortened survival \u20134. TrastHER2 is part of the epidermal growth factor (EGF) family, along with 3 other receptors: epidermal growth factor receptor , HER2 (erbB2), HER3 (erbB3), and HER4 (erbB4). The HER2 gene is located on the long arm of chromosome 17 and encodes a 185-kDa transmembrane protein . The HERThe mechanism of action of Trastuzumab is perceived to be through both innate and adaptive immunities. Innate mechanisms lead to cell cycle arrest, with a noted increase in p27 levels, and decrease in cyclin D1 and cyclin-dependent kinase 2 activity . TrastuzTrastuzumab has become the standard of care in the treatment of patient with HER2 positive breast cancer. Data from several randomized trials demonstrated that the addition of Trastuzumab to chemotherapy regimens in the adjuvant setting improves outcome in women with early stage breast cancer \u201322. In tThe ideal timing of Trastuzumab administration appears to be concurrent administration with chemotherapy, based on the NSABP trial . HoweverTrastuzumab has also been shown to be effective in improving outcome for patients with HER2 positive metastatic breast cancer . This efTrastuzumab has been evaluated in combination with hormonal therapy in postmenopausal women with metastatic breast cancer, that is, both hormone receptor and HER2-positive. The TAnDEM study showed that the combination of anastrozole and Trastuzumab was more effective in improving outcomes when compared with anastrozole alone .Trastuzumab has been evaluated extensively in the neoadjuvant setting. A review by Lazaridis et al. presented positive data regarding the integration of Trastuzumab into neoadjuvant treatment regimens . The folLastly, a trial by Buzdar et al. evaluated the effect of adding Trastuzumab to chemotherapy in the neoadjuvant setting for operable HER2 positive breast cancer. The trial was stopped early due to significantly higher rates of pathological response in the Trastuzumab arm . PatholoCardiac toxicity in patients receiving anthracycline-based chemotherapy has been well established. The mechanism of doxorubicin cardiotoxicity involves direct injury to cardiac myocytes through increased free radicals and oxidative stress \u201345. DoxoTrastuzumab therapy, unlike anthracyclines, has been associated with reversible injury to the cardiac myocytes. This is mainly due to the fact that it does not appear to cause structural damage to the myocardium . Human eHER2 binds to Neuregulin-1 and initiates this cascade, perpetuating signals to maintain cell survival, response to stress, and prevent apoptosis. Trastuzumab blocks the HER2 receptor, causing these pathways to be interrupted \u201356. The Certain risk factors have been associated with increased risk of cardiac dysfunction with Trastuzumab treatment. These included age >50 years, concomitant use of an anthracycline, hypertension requiring treatment, and post-AC LVEF values of 50\u201354% . In addiTrastuzumab has become widely used for the treatment of HER2 positive breast cancer. Despite the success of Trastuzumab-based therapy in treating all stages of HER2-positive breast cancer, resistance to Trastuzumab is an important issue which affects outcome for a subset of patients. These observations have prompted research into the mechanisms of Trastuzumab resistance, which are thought to underlie failure of therapy . No cleaLapatinib is a dual EGFR and HER2 receptor tyrosine kinase inhibitor , 76. LapTrastuzumab has been proven to be effective in improving outcomes for patients with early operable as well as metastatic HER2 positive metastatic breast cancer. It has also been shown to increase the pathological response when used in the neoadjuvant setting. Trastuzumab therapy has been associated with an increased risk of cardiac toxicity, especially when used in combination with anthracyclines. Resistance to Trastuzumab therapy has also been documented, as patients have had disease progression while on treatment. A better understanding of the mechanisms of resistance to Trastuzumab therapy constitutes the cornerstone of finding new better tailored therapeutic agents capable of reducing rates of treatment failure and disease progression. Multiple new drugs are under investigation, targeting a wide array of receptors and cell cycle regulatory proteins. Preclinical pharmacological and genomic data will soon make its way into the clinical domain. Integrating this knowledge into therapeutic decision making may change the identity of HER2 positive breast cancer from a one drug for all diseases into a personalized individualized therapy, tailored to each patient's predictable response."}
+{"text": "HER2-positive breast cancers have poorer prognosis and are prime candidates for molecular-targeted therapy because they are driven by the unique mechanism of HER2 oncogene addiction. While anti-HER2 agents such as trastuzumab and lapatinib are integral to the treatment of HER2-positive breast cancer, intrinsic and secondary resistance pose a significant challenge, underscoring the need to develop novel anti-HER2 therapies. In recent years, an array of promising and novel anti-HER2 therapeutic agents and their combinations have entered various stages of clinical development. However, questions remain on the optimal sequences of HER2-directed therapies and selection of patients for the most appropriate drug or combinations; incompletely defined mechanisms of trastuzumab action and resistance have also dampened the progress of more successful biomarker-driven treatment approaches. This paper summarizes existing preclinical and clinical evidence on the mechanisms of trastuzumab action and resistance and provides an up-to-date overview of novel HER2-directed therapies in clinical development. Human-epidermal-growth-factor-receptor-2 (HER2-) overexpressing breast cancers account for 20\u201325% of invasive breast cancers and are associated with an aggressive biologic behaviour translating to poorer clinical outcomes . The dev Despite this notable success, 70% of patients with HER2-positive breast cancers demonstrate intrinsic or secondary resistance to trastuzumab , highlig The data for this paper were obtained by searching the PubMed database using Entrez. The search terms used included the following combined subject headings: HER2-positive breast cancer, herceptin, trastuzumab, resistance, p95HER2, phosphatidylinositol 3-kinase (PI3K)/Akt, phosphatase and tensin homolog (PTEN), HER3, insulin-like growth factor 1 receptor (IGF-1R), angiogenesis, lapatinib, pertuzumab, trastuzumab-DM1 (T-MD1), HER2 tyrosine kinase inhibitors (TKIs), heat-shock protein (HSP) 90 inhibitors, vascular endothelial growth factor (VEGF) inhibitors, IGF-1R inhibitors, and bispecific antibodies. The citation lists of all retrieved articles were examined to identify potentially relevant articles, and proceedings from conferences of the American Society of Clinical Oncology and San Antonio Breast Cancer Symposium were searched for relevant abstracts.HER2 belongs to a family of transmembrane receptor tyrosine kinases, which also includes HER1 ), HER3, and HER4. Ligand binding to the ECD of these receptors results in either homodimerisation between two molecules of the same receptor or heterodimerizaton between two different receptors. Dimerisation in turn induces tyrosine kinase phosphorylation and downstream signalling onto the PI3K and mitogen-activated protein (MAP) kinase cascades, leading to cell survival and proliferation, respectively. While EGFR, HER2, and HER3 are all implicated in carcinogenesis, the dimers vary in their signalling potencies, with the HER2/HER3 heterodimer possessing the strongest mitogenic potency, particularly in the activation of the PI3K/Akt survival pathway. The HER2 protein possesses two unique features; firstly, unlike other HER family members which exist in an inactivated state, it can be constitutively activated and is capable of ligand-independent dimerisation, and secondly, it is the preferred heterodimerisation partner for other HER proteins , 6. Ironically, the mode of action of trastuzumab remains incompletely defined despite its routinary clinical application. Extensive preclinical research has been conducted to elucidate these mechanisms, and the following possibilities have been proposed.\u03b3 receptor on immune effector cells, particularly natural-killer cells, resulting in cell lysis of HER2-positive target cells bound to trastuzumab [\u03b3 receptors [in vivo data from a pilot study of 11 patients with HER2-positive early breast cancer, where a positive correlation was observed between response to neoadjuvant trastuzumab and ADCC activity [An important proposed mechanism of action of trastuzumab is antibody-dependent cellular cytotoxicity (ADCC), which is triggered through the detection of Fc portion of trastuzumab by the Fcstuzumab . This meeceptors . These oactivity .p95HER2 fragments resulting from the proteolytic cleavage of the HER2 ECD have generated much interest due to the association of the 100\u2013115\u2009kDa p95HER2 fragment with a clinically more aggressive subset of HER2-positive breast cancers . A preclKip1 expression [The role of trastuzumab in abrogating the PI3K/Akt signaling pathway has been addressed in two preclinical studies, where treatment of HER2-gene-amplified breast cancer cells with trastuzumab caused growth inhibition through PTEN upregulation and downregulation of PI3K activity and Akt function , 13. Othpression , 15.\u03b21, further enhances VEGF secretion [Investigators have reported that HER2-overexpressing cell lines possess higher basal levels of VEGF expression and that stimulation with the HER3 and HER4 ligand, heregulin ecretion , suggestecretion , whilst ecretion .Understanding the mechanisms behind trastuzumab resistance is a critical step towards the development of novel anti-HER2 strategies. Molecular mechanisms that contribute to trastuzumab resistance include the following.Truncated p95HER2 fragments exhibit resistance to trastuzumab because they lack trastuzumab-binding epitopes and may arise either through proteolytic cleavage of the HER2 ECD or alternative translation-initiation sites of the HER2 protein . Due to Genetic aberrations in the PI3K/Akt pathway are among the most prevalent in breast cancer and have been shown to mediate trastuzumab resistance. These include loss-of-function PTEN deletions and activating mutations of PI3KCA, the gene encoding the p110 catalytic subunit of PI3K . A preclInhibition of the HER2 oncogenic pathway with trastuzumab may result in compensatory crosstalk and activation of alternative signalling pathways, such as IGF1R and HER3 signalling pathways . AberranThe binding between trastuzumab and HER2 may be disrupted by the membrane-associated glycoprotein mucin-4 (MUC4), as evidenced by the overexpression of MUC4 in a trastuzumab-resistant breast cancer cell line and subsequent restoration of trastuzumab binding through MUC4 siRNA knockdown . SimilarOnly two agents possess regulatory approval for the treatment of HER2-positive breast cancer, with a lull of nearly a decade between the initial FDA approval of trastuzumab and that of lapatinib in 2007. Therefore, the management of patients with prior trastuzumab failure has long represented an area of unmet clinical need, with existing treatment options that include HER2-directed therapies being limited to (i) the continuation of trastuzumab beyond progression, (ii) the alternative use of lapatinib, or (iii) a combination of both.versus 27%, P = 0.0115) and median time-to-progression  [NCT00444587; THOR, NCT00448279) [Preclinical data showing that trastuzumab withdrawal resulted in rapid re-growth of trastuzumab-resistant cell lines , 31 lent 0.0338) . Data fr0448279) .Lapatinib is a reversible small-molecule TKI of EGFR and HER2 which was first found to possess antitumour activity in HER2-dependent cells lines . Subsequversus 14%, P < 0.09) and PFS  in this group of patients [Lapatinib gained regulatory approval for use in HER2-positive metastatic breast cancer patients who have received prior anthracyclines, taxanes, and trastuzumab, based on a pivotal phase III study demonstrating the superiority of lapatinib and capecitabine compared to capecitabine alone in ORR . In addition, a randomised phase II study has been planned to evaluate the efficacy of lapatinib versus trastuzumab in combination with first-line chemotherapy in metastatic patients whose tumours display concomitant overexpression of HER2 and p95HER2 (NCT01137994). Lapatinib is also being evaluated as monotherapy or in combination with trastuzumab in early-stage breast cancer in the adjuvant  and neoadjuvant  settings. Lapatinib is currently being evaluated in combination with chemotherapy as first-line metastatic treatment in HER2-positive disease in the ongoing MA31 study, where it is being compared to trastuzumab in combination with taxane-based chemotherapy  and median PFS  compared to lapatinib alone [versus 29.5% versus 24.7%, respectively; P < 0.01); dual blockade was associated with mildly increased but manageable toxicities [A preclinical study in HER2-overexpressing breast cancer cell lines suggested that dual anti-HER2 blockade was synergistic because lapatinib induced HER2 accumulation at the cell surface, resulting in enhanced trastuzumab-binding and increased trastuzumab-mediated ADCC . A randoib alone . These fxicities .The emergence of more robust preclinical data in recent years has catapulted therapeutic advances in this arena, resulting in a rapid expansion in the armamentarium of anti-HER2 agents being developed clinically. These include dimerisation inhibitors, antibody-drug conjugates, tyrosine kinase inhibitors, HSP90 inhibitors, mTOR/PI3K inhibitors, antiangiogenic agents, IGF-1R inhibitors, and bispecific antibodies.One of the closest to regulatory approval amongst several novel anti-HER2 agents in advanced clinical development is pertuzumab, which is a humanised monoclonal antibody that binds to an epitope on the dimerisation domain located on domain II of the HER2 ECD, distinct from the binding site of trastuzumab on domain IV. Consequently, it potently inhibits HER2 as well as the dimerisation of HER2 with other HER family receptors, including HER3 . The groNCT00567190) evaluated the benefit of adding pertuzumab to the combination of trastuzumab and docetaxel in previously untreated HER2-positive metastatic breast cancer. Although no comprehensive data has been released, preliminary results of the recently completed study indicate that the primary endpoint of PFS was significantly prolonged in the experimental pertuzumab-containing arm. These potentially practice-changing findings have led Genentech/Hoffman-La Roche to seek regulatory approval for the drug combination [NCT01358877). Pertuzumab combined with trastuzumab results in concurrent blockade of multiple HER family members, and their synergistic activity has been demonstrated in HER2-overexpressing breast cancer xenograft models . Dual inbination . A similversus 29% versus 24%, P < 0.014). Interestingly, a promising pCR rate of 17.8% was achieved with dual anti-HER2 blockade in the absence of chemotherapy, further highlighting the potential of combining two anti-HER2 agents with different mechanisms of action [ The dual anti-HER2 combination of pertuzumab and trastuzumab has been evaluated without chemotherapy in the open-label, phase II BO17929 study conducted on HER2-positive metastatic breast cancer patients with prior trastuzumab failure, yielding extremely promising results. Complete response rates, ORR, and CBR were 7.6%, 24.2%, and 50%, respectively, and the median PFS was 5.5 months. The combination was well tolerated, and importantly, the incidence of cardiac dysfunction was minimal . The ratf action .T-DM1 is the first and only HER2-directed ADC in clinical development and combines the intracellular delivery of a microtubule-depolymerisation agent, DM1, a maytansine derivative, with the antitumour activity of trastuzumab. Upon binding to the HER2 receptor, T-DM1 is internalised and DM1 released intracellularly, enabling the selective delivery of the potent cytotoxic agent to HER2-overexpressing cells with limited systemic toxicity , 49. PreExcellent response rates of 40% to T-DM1 have been reported in an open-label, single-arm, phase II study conducted in patients with HER2-positive metastatic breast cancer, all of whom had progressed on trastuzumab-based therapy and 40% of whom had received prior lapatinib therapy. Severe toxicities including grade 4 thrombocytopenia and transaminitis were rare at 6% . The higversus 41%; T-DM1 versus TH, resp.), T-DM1 was much less toxic, with grade 3 and above toxicities approximately half that of TH (37.3% versus 75%) [NCT00829166). In addition, the role of T-DM1 delivered sequentially with anthracycline-based chemotherapy is being explored in the adjuvant/neoadjuvant setting in patients with HER2-positive early breast cancer (NCT01196052).Multiple clinical trials have been designed to compare the efficacy of single-agent T-DM1 with existing HER2-directed therapies combined with chemotherapy in patients with HER2-positive metastatic breast cancer. Preliminary results of a randomised phase II study (TDM4450g) of T-DM1 versus trastuzumab plus docetaxel (TH) in the first-line treatment of HER2-positive metastatic breast cancer patients were recently released. While response rates were comparable in the two arms (48% sus 75%) . The EMINCT01120184) is underway to evaluate T-DM1 alone and T-DM1 combined with pertuzumab versus the reference arm of trastuzumab plus taxane in previously untreated patients with HER2-positive metastatic breast cancer. Based on preclinical research demonstrating the synergistic antitumour activity of T-DM1 and pertuzumab in a trastuzumab-resistant breast cancer xenograft model , a phaseSince trastuzumab resistance may arise from cross-talk among other HER proteins resulting in lateral activation and incomplete inhibition of downstream signalling, one approach to overcoming trastuzumab resistance is the simultaneous inhibition of multiple HER receptors . SeveralNeratinib, a potent, low-molecular-weight, orally administered, irreversible pan-HER  receptor TKI, is one of the most advanced novel HER TKI in clinical development and offers more complete HER receptor blockade than lapatinib which inhibits only HER1 and HER2. An early preclinical study demonstrated that the compound inhibited cell proliferation of HER2-overexpressing breast cancer cell lines and xenografts through downregulation of the MAP kinase and PI3K/Akt pathways and induced cell cycle arrest .NCT00777101) and in combination with chemotherapy in a randomised phase II study  comparing neratinib and paclitaxel versus trastuzumab and paclitaxel in previously untreated metastatic disease. It is also being evaluated in early-stage disease both in the neoadjuvant and adjuvant settings (NCT01008150 and NCT00878709). Clinical studies have evaluated neratinib as a single agent or in combination with trastuzumab or chemotherapy. A recently published phase II, open-label study evaluated the efficacy and tolerability of neratinib monotherapy in two cohorts of patients with HER2-positive metastatic breast cancer: those with and those without prior trastuzumab treatment. The efficacy results of the two cohorts were a 16-week PFS (the primary endpoint) of 59% and 78%, respectively, and an ORR of 24% and 56%, respectively, while diarrhoea was a common but manageable toxicity . DespitePreliminary data from a phase I/II study of the combination of neratinib and trastuzumab in HER2-positive metastatic breast cancer patients with prior trastuzumab exposure demonstrated both tolerability and efficacy, with an ORR of 27%, 16-week PFS of 47%, and median PFS of 19 weeks . These dNCT01125566).While afatinib (BIBW-2992) targets the same receptors as lapatinib, it does so in an irreversible manner, resulting in more sustained inhibition of EGFR and HER2. It has demonstrated activity in trastuzumab-resistant HER2-overexpressing cell lines as well as promising clinical activity in phase I development . Its potNCT00650572) [NCT00710736).Two other orally active TKIs, ARRY-380 and ARRY-334543, are in the process of development by Array BioPharma. ARRY-380 is a reversible and selective HER2 TKI which has demonstrated significant dose-related tumour growth inhibition superior to that of trastuzumab and lapatinib in preclinical studies, as well as promising efficacy in an ongoing phase I expansion study in HER2-overexpressing solid tumours, including activity in p95HER2-overexpressing tumours (0650572) . ARRY-330650572) , is currHSP90 belongs to a family of chaperone proteins which facilitate the conformational maturation and folding of various signalling proteins, including HER2. In a preclinical study, interference with its function led to ubiquitylation and proteasomal degradation of HER2 and the resultant abrogation of the PI3K/Akt pathway, in turn causing growth inhibition of HER2-overexpressing tumours in murine xenograft models . A potenNCT01271920).  At least three HSP90 inhibitors have undergone clinical investigation in HER2-positive breast cancer, and to date, all have been evaluated in combination with trastuzumab. One promising compound is tanespimycin (17-AAG/KOS-953), which has demonstrated significant activity and tolerability in combination with trastuzumab in a phase II study conducted in advanced trastuzumab-refractory HER2-positive breast cancer, with an ORR of 24%, CBR of 59%, median PFS of 6 months, and median OS of 17 months . These dPTEN loss leads to the constitutive activation of Akt, which in turn activates mTOR in the PI3K/Akt signalling pathway. Two preclinical studies suggest the potential of this pathway as a therapeutic target; HER2-overexpressing breast cancer cell lines and xenograft models transfected with loss-of-function PTEN mutations and activating PIK3CA mutations resulted in trastuzumab and lapatinib resistance which was effectively reversed by the PI3K/mTOR inhibitor, NVP-BEZ235 , 69.NCT01283789).Everolimus is the most advanced mTOR inhibitor undergoing clinical investigation and is being developed in combination with existing HER2-directed therapies with or without chemotherapy. A recently published phase I/II study evaluated the chemotherapy-free combination of everolimus and trastuzumab in heavily pretreated HER2-positive metastatic breast cancer patients with prior trastuzumab exposure, which yielded an ORR of 15%, CBR of 34%, and median PFS of 4.1 months. The overall safety profile was acceptable, but did include a less than 10% incidence of grade 3 diarrhoea, fatigue, and stomatitis . The comNCT00876395, NCT01007942).The combination of everolimus with trastuzumab and weekly paclitaxel appeared highly active in heavily pre-treated HER2-positive metastatic breast cancer patients with prior trastuzumab and taxane exposure, yielding an ORR of 25%, stable disease (SD) rate of 56%, and acceptable toxicity profile in a multicentre phase II study . Two plaNCT01111825).Apart from everolimus, two other rapamycin analogues in the developmental pipeline in the treatment of HER2-positive breast cancers are deforolimus (AP23573) and temsirolimus (CCI-779). A phase II study of oral deforolimus in combination with trastuzumab has recently been completed in HER2-overexpressing metastatic breast cancer patients with prior trastuzumab exposure (NCT00736970). Compensatory increase in HER3 signalling with inhibition of the PI3K/Akt signalling pathway supports the novel approach of dual inhibition with an mTOR inhibitor and a pan-HER receptor TKI , and theNCT01132664), while BEZ235, a dual PI3K and mTOR inhibitor, is planned for evaluation as a single-agent in a phase II study (NCT01288092) [Novartis is currently conducting early-phase studies of two PI3K inhibitors that compete reversibly with the ATP-binding site of the PI3K p110 catalytic subunit. BKM120, a pan-class I PI3K inhibitor, is being assessed in combination with trastuzumab in a phase Ib/II study of HER2-overexpressing breast cancer patients with prior trastuzumab exposure (1288092) , 74.NCT00391092) and ECOG1105 (NCT00520975). The same strategy is also being evaluated in the adjuvant setting in the ongoing BETH study (NCT00625898) [The rationale for the simultaneous blockade of both HER2 and VEGF pathways is based on preclinical data demonstrating upregulation of angiogenesis in HER2-overexpressing breast tumours, and clinical data demonstrating that overexpression of both HER2 and VEGF was associated with a poorer prognosis in breast cancer patients in a large retrospective analysis . Followi0625898) .NCT00558103). A phase II open-label study assessed the safety and efficacy of adding pazopanib, an oral angiogenesis inhibitor targeting VEGFR, platelet-derived growth factor receptor and c-kit, to lapatinib in previously untreated HER2-positive metastatic breast cancer. Results showed lower 12-week progressive disease (19% versus 27%) and better response rates (44% versus 30%) with the combination compared to lapatinib alone, and whilst toxicities of diarrhoea and abnormal liver function tests were greater in the combination arm, they were still regarded as tolerable . This haPfizer) and small-molecule selective IGF-1R TKI, NVP-AEW541 (Novartis) have demonstrated antitumour activity against trastuzumab-resistant breast cancer tumour models [NCT0068493), whilst the combination of trastuzumab and BMS-754807, a small-molecule, reversible IGF-1R TKI, is undergoing evaluation in patients with prior trastuzumab failure in a phase I/II study (NCT00788333).Bidirectional cross-talk between the IGF-1R and HER2 signalling pathways is one mechanism of trastuzumab resistance, and the human anti-IGF-1R antibody, CP-751871  [NCT00452140). Continuing strategies to overcome trastuzumab resistance include the development of a class of agents known as trifunctional, bispecific antibodies. MM-111 is an antibody targeting both the HER2/HER3 heterodimer and the HER3 ligand, heregulin, and is currently being evaluated in combination with trastuzumab in HER2-overexpressing metastatic breast cancer patients with prior trastuzumab exposure (1097460) . A phaseNCT00301899) and NeoSphere [Rational combinations of novel anti-HER2 therapies are of particular interest not only because of their ability to overcome trastuzumab resistance through their concurrent blockade of multiple HER2 family members, but also for their potential to offer chemotherapy-free therapeutic options that are relatively less toxic. The combination of trastuzumab and lapatinib has recently been integrated into clinical practice . Most oteoSphere , which seoSphere . All theeoSphere . Lastly,eoSphere . Apart fWith the emergence of several novel HER2-directed agents, recent therapeutic advancements have been remarkable compared to the limited progress following the initial regulatory approval of trastuzumab more than a decade ago. Improved insights into the mechanisms of trastuzumab resistance have led to new treatment strategies employing dual anti-HER2 blockade, which have improved response rates and progression-free survival.While the substantial amount of research dedicated to the development of novel ant-HER2 agents is laudable, the vast array of treatment options in an ever-changing landscape of anti-HER2 therapy may raise more questions than answers. Clinicians will be continually challenged to design optimal combinations and sequences of anti-HER2 agents, chemotherapeutic agents, and even endocrine therapy for the individualised treatment of patients with HER2-positive breast cancer. These issues can rarely be fully addressed through the simplistic design of current therapeutic trials. At present, a physician treating an individual who has progressed on first-line trastuzumab-based therapy already faces the dilemma of whether the patient should receive further trastuzumab together with an alternative chemotherapeutic agent, continue trastuzumab in combination with lapatinib, or switch to lapatinib. The growing number of HER2-directed therapies in the pipeline will only add to the complexity of this decision-making process. In addition, a large proportion of HER2-positive patients relapsing with metastatic disease in the future will have received adjuvant trastuzumab or even lapatinib therapy, indicating that new treatment paradigms will be required for this group of patients.The extensive preclinical efforts in elucidating mechanisms of trastuzumab resistance should translate into individualised therapy through biomarker-driven approaches. However, this would first require the development of validated assays for the accurate measurement of resistance factors in archival tissue specimens, and to date, advancements in this arena have been slow . For exaTrastuzumab resistance poses a significant challenge in the treatment of HER2-positive breast cancer. Substantial research has been dedicated to elucidating mechanisms of trastuzumab resistance, as well as developing a myriad of novel anti-HER2 therapeutic agents with promising clinical activity. This has resulted in a major paradigm shift in the treatment of HER2-positive breast cancer and has given rise to a rapidly expanding range of therapeutic options in active clinical development. Future efforts should be directed towards biomarker-driven, HER2-directed therapies for optimal selection of therapy for the individual patient."}
+{"text": "Trastuzumab has recently been introduced as a treatment for HER2-positive metastatic and/or unresectable gastric cancer (MUGC); however, compared with breast cancer, some issues concerning HER2 and trastuzumab therapy for gastric cancer remain unclear. A 74-year-old woman received trastuzumab-containing chemotherapy for HER2-positive MUGC. She had a marked response to 8 months of chemotherapy, and gastrectomy and hepatic metastasectomy with curative intent were performed. The resected specimen showed complete loss of HER2 positivity in the residual tumor. For MUGC, a change in HER2 status during the course of the disease with or without chemotherapy has rarely been reported. However, in breast cancer, a significant frequency of change in HER2 status during the course of disease has been reported, and reevaluation of HER2 positivity in metastatic/recurrent sites is recommended. The choice of trastuzumab for MUGC is currently based on the HER2 status of the primary tumor at the time of initial diagnosis, without reassessment of HER2 status during the course of disease and/or in metastatic/recurrent sites, on the assumption that HER2 status is stable. However, our case casts doubt on the stability of HER2 in gastric cancer. The primary treatment for patients with metastatic and/or unresectable gastric cancer (MUGC) is systematic chemotherapy. Although the combination of 5-fluorouracil and cisplatin has been the standard regimen for the treatment of MUGC, new cytotoxic agents such as S-1, capecitabine, paclitaxel, docetaxel, oxaliplatin, irinotecan, and their combinations have proven to be more effective and better tolerated, resulting in the improvement of median survival up to 13 months .We report a case in which chemotherapy containing trastuzumab made it possible to perform curative gastrectomy in a patient with HER2-positive MUGC at initial diagnosis; this case is noteworthy in that HER2 positivity in resected specimens of the residual tumor was completely lost. Loss of HER2 positivity after treatment with trastuzumab for HER2-positive MUGC has rarely been reported. HER2 status is an essential biomarker for the effectiveness of trastuzumab, and consequently, knowledge of HER2 stability during the course of disease is critical for determining the introduction, the continued use, or elimination of trastuzumab. We discuss the stability of HER2 status in gastric cancer and provide a literature review of this important topic.A 74-year-old woman with the chief complaint of palpable masses in her abdomen presented to our hospital in May 2013. Physical examination revealed one 50-mm mass in the upper central abdomen and three 20\u201330-mm palpable masses in the other parts of her abdomen. Esophagogastroduodenoscopy (EGD) revealed an ulcerative mass with raised margins along the lesser curvature extending from the lower body of the stomach to the antrum . Biopsy 2/day) orally on days 1\u201314, cisplatin (80\u2009mg/m2) intravenously on day 1, and trastuzumab (8\u2009mg/kg loading dose followed by 6\u2009mg/kg) intravenously on day 1. From the 3rd course, the doses of capecitabine and cisplatin were reduced to 1500\u2009mg/m2/day and 60\u2009mg/m2, respectively, due to nonhematologic toxicity . After completion of the 4th course of chemotherapy, at 3 months after diagnosis, a 76% decrease in measureable tumor burden compared to baseline according to RECIST 1.1 criteria was observed. From the 6th course, cisplatin was discontinued due to renal impairment, but treatment with capecitabine and trastuzumab continued. After completion of the 11th course, at 8 months after diagnosis, EGD showed a marked reduction of the gastric tumor  according to the 7th TNM classification of the American Joint Committee on Cancer/Union for International Cancer Control (AJCC/UICC) staging system for gastric cancer. She was treated with 3-week courses of capecitabine (2000\u2009mg/mic tumor , and conic tumor  showed aic tumor . AscitesGiven this response to the treatment, complete resection of the residual tumor was deemed possible, and 9 months after the diagnosis, distal gastrectomy with D2 lymphadenectomy and hepatic metastasectomy of the small nodule in the lateral segment were performed. Operative findings showed no macroscopic peritoneal metastasis and the absence of peritoneal lavage cytology. Macroscopic complete resection was possible. Pathologic findings of the 36 \u00d7 25\u2009mm mass from the resected stomach revealed a moderately differentiated adenocarcinoma with subserosal invasion  and hyalApproximately 15\u201320% of invasive breast cancers have HER2 overexpression and/or gene amplification . HER2 haIn breast cancer, discordance in HER2 status between the primary tumor and the metastasis/recurrence and HER2 stability during the course of disease has been evaluated in several reports. The discordance rate of HER2 status in breast cancer has been reported to be 3\u201316% \u201313, withSeveral previous reports have evaluated how chemotherapy with or without anti-HER2 agents, including trastuzumab, influences HER2 expression. The discordance rate of HER2 status before and after NAC has been reported to be 0\u20139.5% \u201317. In HIn addition to studying the association between HER2 status and traditional chemotherapeutic agents, several reports have analyzed the association between change in HER2 status and trastuzumab therapy. A loss of HER2 positivity in patients treated with trastuzumab therapy has been reported in 14.7\u201337% of HER2-positive breast cancers \u201321. NakaHER2 overexpression and/or amplification occurs in 7\u201334% of gastric cancer cases , 23. In When analyzing loss of HER2 in a sample obtained after treatment, we must consider the possibility of a false-negative result for HER2 expression on immunohistochemistry. A sample taken by biopsy is only part of a tumor, and a resected sample might be one of many tumors within the body; therefore, loss of HER2 might be a false-negative due to heterogeneity within the tumor or discordance between the sites of tumors. In fact, it is known that the heterogeneity of HER2 expression within gastric tumors is much more frequent than in breast cancer , 23. TheCurrent practice guideline for the treatment of breast cancer recommended that biomarkers, including HER2 status and hormone receptors, should be evaluated not only for the primary tumor but also for the initial metastatic or recurrence tumor tissues, especially if the first determination of HER2 status is negative, in order not to lose the chance of anti-HER2 therapy . CurrentAlthough the use of trastuzumab has been shown to be highly effective in treating HER2-positive MUCG, several issues regarding HER2 stability and trastuzumab therapy for gastric cancer remain to be elucidated. First, clinicians need to know how often HER2 status converts with tumor progression, metastasis, or treatment. If a change in HER2 status is found to be significantly frequent in gastric cancer, management strategy recommendations similar to those of breast cancer should be introduced for gastric cancer, although it will be important to consider that biopsy from metastases/recurrence or metastasectomy is invasive and burdensome for patients. If the factors that contribute to HER2 change are identified, only those patients who have such factors, rather than all patients with MUGC, would need to submit to biopsy from metastases/recurrence or metastasectomy. Second, clinicians need to evaluate whether loss of HER2 positivity in specimens obtained during the disease course in HER2-positive gastric cancer always indicates resistance to trastuzumab. As we have mentioned, HER2 status taken from samples may not always represent all tumors in the body. In the present case, although macroscopic complete resection was possible, there was still a sufficient possibility of remaining micrometastases. We decided to treat the patient with adjuvant therapy comprised of capecitabine and trastuzumab after the patient gave her informed consent. Therapy comprised of capecitabine and trastuzumab was chosen because her tumors were not resistant to these medications until resection, and trastuzumab has a significant benefit in tumor cell eradication in the event that the remaining micrometastases retain HER2-positivity. Third, clinicians need to know if the loss of HER2 positivity has a significant prognostic impact on MUGC, because some studies have shown that loss of HER2 positivity in HER2-positive breast cancer was associated with a significantly worse prognosis compared to patients with tumors that maintained HER2 expression , 20, 21.Even if a marked response to chemotherapy allows the possibility of curative resection in MUGC, currently, the consistent standard treatment is to continue chemotherapy. However, the survival rate in MUGC treated by chemotherapy alone is obviously insufficient. Surgical resection with curative intent after a response to chemotherapy for MUGC is called adjuvant or salvage surgery. The benefit of such surgery was recently evaluated, and a favorable prognosis was suggested, with a 3-year survival rate of 46\u201355% and a median survival of 29\u201343 months \u201332, althIn conclusion, we report the case of a patient with HER2-positive MUGC at initial diagnosis who received chemotherapy including trastuzumab; following chemotherapy and surgery in this patient, a resected specimen of the stomach showed loss of HER2-positivity in the residual tumor, suggesting that HER2 status is not always stable. Treatment with trastuzumab is very effective and less toxic than traditional cytotoxic drugs. If HER2 positivity is gained during the course of disease, it is an easy judgment for clinicians to add trastuzumab to chemotherapy, thus allowing patients to benefit from trastuzumab therapy. However, when cases convert from positive HER2 status to negative HER2 status, clinicians remain uncertain as to whether the change in status is truly due to a biologic change rather than a false-negative result. Therefore, it is a more difficult and less confident judgment to remove trastuzumab from chemotherapy, even though its removal may result in avoiding unnecessary treatment. Further studies concerning HER2 status in gastric cancer are needed in order to appropriately use trastuzumab for these patients."}
+{"text": "Breast cancers over-express the human epidermal growth factor receptor 2 (HER2) in about 15% of patients. This transmembrane tyrosine kinase receptor activates downstream signaling pathways and leads to proliferation of cancer cells. Trastuzumab, an anti-HER2 monoclonal antibody, improves outcome in women with early and metastatic breast cancer. Resistance to trastuzumab involves the phosphoinositide 3-kinase/mammalian target of rapamycin (PI3K/mTOR) pathway, truncation of the Her2 receptor or lack of immune response. The last decade has seen major advances in strategies to overcome resistance to trastuzumab. This includes the development of antibody-drug conjugates, dual HER2 inhibition strategies, inhibition of PI3K/mTOR pathway and development of modulators of immune checkpoints. About 15% of breast cancer over-expresses the human epidermal growth factor receptor 2 (HER2) . Over-exTrastuzumab is a humanized recombinant monoclonal antibody that targets the HER2 extracellular domain. The use of trastuzumab is considered as standard of care both in early and metastatic HER2 over-expressing breast cancer. Numerous clinical trials have confirmed that trastuzumab improves overall survival (OS) in metastatic breast cancers \u201313. In evia the PI3K and MAPK pathways, and activation of the immune response via antibody dependent cell-mediated cytotoxicity (ADCC) and eventually adaptive immune response [Its antitumor activity is hypothesized to be related to two different mechanisms of action: downregulation of the intracellular signaling pathway response \u201322.Unfortunately, resistances to trastuzumab occur, mainly in the metastatic setting, where most of the patients treated with trastuzumab have a disease progression within one year . MoleculIn the present review, we will present clinical data on the main strategies that aimed at overcoming trastuzumab resistance. The targets and drug family under investigation are reported in Figure\u00a0Lapatinib is a small molecule, dual tyrosine kinase inhibitor (TKI) of EGFR and HER2. It inhibits the intracellular kinase domain of HER2 contrary to trastuzumab that inhibits the extracellular domain and blocks ligand-induced heterodimer signaling. It could prevent signaling related to truncated HER2 receptor or enhance trastuzumab-dependant ADCC, thanks to an accumulation of HER2 at the cell surface.P <0.001). In the same trial, the median overall survival times were 75\u00a0weeks for the combination arm and 64.7\u00a0weeks for the capecitabine arm  [P\u2009=\u20090.0124) [It has shown its efficacy when combined with capecitabine, in terms of time to progression (hazard ratio (HR): 0.57; 95% confidence interval (CI) 0.43 to 0.77; =\u20090.210) \u201338. Lapa\u20090.0124) .P\u2009=\u20090.011) and OS  [The efficacy of dual HER2 blockade with trastuzumab and lapatinib was investigated in the phase III study EGF104900. Patients with HER2-positive metastatic breast cancer (MBC) who progressed during trastuzumab treatment were randomly assigned to receive lapatinib in monotherapy or lapatinib in combination with trastuzumab. The combination was associated with better outcome both in progression free survival (PFS)  .P\u2009=\u20090.98). The dual HER2 blockade was associated with a higher pCR  as compared to single-agent HER2 therapy but the difference was not statistically significant (P\u2009=\u20090.095) [Following the results of these randomized trials in the metastatic setting, the efficacy of lapatinib has been investigated in early breast cancer, mainly in the context of trials testing dual inhibition of HER2. In the phase III trial of NSABP (protocol B-41), 529 patients were randomized to receive weekly paclitaxel with either trastuzumab weekly, lapatinib daily or the association trastuzumab plus lapatinib before undergoing surgery. Lapatinib alone had a similar percentage of pCR as trastuzumab . There was no significant difference in pCR between the lapatinib and the trastuzumab group [In another randomized trial performed in the neo-adjuvant setting (Neo ALTTO), patients were randomized among lapatinib, trastuzumab or lapatinib plus trastuzumab, all in combination with paclitaxel after six weeks of targeted therapy alone. The pCR rate was significantly higher in the group treated with dual inhibition (51.3%) as compared to trastuzumab alone (29.5%) . Nevertheless, this lack of benefit could be related to the low number of events.First results from the phase III ALLTO trial comparing one year of lapatinib alone, trastuzumab alone, their sequence or their combination in an adjuvant setting in 8,381 HER2 positive breast cancers have been reported . AccordiNeratinib is an oral irreversible pan-HER inhibitor. Preclinical data on breast cancer cell lines suggest that it could overcome both primary and acquired trastuzumab resistance in HER2 positive breast cancer cell lines .Neratinib has shown antitumor activity among both pretreated and trastuzumab naive patients. In a phase II trial, the median PFS observed with neratinib was 22.3\u00a0weeks among patients with prior trastuzumab treatment and 39.6\u00a0weeks with trastuzumab naive patients. Objective response rates were 24% and 56%, respectively .P\u2009=\u20090.231 and P\u2009=\u20090.280, respectively) [Neratinib single agent has been compared with the association of lapatinib plus capecitabine. Both median PFS (4.5\u00a0months) and OS (19.7\u00a0months) for neratinib single agent were found to be numerically inferior to that of the combination therapy, although not statistically significant  .Neratinib is currently developed in combination with paclitaxel, vinorelbine, capecitabine and temsirolimus \u201349. The The most common adverse event of this treatment is diarrhea in more than 90% of the cases, and then neutropenia (50% of the cases) ,48.The vascular endothelial growth factor (VEGF) plays a key role in progression of this cancer by promoting tumor angiogenesis . BevacizP\u2009=\u20090.0162). The median PFS was 16.8\u00a0months in the bevacizumab arm versus 13.9\u00a0months [In the AVEREL study, the efficacy of bevacizumab was evaluated in first line therapy for locally recurrent or metastatic HER2 positive breast cancer. In this phase III study, the HR for progression was 0.72 . In this trial, patients were randomly assigned to receive chemotherapy, trastuzumab plus bevacizumab, or chemotherapy and trastuzumab alone. No difference of efficacy was observed between the two arms  .Other antiangiogenic agents that can target VEGFR, such as multitargeted anti-angiogenic TKIs  have shown promising results .Resistance to trastuzumab can be explained by signaling through other HER dimerization . Pertuzuet al. have evaluated whether adding pertuzumab to trastuzumab could reverse trastuzumab resistance. The objective response rate and clinical benefit rate (CBR) were 3.4% and 10.3% in patients who received pertuzumab monotherapy after trastuzumab. At the opposite end, objective response rates and CBR were 17.6% and 41.2% in patients who received the combination after progression on trastuzumab [Cortes stuzumab .Based on these data, the efficacy of adding pertuzumab to trastuzumab has been investigated.P <0.001). The pertuzumab arm was also associated with an OS improvement. The median OS in the placebo group was 37.6\u00a0months (95% CI 34.3 to NE (not estimable)) and had been not reached in the pertuzumab group (95% CI 42.4 to NE)  [In the CLEOPATRA study, patients were randomized between placebo plus trastuzumab plus docetaxel or pertuzumab plus trastuzumab plus docetaxel. The median PFS was 12.4\u00a0months in the placebo group versus 18.7\u00a0months in the pertuzumab group  .The combination of chemotherapy with trastuzumab and pertuzumab has also shown interesting results in the neo-adjuvant setting.P\u2009=\u20090.0141). Interestingly, pertuzumab and trastuzumab without chemotherapy was associated with a 16.8% pCR [The NeoSphere study (multicenter phase II study) evaluated the efficacy of dual inhibition using pertuzumab. Patients who received pertuzumab and trastuzumab plus docetaxel had a significantly higher pCR rate  compared to patients treated with trastuzumab and docetaxel  then three cycles of docetaxel, or three FEC then three docetaxel with the combination of trastuzumab and pertuzumab or docetaxel plus carboplatin plus the combination during six cycles. The primary endpoint was to assess the cardiac safety. The pCR rates were quite similar in the three arms  .In the early stage of breast cancer, the efficacy of pertuzumab is currently being investigated in the adjuvant setting .Trastuzumab emtansine (T-DM1) is an antibody-drug conjugate and is composed of trastuzumab covalently linked to maytansine, a cytotoxic agent .P <0.001). The median OS at the second interim analysis was 30.9\u00a0months in the T-DM1 arm versus 25.1\u00a0months in the lapatinib arm  [The EMILIA study, a phase III registration trial compared T-DM1 to lapatinib and capecitabine in patients with HER2 positive advanced breast cancer previously treated with trastuzumab and a taxane. The median PFS was 9.6\u00a0months with T-DM1 versus 6.4\u00a0months with lapatinib plus capecitabine  .P <0.0001). Final overall survival analysis is still awaited but interim analysis showed a trend favoring T-DM1 with a lower incidence of grade 3 or worse adverse events [The phase III TH3RESA trial compared third line treatment (including trastuzumab and lapatinib) of metastatic or unresectable locally advanced or recurrent HER2 positive breast cancer with T-DM1 to the treatment of the physician\u2019s choice. T-DM1 treatment significantly improved PFS compared with physician\u2019s choice , compares single-agent T-DM1 to T-DM1 combined with pertuzumab to trastuzumab plus a taxane in first line treatment of metastatic breast cancer.These studies will provide more information about the indications of T-DM1 in the treatment algorithms for HER2-positive disease.The mammalian target of rapamycin (mTOR) is a serine-threonine protein kinase that mediates mRNA translation and protein synthesis. Activation of this pathway is known as a mechanism of trastuzumab resistance ,64. PrecIn a phase I/II study, patients with HER2-positive metastatic breast cancer received trastuzumab combined with everolimus, after resistance to trastuzumab. Fifteen percent of patients had a partial response and 19% had a long stable disease (\u22656\u00a0months). The clinical benefit rate was 34% .A phase II study evaluated the efficacy of everolimus combined with trastuzumab and paclitaxel in patients who were resistant to trastuzumab and taxane therapy. The median PFS was 5.5\u00a0months and the median OS was 18.1\u00a0months . This coP\u2009=\u20090.0067). In this study, several biomarkers  were analyzed to find some subpopulation for whom the benefit of everolimus was higher. Patients with a low PTEN and high pS6 level seemed to derive more benefit from addition of everolimus. Median PFS gain was 12\u00a0weeks for the high pS6 level subgroup  and 18\u00a0weeks for the low PTEN subgroup . Unfortunately, there was no marker-treatment interaction with PIK3CA mutation. These promising results deserve additional research.The BOLERO-3 study compared the combination of everolimus, trastuzumab plus vinorelbine to trastuzumab and vinorelbine. The association of the mTOR inhibitor with vinorelbine significantly improved PFS  is a chaperone which stabilizes oncogenic proteins. Inhibition of HSP90 leads to the degradation of these proteins involved in cancer biology . HSP90 i17-Demethoxygeldanamycin (17-AAG) inhibits the activity of HSP90, thereby inducing the degradation of many oncogenic proteins. In a phase II study, 17-AAG (tanespimycin) was given in combination with trastuzumab in patients who previously failed to trastuzumab. The overall response rate (ORR) was 22%, the CBR was 59%, the median PFS was six months and the median OS was seventeen months .In another phase II study, retaspimycin (IPI-504) given with trastuzumab showed modest clinical activity, but it is possible that under-dosing limited efficacy . Other sThese findings are promising and other studies are expected to develop these new targeted therapies.Programmed death 1 (PD-1) is a co-inhibitory receptor and acts as a negative regulator of the immune system. It is overexpressed on tumor-infiltrating lymphocytes (TIL). The PD-1 ligand, PD-L1, is expressed by multiple carcinoma, including breast cancers. This suggests that the PD-1/PD-L1 signaling pathway could be a candidate target in breast and other cancers.T cell infiltration is predictive for the efficacy of trastuzumab \u201376. BiomPreclinical studies have shown a synergism between trastuzumab and anti-PD1 antibodies .Other monoclonal antibody (mAb)-based therapies are being investigated including anti CD73. Pre-clinical data have suggested that it can delay tumor growth and inhibit the development of metastases .de novo resistance is a serious concern. The understanding of resistance mechanisms could allow developing strategies to prevent or overcome this resistance. The development of novel targeted therapies has changed the practices in metastatic settings.Although trastuzumab remains the standard treatment in patients with HER2 overexpressing breast cancer in neoadjuvant, adjuvant and metastatic settings, the presence of acquired and New standards of care include trastuzumab plus pertuzumab plus docetaxel in first line treatment and TDM-1 for trastuzumab-resistant patients. In early breast cancer, dual HER2 blockade has shown promising results in the neoadjuvant setting. This strategy is being evaluated in the adjuvant setting in several randomized trials.Since several different targets are under investigation, there is a need to identify predictive biomarkers to optimize combination strategies for suitable patients. Loss of PTEN and a high level of pS6 could facilitate the selection of appropriate patients who can benefit from personalized targeted therapy."}
+{"text": "Breast cancer is the most common cancer in US women, affecting approximately 1 in 8 women over the course of alifetime. Nearly 40,000 women die of breast cancer every year . In the past decade,we have come to understand that breast cancer is a heterogeneous disease, comprising subtypes that are defined bygene expression profiling . Treatment choices such as chemotherapy, endocrine therapy, andtherapies targeted toward specific genetic alterations have resulted in improved survival.Approximately 25% of all breast cancers are classified as HER2 positive, in which there is overexpression of the HER2protein (as measured by immunohistochemistry) and/or amplification of the HER2 gene (determined by fluorescence insitu hybridization). HER2 activation triggers an intracellular signaling cascade, which results in cell proliferation, survival,invasion, and angiogenesis. HER2-positive breast cancers have an aggressive phenotype. However, with the advent ofHER2-targeted therapy, the natural history of HER2-positive breast cancer has been dramatically improved .Trastuzumab (Herceptin) is a monoclonal antibody that targets the HER2 receptor tyrosine kinase. In a study of 469patients with meta-static breast cancer randomized to receive standard chemotherapy vs. chemotherapy plustrastuzumab, the group receiving trastuzumab demonstrated response rates of 50% vs. 32% and median survival timesof 25.1 vs. 20.3 months, respectively . Trastuzumab was approved by the US Food and DrugAdministration (FDA) for use in patients with metastatic breast cancer in 1998. It was subsequently evaluated in thenonmetastatic setting and showed striking benefits in relapse-free survival and overall survival (OS), leading to itsapproved use in patients with early-stage HER2-positive breast cancer in 2006 .Despite the benefits of adjuvant trastuzumab for HER2-positive breast cancer, recurrences do occur. For thesepatients, resistance to trastuzumab ultimately develops, and they eventually succumb to their disease. Therefore, therewas a need to develop other drugs for patients who develop trastuzumab resistance.Lapatinib (Tykerb) was the second HER2-directed agent approved by the FDA for use in metastatic breast cancer. It isa small-molecule tyrosine kinase inhibitor that targets the intracellular portion of the HER2 receptor. Its approval waslargely based on a study of patients with advanced breast cancer whose disease had progressed on an anthracycline, ataxane, and trastuzumab; patients were randomized to receive either capecitabine or capecitabine with lapatinib. Theaddition of lapatinib improved median time to progression from 4.4 to 8.4 months, and the combination was approvedby the FDA in March 2007 . Since that time, studies evaluating the use of trastuzumab with varyingchemotherapeutic agents have been performed, and it has been incorporated into widespread use . The use of lapatinib in combination with endocrine therapy has also been evaluated and is approved for use inmetastatic HER2-positive breast cancer.In June 2012, pertuzumab (Perjeta), a new monoclonal antibody that binds and blocks the action of the HER2receptor in a manner complementary to that of trastuzumab, was approved for use in first-line metastatic HER2-positive breast cancer in combination with taxane chemotherapy and trastuzumab. This approval was based on ademonstrable benefit in progression-free survival  when pertuzumab was added to docetaxeland trastuzumab .The newest agent in the armamentarium against HER2-positive breast cancer is ado-trastuzumab emtansine(Kadcyla), also known as T-DM1, which earned FDA approval in February 2013 for metastatic HER2-positive breastcancer that has progressed on a trastuzumab-containing regimen . See the Table on the next page fora summary of key information.Ado-trastuzumab emtansine is described as an antibody drug conjugate (ADC). It contains trastuzumab attached toa chemotherapy molecule (DM1) by a stable linker molecule. Trastuzumab is a humanized, anti-HER2 IgG1 antibody.The DM1 chemotherapy molecule is a maytansine derivative that was studied in the 1970s at the National CancerInstitute. Development was halted at that time due to unacceptable toxicity in human trials. However, in ado-trastuzumab emtansine, a thioether linker (MCC) stabilizes the compound so that the DM1 chemotherapy molecule istargeted to the HER2+ cancer cell. The chemotherapy is internalized and released into that cell only after it is attachedto the HER2+ cell. Therefore, the cancer cells are destroyed, and surrounding normal tissue is spared the toxicity of thechemotherapy.Ado-trastuzumab emtansine demonstrates mechanisms of action of both trastuzumab and DM1. In vitro, similar totrastuzumab, it inhibits HER2 receptor signaling and enhances antibody-dependent cell-mediated cytotoxicity. Ado-trastuzumab emtansine, like trastuzumab, inhibits shedding of the HER2 extracellular domain, which is a knownmechanism of resistance to trastuzumab. The DM1 chemotherapy molecule, upon internalization and release into thecancer cell, inhibits microtubule function, thereby interfering with progression through the cell cycle .A phase I, multicenter, open-label, dose-escalation study of single-agent ado-trastuzumab emtansine was initiatedto assess its safety, tolerability, and pharmacokinetics in patients with HER2-positive metastatic breast cancer who hadpreviously received trastuzumab .Twenty-four patients were treated at doses ranging from 0.3 to 4.8 mg/kg. In this study, 3.6 mg/kg was identified asthe maximum tolerated dose (MTD). The dose-limiting toxicity was thrombocytopenia, yet it was usually mild (grade 1or 2) and rapidly reversible upon discontinuation of therapy. Platelet count usually dropped starting 1 day after ado-trastuzumab emtansine administration, with a nadir around day 8 and recovery by day 15. There were no bleedingevents that required transfusion or any other intervention.Overall, the most commonly reported adverse events (AEs) were thrombocytopenia (54.2%), elevatedtransaminases (41.7%), fatigue (37.5%), anemia (29.2%), and nausea (25.0%). No patients experienced grade > 1nausea, vomiting, alopecia, or neuropathy. The overall response rate (ORR) was 44% in the 9 patients with measurabledisease treated at the MTD. The clinical benefit rate (CBR) was 73% (ORR + stable disease) among the 15 patientstreated at the MTD. The median duration of treatment was 238 days for these 15 patients.Based on the favorable phase I safety and efficacy profile, the clinical development of ado-trastuzumab emtansinecontinued. A phase II, open-label, single-arm study of ado-trastuzumab emtansine (TDM4374g) included 110 patientswho had previously been treated with trastuzumab, lapatinib, an anthracycline, a taxane, and capecitabine. Theprimary objectives were ORR and safety. On average, patients had been treated for metastatic breast cancer with sevenprior agents. The ORR was 34.5% and the CBR was 48.2%. The median PFS was 6.9 months in this heavily pretreatedgroup of patients . In another phase II, open-label, single-arm study of ado-trastuzumab emtansine(TDM4258g) that included 112 patients, ORR was 26% and median PFS was 4.6 months .2 twice daily for 14 of every 21 days. The primary endpointswere PFS and OS. A total of 88% of the patients had received prior systemic treatment in the metastatic setting; 12% ofthe patients had prior treatment only in the neoadjuvant or adjuvant setting with disease relapse within 6 months.Patients received a median of three systemic agents for metastatic disease.The EMILIA study was a phase III, randomized, multicenter, open-label trial of ado-trastuzumab emtansine vs.capecitabine plus lapatinib in 991 women with metastatic HER2-positive breast cancer who progressed on or within 6months of having received trastuzumab and who had received taxane chemotherapy . Patients wererandomly allocated (1:1) to receive ado-trastuzumab emtansine 3.6 mg/kg once every 21 days or oral lapatinib 1,250mg/day once daily plus oral capecitabine 1,000 mg/mMedian PFS was 9.6 months in the ado-trastuzumab emtansine group vs. 6.4 months in the lapatinib pluscapecitabine group. The hazard ratio for PFS was 0.65 with ado-trastuzumab emtansine vs. capecitabine plus lapatinib.Median duration of survival was 30.9 months in the ado-trastuzumab emtansine group vs. 25.1 months in the lapatinibplus capecitabine group .2 (HT) at the investigator\u2019s discretion, once every 3 weeks. The primary endpoint was PFSand safety. Secondary endpoints included OS, ORR, duration of response (DOR), CBR, and quality of life (QOL). Of note,only 27.1% and 17.9% of patients in the ado-trastuzumab emtansine and HT groups, respectively, had received priortrastuzumab in the adjuvant or neoadjuvant setting. The ado-trastuzumab emtansine group demonstrated a medianPFS of 14.2 months compared with 9.2 months in the HT group. The hazard ratio for PFS was 0.59 with ado-trastuzumab emtansine vs. HT. The ORR and CBR in the ado-trastuzumab emtansine group was 64.2% vs. 58% in the HTgroup .More recently, results from TDM4450g, a phase II, multicenter, open-label study of ado-trastuzumab emtansine inthe first-line setting, were published. This was the first trial to directly compare ado-trastuzumab emtansine with astandard trastuzumab plus chemotherapy regimen in patients who had not received treatment for metastatic disease.In this trial, 137 patients with advanced HER2-positive breast cancer were randomized in a 1:1 ratio to receive ado-trastuzumab emtansine 3.6 mg/kg IV once every 3 weeks vs. trastuzumab 8 mg/kg loading dose then 6 mg/kg IV anddocetaxel 75 or 100 mg/mIn the single-arm, phase II study TDM4374g, fatigue (61.8%), nausea (37.3%), and thrombocytopenia (38.2%) wereamong the most common adverse events (AEs) seen. Thrombocytopenia (9.1%), fatigue (4.5%), and cellulitis (3.6%)were the most common grade 3 adverse events. In TDM4258g, the other single-arm phase II study, the most frequentgrade 3 AEs were hypokalemia (8.9%), thrombocytopenia (8.0%), and fatigue .In the EMILIA study, grade 3 adverse events were more common with capecitabine plus lapatinib vs. ado-trastuzumab emtansine (57% vs. 40.8%). The most commonly reported grade 3 AEs in the capecitabine plus lapatinibgroup were diarrhea (20.7%) and palmar-plantar erythrodysesthesia (16.4%). Thrombocytopenia and elevated serumconcentrations of aspartate transaminase (AST) and alanine transaminase (ALT) were the most commonly reportedgrade 3 adverse events in the ado-trastuzumab emtansine group, affecting 12.9%, 4.3%, and 2.9% of patients,respectively.While thrombocytopenia is a common side effect of ado-trastuzumab emtansine, it led to discontinuation oftherapy in only 2% of patients in the EMILIA study. Thrombocytopenia was usually seen in the first two cycles oftherapy, responded to dose reductions, and was rarely associated with significant bleeding. The rate of grade 3 or 4bleeding events was low overall in the ado-trastuzumab emtansine group .In the phase II TDM4450g trial, treatment with ado-trastuzumab emtansine also resulted in fewer grade \u2265 3 adverseevents than with the comparator\u2014in that case, HT (AEs: 46.4% vs. 90.9%). Grade 4 AEs occurred in 57.6% of patientsreceiving HT vs. 5.8% in patients receiving ado-trastuzumab emtansine. A total of 40.9% of patients in the HT groupexperienced AEs leading to treatment discontinuation (of either drug) vs. 7.2% in the ado-trastuzumab emtansinegroup. In the HT group, the most common AEs of any grade were alopecia, neutropenia, diarrhea, and fatigue. The mostcommon AEs in the ado-trastuzumab emtansine group were fatigue, nausea, increase in serum AST, fever, andheadache. A notable difference in side-effect profile between ado-trastuzumab emtansine and taxane-basedchemotherapy with trastuzumab is the lack of alopecia seen with ado-trastuzumab emtansine. Consistent with the AEprofile of both study arms, QOL assessments in this study favored ado-trastuzumab emtansine over HT .Studies of therapy with ado-trastuzumab emtansine took special note of cardiac events due to the known potentialfor trastuzumab-associated cardiotoxicity. With trastuzumab, this cardiotoxicity, manifest by decreases in leftventricular ejection fraction (LVEF), is usually asymptomatic and readily reversible. Additionally, trastuzumab-associatedcardiotoxicity is worsened in patients receiving concurrent or prior anthracycline therapy .In a single-arm phase II study (TDM4374g), at a median follow-up of 17.4 months, no left ventricular ejectionfraction decline to \u2264 45% or symptomatic congestive heart failure was observed, and no patients discontinuedtreatment because of cardiotoxicity. Similarly, in TDM4258g, there was no dose-limiting cardiotoxicity observed . In the randomized TDM4450g trial, there were no clinically significant cardiac events in either group. At amedian follow-up of 23 months, 3 patients\u20141 in the ado-trastuzumab emtansine group and 2 in the HT group\u2014had anasymptomatic decline in LVEF to \u2264 40% .Primarily because it contains trastuzumab, the FDA-approved prescribing information recommends that all patientstreated with ado-trastuzumab emtansine have a baseline LVEF assessment at baseline and at regular intervals  during treatment . At least temporary discontinuation of therapy is recommended ifthe LVEF falls to < 40% or is 40% to 45% with a 10% absolute decrease below the pretreatment value. In this case, LVEFshould be rechecked 3 weeks later. If it has not improved or worsened, then permanent discontinuation isrecommended. However, if there is improvement, it is acceptable to restart ado-trastuzumab emtansine with closecardiac monitoring.In a phase III study of patients with HER2-positive metastatic breast cancer previously treated with trastuzumab,ado-trastuzumab emtansine resulted in a 35% reduction in the risk of progressive disease compared with standardtreatment . In the phase II trial of ado-trastuzumab emtansine used in the first-line setting, therewas a 41% reduction in risk of progressive disease compared with a standard therapy . Remarkably,these improvements in efficacy came with a decrease in toxicity vs. the comparator arm.Ado-trastuzumab emtansine is an effective, tolerable, IV, \"smart\" therapy, now approved for use in patients withHER2-positive breast cancer who have progressed on or within 6 months of a trastuzumab-containing treatmentregimen. Ongoing studies are evaluating its use as first-line therapy for metastatic disease, in combination with otherHER2-directed therapies and in the neoadjuvant setting. The use of ado-trastuzumab emtansine may be expanded ifthese trials demonstrate safety and efficacy in these studies. Therefore, the use of ado-trastuzumab emtansine isexpected to increase dramatically. In light of this, it is essential for the oncology advanced practitioner to understand itsmechanism of action, efficacy, and adverse event profile."}
+{"text": "The improvement in cancer therapy and the increasing number of long term survivors unearth the issue of cardiovascular side effects of anticancer treatments. As a paradox in cancer survivors, delayed cardiotoxicity has emerged as a significant problem. Two categories of cardiotoxic side effects of antineoplastic drugs have been previously proposed: Type I cardiotoxicity, defined as permanent cardiotoxicity, is usually caused by anthracyclines; Type II cardiotoxicity, considered as reversible cardiotoxicity, has been mainly related to monoclonal antibodies. The cardiotoxicity of antibodies has been associated to trastuzumab, a humanized anti-ErbB2 monoclonal antibody currently in clinical use for the therapy of breast carcinomas, which induces cardiac dysfunction when used in monotherapy, or in combination with anthracyclines. Furthermore, recent retrospective studies have shown an increased incidence of heart failure and/or cardiomyopathy in patients treated with trastuzumab, that can persist many years after the conclusion of the therapy, thus suggesting that the side toxic effects are not always reversible as it was initially proposed. On the other hand, early detection and prompt therapy of anthracycline associated cardiotoxicity can lead to substantial recovery of cardiac function. On the basis of these observations, we propose to find a new different classification for cardiotoxic side effects of drugs used in cancer therapy. BCbreast carcinomasCHFcongestive heart failureLVEFleft ventricular ejection fractionHFheart failureCMcardiomyopathyLVESVleft ventricular end systolic volumeLVEDDleft ventricular end diastolic dimension; RS, radial strainIt has been estimated that in January 2014 in USA about 14,5\u00a0million people with a history of cancer were still alive,The improvement in cancer therapy and the increasing number of long-term survivors, unearth the relevant issue of cardiovascular side effects of anticancer treatment. Type I cardiotoxicity, defined as permanent cardiotoxicity, is usually caused by anthracyclines. Type II cardiotoxicity, considered as reversible cardiotoxicity, has been mainly related to monoclonal antibodies or tyrosine kinase inhibitors.The mechanism underlying anthracycline cardiotoxicity is well described in literature and includes cell damage due to radical free formation and oxidative stress.The cardiotoxicity of anti-ErbB2 antibodies has been associated to trastuzumab, a humanized anti-ErbB2 monoclonal antibody, currently in clinical use for the therapy of BC.However, cardiac toxicity was recognized as an important side effect at an early stage in the development of Trastuzumab, manifested as symptomatic CHF or asymptomatic LVEF decline,Large-scale clinical studies with Trastuzumab, have shown that up to 7% or 28% of patients suffer from cardiac dysfunction when Trastuzumab is used in monotherapy, or in combination with anthracyclines, respectively.Recently independent studies have shown an increased incidence of HF and/or CM in patients treated with trastuzumab in monotherapy (up to 30%) or in combination with anthracyclines (up to 40%), particularly in elderly breast cancer patients with a history of other diseases.In these studies an interesting aspect has been evidenced: the trastuzumab related cardiotoxic side effects progressively increased during 3\u20135\u00a0years after the end of treatment with trastuzumab, thus suggesting that the cardiotoxicity onset could occur even post treatment and the patients were not appropriately subjected to follow up inspections.In agreement with these observations, ICARO Network showed an increased trastuzumab-related cardiotoxicity (up to 38%) in elder patients (age > 60\u00a0years) according with data previously described.Cardiotoxicity induced by Trastuzumab had long been considered reversible as it has been supposed that the withdrawal of the antibody allows for the return of function of the ErbB2 cardiomyocyte survival pathway and reversal of EF decline, in contrast to the permanent myocyte dysfunction induced by anthracyclines.The mechanism of cardiotoxic effects of trastuzumab is not completely clarified, but it has been attributed to blockade of HER-2 signaling in cardiac myocytes as trastuzumab interferes with ErbB2/ErbB4 heterodimerization induced by Neuregulin1in vitro and in vivo studies in human cardiac cell cultures and in mice, respectively, clearly indicate that Trastuzumab induces apoptosis of cardiomyocytes thus leading to irreversible cell death.However recent retrospective studies suggest that the cardiotoxic side effects of Trastuzumab should be carefully reconsidered as they can persist many years after the conclusion of the therapy, thus strongly suggesting that they are not always reversible as it was initially proposed.Several studies report on risk prediction model based on echocardiography imaging analyses in patients treated with anthracyclines or trastuzumab,Chen J et\u00a0al. observed, in a cohort of 45537 women with early stage breast cancer, that the cumulative incidence of HF or CM was higher for patients treated over three years with trastuzumab alone (32.1%) and trastuzumab with anthracyclines (A+T) (41.9%) compared with patients who received no adjuvant therapy (18.1%). In secondary analyses carried out by evaluating HF and CM separately, the combined treatment of anthracyclines and trastuzumab was associated with HF alone and CM alone compared with no adjuvant therapy in their models. Trastuzumab in the absence of anthracycline therapy was borderline significantly associated with HF alone, but was clearly associated with CM alone compared with no adjuvant therapy. Furthermore, compared with patients who received no adjuvant chemotherapy or trastuzumab, the use of trastuzumab was associated with an absolute 14% higher incidence rate for HF or CM.Another study reports on a retrospective analysis of a cohort of 12500 women diagnosed with breast cancer and treated by adjuvant therapy.On the contrary, the hazard ratio for HF and CM (the incidence of HF and CM in treated patients with respect to untreated control population) associated with anthracyclines seems to be higher in younger patients as it is statistically significant among women younger than 55\u00a0years but not among older women. Similarly the hazard ratio associated with trastuzumab treatment is higher in younger women (< 64\u00a0years) with respect to older women (> 74\u00a0years). Bowles et\u00a0al. report an hazard ratio of 15.46 or 10.16 in women younger than 55\u00a0years and women aged 55\u201364\u00a0years respectively, 5\u00a0years since start of treatment. In elder women a hazard ratio of 2.57 was reported. These hazard ratios suggest a fourfold increase in the risk of HF or CM among women treated with trastuzumab.Trastuzumab toxicity is not only directly related to the presence of other risk factors, as in a more accurate analysis Bowles et\u00a0al. reported the hazard ratio corrected by excluding women with comorbidities, and the results did not change significantly. The overall risk of incidence of HF or CM was increased in women treated with anthracyclines, but it was even greater in women treated with trastuzumab.Moreover some authors discuss how trastuzumab, classified as type II cardiotoxic agent, can also trigger irreversible cardiotoxicity,Altogether these are important observations because they strongly indicate that side effects of trastuzumab not only affect women during treatment, but they also occur many years after the treatment as a delayed cardiotoxicity. The mechanisms of cardiotoxicity induced by anthracycline or by trastuzumab may explain the difference in the risk of HF or CM observed after cancer therapy with these antineoplastic drugs.Several studies indicate that ErbB2 has an important role in heart development and function. In cardiac tissues ErbB2 works as a co-receptor for another ErbB receptor tyrosine kinase family member, ErbB4 and its peptide ligand neuregulin 1 (NRG1).Even though trastuzumab prolongs the survival of women with Her2 positive breast cancer, its cardiotoxic side effects are important. The initial hypothesis has been made that trastuzumab-associated cardiotoxicity is related to the inhibition of the neuregulin-1 activated pathway.L/BCL-XS ratio, which likely leads to loss of mitochondrial membrane integrity with multiple major deleterious intracellular consequences including loss of electron transport, generation of free radicals, uncoupling of oxidative phosphorylation which leads to ATP reduction, release of pro-apoptotic proteins such as cytochrome c.Another possible mechanism for trastuzumab-associated cardiotoxicity is represented by mithocondrial dysfunction and distruption of cellular energetic due to the altered BCL-Xin vitro on cultures of cardiac cells and in vivo on animal models. In vivo studies in mice have shown that trastuzumab treatment significantly affects both functional and structural properties of the heart. It altered the expression of genes involved in cardiac functions, adaptability to pressure, vasodilatation and contractility ,Trastuzumab-associated cardiotoxicity was confirmed by findings obtained Cardiac damage has been observed also by electron microscopy imaging. Trastuzumab treatment causes cardiomyocyte ultrastructure alteration, associated with ultrastuctural damages of heart tissues in mice. In particular, alterations in intermitochondrial distance, thickness of myofibers and number of mitochondria have been observed.L ratio.Moreover, in trastuzumab-treated mice it has been shown an activation of apoptotic pathways, such as PARP cleavage, caspase 3/7 activation and increase of Bax/BCL-XFunctional alterations of heart in treated mice were also detected as trastuzumab was found to significantly reduce fractional shortening by increasing left ventricular end-diastolic dimension (LVEDD).in vitro assays Trastuzumab was found to significantly reduce cell viability of cardiomyocytes.L in cardiomyocytes, thus inducing apoptosis.In in vitro studies it has been also confirmed that the cardiotoxic effects of trastuzumab are also based on its ability to prevent the assembly of NRG-1/ErbB2/ErbB4 complex, required for cardiomyocyte survival. Indeed trastuzumab treatment was capable of inhibiting ligand-induced cell proliferation, thus affecting not only the basal cardiomyocyte survival but also the ligand-induced ErbB2/ErbB4 heterodimerization signaling pathway downstream In these Doxorubicin is a highly effective anthracycline but its clinical use is compromised by the development of a severe form of cardiomyopathy and heart failure. The mechanisms of the doxorubicin-related cardiotoxicity have been extensively studied and two main pathways have been proposed. First, doxorubicin has been supposed to induce cardiotoxicity by ROS formation,In the past few decades, novel anticancer drugs have been developed that effectively induce tumor regression, thus prolonging patient's survival. However, cardiovascular side effects of these new drugs can lead to therapy related heart failure. Cardiac side effects of anti-Her2 anticancer agents, such as trastuzumab or tyrosine kinase inhibitors, were totally unexpected.Thus, the initial hypothesis has been made that trastuzumab-associated cardiotoxicity is related to the inhibition of the NRG1 activated pathway,in vitro and in vivo.Our studies have demonstrated that trastuzumab directly induces damage in cardiomyocytes both \u00a0Systolic and diastolic dysfunctions, asymptomatic myocardial ischemia or undiagnosed myocarditis are more frequently in the elderly. Thus it is likely that ErbB2/ErbB4 pathway is chronically activated in these conditions and its blockage by trastuzumab treatment may empathize trastuzumab-related cardiotoxicity in elder patients with undiagnosed heart diseases.This may explain the increased trastuzumab-associated cardiotoxicity in elderly or in patients with other risk factors related to old age such as the higher incidence of systo-diastolic left ventricular dysfunction or chronic myocardial ischemia in diabetic patients.Some data suggest that cardiotoxicity in patients treated with anthracyclines is not necessarily irreversible but it may become reversible if early diagnosed.These findings indicate that a different approach to antitumor treatment-related cardiotoxicity is needed and we cannot anymore consider trastuzumab-related cardiotoxicity less important than anthracycline-related cardiotoxicity or only as a consequence of previous anthracycline treatment as it occurs also in trastuzumab monotherapy. Thus it becomes essential to identify patients with high risk factors or asymptomatic heart dysfunction before starting the treatment with trastuzumab, in order to treat them appropriately or strongly reduce the risk factors.Considering these important observations, the type I and type II classification, based on reversible or not-reversible cardiotoxicity, has become inappropriate as the reversibility concept is ambiguous. It has been demonstrated that ErbB2 inhibitors can be toxic for cardiomyocytes when used in monotherapy in a fashion similar to doxorubicin.The incidence of cardiotoxicity in the real-world population of cancer patients treated with trastuzumab monotherapy is completely different with respect to that observed in clinical trials, as adjuvant clinical trials of trastuzumab have typically enrolled younger women without cardiac comorbidities, excluding older people or people affected by cardiovascular diseases,Furthermore, the incidence of Trastuzumab cardiotoxicity after ten years follow up is underrated, because it does not represent the incidence of real-world population of cancer patients treated with trastuzumab alone.Since older patients are increasingly treated with these anti-ErbB2 drugs, and trastuzumab is widely used for its efficient therapeutic effects on metastatic cancer thus prolonging even more patient's survival in last decades, a different approach is needed to guarantee the survival of treated patients to avoid that women recovered from cancer paradoxically die for heart failure.Also other immunotherapies and targeted drugs have been included in the type II cardiotoxicity such as angiogenesis inhibitors Bevacizumab (anti-VEGF humanized mAb), and TK inhibitors On the basis of these considerations may we still consider Type I and Type II cardiotoxicities clearly different? We propose to find a new different classification for cardiotoxic side effects mainly based only on the types of drugs used in cancer therapy, so that we can discriminate the anthracycline-related cardiotoxicity triggered by anthracyclines or anthracycline-like drugs, ErbB2-related cardiotoxicity, due to trastuzumab or other ErbB2 inhibitors and anti-angiogenic \u2013 related cardiotoxicity ."}
+{"text": "The discovery of human epidermal growth factor receptor 2 (HER2) and its role in the biology of breast cancer and the subsequent development of HER2-targeted therapies, have dramatically improved clinical outcomes for women with early-stage and advanced HER2-positive breast cancer (BC).HER-2 targeted therapies represent a major step forward in achieving the goal of delivering individualized targeted therapy for BC, and trastuzumab was the first anti-HER-2 strategy to be approved for treatment of HER-2 positive BC.This review discusses the treatment of metastatic HER2-positive BC and describes efficacy and safety of novel anti-HER2 target therapies in first-line metastatic settings and the future challenges include refining such treatments, reducing toxicity and simultaneously developing innovative therapies. Furthermore, combinations of trastuzumab and drugs targeting the downstream pathway are described.In the next future will be possible to use an ample armamentarium of combination therapies directed against HER2 and key signaling components integrated in the HER network. This approach will allow clinicians to tailor the management of the individual patient on the basis of tumor- specific biomarker profiles.There is an urgent need for prospective biomarker-driven trials to identify patients for whom targeting is cost-effective. About 20\u00a0% of invasive breast cancers (BC) are HER2-positive and characterized by amplification and/or overexpression of HER2, a transmembrane receptor with tyrosine kinase (TK) activity, resulting in HER2 gene amplification on chromosome 17. This subtype of BC shows an intrinsic malignancy and has a poor prognosis in the absence of specific treatment. About 10\u00a0% of the cases will be diagnosed as metastatic disease and the 5-year overall survival (OS) in these patients achieves 20\u00a0% , of which 2\u20135\u00a0% are long-term survivors \u201311.Trastuzumab, a humanized monoclonal antibody that selectively binds to the HER2 on the surface of tumour cells, when added to chemotherapy in the first-line advanced treatment of HER2-positive BC is associated with a significantly reduced risk of progression and death compared to chemotherapy alone \u201316.However, despite these deep therapeutic advances, the progression free survival (PFS), and OS of patients treated with trastuzumab and chemotherapy-based regimens for metastatic BC (MBC) is about 7\u00a0months (vs about 5\u00a0months without trastuzumab) and 25\u00a0months (in contrast to 20\u00a0months without trastuzumab) respectively , 18.In the last 5\u00a0years we are witnessing an exponential development of new anti HER2 molecules and results of their activity in terms of outcome for the advance tumor are very exciting.In this article, we will analyze the most relevant aspects related to new developments with anti-HER2 therapies and the more recent clinical evidences and therapeutic strategies with the modern use of biological anti HER2 drugs at the first progression of BC patients.With regard to blocking gene expression, the most significant strategy in HER2-targeted therapies have been made using monoclonal antibodies directed against the extracellular domain of the HER2 protein, named trastuzumab. Binding with high affinity to the extracellular domain of HER2, trastuzumab inhibits the proliferation of tumour cells that overexpress HER2. It demonstrated antitumour effects when administered as a single agent, and additive and synergistic effects when administered in combination with a range of antineoplastic agents (1).vs. 32\u00a0%, p\u2009<\u20090.001)], duration of response [DR ], time to progression [TTP ], time to failure [TTF ]. The addition of trastuzumab to paclitaxel increased the ORr from 17 to 41\u00a0% (p\u2009<\u20090.001), the DR from 4.5 to 10.5\u00a0months (p\u2009<\u20090.01), the TTP from 3.0 to 6.9\u00a0months (p\u2009<\u20090.001) and the TTF from 2.9 to 5.8\u00a0months (p\u2009<\u20090.001). The addition of trastuzumab to adriamycin plus cyclophosphamide (AC) increased the RR from 42 to 56\u00a0% (p\u2009=\u20090.02), the DR from 6.7 to 9.1\u00a0months (p\u2009=\u20090.005), the TTP from 6.1 to 7.8\u00a0months (p\u2009<\u20090.001) and the TTF from 5.6 to 7.2\u00a0months (p\u2009<\u20090.001). The median OS for patients who received trastuzumab and chemotherapy combination was 25\u00a0months vs. 20\u00a0months for those who received chemotherapy alone (p\u2009=\u20090.046). This result is even more significant in light of the fact that two-thirds of the women who are progressive on chemotherapy alone arm went on to receive open-label trastuzumab on a compassionate-use protocol .Also the visceral disease seems to get a better PFS, but the number of patients with non-visceral disease was very limited, and therfore no defined considerations it is possible to drive.The safety profile of pertuzumab, trastuzumab and taxane was consistent with the known safety of patients with long-term exposure to dual targeting. It means that we now have a treatment that improves both PFS and OS without affecting the QoL of patients in terms of haematological, not haematological and cardiac safety. This information is very important for the long duration of exposure to the two biological molecules which the patient can support.Constitutive activation of PI3K/AKT/mTOR signalling due to PTEN loss can lead to trastuzumab resistance. mTOR inhibition sensitises PTEN-deficient tumours to trastuzumab, thereby suggesting that the combination of everolimus, the mTOR inhibitor, and trastuzumab have a role in the treatment of HER2-overexpressing BC , 36.The addition of the mTOR inhibitor, everolimus, to trastuzumab and chemotherapy showed clinical benefit in heavily pretreated patients with HER2-positive MBC progressing on previous trastuzumab and taxane therapy .No so high enthusiasm was declared when the two target combination was tested in first-line MBC. In Bolero 1 trial, patients were randomly assigned to receive either everolimus 10\u00a0mg once a day orally or placebo plus weekly trastuzumab intravenously (4\u00a0mg/kg loading dose on day 1 with subsequent weekly doses of 2\u00a0mg/kg of each 4\u00a0week\u00a0cycle) and paclitaxel intravenously  .p\u2009=\u20090.\u200911). In the HRs negative subpopulation, median PFS with everolimus arm was 20\u00a0months (95 % CI: 14.9-24.0) versus 13\u00a0months (10.0-16.5) with placebo arm ; There was a clinically relevant prolongation of PFS with the addition of everolimus in HRs negative patients (7\u00a0months), but the p value did not meet prespecified criteria for significance by a small margin. However, based on the statistical design, the threshold for statistical significance in the HRs-negative subpopulation was rather stringent (p\u2009=\u20090.0044) .In the recent years, a new group of compounds that bind irreversibly to the adenosine triphosphate binding pocket of HER receptors have been developed. One of these compounds, neratinib, has passed preclinical phases and is currently undergoing various clinical trials. Importantly, pan-HER TKI are very attractive strategies for this purpose. Among them, JNJ-28871063 has been shown preclinically to penetrate the blood barrier brain (BBB) more effectively than lapatinib, being also effective in improving survival of xenograft mouse models with HER2 positive intracranial metastases . NeratinHormonal therapy and trastuzumab represent one of the oldest and one of the newest treatment modalities for BC, respectively. Recent data have suggested that HER2 overexpression is associated with resistance to hormonal therapy and there is considerable preclinical evidence to support the existence of interaction or cross talk between HER2 and estrogen-receptor signalling pathways in BC. Preclinical data also demonstrate that adding trastuzumab to hormonal therapy results in greater antitumour activity than either agent alone. The existence of an inverse relationship between estrogen receptors ER expression and HER2 overexpression has also been well established clinically. Thus, a range of clinical trials are now ongoing to determine whether the addition of trastuzumab to hormonal therapy will provide BC patients with benefits in clinical practice. For patients with bone-only spreading disease and indolent disease progression, the combination of anti-HER2 and endocrine therapy as first-line treatment represents a valid therapeutic option. Three trials have examined the addition of HER2-targeted agents to aromatase inhibitors (AI) in postmenopausal women with a first recurrence Table\u00a0.Table 1Svs. 2.4\u00a0months; HR 0.63) and an irrelevant improvement in OS (28.5\u00a0months vs. 24\u00a0months). Also the response rate was in favour of the combination therapy (20 vs. 7\u00a0%). The most common toxicities seen in the combination arm were fatigue (21\u00a0%), vomiting (21\u00a0%), and diarrhea (20\u00a0%); however, the vast majority of events were grades 1 and 2.In the TANDEM study, 207 patients were randomized to anastrozole (1\u00a0mg daily) plus trastuzumab  or to anastrozole alone . The comvs. 3\u00a0months; HR: 0.67), the duration of which was similar to the duration achieved in the HER2-negative group (15\u00a0months). The rates of response and clinical benefit were 27 vs 13\u00a0% and 65 vs 39\u00a0%, respectively, in favour of both trastuzumab-containing arm.The combination of letrozole plus trastuzumab was compared with letrozole alone in the Electra study ; fifty-sA third study, EGF30008, compared the all-oral combination of letrozole (2.5\u00a0mg daily) and lapatinib (1500\u00a0mg daily) with letrozole alone . Of the On Table\u00a0The DETECT V/CHEVENDO trial is a randomized phase III study which aims to compare the combination of trastuzumab, pertuzumab and a chemotherapy drug  with the combination of trastuzumab, pertuzumab and hormonal therapy . It is an ongoing trial currently recruiting participants [NCT02344472]. Finally, the phase II 1303GCC trial will compare trastuzumab in combination with pertuzumab alone vs trastuzumab, pertuzumab and eribuline vs trastuzumab, pertuzumab and hormonal therapy (anastrozole or fulvestrant) in locally advanced or metastatic BC affecting patients aged 60 or more [NCT02000596].Although for patients with HRs/HER2 positive disease improvements in TTP or PFS were seen with the addition of anti-HER2 molecules to endocrine therapy, the gains are modest, and no study has demonstrated an improvement in OS. Hence, the use of such approaches has to be weighted against the significant benefit in PFS and OS seen when anti-HER2 molecules\u00a0are combined with chemotherapy as outlined earlier.CNS progression is a frequent phenomenon in trastuzumab-treated patients. Whether or not it reflects the lack of penetration of trastuzumab through the blood brain barrier or a higher propensity of HER-2 positive disease to spread into the CNS, it is reasonable to continue trastuzumab in the subgroup of patients who develop CNS metastases as the only site of disease progression, since increasing evidence suggests a benefit in terms of OS for patients continuing trastuzumab after receiving radiotherapy for intracranial disease , 56. On An important challenge is the prevention of CNS metastases in HER2 positive metastatic disease For the first time, in the recent CEREBEL study  patientsPatients enrolled onto CEREBEL had similar population characteristics to those reported in other large prospective clinical trials of HER2-positive MBC that used a capecitabine combination , 59, 60 Recent findings, revealed intersting activity of T-DM1 in HER2 postive patients with brain metastasis, also in that case without any loco-regional treatment for CNS recurrences. Probably T-DM1 therapy might be able to prevent out-growth to macro-metastases. In addition, T-DM1 could be useful for patients with established brain metastases that qualify for primary systemic therapy, although WBRT is likely to become necessary eventually , 62.Still, these results suggest that ongoing investigation of T-DM1 in brain metastases is warranted.p\u2009=\u20090.002), as well as a follow up of two years relapse of disease at CNS was much lower  [Recently an interesting finding has been highlighted with the use of neratinib. The phase 2 study NeferTT compared paclitaxel associated with trastuzumab or neratinib in a cohort of 479 HER2 positive patients. Despite the result in terms of PFS was not in favour of either treatment arms, in the group treated with Neratinib the incidence of symptomatic brain metastases was significantly lower  . NeratinLimitations of the research include the lack of specific data on patients with HER2-positive brain disease, how to measure efficacy of various chemotherapy agents and of anti-HER2 molecules. When there is a lack of multiple robust comparative studies, this precludes recommendations on the basis of high-quality evidence .In Table\u00a0Recently, preliminary results on safety of IIIb PERUSE trial (NCT01572038)  were shoPERTAIN trial (NCT01491737) is looking at combining pertuzumab with trastuzumab and an aromatase inhibitor to treat HER2/HR positive advanced BC; The trial want to find out how safe the combination of pertuzumab, trastuzumab and an aromatase inhibitor is and the activity of the double anti HER2 block with endocrine therapy in postmenopausal patients.In order to test the introduction of different chemotherapic agents from taxane therapy in association with pertuzumab and trastuzumab, phase II VELVET study (NCT01565083) is enrolling patients receiving or the two anti-HER2 molecule as separate infusion or receiving pertzumab and trastuzumab in single saline infusion bag after the first cycle.To date is not investigated the subcutaneous trastuzumab administretion in association with pertuzumab. METAPHER trial (NCT02019277) is a multicenter, international, single-arm post licence investigation that was designed in order to evaluate the safety and efficacy of the combination with pertuzumab plus trastuzumab subcutaneously associated to taxane.In HER2 positive disease the use of trastuzumab is well established. The strong recent data clearly recommend the early use of pertuzumab in combination with trastuzumab and paclitaxel or docetaxel in MBC and ongoing trial will define the integration in the adjuvant setting of these double HER2 inhibition. The mandatory use of this combination in first-line metastatic setting is regardless of the site of the disease concerned. Although we do not have today any results regarding the activity of pertuzumab in population that develops early brain metastases, there is prelimnary evidence of a delayed onset of the CNS spreading with the inclusion of pertuzumab treatment to the standard HER2 double biological therapy. An attrattive field of research would be the response of double block on CNS metastases at the first recurrence of disease.Positive data support the combination of trastuzumab and endocrine agents in that case in which is not well indicated chemotherapy incuding agents, such as elderly patients, indolent progressive disease, absence of visceral crisis. Actually, we have no data to support the use of HER2 double block plus hormonal therapy in selective cases with first recurrence of disease.Unfortunately, all the HER-2 positive MBC patients will eventually develop resistance to pertuzumab plus trastuzumab and taxanes, or to trastuzumab combined with endocrine therapy, even those who initially benefit from the treatment.No other anti HER2 biological agents showed better efficacy than pertuzumab and trastuzumab in first-line therapy. T-DM1 seems to offer improved safety and efficacy over two widely used treatments for HER2-positive MBC. T-DM1-associated adverse reactions were generally manageable with appropriate dose modification and supportive care. The safety profile in first-line MBC or early BC is expected to be similar, and clinical trials are under way to evaluate T-DM1 in these settings.There is an urgent need for prospective biomarker-driven trials to identify patients for whom dual HER2 targeting is cost-effective \u201368.In conclusion, pertuzumab associated to trastuzumab represents now the milestone of first therapeutic approach in HER2 postive subtypes tumor, and the benefit in terms of outcome disease achieved with \u201cCleopatra treatment\u201d is one of the more deep enthusiastic result obtained in the story of MBC cure.Finally, the research has focused on molecular mechanisms underlying resistance to trastuzumab and pertuzumab. However, there is still much that we need to\u00a0lern, in particular to better define activity correlated with biomarkers that could be define resistence or sensitivity to the specific target molecule.The future is one in which it will be possible to use an ample armamentarium of combination therapies directed against HER2 and key signaling components integrated in the HER network. This therapeutic approach will allow clinicians to tailor the clinical management of the individual patient on the basis of tumor-specific biomarker profiles, as captured at the time of diagnosis and in the course of treatment.BBB, blood barrier brain; BC, breast cancer; CNS, central nervous system; EMA, European Medicines Agency; FDA, Food and Drug Administration; HER2, human epidermal growth factor receptor 2; MBC, metastatic breast cancer; ORr, overall response rate; OS, overall survival; PFS, progression free survival; TK, tyrosine kinase; TTP, time to progression"}
+{"text": "By increasing the understanding of the molecular mechanisms of combined HER2-targeted therapies, we aim to be better able to select patients who would respond to these treatments and understand some of the mechanisms of resistance to HER2-targeted treatments. Recent studies have demonstrated an increased effectiveness of dual targeted HER2 therapies against HER2-amplified breast cancer as compared with single blockade. These studies have resulted in the recent US Food and Drug Administration approval of the combination of taxane chemotherapy with pertuzumab and trastuzumab in the first-line metastatic setting as well as an accelerated approval in the neoadjuvant setting. Another mechanism for overcoming resistance to HER2 targeted therapies is the antibody-drug conjugate trastuzumab-emtansine, which targets the HER2 receptor conjugated to the potent antimicrotubule agent mertansine, allowing for intracellular release of the cytotoxic drug. Studies evaluating the efficacy of dual blockade with antibody-drug conjugate are currently ongoing. This article reviews recent data on different combinations of anti-HER2 treatments as well as ongoing and future research in this area.The estrogen receptor and human epidermal growth factor receptor (HER) signaling pathways are the dominant drivers of cell proliferation and survival in the majority of human breast cancers. Not surprisingly, targeting these pathways provides the most effective therapies in appropriately selected patients. However, The online version of this article (doi:10.1186/s13058-014-0419-5) contains supplementary material, which is available to authorized users. Recognition of the impact of human epidermal growth factor receptor (HER)-2 overexpression or amplification in approximately 15 to 20% of all cases of invasive breast cancer has resulted in the development of multiple drugs that inhibit the proliferative signal pathway associated with this molecular alteration. The incorporation of HER2-directed therapy has improved the overall survival (OS) of metastatic breast cancer (MBC) patients by greater than 20% and has increased the cure rate of breast cancer in the adjuvant setting by approximately 30 to 40% ..14].Table\u00a0Despite the success of these agents that target the HER family as single agents, there are a number of escape mechanisms from HER-targeted therapies. Clinically, a more complete blockade of the HER receptor layer has been shown to be therapeutically meaningful in prolonging survival in patients. With incomplete blockade of the receptor input layer, proliferative and survival signals can be generated from several different dimer pairs. The idea that the redundancy in the input layer of the network might provide an escape mechanism around a single-agent block has been explored in preclinical trials and neoadjuvant trials as well as in adjuvant trials. Dual HER2 blockade is defined as a more complete blockade of the HER2 and HER signaling pathway by combining two inhibitors with complementary mechanisms of action. In this article, we will review the data supporting these findings and the plans for further evaluation of dual HER2 blockade.de novo and acquired mechanisms of drug resistance exist. Several possible causes of resistance to both trastuzumab and lapatinib have been identified in preclinical studies. Few of these have been prospectively validated in clinical trials. There is enough indication to suggest that some of them do limit the effectiveness of HER2-directed therapy, particularly when these agents are used as single agents.Despite the success in MBC, responses to single-agent trastuzumab are limited and cancer will eventually progress. Many patients treated with adjuvant trastuzumab will be cured of the disease, but disease will recur in some of them. This suggests that both n = 1,082) did not find an impact on DFS . Ba. Ba31]. P = 0.08) and a trend towards improved OS  in patients receiving the combination . A . A 42].  0.0008) .P = 0.0141) as well as in the breast and lymph node pCR (39.3% vs. 21.5%). Consistent with previous studies, a lower pCR rate was noted for hormone receptor-positive patients compared with hormone receptor-negative tumors (26% vs. 63%). The combination targeted therapies only arm also had a 16.8% breast-only pCR rate and an 11.2% breast and lymph node pCR rate ,,[In MDA-175 cells, the combination of T-DM1 and pertuzumab showed enhanced antiproliferative activity and induction of apoptosis compared with either agent alone . In Caluin vivo in the KPL-4 breast tumor xenografts resulted in statistically significant inhibition of tumor growth as compared with the single-agent treatment group. Sustained tumor growth inhibition was also seen for the duration of the study (88\u00a0days) compared with 40\u00a0days with T-DM1 alone [The combination of T-DM1 and pertuzumab M1 alone .A global phase Ib/II study was conducted to investigate the safety and efficacy of T-DM1 and pertuzumab. The phase Ib results demonstrated acceptable tolerability and promising efficacy (response rate 44.4%) in heavily pretreated MBC patients . The MARin vivo in the BT474-me breast cancer cell line . Tumors treated with single-agent T-DM1 and those treated with the combination of trastuzumab plus lapatinib showed a similar reduction in tumor size. The most significant tumor size reduction was observed in the group treated with the combination of TDM-1 plus lapatinib, where tumor regression was observed in the first 2\u00a0days and was significantly superior to the regression observed in the tumors treated with trastuzumab plus lapatinib combination . Proliferation was reduced by lapatinib and lapatinib combination in both cell lines  was observed with afatinib, demonstrating the activity of this agent in this refractory metastatic setting .Neratinib is an oral irreversible inhibitor of endothelial growth factor receptor and HER2 tyrosine kinases. A phase II trial of single-agent neratinib showed a 24% response rate in MBC patients who had progression following trastuzumab and a 56% response rate as first-line therapy . DiarrheSeveral completed neoadjuvant trials have demonstrated significant differences in the rates of pCR among hormone receptor-positive and hormone receptor-negative subsets, with higher pCR rates (at least twice as high) in the hormone receptor-negative subsets Table\u00a0. The higde novo and acquired resistance exist. With the help of a neoadjuvant model, many studies have demonstrated that single-agent HER2-targeted therapies are efficacious but response is incomplete. Large randomized clinical trials have also demonstrated that dual HER2 targeted combinations with trastuzumab/lapatinib and trastuzumab/pertuzumab are synergistic. Recently, the ADC T-DM1 has been approved for the treatment of HER2-overexpressing MBC. Combination of dual HER2-targeted treatments with T-DM1 and lapatinib or pertuzumab may demonstrate improved efficacy in patients. The results of the ALTTO trial highlight the challenge of determining which patients need multiple targeted therapies. In the future, correlative science embedded within the clinical trials will be invaluable in developing personalized therapy. Studies aimed at characterizing the different genetic alterations associated with resistance to HER2-directed therapies may lead to the discovery of new targets that may overcome resistance.Therapies directed at HER2 establish a successful treatment paradigm, but `Recent advances in breast cancer treatment-, edited by Jenny Chang. Other articles in this series can be found at http://breast-cancer-research.com/series/treatment.This article is part of a series on"}
+{"text": "Preoperative therapy with chemotherapy and the HER2-targeted monoclonal antibody trastuzumab is valuable for patients with large or locally advanced HER2-positive (HER2+) breast cancers but traditional methods of measuring HER2 expression do not accurately stratify patients for likelihood of response. Quantitative immunofluorescent approaches have the potential to provide a mathematically continuous measure of HER2. Here we seek to determine whether quantitative measurement of HER2 or phospho-HER2 correlates with likelihood of response to trastuzumab- containing neoadjuvant therapy.in situ protein expression. Patients then received 18\u00a0weeks of treatment, followed by surgery to assess pathologic response to the neoadjuvant regimen.We evaluated core biopsy samples from 27 HER2+ breast cancer patients enrolled in a preoperative clinical trial using trastuzumab, nab-paclitaxel and carboplatin combination therapy (BrUOG BR-211B (NCT00617942)). Tumor core biopsies were taken before initiation of treatment and 9\u201313 days after patients received \"run-in\" doses of either single agent trastuzumab or nab-paclitaxel. The AQUA method of quantitative immunofluorescence was used for analysis of A HER2 score of 2111 by AQUA analysis has been shown to be equivalent to HER2 3+ by immunohistochemical staining in previous studies. Of 20 evaluable patients, 10 cases who achieved a pathologic complete response (pathCR) with neoadjuvant treatment had a mean HER2 level of 10251 compared with 4766 in the patients without pathCR (p\u2009=\u20090.0021). Measurement of phospho-HER2 showed no difference in pathCR vs non-pathCR groups. In 9 patients who had HER2 levels repeated after a single treatment with trastuzumab there was no evidence of a reduction in the HER2 or phospho-HER2 levels following that exposure.High levels of HER2 are associated with achievement of a pathCR in the preoperative setting, while levels of Phospho-HER2 were not predictive of response. This data suggests that accurate measurement of HER2 may help determine the likelihood of response in the pre-surgical setting. Further validation in larger cohorts is required, but this pilot data shows the feasibility of this approach. Human epidermal growth factor receptor 2 (HER2) is amplified or over-expressed in around 20% of breast cancer cases, and the amplification of HER2 is usually associated with worse prognosis-3. TrastPre-surgical or neoadjuvant chemotherapy is standard therapy for inflammatory and locally advanced breast cancer. The addition of trastuzumab to chemotherapy in the pre-surgical setting in HER2+ patients has been tested in several phase II studies-14, withAlthough the use of trastuzumab as part of the pre-surgical regimen for breast cancer has increased, a uniform clinical benefit of trastuzumab in combination with chemotherapy is not observed. The likelihood of achieving a pathCR in this cohort is higher in trastuzumab treated patients with hormone receptor- negative HER2+ cancers compared to hormone receptor-positive HER2+ cancers. Other gBrUOG BR-211B (NCT00617942) was a pre-surgical trial for stage II-III HER2+ breast cancer patients led by the Brown University Oncology Group (BrUOG) and the Yale Cancer Center. Patients were treated with q3week carboplatin, weekly nab-paclitaxel and trastuzumab for 18\u00a0weeks. In this trial, research biopsies were collected before initiation of treatment and again after a brief \"run-in\" exposure to either trastuzumab or nab-paclitaxel before patients received their first doses of the entire treatment regimen, allowing the testing of two hypotheses: 1) that the level of HER2 or pHER2 is associated with the likelihood of achieving a pathological complete response; and 2) that short exposure \"run-in\" treatment with trastuzumab alters the expression of HER2 or pHER2. In this paper, we quantitatively measured the level of HER2 and pHER2 (pY1248) to address these two issues.2 (determined by the institution at which the patient enrolled on the study). After 9 \u2013 13\u00a0days biopsies were repeated. Patients then received trastuzumab 2\u00a0mg/kg weekly (patients who received \"run-in\" nab-paclitaxel were treated with 4\u00a0mg/kg for the first week), weekly nab-paclitaxel 100\u00a0mg/m2 and carboplatin AUC 6 every 3\u00a0weeks for 18\u00a0weeks. Pathologic complete response  was then assessed at definitive surgery within 6\u00a0weeks from the last dose of pre-surgical therapy. Pairs of biopsies (before and after \"run-in\" treatment) from twenty-seven patients were obtained for biomarker studies , was designed to determine the clinical and pathologic response rates of treatment with q3week carboplatin, weekly nab-paclitaxel and weekly trastuzumab in resectable and unresectable locally advanced breast cancer. Eligibility for the trial included histologically documented adenocarcinoma, female age greater than 18, stage IIA-IIIC disease, no evidence of metastatic disease, no prior systemic therapy, not pregnant or lactating, no baseline neuropathy greater than or equal to grade 2, and HER2 positive defined by IHC 3+ or FISH ratio greater than or equal to 2.0. Baseline biopsies were obtained before the treatment. Randomized \"run-in\" treatment was given to patients with either a single dose of trastuzumab 6\u00a0mg/kg or two weekly doses of nab-paclitaxel 100\u00a0mg/mFormalin fixed paraffin embedded tissue biopsies from twenty-seven patients were collected and immediately fixed in formalin to prevent artifact associated with delayed time to fixation. Specimens were then processed, sectioned and deparaffinized in xylene, followed by antigen retrieval at 97\u00b0C in pH\u00a06 sodium citric buffer for 20\u00a0minutes. Slides were incubated with 0.3% bovine serum albumin in 0.1\u00a0M tris-buffered saline with 0.05% Tween-20 to block non-specific binding, then incubated with primary antibodies at 4C overnight. The primary antibodies to HER2  and to phospho-HER2 pY1248  have been previously extensively validated and were only tested for reproducibility before use in our studies. Antibodies diluted 1:1000 and 1:100 respectively showed uniform membrane staining as has been previously described for each . Pathological complete response was used to stratify patients, Fischer\u2019s PLSD was used to compare the mean difference of target biomarkers within each groups. Ordinary least square (OLS) method and paired t-test were used to test if run-in treatment alternated the expression of biomarkers.Among the 27 patients, assessment of pathologic response was available for 23. Of these patients, 20 pretreatment biopsies were evaluable, as were 12 of the repeat biopsies after \u2018run-in\u2019 treatment. Among the 20 patients with evaluable tissue and known response, 50% had pathSince there is a known inverse association between estrogen receptor (ER) and response in the pre-surgical setting, we evaluated the mean levels of HER2 protein as a function of clinical ER status. The mean AQUA score in ER negative patients was 8615 compared to the 5498 in ER positive patients. This difference is not statistically significant in a two sample mean test . This slope is not statistically significantly different from 1, suggesting that HER2 level is not affected by a single dose of trastuzumab treatment. The result is confirmed by the paired t-test of these 9 pairs of baseline and post-treatment biopsies \u2013 the mean of post baseline difference is 449.4 AQUA score units (p\u2009=\u20090.4181) . The mean of pHER2 level measured by the PN2A antibody in the pathological complete response group was 2768.0 AQUA score units, compared with 2183.7 in the no PathCR group (p\u2009=\u20090.4689) . The slope is not statistically significantly different from 1 (p\u2009=\u20090.212), suggesting that pHER2 level is not altered by the single dose of trastuzumab treatment. This result is confirmed by the paired t-test of the 9 pairs of baseline and post-treatment biopsies \u2013 the mean of post baseline difference is 61.3 AQUA score units (p\u2009=\u20090.8781)  levels. Among baseline biopsies, 21 samples had both evaluable tissues for HER2 and pHER2, and among post-treatment biopsies, 15 samples had evaluable tissues for both HER2 and pHER2. We did not observe an association between HER2 and pHER2 in either baseline biopsies or in post-treatment biopsies . M. Abu-Khalaf, L. Harris, N. Sinclair, H. Cheng, Y. Bai, and V. Bossuyt have no competing interests.HC did the quantitative measurements in the lab and the data analysis and wrote the first draft of the manuscript. YB assisted in the quantification of the specimens. WS designed the trial, dealt with clinical issues and problems during the conduct of the trial, oversaw clinical data collection and analysis, and assisted in manuscript preparation. NS assisted with the trial execution at the Brown site, overall clinical data collection and analysis, and assisted in manuscript preparation. VB read the pathology at Yale and did all aspects of the work related to determination of pathologic complete response. MK assisted with the trial execution at the Yale site. LH ran the trial at the Yale site, assisted with data analysis and assisted in manuscript preparation. DR runs the lab in which the work was done, reviewed all of the data collection and analysis and assisted in manuscript preparation. All authors read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/14/326/prepub"}
+{"text": "ERBB2 analogous to those detected in EGFR and never coexisting with EGFR, KRAS, or ALK alterations  or of HER2 gene amplification by in situ techniques. Interpretation and reporting are crucial moments, especially in in situ hybridization, where amplification of the chromosome 17 centromeric region (CEP17) has been shownto account for misleading HER2 FISH results, precluding anti-HER2-based therapy in some patients. In addition, heterogeneity of HER2 amplification must be considered in clinical therapeutic decisions, despite pilot results suggesting that a similar trastuzumab benefit for patients with HER2 amplification, either diffuse or focal  to block their aggressive signal underscores the need for in-depth analysis of diagnostic properties specific for these alterations as part of clinical HER2 status evaluation before choosing among HER2-directed therapeutic options. In this context, Sapino and coworkers  present or focal . Anotheror focal .2-terminal residues into the rat EC5-TM cut-down plasmid to regenerate the whole extracellular domain (HuRT) or by cloning the first 410 NH2-terminal rat residues into the remaining residues from human HER2 (RhuT) showed superior performance in breaking tolerance to the HER2 self-antigen (Molecular alterations of HER2 and its presence on the tumor cell membrane endow this oncoprotein with relevant immunological properties, making it an ideal target antigen for long-term cancer immunoprevention. As thoroughly described by Lollini et al. , HER2 is-antigen , 18. PreOverall, while the benefit of anti-HER2 therapies demonstrated in clinical trials indicates that HER2 is, to date, one of the most useful molecules for targeted therapy, optimization of these therapies for HER2-positive cancer patients awaits further studies. The issues considered in this Research Topic point to the need to better define the role of activating molecular alterations of HER2; refine HER2 clinical testing to design the most tailored treatment for breast cancer patients; and tailor anti-HER2 vaccines to prevent relapse in high-risk breast cancer patients or progression in patients with HER2-overexpressing minimal residual disease.Such knowledge will also be highly relevant in considering the ability of new HER2-targeted drugs, i.e., the monoclonal antibody pertuzumab, the tyrosine kinase inhibitor lapatinib, and the antibody\u2013drug conjugated trastuzumab-DM1, to improve the therapeutic effects of trastuzumab. While these new drugs also target HER2, it is not yet known whether activating HER2 mutations are sensitive to novel strategies. In view of recent results obtained in different clinical trials indicating that combining two anti-HER2 drugs with chemotherapy is the most effective treatment modality for HER2-positive patients , HER2 clThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "HER2 drives tumorigenesis and cancer progression in a subset of patients with gastric cancer (GC), and treatment with trastuzumab, a humanized HER2-neutralizing antibody, improves the overall survival rate of HER2-positive patients. However, a considerable portion of the patients does not respond to trastuzumab and the molecular mechanisms underlying the intrinsic resistance to anti-HER2 therapy in GC is not fully understood.Genetic amplification of HER2 fusion to discover the DNA integration structure. A multicolor FISH assay for HER2 split screening was conducted to confirm HER2 fusion and IHC (HercepTest\u2122) was used to detect the membranous expression of HER2. Fusion cDNA were transfected into NIH/3T3 cells and generate stable cell line by lentivirus. The expression of exogenous HER2 fusion proteins and pHER2 were examined by western blot analysis. In vitro efficacy studies were also conducted by PD assay and softagar assay in cell line expression wild type and fusion HER2. T-DM1 was used to assess its binding to NIH/3T3 cells ectopically expressing wild-type and fusion HER2. Finally, the anti-tumor efficacy of trastuzumab was tested in NIH/3\u00a0T3 xenografts expressing the HER2 fusion variants.We performed whole-transcriptome sequencing on 21 HER2-positive tumor specimens from Chinese GC patients. Whole genome sequencing was performed on the three samples with HER2 fusions with ZNF207, MDK, or NOS2 in 21 HER2-amplified GC samples . Two of the fusions, ZNF207-HER2, and MDK-HER2, which are oncogenic, lead to aberrant activation of HER2 kinase. Treatment with trastuzumab inhibited tumor growth significantly in xenografts expressing MDK-HER2 fusion. In contrast, trastuzumab had no effect on the growth of xenografts expressing ZNF207-HER2 fusion, due to its inability to bind to trastuzumab.We identified three new Our results provide the molecular basis of a novel resistance mechanism to trastuzumab-based anti-HER2 therapy, supporting additional molecule stratification within HER2-positive GC patients for more effective therapy options.The online version of this article (doi:10.1186/s12967-015-0476-2) contains supplementary material, which is available to authorized users. Gastric cancer (GC), as the second leading cause of cancer deaths worldwide, accounted for 989,600 new cases and 738,000 deaths globally in 2011 . TrastuzHER2 gene amplification was initially discovered as an oncogene in breast cancer (BC), which led to the development of HER2-targeted therapeutics for treating HER2-positive BC \u2009\u00d7\u2009100, and was used to evaluate anti-tumor efficacy. Student\u2019s t tests were used to compare the TGI of the treatment group with that of the control group. Statistical tests were two sided, with P\u2009<\u20090.05 considered significant.6- to 8-week-old female nude (HER2 (chr17q12) in-frame fusion transcripts with 5\u2019 partners of ZNF207 (chr17q11.2), MDK (chr11p11.2), or NOS2 (chr17q11.2) in three HER2-positive GC samples of GC196, 431-9540474\u00a0T, and GC334, respectively  on 21 HER2-positive tumor specimens from Chinese GC patients whose tumors were surgically removed and who were treatment na\u00efve, using the HiSeq2000 system (Illumina). A number of candidate fusion transcripts were identified with more than three chimerical reads, which were subsequently followed by RT-PCR/Sanger sequencing confirmation. This led to the identification of three HER2 fusion genes\u2014ZNF207 (exon 1\u20132)/HER2 (exon 18\u201330), MDK (exon 1\u20134)/HER2 (exon 11\u201330), and NOS2 (exon 1\u20132)/HER2 (exon 2\u201330)\u2014were further confirmed in these tumor DNA samples  were captured for the genomic sequences outside the fusion gene. In the GC334 specimen, in addition to the high reads (>1800) of the fusion partners of NOS2-HER2 fusion that were detected, an average of 500 reads was also captured for the entire genomic sequence of wild-type HER2 gene.In the GC196 sample, over 100 reads were detected for -fusion-positive tumor specimens . In the tumor harboring ZNF207-HER2, the increased expression of HER2 mRNA was observed only after the fusion site, whereas the increased expression of ZNF207 mRNA was detected only before the fusion site, further confirming that the amplification of the ZNF207-HER2 fusion was a homogeneous event in the sample  assay to assess the genetic amplification status of the ZNF207-HER2 and NOS2-HER2 fusion genes, as well as to dissect their relationship to the wild-type HER2 gene in the GC196 and GC334 samples, respectively. Based on hematoxylin and eosin staining, both primary tumors with the two HER2 fusions were defined as adenocarcinoma by pathologists  sample of 431-9540474\u00a0T was unavailable for the multicolor FISH analysis, the whole genome sequencing data suggested a mixture of tumor cell populations harboring gene amplifications of wild-type HER2, MDK-HER2, and wild-type MDK  with a HercepTest\u2122 in FFPE samples of GC196 and GC334. Strong staining (IHC 3+) was detected in both samples , which are common genetic alterations identified in GC [HER2 fusions from these known oncogenic alterations suggests that the HER2 fusions are oncogenic drivers. In addition, sequence analysis revealed that proteins encoded by ZNF207-HER2 and MDK-HER2 fusion variants contained a partial extracellular domain, a transmembrane domain, and a full kinase domain of HER2   Figure\u00a0C. TogethMDK-HER2 or ZNF207-HER2, similar to the results observed in the original primary tumor samples  : a fusion between CDK12 exon 12 and HER2 intron 4, and a second fusion between NEUROD2 exon 1 and HER2 exon 8 [HER2 fusions. In the current study, we performed a whole-transcriptome sequencing of 21 HER2-positive GC tumor samples taken from Chinese patients, and discovered three HER2 fusion transcripts due to HER2 gene fusions. Two of them, ZNF207-HER2 and MDK-HER2 were truncated in the N-terminal extracellular domains, but they remained intact in the kinase and transmembrane domains of HER2. The amplification and overexpression of the three HER2 gene fusions were detected in the primary GC samples by multicolor FISH and RNAseq or IHC-based HercepTest\u2122 analysis. The ectopic expression of ZNF207-HER2 and MDK-HER2 in the NIH/3T3 cells led to a constitutive activation of HER2 and downstream signaling, and thus, cell transformation in vitro and tumorigenesis in vivo, demonstrating the oncogenic driver of the fusions. Furthermore, the xenografts ectopically expressing MDK-HER2 but not ZNF207-HER2 were sensitive to trastuzumab. Interestingly, the HER2 fusions were found to be mutually exclusive with mutations of PI3KCA, BRAF, KRAS, and HER3 and amplifications of FGFR2 and c-MET. Collectively, our data confirmed for the first time the presence of oncogenic HER2 arrangements in patients with GC. The ZNF207-HER2 fusion represents a novel intrinsic resistance mechanism to trastuzumab-based anti-HER2 therapy, due to the loss of binding ability to trastuzumab.Several studies have recently used NGS to understand the molecular basis of GC, and a number of previously unknown genetic alterations have been reported , includi2 exon 8 . HoweverHER2 amplification, a significant portion of the patients do not respond clinically to the treatment, and there is little understanding of the molecular mechanism underlying this intrinsic resistance. In contrast, the understanding of the mechanisms of both intrinsic and acquired resistance to HER2 inhibitors in HER2-positive BC is far more advanced [HER2-\u039416) in the extracellular domain of the HER2 receptor, preventing disruption of HER2 homodimers upon binding by trastuzumab [HER2-\u039416 in a GC tumor sample, which naturally harbored HER2-\u039416. Surprisingly, its corresponding patient-derived gastric cancer xenograft (PDGCX), which retains HER2-\u039416 (data not shown), responded well to trastuzumab treatment, with a significant tumor regression being observed (data not shown). Given the lack of clinical evidence of association between HER2-\u039416 and resistance to trastuzumab in BC, as well as the lack of preclinical data on the anti-tumor efficacy of trastuzumab in xenografts carrying HER2-\u039416 [HER2-\u039416 was not a resistance mechanism to trastuzumab in GC when tested in the PDGCX model. Additional HER2-\u039416 positive PDGCX models are warranted to confirm this observation further.Despite the overall survival benefit achieved with trastuzumab in GC patients carrying advanced ,23. For advanced ,25; a spstuzumab ; In our HER2-\u039416 , our datHER2 fusions, we also found two recurrent in-frame BRAF fusion transcripts, BAIAP2L1-BRAF (data not shown), in another cohort of HER2-amplified GC patients. Although further work is needed to demonstrate its oncogenic activity and sensitivity to trastuzumab or BRAF inhibitor, the findings suggest that BAIAP2L1-BRAF could be a potential resistance mechanism to trastuzumab, as it maintains an intact BRAF kinase domain [Surprisingly, in addition to the e domain .HER2 gene amplification is determined by the ratio between the numbers of signals from the hybridization of the HER2 gene probe (covers the whole HER2 gene) and the number of signals from the hybridization of the reference chromosome 17 centromere probe [HER2 fusions  score of 3+ (HercepTest\u2122 score of 2+ needs further FISH confirmation). re probe . The antHER2 fusions. This notion is further supported by our observations that NIH/3T3 cells expressing either ZNF207-HER2 or MDK-HER2 showed to be sensitivity to lapatinib, afatinib, and neratinib in vitro (data not shown).In addition to the antibody, a number of small-molecule HER2 kinase inhibitors are available: lapatinib, an approved agent for HER2-positive BC patients, and afatinib and neratinib, two irreversible kinase inhibitors, currently in phase III clinical trials for HER2-positive BC. The modulation of AKT signaling by lapatinib in the cells expressing the HER2 fusions Figure\u00a0A suggestHER2 amplification in 41% (21/51) of HER2-amplified tumors. The mutually exclusive co-amplification of HER2 with EGFR, FGFR2, FGFR2 and MET was also observed respectively in some of the tumors, suggesting the potential challenges for design of targeted-therapy approaches [MDK-HER2 and NOS2-HER2 with wild HER2 (intra-tumor heterogeneity) is yet to be uncovered. Further studies to explore the responsiveness of the HER2 fusions to combination of trastuzumab with pertuzumab or chemotherapies may lead to additional insights into the impact of the HER2 fusions to anti-HER2 therapies.Besides the functional and phonotypical heterogeneity, emerging evidences indicate that genetic heterogeneity among tumor cells contributes to the advantages for survival, proliferation, metastasis and resistance to anti-cancer therapies. Recently, Tajiri et al. examined 475 GC samples using multiple ligation-dependent probe amplification (MLPA) and FISH analysis and revealed intratumoral heterogeneity of proaches . The homIt is noteworthy that the HER2 positive GC samples used for this study were collected prior the introduction of trastuzumab to China, thus we lack evidence for clinical response of the tumors harboring HER2 fusions to trastuzuamb. Further studies on GC samples from patients treated with trastuzumab at different stages will help to confirm the effect of the HER2 fusions to trastuzmab therapy and their oncogenic property.ZNF207-HER2, along with the discovery of two recurrent BAIAP2L1-BRAF, strongly indicate a large degree of molecular heterogeneity, even in the well-defined HER2-positive segment, representing potential de novo resistance to trastuzumab-based GC therapies. In addition, whether a similar mechanism would exist in BC also needs to be exploited.Although further large-scale clinical investigations are needed to understand the clinical prevalence in GC patients, our data on HER2 fusion genes in GC patients whose tumors were clinically classified as HER2-positive. Our results suggest that these HER2 fusions are genetically amplified driver oncogenes that respond differently to the HER2-neutralizing antibody trastuzumab. The resistance of ZNF207-HER2 to trastuzumab and the existence of the recurrent BRAF fusion variants warrant molecular subtype diagnoses of HER2-positive GC patients for more effective personalized trastuzumab therapies and for future treatment options.In summary, we uncovered three previously unidentified"}
+{"text": "The evolving field of HER2-targeted therapy has significantly improved the outcome of women diagnosed with HER2-positive invasive breast cancer. In this review, we sought to summarise the efficacy of trastuzumab-based regimens in the adjuvant and neoadjuvant setting with a special emphasis on relevant clinical questions: treatment duration, sequence of trastuzumab administration, toxicity, the role of anthracycline-based regimens, and optimal management of small HER2+ tumours. Controversial topics are discussed taking into consideration the development of modern anti-HER2 agents. Breast cancer (BC) is a heterogeneous disease with several biological subtypes. Human epidermal growth factor receptor 2 (HER2) is a strong phenotype determinant present in approximately 20%  of all BIn the adjuvant setting, anti-HER2-targeted therapy with trastuzumab greatly contributed to improvement of clinical outcomes, as measured by disease-free survival (DFS) and overall survival (OS). Several multicentre international trials were designed to assess the role of trastuzumab treatment in high-risk early-stage BC patients, defined as node positive or node negative with tumours larger than 1 cm  or 2 cm These findings were further scrutinised in a meta-analysis that gathered the results of eight trials  testing the benefit of trastuzumab when added to adjuvant chemotherapy versus chemotherapy alone . With a Recently, trastuzumab was also prospectively tested in a cohort of patients mainly with stage I HER2-positive BC . The antFinally, population-based studies reported reassuring patient safety outcomes and treatment compliance \u201313.Neoadjuvant therapy is the standard approach for treating locally advanced and inflammatory BCs; however, it can be also considered an equally valid strategy for the treatment of early-stage BCs . In HER2In the neoadjuvant setting, trastuzumab has been tested in combination with chemotherapy and other anti-HER2 agents . The \u2018fiSubsequently, the \u2018second generation\u2019 trials compared trastuzumab to other anti-HER2 agents or the added benefit of other anti-HER2 agents to trastuzumab plus chemotherapy. The GeparQuinto trial  performeper se effective in achieving pCR in a subset of patients without any additional chemotherapy.Besides lapatinib, trastuzumab was also tested in combination with pertuzumab. The NeoSphere trial  was a muOnly recently was the treatment duration of trastuzumab more clearly established. The pivotal trials studying the role of trastuzumab in early BC used an empirical reference therapy duration of one year \u20134. HowevThe FinHER trial  tested aMoreover, the phase III study PHARE  randomlyIn search of improved efficacy, the HERA trial, an international, multicentre, open-label phase III trial, besides comparing one year of adjuvant trastuzumab with observation after standard adjuvant chemotherapy, also enrolled patients to a third arm treated with two years of trastuzumab . This trGrounded in the current evidence, one year of adjuvant trastuzumab remains the standard treatment duration.Anthracycline-based chemotherapy regimens were used in the majority of the trials evaluating trastuzumab in the adjuvant setting . As prevWhereas some of the pivotal trials opted to give trastuzumab after chemotherapy , others preferred to administer trastuzumab concurrent with paclitaxel . The NCCFinally, some studies also assessed the sequence of chemotherapies (i.e. anthracycline and taxane) given in combination with trastuzumab. A randomised phase III neoadjuvant clinical trial  tested aThe studies leading to the approval of trastuzumab used an intravenous (IV) formulation of the drug. While IV trastuzumab has already been shown to be a cost-effective therapy , its admHER2 overexpression remains the only validated predictive marker of response to anti-HER2 therapy, even though the response to anti-HER2 directed therapies based on this marker is not homogeneous. The development of markers that would allow selecting patients with the highest likelihood to respond would be of much benefit to maximise benefit and decrease harm.18F-FDG positron emission tomography (PET)/computed tomography (CT) imaging is being tested as a predictor of the likelihood of obtaining a pCR. The NeoALTTO trial . It. It41]. Trastuzumab emtansine (T-DM1) is a conjugate between trastuzumab antibody and emtansine (DM1), a cytotoxic drug  45]. In. In45]. a-b) were considered to be \u2018low risk\u2019 tumours and often considered not to benefit from anti-HER2 directed therapy. However, some retrospective studies [As previously discussed, trastuzumab significantly enhanced the clinical outcomes in patients with \u2018high risk\u2019 HER2-positive BCs, i.e. tumours larger than 1 cm  or 2 cm  studies \u201348 and a studies . Yet, st studies .The NeoSphere trial  (previouHER2 blockade has brought significant clinical benefit with acceptable toxicity, leading to a paradigm shift in the management of this population with hitherto poor prognosis. The preliminary data from combining new anti-HER2 therapies with trastuzumab are exciting, and several large studies are underway to validate these in the neoadjuvant and adjuvant settings.The authors declare no conflicts of interest."}
+{"text": "We sought to determine the predictive value of in situ mRNA measurement compared to traditional methods on a cohort of trastuzumab-treated metastatic breast cancer patients.A tissue microarray composed of 149, classified as HER2-positive, metastatic breast cancers treated with various trastuzumab-containing chemotherapy regimens was constructed. HER2 intracellular domain(ICD), HER2 extracellular domain(ECD) and HER2 mRNA were assessed using AQUA. For HER2 protein evaluation, CB11 was used to measure ICD and SP3 to measure ECD of the HER2 receptor. In addition, HER2 mRNA status was assessed using RNAscope assay ERRB2 probe. Kaplan \u2013 Meier estimates were used for depicting time-to-event endpoints. Multivariate Cox regression models with backward elimination were used to assess the performance of markers as predictors of TTP and OS, after adjusting for important covariates.HER2 mRNA was correlated with ICD HER2, as measured by CB11 HER2, with ECD HER2 as measured by SP3  and with FISH HER2 . All markers, HER2 mRNA, ICD HER2 and ECD HER2, along with FISH HER2, were found prognostic for OS , and except for FISH HER2, they were also prognostic for TTP Log-rank p\u200a=\u200a0.036, 0.068 and 0.066 respectively) in this trastuzumab- treated cohort. Multivariate analysis showed that in the presence of pre-specified set of prognostic factors, among all biomarkers only ECD HER2, as measured by SP3, is strong prognostic factor for both TTP  and OS .The expression of HER2 ICD and ECD as well as HER2 mRNA levels was significantly associated with TTP and OS in this trastuzumab-treated metastatic cohort. In situ assessment of HER2 mRNA has the potential to identify breast cancer patients who derive benefit from Trastuzumab treatment. HER2, a proto-oncogene encoding HER2 tyrosine kinase receptor, is amplified in 10 to 20% of breast cancers, leading to HER2 protein overexpression and an aggressive tumor phenotype associated with reduced survival and high metastatic potential. The advent of molecular targeting of HER2 receptor with trastuzumab has substantially improved the outcome of breast cancer patients. Although single-agent trastuzumab exerts some antitumor activity, the highest clinical benefit is derived when trastuzumab is combined with chemotherapy In recent years, targeted therapies such as the anti-HER2 humanized monoclonal antibody trastuzumab, have changed the therapeutic landscape in breast cancer. Accurate assessment of HER2 status is necessary to recommend therapy for patients who are most likely to benefit from the treatment and minimize unnecessary overtreatment in the setting where potential side effects may occur Despite the reported and proven benefits of trastuzumab in HER2-overexpressing metastatic breast cancer patients, approximately 50% of them The assessment of HER2 overexpression by two immunohistochemical (IHC) assays and three fluorescent in-situ hybridization (FISH) assays have been approved by the US Food and Drug Administration (FDA) http://clinicaltrials.gov/ct2/show/NCT00005970?term=N9831&rank=2. Accessed April 18, 2011), showed decrease in the number of patients eligible for trastuzumab therapy when the ASCO/CAP criteria were applied To minimize discrepancies, the American Society of Clinical Oncology (ASCO) and College of American Pathologists (CAP), developed guidelines for optimal laboratory evaluation of HER2 status by modifying the FDA criteria, which had been used in pivotal trastuzumab trials type DX RT-PCR for HER2 assessment was reported. This high false-negative rate of RT-PCR assay highlights the shortcomings of this non-morphologic assay and the importance of standard immunohistological methods in HER2 testing. This result could open the door for a new method of in situ quantitative analysis of HER2 mRNA levels that would reflect more precisely HER2 status by combining quantitative determination of gene expression levels and morphologic assessment.In spite of these changes, efforts to optimize testing methods are ongoing. It has been suggested that HER2 status can be assessed with different approaches as a continuous variable and can be assessed on mRNA level The aim of this study was to assess HER2- mRNA as a potential predictor of benefit from trastuzumab-based chemotherapy and to correlate it to HER2 protein levels and to FISH by using a combination of automated-quantitative immunofluorescence and a new method of mRNA in situ hybridization marketed as RNAscope.st line (n\u200a=\u200a130) were included in the analysis. The translational research protocol was approved by the Bioethics Committee of the Aristotle University of Thessaloniki School of Medicine  under the general title \u201cInvestigation of major mechanisms of resistance to treatment with trastuzumab in patients with metastatic breast cancer\u201d. All patients included in the study after 2005 provided written informed consent for the provision of biological material for future research studies, before receiving any treatment. Waiver of consent was obtained from the Bioethics Committee for patients included in the study before 2005.The breast cancer cohort used for this study consists of 149 patients classified as HER2-overexpressing by locally performed IHC at the time of pathological assessment, who were diagnosed in Greece from 1999 through 2006 with metastatic breast cancer. Patients were treated with various Trastuzumab-based combinations for metastatic disease in situ hybridization (ISH) formalin-fixed paraffin embedded (FFPE) tissue has been previously described The RNAscope  technique of mRNA Briefly, the assay uses a pool of up to 20 probe pair sets for each mRNA target of interest. Probe pairs bind along an mRNA region and create a unique 28 base-pair sequence recognized by the preAMP which then allows for binding during the subsequent amplification steps and finally the amplified target is detected by cy5 tyramide & AQUA .ERBB2 gene (by ACD), the housekeeping gene ubiquitin C (UbC) as a positive control or the bacterial gene DapB as a negative control. ERBB2 gene or UbC specific hybridization signals were detected with Cy5-tyramide. Sections were then incubated with 0.3% bovine serum albumin (BSA) in 0.1 mol/L of Tris-buffered saline  for 30 minutes at room temperature followed by incubation with a wide-spectrum rabbit anti-cow cytokeratin antibody  in BSA/tris-buffered saline for 1 hour at room temperature. The cytokeratin signal was detected with Alexa 546 conjugated goat anti-rabbit  incubated for 1 hour at room temperature. Slides were then mounted using ProlongGold plus 4,6-diamidino-2-phenylindole (DAPI).HER2 mRNA status was assessed by in situ hybridization using the RNAscope FFPE assay kit according to the manufacturer\u2019s instructions modified for fluorescence detection of transcripts using Cy5-tyramide. In brief, slides with TMA sections were treated with heat and protease digestion followed by hybridization with target probes to In Situ quantitative measurement of biomarkers was done by using the following:anti-HER2 mouse monoclonal antibody, clone CB11 (by Biocare) Epitope: Intracellular domain of human HER2 receptor.anti-HER2 mouse monoclonal antibody, clone SP3 (by Thermo Fischer) Epitope: Extracellular domain of human c-erbB2.ERRB2 probe, for HER2 mRNA (RNAscope assay by ACD), according to the manufacturer\u2019s protocol modified for detection with Cy-5 Tyramide.Each antibody was validated by performing 1) titering, 2) reproducibility assessment on index arrays, and 3) verification of linearity with expression on cell line series, according to a previously described protocol The AQUA method of QIF has been described elsewhere Correlation of each biomarker with immunohistochemistry/FISH was assessed by using the Pearson and Spearman\u2019s rank correlation coefficient. All biomarkers were treated as binary variables. Dichotomization of CB11 and SP3 was based on the corresponding median AQUA scores (620.41 and 99.42 respectively), whilst the signal-to-noise threshold was used as a cut point for HER2mRNA (<100: negative vs. \u2265100 positive). Overall survival (OS) and time to progression (TTP) were the primary endpoints of interest. TTP survival times were calculated in months, from Trastuzumab initiation to the date of disease progression, censoring or last follow-up exam. Survival curves were calculated using the Kaplan-Meier method and differences in survival times between groups were assessed by using the log-rank test. Multivariate Cox regression models were used to assess the performance of each marker and FISH HER2 after adjusting for other important predictors, namely age group (<50 vs. \u226550 years), disease grade (I & II vs. III), status of distant metastasis and ER status. For a simultaneous assessment of all HER2 biomarkers and FISH in the presence of the aforementioned pre-specified set of prognostic factors, multivariate Cox regression models, with backward selection, were also fitted. During the backward elimination process, the possibility of significant interactions between any pair of biomarkers and each biomarker by ER status was also tested. None of these candidates was found statistically significant and hence no interaction terms are included in the final multivariate Cox proportional hazards (PH) models.http://www.r-project.org/).Statistical analysis was performed using R Statistical Software  and with FISH HER2  for CB11, HR\u200a=\u200a0.46  for SP3 and HR\u200a=\u200a1.68  for HER2 mRNA. In a similar model with all pre-specified prognostic factors present, TTP survival was also more favorable for patients with amplified HER2 gene status .The multivariate TTP analysis included all biomarkers and FISH HER2 as well as the aforementioned prognostic factors. Applying a backward elimination process, it was found that ECD HER2, as measured by SP3, is the only biomarker that retains its prognostic ability for TTP survival . FISH HER2 was also marginally significant at \u03b1\u200a=\u200a10% .OS was found significantly longer for patients with high HER2 ICD , high HER2 ECD , high HER2 mRNA  and amplified HER2 gene status .Multivariate analysis showed that after adjustment for the pre-specified set of prognostic factors, high HER2 ECD protein levels, as measured by SP3, predict better overall survival , Herceptest and FISH and showed a higher discrimination power compared to HercepTest One possible explanation of our findings may reside in the molecular target of trastuzumab which is the extracellular domain of HER-2 Our study also shows a significant correlation of HER2-mRNA levels with conventional immunohistochemistry and in situ-hybridization methods as well as FISH. We found that HER2 status by FISH, AQUA HER2-proteins and HER2-mRNA levels are all independent predictor factors for TTP after Trastuzumab-containing chemotherapy in this metastatic cohort. In our study, HER2 mRNA status was assessed by in situ hybridization using the RNAscope FFPE assay in combination with the AQUA method of automated quantitative immunofluorescence. In situ quantitative measurement of both HER2-mRNA and protein; is reproducible, automated method that reduces intra-observer variability. Since the interpretation of HER2 immunostaining and in situ-hybridization may be influenced by laboratory and observer variability, the use of the AQUA automated method in measurement of HER2 protein along with the HER2-mRNA level could improve the diagnostic accuracy of HER2 status,. QISH enables a relatively easy, fast and reproducible quantification of HER2-mRNA expression feasible in routine FFPE tissue.In summary, our study demonstrates that measurement of HER2-m RNA levels with this novel method has a predictive value for response to Herceptin-based chemotherapy in metastatic breast cancer. Additional studies in prospective cohorts are required to validate these findings with the ultimate goal to build a potential predictive model of trastuzumab therapy and complete the puzzle of HER2 testing optimization.Figure S1He2mRNA hybridization.(TIF)Click here for additional data file."}
+{"text": "Breast cancer is the second leading cause of cancer death among women. Human epidermal receptor 2 (HER2) positive breast cancer (HER2+ BC) is the most aggressive subtype of breast cancer, with poor prognosis and a high rate of recurrence. About one third of breast cancer is HER2+ BC with significantly high expression level of HER2 protein compared to other subtypes. Therefore, HER2 is an important biomarker and an ideal target for developing therapeutic strategies for the treatment HER2+ BC. In this review, HER2 structure and physiological and pathological roles in HER2+ BC are discussed. Two diagnostic tests, immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH), for evaluating HER2 expression levels are briefly introduced. The current mainstay targeted therapies for HER2+ BC include monoclonal antibodies, small molecule tyrosine kinase inhibitors, antibody\u2013drug conjugates (ADC) and other emerging anti-HER2 agents. In clinical practice, combination therapies are commonly adopted in order to achieve synergistic drug response. This review will help to better understand the molecular mechanism of HER2+ BC and further facilitate the development of more effective therapeutic strategies against HER2+ BC. Breast cancer is one of the most common cancers and the second leading cause of cancer death among women of all races . AccordiHER2 gene amplification and HER2 protein overexpression, accounts for about 25%\u201330% of all breast cancers . In. In51]. On the other hand, IHC testing has some limitations, for example the effect caused by the pre-analytic, analytic and post-analytic processes. There is no uniform control for time, type of tissue fixation, and temperature of paraffin embedding, and there is no standard for processing the tissue samples, all of which may result in fluctuation of the IHC results of the same specimens. Moreover, reduced immuno-reactivity for HER2 proteins to their corresponding antibodies may happen due to prolonged storage of unstained slides, causing the IHC scores to be negatively affected. Most importantly, IHC test is a semi-quantitative method, as it is based on a subjective determination of the intensity of the color reaction .FISH is a more reliable, sensitive and accurate testing tool with less influence by pre-analytic and analytic variable factors. A major advantage of FISH compared to IHC is that the evaluation of HER2 status is much more quantitative and includes internal control cells which are located adjacent to tumor cells in the same tissue section for parallel comparison . This meHER2/neu gene [HER2/neu gene copies can be estimated. The ratio of HER2/neu gene to chromosome 17q centromere (CEP 17) will then be calculated [Three types of FISH assays are approved by the FDA, including PathVysion (Abbott Laboratories) and Dako PharmDx (Dako Corporation) FISH test which two use dual probes (one for HER2 and the other for the centromere 17) and the Ventana Inform  which uses a single probe only for HER2. These testing methods share a similar testing procedure, which utilizes fluorescently labeled probes that are partly complementary to the neu gene . After blculated . Accordilculated .However, FISH also has its limitations. It usually takes about two days and requires the use of expensive fluorescence microscopy. In addition, it requires extensive training and expertise to distinguish between normal cells and malignant cells from the FISH results . FurtherOverexpression of HER2 is closely related to the development and progression of breast cancer. Therefore, HER2 becomes a critical target for developing therapeutic drugs against HER2+ BC. The development of anti-HER2 therapies has significantly improved the clinical outcome for patients with HER2+ BC . In this\u00ae, Genetech) is the first humanized monoclonal antibody approved for the treatment of HER2+ BC by the FDA in 1998. With the advent of trastuzumab, the prognosis of patients with HER2+ BC both in metastatic and adjuvant settings has been dramatically improved. Several clinical trials have shown that trastuzumab improves overall survival (OS) in metastatic breast cancer [Trastuzumab , disruption of downstream signaling pathways, inhibition of cleavage of HER2, and promoting endocytosis of HER2 receptors ,60. ThesThough trastuzumab exerts its effect quite successfully in the treatment of early and advanced HER2+ BC, a proportion of patients have intrinsic or acquired resistance to it. In general, there are four proposed mechanisms for resistance to trastuzumab ,62,63,64First, the interaction between receptor and antibody is blocked. Obstacles preventing trastuzumab binding to HER2 also explain the resistance to some extent. Several studies reported that MUC4, also a transmembrane protein, may mask the epitope on HER2. Hence, trastuzumab has difficulty to access and bind to HER2. Therefore, the efficacy of trastuzumab may be significantly reduced ,66.Second, the immune system fails to respond. As is mentioned above, ADCC may take a non-negligible role in the antitumor action of trastuzumab. If polymorphisms and other dysfunctions of Fc receptor make it fail to trigger an immune-mediated mechanism, this would reduce the ADCC response to trastuzumab, leading to resistance to trastuzumab .p < 0.0001) [Third, downstream signaling pathways are upregulated. Phosphatase and tensin homolog (PTEN) loss, presence of p95 (extracellular receptor cleavage forming truncated form of HER2 p95) ,68 and p 0.0001) . Presenc 0.0001) .Fourth, alternative signaling pathways are activated. Even though trastuzumab successfully recognizes and acts on HER2 preventing the signaling transduction pathways induced by HER2-containing dimers, alternative pathways unrelated with HER2 can be activated by other factors, such as insulin-like growth factor-I receptor (IGF-IR) .\u00ae, Genetech) is the second humanized monoclonal antibody for anti-HER2 therapy approved by the FDA in 2013. Like trastuzumab, it exerts its function by binding with an epitope on the extracellular domain of HER2 receptors, therefore preventing the formation of HER2-containing heterodimers. However, pertuzumab could form a complex with HER2 on the heterodimerization interface, which has different epitopes from trastuzumab [Pertuzumab  is one of them, showing great promise. It is an Fc-optimized chimeric monoclonal antibody with enhanced ADCC . CurrentMonoclonal antibodies exert their functions by binding to the extracellular domain of HER2 receptor, which prevents the dimerization of HER2 and other EGF receptors, while tyrosine kinase inhibitors (TKIs) bind to the intracellular tyrosine kinase domain of HER2 to prevent the phosphorylation of tyrosine kinase and thus inhibit the activation of downstream signaling pathways.\u00ae, GlaxoSmithKline) is the second anti-HER2 targeting agent, approved by the FDA in 2005. It is an orally active, reversible and dual small molecular inhibitor of HER2 and HER1 with prolonged inhibition of tyrosine phosphorylation in tumor cells [n = 138) who received treatment of lapatinib for 17.6 weeks demonstrated an overall response (OR) of 31%, and progression-free survival (PFS) rate of 63% at Month 4 and 43% at Month 6. The most common adverse events caused by lapatinib were diarrhea, rash, pruritus, and nausea. However, these events were primarily graded at mild level as 1 or 2 [Lapatinib  and stable disease was 37% (n = 37) [Afatinib (BIBW-2992) (Boehringer Ingelheim) is an orally active irreversible dual inhibitor of EGFR and HER2. Its chemical structure is presented in (n = 37) . Though n = 66) and the other was not pretreated (n = 70). The overall response rate (ORR) was 24% and 56%, respectively. Efficacy results were better in the non-pretreated group, with PFS rate 78% in the trastuzumab native group and 59% in the trastuzumab pretreated group. Moreover, the study also reported that a majority of the recruited patients showed reduction in their tumor sizes [Neratinib  is also an orally taken and active irreversible inhibitor of EGFR, HER2 and HER4 receptors. or sizes . TherefoAdo\u2013trastuzumab emtansine  is an ADC which was approved by the FDA in 2013 . The strThe potential acting mechanism is shown in Recently, a study constructed a novel HER2 directed ADC of a biparatopic antibody linked with a tubulysin-based microtubule inhibitor. It was found that this novel ADC showed a greater efficacy for HER2+ BC than T-DM1. The reported biparatopic antibody can recognize and bind to two distinct epitopes on the HER2 receptor. This interaction could induce clustering of HER2 which could then facilitate the internalization, lysosomal trafficking and degradation of the clustered HER2. Through thoughtful experimental design, the study also indicated that a broader group of patients (eligible or ineligible and relapsed/refractory for T-DM1 treatment) could benefit from this biparatopic ADC .Heat shock protein 90 (HSP90) inhibitors are novel therapeutic approach for HER2+ BC. HSP90 is a molecular chaperone which is necessary for maintaining the stability and function of proteins. When HSP90 is inhibited by its corresponding inhibitors, its client protein will be unstable and eventually undergo degradation by proteinases. HER2 is one of the most sensitive client proteins of HSP90 . High leInhibitors of downstream signaling pathways are also a class of emerging agents against HER2+ BC. These inhibitors, which include mammalian target of rapamycin (mTOR) inhibitors and PI3K inhibitors, act directly on downstream signaling pathways to inhibit tumor cell proliferation and promote apoptosis ,14,68. PStrategies of combining HER2 targeted agents with each other and combining anti-HER2 drugs with chemotherapy are usually carried out for the treatment of HER2+ BC. Various therapeutic approaches have been developed . CombinaRecent studies reported that activating mutations of HER2 in patients without HER2 amplification might occur in 2%\u20134% of breast cancers . These HHER2 is one of the best characterized molecular biomarkers and an ideal target for developing therapeutic strategy for the treatment of HER2+ BC. Clinically, methods for evaluating HER2 status are generally utilized to determine the subtype of breast cancers, and then identify the appropriate molecular therapy for corresponding breast cancer. Based on the understanding of the HER2 biology and its role in breast cancer, a variety of HER2 targeted agents have been developed. Among those agents, monoclonal antibody trastuzumab as the prior choice for the treatment of HER2+ BC benefits patients significantly in clinical practice. However, intrinsic or acquired drug resistance to trastuzumab may be engendered in many patients with HER2+ BC. Therefore, clinically, combination therapies of trastuzumab and other anti-HER2 agents and combination therapies of anti-HER2 agents and chemotherapy are commonly conducted to optimize their therapeutic efficacy. However, these combination therapies still have some limitations, such as side effects. The economic costs of combination of HER2 targeted therapies may be prohibitive for patients. This means that only a minority of patients can gain benefits from the combination. The ultimate purpose is to be able to customize or personalize drug therapy with high efficacy and low toxicity. Hence, a great deal of effort is still needed to seek better therapeutic strategies to combat HER2+ BC."}
+{"text": "The purpose of this study was to retrospectively review the pathologic complete response (pCR) rate from patients (n=86) with stage II and III HER2-positive breast cancer treated with neoadjuvant chemotherapy at our institution from 2008 to 2013 and to determine possible predictive and prognostic factors. Immunohistochemistry for hormone receptors and Ki-67 was carried out. Clinical and pathological features were analyzed as predictive factors of response to therapy. For survival analysis, we used Kaplan-Meier curves to estimate 5-year survival rates and the log-rank test to compare the curves. The addition of trastuzumab to neoadjuvant chemotherapy significantly improved pCR rate from 4.8 to 46.8%, regardless of the number of preoperative trastuzumab cycles (P=0.0012). Stage II patients achieved a higher response rate compared to stage III (P=0.03). The disease-free and overall survivals were not significantly different between the group of patients that received trastuzumab in the neoadjuvant setting  and the group that initiated it post-operatively . Axillary pCR post neoadjuvant chemotherapy with trastuzumab was associated with reduced risk of recurrence  and death . In conclusion, we confirmed that trastuzumab improves pCR rates and verified that this improvement occurs even with less than four cycles of the drug. Hormone receptors and Ki-67 expressions were not predictive of response in this subset of patients. Axillary pCR clearly denotes prognosis after neoadjuvant target therapy and should be considered to be a marker of resistance, providing an opportunity to investigate new strategies for HER2-positive treatment. Breast cancer is the most common malignancy among women all over the world, and it is considered a heterogeneous disease. Around 25% of all breast cancer overexpress the human epidermal growth factor receptor 2 (HER2), and is traditionally associated with worse prognosis . The actin vivo assessment of tumor response to chemotherapy  is usually defined as absence of residual invasive cancer in breast and lymph nodes in surgical specimens after neoadjuvant therapy. It is considered an important prognostic factor and is associated with long-term survival. pCR has been adopted as the primary end point for neoadjuvant trials and reaches up to 78% in patients treated with trastuzumab ,7. HowevIn this article, we reviewed the rate of pCR from patients with HER2-positive breast cancer treated with neoadjuvant chemotherapy at our institution and investigated possible clinical, histological and immunohistochemical predictive and prognostic factors. This knowledge would allow a better selection of patients that could benefit from therapy with trastuzumab. In addition, costs and adverse events could be minimized, leading to an individualized cancer treatment .This cohort study with retrospective data collection evaluated clinical, histological, and immunohistochemical characteristics of all patients with histologically confirmed HER2-positive, stage II and III breast cancer, treated with neoadjuvant chemotherapy between 2008 and 2013 at our institution. The Institutional Review Board of the Hospital das Cl\u00ednicas, Faculdade de Medicina de Ribeir\u00e3o Preto, SP, Brazil, approved this study (#497.095).in situ hybridization (CISH).The HER2 status was assessed by immunohistochemistry (IHC) and tumors were considered HER2-positive when IHC staining was 3+  and 2+ , in which the HER2 gene amplification was confirmed by chromogenic 2 in one recipient paraffin block.We used microscopically selected representative samples from breast tissues stored in our Pathology department. A paraffin tissue microarray (TMA) block was built to minimize experimental variability and reduce costs. We used the Tissue Microarray Builder Kit  to arrange 24 cylinders of 2 mm).Immunohistochemical staining for estrogen receptor, progesterone receptor and Ki-67 was performed in the TMA sections using mouse monoclonal antibody at 1:200, 1:200 and 1:100 dilutions, respectively , and used the software ImageScope (USA) for cell count. A 14% cut-off was used to define a high expression of Ki-67. At least 500 contiguous tumor cells were counted to establish the index.In order to confirm the amplification of the HER2 gene we performed a dual color chromogenic (CISH) assay using the Kit CISH\u2122 HER2 SPOT-Light\u00af, Zymed  in the TMA sections. The interpretation followed the College of American Pathologists guidelines. The amplification was confirmed in all 41 tumors tested.Patients were treated with neoadjuvant chemotherapy with anthracyclines and/or taxanes, for at least 4 cycles, according to the current protocol. The 86 patients included in the study were divided into two groups: 65 patients received neoadjuvant chemotherapy with trastuzumab followed by adjuvant trastuzumab while 21 patients received neoadjuvant chemotherapy alone followed by adjuvant trastuzumab.2 epirubicin + 500\u2013600 mg/m2 cyclophosphamide followed by 4 cycles of 100 mg/m2 docetaxel every 21 days +/- trastuzumab; 2) 4 to 6 cycles of 80\u2013100 mg/m2 docetaxel + trastuzumab every 21 days; 3) 6 cycles of 500 mg/m2 fluorouracil + 75 mg/m2 epirubicin + 500 mg/m2 cyclophosphamide every 21 days; 4) 4 cycles of 75 mg/m2 docetaxel + 60 mg/m2 epirubicin every 21 days. All patients completed 1 year of treatment with adjuvant trastuzumab, except those that developed severe toxicity.The chemotherapy regimens used were: 1) 4 cycles of 75 mg/mDisease-free survival was considered as the length of time between the surgery and the first recurrence event . Overall survival was considered as the length of time between the cancer diagnosis and death. Patients that were lost to follow-up or did not reach any event (recurrence or death) were censored in the analysis.Statistical analyses were done with GraphPad Prism 6 software (USA). To analyze the categorical variables, we used Pearson chi-square test or Fisher's exact test. For survival analysis, we used Kaplan-Meier curves to estimate 5-year survival rates and the log-rank test to compare the curves. Statistical significance was assumed at a 0.05 level (P<0.05).All of the 86 patients were treated with adjuvant trastuzumab, 66 completed 1 year of adjuvant treatment, 8 developed cardiac toxicity severe enough to interrupt the drug (9.5%), while 11 were still under treatment with trastuzumab at the time of the study. One patient from the first group died during the neoadjuvant treatment from febrile neutropenia and, therefore, did not receive surgical or adjuvant treatment.The addition of trastuzumab to the neoadjuvant chemotherapy significantly improved the pCR rate. Of the 64 patients that received at least one cycle of trastuzumab in the neoadjuvant setting, 30 achieved pCR (46.8%), while in the group of 21 patients treated with neoadjuvant chemotherapy without trastuzumab only 1 achieved pCR (4.8%).In a subgroup analysis, we evaluated if the number of trastuzumab cycles received preoperatively influenced the pCR rate. Of the 65 patients treated with neoadjuvant chemotherapy with trastuzumab, 46 received at least 4 cycles of trastuzumab (T group) and 19 received only 1 to 3 cycles of the drug together with neoadjuvant chemotherapy (Chemo/T group). As can be seen in =0.1). In the group of patients that achieved pCR, 35% underwent breast-conserving surgery, while in the group with residual tumor in the breast this rate was 39% (P=0.8).The rates of breast-conserving surgery were not significantly influenced by the addition of trastuzumab nor was pCR. Of patients treated with neoadjuvant chemotherapy with trastuzumab, 33% had conservative surgery, compared with 52% from the chemotherapy alone .The disease-free and overall survival  were notWe investigated clinical, histological and immunohistochemical predictive factors for response to neoadjuvant chemotherapy with trastuzumab in the 65 patients treated with at least one cycle of the drug preoperatively . The onlWe evaluated possible prognostic factors in our population of HER2-positive breast cancer patients treated with neoadjuvant chemotherapy associated with trastuzumab. pCR is considered an important prognostic factor and is associated with better disease-free and overall survival . pCR no. The 5-yOur findings confirmed that the addition of trastuzumab to neoadjuvant chemotherapy significantly improves pCR rates. This is consistent with other trials that demonstrated that 1 year of trastuzumab starting as neoadjuvant almost doubled pCR rates . The ideIn a meta-analysis published in 2011, even though the probability to achieve pCR was higher in the trastuzumab plus chemotherapy group , breast-conserving surgery rates were similar to the group that used chemotherapy alone . Our stuThe 3 major trials that evaluated neoadjuvant treatment with trastuzumab had a limitation in the survival analyses, because they compared it with patients that did not receive adjuvant trastuzumab and patients with HER2 negative tumors ,14,15. OEven though trastuzumab presented a great improvement in the treatment of HER2-positive breast cancer, it is associated with relevant adverse cardiac events and with significantly elevated cost of treatment ,18,19. IOur findings reinforce the importance of early diagnoses in some aspects. Only 22 of the 86 patients were at stage II disease, but they had significantly greater chance of achieving pCR and having conservative surgery when compared to the patients at stage III. The relevance of the TNM staging has been questioned in the last few years . A recenWe evaluated possible prognostic factors in our population of HER2-positive breast cancer patients treated with neoadjuvant chemotherapy associated with trastuzumab. Several studies have demonstrated a relation between the number of positive nodes in the axilla after neoadjuvant treatment and survival \u201325. Ou"}
+{"text": "NeoSphere showed significantly higher pathologic complete response (pCR) with neoadjuvant pertuzumab, trastuzumab, and docetaxel compared with trastuzumab plus docetaxel, pertuzumab plus trastuzumab, or pertuzumab plus docetaxel. We assessed associations between human epidermal growth factor receptor 2 (HER2) pathway-related biomarkers and clinical outcome in response to these regimens.Tumor, serum, and whole blood samples were collected at baseline and post neoadjuvant treatment before surgery. Associations between biomarkers and pCR, and between biomarkers and clinical variables were assessed in the overall and estrogen receptor (ER)-positive and ER-negative populations. Changes in serum marker levels between baseline and post-neoadjuvant treatment were examined.P\u2009=\u20090.001) and a significant treatment interaction (P\u2009=\u20090.0236) with pertuzumab, trastuzumab, and docetaxel . Low serum transforming growth factor alpha (TGF\u03b1) was associated with higher pCR rates with pertuzumab plus trastuzumab (P\u2009=\u20090.04) without a significant treatment interaction. Presence of truncated HER2 did not affect pCR. A non-significant decreased pCR benefit was observed consistently across groups in patients with mutated PIK3CA while the treatment benefit from pertuzumab was maintained when comparing the trastuzumab plus docetaxel and pertuzumab, trastuzumab, and docetaxel groups. Notably, PIK3CA exon 9 mutations were associated with residual disease (pooled groups), which was not found for exon 20 mutations. Serum HER2 extracellular domain levels were significantly increased between baseline and post-neoadjuvant treatment in the non-trastuzumab-treated group, and decreased in the trastuzumab-containing groups (likely due to trastuzumab\u2019s mechanism of action). Differences in biomarker profiles according to ER status were observed.No markers were associated with pCR across all groups; however, significant associations were observed for two markers in individual groups. High HER2 was significantly associated with higher pCR rates  contains supplementary material, which is available to authorized users. Hoffmann-La Roche Ltd., Basel, Switzerland) is directed at the dimerization domain of HER2 and inhibits dimerization with other HER receptors while stimulating antibody-dependent cell-mediated cytotoxicity (ADCC) [\u00ae, F. Hoffmann-La Roche Ltd.) binds to the transmembrane domain to inhibit mitogenic signaling, block HER2 cleavage, and stimulate ADCC [Human epidermal growth factor receptor 2 (HER2) is the clinically validated biomarker for HER2-targeted therapies, several of which are approved in the neoadjuvant, adjuvant, and metastatic settings for HER2-positive breast cancer. Pertuzumab (PERJETAy (ADCC) \u20133. Trastate ADCC \u20136. Due tate ADCC .\u00ae, Sanofi-Aventis, Paris, France) (group B) had a significantly higher pathologic complete response (pCR) rate compared with those treated with trastuzumab plus docetaxel (group A), pertuzumab plus trastuzumab (group C), or pertuzumab plus docetaxel (group D)  [In the NeoSphere study, patients treated with neoadjuvant pertuzumab, trastuzumab, and docetaxel (Taxoterectively) . The comHER2-positive/estrogen receptor (ER)-positive and HER2-positive/ER-negative breast cancer are known to have different patterns of gene expression, and treatment outcome seems to be driven by different biologic pathways , 11\u201314. HER2, with regards to pCR, as p95 was previously reported to predict worse outcomes in patients with HER2-positive breast cancer [We assessed a panel of biomarkers, in tumor specimens and in sera, to characterize the molecular profile of the biomarker population of NeoSphere, and to explore biomarkers correlated with different treatments and/or different subsets of patients in this trial. The objective of this exploratory analysis was to identify those biomarkers (or combinations of biomarkers) with the best association (positive or negative) with pCR in response to the treatment regimens used in the NeoSphere study. In particular, we attempted to identify biomarkers that would predict a benefit from the addition of pertuzumab to a trastuzumab-based regimen. The markers tested included those that are involved in downstream signaling of HER2, belong to a group of related receptor tyrosine kinases that could serve as salvage routes for an inhibited HER2 pathway, or are ligands of HER family proteins that induce activation of the HER2 pathway. We also assessed the presence of truncated forms of HER2, including p95t cancer .in situ lesions were allowed [The study design and patient characteristics have been reported previously . Briefly allowed .Collection of core biopsies, sera, and whole blood from all patients was mandatory at baseline. Tumor samples were obtained as formalin-fixed, paraffin-embedded tissue. Tissue obtained after the neoadjuvant treatment period was derived from resection specimens.in situ hybridization (FISH), RNA extraction, quantitative reverse transcription polymerase chain reaction (qRT-PCR), and DNA isolation were performed centrally by Targos Molecular Pathology GmbH, Kassel, Germany. Targos followed the protocols and processing instructions developed by Roche Diagnostics GmbH, Penzberg, Germany. Commercially available assays or kits were used where specified, and performed according to the manufacturer\u2019s instructions. All other assays were developed by Roche Diagnostics for exploratory research purposes only.Tissue processing, immunohistochemistry (IHC), fluorescence Expression of HER2 , HER3 , insulin-like growth factor 1 receptor , phosphatase and tensin homolog , and pAKT  were assessed by IHC, and a modified H-score  was deriTherefore the modified H-score has a maximum value of 400 instead of the standard H-score of 300. The percentage of cells stained with an intensity of 0 was used only for quality control. Cases with no staining on the tissue section were assigned a score of 0. Modified H-scores were calculated for subcellular compartments for which specific staining was identified and for which there was a biologic rationale for the subcellular location of the respective marker (e.g. for PTEN and AKT nuclear staining).Image acquisition and analysis of HER2 staining intensity took place at the Royal Marsden Hospital  using the Ariol image analysis system (Leica Microsystems (Gateshead) Ltd., UK) equipped with a BX61 microscope  and a black and white MegaPlus ES 4.0/E camera . Slides were scanned and analyzed as previously described , except HER1, HER2, HER3, Amphiregulin (AREG) and Betacellulin mRNA levels in tumor tissue were assessed relative to the G6PD gene by qRT-PCR . c-Myc amplification was assessed by FISH .PIK3CA) on tumor DNA were performed using TaqMan-PCR  at Roche Translational Research Sciences . This led to a technical success rate of approximately 60%. To increase the sample size, a different method requiring less DNA input was applied at Genentech Laboratories, San Francisco, CA, USA. DNA was extracted from IHC-stained slides, amplified, and subsequently assessed using the DxS assay , which detects mutations E542K, E545K/D, and H1047R in exons 9 and 20. Mutational analysis per exon is presented to allow for pooling of the data on 328 cases overall. PIK3CA subgroups were defined based on the presence or absence of any mutation (mutant versus wild-type). \u201cWild-type\u201d was only assigned to samples in which all reactions gave a valid result for \u201cno mutation.\u201d If one or more reactions failed, that sample was classified as \u201cnot assessable.\u201dMutational analyses of eight mutations at four hot spots in exons 7, 9, and 20 within the gene encoding the catalytic subunit of phosphoinositide 3-kinase (Enzyme-linked immunosorbent assay (ELISA) was used to detect AREG, EGF, serum HER2 extracellular domain (sHER2), and transforming growth factor alpha (TGF\u03b1) in serum using an immunologic multiparametric chip technique (Roche Diagnostics). Levels of each serum marker were compared at baseline and at surgery in matched pairs from the same patients. Truncated forms of HER2 (the intracellular domain (ICD) and HER2 extracellular domain (ECD), where a ratio <1 indicates the presence of truncated forms), were measured in formalin-fixed, paraffin-embedded breast cancer tissue as described by Kr\u00fcger et al. .PIK3CA mutation and c-Myc amplification, where cutoffs were applied following a biologic rationale (wild-type versus mutant PIK3CA and c-Myc:centromere ratio \u22652). Instead of a data-driven cutoff, we used a prespecified median cutoff to reduce the number of false-positive findings due to the concomitant multiple testing and optimal cutoff selection. Box and whisker plots and summary statistics were used for initial data exploration and selection of relevant biomarkers. Spearman\u2019s correlation was performed to identify the correlated biomarkers. Biomarkers with measurements near the limit of quantification were excluded from analyses.The patient population used (the biomarker population) was a subset of the intent-to-treat (ITT) population that contributed meaningful data to the analysis  and biomarkers were assessed in the overall biomarker population using the Chi-square test.The association between biomarkers and pCR by treatment group were assessed by the Cochran\u2013Mantel\u2013Haenszel Chi-square test, stratified by hormone receptor status and breast cancer type. The treatment interaction test was performed for groups A and B to analyze the interaction between biomarkers and treatment in the association with pCR.Analyses of the association between biomarkers and clinical variables, and of the association between biomarkers and pCR by treatment group, were repeated in ER-positive and ER-negative subgroups. These analyses were exploratory and secondary in nature, and therefore were not taken into account when adjusting for multiple comparisons.AREG and Betacellulin measured by qRT-PCR were generally very low (less than the limits of variability for these assays); hence, detailed interpretation of the data was not considered meaningful. The baseline levels of all biomarkers were well-balanced across all four treatment groups   while the remaining biomarkers showed no significant difference when adjusted for ER status and breast cancer type  Fig.\u00a0. These f02) Fig.\u00a0. In grouIn an exploratory analysis performed on truncated forms of HER2 without using high/low cutoffs, there was no association observed between pCR and these truncated proteins via the HER2 ECD/ICD ratio Fig.\u00a0.Fig. 3HuP\u2009=\u20090.0236) with a large benefit from the combination of pertuzumab, trastuzumab, and docetaxel in the group with expression of HER2 above the median (odds ratio (OR) 2.07 ) and no significant benefit for low HER2 expression. However, clustering of H-scores within a small dynamic range .A comparison of baseline levels of the serum markers AREG, EGF, TGF\u03b1, and sHER2 between patients achieving pCR and those with residual disease did not predict pCR , EGFR mRNA expression, sHER2, HER2 mRNA expression, and membrane HER2 protein expression were higher in ER-negative samples  with ER-negative tumors (P\u2009=\u20090.05) but not ER-positive tumors (P\u2009=\u20090.21). Detailed analyses of biomarker levels by ER status are available online  but not the ER-positive subgroup (P\u2009=\u20090.54)  versus group A (trastuzumab plus docetaxel) in the ER-negative (54) Fig.\u00a0.Fig. 6InEGFR mRNA, HER2 mRNA, and HER2/HER3 mRNA were associated with ER-negative disease, while higher levels of HER3 protein, IGF1R protein, serum AREG, AREG mRNA, and HER3 mRNA were associated with ER-positive disease. Other clinical variables were associated with higher levels of certain biomarkers; however, no clear biologic explanations were evident and multiplicity of testing may have introduced bias.Higher levels of HER2 protein, cytoplasmic PTEN, sHER2, c-Myc) of cases. While no new single marker could be confirmed as predictive of treatment benefit, these analyses revealed several important observations that will impact future trial designs.NeoSphere demonstrated that mandatory biomarker sampling is feasible in a clinical trial setting. Samples were available from nearly all patients and the planned panel of biomarkers could be assayed reliably in 99.8% (HER2) to 65.9%  using both the modified H-score and digital image analyses. The digital readout resulted in a wider dynamic range compared with the manual scoring, showing a more pronounced effect in predicting pCR. While digital image analyses allowed us to better discern the pCR and non-pCR subgroups, HER2 levels remained highly overlapping between patients experiencing pCR versus patients not experiencing pCR and did not allow us to define clearly distinct populations that were either clinically or biologically meaningful.PIK3CA mutational status appears to have a relevant role in defining the likelihood of pCR with all treatment regimens tested in NeoSphere. However, while a decreased benefit was observed, the magnitude of the treatment effect with the addition of pertuzumab was maintained . This was similar to associations reported in the CLEOPATRA trial [PIK3CA mutant tumors, regardless of treatment regimen [PIK3CA mutations in exon 9 were linked to a lack of sensitivity to HER2-directed monoclonal antibodies. Although independent confirmation is needed, due to the lower frequency and lack of statistical power for exon 9 mutations, this finding might be explained by the different mechanisms and downstream effects that are proposed based on preclinical observations for the gain of function mutations in helical (exon 9) versus kinase (exon 20) domain [The RA trial . CLEOPAT regimen . Interes) domain .PIK3CA mutations at exons 9 and 20, although the benefit from pertuzumab was maintained regardless of mutation status [PIK3CA mutant tumors regardless of treatment regimen [PIK3CA mutations had worse outcomes compared with those with wild-type tumors when treated with lapatinib plus capecitabine [PIK3CA mutation on outcome, either when given as monotherapy or in combination with other therapeutics such as PI3K inhibitors, with the goal of improving the poor prognosis of patients carrying PIK3CA mutations. The data from NeoSphere suggest that such an approach could be useful only in tumors carrying the activating exon 9 mutation.In CLEOPATRA, there was an association between poorer prognosis and pooled n status . Similar regimen . In addicitabine . This waOur results also provide clinical support for the blockade of HER2 cleavage by trastuzumab . TrastuzAnother relevant aspect that emerged from our analyses is the distinct difference between ER-positive and ER-negative tumors . HER2-poA limitation of the biomarker analysis was that there was a narrow range of HER2 protein levels with little numerical difference between cutoffs, hindering an appropriate exploration of HER2 protein-related impact on treatment outcome. In addition, there was no significant difference in the pCR rates of patients in the subgroups with higher and lower HER2 levels, who received pertuzumab plus trastuzumab without docetaxel (group C). As the chemotherapy backbone is not known to impact HER2-related effects, the association between HER2 protein levels and pCR rates should have been detectable in both of the groups receiving trastuzumab plus pertuzumab.PIK3CA mutation at exon 9 is limited by the small sample size and warrants further exploration in larger datasets.Given that we were limited by small numbers of patients in some subpopulations, our analyses did not provide any additional predictive markers supporting a refinement of the HER2-positive target population treated with trastuzumab, pertuzumab, and docetaxel. It should be acknowledged that the use of the median cutoff for biomarker assessment could have overlooked a predictive value of some of these biomarkers at different, biologically meaningful, cutoffs that have not been explored in this study. However, our analysis did highlight the different biology of ER-positive and ER-negative HER2-positive tumors. The observation of a lower likelihood of pCR with trastuzumab, pertuzumab, and docetaxel in tumors harboring In conclusion, our data show that conventional assessment of HER2 by IHC or FISH should continue at this time, and that HER2 remains the only biomarker suitable for patient and/or regimen selection in this population. The observations in NeoSphere, however, may guide future neoadjuvant trial designs."}
+{"text": "HER2 is overexpressed in 20% of invasive breast cancers (BCs) and correlates with a more aggressive disease. Until the advent of targeted agents, HER2 was associated with worse outcomes. Rationally designed HER2-targeted agents have been developed and introduced into clinical practice for women with HER2-amplified BC, improving disease-free and overall survival for primary and metastatic tumors. Trastuzumab, a recombinant humanized anti-HER2 monoclonal antibody, combined with chemotherapy, remains the standard of care for patients with HER2-positive BCs. However, many patients do not respond to this agent, whereas newer drugs have proven to be efficacious in clinical trials. The identification of biomarkers that select sensitive tumors and patients who will benefit from these new agents would help the incorporation of these therapies, limiting the risk of side effects and overtreatment and improving the outcomes of all patients with early-stage HER2-positive BC. We review the mechanisms of action of HER2-targeting agents, focusing on the involvement of the immune system and related predictive biomarkers. The tyrosine kinase HER2, with the other members of the HER (human EGF receptor) family of receptor tyrosine kinases , controls many signaling pathways in various cellular functions, including proliferation, migration, survival, DNA repair, and angiogenesis  of HER2 and, with or without chemotherapy, is the basis for systemic treatment of metastatic and early HER2-positive BC . AlthougDespite the therapeutic options that are available, the clinical benefit of trastuzumab and its combination with other HER2-targeted therapies that have complementary mechanisms of action\u2014the dual blockade approach\u2014remain modest, with many patients who do not improve survival with these agents. Many studies have been performed on the mechanisms of trastuzumab action and the efficacy and resistance of second-generation HER2-targeting compounds to identify patients in whom the therapeutic effects of these tailored therapies can be optimized.We review mechanisms of action of these drugs, focusing on the involvement of the immune system and the related biomarkers that have potential value in selecting patients for the most appropriate treatment option in neoadjuvant-adjuvant settings.The treatment of HER2-positive BC with MAbs and TKIs aims to impede uncontrolled tumor growth and invasiveness by blocking the intracellular signals that are derived from HER2. In addition to inhibiting oncogenic stimuli, the efficacy of HER2-targeting agents in BC is also based on their ability to engage antitumor immunity .Trastuzumab  uses several mechanisms to block HER2 signaling  Figure , underlyMoreover, trastuzumab inhibits the proteolytic cleavage of HER2, preventing shedding of the extracellular domain (ECD) and the generation of phosphorylated truncated p95-HER2, which has been implicated in tumor growth and progression ; this ac\u03b3R) . The efficacy of trastuzumab is lost in Fc\u03b3R-deficient mice and on inhibition of Fc\u03b3R engagement in preclinical models [\u03b3R reduces the efficacy of trastuzumab in BC patients [\u03b3RIIIA (CD16) and are the major effectors of ADCC. Consistently, it has been reported that patient response to trastuzumab monotherapy is associated with robust tumor infiltration of lymphoid cells [in vitro antibody-dependent cellular cytotoxicity [\u03b3 (IFN\u03b3) [One of the most significant mechanisms of action of trastuzumab is the antibody-dependent cellular-mediated cytotoxicity (ADCC) . Trastuzl models . Similarpatients , 17. NK id cells \u2014primarilid cells \u2014and a grtoxicity , 21. We toxicity \u2014NKG2D ex\u03b3 (IFN\u03b3) .\u03b3R on macrophages (Another recent study reported that trastuzumab induces antibody-dependent cellular phagocytosis- (ADCP-) mediated cell death through recognition of trastuzumab-opsonized cells by Fcrophages . Anti-HE\u2212/\u2212 mice, which lack T and B lymphocytes [Other studies that have aimed to determine the function of the immune system in trastuzumab activity revealed a critical role of adaptive immune cells \u201327. Antiphocytes , and thephocytes , 26. CD8phocytes , 26. Acc\u03b3 and IFNAR1 (type I IFN receptor) [\u03b3-producing CD8+ T cells. In addition, trastuzumab, through its Fc region, increases HER2 uptake by dendritic cells, facilitating cross-presentation of HER2 peptides and activation of antigen-specific T cells [\u03b3 [Stagg et al. demonstrated that trastuzumab depends in part on the antitumor effects of IFNs using neutralizing antibodies to IFNeceptor) . They pr T cells . In supp T cells . These ccells [\u03b3 . The samcells [\u03b3 .\u03b3, leading to their recognition and death [\u03b3 and tumor necrosis factor \u03b1 (TNF\u03b1), contribute to the induction of a cytotoxic antitumor response that cooperates with trastuzumab to upregulate MHC-I on HER2-positive BC cells, facilitating their recognition and lysis by CD8+ lymphocytes [\u03b3 enzyme-linked immunosorbent spot analysis (ELISPOT) than non-pCR patients after treatment [Mortenson et al. demonstrated that also CD4+ T cell participates in anti-HER2 therapy: CD4 depleting antibodies reduce antitumor activity of anti-HER2 MAbs that exert their effect also through a CD4-dependent antitumor-specific response . Upon trnd death . CD4+ T-phocytes . Accordireatment . Moreovereatment . Signalireatment . Per thereatment .Although trastuzumab significantly increases anti-HER2 humoral responses (against the extracellular and intracellular domains) primarily in metastatic patients with objective responses , 36, prein vitro [The monoclonal antibody pertuzumab  binds to the extracellular domain of HER2 and prevents the ligand-mediated dimerization of HER2 with HER1 and HER3 by steric hindrance  Figure . In partin vitro .Based on its synergistic effects when combined with trastuzumab versus alone as a monotherapy , 41, mosADCC is one of the most important mechanisms of action of trastuzumab and pertuzumab, as evidenced by the rise in NK cells that infiltrate and penetrate deeper into the tumor burden of mice that harbor trastuzumab-resistant JIMT-1 cells and have been treated with trastuzumab and pertuzumab compared with mice that have been given each agent individually . Based oMany tyrosine kinase inhibitors (TKIs) have activity in trastuzumab-resistant BC and can be used as alternatives to block HER2 signaling. Among such emerging HER TKIs , lapatinin vitro and in vivo by inhibiting HSF1 (heat shock transcription factor 1) and its target, HSP90 [\u03b3H2AX foci [Lapatinib downregulates phospho-HER2 (p-HER2), p-EGFR, and p-ERK and promotes mutant p53 degradation t, HSP90 . In addi2AX foci . The ant2AX foci . In conj2AX foci .\u03b3-secreting CD4+ and CD8+ T cells in a Stat1-dependent manner [\u03b3-secreting CD8+ cells.By blocking the tyrosine kinase domain of HER2, lapatinib elicits the accumulation of HER2 on the cell membrane  in the Bt manner . In contin vitro and in cells with innate and acquired trastuzumab resistance [Neratinib  is an oral pan-HER inhibitor that bonds covalently with a conserved cysteine residue (Cys-773) in the kinase domain of HER, leading to its irreversible inhibition and thus blocking the pathways that lie downstream of EGFR, HER2, and HER4 . Its spesistance , 57. Liksistance , 57. Nersistance .Trastuzumab was approved for metastatic HER2-positive BCs in 1998 by the FDA after a phase III trial demonstrated that its addition to standard chemotherapy extended the time to progression from 4.6 to 7.4 months and reduced the relative risk of death by 20% .p value < 0.001) with no additional toxicity [p value < 0.001) in HER2-positive patients who received trastuzumab versus those who did not [Neoadjuvant treatment with trastuzumab and chemotherapy was introduced into clinical practice, based on results of 3 phase III trials that recorded higher pathologic complete response (pCR) rates in the trastuzumab arm , comparetoxicity . Moreove did not . Also, i did not .n = 13493 women) showed that survival in trastuzumab-treated patients was superior in terms of DFS (risk ratio (RR): 0.62; 95% CI: 0.56\u20130.68) and mortality  [In the adjuvant setting, based on the results of 4 large trials  .In analyses of \u201creal-world\u201d treatment, patients who were given trastuzumab for early-stage HER2-positive BC had 5-year DFS and OS rates that were comparable with those in randomized trials. Of 476 patients in the Netherlands, those who were treated with trastuzumab had a superior DFS  than subjects who underwent chemotherapy alone . A retrop < 0.0001) [Pertuzumab was approved by the FDA in 2012 for use in combination with trastuzumab and docetaxel for patients with HER2-positive MBC who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease, based on a multicenter, randomized, double-blind, placebo-controlled trial (CLEOPATRA) in which its addition to trastuzumab and docetaxel improved progression-free survival  . In 2013 0.0001) , whereas 0.0001)  (Table 1p = 0.045), despite the 3-year DFS rising modestly from 93.2% to 94.1% [Positive results were recently published for the phase III APHINITY trial, comparing the activity of adjuvant pertuzumab, trastuzumab, and chemotherapy versus trastuzumab and chemotherapy. The study met its primary endpoint and showed that the dual blockade approach effected a statistically significant reduction in the risk of recurrence of invasive disease or death compared with trastuzumab and chemotherapy alone , based on a phase III study that compared lapatinib/capecitabine with capecitabine alone in patients with MBC who progressed after chemotherapy/trastuzumab, in which TTP improved from 4.4 to 8.4 months . Lapatinp < 0.001) (779 patients) [p = 0.003) [Dual blockade of HER2 with trastuzumab and lapatinib has been examined in the neoadjuvant treatment setting in 4 randomized studies , compariatients) . Althoug= 0.003) .p = 0.0480) with concomitant dual blockade compared with trastuzumab alone was not statistically significant  [Dual blockade in the adjuvant setting with trastuzumab and lapatinib in combination with taxanes was tested in 8381 women in the phase III ALTTO trial, but the 16% improvement in DFS  .Neratinib has been investigated in all settings (reviewed in ). In thep = 0.0091) [p = 0.0013) than HR-negative patients .In the adjuvant setting, neratinib has recently been approved by the FDA for extended treatment of early-stage HER2-positive BC , based o 0.0091) . NotablyAll current data (reviewed in ) suggestGiven the availability of effective agents, biomarkers that differentiate patients who actually need new adjuvant therapies must be identified. Several efforts have been made in the last decade to discover biomarkers that predict who might benefit from trastuzumab, but most have failed to be consistently validated in tumor samples from randomized clinical trials (reviewed in ).New high-throughput genomic technologies have increased the rate of discovery of potential markers with prognostic or predictive value. These technologies demonstrated the intrinsic molecular heterogeneity in clinically HER2-positive BCs. The PAM50 classifier identified all of the intrinsic subtypes in HER2-amplified BCs, 50% of which are classified HER2-enriched (HER2-E) . These tERBB2 and ESR1 mRNA levels influence the degree of benefit that is received from adjuvant trastuzumab [ERBB2 and ESR1, is predictive of early relapse in adjuvant setting [ESR1 and ERBB2 levels, as determined by mRNAseq, when considered as continuous variables, were individually linked to pCR, and their incorporation into an exploratory multivariate model removed intrinsic subtype, HER2 amplicon signature, and clinical assays for ER or HER2 from the model in the CALGB 40601 trial [ERBB2 and ESR1 were confirmed in the NeoALTTO trial across arms [ESR1 and ERBB2 RNA can be implemented in the clinical setting, but their predictive ability in HER2-positive BC supports the superiority of evaluating their mRNA levels over standard IHC tests and suggests that they better mirror activity of HER2 and tumor-addiction to its downstream signals, as PAM50 did.A retrospective analysis of the NSABP B-31 study indicated that stuzumab . Similar setting . In the 01 trial . The levoss arms  as the moss arms  and in toss arms   , single-Although much work remains in the effort to refine and optimize biomarkers predictive of trastuzumab/HER2 double-blockade benefits and their application in patients, the reported robustness of immune infiltration/TIL evaluation  and the The implementation of immune markers in everyday clinical practice requires robust assessment of their clinical utility and of the test analytical and clinical validity, other than the understanding of their added predictive value, if any, on tumor intrinsic characteristics  and the identification of the best performing immune-related marker. Indeed, TIL evaluation on H&E slides is an easy method to provide raw information on the complexity of the tumor immune microenvironment, but it does not give information on the composition and functional status of the immune infiltrate that can be obtained using immune gene signatures, as evaluated by mRNA profiling. Several efforts have been made to standardize TIL assessment, and guidelines have been published and continuously improved , 113. ThIn an attempt to understand the clinical utility of immune markers in predicting response to trastuzumab in CHERLOB study, TILs failed to provide an independent prediction of pCR beyond PAM50 and were outperformed by immune-related gene signatures . These dSeveral key questions remain regarding the immune-biology of HER2-positive tumors that could help in developing new strategies to modulate immune response and improve anti-HER2 therapy efficacy; what drives immune infiltration in tumors is an ongoing area of research. It has been hypothesized that immune infiltrate is dictated by high mutational burden corresponding to a greater amount of neoantigens. Although cancer neoantigens are required for mounting an anticancer immune response, recent evidence showed that mutational burden does not correlate with the presence or absence of CD8+ T cells in the tumor microenvironment of melanoma and with T cell signature in any cancer type . AccordiIndependently from TIL recruitment mechanisms, another important issue in the prospect of augmenting trastuzumab activity by strategies of immune modulation regards the activation status of such infiltrating immune cells. It is possible that the presence of TILs in the tumor burden mirrors an exhausted immune response, the presence of intratumoral immune suppression or a near-equilibrium immune state with immune surveillance able to only partially control the tumor growth of immunogenic subclones slowing the genomic diversification of the cancer . In suppEfficacy of drugs in those patients with immune-enriched tumors suggests that chemotherapy and HER2-targeting agents may relieve the preexisting immune suppression and/or tilt the balance in favor of immune surveillance . In thisTo activate antitumor immunity, recent preclinical data suggested that one strategy could be the blocking of PD-1/PD-L1 interaction, since it synergizes with anti-HER2 therapy . Accordi"}
+{"text": "Hormone receptor status has major implications for treatment and survival of breast cancer. Yet the impact of hormone receptor status on outcome after Trastuzumab has received little attention. The objective here was to explore any differential effects of Trastuzumab treatment (Trast +ve) on Luminal B HER2 or HER2+(ER\u2212) breast cancer subtypes.A cohort of 469 HER2 receptor-positive breast cancers was categorised by molecular subtype and Trastuzumab treatment. Effects of Trastuzumab treatment on survival, locoregional recurrence and distant metastasis were investigated by subtype, using univariate and multivariate analysis.p\u00a0<\u00a00.001) and OS (p\u00a0<\u00a00.001), while Trast +ve HER2+(ER\u2212) patients had significant improvements in 5-year DFS (p\u00a0=\u00a00.012) alone. Only Trast +ve Luminal B HER2 cancers displayed a significant reduction in LRR rates (p\u00a0<\u00a00.001). A significant reduction in distant metastasis rates was seen in Trast +ve Luminal B HER2 (p\u00a0<\u00a00.001) and HER2+(ER\u2212) (p\u00a0=\u00a00.009) cancers. Interestingly, bone metastasis rates in Trast +ve Luminal B HER2 cancers demonstrated the greatest reduction (36.2\u20136.7%). Multivariate analysis of Trast +ve patients found no difference in distant metastasis rates (p\u00a0=\u00a00.96) between subtypes. Significantly, lower LRR rates were seen in Trast +ve Luminal B HER2 cancers, compared to Trast +ve HER2+(ER\u2212) (p\u00a0=\u00a00.018).Trast +ve Luminal B HER2 patients had significant improvements in 5-year DFS  contains supplementary material, which is available to authorized users. Advances in molecular profiling have allowed breast cancer to be categorised into clinically relevant molecular subtypes. \u20133. In apTrastuzumab is a monoclonal antibody that binds to the HER2 receptor and interferes with the HER2-mediated signalling cascade, preventing proliferation and eventually leading to cell death . TrastuzWhile improvements in survival in HER2 receptor-positive cancers have been demonstrated in multiple studies, few studies have examined if Trastuzumab treatment has a varied response between Luminal B HER2 and HER2+(ER\u2212) breast cancers. The aim of this study was to assess the impact of Trastuzumab therapy on the survival or outcome on the two HER2 receptor-positive breast cancer subtypes, before and after the introduction of Trastuzumab as part of the adjuvant treatment regime.This study group consists of all patients with HER2 receptor-positive breast cancers treated at a tertiary referral unit entered into a prospectively maintained database from 1991 to 2014. Only patients with a definitive HER2 receptor-positive subtype were included. All clinical pathological details and treatment regimes were analysed. Hormone receptor-positive patients received hormone therapy, as per standard clinical treatment protocols at the time of diagnosis. Clinically, testing for HER2 receptor status began at our centre in 1999. In order to find HER2 receptor-positive patients not treated with Trastuzumab, we used a cohort of patients identified using retrospective testing of pathology samples. A cohort of HER2 receptor-positive patients who received no Trastuzumab treatment was provided by retrospective testing of HER2 receptor status on patients included on a prospectively collected tissue microarray (samples from 1994 to 2001). Historically in our program, Trastuzumab therapy was introduced as adjuvant therapy in 2006, prior to this it was available only to patients recruited on clinical trials. Patients were categorised as received adjuvant/neo-adjuvant Trastuzumab (Trast +ve) or no Trastuzumab treatment (Trast \u2212ve).Breast cancer subtypes were defined using ER, PR and HER2 receptor status. Luminal B HER2 was defined as  and HER2+(ER\u2212) as  according to standard clinical pathological guidelines. The ER and PR receptor status were determined independently by clinical pathologists using immunohistochemistry as per ASCO guidelines (ALLRED score >2 or more than 1% stain positive). The HER2 receptor status was identified by Herceptest, as part of the routine clinical evaluation, with a score of 3+ considered positive. Any +2 inconclusive results were confirmed using a FISH testing as per ASCO guidelines, with a HER2/CEP17 ratio greater than two considered amplified.Overall survival (OS), disease free survival (DFS), and patterns of recurrence were determined. The 5-year DFS & OS were determined and only patients who had completed 5\u00a0years of follow-up were included in the analysis.Breast cancer recurrence was defined as a return of cancer after treatment and after a disease free period. Only stage I\u2013III breast cancers were included for this section of the analysis. Recurrence was divided into LRR and distant metastasis. LRR is defined as recurrence at the same site of the primary cancer or the regional lymph nodes, while distant metastasis is recurrence at a distant site from the primary cancer.p value of less than 0.05 was considered statistically significant. The Kaplan\u2013Meier method was used to determine survival distributions. The log rank was used to determine any statistically significant differences in survival between the indicated groups. Cox regression was used for multivariate analysis, with logistic regression used to analyse categorical data.Statistical analysis was performed using R statistical software version 3.2.3. A This study was conducted in accordance with the granted National University of Ireland Galway and University College Hospital Galway ethical approval. Informed consent was obtained from all patients. All patients had histologically confirmed breast cancer and all relevant clinicopathological and demographic data were obtained from a prospective breast cancer database.The study consisted of 468 HER2 receptor-positive patients eligible for this study, treated in our institute between 1991 and 2014. From these, 287 (61%) were found to be Luminal B HER2, with the remaining 181 (39%) patients HER2+(ER\u2212). The median age of patients was 63 and the median follow-up was 49\u00a0months. The majority of the overall cohort was recruited after Trastuzumab received approval for adjuvant treatment in 2006 (Table\u00a0p\u00a0<\u00a00.001). Furthermore, 263 (91.6%) of the Luminal B HER2 cancers received adjuvant hormone therapy. In the series recurrence occurred in 94 (20.1%) patients, of which 15 (3.2%) had LRR alone. 54 (11.5%) patients had distant metastasis alone and 25 (5.3%) patients had both LRR and distant metastasis. There was no significant difference in the distribution of age, stage or treatment of cancers between the two subtypes  patients were treated with Trastuzumab (Trast +ve). The clinical pathological details of the cohort are listed in Table\u00a0p\u00a0<\u00a00.001) and OS (p\u00a0<\u00a00.001)  but not OS (p\u00a0=\u00a00.135)  subtypes Figure S1) and Trastuzumab treatment significantly improved overall survival in both subtypes . No difference was seen in survival between the two subtypes in either the Trast \u2013ve or Trast +ve patients. Next to assess the impact of Trastuzumab introduction on each subtype, the 5-year DFS and OS were compared between the Trast \u2013ve and Trast +ve groups in both subtypes. Analysing the DFS and OS by subtype, an increased survival rate is seen for Trast +ve patients in both Luminal B HER2 and HER2+(ER\u2212) patients. However, a greater improvement was seen in Luminal B HER2 patients. Luminal B HER2 cancers had a statistically significant improvement in both 5-year DFS ( and Trasp\u00a0=\u00a00.004) and OS . However, no significant increase in hazard ratio was seen in Trast \u2013ve HER2+(ER\u2212) cancers compared to the Trast +ve group in 5-year DFS  or OS .No significant increased risk was seen in the HER2+(ER\u2212) subtype when compared to Luminal B HER2 cancers for either 5-year DFS  or 5-year OS  (Table S1). Analysing risk factors for survival, higher grade was not associated with worse outcome but Trastuzumab given in the neo-adjuvant setting was associated with a significant improvement in 5-year DFS . A multivariate cox proportional hazard model analysis of survival was performed, where the model was controlled for age, stage, grade and chemotherapy treatment  and in HER2+(ER\u2212)  (Table\u00a0p\u00a0<\u00a00.001); however, there was no significant reduction in HER2+(ER\u2212) breast cancers . Trastuzumab treatment induced a significant reduction in distant metastasis rates in both subtypes, with a greater reduction observed in Luminal B HER2  compared to HER2+(ER\u2212) .Recurrences occurred in 52 (18.1%) of Luminal B HER2 breast cancers and 42 (23.2%) of HER2+(ER\u2212) breast cancers overall. A significant reduction in recurrence rates in Trast +ve patients was observed in both Luminal B HER2 . HER2+(ER\u2212) breast cancers did show decreases in all metastatic sites except for brain in Trast +ve patients; however, these reductions only approached significance in bone (p\u00a0=\u00a00.075), lung (p\u00a0=\u00a00.086) and liver (p\u00a0=\u00a00.075).Analysis of the effects of Trastuzumab treatment on distant metastasis by site of recurrence and subtype was performed Table\u00a0. For Trap\u00a0=\u00a00.557). Importantly in Trast +ve patients, a significantly lower odds ratio for LRR was seen in Luminal B HER2 cancers compared to HER2+(ER\u2212) . Distant metastasis rates to bone were the only significant difference between the two subtypes, in the no Trastuzumab group . Following Trastuzumab treatment, no difference was seen between subtypes in bone metastasis  but a significantly lower risk in brain metastasis is seen in the Luminal B HER2 cancers .Performing a multivariate analysis of recurrence risk by treatment, metastatic site and subtype Table\u00a0, no diffThe impact of Trastuzumab treatment has been well established, greatly improving survival and significantly reducing recurrence in HER2 receptor-positive breast cancers , 21, 22.Few previous studies have compared survival or recurrence rates between the two HER2 receptor-positive breast cancers since the introduction of Trastuzumab. Romond et al. compared survival between the two HER2 receptor-positive breast cancers and found at 4-year follow-up that hormone receptor status minimally influenced the response to Trastuzumab, although hormone receptor status was reported as a significant predictor in DFS . Our finPrevious studies demonstrated that bone was the most common recurrence site in Luminal B HER2 breast cancers and lung was most common for HER2+(ER\u2212) , 9. We sA potential reason for variation between subtypes could be that HER2 receptor over expression reduces the response to hormone therapy. Studies have observed increased hormone resistance rates in Luminal B HER2 cancers compared to Luminal A cancers , 28. CroAnother potential difference between subtypes could be the increased number of grade 3 cancers seen in the HER2+(ER\u2212) group. It has been shown that both HER2+(ER\u2212) and triple-negative breast cancers have worse outcomes and present with higher-grade cancer than Luminal cancers . AlthougIn patients receiving neo-adjuvant Trastuzumab chemotherapy, around 40% of patients will have a complete pathological response , 32. ThiThis study once again shows the benefit of Trastuzumab treatment in HER2 receptor-positive breast cancers, demonstrating the effects on both survival and recurrence rates. It also highlights how a targeted therapy has altered responses in related breast cancer subtypes, emphasising their molecular differences. Demonstrating a more positive impact of Trastuzumab treatment on Luminal B HER2 cancers supports the need to further characterise the mechanism of action of Trastuzumab in each subtype, suggesting that key differences remain to be defined. This work highlights the need to fully understand the subtype-specific effects and mechanisms of action of Trastuzumab therapy, which will allow truly individualised breast cancer management regimes to be implemented.Supplementary material 1 (DOCX 267\u00a0kb)Below is the link to the electronic supplementary material."}
+{"text": "Breast Cancer (BC) is a highly prevalent disease. A woman living in the United States has a 12.3% lifetime risk of being diagnosed with breast cancer [HER2 is a member of the epidermal growth factor receptor (EGFR) family. Other family members include EGFR or HER1, HER3 and HER4. HER2 can form heterodimers with any of the other three receptors, and is considered to be the preferred dimerization partner of the other HER or ErbB receptors .In addition to being an important prognostic factor in women diagnosed with BC, HER2 overexpression also identifies those patients who benefit from treatment with agents that target HER2, such as trastuzumab, pertuzumab, trastuzumab emtansine (T-DM1) and small molecules tyrosine kinase inhibitors of HER2 , 11, 127This review paper will concentrate on major biological pathways that ultimately lead to resistance to anti-HER2 therapies in BC, summarizing their mechanisms. Strategies to overcome this resistance, and the rationale involved in each tactics to revert this scenario will be presented to the reader. Since the approval of trastuzumab in the adjuvant setting by the FDA in 2006, most patients with HER2+ early BC are doing very well with standard trastuzumab therapy added to chemotherapy. Planned Joint Analysis of OS from NSABP B-31 and NCCTG N9831, demonstrated that the addition of trastuzumab to a taxane and anthracycline chemotherapy backbone resulted in a durable improvement in survival, after a median time on study of approximately eight and a half years. 2 and trastuzumab at 2 mg/kg for 12 weeks, followed by 9 months of trastuzumab in 406 women with HER2-positive, node-negative tumors \u2264 3 cm. Disease-free survival achieved an impressive result at 3 years of 98.7% (P < .0001), and the regimen was associated with great cardiac safety. [In fact, patients nearly diagnosed with localized HER2+ BC have an excellent prognosis, even if treated with less toxic adjuvant systemic therapy, as recently demonstrated by Dana Farber investigators . This noIn the metastatic setting, Slamon et al.  evaluateIncorporation of new agents, as evidenced by the CLEOPATRA trial, in which pertuzumab, a humanized monoclonal antibody that binds to HER2 at a different epitope than that at which trastuzumab binds, was added to the standard docetaxel and trastuzumab combination, and lead to striking improvements in PFS and OS in a cohort of advanced HER2+ BC patients, reaching the median OS boundary of almost 5 years. \u201315Despite this robust clinical benefit, anti-HER therapy resistance, either de novo or acquired, is an important clinical challenge in the management of BC patients. Research has been dedicated to a better understanding of the molecular mechanisms involved of trastuzumab resistance. The PI3K/AKT/mTOR pathway is an important growth factor pathway and a key effector of HER2 signalling. HER2 phosphorylation may lead to pathway activation. ConstituMany investigators evaluated trastuzumab benefit in patients enrolled in clinical trials in distinct disease scenarios, according to alterations in the PI3K pathway. Most of them failed to demonstrate a relationship between PIK3CA mutations and trastuzumab benefit. As an example, the FinHER adjuvant phase III trial genotyped 687 HER2+ BC patients. PIK3CA mutations were not statistically significantly associated with trastuzumab benefit, or survival outcomes.  SimilarlThe EMILIA trial compared the effectiveness of TDM-1 versus lapatinib and capecitabine in patients previously treated with trastuzumab. Samples from patients were prospectively collected for PIK3CA mutation analysis. Patients in the lapatinib arm with PIK3CA mutations had worse outcomes than those with wild-type PIK3CA, but the presence of PIK3CA mutations had absolutely no effect on PFS or OS in patients treated with T-DM1, suggesting that this drug might be an attractive alternative for patients harbouring this alteration. in vitro studies that initially identified PIK3CA mutation as a resistance factor for HER2-targeted treatment did not account for trastuzumab mediated antibody dependent cellular cytotoxicity (ADCC). Recognition of tumor cells opsonized by monoclonal antibodies, such as trastuzumab, is mediated through receptors expressed on effector cells, as well as monocytes, dendritic cells, and granulocytes. Upon recognition, these effectors induce tumor cell death. Dendritic cells capture the monoclonal antibody conjugated with tumor antigens released by dying cells in the form of immune complexes. Ultimately, these processed cells are presented to cytotoxic and helper T cells. As a consequence, both tumor-specific cytotoxic T cells and T-helper cells are activated, leading to tumor B-cell stimulation and expansion. The production of tumor-directed host antibodies is the final step in this important ADCC cytotoxic mechanism. [in vitro or in immunosuppressed models. Furthermore, trastuzumab is a human monoclonal antibody and therefore, unlikely to engender an immune reaction in a model system in vitro.The evidence described above is somehow contradictory to preclinical data. One important aspect to be taken into account is the fact that chanism.  Also, trchanism.  In fact,chanism.  PrecliniSurvival outcomes of HER2+ BC patients might be influenced by PIK3CA status. Biomarker analysis from the CLEOPATRA trial demonstrated that PIK3CA mutation was associated with worse survival outcomes among patients with advanced HER2+ BC. NevertheAdditionally, a group of researchers from Memorial Sloan-Kettering Cancer Center evaluated a group of 63 patients with HER2+ BC with disease recurrence after adjuvant trastuzumab treatment, or progressive metastatic disease on a trastuzumab-containing regimen. All patiThese authors also compared PTEN loss and PIK3CA mutation rate between 2 HER2+ BC cohorts of patients: one of them refractory to trastuzumab and the other unexposed to trastuzumab. They demonstrated that the combined rate of PTEN loss and PIK3CA mutation in the trastuzumab-refractory tumors was 71%, compared with 44% in the unexposed cohort, suggesting that trastuzumab exposure may lead to alterations in PIK3CA pathway.Therefore, evidence supporting the hypothesis that PI3K alterations might lead to worse prognosis in HER2+ BC, as well as resistance to anti-HER2 therapy, is mostly based on small retrospective series. At the present time, the first (and still only) actionable genomic alteration in BC, is amplification of HER2, and anti-HER2 therapy is required in all disease scenarios where this alteration is observed.Correlation between PI3K alterations and pCR achievement was extensively studied. Loibl and colleagues investigated whether the presence of a PIK3CA mutation affected the odds of achieving a pCR among patients enrolled in the GeparQuattro, GeparQuinto, and GeparSixto neoadjuvant clinical trials.  In thesep < 0.001), for patients with and without a PIK3CA mutation, respectively. [Of note, at the 2015 American Society of Clinical Oncology (ASCO) Meeting, investigators reported pCR rates according to PIK3CA status among HER2+ BC patients who received neoadjuvant trastuzumab, lapatinib, or both in addition to a taxane-based chemotherapy. Significantly lower rates of pCR were observed in PIK3CA mutant tumors after anti-HER2 treatment, namely 16.2% versus 29.6% (ctively. Table p=0.0067).[Therefore, much interest is focused on this important proliferative pathway that may contribute to trastuzumab resistance. Inhibition of mTOR has been shown to be an important therapeutic strategy in HER2+ BC. BOLERO-3 aimed to assess whether the addition of the mTOR inhibitor everolimus to trastuzumab might restore sensitivity to trastuzumab. Eligible patients for this trial had HER2+, trastuzumab-resistant, advanced BC who had previously received taxane therapy. Patients were randomized to receive daily everolimus (5 mg/day) plus weekly trastuzumab (2 mg/kg) and vinorelbine (25 mg/m2) or to placebo plus trastuzumab plus vinorelbine, in 3-week cycle. As a result, the addition of everolimus prolonged PFS from 5.78 months to 7.00 months . In PFS sBOLERO-1 also focuses on the strategy of targeting the PI3K/AKT/mTOR pathway. In this trial, everolimus was added to paclitaxel and trastuzumab in patients with metastatic HER2+ BC patients who had not received previous trastuzumab or chemotherapy for advanced BC within 12 months of randomisation. Primary endpoint was PFS, and secondary endpoints included OS, response rate (RR), and clinical benefit rate. The results were presented at the 2014 San Antonio Breast Cancer Symposium (SABCS) and published in Lancet Oncology. The studConsidering that mTOR inhibitors add a substantial amount of toxicity to therapy, biomarkers to identify patients who could derive more benefit from therapy are being studied. At the 2015 ASCO Meeting, researchers evaluated tumor tissue from patients recruited in BOLERO-1 and BOLERO-3. Exons of 282 cancer related genes were analyzed by next generation sequencing (NGS), and PTEN levels were evaluated by immunohistochemistry. Hyperactive PI3K pathway was defined as low PTEN levels or mutations in PIK3CA pathway. In both trials, patients with hyperactive PI3K derived more benefit from everolimus.Also, at 2013 ESMO  Conference, investigators presented data on patients from BOLERO-3 with low PTEN or high pS6 levels. Those inContrasting with these results, biomarker analysis from BOLERO-2, which involved 3,230 exons of 182 oncogenes and tumor-suppressor genes that were sequenced using next-generation sequencing, on 309 tissue samples, demonstrated a positive treatment effect in favor of everolimus across the various key genetic marker subgroups. In truthOther trials are currently being designed to specifically target the PI3K/AKT pathway in conjunction with HER2 itself, in order to hopefully achieve more durable and potent antitumor effects and overcome the resistant to treatment. These PI3K inhibitors are being introduced to the treatment of women with HER2+ BC in several stages of disease, from the neoadjuvant setting to the metastatic setting, after several lines of standard treatment.As an example, the NeoPHOEBE study (NCT01816594), recruited women with HER2+ newly diagnosed early BC larger than 2cm. Patients were randomized to receive neoadjuvant weekly paclitaxel and Trastuzumab in combination with an oral PI3K inhibitor, BKM120, or placebo. The study has been completed, and was conducted in two separate cohorts (PIK3CA mutated and PI3K3CA wild-type) using a two-stage approach. NCT02152943 is evaluating everolimus, letrozole, and trastuzumab.The combination of trastuzumab with a PI3K inhibitor was evaluated in a phase 1 clinical trial. Buparlisib plus trastuzumab was tested in a cohort of HER2+ metastatic BC patients resistant to trastuzumab-based therapy, with a manageable toxicity profile and preliminary evidence of clinical activity. Of note, inhibition of the PI3K/AKT/mTOR and RAS/MEK/ERK pathways was observed in paired tumor biopsies. Pan PI3KRecently, at ASCO 2015, an oral PI3K\u03b1 inhibitor, BYL719, was evaluated in combination with trastuzumab and a HER3 inhibitor, in a heavily pre treated HER2+ metastatic BC population (median number of previous therapy lines of 6). Clinical activity was observed in patients harbouring PIK3CA mutations. Nevertheless, gastrointestinal and metabolic toxicities were an important issue, warranting exploration of intermittent schedule regimens. The PIK3CA pathway may be targeted in other downstream points of the pathway, such as Akt. The Akt-inhibitor MK2206, was evaluated before surgery in patients with stage I, II or III BC with various combinations of ER, PR and HER2.Many other trials are being performing with the important aim to target the PI3K/AKT/mTOR pathway in conjunction with HER2. Toxicity associated with PI3K/AKT/mTOR pathway inhibitors may be taken into account, as well as the added financial cost. Deaths attributable to everolimus were seen BOLERO-1, due to pneumonitis, pulmonary embolism, respiratory failure, pulmonary edema, pneumonia, and cardiorespiratory arrest. Management of adverse events related to these drugs, especially when combined with chemotherapy, is of extreme importance.Therefore, the PI3K/AKT/mTOR pathway seems to play an important role in anti-HER2 therapy resistance. The optimal timing of targeting this pathway, either in the first line setting, or in a disease scenario where resistance is already established is yet to be determined. Also, the specific point of the pathway to be elected as the ideal target is still unclear. There are many options, ranging from mTOR-inhibitors to Akt-inhibitors and specific inhibitors of different isoforms of PI3K. Additionally, a balance between cost and side effects is of extreme importance in moving forward this strategy to clinical practice.The aminoterminal-truncated form of the HER2 receptor, that undergoes a proteolytic cleavage generating a truncated fragment, is denominated p95HER2 and is constitutively active. Also, p95HER2 fragments may arise through translation of the mRNA encoding HER2 from internal initiation codons. It has kThe presence of p95HER2 has been associated with worse survival outcomes in patients with localized HER2+ BC. Primary breast tumor tissues were evaluated by Western blot analysis for HER-2 protein forms, including p185HER-2 and p95HER-2. Authors found that a high level of p95HER-2 in primary tumor tissue correlated with reduced 5-year disease-free survival (DFS) . Differences in DFS were quite impressive between the two groups, namely 139 versus 32 months, for low and high levels of p95HER2, respectively.Despite being an independent prognostic factor in breast cancer, defining a group of patients with HER2+ disease with significantly worse survival outcomes, p95HER2 is also a marker of resistance to trastuzumab. Previous studies demonstrated that metastatic BC patients overexpressing p95HER2 had considerably lower response rates to trastuzumab compared with patients expressing full-length HER2. In this Other studies reported a correlation between elevated p95 expression and poor outcomes in response to trastuzumab treatment., 49In vitro experiments observed that chemotherapy sensitizes p95HER2/611CTF-positive patient-derived xenografts to trastuzumab, which may be related to HER2 stabilization induced by chemotherapy.[Interestingly, recent studies showed that tumors expressing the most active p95HER2 fragment, the so-called p95HER2/611CTF, indeed do respond to trastuzumab in combination with chemotherapy. The 611CTF fragment is highly oncogenic, because it spontaneously homodimerizes into a constitutively active form. In vitrootherapy. Another Larger studies are highly awaited for confirmation of p95HER2 as a biomarker of resistance or sensitivity to anti-HER2 therapy, enabling development of strategies to target this form of HER2. Evidence is accumulating indicating that trastuzumab alone is not effective in patients who have expression of p95HER2 isoforms. Figure Chemotherapy, in conjunction with trastuzumab, is essential to achieve response to therapy. Larger and well-controlled studies, using pre-defined clinical cutoffs for p95 expression and also blinded analyses are highly awaited.Insulin-like growth factor-I receptor (IGF-IR) is another pathway implicated in trastuzumab resistance. This recImportant data demonstrated that interaction between HER2 and IGFR-IR occurs in trastuzumab-resistant cells and that inhibition of IGF-IR tyrosine kinase activity may lead to decreased HER-2 phosphorylation with consequent restoration of trastuzumab sensitivity. This important cross talk between HER-2 and IGF-IR could potentially lead to clinical use of IGF-IR-targeted agents to block this receptor.In vitro studies demonstrated that inhibition of HER2 signaling using trastuzumab, and inhibition of IGF-IR signaling using a dominant negative construct produced synergistic growth inhibition of HER2-overexpressing breast cancer cells.[er cells., 56in vitro inhibition of IGF1R expression was made through small receptor tyrosine kinase inhibitors, response to trastuzumab was substantially improved, suggesting an interaction between HER2 and IGFR. [Of note, in experiments in which nd IGFR. Future clinical trials of HER2 and IGF1R-inhibitors are awaited to corroborate these preclinical findings. Analysis of potential predictive biomarkers to identify tumors that may achieve maximum benefit from this approach would be of great interest.c-MET is a receptor tyrosine kinase (RTK) encoded by the MET proto-oncogene that is largely expressed in epithelial/endothelial cells.  Upon binOverexpression of c-MET has been shown to contribute to the development of the invasive phenotype during BC progression. Poorly differentiated and invasive cell lines may express high levels of the receptor and ligation by HGF is associated with increased motility and invasiness.Previous trials have shown that overexpression of c-MET in BC primary tumors is strongly associated with worse disease-free survival compared to tumors without c-MET overexpression., 63MET expression might be associated with resistance to treatment in BC patients, even in a cohort of individuals co expressing ERBB2, in which a highly effective treatment, such as trastuzumab, is largely available.In fact, overexpression c-Met has emerged as a potential contributor to trastuzumab resistance and has been shown to be highly elevated in HER2-positive breast cancer cell lines and in 25% of HER2-positive breast cancer patients tissues., 65 LossCell line experiments demonstrated that foretinib, a multikinase MET inhibitor, combined with erlotinib or lapatinib, was capable of cell growth inhibition of MET-amplified or overexpressing cell lines. AdditionMany therapeutic strategies to target Met are currently under clinical development, including tyrosine kinase inhibitors and monoclonal antibodies, which could potentially be associated with anti-HER2 therapy in patients with BC overexpressing HER2 to optimize treatment and avoid tumor resistance. As an example, cabozantinib, a small molecule inhibitor of the tyrosine kinases c-Met and VEGFR2, is currently being evaluated in combination with trastuzumab, in HER2+ BC patients who have brain metastasis (NCT02260531).The proto-oncogene Src encodes for the non-receptor protein tyrosine kinase Src, which is involved in many cellular events, mediating cell proliferation and survival. de novo. In fact, data points to the fact that Src activation by itself is sufficient to confer trastuzumab resistance.[Src has extensive interaction with transmembrane receptor tyrosine kinases (RTKs) at the cell membrane, such as HER1 and HER2. Src activation confers resistance to trastuzumab, both acquired and sistance.In vitro targeting Src universally sensitized trastuzumab-resistant cells to trastuzumab treatment, and was able to suppress tumor growth in multiple preclinical resistance models. Other studies also demonstrated that Src activation is involved with trastuzumab mechanisms of resistance, and indicates poor prognosis in patients with HER2+ BC.[The relationship between SRC activation and patient response to trastuzumab-based therapies was previously studied in a cohort of 57 patients who were evaluated for SRC activation in primary breast tumors. As featured, patients with high amounts of phosphorylated Src (pSrc) in tumors demonstrated a lower clinical response rate and a higher progressive disease rate after trastuzumab therapy. Additionally, the OS of patients with high pSrc tumors (median 34.2 months) was significantly lower than that of patients with low pSrc tumors (median 57.9 months). In vitroHER2+ BC.Resistance to lapatinib was also demonstrated in Src activated cell lines. Saracatinib, a small molecule inhibitor of Src, was combined with lapatinib, and significantly prolonged survival of xenografted mice compared with saracatinib alone.Therefore, blocking Src interaction with HER2 is a promising strategy that might impact the management of HER2+ BC patients.Trastuzumab mechanism of action is dependent on the host immune system. As a consequence, trastuzumab is only partially effective in mice defective for the receptor of immunoglobulins (gamma receptor knockout mice). Innate and adaptive immune mechanisms are emerging as key players in modulation of the effects of HER2-targeted drugs.Therefore, sensitivity to anti-HER2 therapy depends on a well functioning host immune system. Loi et al. evaluated tumor PIK3CA mutations, lymphocyte infiltration, and RFS in an early HER2+ BC cohort of patients enrolled on the Finher Trial. , 73 In tIn the neoadjuvant setting, signals of immune system activation were associated with response to pertuzumab and trastuzumab in the Neosphere study. In this analysis, baseline core biopsies were collected from 387 out of 417 patients and evaluated by gene expression profiling. Patients identified as having low expression of PD-L1 had lower pathologic complete response rates (pCR). In contrast, individuals with high expression of STAT1 and IFNG, achieved high pCR rates, irrespective of estrogen receptor status.Tumor cells display genetic and epigenetic changes that provide plenty of tumor-associated antigens, which could potentially elicit host immune system recognition and tumor cell destruction. Avoidance of this host intrinsic defense mechanism is fundamental for tumor progression. As a consequence, immune-checkpoint proteins are frequently deregulated by tumors. CytotoxiAmong one of the first reports that recognized the importance of this rapidly evolving field in BC was presented at the 2013 SABCS. Breast tRecently, Perez et al. defined a group with enriched immune functions in patients enrolled in the N9831 trastuzumab adjuvant trial, based on the expression of 87 genes. Using geAnalysis of immune markers in HER2+ BC indicates that host immune system integrity is extremely important to trastuzumab response. Future clinical trials exploring patient immune system, with the ultimate goal of maximizing immune response, might result in great improvement in trastuzumab benefit and sensitivity.Table Lapatinib is a synthetic, orally active TKI that reversibly blocks phosphorylation of the epidermal growth factor receptor (EGFR), HER2, Erk-1 and-2 and AKT kinases . Other TLapatinib in combination with capecitabine is FDA-approved for the treatment of HER2+ metastatic BC that have received prior therapy with trastuzumab . Also, iin vitro synergistic interaction was demonstrated between those two drugs [Combining trastuzumab with lapatinib is an attractive strategy, since both intracellular and extracellular HER2 domains would be targeted. Indeed, wo drugs . Dual anwo drugs , and alswo drugs , 85. Nevwo drugs .Unfortunately, acquired resistance to lapatinib often develops in patients who initially responded to therapy. Chronic exposure to lapatinib may convert HER2-over-expressing BC cells that are initially sensitive to lapatinib-induced apoptosis to resistant cells . Importain vitro, suggesting that this is a strategy that might be a possible treatment option to be tested in future clinical trials [Small molecule TKIs are being studied in combination with drugs that target the PIK3CA/AKT pathway, which was previously discussed as being implicated in trastuzumab resistance. PI3K inhibitors in monotherapy might display modest clinical activity, and a potential resistance mechanism frequently involves increased expression and phosphorylation of the HER family of receptors, particularly HER2 and HER3 , 90. Thel trials .Another potential mechanism to lapatinib resistance is activation of AXL, which is a membrane-bound receptor tyrosine kinase . In a laThis humanized monoclonal antibody that binds to HER2 is an effective inhibitor of EGFR/HER2 driven signaling pathway. Compared to trastuzumab, much less is known about development of resistance to this targeted agent. Of note, in a tamoxifen-resistant BC cell line, pertuzumab promoted rapid formation of HER3/EGFR heterodimers, with subsequent phosphorylation of AKT and ERK1/2 . In thisIn ovarian cancer, microRNA-150 (miR-150) expression was induced by pertuzumab in a cell line model, and suppression of miRNA-150 resulted in decreased drug sensitivity to pertuzumab and cell apoptosis . miRNAs The development of resistance to anti-HER2 therapies seems complex, and is probably associated with multiple mechanisms. A generated transgenic mouse model of HER2+, PIK3CA mutant BC acquired resistance to trastuzumab, pertuzumab in combination with the pan-PI3K inhibitor BKM120 after treatment exposure. Initially, tumor regression occurred after 6 weeks of therapy. Nevertheless, within two months, all tumors relapsed. Of note, p95 HER2, which was not detected in untreated tumors, was expressed in resistant clones, and HER2 expression was significantly reduced . This daTrastuzumab emtansine (T-DM1) is an antibody-drug conjugate that is active in second line, as well as later lines in the treatment of advanced HER2+ BC that has progressed on trastuzumab therapy , 100. AlPrimary resistance to T-DM1 may be relatively infrequent, particularly in patients who have no prior exposure to trastuzumab. The most common scenario is found in patients who initially responded, but eventually ceased to respond, despite continued treatment with T-DM1. It is important to know that DM1 and its metabolites need to accumulate in cell cytoplasm to reach a concentration that exceeds the threshold needed to evoke cell death . ConsequAnother important resistance mechanism of T-DM1 is mediated by neuregulin b1 (NRG) , the ligOther HER2-targeting antibody-drug conjugate (ADC) are currently under development, such as SYD985. In the ongoing phase 1 clinical trial, safety and efficacy of SYD985 have been evaluated in European Oncology Centers, where patients with locally advanced or metastatic solid tumors of any origin were treated with SYD985. Of note, objective responses were seen in metastatic HER2+ BC patients who were refractory to previous HER2-targeted treatments, including T-DM1 .de novo. In either case, this is a potentially life-threatening event, which may lead to rapidly progressive disease, or can result in important quality of life impairment for patients, due to disease related symptoms. A better knowledge of these mechanisms is of extreme importance for the development of effective strategies to overcome resistance.Resistance to trastuzumab and other anti-HER2 therapies is an event that may occur during the course of therapy or In developing more effective and durable treatment strategies, multitargeted therapy should be considered. The recognition of specific molecular predictors of response to emerging therapies will allow a more personalized approach to the treatment of HER2-amplified BC.Enrolling patients into clinical trials, with the purpose of understand and target the molecular mechanisms involved in HER2 therapy resistance is of crucial importance. Laboratory, pre clinical and clinical findings, such as seen at the BOLERO-1 and 3 trials, are very promising in this field, but have not yet been incorporated in clinical practice. Also, a better characterization between the relationship of tumor inflammatory infiltrate or molecular inflammatory signature, and trastuzumab benefit is warranted, before its incorporation in clinical practice.Nowadays, the focus on HER2 expression/amplification status alone is not a realistic approach to understand the underlying mechanisms of disease progression and resistance. Improvement of patient outcomes in this disease setting will only be clinically meaningful if resistance pathways involved in disease progression are better recognized, understood and targeted."}
+{"text": "HER2)\u2010positive breast cancer. For dichotomous variables, the relative risk ratio (RR) and 95% confidence interval (CI) were used to investigate outcome measures: pathological complete response (pCR), neutropenia, diarrhea, dermatologic toxicity, and congestive heart failure (CHF). Eight randomized controlled trials of 2350 participants  were selected to compare the efficiency and safety of lapatinib to trastuzumab. A significant difference was found between lapatinib and trastuzumab for pCR . In six studies, a significant difference was found between trastuzumab and combination therapy for pCR , diarrhea , and dermatologic toxicity , but none was found for neutropenia  or CHF . Combination therapy compared to trastuzumab alone increases the pCR rate of HER2\u2010positive breast cancer patients with no additional cardiac events. Trastuzumab, which is still the first\u2010line therapy in breast cancer, increases the pCR rate more than lapatinib.This meta\u2010analysis compared the efficiency and safety of lapatinib and trastuzumab, alone or in combination, administered with neoadjuvant chemotherapy in patients with human epidermal growth factor receptor 2 ( Human epidermal growth factor receptor 2 (HER2) is a member of the ErbB family of receptors and is overexpressed in 15\u201320% of breast cancer. Considered a prognostic and predictive marker of breast cancer, HER2 is highly aggressive and significantly reduces disease\u2010free and overall survival Two therapeutic approaches are used to inhibit HER2\u2010mediated signaling. The first approach is trastuzumab, a humanized monoclonal antibody that blocks the activity of HER2, which improves the prognosis of early and advanced stage HER2\u2010positive breast cancer A meta\u2010analysis of all relevant published randomized, controlled trials (RCTs) was performed to compare the efficiency and safety of lapatinib and trastuzumab, alone or in combination, administered with neoadjuvant chemotherapy in patients with HER2\u2010positive breast cancer.The search strategy consisted of a systematic review of the literature for RCTs over the last 5\u00a0years in any language in the Wanfang Data, PubMed, the Cochrane Library, Medline, and EBSCO databases. The publication time searched was from March 2011 to March 2016. The search terms used were \u201ctrastuzumab,\u201d \u201clapatinib,\u201d \u201cher\u20102 positive,\u201d \u201cbreast AND (cancer OR tumor OR carcinoma),\u201d and \u201crandomized controlled trials OR RCT.\u201d Article selection was based on the methodology used in the RCTs. A total of 39 Chinese articles and 506 English articles were identified. These articles were reviewed and screened for duplicate or incomplete data. When relevant data were unclear, the articles were read by different investigators and then discussed.Inclusion criteria were RCTs that (1) pathologically confirmed breast cancer and HER2 positivity, (2) patients aged over 18\u00a0years, (3) chemotherapy tolerance, (4) expected lifetime of more than 3\u00a0months, (5) compared trastuzumab with lapatinib or trastuzumab versus the combination therapy, and (6) reported sufficient data on outcomes. Exclusion criteria were (1) nonrandomized and nonclinical controlled trials, (2) trials with missing data, and (3) duplicate reports, trials of poor methodological quality and trials with obvious bias.Data extracted from each article included the name of the first author, year of publication, journal name, study quality, intervention, number of patients in the study, dosage used in the three groups , and the number of patients with different endpoints.Several outcomes were measured: pCR, neutropenia, diarrhea, dermatologic toxicity, and congestive heart failure (CHF). pCR was defined as the absence of any invasive component in the resected breast specimen. Adverse events were graded according to the National Cancer Institute Common Toxicity Criteria Version 3.0. The number of patients with grade 3\u20134 adverse events was determined from the articles. Disagreement regarding data extraction was resolved by discussion and consensus among the investigators.The methodological quality of the RCTs was assed according to the Cochrane Handbook for Systematic Reviews of Interventions Version 5.0.0: (1) random sequence generation, (2) concealment of allocation, (3) blinding of participants and personnel, (4) blinding of the outcome assessment, (5) incomplete outcome data, (6) selective reporting, and (7) other sources of bias.P\u2010value of <0.05 was considered statistically significant. The inconsistency index (I2) statistic and the Q statistic were used to test the heterogeneity between RCTs P\u00a0>\u00a00.1; I2\u00a0\u2264\u00a050%), a fixed effect model was used for secondary analysis; otherwise , a random\u2010effect model was used Data were analyzed using Review Manager v.5.3 software . For dichotomous variables, outcomes were calculated as the relative risk ratio (RR), the 95% confidence interval (CI), and a A total of 39 Chinese papers and 506 English papers were selected, published from March 2011 to March 2016. The literature selection process is presented in the PRISMA flowchart . The heterogeneity test was not statistically significant; therefore, data for each outcome was calculated using the fixed effects model . The meta\u2010analysis indicated a significant difference in the pCR rate in patients treated with trastuzumab compared to lapatinib   were also analyzed. Compared to trastuzumab alone, combination therapy showed a higher pCR rate   Fig.\u00a0. Six stuI2\u00a0=\u00a068%; P\u00a0=\u00a00.009). The six studies included in the meta\u2010analysis indicated no significant difference in the neutropenia adverse event between the lapatinib and trastuzumab group  . The four studies included in the meta\u2010analysis indicated no significant difference in the neutropenia adverse event in patients between the trastuzumab and combination groups   Fig.\u00a0.I2\u00a0=\u00a00%; P\u00a0=\u00a00.81). The seven studies included in the meta\u2010analysis indicated a significant difference in the diarrhea adverse event in patients between the lapatinib and trastuzumab groups  . The four studies included in the meta\u2010analysis indicated a significant difference in the diarrhea adverse event in patients between the trastuzumab and combination groups  . The seven studies included in the meta\u2010analysis indicated a significant difference in the dermatologic toxicity in patients between the lapatinib and trastuzumab groups  . The five studies included in the meta\u2010analysis indicated a significant difference in the dermatologic toxicity in patients between the trastuzumab and combination groups  . The five studies included in the meta\u2010analysis indicated no significant difference in the CHF in patients between the lapatinib and trastuzumab groups    Fig.\u00a0.This study compared the efficiency and safety of lapatinib and trastuzumab, alone or in combination, combined with neoadjuvant chemotherapy in patients with HER2\u2010positive breast cancer. The meta\u2010analysis provided evidence that lapatinib and trastuzumab combination therapy significantly increased the pCR rate. Trastuzumab increased the pCR rate more than lapatinib. Lapatinib caused skin rash, diarrhea, and other adverse events.Neoadjuvant chemotherapy has been reported to be equivalent to adjuvant chemotherapy in terms of survival and overall disease progression in the treatment of breast cancer Trastuzumab substantially improves the efficacy of chemotherapy in HER2\u2010positive breast cancer patients. Resistance to trastuzumab still develops in some women after adjuvant therapy, which increases the importance of the development of additional agents that target HER2 through different mechanisms of action P\u00a0=\u00a00.003). Moreover, the pCR rate of the combination group was 1.33 times higher than that of the trastuzumab group. These results might be explained by the lower ability of lapatinib to block the HER2 pathway compared to trastuzumab. Furthermore, trastuzumab may have additional antitumor efficacy through the recruitment of immune effector cells responsible for antibody\u2010dependent cytotoxicity and inhibiting angiogenesis In the eight RCTs, the pCR rate as the first endpoint was analyzed for the lapatinib, trastuzumab, and combination groups. A significant difference in the pCR rate between the lapatinib and trastuzumab groups was found P\u00a0=\u00a00.00. MoreoveThe meta\u2010analysis analyzed grade 3\u20134 adverse events according to the national criteria. Common adverse reactions of lapatinib were diarrhea and skin rash while trastuzumab showed potentially serious cardiac toxicity. The incidence of adverse events, such as diarrhea and skin rash, in the lapatinib group was significantly higher than in the trastuzumab group. Lapatinib and trastuzumab combination therapy also exhibited the same effect. Surprisingly, the results demonstrated that the combination did not increase cardiac toxicity compared to trastuzumab, which indicates that combination therapy is safe and effective.This meta\u2010analysis had several limitations. As shown in Table\u00a0In conclusion, the currently available evidence shows that lapatinib and trastuzumab combination therapy significantly increases pCR rates in HER2\u2010positive breast cancer patients with no additional cardiac side effects compared to trastuzumab alone. Trastuzumab is better than lapatinib according to the pCR rate from our data. However, trastuzumab is still the first\u2010line targeted therapy in breast cancer and cannot be replaced by lapatinib because of cost considerations. Large, high\u2010quality, double\u2010blind trials are needed to confirm the efficiency of lapatinib and trastuzumab combination therapy, and verify whether combination therapy can prolong disease\u2010free survival or overall survival.The authors declare that they have no conflict of interest."}
+{"text": "Betula pendula. Broad-sense heritability (H2) and coefficient of genotypic variation (CVG) were estimated for metabolites in senescent leaves and litter using 19 genotypes selected from a B. pendula population in southern Finland. We found that most of the secondary metabolites remained through senescence and decomposition and that their persistence was related to their chemical properties. Intrapopulation H2 and CVG for intracellular phenolics, epicuticular flavonoid aglycones and condensed tannins were high and remarkably, increased from senescent leaves to decomposed litter. The rank of genotypes in metabolite concentrations was persistent through litter decomposition. Lignin was an exception, however, with a diminishing genotypic variation during decomposition, and the concentrations of lignin and condensed tannins had a negative genotypic correlation in the senescent leaves. Our results show that secondary metabolites and their intrapopulation genotypic variation can for the most part remain through leaf senescence and early decomposition, which is a prerequisite for initial litter quality to predict variation in litter decomposition rates. Persistent genotypic variation also opens an avenue for selection to impact litter decomposition in B. pendula populations through acting on their green foliage secondary chemistry. The negative genotypic correlations and diminishing heritability of lignin concentrations may, however, counteract this process.Abundant secondary metabolites, such as condensed tannins, and their interpopulation genotypic variation can remain through plant leaf senescence and affect litter decomposition. Whether the intrapopulation genotypic variation of a more diverse assortment of secondary metabolites equally persists through leaf senescence and litter decomposition is not well understood. We analyzed concentrations of intracellular phenolics, epicuticular flavonoid aglycones, epicuticular triterpenoids, condensed tannins, and lignin in green leaves, senescent leaves and partly decomposed litter of silver birch,  Plants produce an abundance of diverse secondary metabolites such as phenolics and terpenoids. These compounds were thought to be waste products until ortho-diphenol) are preferential substrates for PPOs  remain and preserve their genotypic variation through the early phase of litter decomposition. These hypotheses, if supported, would manifest the persistence of genotypic variation of foliar chemistry through senescence and decomposition: a prerequisite for the initial litter quality to predict and the selection acting on foliar chemistry to affect litter decomposition.In this study, we focus on the fate of foliar secondary metabolites and the persistence of their genotypic variation through leaf senescence and litter decomposition in a n Europe , where ie growth  and physe growth  as well e growth  and decoe growth , 2015. Fe growth , their ge growth  are equar larvae . The abile found , but theB. pendula trees . The trees that grow in Kuikanniitty consist of the micropropagated progeny of 30 la trees , selectela trees . The soun = 5) on June 26. The collected leaves were immediately frozen in liquid nitrogen. For collecting senescent leaves, two south-side branches (at the height of 140\u2013300 cm) of each tree were enclosed in mesh bags before leaf fall (September 8 to 10) in all six blocks . The mesh bags were collected after leaf fall (October 28 to 30), their contents were pooled within a tree and random subsamples of leaves were taken for laboratory analyses. Remaining leaves were stored in plastic bags in 4\u00b0C until November 5, when 10-g  samples were used to establish litter patches on the ground of a clear-cut, B. pendula-Pinus sylvestris forest site in Loppi, south Finland . The soil in this site is post-glacial sorted fine sand with a pH of 5.0 and total C and N concentrations of 6 and 0.3%, respectively, in the upper 0\u20135 cm layer (Pteridium aquilinum (L.) Kuhn, grasses Calamagrostis arundinacea (L.) Roth and Deschampsia flexuosa (L.) Trin., and dwarf shrubs Vaccinium myrtillus L. and Vaccinium vitis-idea L.  was collected from the trees in five replicate blocks , and again extracted with 1 ml of 100% for 10 min. The supernatants were dried in a vacuum concentrator at 45\u00b0C and stored at 4\u00b0C.3+ -reagent were added and the suspension was incubated at 90\u00b0C for 50 min. After being cooled with ice, the absorbance of the suspension was measured at 550 nm using cyanidin chloride  as a quantification standard.Lignin was determined from the precipitants  using the method described in 2O and (B) 0.1 % formic acid in acetonitrile . The flow was 0.41 ml min-1 and the elution was performed with a gradient as follows: B started with 5%, was increased to 50% by 15 min, to 60% by 35 min, to 85% by 45 min and to 98% by 50 min and then kept at 98% for 5 min. The column was returned to its starting condition with 15 min equilibration, giving a total of 70 min for each run. The injection volume was 12 \u03bcl with a partial loop. The MS was run in a positive ion mode with a mass range of 150\u20131500 m/z. The capillary temperature was kept at 320\u00b0C and the voltage at 5 V. The sheath gas flow rate was kept at 20 ml min-1, auxiliary gas flow rate at 5 ml min-1 and sweep gas flow rate at 5 ml min-1. The tube lens was set to 80 V. The areas for the compounds were integrated using the Xcalibur software.For quantifying the concentrations of small-molecular phenolics and triterpenoids, a 500-\u03bcl aliquot of the methanol resuspension was dried in a vacuum centrifuge at 45\u00b0C and stored at \u201320\u00b0C. After storage, the samples were dissolved in 250 \u03bcl 100% methanol and 250 \u03bcl distilled water. High-performance liquid chromatography-mass spectrometry (HPLC-MS) was then performed using Thermo Finnigan LC with the flow split into two between a Thermo LTQ MS  with electrospray ionization (ESI) and a Finnigan PDA detector with a subsequent Corona Ultra charged aerosol detector. The column was C-18 Luna with an inner diameter of 2 mm, length of 150 mm and a particle size of 3 \u03bcm . The temperature of the tray was set to 18\u00b0C and the column to 40\u00b0C. The solvents were (A) 0.1% formic acid  in HD-glucopyranoside (DHPPG); (+)-catechin (Aldrich) for (+)-catechin; quercetin 3-glucoside (Extrasynthese) for myricetin, quercetin, and kaempferol derivatives; and acacetin (Extrasynthese) for flavonoid aglycones. Triterpenoids are reported as arbitrary units (peak area g-1 dry mass). For the analyses of heritability and statistical significance of genotypic variation in the senescent leaves and decomposed litter, the small-molecular phenolics and triterpenoids were grouped into intracellular phenolics -catechin, myricetin glycosides, quercetin glycosides, and kaempferol glycosides), epicuticular flavonoid aglycones and epicuticular triterpenoids. In addition, the intracellular phenolics were tested as subgroups; i.e., phenolic acids (CQAs and CouQAs), myricetin glycosides, quercetin glycosides, and kaempferol glycosides.The compounds were annotated using retention times, UV spectra and HPLC-MS. Peak picking was done using MetAlign software  based onTo avoid a multitude of mean tests and to allow easy statistical inference in the graphs , we inteB. pendula genotypes, all trees within a genotype had an equal genetic structure. In such material, all variation that is found within genotypes can be considered to be due to the variation in environment, or due to a measurement error, and all variation found between the genotypes to be genetic (H2) can be calculated  were calculated according to the Eq. 2, where  is the phenotypic mean.Coefficients of genotypic variation . Compounds with qualitative variation were excluded from these analyses and the senescent leaves and decomposed litter were analyzed separately as not all the compounds of senescent leaves were present in litter. Before PCA, both columns and rows of the data matrix were transformed to have a mean of zero and a standard deviation of 1. This was done to reduce the quantitative differences among the compounds and the samples and thus, focus more on chemical profiles. Compounds with skewed distribution were logGenotypic correlations among the compound groups and between the senescent leaves and decomposed litter were tested using the Spearman rank correlation analysis. The persistence of genotypic variation in the chemical profiles revealed by PCA between the senescent leaves and litter was tested as rank correlations of the genotype means of PC axis scores. All statistical analyses were performed using the SPSS 15.0.1 and SPSS 18 statistical packages  except for the PCA, which was performed using the SIMCA-P+ software .Figure 1A). The concentrations of CouQAs were on average 97% lower in the senescent than green leaves and decreased below the detection limit during litter decomposition . DHPPG concentration was 99% lower in the senescent than green leaves and also decreased below detection during decomposition .All those secondary metabolites that were found in green summer leaves were also detected in senescent leaves, except for CQAs . Concentrations of myricetin glycosides decreased on average by 93% during leaf senescence and none of the six compounds was detected in the decomposed litter . In contrast, concentrations of quercetin and kaempferol glycosides decreased on average by 79 and 76% during leaf senescence and all compounds, except for kaempferol-3-glucoside, were also detected in the decomposed litter . Based on the comparison of confidence intervals, the reduction in concentration during leaf senescence was statistically significant for all flavonol glycosides, except for kaempferol 3-arabinofuranoside . During litter decomposition, the concentration of quercetin and kaempferol glycosides decreased on average by 86 and 52%, and except for kaempferol 3-glucuronide, the decrease was statistically significant in all compounds .The decrease of flavonol glycoside concentrations during leaf senescence and litter decomposition varied among the flavonoid subgroups . The concentrations were on average 27% lower in the senescent than green leaves and the decrease was statistically significant for nine of the 15 compounds . For one of the compounds (F15), the concentration increased by 70% . During litter decomposition, the concentrations of flavonoid aglycones decreased on average by 51% and the decrease was statistically significant for all compounds .The concentrations of epicuticular flavonoid aglycones varied a lot in the green leaves, but displayed relatively similar dynamics during leaf senescence and litter decomposition , but this decrease was driven by one abundant compound T8 that was annotated as 12-O-acetyl-3-O-malonylbetulafolientriol. When T8 was excluded from calculations, the mean concentration of triterpenoids increased by 4%, and for the two ocotillol-type triterpenoids, papyriferic acid (T7) and its derivative (T6), the increase was statistically significant . During litter decomposition, all triterpenoids had parallel dynamics, the mean concentration decreased by 55% and the decrease was statistically significant for all compounds .The mean concentration of triterpenoids decreased during leaf senescence by 25% . During litter decomposition, lignin concentration increased further by 23%, but tannin concentration decreased by 87% . The (+)-catechin concentration decreased by 97% during senescence, but did not change during decomposition .Of the polymers, the concentration of lignin increased by 51%, while the concentration of condensed tannins did not change during leaf senescence .The secondary metabolites displayed both qualitative (absence or presence in only certain genotypes) and quantitative  genotypic variation. Qualitative variation was found among flavonol glycosides: the 3-glucuronides were lacking in four of the 19 genotypes  and the 3-arabinofuranosides were found in four genotypes only . The qualitative variation remained through the senescence and decomposition as these compounds were also found in the decomposed litter . Of the main metabolite groups, the epicuticular triterpenoids  had the highest broad-sense heritability, H2 (0.281) and coefficient of genotypic variation, CVG (0.138) in the senescent leaves (Table 1). The other groups had very similar heritabilities (0.113\u20130.121), whereas the CVG varied more, with lignin and epicuticular flavonoid aglycones having lower CVG than intracellular phenolics and condensed tannins (Table 1). The genotypic variation was statistically not highly significant in the senescent leaves, except for triterpenoids (Table 1). Among the intracellular phenolic subgroups, myricetin glycosides and kaempferol glycosides had very high values of H2  and CVG (0.331 and 0.219), while those of phenolic acids and quercetin glycosides resembled the values of intracellular phenolics in general . As a result, the decomposed litter had statistically highly significant genotypic variation in all compounds except for lignin that had lost genotypic variation during decomposition (Table 1).Quantitative genotypic variation was found in all compound groups  and PC2 mostly genotypic variation  . In the decomposed litter, genotypic variation was significant along both the PC1  and the PC2  . The ranks of genotype mean scores correlated positively between the senescent leaves and decomposed litter for PC2 , but not for PC1 . The genotype 16 was most distinct from others in both senescent leaves and decomposed litter . Triterpenoids and the most lipophilic flavonoid aglycones (F11-F15) were the compounds that best explained the genotypic variation along the PC axes . In the decomposed litter, four triterpenoids, including papyriferic acid (T7) and its derivative (T6), formed a tight cluster separated from the rest of the compounds .The genotypic variation in the small-molecular compounds of senescent leaves was also clearly visible in the PCA of individual compounds, where PC1 represents environmental variation . Among the intracellular phenolic subgroups of the senescent leaves, concentrations of phenolic acids correlated positively with the concentrations of quercetin glycosides  and kaempferol glycosides , which also correlated with each other . The ranks of genotype mean concentrations correlated positively between the senescent leaves and decomposed litter for intracellular phenolics , flavonoid aglycones , triterpenoids  and condensed tannins , but not for lignin  .The genotype mean concentrations of the two epicuticular compound groups \u2013 flavonoid aglycones and triterpenoids \u2013 were positively correlated in the senescent leaves, whereas the mean concentrations of condensed tannins correlated negatively with the concentrations of flavonoid aglycones and lignin  remained in the senescent leaves. As we hypothesized, the remaining metabolites also exhibited significant genotypic variation with high broad-sense heritabilities and coefficients of genotypic variation. During decomposition, most metabolites decreased in concentration, suggesting that they were decomposed faster than the litter material on average, but the genotypic variation was persistent. This was manifested by the increasing heritabilities and coefficients of genotypic variation of the intracellular phenolics, surface flavonoid aglycones and condensed tannins during litter decomposition. Confirming the persistence of genotypic variation, the genotype ranks in metabolite concentrations remained stable under field conditions and microbial degradation. Considering that secondary metabolites can affect litter decomposition and nutrient cycling  moiety, which makes them preferential substrates for PPOs (The absence of CQAs in the senescent leaves was expected due to their catechol (for PPOs . Monophefor PPOs .-1 dry mass) in the green leaves, but lost little of their concentration during leaf senescence. Epicuticular flavonoids are typically highly methylated, which makes them lipophilic, but at the same time shields the reactive hydroxyl groups from oxidation . The two triterpenoids that increased in concentration during senescence were both ocotillol-type of oxidized dammaranes . These are known to be formed from corresponding dammaranes in oxidative conditions, e.g., through UV-induced photochemical reactions  during the senescence. In the PCA of decomposed litter, two other triterpenoids (T1 and T3) clustered together with the oxidized ocotillol-type triterpenoids (T6 and T7), which suggests that the concentration pattern of these compounds was also influenced by oxidative processes.The flavonoid aglycones, which situate on leaf surface , had a lxidation . During er input . The otheactions . It is tB. pubescens ssp. czerepanovii  of growth has earlier been estimated to vary between 0.10 and 0.19 for those trees, from which we collected the litter  that have high papyriferic acid production. Recent results also suggest that the concentrations of condensed tannins in leaf litter could be the target of selection due to the beneficial effects of high tannin concentrations on plant nitrogen uptake in certain conditions  and initial litter quality hypothesis (most other metabolites) , which is known to defend birch twigs against hare browsing , 1996, wtes) cf. . The inites) cf. . Our restes) cf.  and inhites) cf. , and sintes) cf. .B. pendula. Epicuticular flavonoid aglycones and triterpenoids are synthesized in multicellular peltate glands on birch leaves and twigs and excreted to the surface as a mixed resin to provide chemical defense and protect from desiccation , which is a prerequisite for a long-term genetic influence on decomposition. However, we also found significant genotypic correlations among the compound groups. Of these, the positive correlation between flavonoid aglycones and triterpenoids has earlier been found in the green leaves  and barkiccation . By contB. pendula green foliage remain in the senescent leaves, although in much lower concentrations, and can withstand the first phase of decomposition. The persistence of the compounds appears to be related to their chemical properties, and particularly to their susceptibility to oxidation. It further appears that the genotypic variation of metabolite concentrations persists through leaf senescence and litter decomposition. This supports the hypothesis that initial litter quality can explain the variation in litter decomposition rates. It also opens an avenue for selection to impact litter decomposition in B. pendula populations through acting on their green foliage secondary chemistry. Whether this takes place, however, likely depends on the relative strength of the link of litter decomposition to secondary metabolites in comparison to the other attributes of B. pendula litter. At a particular forest site, finally, the significance of changes in litter metabolite concentrations caused by the selection apparently depends on the relative importance of litter chemistry among other biotic and environmental factors that control litter decomposition rates.The green foliage secondary chemistry of a tree population is a reflection of various selection forces, such as herbivory, which act on the genotypic structure of the population. Our results show that a majority of those secondary metabolites that have earlier been found to characterize JM designed the study and MR arranged the plant material; UP and HK carried out the field and laboratory work; TS contributed to the field work and SK-S and MK guided the laboratory analyses; UP, SK-S, and MK interpreted the data; JM, UP, SK-S, and TS analyzed the data; UP and JM wrote the manuscript and SK-S, MK, MR, and TS developed the text.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "It has come to our attention that Dr. Sreenivas Gannavaram does not meet criteria necessary to be listed as an author, as specified by Frontiers; therefore, he has been removed from the authors' list and mentioned Acknowledgments instead.The updated Author Contributions statement and Acknowledgments are below.The authors apologize for this error and state that it does not change the scientific conclusions of the article in any way.The original article has been updated.NT, VK, MG, and AS: designed and performed the experiments and co-wrote the MS. SS and VS: assisted in design of the study, statistical analysis, and MS writing. RS: conceived, designed, directed, and supervised the complete study.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Phenylketonuria (PKU) is an autosomal recessive genetic disease, caused by the phenylalanine hydroxylase (PAH) deficiency in the metabolic pathway, which prevents phenylalanine from being converted into tyrosine, leading to a large amount of phenylalanine discharged from the urine. Therefore, it is necessary to establish a simple, fast, accurate and reliable PKU molecular diagnostic method for clinical diagnosis.We established a novel diagnostic method by combining a single-tube multiplex PCR technique with molecular hybridization technique. The method was verified by DNA sequencing technology. The established new technology successfully detected 9 common PAH gene mutations in the Chinese population.Double-blind analysis indicated that the diagnostic accuracy and specificity of the PKU sample were all 100%. Frequencies of single mutation R111X, R176X, Ex6\u201396A, R241C, R243Q, R252Q, Y356X, V399\u2009V and R413P genotypes were 8, 0.5, 16.5, 1.5, 27, 4.5, 13, 10.5, 8.5% respectively.The established method of combing single-tube multiplex PCR with molecular hybridization technology can accurately and rapidly detect PAH gene mutations in Chinese and is suitable for screening of large PKU populations with clinical samples. Phenylalanine hydroxylase (PAH) is an enzyme which is necessary to metabolize the amino phenylalanine to the amino acid tyrosine. It is a key enzyme in the phenylalanine metabolic pathway . PhenylkPAH gene is located on chromosome 12q22-q24.1 and contains 13 exons and 12 introns encoding with a protein containing 452 amino acids. At present, more than 600 mutations of PAH have been reported worldwide, and more than 70 mutations have been detected in China, mostly on exon 6th, 7th, 11th, and 12th exon. Among them, the 9 mutations R111X, R176X, Ex6\u201396A\u2009>\u2009G, R241C, R243Q, R252Q, Y356X, V399\u2009V, R413P are the most common types of PAH mutations in Chinese population [PAH gene in different ethnicities and different regions are quite different and show great genetic heterogeneity, therefore, rapid detection of race-specific and common mutations is the focus of research. As a mature technology, reverse dot blot (RDB) technology has been successfully applied to the genotypic diseases such as thalassemia and Glucose-6-phosphate dehydrogenase(G6PD) deficiency [The ficiency . In thisA clinically tested blood sample was drawn and anticoagulated using EDTA-2Na-. The DNA was extracted using the Qiagen Whole Blood Genomic DNA Extraction Kit . Thirty DNA standard samples of 30 PAH genotypes identified by DNA sequencing were 27 in 9 mutants and 3 in wild-type. The R243Q (G\u2009\u2192\u2009A) genotype was an artificial plasmid used for the establishment of this method. .PAH gene mutations detected include the following sites: R111X (c.331C\u2009\u2192\u2009T), R176X (c.526C\u2009\u2192\u2009T), Ex6\u201396A\u2009>\u2009G (c.611A\u2009\u2192\u2009G), and R241C (c.721C\u2009\u2192\u2009T).), R243Q (c.728G\u2009\u2192\u2009A), R252Q (c.755G\u2009\u2192\u2009A), Y356X (c.1068C\u2009\u2192\u2009A), V399\u2009V (c.1197A\u2009\u2192\u2009T), R413P (c.1238G\u2009\u2192\u2009C). In this study, five pairs of primers were designed to amplify the 9 mutation site fragments. A total of 18 probes were designed, of which 9 probes were used to detect the mutation sites and the other 9 probes were normal control probes. The 5\u2032 end of the primer was biotin labeled.Primer 5.0 software was utilized to design the corresponding primers and detection probes. The PAH wild-type gene and mutant detection probes both crossed the point mutation site, and their 5\u2019ends were aminated (5\u2032-NH2). The sequence of primers and probes is illustrated in Tables\u00a0The designed ted 5\u2032-NH. The seqIn this study, biotinylated PCR products were hybridized with oligonucleotide probes on the solid phase to achieve PAH genotyping.3 -Na2CO3 buffer (pH\u20098.0) at the corresponding position. Dried in the air for 20\u2009min, and then soaked in a nylon membrane with 0.1\u2009mol/L NaOH for 10\u2009min. After rinsing with distilled water, dry at room temperature for 10\u2009min.The molecular hybrid membrane was prepared as follows: The carboxyl nylon membrane  was acidified with 0.1\u2009mol/L HCl for 10\u2009min, and the nylon membrane was activated with ethyldimethylaminopropyl diimine  for 10\u2009min. Rinsing the membrane with distilled water twice and air dried for 20\u2009min. Then, according to the layout of the probe on Fig.\u00a0The PCR conditions were as follows: In a 25\u2009\u03bcL PCR reaction system, 1\u2009\u03bcL PCR buffer, 400\u2009\u03bcmol/L dN(U)TP, and 0.2\u2009\u03bcmol/L PAH primers, and 2\u2009U Taq enzyme  and 0.5\u2009U UNG enzyme  were used. The PCR reaction was performed on a T100 PCR machine . The reaction conditions were incubation at 50\u2009\u00b0C for 15\u2009min, predenaturation at 95\u2009\u00b0C for 10\u2009min, then 95\u2009\u00b0C, 30s; 57\u2009\u00b0C, 30s; 72\u2009\u00b0C, 30s for 40\u2009cycles, and 72\u2009\u00b0C for 5\u2009min.After the amplification was completed, 5\u2009\u03bcL of the PCR product and 5\u2009\u03bcL of DL2000 marker  were electrophoresed on a 1.5% agarose gel. Observe the electrophoresis result on a gel imager .Molecular hybridization assays include hybridization, washing, incubation, washing, and color development. The hybridization solution used for molecular hybridization analysis is presented in Table\u00a0Hybridization: a membrane strip was placed in a hybridization tube containing 10\u2009mL of Liquid A. Single-tube multiplex PCR amplified products were added. After treatment at 100\u2009\u00b0C for 10\u2009min, hybridization was performed in a molecular hybridization oven  at 45\u2009\u00b0C for 2\u2009h. At the same time, added about 45\u2009mL of Liquid B to a 50\u2009mL centrifuge tube and placed in a hybridization chamber for preheating.Washing the membrane: After the hybridization is completed, the membrane strip was moved to the liquid B and the membrane was washed at 45\u2009\u00b0C for 10\u2009min.Incubation: Prepare the incubating liquid and incubate the membrane strip in it for 30\u2009min at room temperature.Washing the membrane: Discard the incubating liquid, add Liquid A and gently wash the membrane twice at room temperature for 5\u2009min each time. After draining, add Liquid C and wash the membrane for 2\u2009min at room temperature.Color development: Prepare a Color-substrate solution, soaked the membrane strip in it and protected from light for 10\u2009min. After the color development is completed, wash the membrane with deionized water once to observe the result.It is judged by whether a blue spot signal appears at the test site or not. It\u2019s indicating that the sample is wild type when all normal sites (N) on the membrane were developed and all mutation sites (M) were not colored. On the contrary, Mutation sites (M) appeared on the strip indicates that the site is positive.Ten DNA samples of the 10 (including wild-type) PAH genotypes mentioned above were taken and replicated within the batch (3 times) and inter-assay (10\u2009days) tests to determine the repeatability of the PCR-Reverse Dot Blot method. One hundred eighty PKU-deficient and 20 PKU-normal DNA samples were tested by DNA sequencing and the established method in the double-blind experiment to assess specificity and accuracy.Using multiplex PCR in a single tube, we amplified PAH gene fragments of the detection loci whose size is 338\u2009bp, 274\u2009bp, 232\u2009bp, 191\u2009bp, and 145\u2009bp respectively. The electrophoresis band is clear and without smear, indicating that the established PCR system can efficiently amplify PAH gene fragments of blood DNA  using the method above were validated by DNA sequencing analysis. The results of PCR-Reverse Dot Blot are consistent with DNA sequencing analysis results, it\u2019s shown that the detection method, PCR amplification combined with reverse dot hybridization technique, established in this study can be used to detect common mutants of PAH.The repetitive test results showed that hybridized spots have a consistent color depth detected in wild-type and mutation PAH samples by the above method.As for the result of the inter-batch repeat experiment, due to different room temperature, it has a certain degree of color depth difference but it does not affect the interpretation of results. Before methodological comparison, the designed probes and primers should be validated in multiple samples to ensure that the color of each point is uniform and visible to the naked eye.The specificity and accuracy of the PCR-RDB technique were evaluated using 200 DNA samples of known PAH genotypes. A double-blind controlled trial was conducted so that neither the researchers nor the participants knew who they had taken. And the results of the double-blind controlled trial show that the genotypes of all DNA samples detected by this technique were identical to the results of the DNA sequencing analysis, with 100% specificity and accuracy.In this study, the frequencies of different genotypes were shown in Table DNA sequencing results of partial samples were shown in Fig.\u00a04), so PKU is divided into typical PKU and BH4 deficient PKU, the former accounted for 98 to 99% [4 PKU patients use BH4 therapy [Phenylketonuria is an amino acid metabolic disease that is mainly caused by a decrease or absence of PAH activity in the human body. The function of PAH requires the use of tetrahydrobiopterin , PCR-single strand conformation polymorphism(PCR-SSCP), denaturing high-performance liquid chromatography (DHPLC), direct sequencing and other techniques are mainly applied to detect PAH gene mutations in China \u201314. The PAH gene in the Chinese population. The experimental results are in full compliance with the sequencing results. This method is characterized by good repeatability, high specificity, and high accuracy. It can detect 9 common PAH gene mutations in the Chinese population in one PCR reaction and one molecular hybridization within one working day. The method is cheap and convenient. This research provides a simple, rapid and accurate gene detection method for clinical screening of large populations of PAH gene mutations.In this study, the RDB technique was used to detect 9 common mutation- sites in the"}
+{"text": "The objective of the current study was to characterize the relationship between diet quality and body composition in participants living with IBD, specifically Crohn\u2019s disease (CD) or ulcerative colitis (UC), in Atlantic Canada. Participants from the Atlantic Partnership for Tomorrow\u2019s Health (PATH) study are residents of one of the four Atlantic Canada provinces. Participants who completed the dietary questionnaire and had body composition measured were included in the study . A greater number of participants with IBD reported having multiple chronic conditions compared to those without IBD. Those with UC had statistically higher body weight and body mass index (BMI) compared to those without IBD. Overall, significant positive correlations were observed between adiposity and servings of refined grains, and meats and alternatives such as eggs and fish, whereas negative correlations were observed with servings of vegetables, fruit, whole grains, and alternatives such as tofu, and nuts/seeds. Participants with IBD (both CD and UC) consumed more refined grains than those without IBD. Using logistic regression analysis, participants consuming more servings of vegetables and whole grains were less likely to have CD where as those consuming more serving of fruit and bean/legumes were less likely to have UC. In the Atlantic PATH cohort, which includes a region of the world with a high incidence of IBD, distinct differences in adiposity and diet quality were observed in individuals with specific types of IBD compared to those without. There is a need for collaborative efforts to address weight management and diet quality issues in those living with IBD in the Atlantic Canadian region. Both the incidence and prevalence of inflammatory bowel diseases (IBD), including Crohn\u2019s disease (CD), ulcerative colitis (UC) and IBD-type undetermined IBDU are increasing worldwide.  There isPatients with CD often have abnormal mesenteric adipose tissue, known as fat-wrapping or \"creeping fat\", and mesenteric fat has been found to be a source of pro-inflammatory cytokines . PatientIn addition to excess adipose tissue, diet quality also plays a role in the regulation of the intestinal microbiome and can further augment the associated inflammatory conditions \u201310. DietThus, the aim of the current study was to characterize the relationship between body composition and lifestyle behaviours such as physical activity and diet in participants with CD, UC, or without IBD from Atlantic Canada, a region of the country that not only has the highest incidence in the country ,14 but hParticipants age 30 to 74 years and residents of one of the four Atlantic Canada provinces were eligible to participant in the Atlantic Partnership for Tomorrow\u2019s Health (PATH) study. All participants provided written informed consent prior to data/sample collection. A total of 31,173 participants that were recruited into the Atlantic PATH cohort between 2009\u20132015 completed the baseline questionnaire which included demographic information, anthropometric data, lifestyle behaviours and medical history  as previously described [A subset of participants completed a dietary questionnaire and had physical measures  taken. To address the aim of the study, the current project involves a sub-sample of Atlantic PATH participants, who had both completed the dietary questionnaire and had body composition measured and had indicated one specific type of IBD. To allow for comparisons between CD and UC, participants that indicated having both CD and UC were excluded n = 27). Thus, the subsample included a total of 12,802 participants , showing relative enrichment of IBD within our cohort as compared with reported prevalence data exceeding 0.3% in North America 7. Thus, .Demographic  and lifestyle data  were assessed. The urban/rural classification was based on previously published work in which the Postal Code Conversion File Plus  was used to classify study participants as living in urban or rural . The lev2 were considered underweight, normal weight, overweight and obese, respectively [Anthropometric data, including height, weight, waist and hip circumference were used to calculate BMI and waist-to-hip ratio. Participants with a BMI of <18.5, 18.5\u201324.9, 25.0\u201329.9 and \u226530.0 kg/mectively . Body coDiet quality data from participants in the cohort has been previously published . In brieAll statistical analyses were performed with IBM SPSS Statistics software (version 23). Chi-square analyses were used to determine significant associations between demographic, behavioural and dietary variables in those with and without IBD. Differences in continuous anthropometric data among those with and without IBD were analyzed using ANOVA, if necessary followed by post hoc two-tailed t tests adjusted with a Bonferroni correction for multiple comparisons. Categorical variables were presented as counts (%) and continuous variables were presented as means \u00b1 standard deviation. The relationship between diet variables and adiposity was assessed by Pearson correlation coefficients. To examine the association between dietary variables and IBD, logistic regressions were used to calculate odds ratios (OR) with 95% confidence intervals. Models were unadjusted or adjusted for variables with p<0.05 or factors previously reported to impact IBD . Chronic conditions include hypertension, myocardial infarction, stroke, asthma, chronic obstructive pulmonary disease, depression, diabetes, liver cirrhosis, chronic hepatitis, irritable bowel syndrome, eczema, lupus, psoriasis, multiple sclerosis, osteoporosis, and arthritis. For the development of the statistical models for predicting the probability of having IBD, demographic variables, lifestyle behaviors, and anthropometric measures were included in the regression models. The model\u2019s good calibration was determined by a non-significant (P>0.05) Hosmer-Lemeshow\u2019s goodness of fit test. Only variables with a p<0.05 and that showed good model fit were retained in the final regression model. All corrected p-values <0.05 were considered statistically significant.A significant association was observed between IBD and smoking status, alcohol consumption and the number of chronic conditions. Most participants without IBD had never smoked whereas a higher percent of those with CD or UC were former smokers. A smaller percent of participants with IBD were regular/habitual alcohol consumers (33% of CD and 40% of UC) compared to nearly half (48%) of those without IBD. Of those with IBD, approximately \u00bc of participants had 4 or more chronic conditions compared to less than 5% of those without IBD. There was no statistically significant association between IBD and sex, province, urban/rural, age, education, income, alcohol consumption, and physical activity level, .Several measures of adiposity were higher in participants with IBD  body mass, thus limiting its use in detecting a loss of muscle mass or strength. Furthermore, some studies have shown that in patients with IBD, BMI does not correlate well with fat-free mass  and reseOver the past decade, a clear association has been established between diet-induced obesity and the gut microbiota, and research in this area continues to grow as scientists seek to unravel the underlying mechanisms ,40. MoreThe relationship between diet and the development or management of IBD is complex and varies depending on the type and activity of the disease . A populMajor strengths of the current study include a large sample size, measured anthropometric data for assessment of adiposity, and participants from a population that is known worldwide for its prevalence of IBD. Limitations of the current study include that data are self-reported regarding disease diagnosis, physical activity level, and diet history, and its cross-sectional design. Because baseline data was used for this cross-sectional study, we currently can only identify associations, not causality. However, since participants of the Atlantic PATH cohort are part of a large longitudinal study, it will be possible in the future to examine the role of genetic, environmental, behavioural, and lifestyle factors in the development of disease .In conclusion, this is the first population-based Canadian study in adults to investigate the relationship between diet factors, body composition, other comorbidity and the prevalence of specific types of IBD in an area of the county known to have the highest incidence of the disease worldwide. Adiposity was significantly higher in participants with UC compared to those without IBD in the Atlantic PATH cohort. Findings from this study show that most participants with IBD were consuming a diet similar to those that did not have IBD, with the highest proportion of individuals meeting guidelines in the milk and dairy category. In the regression analysis, a protective effect of servings of fruit and bean/legumes was observed against UC whereas vegetables and whole grains servings were protective of CD. Ongoing and future prospective nutritional intervention studies will offer novel insights in a combined approach to optimizing IBD specific outcomes in the context of improving overall population health \u201352.S1 Table(PDF)Click here for additional data file.S2 Table(PDF)Click here for additional data file.S3 Table(PDF)Click here for additional data file."}
+{"text": "Larimichthys crocea) genes does not exist. The gene having to do with the growth efficiency of fish will have a huge impact on research. For example, the protein encoded by the IFIH1 gene is associated with the function of viral infection in the immune system, which affects the survival rate of large yellow croakers. Thus, we collected data through the published literature and combined them with a biological genetic database related to the large yellow croaker. Based on the data, we can predict new gene\u2013trait associations which have not yet been discovered. This work will contribute to research on the growth of large yellow croakers.The importance of a gene\u2019s impact on traits is well appreciated. Gene expression will affect the growth, immunity, reproduction and environmental resistance of some fish, and then affect the economic performance of fish-related business. Studying the connection between gene and character can help elucidate the growth of fishes. Thus far, a collected database containing large yellow croaker ( Larimichthys crocea), whose meat is delicious and has therapeutic effects, is a crucial source for the fish markets. Larger yellow croakers, belonging to Asian croakers, are economically important, however few studies focus on the genes related to economic traits of the large yellow croaker. With the development of molecular biology technology [The large yellow croaker  and the Baidu Encyclopedia (https://baike.baidu.com/). While collecting these papers, we filtered out the economic traits associated with the large yellow croaker. We used relevant genes to find data on the corresponding protein and protein sequence through Uniprot. The collected data contained the following information: reference, gene symbol/name, Uniprot Entry, protein sequence, trait, cause, pubmedID, chromosome location, and more.In order to systematically study the relationship between various traits and genes of the large yellow croaker, two contributions are made in this work. First, we collected large yellow croaker gene\u2013trait associations that can affect economic activities related to the fish by searching the existing literature. Second, on the basis of these data, we predicted unknown gene\u2013trait relationships. We collected papers related to the large yellow croaker through PubMed  and false positive rates  . Thus, tk value affected the prediction performance for gene\u2013trait associations. We performed a series of comparative experiments in order to estimate the influence of k. As a result, the KATZ-YC achieved a better prediction performance when k was set as 2  when using 2-fold b and 5-fPPARa [COX2 [IL-1\u03b2 [The gene\u2013trait associations were mainly collected from published papers related to the large yellow croaker. The database contained information about the relevant genes, the corresponding traits that have been generated, and the causes for the trait  was computed in a similar way as for genes, as follows:By making an analogy between the calculating methods of gene associations and trait associations, we can use the same method to obtain connections of traits. The Gaussian interaction profile kernel similarity for traits (Pseudosciaena crocea) [KATZ measure has been successfully applied in many areas, such as link prediction of some microbial-diseases  associat crocea) . The KATKG, the trait similarity matrix KT, and the adjacent matrix A as follows:The KATZ-YC first calculated the number of walks between gene nodes  \u00d7 (24 + 102) depicted the association possibilities of all the gene\u2013trait pairs. Furthermore, we represented the partitioned matrix S\u2032 as follows:Here, matrix S within the matrix S12, which could provide the correlative probability between each gene and trait. However, we collected a only small amount of data because the gene\u2013trait association network is still sparse. Walks with long lengths in a sparse network may be unimportant and could perturb the link prediction. Thus, we set parameter k to be 2, 3 and 4 and evaluated the parameter k\u2019s influence on the prediction performance. We calculated the respective unknown association probability when k was set as 2, 3 and 4 by the following formula. Here, the final prediction result matrix could be represented by matrices A, KT, and KG.We finally predicted the result for matrix Considering research about gene\u2013trait associations of large yellow croakers was scarce, and that databases of this species were lacking, we achieved the following two tasks in this paper. First, we collected genes related to economic traits of large yellow croakers by searching various literatures and collated expressions, protein sequences, and other information associated with these genes. Second, we used a heterogeneous network to describe gene and trait similarity based on gathered known information about gene\u2013trait associations. We further used that information to implement the KATZ-YC algorithm, improved from KATZ, in order to perform the prediction work on unknown gene\u2013trait associations.With the development of molecular technology, more correlation between genes and traits will be found. We can build a database by collecting more data based on the abovementioned ones, and we can execute predictive models. Through the association between genes and traits, we have obtained a possible existing link between some economic traits. This work contributes to filling the void in associations between genes and economic traits of large yellow croakers. In the aquaculture of the large yellow croaker, the probability of occurrence of other traits can be predicted according to the appearance of some traits. These traits could effectively promote growth and reproduction or the prevention of possible illnesses. This understanding can further accelerate the development of the large yellow croaker breeding industry."}
+{"text": "Here, we purified both hPSC-derived and primary mouse spinal motor neurons in parallel and used extracellular multi-electrode array (MEA) recording to compare the pharmacological sensitivity of neuronal excitability and network function. We observed similar effects for most receptor and\u00a0channel agonists and antagonists, supporting the consistency between human PSC-derived and mouse primary spinal motor neuron models from a physiological perspective.Directed differentiation of human pluripotent stem cells (hPSCs) has enabled the generation of specific neuronal subtypes that approximate the intended primary mammalian cells on both the RNA and protein levels. These cells offer unique opportunities, including insights into mechanistic understanding of the early driving events in neurodegenerative disease, replacement of degenerating cell populations, and compound identification and evaluation in the context of precision medicine. However, whether the derived neurons indeed recapitulate the physiological features of the desired  The approach holds promise both for individual diseases and for subgroups as may be pursued in personalized or targeted medicine2. The potential value for such applications is particularly large in neurodegenerative diseases, for which access to early stage tissue is difficult or impossible and for which the large majority of disease cases are apparently sporadic, potentially limiting the accuracy of mouse models when mechanistic inference from rare monogenetic cases may not extend to sporadic ones. Furthermore, a growing appreciation for the effects of human-specific genes and genetic background adds additional levels of complexity that cannot be addressed in mouse models4.Deriving specific disease-relevant cellular subtypes from human pluripotent stem cells (hPSCs) may serve potentially valuable roles in disease modelling, cell replacement, and drug development5, and more recent reports have used unbiased RNA expression profiles to support the accuracy of the model motor neurons6. While the RNA transcriptome yields a valuable and unbiased view of the templates available for cellular function, differences in RNA processing, spatial restrictions, translation, and post-translational modification may yield profound differences in the integrated ensemble of cellular functions7. Indeed, the primary role of a neuron is a physiological one: to integrate synaptic inputs and generate an efferent signal transmitted to another neuron or effector cell such as muscle in the case of spinal motor neurons. How accurately stem cell models reflect the physiology of bona fide neurons remains unaddressed.Initial hPSC modeling studies identified neuronal subtypes such as spinal motor neurons based on the expression of specific protein markers8. Thus, focusing on physiology and particularly the cohort of functional ion channels in specific neurons can provide a parallel functional assessment of the value of human stem cell-based models.The rich diversity of voltage-gated ion channels, particularly potassium channels, and the specific combinations of these channels enable fine tuning of the physiological features of neuronal subpopulations to match and in some cases even define their functions9. However, a growing body of evidence supports this position in multiple neurodegenerative diseases as well, including amyotrophic lateral sclerosis (ALS)12, Parkinson\u2019s disease13, and Alzheimer\u2019s disease15. While a group of stem cell modelling studies have already documented abnormal motor neuron excitability in ALS, the underlying assumption that the physiology of hPSC-derived motor neurons accurately reflects the physiology of bona fide motor neurons has not been addressed. Thus, the physiological concordance of the model neurons with primary ones may be particularly important in modelling diseases of specific vulnerable neuronal types.Recent clinical phenotypes have raised the question as to whether abnormal neuronal excitability contributes to specific neurological diseases and whether the physiological features and functions of neuronal populations may contribute to their selective vulnerabilities. This possibility seems particularly strong in familial epilepsies and rare pain syndromes due to mutations in specific sodium and potassium channelsbona fide primary motor neurons and identify major determinants of excitability in each group, we compared the pharmacological profiles of purified human and mouse motor neurons using multi-electrode array (MEA) recordings. We observed a high degree of similarity between motor neurons derived from hPSCs and mice using immunocytochemistry and qPCR of ion channel transcripts. We then quantified the spontaneous activity of motor neuron cultures from each species using longitudinal MEA recording over a span of four weeks. Using a timepoint at which both mouse and human motor neuron cultures exhibited robust network activity, we first determined the contribution of multiple neurotransmitters to synchronized neuronal firing. We then identified the contributions of individual ion channel classes to intrinsic excitability and action potential firing. Although the effect sizes were sometimes larger in primary mouse motor neuron cultures than in hPSC-derived motor neuron cultures, consistent with a greater functional maturation of the primary neurons, the neurotransmitter and ion channel blockers controlling motor neuron networking and intrinsic firing were similar in both groups.To assess the similarity of hPSC-derived spinal motor neurons and 16. We leveraged this consistent selective expression to obtain highly congruent populations of mouse and human spinal motor neurons in parallel experimental paradigms :GFP mouse strain, which matches endogenous Hb9 expression18, and FACS-purified motor neurons from embryonic mouse spinal cords (12.5\u201313.5 days post-conception). We chose this age based on the technical feasibility to generate a sufficiently large population of motor neurons and the established use of this protocol in the literature20. FACS gating parameters were similar for both hPSC-derived and mouse primary motor neurons , which blocks the \u03b1-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subset of glutamate receptors, nearly eliminated the synchronized bursts in both human and mouse motor neurons. D-(-)-2-Amino-5-phosphonopentanoic acid (D-AP5), which blocks the N-methyl-D-aspartate (NMDA) subset of glutamate receptors, yielded a partial inhibition in both species, although the effect was highly variable in mouse cultures. To assess for contamination from interneurons, we applied bicuculline, which blocks gamma-aminobutyric acid (GABA)-A receptors and did not observe a significant effect on network bursting in either species. Finally, we looked for direct electrical coupling between motor neurons using the gap junction inhibitor carbenoxolone and found that it reduced networking, consistent with the role of gap junctions in motor neuron development24. This effect was larger in mouse cultures compared with human cultures.Human and mouse motor neurons express ChAT, and acetylcholine is the primary transmitter at the neuromuscular junction 25. To address this potential explanation, instead of the HB9::GFP hPSC line, we used an Islet::tdTomato hPSC line to purify motor neurons. We found similar network properties, including a strong sensitivity to glutamatergic blockers , N-type (CaV2.2) and T-type (CaV3) calcium channels, respectively30. Effects of all three drugs were modest for both mouse and human neurons, with only the effect of nimodipine on hPSC-derived motor neurons reaching significance .KCNQ (Kv7) potassium channel openers have previously been shown to reduce motor neuron activity in both hPSC-derived and mouse motor neurons38. The HCN channel blocker ZD728839 showed a trend toward reduction of firing in hPSC motor neurons and a significant decrease in mouse motor neurons  and the WA09 (H9) Isl::tdTomato (kindly provided by J. Ichida) were maintained in mTeSR  on Matrigel  until 90% confluent, when they were either passaged or differentiated.The HUES3 HB9::GFP line3. Cells were fed daily for a period of 14 days with NB/B27: a 1:1 mixture of Neurobasal  and DMEM/F12  supplemented with GlutaMAX , NEAA , Pen/Strep , N2 , and B27 . From day 0 to day five the media was supplemented with dual SMAD inhibitors SB-431542  and LDN-193189  as well as Retinoic acid  and SAG . From day six through day 13, the dual SMAD inhibitors were replaced with DAPT  and SU-5402 . Dissociation of the 2D motor neuron culture was performed on day 14 by incubating the culture in StemPro Accutase Cell Dissociation Reagent  with DNase  for one hour at 37\u2009\u00b0C. The resulting cell suspension was dissociated mechanically by pipetting 20 times followed by centrifugation at 200 rcf for six minutes. The cell pellet was resuspended in sterile filtered sort buffer consisting of 1% BSA , 15\u2009mM HEPES , 1% Pen/Strep , 2\u2009mM EDTA  in PBS  with DAPI  and filtered through a 40\u2009\u00b5m nylon mesh  immediately prior to FACS sorting.Differentiation of hPSCs into motor neurons was performed as previously publishedFACS sorting was performed with either a BD FACSAria II or a BD FACSAria Fusion. After sorting, motor neurons were maintained in motor neuron maintenance media consisting of Neurobasal media , GlutaMAX , NEAA , N2 , B27 , and Pen/Strep  supplemented with GDNF , BDNF , and CNTF  with half media changes 3 times per week.20. After spinal cord isolation, the tissue was submerged in PBS  at 4\u2009\u00b0C followed by incubation with Trypsin-EDTA  at 37\u2009\u00b0C for 10\u2009minutes with agitation. The Trypsin-EDTA mixture was then carefully replaced with 1\u2009ml of NB/B27 with DNase  and 0.4% BSA , and the tissue was mechanically dissociated by pipetting 20 times with a fire-polished Pasteur pipette. The resulting cell suspension was filtered through a 100\u2009\u00b5m cell strainer , centrifuged at 150 rcf for five minutes and resuspended in the same sort buffer composition as for the hPSC derived motor neurons for FACS sorting.Embryonic motor neurons were harvested from E12.5\u201313.5 spinal cords of B6.Cg-Tg(Hlxb9-GFP)1Tmj/J (Hb9:GFP) mice  under the dissecting microscope as previously describedThe cerebral cortex from mouse pups ranging P1-P3 was dissected and placed into HBSS  buffer containing 1% Pen/Strep  and 10\u2009mM HEPES . The tissue was then dissociated enzymatically with 0.5\u2009ml of 0.25% Trypsin-EDTA  for 5\u20138\u2009minutes at 37\u2009\u00b0C. The trypsin was then inactivated by adding 1.5\u2009ml of glial media: MEM  with 10% heat inactivated donor equine serum , 3% Glucose , and 1% Pen/Strep . The resulting suspension was mechanically dissociated and then centrifuged at 200 rcf for nine mins, resuspended in glial media and slowly filtered using a 100\u2009\u00b5m mesh filter, after which the filtrate was then seeded in tissue culture vessels coated with Poly-D-Lysine (PDL) .Cells were washed for 5\u2009minutes in PBS and then fixed with 4% (w/v) paraformaldehyde  for 15\u2009minutes, followed by three washes, 5\u2009minutes each, in PbTr . Following an additional 10\u2009minutes permeabilization with PbTr, the cells were blocked in PbTr with 5% normal donkey serum  for 45\u2009minutes. Primary antibodies  were diluted in blocking buffer and cells were incubated overnight at 4\u2009\u00b0C in a humidified chamber. After three 5\u2009minute washes with PbTr, cells were incubated in the dark for an hour with secondary antibodies . Cells were finally washed three times with PbTr, and the slides were mounted in Prolong Diamond with DAPI . Slides were mounted overnight at room temperature prior to imaging.2 Profiler PCR Array Mouse Neuronal Ion Channels  and RT2 Profiler PCR Array Human Neuronal Ion Channels , respectively. RNA was extracted of sorted neurons immediately after FACS using Trizol and 2\u2009\u00b5g of RNA were converted to cDNA with the High-Capacity cDNA Reverse Transcription Kit . qPCR was performed with iQ SYBR Green Supermix  in a Biorad CFX96 according to the array manufacturer\u2019s protocol.Gene expression analysis of FACS sorted Hb9::GFP mouse motor neurons and HUES3 HB9::GFP hPSC-derived motor neurons was performed by qPCR array the RT48-well MEA plates (Axion Biosystems) were coated with 50\u2009\u00b5g/ml PDL in 5\u2009\u00b5l drops in the centers of the wells at room temperature for 1\u2009h. After three washes with PBS, the plates were coated with laminin  for 1\u2009hour. Sorted motor neurons  were plated in a volume of 5\u2009\u00b5l per well and allowed to attach for 1\u2009hour at 37\u2009\u00b0C. Motor neuron maintenance media (see above) was added to each well to a total volume of 300\u2009\u00b5L. Longitudinal MEA recordings were performed immediately prior to media changes three times per week by loading the MEA plate into the pre-warmed Maestro MEA plate reader (Axion Biosystems). After allowing for five minutes of equilibration, the plate was recorded for five minutes.Drugs were pre-mixed at 10x concentration in 48 well plates (see Supplemental Table\u00a0For network burst analysis Fig.\u00a0, we usedFor drug effects in blocked neurons Fig.\u00a0, we firsSupplementary Info"}
+{"text": "Desmonostoc muscorum CCALA125 strain extracts were enriched by polymeric resin treatment, and subjected to HPCCC affording three cyclic lipopeptides (1\u20133), which were further repurified by semi-preparative HPLC, affording 1, 2, and 3, with a purity of 86%, 92%, and 90%, respectively. The chemical identities of 2\u20133 were determined as muscotoxins A and B, respectively, by comparison with previously reported ESI-HRMS/MS data, whereas 1 was determined as a novel muscotoxin variant (muscotoxin C) using NMR and ESI-HRMS/MS data. Owing to the high yield (50 mg), compound 2 was broadly screened for its antimicrobial potential exhibiting a strong antifungal activity against Alternaria alternata, Monographella cucumerina, and Aspergillus fumigatus, with minimum inhibitory concentration (MIC) values of 0.58, 2.34, and 2.34 \u00b5g/mL; respectively, and weak antibacterial activity against Bacillus subtilis with a MIC value of 37.5 \u00b5g/mL. Compounds 1 and 3 were tested only against the plant pathogenic fungus Sclerotinia sclerotiorum due to their low yield, displaying a moderate antifungal activity. The developed chromatographic method proved to be an efficient tool for obtaining muscotoxins with potent antifungal properties.Muscotoxins are cyanobacterial cyclic lipopeptides with potential applications in biomedicine and biotechnology. In this study,  Cyanobacteria are Gram-negative photosynthetic microorganisms that have gained attention as a source of potential therapeutically useful compounds . One gro\u03b2-amino fatty acid [Desmonostoc muscorum CCALA125 (synonymous to Luke\u0161ov\u00e1 1986/14 and NIVA-CYA 817). The structures of these compounds were determined by detailed HRMS/MS and NMR analysis, and Marfey\u2019s reagent was used for chiral amino acid analysis after acid hydrolysis [Muscotoxins are cyanobacterial CLPs comprising 11 amino acid units including a tty acid . Our grodrolysis . Muscotodrolysis . HoweverCymbopogon citratus [Beta vulgaris [Siparuna glycycarpa [Microcystis aeruginosa [Chlorella zofingiensis [High-performance countercurrent chromatography (HPCCC) is a solid support-free chromatographic technique that uses two immiscible solvent phases. The equipment uses centrifugal force for retaining the stationary phase within the column, while the mobile phase is pumped through the column . Those ccitratus , Beta vuvulgaris , and Sipycycarpa , respectruginosa , and canngiensis , using cngiensis .As muscotoxins belong to the class of cyclic lipopeptides usually possessing antimicrobial activities, they could be interesting targets for addressing combinatorial biosynthesis strategies aimed at enhancing their potential pharmacological efficacy or mitigating toxicity issues. Herein, we report the separation of muscotoxins from cyanobacteria by the combined use of HPCCC, polymeric resins, and HPLC. The isolated compounds were tested for their antimicrobial activity against a panel of fungi, as well as Gram-positive and Gram-negative bacteria.2 and 3 from D. muscorum CCALA 125 extract were determined by comparing their ESI-HRMS/MS spectra with the literature data [2, the major CLP in the extract  for the target compound. Moreover, it should exhibit a short settling time (less than 30 s) and a suitable density difference between the upper and lower phases of the two-phase solvent system, in order to favor the retention of stationary phase inside the HPCCC column [K2/K1, K2 > K1) should be greater than 1.5 [K values show a poor resolution because they elute closer to the solvent front. On the contrary, those compounds with larger K value are better separated but elute as wider peaks and at later elution times [K values of the compounds 1\u20133 was investigated. The K value is frequently estimated by using HPLC with UV detection, which is calculated by dividing the peak area of the target compound in the upper phase by that of the peak area of the same target compound in the lower phase. However, given that UV chromatogram provided insufficient peak areas for minor muscotoxins, the MS detector was thus used to estimate the K values. By using this approach, the peak area of the molecular ions corresponding to the target compounds were selectively monitored from the base peak chromatogram. As presented in the n-hexane, ethyl acetate, ethanol, and water in a ratio of 1:5:1:5) gave suitable K values and a proper separation factor (\u03b1) for compounds 2 and 3, as well as a short settling time. However, the solvent system 10 gave a small K value (K \u2264 0.5) for compound 1, indicating that this compound would be poorly separated from other contaminants. Hence, to have a suitable K value, the solubility of compound 1 in the upper phase should be increased. The improvement of the K value of compound 1 could be achieved by finding out a new solvent system or by modifying the composition of the already selected solvent system. In the present study, the system 10 was acidified by adding acetic acid leading to the system 11 . This modification favored the solubility of compound 1 in the upper phase of the solvent system 11, giving rise to an appropriate partition coefficient (K = 1.09), a short settling time, and a suitable density difference. Although the partition coefficients of the target compounds in systems 10 and 11 are strongly correlated, the system 10 ensured a sufficient selectivity (\u03b1 = 1.5) between the compounds 2 and 3. Overall, these results indicated that the separation of the compounds 1\u20133 would demand the application of a two-step HPCCC method. In this context, the solvent system 10 showed selectivity for the compounds 2 and 3, and solvent system 11 was selective for the compound 1. In HPCCC, it is very well established that when the retention of stationary phase is increased, a good chromatographic resolution is achieved [2 and 3 was achieved when injecting 100 mg of enriched extract.When working with HPCCC, the search for a proper two-phase solvent system has been informed to represent the major part of the work involved in the HPCCC separation . An apprC column ,26, whicthan 1.5 ,26. It ion times . In the achieved . A reducn-Hex\u2013EtOAc\u2013EtOH\u2013H2O, 1:5:1:5) was used as mobile phase at a flow rate of 1 mL/min. This process was repeated 10 times to separate all enriched extract. The stationary phase retention during the HPCCC separation was 72%. Three peaks fractions that were eluted at the retention times from 68 to 88 min, from 110 to 135 min, and from 150 to 170 min, corresponded to the compound 1-containing fraction (Fr.1), compound 2, and compound 3, respectively , as well as the compounds 2  and 3 . Fr.1 was further subjected to a second HPCCC purification step using solvent system 11, with its lower phase as the mobile phase at a flow rate of 1 mL/min. The target compound 1 was eluted at the retention times from 170 to 190 min . The stationary phase retention during the HPCCC separation was 70%. In this study, the isolation of compound 1 is reported for the first time. The separation of this kind of CLPs with closely related chemical structures demonstrates the powerful selectivity of HPCCC.The optimized operating conditions were used to process 1000 mg of enriched extract using HPCCC, where the lower phase of the solvent system 10 , 2 , and 3  were obtained by HPLC when considering the stereoisomers of the target compounds as contaminants (The combined use of HPCCC and HPLC has proven to be efficient in the isolation of CLPs . This chaminants . The HPL2 and 3 was confirmed by ESI-HRMS/MS experiments. The fragment ions generated from the fragmentation of the molecular ions at m/z 1211.67 (2) and m/z 1225.68 (3) were in excellent agreement with those of the amino acid sequence of muscotoxins A and B; respectively [D. muscorum CCALA 125. Compounds 2 and 3 differ from each other only by a -CH3 group (methyl group) corresponding to the substitution of l-proline for \u03b3-methylproline, as previously demonstrated by our team using 2D NMR methods [1 was determined by the combination of NMR and ESI-HRMS/MS. Two-dimensional nuclear magnetic resonance spectroscopy (2D NMR) experiments including COSY, TOCSY, and 1H-13C HSQC-TOCSY were performed to identify the amino acids composition of 1, as shown in 1, Gln2, Gly3, Pro4, Phe5, Val6, Ser7, dThr8, Ser9, Ile10, Pro11) (1) was assigned as muscotoxin C, which differs from the previously described muscotoxin A (2) in the substitution of Ile6 by Val6  . This pe, Pro11) . The nov by Val6 .1\u20133) were tested for their antifungal activity against common plant pathogenic fungi, S. sclerotiorum. Interestingly, despite the isolated variants differing only in one amino acid residue, their antifungal activity against S. sclerotiorum differed significantly . These data hint the possible role of the amino acid substitution in the peptidic core of the molecule, such as Pro by \u03b3-MePro or Val by Ile enhancing the bioactivity. Owing to the high-yield isolation of compound 2 and the unavailability of sufficient amounts for minor variants isolated (1 and 3), the antimicrobial activity against five bacterial and eight fungal isolates was investigated only for compound 2. Among all the bacterial strains tested, 2 showed a weak antibacterial activity only against the Gram-positive pathogen Bacillus subtilis with a minimum inhibitory concentration (MIC) value of 37.5 \u00b5g/mL and MIC95 at \u2264300 \u00b5g/mL. However, it exhibited a moderate to strong antifungal activity against all the fungal strains tested, except Bipolaris sorokiniana. The strongest activity was observed against Alternaria alternata, Monographella cucumerina, and Aspergillus fumigatus, with MIC values of 0.58, 2.34, and 2.34 \u00b5g/mL, respectively, and minimum fungicidal concentration (MFC) values of 75, 75, and 37.5 \u00b5g/mL, respectively  and Analytika . The methanol used for extraction was obtained from Analytika . Acetonitrile and water for HPLC-HRMS analyses were obtained either from Sigma-Aldrich  or Merck , and were of LC-MS grade purity. Deionized water was obtained using reverse-osmosis . Non-ionic polymeric adsorbents (Amberlite XAD16 and Amberlite XAD-7) were from Sigma-Aldrich .D. muscorum CCALA 125 was cultivated in a 15 L photobioreactor on Anabaena medium by bubbling CO2-enriched air (2%) at 28 \u00b0C for 10 days [g, 15 min), frozen at \u221240 \u00b0C, and then freeze-dried, affording 40 g of dried biomass. Sea sand was used for disintegration of the freeze-dried biomass and methanol (1 L) for extraction. The extraction operation was repeated three times on the same biomass. The resulting suspension (3 L) was centrifuged  and the supernatant was concentrated to total dryness using a rotary evaporator (at 40 \u00b0C). About 6200 mg of dried crude extract was obtained, which was stored at 2 \u00b0C for the subsequent enrichment process.The filamentous cyanobacterium  10 days . The celTwo non-ionic polymeric resins, that are commercially offered as XAD-16 and XAD-7 Amberlite resins, were consecutively used for enriching the dried crude extract that was obtained in the previous step. For that purpose, a suspension made of 6.200 g of dried crude extract and 500 mL of water was prepared and loaded into an Amberlite XAD-16 resin column . To remove the non-adsorbed components from the column, 1 L of water was passed thorough the column. The resulting aqueous solution (1.5 L), eluted from XAD-16 resin column, was further passed through the XAD-7 resin column . Again, the XAD-7 resin column was rinsed with water to remove the non-adsorbed components. Finally, the adsorbed compounds were released from each column using methanol as eluent (1.5 L). The resulting methanol eluates from each column were separately concentrated to total dryness using a rotary evaporator (at 40 \u00b0C). The dried enriched extracts were analyzed by HPLC-UV-ESI-HRMS.A HPCCC apparatus  was used for separating the target compounds from the enriched extract. It was used a semi-preparative HPCCC column (134 mL). A H50/H150 Smart Water Chiller  was used for adjusting the temperature of separation work. The stationary and mobile phases were pumped with a Q-Grad pump . The effluent from the column was continuously monitored with a Sapphire UV-VIS spectrophotometer  operating at 240 nm. The chromatographic run was processed using an EZChrom SI software platform .n-hexane, ethyl acetate, ethanol, water, and acetic acid in different proportions (K) of the target compounds. In addition, given that the settling time as well as the density difference between the upper and lower phases of each two-phase solvent system are parameters associated with the retention of stationary phase in the column, they were thus estimated [K), which were calculated by dividing the peak area of the target compound in the upper phase by the peak area of compound in the lower phase.Different two-phase solvent systems were prepared using portions . The prestimated ,26 and uThe best two-phase solvent system selected from the previous step was prepared at a large scale for separating the target compounds by HPCCC. The components of the selected system were added into a separating funnel and shaken vigorously and were then left to equilibrate. After 20 min, the upper and lower phases were separated and degassed by applying sonication. The sample solution was prepared by dissolving the enriched extract in 3 mL of the lower phase of the selected solvent system.n-Hex\u2013EtOAc\u2013EtOH\u2013H2O  was used in reverse elution mode for obtaining compounds 2\u20133, and the 1-containing fraction. In the HPCCC second step, the solvent system composed of n-Hex\u2013EtOAc\u2013EtOH\u2013H2O\u2013AcOH, 1:5:1:5:1 was used in reverse elution mode for obtaining the compound 1. In the reverse elution mode, the lower phase of the two-phase solvent system is used as the mobile phase and the upper phase as the stationary phase. At the beginning, the HPCCC column was filled with the upper phase (stationary phase), and it was rotated at 1200 rpm. After that, the lower phase (mobile phase) was pumped through the column at a flow rate of 1 mL/min. When reaching the hydrodynamic equilibrium, that is, when the volume of stationary phase that is eluted from the column is constant, the sample solution was injected. The separation was performed at 28 \u00b0C. The fractions that eluted from the HPCCC column were collected and analyzed offline by HPLC-ESI-HRMS. The retention of the stationary phase (Sf) during the HPCCC run was calculated as follows:The separation of the target compounds from the enriched extract was performed using a two-step HPCCC method. In the HPCCC first step, the solvent system composed of \u22121, and the column temperature was set at 28 \u00b0C.The HPCCC peak fractions corresponding to the target compounds were repurified using a semi-preparative Agilent 1100 HPLC system. The separation was performed on a reverse phase Reprosil 100 C18 column  using a mobile phase composed of acetonitrile (A) and water (B) using the following gradient: 0\u20132 min, 70% B; 2\u20136 min, 70\u201360% B; 6\u201315 min, 60\u201330% B; 15\u201316 min, 30\u20130% B; 16\u201320 min, 0\u20130% B; 20\u201321 min, 0\u201370% B. The peaks were detected with a diode array detector (DAD) at a monitoring wavelength of 240 nm. The mobile phase was pumped at a flow rate of 2 mL minm/z, operating in the positive ion mode. The peaks were recorded with a diode array detector (DAD) at a monitoring wavelength of 240 nm.The extracts and HPCCC fractions were analyzed using a Dionex UltiMate 3000 HPLC system  coupled with a diode array detector (DAD) and with electrospray ionization sourced-high resolution mass spectrometer . The separations were performed on a reversed phase column , held at a constant temperature of 30 \u00b0C. The mobile phase of the HPLC run consisted of the combination of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). The following gradient was used: 0\u20131 min, 85% A; 1\u201320 min, 85\u20130% A; 20\u201325 min, 0% A; 25\u201330 min, 0\u201385% A, which was pumped at a constant flow rate of 0.6 mL/min. The source parameters were as follows: the spray needle voltage was set at 3.8 kV, nitrogen was used both as the nebulizing gas (3 bar) and the drying gas (12 L/min), and the temperature was 210 \u00b0C. The fragmentation of the molecular ions was induced by using nitrogen as a collision gas. The cyclic oligopeptide part of the target compounds was determined at collision energy of 60 eV. The scanning range was 50\u20132600 1\u20133 are presented in 1 was determined by NMR data as presented in 1H, 150.93 MHz for 13C, Bruker Biospin GmbH, Rheinstetten, Germany) in CD3OD, 303.2 K. The residual solvent signals were used as an internal standard (\u03b4H 3.330 ppm and \u03b4C 49.05 ppm). 1H-NMR, 13C-NMR, COSY, TOCSY, 1H-13C HSQC, 1H-13C HMBC, 1H-13C HSQC-TOCSY, and J-resolved spectra were measured using the standard manufacturer\u2019s software TopSpin 3.5. The 1H-NMR spectrum was zero-filled to 2-fold data points and multiplied by a window function , before Fourier transformation to improve the resolution. The 13C-NMR spectrum was zero filled to 2-fold data points. Subsequently, the line broadening (1 Hz) was used to improve signal-to-noise ratio. Protons were assigned by COSY, TOCSY, and HSQC-TOCSY, and the assignment was transferred to carbons by HSQC. The chemical shifts are given on the \u03b4 scale (ppm), and coupling constants are given in Hz. The digital resolution allowed us to present the proton and carbon chemical shifts to three or two decimal places. The proton chemical shift readouts from HSQC are reported to two decimal places. The operating conditions of the ESI-HRMS instrument are indicated in the previous section.The chemical identity of the target compounds was determined by ESI-HRMS and NMR analysis in comparison with literature data . The MS 1\u20133) was initially tested only against plant pathogenic fungi Sclerotinia sclerotiorum by determining the minimum inhibitory concentration (MIC) using disc diffusion assay. Compounds (1\u20133) were dissolved in MeOH at different concentrations and further transferred (20 \u00b5L) on layer filter paper targets (size 5 mm) to get desired concentrations of 250\u20131.5625 \u00b5g/disk. Discs were placed at the border of Petri dish (average 35 mm) containing Czapek-Dox medium. The mycelial target of the plant pathogenic fungus S. sclerotiorum (0.5 cm in diameter) was inoculated on the opposite sites of dish. The fungicide RANCONA 15 ME  and methanol were used as positive and negative control, respectively. Each experiment was performed in triplicate. The growth of fungal mycelium after 4 days in the presence of the studied compounds was evaluated using digital image analysis. The macro-optic system, consisting of a digital camera DUS-1 (5Mpx) and objective lens type Cosmicar  were used for acquisition of images of the Petri dishes. The images (TIFF format) were converted by thresholds, and the area of binary objects corresponding to size of grown mycelium was measured and evaluated by software NIS-ELEMENTS AR ver. 3.2  and by a method published previously [Due to the unavailability of enough amounts of isolated compounds, the antifungal activity for all the isolated compounds , B. subtilis (CCM1999), S. sanguinis (CCM4047), P. aeruginosa (CCM1959), E. coli (CCM2024), and eight fungal isolates; C. friedrichii (BCC020_2879), A. fumigatus (BCC020_2845), F. oxysporum (BCC020_2866), T. harzianum (BCC020_0606), B. sorokiniana (BCC020_1571), M. cucumerina (BCC020_2872), C. globosum (BCC020_2527), and A. alternata (BCC020_0609) using broth two-fold microdilution method following the standard protocol [S. aureus and S. sanguinis, gentamycin (32\u20130.0625 \u00b5g/mL) was used as positive control for Bacillus subtilis, E. coli, and P. aeruginosa, whereas fluconazole (32\u20130.0625 \u00b5g/mL) was used as positive control for all the fungal isolates. After incubation, the well with the least concentration of the compound showing any inhibition in the growth was taken as the MIC value for the respective organisms. MIC95 was determined as the concentration required to inhibit or kill 95% of bacterial isolates spectroscopically at 600 nm. Minimum fungicidal concentration (MFCs) were determined after 48 h incubation by removing 10 \u00b5L of the contents from wells showing no visible growth and spreading them on to Sabouraud dextrose agar plates [Furthermore, compound protocol . Brieflyr plates . The plaDesmonostoc muscorum strain CCALA125 by the combined use of adsorption on polymeric resins, HPCCC, and HPLC methods. As these three chromatographic methods are recognized to be orthogonal against each other, therefore, their combined use rendered the separation of chemically similar compounds. Muscotoxin C was isolated for the first time and its chemical structure was established by MS and NMR spectroscopic data. The described isolation method is an efficient approach for obtaining CPLs from cyanobacterial biomass and represents a methodological reference than can be scaled up for obtaining these compounds in higher amounts. Muscotoxin A was found to exhibit a potent antifungal activity against plant pathogenic fungi, thus, it might have applications as an agricultural fungicide or be used as a potential chemical template for developing new fungicides.Three CLPs (muscotoxins A\u2013C) were isolated and purified from the filamentous cyanobacterium"}
+{"text": "Nitrate (N) response is modulated by light, but not understood from a genome-wide perspective. Comparative transcriptomic analyses of nitrate response in light-grown and etiolated rice leaves revealed 303 and 249 differentially expressed genes (DEGs) respectively. A majority of them were exclusive to light (270) or dark (216) condition, whereas 33 DEGs were common. The latter may constitute response to N signaling regardless of light. Functional annotation and pathway enrichment analyses of the DEGs showed that nitrate primarily modulates conserved N signaling and metabolism in light, whereas oxidation\u2013reduction processes, pentose-phosphate shunt, starch-, sucrose- and glycerolipid-metabolisms in the dark. Differential N-regulation of these pathways by light could be attributed to the involvement of distinctive sets of transporters, transcription factors, enriched cis-acting motifs in the promoters of DEGs as well as differential modulation of N-responsive transcriptional regulatory networks in light and dark. Sub-clustering of DEGs-associated protein\u2013protein interaction network constructed using experimentally validated interactors revealed that nitrate regulates a molecular complex consisting of nitrite reductase, ferredoxin-NADP reductase and ferredoxin. This complex is associated with flowering time, revealing a meeting point for N-regulation of N-response and N-use efficiency. Together, our results provide novel insights into distinct pathways of N-signaling in light and dark conditions. Rice has the least NUE among cereals and therefore tops all other crops in N-fertilizer consumption in India2. The molecular aspects of nitrate transport, assimilation, signalling and crosstalk with water, hormone, and development are better understood than the biological determinants of crop nitrogen use efficiency14. Characterization of the phenotype for NUE will be crucial for progress in this regard15.A major challenge in improving crops for input use efficiency is to understand and optimize the inputs for various agroclimatic conditions including light and photoperiod, soil type, altitude, humidity etc. Nitrogen (N) is quantitatively the most important fertilizer input for intensive cropping, but globally, nitrogen use efficiency (NUE) is as low as 30\u201340% for various crops, which is a major cause for economic losses and environmental consequences of N pollutionNR) and nitrite reductase (NiR), followed by their assimilation into amino acids through the glutamine synthetase and glutamate synthase (GS-GOGAT) cycle. This requires 2-oxoglutarate (2-OG) from the carbon metabolism and hence coordination between C and N metabolism4. Transcriptomic studies have revealed thousands of nitrate-responsive genes in Arabidopsis18, rice23 and maize24. They include those involved in metabolism, redox balance, signaling, stress, hormones, development etc., indicating their possible role in NUE26. Heterotrimeric G-protein gamma subunit has been identified as a QTL for NUE in rice27, while the beta subunit has been shown to mediate nitrate-responsive root development28. G-proteins were implicated in light regulation of NR gene expression in our earlier studies in maize30 and rice31. Our transcriptome studies in G-protein mutants showed their role in other nitrogen and/or stress responses36.Nitrate is taken up into the cell by a family of transporters and converted into ammonium ions by the serial action of nitrate reductase , a positive regulator of light signalling, has been shown to enhance nitrate uptake in Arabidopsis40. Interestingly, N regulates flowering time by modulating a blue-light receptor cryptochrome 1 (CRY1) in Arabidopsis41. Sucrose mimics light-responses and its exogenous application induces NR activity possibly via hexose\u2019s sensor independent N-signalling pathway in Arabidopsis42. Further, metabolite sensor SNRK1 regulates NR and sucrose phosphate synthase activity and therefore controls both N and C metabolism43.Light is an important regulator of plant N-responses, both through photosynthesis and C/N balance, as well as through light signalingMost of the above information on the role of light in N-response was based on Arabidopsis and not on crop plants. Therefore, to delineate the molecular basis of light-dependent and independent nitrate response, we analysed the nitrate-responsive leaf transcriptomes of light-grown and etiolated rice seedlings in this study.3 was found to be optimum in light and dark conditions  elongated mesocotyl and coleoptile length compared to light-grown condition   of\u2009\u00b1\u20091 and p value\u2009\u2264\u20090.05 were used to define the differentially expressed genes (DEGs). Multiple testing corrections using Benjamini\u2013Hochberg adjusted p value were tried but not considered, as they produced many false negatives by eliminating many well-known N-responsive genes obtained\u00a0from qualifying our geomean cutoff (log2FC) of\u2009\u00b1\u20091 45 to predict the subcellular distribution of proteins encoded by nitrate-responsive DEGs in light and dark, which revealed that they are predominantly targeted to the nucleus, followed by plasma membrane, chloroplast and others 48. The results were broadly similar to those from GO analysis, with nitrate-responsive changes to metabolism, cellular responses, regulation and hormone biosynthesis among others  pathways such as phenylpropanoid biosynthesis, nitrogen metabolism, phenylalanine metabolism, hormone signal transduction and photosynthesis in light, whereas in the dark, they were starch and sucrose metabolism, metabolic pathways, glycerolipid metabolism and N-Glycan biosynthesis Table .To validate the expression profile of nitrate-responsive genes involved in nutrient, stress and development, 6 DEGs out of 8 tested DEGs encoding transporter, transcription factors and others showed statistically significant differences in qRT-PCR, thus validating the microarray results Fig.\u00a0.Figure 4bHLH120 (Os09g0455300/BGIOSGA030896), bHLH066 (Os03g0759700/BGIOSGA013600). However, universal stress domain containing protein (Os02g0707900/BGIOSGA005763), efflux transporter of nicotianamine 1 (Os11g0151500/BGIOSGA034485) and MYB family transcription factors  were up-regulated by nitrate in the dark but not detected in light condition. The SPX domain containing protein (Os02g0202200/BGIOSGA007749) was down-regulated in both light and dark. The reason for non-detected DEGs in microarray was their statistically non-significant expressions (Table The details of these DEGs and corresponding primer sequences used for qRT-PCR are provided in Table ns Table . The qRToryzabase database (https://shigen.nig.ac.jp/rice/oryzabase/) and found that N-responsive DEGs were assigned to culm, root, leaf, spikelet, seed, heading date and panicle  and LTP family protein (LOC_Os02g44310.1). Phytoene synthase (PSY) regulates carbon flux in carotenoid biosynthesis and is required to induce carotenogenesis-dependent ABA accumulation in root under different abiotic stress conditions50. The up-regulated expression of PSY in light may be associated with root inhibition by high nitrate in rice. Leaf is the primary organ for photosynthesis in rice and application of high N dose has been shown to reduce photosynthetic NUE51. Among leaf-associated N-responsive DEGs, we observed up-regulated expression of Zn transporter 3 (LOC_Os04g52310.1) and ABA stress-ripening (LOC_Os11g06720.1) in light, whereas plastid terminal oxidases 1 (LOC_Os04g57320.1) and YABBY domain containing protein (LOC_Os04g45330.1) were up-reregulated in dark , it was of interest to examine how many of the N-responsive genes identified here are expressed in other stages/tissues of the rice plant. This allows to separate those genes that are ubiquitously expressed in most of the organs from those that are unique to specific organs/stages for further validation of their nitrate response. This was particularly relevant in view of the incomplete characterization of the phenotype for N-response/NUE. We therefore searched the cle Fig.\u00a0. The avaark Fig.\u00a0.Figure 553, whereas YABBY domain containing proteins are known to regulate leaf morphology in plants54. A few DEGs were also associated with agronomically important traits , which revealed 270 and 216\u00a0N-responsive DEGs exclusive to light and dark conditions, respectively, with an additional 33 genes in common , RiceSRTFDB (https://www.nipgr.ac.in/RiceSRTFDB.html), STIFDB (https://caps.ncbs.res.in/stifdb/) and MapMan and classifying them into families using Rice SRTFDB  in rice. This was done by searching the for N-responsive DEGs in different transcription factor databases viz. RiceFREND  was used to identify the over-represented motifs in the 1\u00a0kb promoter sequences of the N-responsive DEGs identified in light and dark conditions.Transcription factors (TFs) act as master regulators by binding to cis-acting motifs in the promoter regions of genes to control diverse cell processes, including N signaling57. We further predicted the motif enrichment using 1\u00a0kb promoter sequence of all the DEGs identified in light and dark conditions. Examination of the 20 most significantly enriched motifs in DEGs identified under light and dark conditions revealed that they are entirely different sets, despite the fact that 33 DEGs were common to both conditions  networks built from yeast one-hybrid screens and validated by knockouts57, similar networks were developed in this study using their orthologues in rice. Prior to this, we verified the level of gene conservation between rice and Arabidopsis using Orthovenn 265. We observed 11,367 and 11,956 orthologous clusters in Arabidopsis and rice, respectively, of which 9,698 orthologous clusters were common . We identified 144 conserved orthologs in rice, with 91 in light and 53 in dark conditions, of which many, but not all were N-responsive in our microarray data  networks using N-responsive DEGs in light and dark conditions Figs. , S9. Theork Fig.  and noneork Fig. , suggestork Fig. . This cl24. Light regulation of nitrate assimilation was studied extensively in etiolated and green plants from the point of view of direct light signaling through photoreceptors or indirect signaling through C-metabolites. However, to the best of our knowledge, no study has comprehensively analyzed genome-wide nitrate signaling in light and dark conditions. Therefore, we exploited the availability of functional genomic tools to analyze the nitrate-responsive transcriptome in etiolated and green leaves of rice, a crop notorious for its poor NUE among cereals. This enabled us to understand light-dependent and light-independent nitrate responses, visualize the networks of underlying interactions and identify potential candidates to manipulate N-responses/NUE in rice.To date, a number of N-transcriptomic studies were carried out to identify the number of genes and associated pathways involved in N-uptake, -signaling, -metabolism and assimilation among others3, downstream metabolites, or the influence of root-shoot translocation parameters that may respond differently in light and dark29. These experimental factors can confound the interpretation of results, whereas we obtained consistent results when cut-leaves were treated with standardized concentrations of nitrate29 as was done in the present case. Our transcriptome analyses showed very distinctive sets of nitrate responsive genes in etiolated and green leaves, with only 33 common between them. The common up-regulated genes such as NR, FNR, ENOD20, BTBA4 were involved in N-metabolism while those commonly down-regulated such as peroxidase cysteine-rich repeat secretory protein 55, go35 NBS-LRR were involved in stresses  in dark condition ; its regulation by light offers a crucial meeting point in the mechanism of nitrate response and therefore a potential target to manipulate NUE. Moreover, flowering time is also an important determinant of crop duration in rice and we have already shown that long duration rice genotypes tend to have higher NUE15.Sub-clustering of the PPI networks using MCODE did not reveal any molecular complex in the dark, but a single molecular complex was identified in light, consisting of NiR, FNR and ferredoxin Fig. . FNR has72. Genes involved in the transport of chloride, amino acid, potassium, sulfate, and water channel were also up regulated in light  transporters were among the most abundant DEGs, though their members were different in light and dark conditions Table . They arht Table . It is k57. The constructed NTR networks using rice orthologs were similar to Arabidopsis NTR networks as expected, suggesting a core of nitrate-regulated genes and that their associated connections are highly conserved between rice and Arabidopsis. Mapping the nitrate-responsive gene expression data produced two distinct NTR networks for light and dark  or double distilled water (control) for 90\u00a0min. In case of dark experiments, similar treatments were given to excised leaves in dark condition. The control and nitrate-treated leaves were instantly frozen in liquid nitrogen and stored at -80 \u00baC till use.Seeds of rice https://imagej.nih.gov/ij/download.html). Statistical unpaired T test analyses were performed in the GraphPad Prism 6 software(https://www.graphpad.com/scientific-software/prism/).Ten days old seedlings grown in light and dark conditions were kept in horizontal position and digital images were captured. The lengths of mesocotyl and coleoptile were measured using ImageJ software  for 10\u00a0min at 4\u00a0\u00b0C. The supernatant was retrieved and 0.5\u00a0ml of it was mixed with 4.5\u00a0ml of aqueous 80% ice-cold acetone. The absorbance was measured at 663.2 and 646.8\u00a0nm and chlorophyll content was calculated using the formula: Ch-a\u2009=\u200912.25\u2009\u00d7\u2009A663.2\u2014279\u2009\u00d7\u2009A646.8; Ch-b\u2009=\u200921.5\u2009\u00d7\u2009A646.8\u20145.1\u2009\u00d7\u2009A663.2. Statistical unpaired T test analyses were performed in the GraphPad Prism 6 software (https://www.graphpad.com/scientific-software/prism/).The chlorophyll content was estimated as described earlier38. Briefly, 100\u00a0\u00b5l of leaf crude extract was added to the reaction mixture containing 5\u00a0mM KNO3 and 5\u00a0mM EDTA in 0.1\u00a0M sodium phosphate buffer (pH 7.5) in a total reaction volume of 0.4\u00a0ml. The reaction was incubated for 20\u00a0min at 25\u00a0\u00b0C and terminated by adding 0.6\u00a0ml of freshly prepared stopping mixture [1:1 ratio of NED (0.1% w/v) and sulfanilamide (1% w/v in 3\u00a0N HCl)]. The pink colour was measured spectrophotometrically at 540\u00a0nm. NR activity was calculated as nmoles of nitrite/mg protein/min with the help of a standard curve generated using known concentration of nitrite. NR specific activity was expressed as enzyme activity per mg protein and mean data of three independent experiments with internal triplicates were used to plot the graph with standard errors.Nitrate reductase assay was performed after 6\u00a0h of treatment with potassium nitrate as described earlier78. The RNA pellet was washed with ethanol , dried at room temperature, dissolved in DEPC-treated autoclaved water and frozen at \u2212\u00a020\u00a0\u00b0C till further use. Microarray experiments were performed using RNA isolated from two independent biological replicates as flip-dye replicates at Genotypic Technology Pvt Ltd, Bengaluru, India. The quality and quantity of total RNA were analyzed using Agilent Bioanalyzer as per the manufacturer\u2019s protocol.Total RNA was isolated from leaves frozen after 90\u00a0min of treatment with either water (control) or potassium nitrate (120\u00a0mM), using modified hot phenol method as described79. Labeling was performed using low RNA Input Fluorescent Linear Amplification Kit .Total RNA was used to synthesize the first and second strand cDNA. Reaction mixture containing 500\u00a0ng RNA and 1.2\u00a0\u00b5l of oligo dT-T7 Promoter Primer in nuclease-free water was incubated at 65\u00a0\u00b0C for 10\u00a0min. Then 4.0\u00a0\u00b5l of 5\u2009\u00d7\u2009First strand buffer, 1\u00a0\u00b5l of 10\u00a0mM dNTP mix, 2\u00a0\u00b5l of 0.1\u00a0M DTT, 1\u00a0\u00b5l of 200 U/\u00b5l MMLV-RT, and 0.5\u00a0\u00b5l of 40U/\u00b5l RNaseOUT were added and incubated at 40\u00a0\u00b0C for 2\u00a0h. After CDNA synthesis, 8\u00a0\u00b5l of NTP mixture, 2.4\u00a0\u00b5l of 10\u00a0mM Cyanine-5-CTP or Cyanine-3-CTP , 6\u00a0\u00b5l of 0.1\u00a0M DTT, 20\u00a0\u00b5l of 4\u2009\u00d7 Transcription buffer, 0.6\u00a0\u00b5l of inorganic pyrophosphatase, 0.5\u00a0\u00b5l of RNaseOUT, 0.8\u00a0\u00b5l of T7 RNA polymerase, and 15.3\u00a0\u00b5l of nuclease-free water were added to reaction mixture and incubated at 40\u00a0\u00b0C for 2\u00a0h. Qiagen'sRNeasy mini spin columns were used to purify the amplified samples. The cRNA quantity and specific activity were determined using NanoDrop ND-1000 (v 3.2.1.) and samples with specific activity\u2009>\u20098 were used for hybridization. Reaction mixture containing 1,650\u00a0ng of each Cyanine labeled cRNA (41.8\u00a0\u00b5l), 10\u2009\u00d7\u2009Blocking agent (11\u00a0\u00b5l) and 25\u2009\u00d7\u2009Fragmentation buffer (2.2\u00a0\u00b5l) was incubated at 60\u00a0\u00b0C for 30\u00a0min in dark. The fragmented cRNA were mixed with 2\u2009\u00d7\u2009Hybridization Buffer (55\u00a0\u00b5l) and resulting 110\u00a0\u00b5l mixtures was hybridized at 65\u00a0\u00b0C for 17\u00a0h in an Agilent Microarray Hybridization Chamber with Hybridization Oven. After hybridization, slides were washed with Agilent Gene Expression Wash Buffer I and incubated them for 1\u00a0min at room temperature and 37\u00a0\u00b0C. Slides were washed again with Wash buffer II in similar condition, cleaned and dried by rinsing with acetonitrile and then scanned using Agilent scanner (G2565B) set at 100% laser power. Agilent Feature Extraction software (version 9.1) was used to extract the data, which was normalized as per the recommended Per Spot and Per Chip protocol. This is a 2-color default normalization,\u00a0(Per Spot and Per Chip: Intensity dependent (Lowess) normalization) where each raw intensity value corresponding to the control channel is adjusted using a locally-weighted regression method called Lowess. Each value in the signal channel was divided by the adjusted control value, resulting in the final normalized value. The raw data were analyzed using GeneSpring 9 GX software and submitted at NCBI GEO database (Accession number: GSE12940).Microarray data analyses were performed as described earlier47 using default parameters. We have considered only statistically significant  GO terms for further analyses. TreeMap (https://www.treemap.com/) software was used to graphically represent the GO enrichments obtained from Expath analysis. Expath 2.0 tool47 was also used to perform the comparative pathway enrichment analyses of DEGs in light and dark. Mapping of DEGs onto various biological pathways was done using MapMan version 3.5.1 (https://mapman.gabipd.org/mapman-download)48. The fold change value (log2FC) and corresponding p value were used for significant enrichment of DEGs associated pathways in PageMan80. Over-represented and under-represented pathways are depicted with red and blue coloured boxes, respectively.Gene ontology based functional annotations of the DEGs were performed by Expath 2.0 toolhttps://rice.plantbiology.msu.edu/) and then analyzed by CELLO program (https://cello.life.nctu.edu.tw/) using default parameters for eukaryotes. Subcellular predictions were also made using TargetP 2.0 (https://www.cbs.dtu.dk/services/TargetP/)81.To predict the subcellular localization, the amino acid sequences of DEGs were retrieved from RGAP database (https://quantprime.mpimp-golm.mpg.de/?page=about). DEGs were selected based on their up- and down-regulated expression for described biological pathways. Approximately 2\u00a0\u00b5g of total RNA isolated from the control and nitrate-treated leaves was reverse transcribed into cDNA (20\u00a0\u03bcl volume) using cDNA synthesis kit . Its amplification reaction was carried out in 10\u00a0\u03bcl volume containing 1\u00a0\u03bcl of cDNA, 0.5\u00a0\u03bcl of forward and reverse gene specific primers (10\u00a0\u00b5M) and 5\u00a0\u03bcl of KAPA SYBR FAST Master Mix (2X) Universal . The reactions were performed in Aria Mx real-time PCR system . The relative accumulation of transcripts was analyzed by the comparative C(T) method using actin (BGIOSGA013463) as an internal control. Melting curve analyses of the amplicons were used to determine the specificity of qPCR reactions. Statistical unpaired T test analyses were performed using GraphPad Prism 6 software (https://www.graphpad.com/scientific-software/prism/).To confirm the expression pattern of the DEGs, qRT-PCR was performed in three independent biological replicates, with three technical replicates using gene-specific primers Table . All thehttps://string-db.org/), MCDRP (https://www.genomeindia.org/biocuration/), BioGRID (https://thebiogrid.org/) and PRIN (https://bis.zju.edu.cn/prin/). We mapped the DEGs to the protein\u2013protein interaction (PPI) networks based on experimental score, using Cytoscape version 6.066. To detect the molecular complexes, we used molecular complex detection (MCODE) plugin in Cytoscape. We also downloaded all the Arabidopsis orthologs from PlantGDB database (https://www.plantgdb.org/), which were used to generate and annotate DEGs-associated PPI and nitrate-responsive transcriptional regulatory networks in rice.The lists of experimentally validated interacting proteins for the DEGs analyzed in this study were retrieved from the databases STRING (https://rapdb.dna.affrc.go.jp/tools/dump). The motif discovery oligo analysis tool of Regulatory Sequence Analysis Tools (RSAT) software82 was used to identify enriched motifs (6\u20138 bases oligonucleotides) in the promoter sequences using default parameters. Rice (Oryza sativa IRGSP-1.0.42) whole genome was used as the background and motifs were predicted in both the DNA strands.One kb promoter regions upstream of the translational start site of the DEGs were downloaded from RAPDB database (Supplementary information 1Supplementary information 2"}
+{"text": "Hordeum brevisubulatum evolves better strategies to retain K+ to improve high-salt tolerance. Hence, uncovering K+-efficient uptake under salt stress is vital for understanding K+ homeostasis. HAK/KUP/KT transporters play important roles in promoting K+ uptake during multiple stresses. Here, we obtained nine salt-induced HAK/KUP/KT members in H. brevisubulatum with different expression patterns compared with H. vulgare through transcriptomic analysis. One member HbHAK1 showed high-affinity K+ transporter activity in athak5 to cope with low-K+ or salt stresses. The expression of HbHAK1 in yeast Cy162 strains exhibited strong activities in K+ uptake under extremely low external K+ conditions and reducing Na+ toxicity to maintain the survival of yeast cells under high-salt-stress. Comparing with the sequence of barley HvHAK1, we found that C170 and R342 in a conserved domain played pivotal roles in K+ selectivity under extremely low-K+ conditions (10 \u03bcM) and that A13 was responsible for the salt tolerance. Our findings revealed the mechanism of HbHAK1 for K+ accumulation and the significant natural adaptive sites for HAK1 activity, highlighting the potential value for crops to promote K+-uptake under stresses.Potassium retention under saline conditions has emerged as an important determinant for salt tolerance in plants. Halophytic  Potassium represents 2.6% of the weight of the Earth\u2019s crust. However, dissolved K in soil\u2014as the only fraction directly available to plant\u2014is deficient, especially in saline\u2013alkali land and arid land . Retaini+/K+ uptake proteins/K+ transporter) proteins function as K+-transporters and the major contributor for K+ nutrition in K+ depleted soil [Arabidopsis), which indicates the important physiological roles of such transporters in crops. Their proteins possess 10\u201315 transmembrane (TM) domains and are divided into 5 clusters [AtHAK5, HvHAK1, OsHAK1, OsHAK5, ThHAK1, SlHAK5, CcHAK1 and so on [+ transport feature that allows plant to thrive under low-K+ (<1 mM) conditions. In fact, K+ uptake in plants also demands these HAK-type transporters under multiple stresses such as salinity, Cs+ -polluted or drought soils [+, Cs+ or drought indirectly reduces soluble K+ concentration in soil that leads to K+ deficiency [+ or Cs+ in cells causes ion imbalances with a reduced K+/Na+ or K+/Cs+ ratio that inhibits plant growth [OsHAK1 in rice leads to about 50\u201355% lower K+ uptake than wild types in K-starved environments, and causes sensitivity to drought and salt [+/K+ homeostasis and the membrane potential of root cells under salt conditions [Zea mays L. showed ZmHAK4-mediated shoot K+/Na+ homeostasis for improving salt tolerance, conferring the natural variation of this gene [+ nutrition largely depends on HAK/KUP/KT system, affecting agriculture worldwide.As ion fluxes control ion concentration, the HAK/KUP/KT , and A13 directly affect the K+ uptake under high external Na+ condition. Our study significantly revealed the natural adaptive sites of HbHAK1 were the key residues for improving HAK1-type activity, highlighting the potential value for crops to promote K+ uptake under stresses.Saline land occupies more than 20% of irrigated soil. It reduces crop productivity because most crops are glycophytes . As barllophytes ,23. Hordth China . Our preh barley ,26. AlthH. brevisubulatum plants could maintain a relatively stable level of K+ content under saline conditions and the numbers of upregulated genes of potassium transporters greatly exceeded that in H. vulgare, which showed obvious K+ loss under saline conditions [H. brevisubulatum and H. vulgare plants under 350 mM NaCl treatment. We searched the potential HAK/KUP/KT transporters in PacBio isoform sequencing (Iso-seq) data. Finally, 13 genes with intact coding DNA sequences were obtained and named following the homologous genes in rice and barley. These proteins contained about 708\u2013945 amino acids and were predicted to contain 11\u201314 trans-membrane regions with a long tail in the C-terminal. All these proteins were localized in the plasma membrane, which were analyzed using TargetP tool (http://www.cbs.dtu.dk/services/TargetP/)  . Based ostructed . HAK/KUP+ uptake in H. brevisubulatum, we extracted the expression information of 13 identified HAK/KUP/KT proteins from transcriptomic data of root tissues. The homologous genes coding these 13 HAK/KUP/KT proteins in H. vulgare from transcriptomic data were also extracted. Comparing these genes in H. brevisubulatum and H. vulgare, 9 members with different expression patterns were identified , however, C170A or R342K single mutant transformed strains became unable to grow  via H+/K+ symports at low (<0.2 mM) external K+ content and a low-affinity system (LATS) via ion channels at high (>0.5 mM) external K+ content. High-salt soil frequently causes K+ deficiency, therefore, the HATS in roots dominates K+ uptake from soil under saline conditions to maintain a stable cytosol K+ concentration (100\u2013150 mM) [Arabidopsis [+ transport in K+/Na+ homeostasis under salt [+ acquisition at high external Na+ content is crucial for K+/Na+ homeostasis. The halophytic H. brevisubulatum could grow well under heavy saline-alkali land and be used as a saline-tolerant grass for soil improvement in North China [H. brevisubulatum plant may evolve some distinctive strategies for K+ acquisition improvement under saline conditions. The hypothesis was supported by the salt-treated root transcriptome data which showed abundant genes related to potassium ion transport were upregulated [+ uptake under saline conditions.K\u2013150 mM) ,29. Sinc\u2013150 mM)  and AtHAbidopsis , HATS isbidopsis . AtHAK5 bidopsis , while dder salt ,8,9,19. th China ,32, implegulated . Among tH. brevisubulatum and H. vulgare, the expression of HbHAK1 was induced by salt while transcripts of HvHAK1 was greatly downregulated , as the same experiments confirm HvHAK1, OsHAK5, CcHAK1 and CaHAK1 transformants recover the growth at 0.1-mM K+ added [+ content [+ transport activity and extended the minimum threshold of K+ uptake operated by HAK-type transporters.Through comparing the expression patterns of HAK/KUP/KT proteins between egulated . We furtolerance . HAK/KUPK+ added ,33,34 an content ,10. The H. brevisubulatum and barley, HbHAK1 and HvHAK1 have only 15 different amino acid residues. We used site-directed mutations in cDNA of HbHAK1 and identified the transport activity of mutants HbHAK1 in Cy162 system. C170A and R342K mutant transformants critically reduced the capacity of strains growth under 10 \u03bcM K+ conditions which showed even weaker growth compared with HvHAK1 at 0.1 mM K+ and 0.3+ mM K+ added, while A13T mutants dramatically decrease Na+ tolerance  were plated on MP (Medium lacking Potassium using for plant culture) medium with 0.5% sucrose and 0.8% agar for a week at 21\u201322 \u00b0C with a 16 h/8 h (day/night) photoperiod and 60\u201370% relative humidity.Seeds of d in lab  and ColuH. brevisubulatum and H. vulgare via an RNAprep Pure Plant Kit . Deep sequencing was performed by Beijing Ori-Gene Science and Technology Corp., Ltd. . The transcriptome library construction and sequencing data analysis was described in previous research [http://www.ncbi.nlm.nih.gov/sra/; the accession number is SRP161471.Total RNA was isolated from the root of research . The rawOryza sativa were obtained from the NCBI website. These sequences were used as a BLAST query in the transcriptomic data to identify putative homologs. 13 HAK/KUP/KT proteins with full length of CDS were obtained and their expression data were also extracted. A phylogenetic tree was constructed in MEGA5.0 software (http://www.megasoftware.net/) using protein sequences of these 13 genes and 27 protein sequences of HAK/KUP/KT family in Oryza sativa. The protein sequences of 13 HAK/KUP/KT transporters were list in Protein sequences of HAK/KUP/KT family genes in HbHAK1 was constructed into the vector pBASTA, with green fluorescent protein (GFP) expression driven by the CaMV 35S promoter present in the parent plasmid pBI121 [Arabidopsis athak5 plants using the floral dip method. Transgenic T2 seeds were used for the phenotype analysis. Seeds from the wild type, athak5 and two different transgenic lines overexpressing HbHAK1 on an athak5 background (HbHAK1-1 and HbHAK1-2) were planted in a seed germination pouch with liquid MP medium containing different concentrations of potassium chloride (KCl) [d pBI121  using gade (KCl) . The SeeHbHAK1 overexpression transgenic T1 generation seeds of athak5 were germinated and grown for 4 days at 21\u201322 \u00b0C under dark condition. The leaf epidermal cells of the etiolated seedlings were used for microscopic observation. FM4\u201364 was used to stain the cell plasma membrane. These 4-day seedlings were immersed in 20 \u03bcg/mL FM4\u201364 buffer for 1 min and then washed with water twice. Confocal images were captured using confocal macroscope equipment . The fluorescence signals were excited at 488 nm for GFP and 561 for the FM4\u201364 dye.The cDNA sequences of HbHAK1 and HbHAK2 were amplified with special primers and digested with the SpeI/XhoI or Ecor\u2160/XhoI restriction enzymes, respectively, and ligated into the yeast expression vector p424 [HbHAK1, p424-HbHAK2, p424-HvHAK1, p424-AtHAK5, and p424-OsHAK1 were transformed into yeast (Saccharomyces cerevisiae) strain CY162 trk1\u25b3trk2\u25b3 [ena1\u20134\u25b3 nha1\u25b3 [tor p424 . P424, pk1\u25b3trk2\u25b3  and B31 4\u25b3 nha1\u25b3 . The pri+ were performed in solid AP-T (Arginine Phosphate medium lacking Trp) medium, as described previously [+ ranging from 0.001 to 10 mM, and in the absence or presence of various concentrations of NaCl (50 to 750 mM). For the growth curve, the yeast strains  were grown in liquid SD-T  medium at 30 \u2103 overnight and then transferred to liquid AP-T medium supplemented with different concentration of K+ (0.05 or 2 mM) with the same initial OD600 of about 0.1. The shaker was adjusted to 200 rpm, and the OD600 of the strains was measured every 3 h for three consecutive days of growth. This experiment was repeated in triplicate.Yeast complementation assays at low Keviously  and supp+ depletion experiments, yeast cells were grown overnight at 30 \u00b0C in liquid SD-T medium and then then transferred to liquid AP-T medium for about 4 h for K starvation. The cells were then suspended in 10 mM 2-(N-morpholino) ethane sulfonic acid (MES) supplemented with 2% glucose and adjusted to pH 6 with Ca(OH)2. At time zero, 0.03 mM KCl were added to the medium and the samples were collected at intervals over a 2-h period. K+ contents were identified and quantified by atomic emission spectrophotometry using a PerkinElmer Model 2380 spectrophotometer  [For Kass, US) .For the changes, the different amino acids of HbHAK1 with HvHAK1, we mutated 15 amino acid residues of HbHAK1 according to the right sequence of HvHAK1 by using the Quick change method with site-directed mutagenesis kit . The protocol was followed as recommended. The primers used was listed in H. brevisubulatum were exhibited in H. vulgare can be found in the http://plants.ensembl.org/Hordeum_vulgare/Info/Index, as HvHAK1 (HORVU2Hr1G071570), HvHAK2 (HORVU2Hr1G020220), HvHAK7 (HORVU3Hr1G098670), HvHAK9(HORVU2Hr1G018190), HvHAK11 (HORVU2Hr1G098940), HvHAK15 (HORVU2Hr1G099810), HvHAK18 (HORVU5Hr1G090010), HvHAK23 (HORVU5Hr1G059200) and HvHAK25(HORVU6Hr1G073030).The selected 13 genes for the HAK/KUP/KT in"}
+{"text": "The COVID-19 pandemic has hit almost all countries around the globe, seriously affecting the welfare of populations. Spain is especially hard-hit. In this context, the purpose of the present study is to analyze social, demographic, and economic correlates of mental health during the COVID-19 pandemic in the population residing in Spain.The sample of this cross-sectional study was comprised of 801 participants aged 18 or older and residing in Spain. Data collection was carried out during March and April 2020. Data of mental health (GHQ12) and well-being (Positive and Negative Affect Schedule) indicators, and those of a wide number of social, demographic, and economic variables were recorded. Linear regression models were built to value associations between mental health and social, demographic, and economic indicators.Mental health morbidity was higher in women, younger people, individuals with medium studies, people with fewer children, singles, students, and unemployed individuals. Positive affect was higher among women, people with a high level of studies, those not co-living with dependent seniors, the self-employed, the employed, and those working outside home. Negative affect was negatively associated with age and number of children and was higher among women, people with basic studies, singles, individuals co-living with dependent seniors, homemakers, and students.The most vulnerable populations were found to be women, younger people, people with basic or medium studies, students and individuals with no remunerated activities, single populations, and those co-living with dependent seniors as well as those with a reduced number of children. The entire world is now struggling to overcome one of the most devastating pandemics of the XXI century, until now . COVID-1In order to inhibit the spread of the virus, most countries have established some form of a state of emergency including quarantine periods in which citizens are under strict lockdown and isolation . While tIn periods of uncertainty such as natural disasters, economic crises, and serious health threats, a great variety of studies have found significant changes in people\u2019s mental health and well-being . The exiSimilar studies carried out in United Kingdom have reported higher self-harm behaviors and thoughts of suicide among people experiencing socioeconomic disadvantage, unemployment, disability, chronic physical illnesses, mental disorders, and COVID-19 diagnosis . PreexisMost existing long-term studies on global pandemics were carried out in China and other Asian countries during the SARS pandemic or during the Ebola and influenza pandemics . AccordiThe impact of a pandemic on mental health does not seem to affect everyone at the same level. A study carried out in Australia during the 2007 influenza pandemic found that younger age , lower eLastly, post-quarantine effects may also be taken into account. Both the economy and individuals\u2014particularly the most vulnerable\u2014suffer from the impact of financial loss when people are unable to work. Considerable socioeconomic distress and symptoms of psychological disorders may materialize . Social Mental health is defined by the World Health Organization as \u201ca state of well-being in which the individual realizes his or her own abilities, can cope with the normal stresses of life, can work productively and fruitfully, and is able to make a contribution to his or her community\u201d . Mental Well-being is a key aspect of mental health . The hedFor all these reasons, the purpose of the present study is to analyze social, demographic, and economic correlates of mental health during the COVID-19 pandemic in the population residing in Spain. We aim to evince the factors capable of predicting improvement or exacerbation of psychological distress.This cross-sectional study was designed to assess the associations between social, demographic, and economic factors and mental health indicators during the COVID-19 pandemic in Spain. Snowball technique and convenience sampling were followed to recruit participants as follows: (1) Students enrolled in the nursing degree at the Autonomous University of Madrid were contacted by email and through academic platforms. All potential participants contacted were invited to share the study information with other people within their environment. (2) Professors and researchers directly involved in the present research informed their personal and professional contacts of the study by email and invited them to participate and disseminate the information. (3) Social networks  were used to recruit additional participants. The advert of the study was published on behalf of participation by the European University of Madrid which was accessible to the general public. Similarly, the proposal to participate in the study was published in the professional and personal profiles of each of the researchers involved in the present research. Participants as well as those who decided not to participate in the study were able to share the information of the study with their social and professional networks.After potential participants were informed of the objectives and relevant information of the study, they could indicate consent to participate in the study or not. Upon a positive response, the anonymous questionnaire was deployed. All participants who met the inclusion criteria were recruited. Inclusion criteria were to currently reside in Spain, be aged 18 or over, be able to read, understand, and complete the questionnaire in Spanish, be interested in participating in the study, and provide informed and written consent. Data was collected between March 19th and April 26th, 2020, the most critical periods of the COVID-19 pandemic registered in Spain.Post hoc statistical power calculations were also carried out, for an alpha error of 0.05 and according to the effect size range obtained in the models (considering the two predictors used), showing a statistical power higher than 0.95 in all cases.A total of 37 participants were excluded from the study because they did not meet the inclusion criteria of age (they were under 18 years old). Further, participants in the study were asked if they were active health professionals. Those who met this condition (117 participants) were not included in the present analysis, since their status as health workers has important implications for both risk of infection and mental health and well-being status. As a result, 801 participants provided valid data of mental health indicators and were considered for the analysis. The sample size was calculated using the G-Power tool, for a linear multiple regression, considering an Alpha error of 0.05 and a 0.95 statistical power. Three mental health and well-being indicators were considered in the present study: psychological health status and positive and negative affect.Have you been able to concentrate on whatever you are doing?\u201dThe Goldberg General Health Questionnaire (GHQ-12) was used to assess mental health, employing its short version. This questionnaire is a widely used instrument designed to discriminate whether or not psychological morbidity is present. The validation study of the Spanish version revealed an adequate internal consistency, which ranges between 0.82 and 0.90, a sensitivity between 76 and 100, and a Cronbach\u2019s alpha of 0.76 . The scoIndicate the extent to which you have felt distressed over the past week.\u201dThe Positive and Negative Affect Schedule (PANAS) was employed to measure well-being. This questionnaire is formed by two independent scales, each consisting of 10 items. The positive affect scale measures feelings such as joy or pleasure, and the negative affect scale includes feelings such as anxiety and sadness. Higher scores indicate higher levels of positive and negative affect. The instrument consists of a Likert scale that ranges from very slightly or not at all, to extremely . This qu2) were reported as a number by the participants.Age, number of children, and dwelling size .Country of origin was indicated after the question: what is your country of origin? (Spain/other).Level of education was identified by participants as basic level of studies (primary and secondary school), medium level of studies , and high level of studies (completed university studies).Marital status was identified by each participant from the possible answers: married, single, unmarried partner, separated/divorced, and widowed.Current employment status, during the COVID-19 pandemic was defined as self-employment, employment, unemployment, homemaker, retired, or student.Living with dependent seniors, current reduced income due to the COVID-19 pandemic, and working outside home  were indicated as yes or no.Length of confinement was calculated from the date of completion of the questionnaire, considering March 14th as the first day of confinement .Self-referred current medical diagnosis of COVID-19 (yes/no) was included as covariate for the analysis, given its potential influence on mental health indicators.The protocol for the present study obtained approval from the Ethics Committee of the Faculty of Biomedical and Health Science of the European University of Madrid (No CIPI/20/135). All participants were informed of the purpose and intent of the study and provided written consent. Similarly, anonymity of each of the participants was ensured.All statistical analysis was conducted using the Statistical Package for the Social Sciences software version 21.0  and STATA/SE 14.1 software (Stata Corp LP).p < 0.001).Descriptive statistics  were calculated to describe participant characteristics. Differences between categorical variables and mental health indicators were addressed using Student\u2019s t test for dichotomous variables and ANOVA test for variables with more than 2 categories. The Spearman correlation test was employed to value associations between quantitative variables and mental health indicators after assessing the distribution of each variable using the Kolmogorov\u2013Smirnov test  values of the mental health indicators are presented in p < 0.001, r = \u22120.23), women , people with a medium level of studies , those with a lower number of children , single people , and students . The positive affect score was higher in women , people with a high level of studies , those not living with dependent seniors , self-employees , those with a shorter length of confinement , and those working outside home . Finally, the negative affect score was higher in younger people , women , people with a basic level of studies , those with a lower number of children , single and widowed people , people living with dependent seniors , and homemakers .Characteristics of the participants are also presented in p < 0.001) and in number of children , p < 0.001) was associated with decreased mental health scores. Similarly, a high level of studies , p = 0.001), being married , p < 0.001), being self-employed , p = 0.025), and being retired , p = 0.004) were linked to lower mental health scores. On the other hand, referring gender as female , p < 0.001), reporting a medium level of studies , p < 0.001), being single , p < 0.001), being unemployed , p = 0.029), and being a student , p < 0.001) were associated with a higher mental health score.Linear regression models for the mental health score are presented in p < 0.001), living with dependent seniors , p = 0.006), being unemployed , p = 0.007), being retired , p = 0.005), and being a student , p < 0.001) were linked to decreased positive affect scores. On the other hand, referring gender as female , p < 0.001), a high level of studies , p < 0.001), being self-employed , p = 0.008), being employed , p < 0.001), and working outside home , p = 0.012) were linked to a higher positive affect score.Linear regression models for positive affect scores are presented in p < 0.001) and in number of children , p = 0.004) was associated with lower negative affect scores. Also, a high level of studies , p = 0.004), being married , p = 0.028), being separated or divorced , p = 0.004), being and retired , p = 0.002) are linked to lower negative affect scores. However, reporting gender as female , p < 0.001), basic studies , p = 0.027), being single , p = 0.001), living with dependent seniors , p = 0.006), being a homemaker , p = 0.049), and being a student , p = 0.033) were related to higher negative affect scores.Finally, linear regression models for negative affect scores are presented in According to our results, the most vulnerable populations in terms of mental health morbidity were women, younger people, individuals with a medium level of studies, those with fewer children, single individuals, students, and the unemployed. In contrast, positive affect was higher among women, those with a high level of studies, those not co-living with dependent seniors, the self-employed, the employed, and those working outside home due to the COVID-19 pandemic. Lastly, negative affect was negatively associated with age and number of children and was higher among females, people with a basic level of studies, single individuals and those with unmarried partners, individuals co-living with dependent seniors, homemakers, and students.As expected, and in line with prior studies, more vulnerable individuals in terms of socioeconomic status were more likely to report symptoms of psychological distress . EducatiUnexpectedly, no significant associations were found between length of confinement, mental health morbidity, and negative/positive affect. Prior studies have found contradictory results. While some pointed out negative effects of quarantine duration on psychological health , not allStressors during quarantine should also be considered. Number of children, co-living with a dependent senior, and being alone were found to be related to mental health or well-being. It was also unexpected to find that an increased number of children at home was associated with better mental health status and lower levels of negative affect. Prior studies have identified similar tendencies, suggesting the protective effects of having two or more children at home . HoweverDependent seniors co-living at home were found to be a stressor during quarantine, with lower levels of positive affect and higher levels of negative affect among caregivers, a finding validated by the existing literature on caregiving and its damaging effects on mental health and well-being . This asLastly, although previous literature suggests that having more space at home might be related to increased well-being , particuFinally, sociodemographic factors should also be considered. Age, gender, and marital status have been found to be related to mental health and well-being. In congruence with prior studies carried out in Spain during the COVID-19, women showed higher mental morbidity  and highThis study is not without its limitations, as follows: (1) Perhaps the most relevant limitation we must point out is that the use of social networks to recruit participants for this study may associate a sample selection bias. However, the need to assume this limitation was due to the confinement of the entire Spanish population for the full duration of data collection. There were scarce possibilities of reaching potential participants by other means. In spite of the limitations associated with the use of social networks for data collection, the decision to proceed was supported by some scientific works that have pointed out that social media data maintain the capacity for addressing broad social questions while upholding methodological integrity . Other sHowever, this study provides information about social, demographic, and economic factors able to influence the mental health of a population unable to exert their basic freedoms in the unique instance of a health emergency.In conclusion, the most vulnerable populations in terms of mental health morbidity and well-being were women, younger people, people with basic or medium level of studies, students and individuals with no remunerated activities, singles, and those with unmarried partners. Stressors during confinement were co-living with dependent seniors and having few children. These results highlight the need to consider psychosocial predictors of mental health and well-being in order to design and implement future intervention programs to monitor mental health and well-being outcomes among the most vulnerable individuals in the highly probable context of future pandemics.The raw data supporting the conclusions of this article will be made available by the authors, under limited conditions.The protocol for the present study obtained approval from the Ethics Committee of the Faculty of Biomedical and Health Science of the European University of Madrid. The patients/participants provided their written informed consent to participate in this study.SE-G was the coordinator, main investigator of the study, and oriented and revised the article. LE-G was the coordinator and main investigator of the study, and analyzed the data. JG-P was an investigator of the study and revised the article. MC-G was an investigator of the study and revised the article. All authors have read and agreed to the published version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "MTNR1B gene and year\u2010round oestrus or the litter size in Small Tail Han sheep. To better understand the effects of single nucleotide polymorphism (SNP) rs400827589 in MTNR1B, a population polymorphism analysis was conducted using genotyping data in 45 sheep breeds around the world. The results indicated that TT was the dominant genotype in all sheep breeds. The associations of this SNP with reproductive seasonality and litter size in Small Tail Han sheep showed rs400827589 was correlated with fecundity as assessed by reproductive seasonality and litter size (p\u00a0<\u00a0.05). Bioinformatics analysis indicated the change in amino acid from Ile to Leu may affect the function of the MTNR1B protein by impacting the secondary and tertiary protein structures. The present results demonstrate that rs400827589 could be used in the marker\u2010assisted selection of the litter size in Small Tail Han sheep.In mammals, the melatonin receptor gene has been widely studied since it has a great influence on reproductive traits. However, little is known about the association between polymorphism of the coding region of the  p\u00a0<\u00a0.05). Bioinformatics analysis indicated the change of amino acid from Ile to Leu may affect the function of the MTNR1B protein by impacting the secondary and tertiary protein structuresrs400827589 was correlated with fecundity as assessed by reproductive seasonality and litter size ( In addition, there was ethics approval by the animal ethics committee of IAS\u2010CAAS (No. IAS2018\u20103).Jugular vein blood samples were collected from 737 ewes in six sheep breeds for DNA isolation using the phenol\u2010chloroform method. The information of sheep breeds included in the study was shown in Table\u00a02.2MTNR1B sequences available in the Ensembl (Accession No. ENSOARG00000002933), the primer sequences for genotyping were 5\u2032\u2010TGG ATG AAC AAC CCC TCT GGG ATC CG\u20103\u2032 (Forward), 5\u2032\u2010ACG TTG GAT GTT GTG ATC TTC GCC ATC TGC\u20103\u2032 (Reverse) and 5\u2032\u2010TTG TGA GCC ACT TCT TCG GGG TCA/A3\u2032 (Extension reaction), which amplify a region of 120bp. The MassARRAY\u00aeSNP analysis (http://www.sequenom.com) was subsequently applied for genotyping all 737 sheep. The polymerase chain reactions system and temperature were described in detail in a previous study  (SAS Institute Inc.). p values less than .05 were considered to be significant. The model was described in the previous study ; Gj is the fixed effect of the jth genotype ; IPG is the interaction effect of parity and genotype and ijne is the random residual.The calculations of allele frequencies and genotype frequencies and the Hardy\u2010Weinberg equilibrium tests were performed by using Popgene (version 1.31) , and amino acid sequences were subsequently obtained from NCBI (https://www.ncbi.nlm.nih.gov/protein/195972821). The transmembrane domains before and after mutation in MTNR1B were predicted using TMHMM (http://www.cbs.dtu.dk/services/TMHMM\u20102.0/). Prediction of the secondary structure of MTNR1B and its mutants occurred using Predict Protein (https://www.predictprotein.org/). The MTNR1B protein three\u2010dimensional (3D) structure in sheep was predicted by Iterative Threading ASSEmbly Refinement (I\u2010TASSER) (http://zhanglab.ccmb.med.umich.edu/I\u2010TASSER/), the protein\u2010ligand binding site prediction was performed by a meta\u2010server approach (COACH) (http://zhanglab.ccmb.med.umich.edu/COACH/).The coding sequences of the 33.1MTNR1B exon 2 was selected for genotyping, the different alleles resulted in amino acid changes. The genotype results in 737 samples with a >95% success rate and samples with successful genotyping were included in the population polymorphism analysis (Table\u00a0p\u00a0>\u00a0.05).In this study, rs400827589 in http://asia.ensembl.org/Ovis_aries/Variation/Population?db=core;g=ENSOARG00000002933;r=21:1373657\u20101392132;t=ENSOART00000003171;v=rs400827589;vdb=variation;vf=33224018). The three genotypes were found in different sheep breeds from various countries in the world. The distribution of genotypes was similar to native breeds in China, the dominant genotype was TT and a few sheep breeds had the GG genotype.A population polymorphism analysis was also conducted in another 39 sheep breeds, the results are listed in Table\u00a0p\u00a0<\u00a0.01).We classified six breeds into two categories, year\u2010round oestrus and seasonal oestrus, based on the oestrous characters. The results of the population polymorphism analysis shown in Table\u00a03.2p\u00a0<\u00a0.05).The association analysis between rs400827589 with litter size in Small Tail Han sheep was performed using data from our previous study  sequence. The results indicated that there were seven transmembrane domains, a mutation from T to G led to no change in the transmembrane domains Figure\u00a0. In addi4Melatonin is a highly lipophilic circulating hormone. In addition to regulating insulin secretion and glucose levels, it controls circadian rhythms and reproductive processes . Compared with the distribution of this locus in sheep breeds around the world  in SNP rs400827589 (Table\u00a0MTNR1B in rs400827589 also affected ovine reproductive seasonality and litter size differently, with litter size of the mutant homozygote individuals decreased significantly. This phenomenon indicated that the rs400827589 may be an adverse mutation for litter size in sheep. Further study is required to confirm the mechanism of the effect of rs400827589 on the litter size in sheep.As a key link in the melatonin signalling pathway, polymorphisms of 89 Table\u00a0. The res89 Table\u00a0, 2008, p5MTNR1B rs400827589 was the dominant genotype in sheep around the world. Polymorphism of MTNR1B in rs400827589 can affect reproductive seasonality and was associated with litter size in some Chinese native sheep. In addition, bioinformatics analysis indicated the change of amino acid from Ile to Leu may affect the function of the MTNR1B protein by impacting the secondary and tertiary protein structures. Findings in the present study also indicate that MTNR1B might use to select for litter size in sheep.The TT genotype in We certify that there is no conflict of interest with any organization regarding the material discussed in the manuscript.Xiaoyun He: Visualization; Writing\u2010original draft. Zhuangbiao Zhang: Software. Ming\u2010Xing Chu: Formal analysis; Funding acquisition; Project administration."}
+{"text": "Pediatric-adolescent or developmental gynecology has been separated from general gynecology because of the unique issues that affect the development and anatomy of growing girls and young women. It deals with patients from the neonatal period until maturity. There are not many gynecological problems that can be diagnosed in newborns; however, some are typical of the neonatal period. This paper aims to discuss the most frequent gynecological issues in the neonatal period. Gynecology (from the Greek word \u2018gyne\u2019 = woman) is the area of medicine that specializes in the diagnosis and treatment of diseases affecting female reproductive organs (\u201cwoman\u2019s diseases\u201d). In a broader sense, this medical specialty covers the entire woman\u2019s health, including preventive actions, and represents the specificity of anatomical and physiological distinctness of sex. Pediatric-adolescent gynecology or developmental gynecology is separated from general gynecology because of the unique issues that affect the development and anatomy of growing girls and young women. It deals with patients from the neonatal period until maturity. Girls with gynecological disorders constitute 10% of all gynecological patients. That is why they should be included in specialistic gynecological care, particularly in its preventive aspect.There are not many gynecological problems leading to abnormalities in later development that can be diagnosed in newborns. There are, however, some disorders that are typical of the neonatal period. As far as health promotion and prevention are concerned, it is essential to take care of a baby girl\u2019s health in relation to her future maternity since birth. In the neonatal period, it is crucial to instruct mothers of the proper hygienic procedures for girls\u2019 genitals and of how to prevent diaper dermatitis. Adequate feeding is also important with regard to development.The neonatologist or the pediatrician is usually the first specialist who detects genital abnormalities in a little girl. In most cases, the related changes are physiological. However, if these abnormalities are disturbing or unusual, the baby should be referred to a pediatric gynecologist for a proper gynecological examination and to a pediatric endocrinologist or pediatric surgeon for further examination and treatment.Knowledge of normal prepubertal anatomy and the use of an accurate terminology are essential for describing and documenting anatomic findings. The gynecologist assesses the appearance of the vulva, the size and color of labia minora and majora, the introitus of the vagina, the color of the mucous membrane, and the size of the clitoris. It is also essential to evaluate the hymen and the presence of a discharge from the vagina . This examination is mostly performed visually, without the use of instruments. Normally, the labia majora are full, and the labia minora are thickened. The hymenal folds appear thick and redundant. The vaginal mucosa is pink and moist, with an acidic pH. As the maternal hormone levels decrease, the labia majora lose their fullness, and the labia minora and hymen become thinner and flatter. Visualization of the mid and upper vagina may be accomplished while the baby is in the knee-chest position but often requires a sedated examination and instruments. When performing an anesthesia examination, a lighted Killian nasal speculum and a fiberoptic scope  are useful for examining the prepubertal vagina. A liquid distention medium can be used for vaginoscopy to visualize the whole vagina and cervix. Vaginal cultures should be obtained before the vaginoscopy. The cervix, uterus, and adnexa in the child can be evaluated through an examination, using a finger placed rectally and the other hand abdominally, with the patient lying supine. An ultrasonographic exam allows for assessing the uterine proportions and the appearance of the ovaries. For newborns and small girls, the cooperation between the gynecologist and the mother is obligatory. Educating the mother before this examination is essential both for her reassurance and for gaining her trust.In utero, the vaginal epithelium of the neonate is stimulated by maternal hormones that cross the placenta into the fetal circulation. After delivery, these hormone levels fall rapidly, and a thick, grayish-white, mucoid discharge from the neonate\u2019s vagina can be observed. The secretion usually resolves in 10 days.In some baby girls, the discharge from the vagina is blood-tinged or even grossly bloody. This is usually treated as physiological menstrual-like neonatal bleeding, and it is assumed that no treatment is needed. However, in some studies, it has been shown that such bleeding might be a marker of intrauterine distress in late pregnancy. It is more often observed in infants with intrauterine growth restriction or in those whose mothers suffered from preeclampsia. Moreover, neonatal menstrual-like bleeding may represent a sign of increased risk of developing endometriosis during adolescence and plays a role in the transgenerational evolution of major reproductive disorders ,2,3. PreA foreign body is a common cause of prepubertal vaginal bleeding. Most commonly, the object is toilet paper, a small plastic toy, a cap, or other small objects. Bleeding in such a situation might be accompanied by pelvic pain and a foul-smelling discharge. The unidentified foreign body may lead to urinary tract infection or dermatosis and, in serious cases, to perforation into the peritoneal cavity or fistula formation .A trauma leading to vaginal bleeding in infants can be either accidental or nonaccidental. The most common injury is the straddle injury following a fall on the edge of some object . It rareStreptococcus, S. pyogenes), enteric pathogens , or Candida spp. in infants wearing diapers [Vulvovaginitis  is anoth diapers ,5.Other skin conditions predisposing to vaginal bleeding are atopic dermatitis (eczema and psoriasis) and lichen sclerosis . Trauma Vaginal bleeding may also be a sign of a gynecologic tumor, such as ovarian, vaginal, or vulvar tumor. The most common malignant tumor in young girls is rhabdomyosarcoma, specifically, sarcoma botryoides. The peak age for the development of this tumor is two years, and over 90% of them are detected before five years of age. Patients may present with an intralabial mass that is grape-like in appearance and vesicular . EndoderIn newborns, the hymen is redundant, estrogenized, thick, and elastic, often with a prominent ridge at six o\u2019clock. As the estrogen subsides, the hymen becomes unestrogenized, thin, and significantly more vascular. Assessment of the hymen includes the observation of its shape, variations in the hymenal rim, the degree of estrogen effect, and any signs of trauma or scar tissue. The examination might reveal anatomic variants that sometimes are mistaken for signs of sexual abuse, such as midline sparing (linea vestibularis), failure of midline fusion, urethral prolapse, or labial adhesion. Midline sparing refers to a symmetric, flat avascular area of the posterior vestibule observed in 10% of healthy newborns. It can sometimes be confused with scarring. Congenital abnormalities of the hymen include imperforate, microperforated, cribriform, septated, and annular hymens. They occur in 3\u20134% of the female population. Redundant or fimbriated hymens that appear to be sleeve-like or ruffled are common in newborns because of maternal estrogen effects. The crescentic shape becomes the most common shape around the age of 4 years in the prepubertal female . TypicalIn the presence of congenital malformations such as vaginal atresia or an imperforate hymen, the physiological discharge of the vaginal epithelium stays inside or releases in drops only when the baby cries. The incidence of imperforate hymen is estimated at 0.014\u20130.1%, and its presentation is often late, with amenorrhea in adolescence ,7. HowevPrenatal diagnosis of imperforate hymen with hydrometrocolpos has been reported as early as 25 weeks of gestation, although most cases are described during late pregnancy or after birth ,8,9,10. Labial adhesions are identified when the labia minora are partly or entirely agglutinated. The incidence is reported to be around 1.8%, and the diagnosis is done most frequently between 13 and 23 months of age when the estrogen level is physiologically low . The symInterlabial cysts are another abnormality that may cause anxiety to the parents and pediatricians. They occur in 1:1000 to 1:7000 newborn girls. Most commonly, they are simple hymenal cysts  and paraurethral gland cysts  and present as single small, bulging, golden-colored, or whitish interlabial protrusion adjacent to the urethral meatus and slightly distorting it. The cysts usually resolve spontaneously over 2\u20133 months, and their presence is related to exposure to maternal estrogens. The differential diagnosis of interlabial masses includes anomalies of the ureter or urethra, ectopic tissue, prolapse , or neoplasia (botryoid rhabdomyosarcoma) .An essential part of the physical examination of newborns is an assessment of mammary glands. Breast development occurs during fetal life and is well described as proceeding in female infants for several months after birth. It ceases at 3\u20136 months of age, and the breast bud may regress after that .Neonatal breast enlargement is defined as the benign proliferation of glandular tissue due to estrogens crossing the placenta into the fetal circulation. It occurs in approximately 70% of newborns, both girls and boys, and can be unilateral or bilateral. Usually, the diameter of a breast bud is 1 to 2 cm in the first few weeks of life. Mammary glands in newborns are often hard, hyperemic, and tender. In some newborns, the breasts are excessively big, and the reason for such an exaggerated response to maternal hormones is unclear ,15.Postnatally, falling levels of maternal estrogens are thought to trigger prolactin secretion in the pituitary of the newborn. Prolactinemia stimulates neonatal breasts and causes milk secretion in 5 to 20% of newborns ,15,16. MStaphylococcus aureus (83\u201388%). Typical presentation includes unilateral swelling, erythema, warmth, tenderness, and induration in the absence of systemic signs of infection. If left untreated, it can lead to breast abscess and, rarely, to generalized sepsis [When the mammary glands are enlarged and produce milk, the infant may be more susceptible to breast inflammation and infection. Inadequate secretion of milk due to improper canalization of the lactiferous ducts may lead to stagnation of milk . In such a situation, the infection may result in complications such as mastitis and breast abscess. Neonatal mastitis usually occurs under five weeks of age, with a peak incidence at three weeks of age, and is mostly unilateral. The most common causative agent is d sepsis ,15,21.Supernumerary nipples are a common finding. They might extend along the nipple line on either side of the chest wall, down the abdomen, and may occur in the labia. Bilateral ectopic breast tissue has been described in the vulva .Atypical-appearing genitals pose significant neonatological, gynecological, genetic, surgical, and psychological problems. The examination of the external genitals should include precise measurements of anatomic features, in reference to the normative values ,24,25. TDrs. Charmian Quigley and Frank French proposed a scale to grade the appearance of external genitalia in babies with androgen insensitivity syndrome (AIS), as shown in The diagnosis and treatment of a child with disorders of sex development (DSD) require a multispecialty team experienced in the long-term management of such patients and generally available only in tertiary-care centers. An integrated approach is essential to convey consistent information and an appropriate plan to the parents. They should be given a complete biological background concerning sex determination and the potential causes of DSD in their child, presented in a manner that ensures their understanding of the issues. Parents should be kept fully informed regarding planned diagnostic tests and the interpretation of results. Psychological counseling should be offered to the parents on how to optimally share critical information with more distant members of their family. If surgical intervention is recommended, indications, timing, and access to appropriate services should be discussed with the parents.While our understanding of the genetics of sex determination has advanced rapidly (more than 30 genes are known to contribute to the etiopathogenesis of DSD), the specific molecular disorder may not be defined in many affected children. Existing algorithms are of limited value, due to the broad spectrum of phenotypes and genetic polymorphisms as well as the often long time needed to complete genotyping in highly specialized, but rare, laboratories with appropriate expertise ,26,28. PPhysical examination includes inspection of the neonate for potential dysmorphic features, including head or facial dysmorphisms, orthopedic or heart defects, as DSD may be part of congenital syndromes. The presence of a micropenis due to hypogonadotropic hypogonadism may suggest a coexistent pituitary dysfunction with secondary hypocortisolemia and hypothyroidism. The examination of the external genitalia includes the precise measurement of anatomical structures, in relation to normative values. Besides, the analysis includes the detecton of the presence of gonads, hyperpigmentation of the external genitalia, breast areola and ear lobes, crease of the labioscrotal folds, length, width, and symmetry of the corpora, ventral flexion of the penis, presence and degree of hypospadias, degree of labioscrotal fusion. A well-formed penis and significant labioscrotal rugae may suggest prenatal exposure to elevated testosterone and dihydrotestosterone (DHT) levels. Asymmetric virilization indicates that only one gonad secretes testosterone. A contralateral dysgenetic testis or ovary is present (in the case of ovotesticular DSD) ,32,33.Ovarian cysts usually arise from mature follicles and are the most common abdominal cysts in female fetuses and newborn girls ,35. TheyTorsion is the most common complication of ovarian cysts (50\u201378%). It appears antenatal in most cases and is more common in large cysts. This complication may cause inflammatory adhesions, intracystic bleeding, and rupture. In large cysts, pulmonary hypoplasia or polyhydramnios have been described due to the pressure of the mass on the small intestine, interfering with the fetal swallowing mechanism .The management of congenital ovarian cysts is controversial. It depends on cyst size and complications that might occur during gestation or after birth. Early surgical intervention used to be recommended to prevent torsion and cyst hemorrhage or rupture that may lead to intestinal obstruction. The current trend favors watchful waiting and close follow-up with serial ultrasounds until cyst involution, especially for cysts smaller than 4 cm, which are less likely to be associated with torsion ,39. ThesSymptomatic cysts and those that do not regress after several months should be resected. Complex masses that can lead to such problems as cyst recurrence and small bowel obstruction also require surgical management . ConcernIn preterm babies, multiple ovarian cysts may result from excessive ovarian stimulation syndrome . Other sGynecological problems in neonatal life are unusual and rare. Many conditions that are thought to be pathological are, in fact, anatomical variants or physiological situations. In some cases, however, it is necessary to monitor the newborns with gynecological problems over a longer time to promote fertility and supervise the prepubertal phase. Therefore, knowledge of these abnormalities is essential so that explanations and prognosis can be reassuringly offered to parents."}
+{"text": "Toxoplasma gondii infections. This review was performed to obtain a better understanding of the in vivo and in vitro effects of chitosan on T. gondii strains.The preferred treatment for management of toxoplasmosis is the combined use of pyrimethamine and sulfadiazine. However, there are a wide number of adverse side effects with these medications. Recent research has focused on the use of chitosan for the treatment of Toxoplasma gondii\u201d, \u201cChitosan\u201d, \u201cnanoparticles\u201d and \u201canti-toxoplasmosis\u201d with AND or OR.The current study was carried out according to the PRISMA guideline and registered in the CAMARADES-NC3Rs Preclinical Systematic Review and Meta-analysis Facility (SyRF) database. The search was performed in five scientific databases, including Scopus, PubMed, Web of Science, EMBASE, and Google Scholar, with date limits of 1992 to December 2019. The search was restricted to articles published in the English language. The words and terms searched were \u201cT. gondii, with Me49 and PRU each included in one study. Five studies (56%) were performed in vivo, one study in vitro and 3 studies included in vivo and in vitro tests.Of 2500 manuscripts, 9 met the eligibility criteria for review. All studies used the RH strain of T. gondii, chitosan nanoparticles show potential as an alternative treatment for T. gondii infections.Considering the low toxicity and the high inhibitory potency of chitosan against  The sea2.2After removing duplicate publications, three authors independently reviewed the titles and abstracts of the studies, and the approved studies were selected for further analysis. With scientific documentation and at this stage, studies with inadequate information, with lack of evidence, noncompliance with the methods and misinterpretation of the results were excluded from the present study. A flowchart depicts the study design process . Moreove3in vitro, 5 in vivo, 3 in vitro and in vivo) from 2003 to 2019, met the inclusion criteria for discussion in this systematic review with the data extracted are presented in in vitro studies were performed with the RH strain while two of the in vivo studies included type-2 strains (Me49 and PRU).Nine papers  resulted in morphological changes of the tachyzoites. Also, altered induction of cellular apoptosis in the tachyzoite surface and their structure degradation  encapsulated with chitosan nanospheres or with complete Freund's adjuvant accomplished. And the end challenge of mice with RH and Me49 strains increased the survival time of these groups for 80 and 57\u00a0days, respectively. The life span of these vaccinated groups was significantly increased compared to the control group. Also, the level of INF-\u03b3 was significantly increased in the CTLV-encapsulated groups with chitosan and adjuvant Freund compared to the control group and in the vaccinated group. With CTLV encapsulated chitosan nanospheres (CTLVECNS) and then challenged with Me49 strain, the number of smaller cysts formed by traverse inflammatory cells in the brain of this group was not seen . This study indicated that BALB/c mice injected intramuscularly (G10E-CS) with RH and PRU strains for two weeks and after these injections, were treated with survival time in the RH challenge group for 21\u00a0days. That this significantly higher than the other groups.in vitro and elevated INF-\u03b3 cytokines. It also decreased IL-4 and IL-10 cytokines. The results of this study could be lead to the effectiveness of chitosan microspheres as an effective system for delivering antigenic peptides to dendritic cells in research and development of new vaccines preventing T. gondii infections , and an increase in IgM against parasitoid tachyzoites. Results implied improvement and enhancement of the immune system in mice treated with spiramycin-loaded chitosan nanoparticles .T. gondii.Chitosan nanoparticles have been studied as a natural polymer for the stabilization of metallic nanoparticles. Chitosan-coated zinc oxide by binding to IgG antibodies can evaluate the low level of this antibody using a microfluidic LIF immunosensor device. This method develops chitosan-coated zinc oxide nanoparticles as an efficient and effective analytical tool in the detection and monitoring of toxoplasmosis clinical . There a5T. gondii, chitosan nanoparticles show potential as an alternative treatment for T. gondii infections. Chitosan nanoparticles in combination with other therapies also could provide a higher level of efficacy. However, extensive in vivo and clinical trials on human subjects are needed to approve the impact of chitosan nanoparticles for treatment of toxoplasmosis.Considering the low toxicity and the high inhibitory potency of chitosan against None.The authors declare no conflict of interest."}
+{"text": "Lung cancer has a poor prognosis and a high mortality rate, and patients may develop multidrug resistance. Sparganii Rhizoma-Curcumae Rhizoma (HCSC), the classic herbal drug combination of traditional Chinese medicine (TCM), is commonly used in treating tumors, but its molecular mechanism is still unclear. in vitro the molecular mechanism of action of HCSC in treating lung cancer, as predicted by network pharmacology. Finally, we used the Symmap database to predict the relationship between the herb and TCM syndrome.  We explored the possible mechanisms underlying the antitumor effect of HCSC using network pharmacology. The bioactive components of HCSC and their targets were collected from the TCM Systems Pharmacology (TCMSP) database and PharmMapper. Gene Ontology (GO) and KEGG enrichment analyses were performed; the GeneMANIA platform was used for the functional enrichment analysis of the core targets and their neighboring genes. Molecular docking was performed between the bioactive components and core targets. HCSC freeze-dried powder was prepared, and the bioactive components were verified by liquid chromatography- (LC-) mass spectrometry (MS). Human lung adenocarcinoma H1975 cells were cultured to verify in vitro experiments on NCI-H1975 cells confirmed that HCSC can upregulate the mitochondrial-mediated caspase-dependent apoptosis signaling pathway by inducing the cleavage of caspase-3, caspase-9, and PARP, consistent with the network pharmacology prediction. Further, the qi deficiency and blood stasis associated with TCM syndrome can be treated with HCSC. A total of seven bioactive components were identified by network pharmacological analysis. Through enrichment analyses, it was found that the mechanism of action mainly involved mitochondrial-mediated caspase-dependent cell apoptosis signaling pathways. The results of molecular docking showed that the bioactive components in HCSC have a good affinity with the target proteins . LC-MS confirmed that formononetin and bisdemethoxycurcumin were present in the HCSC freeze-dried powder, consistent with the prediction. The results of  Lung cancer is one of the most common malignancies worldwide; it is associated with high mortality rates, and its incidence has been increasing gradually in recent years . HistopaThere has been no clear name for \u201clung cancer\u201d in the history of TCM. Currently, it is mostly classified into the categories \u201cfeiji,\u201d \u201cxiben,\u201d \u201clung distension,\u201d or \u201chemoptysis.\u201d Shen Jinao, a medical expert of the Qing Dynasty, wrote a book called \u201cIncisive Light on the Source of Miscellaneous Disease,\u201d which pointed out that \u201cevil qi accumulates in the chest, blocks the airway, inhibits the functioning of qi, which causes phlegm-rheum, food accumulation, blood stasis, and the vacuity of right qi. Then it clumped.\u201d Based on the basic theory of TCM and clinical experience, it has been believed that spleen qi is damaged after treatment. Radiotherapy, chemotherapy, and molecular-targeted drugs are heat toxins as per TCM and are more likely to wear qi and damage yin. Therefore, the deficiency of qi and yin was always reported throughout the entire process of lung cancer. This habitus makes patients more prone to qi stagnation and blood stasis.Sparganium stoloniferum. Curcumae Rhizoma, also known as turmeric, is a dried rhizome of common turmeric. According to TCM, the herbal couple Sparganii Rhizoma-Curcumae Rhizoma (HCSC) activates blood circulation to dissipate blood stasis. It is mentioned in \u201cRecords of Chinese Medicine with Reference to Western Medicine\u201d that Zhang Xichun often used HCSC in clinical practice and called it \u201cthe most important medicine for blood quickening.\u201d It was used to treat patients with lung cancer whose right qi could still fight against evil qi to prevent metastasis and recurrence after treatment. HCSC has been clinically proven to relieve the symptoms of patients with tumors, especially gynecological ones [Sparganii Rhizoma is the dried rhizome of cal ones . Modern cal ones \u20138. The acal ones . Curcumical ones \u201311.in vitro experiments. The detailed flowchart of the current study was shown in Network pharmacology is a discipline that combines systems biology and multidirectional pharmacology based on high-throughput omics data analysis, virtual computer calculation, and network database retrieval . Networkhttp://lsp.nwu.edu.cn/tcmsp.php) for Chinese herbal medicines; this platform captures the relationships between drugs, targets, and diseases [http://lilab.ecust.edu.cn/pharmmapper/) was used to simulate the molecular docking of the bioactive components [Homo sapiens,\u201d was collected from the UniProt database (https://www.uniprot.org/) [The bioactive components of HCSC were retrieved from the TCM Systems Pharmacology (TCMSP) platform (diseases . The scrmponents . The ranot.org/) .http://ctdbase.org/) [https://auth.lifemapsc.com/) [https://www.disgenet.org/) [The Comparative Toxicogenomics Database (se.org/) , GeneCarsc.com/) , and Diset.org/)  were seahttps://string-db.org/) [A protein-protein interaction (PPI) network of candidate targets was constructed using the STRING database (db.org/) ; the \u201cmidb.org/)  to consthttp://www.genemania.org/) [P < 0.05). The ClueGO and CluePedia plugins in Cytoscape were used to perform the KEGG enrichment analysis of the core targets (P < 0.05); then, the pathway nodes in the enrichment network were manually selected. Candidate targets were converted to UniProtID using the UniProt software. The \u201csearch&Color Pathway\u201d tool of the KEGG database (https://www.kegg.jp/kegg/pathway.html) [GeneMANIA (ia.org/)  was usedia.org/)  were useay.html)  was usedhttp://www.rcsb.org/) [G\u2009\u2264\u2009\u22125.0\u2009kJ\u2009mol\u22121 was selected as the screening basis. The dominant conformation was analysed and plotted using Schrodinger.The HCSC bioactive components (ligands) were processed using ChemBio 3D software and stored in the mol2 format. Then, AutoDock Tools  were usesb.org/) . The oriHCSC consisted of 45\u2009g of Sparganii Rhizoma and Curcumae Rhizoma each. All crude herbs were provided by the Zhejiang Provincial Hospital of Traditional Chinese Medicine. The herbs were mixed and boiled thrice in 1000\u2009mL double-steamed water for 30\u2009min each time, filtered by vacuum filtration, and concentrated on an induction cooker to about 100\u2009mL. The liquid was then evaporated to dryness in a vacuum at \u221240\u00b0C. The final freeze-dried powder weighed 2.93\u2009g; the yield was 3.25% . The freeze-dried powder of HCSC was then dissolved in double-steamed water (10\u2009mg/mL) and filtered through a microporous filter for sterilisation.2 at 37\u00b0C. Cells in the logarithmic growth phase were used for all the experiments.Human lung adenocarcinoma H1975 cells  were kindly provided by Professor Zhou Caicun . The cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% foetal bovine serum, 100\u2009U/mL penicillin, and 100\u2009mg/mL streptomycin and maintained in a humidified chamber with 5% CO3 logarithmically growing H1975 cells/well were seeded in 96-well plates. After incubation for 24\u2009h until the cell monolayer covered the bottom of the well, the cells were treated with varying concentrations of HCSC  for 24, 48, and 72\u2009h. The 10% Cell Counting Kit-8  solution was added to each well, and the cells were cultured for another 1\u2009h at 37\u00b0C. The optical density (OD) was measured at 450\u2009nm using a multifunctional microplate reader . The inhibition rate is /average OD value of control group\u2009\u00d7\u2009100%). The experiment was repeated three times in parallel. SPSS software was used to calculate the IC20 and IC50 values.A total of 6\u2009\u00d7\u2009105 cells/well) were seeded into 6-well plates. After incubation for 24\u2009h, the cells were divided into the control (CG), low-dose (LD), and high-dose (HD) groups. The CG was treated without HCSC, while the LD and HD groups were treated with IC20 and IC50 proportions of HCSC for 24\u2009h. The cells were collected and suspended in a 100\u2009\u03bcl binding buffer containing 5\u2009\u03bcl Annexin V-FITC and 10\u2009\u03bcl PI. After incubation in the dark for 15\u2009min at room temperature, 400\u2009\u03bcl of binding buffer was added. Flow cytometry  was used to detect cell apoptosis in each group, and the FACSDiva Version 6.1.3 software was used for data analysis.Cells \u2009=\u2009(1\u20130\u2009h wound area/12 or 24\u2009h wound area)\u2009\u00d7\u2009100%. Image J was used to analyse the image data and determine the scratch area. The experiment was repeated three times in parallel.For the wound healing assay, cells were seeded in 6-well plates and incubated until 100% confluence. A sterile 200\u20095 cells/well) were seeded into 6-well plates. After incubation for 24\u2009h, the cells were treated as described above for 24\u2009h. The cells were scraped and collected. The protein of the H1975 cells was extracted with lysis buffer, and the concentration was measured. The sample volume was adjusted according to the internal reference protein to ensure the same amount of protein in each sample. The proteins were separated using sodium dodecyl sulphate-polyacrylamide gel electrophoresis based on their different molecular masses. Then, the proteins were transferred onto polyvinylidene difluoride membranes  using sodium dodecyl sulphate-polyacrylamide gel electrophoresis. The membrane was then immersed in 5% skim milk diluted with tris-buffered saline with 0.1% Tween-20 for 2\u2009h at room temperature. After that, the membrane was cut into several bands and incubated with diluted antibodies (1\u2009:\u20091000) at 4\u00b0C overnight. The antibody selected the relevant proteins in the KEGG enrichment pathway. The bands were washed with tris-buffered saline with 0.1% Tween-20 before incubation with HRP-conjugated secondary antibodies . At room temperature, a second incubation was required for 2\u2009h. The bands were visualised using an electrochemiluminescence system . The experiment was repeated three times in parallel.Cells . The accurate molecular weight and secondary fragment information of the compound obtained from the total ion current diagram was compared with the information in the UNIFI TCM database to obtain the components.The filtered mother liquor of the freeze-dried HCSC powder was diluted to 1\u2009mg/mL with double-distilled water, and the sample was injected. Mass spectrometry conditions were as follows: in the MShttps://www.symmap.org/) [SymMap (ap.org/)  containsA total of 111 bioactive components and 995 targets were identified in the TCMSP database. Eight potential bioactive components of HCSC and their corresponding targets were obtained . Ten targets were selected with the highest fit score in the PharmMapper database. A total of 113 targets were integrated and deleted after duplication . In the The above candidate targets were entered in the STRING database, and the \u201cminimum required interaction score\u201d was set at 0.4 to obtain a PPI network involving 106 potential targets. A \u201cdrugs-bioactive components-potential targets\u201d network diagram was constructed using Cytoscape , 2. In aThe 18 core targets of HCSC were analysed using clusterProfiler  pV\u2009<\u20090..P < 0.05; 36 items in total). In the enrichment results, the P53 signaling pathway was selected and the candidate targets were mapped. This pathway has been reported in the literature to be closely related to lung cancer [The core targets were analysed using ClueGO and CluePedia for the KEGG pathway enrichment analysis  for 24, 48, and 72\u2009h. HCSC can inhibit cell proliferation and exhibit a dose-time effect relationship. Compared with that in the control group, in the test group, the inhibition rate increased, and the increase was statistically significant. The ICter 24\u2009h , 7.P < 0.01). Thus, HCSC can indeed induce apoptosis in H1975 cells, and apoptosis may be the main cause of death (The H1975 cells were treated with varying concentrations of HCSC (2.312\u20135.291\u2009mg/mL) for 24\u2009h. Compared with the control group, the rate of apoptosis in the test group increased significantly as the dose increased (15.17\u2009\u00b1\u20090.95 and 37.6\u2009\u00b1\u20091.64 vs. 6.33\u2009\u00b1\u20090.32) (of death .P < 0.01), and the mobility of the HD group decreased compared with that of the LD group (P < 0.05). After 24\u2009h of scratching, the number of cells at the scratch site of the control group increased, and the scratch healing was obvious. The mobility of the LD and HD groups was reduced compared with that of the control group (P < 0.01); there was no significant difference in the mobility of the HD group compared with that of the LD group , caspase-3, caspase-9, and PARP . We found that compared with that in the control group, in the test groups, the expression level of caspase-3 in H1975 cells was significantly decreased (P < 0.05), whereas the expression level of cleaved caspase-3 was significantly increased (P < 0.05). Compared with that in the control group, in the test groups, the expression level of caspase-3 in H1975 cells in the HD group was significantly decreased (P < 0.01), whereas the expression levels of cleaved caspase-3, cleaved caspase-9, and cleaved PARP were significantly increased (P < 0.01). Compared with that in the LD group, in the test groups, the expression level of caspase-3 in the H1975 cells in the HD group was significantly decreased (P < 0.05), whereas the expression levels of cleaved caspase-3 and cleaved PARP were significantly increased (P < 0.01) and that of cleaved caspase-9 was significantly increased (P < 0.05)  .The total ion current diagram of the freeze-dried HCSC powder was obtained by LC-MS . Upon coSymMap provides herb-symptom relationships and symptom mechanism mapping. The results are as follows: HCSC contains 15 TCM symptoms, 11 TCM syndromes, 43 modern medicine symptoms, and 150 diseases. The TCM symptoms mainly include thoracic obstruction, Zhengjia, cardiodynia, abdominal mass, and amenorrhea, whereas the TCM syndromes involve phlegm-accumulation stasis, lung-spleen qi deficiency, and qi stagnation due to liver depression. The diseases mainly include SCLC, bladder cancer, T-cell immunodeficiency, pancreatic cancer, and other cancers, and the modern medicine symptoms include chest pain, dyspepsia, neoplastic growth, angina pectoris, and menopause.TCM is usually applied in combination; it is a therapeutic treatment mode comprising multiple pharmacological bioactive components that cooperate with different pathways. The mechanism of HCSC with multiple components, multiple targets, and multiple pathways has limited in-depth exploration. However, the emergence of network pharmacology has solved this problem.In this study, we collected seven potential bioactive components of HCSC, among which hederagenin is a common component of Sparganii Rhizoma and Curcumae Rhizoma. Moreover, sitosterol , formonoIn vitro experiments in H1975 cells were used to clarify the activity of HCSC in treating lung cancer and to further verify the relevant molecular mechanisms predicted by network pharmacology. Experimental results showed that HCSC can significantly inhibit the proliferation of H1975 cells, promote apoptosis, and reduce cell migration. HCSC plays an all-around role in the treatment of lung cancer and is expected to overcome the resistance of EGFR-TKI caused by the T790M mutation. Western blotting results showed that the protein expression levels of cleaved caspase-3, cleaved caspase-9, and cleaved PARP in H1975 cells after HCSC treatment were significantly higher than the levels of those in the control group. This suggests that HCSC can upregulate the mitochondrial-mediated caspase-dependent apoptosis signaling pathway by inducing the cleavage of caspase-3, caspase-9, and PARP, consistent with the aforementioned network pharmacology prediction pathway. The activity of HCSC in the treatment of lung cancer is dose- and time-dependent to a certain extent. Because there were fewer concentration gradients in our experiment, more groups still need to be set to verify the above conclusions. LC-MS confirmed that formononetin and bisdemethoxycurcumin were present in the freeze-dried powder of HCSC, which matched the prediction in the database. This suggests that the in vitro antitumor effect of the freeze-dried powder of HCSC may be dominated by formononetin and bisdemethoxycurcumin.This study also explains the relationship between disease-syndrome-herb through the analysis of the SymMap database. According to the basic theory of TCM, lung cancer was historically classified into the Zhengjia category. At present, there is no unified standard for the classification of TCM syndromes in lung cancer. The deficiency of lung-spleen qi and the stagnation of qi and blood stasis are common TCM syndromes in patients with advanced lung cancer, and these syndromes often manifest as dyspepsia and chest pain , 37. Thiin vitro experiments to reach the following conclusions: (1) the core bioactive components of HCSC were sitosterol, formononetin, and bisdemethoxycurcumin; (2) HCSC can upregulate the mitochondrial-mediated caspase-dependent apoptosis signaling pathway by inducing the cleavage of caspase-3, caspase-9, and PARP; (3) the qi deficiency and blood stasis syndrome would be the most suitable for treatment with the HCSC. Thus, this study enhanced the therapeutic potential of HCSC in lung cancer.This research innovatively used network pharmacology and"}
+{"text": "Stevia rebaudiana is a South American plant, the cultivation of which is increasing worldwide due to its high content of sweet compounds. Stevia sweetness is mainly due to steviol glycosides, that are ~250-300 times sweeter than sucrose. Many studies have suggested the benefits of Stevia extract over sugar and artificial sweeteners, but it is still not a very popular sugar substitute. This review summarizes current data on the biological activities of S. rebaudiana extract and its individual glycosides, including anti-hypertensive, anti-obesity, anti-diabetic, antioxidant, anti-cancer, anti-inflammatory, and antimicrobial effects and improvement of kidney function. Possible side effects and toxicity of Stevia extract are also discussed. CFTR, cystic fibrosis transmembrane conductance regulator; GFR, glomerular filtration rate; LPS, lipopolysaccharide; MDCK cells, Madina-Darby canine kidney cells; NF-kB, nuclear factor kappa-light-chain-enhancer of activated B cells; Nrf2, nuclear erythroid factor 2; TRPM5, transient receptor potential cation channel subfamily melastatin member 5; TPA, 12-O-tetradecanoyl-phorbol-13-acetate.Stevia of the Asteraceae family includes 230 species, but only one of them, Stevia rebaudiana Bertoni produces sweet steviol glycosides. It was earlier thought that S. phlebophylla also has this property, but new research denies this .S. rebaudiana is a perennial shrub growing in South America, in particular in Brazil and Paraguay, where it is also known as \u201cHoney Leaf\u201d, \u201cSweet-Leaf\u201d or \u201cSweet-Herb\u201d. Stevia preparations are used in many forms such as fresh and dried Stevia leaves, Stevia leaf powder, extracts and liquid concentrates. Stevia extract is a great alternative for synthetic sweeteners being approximately 200 to 300 times sweeter than sugar . Many sal., 2017). Safetyal., 2017). Stevia preparations are steviol diterpene glycosides .Stevia has been known to people from ancient times. The Guarani Indians called Stevia \u201cKa-a He-e\u201d, which means \u201csweet grass\u201d, and used it to savor bitter drinks such as mate. There are some reports that Stevia was already known in Spain in the 16th century. However, other Europeans learned about the plant only in the late 19th century, after Stevia was introduced and promoted by the botanist Moises Santiago Bertoni . Bertonal., 2008). In 190al., 2008). Duringal., 2015).Stevia was introduced in Japan and research was started to evaluate its beneficial potential for human health. Since then, the Japanese actively use this sweetener in a variety of foods and Japan is one of the major producers of Stevia now . In 201den, 2013). In addank, 2002). S. rebaudiana contain more than 30 different steviol glycosides, among which stevioside and rebaudioside A are present in the highest levels . Rebaudcio, 2015). The cocio, 2015; Goyal ecio, 2015).Stevia leaves are glycosides, stevioside, several types of rebaudiosides (from A to F), steviolmonoside, rubusoside, dulcoside A, and steviolbioside . Less cal., 2002). Rebaudrth, 2020). Despitrth, 2020). Rebaudrth, 2020).Stevia, namely rebaudioside U, T, R and S . Stevioal., 2016). Most oal., 2016; Purkayaal., 2016). Sweet cio, 2015). ProcesStevia leaves contain proteins, carbohydrates, lipids, dietary fibers, oils, vitamins, and phenolic compounds. Dried Stevia leaves contain (per 100 g of dried mass) 11.2-16.0 g proteins, 61.9 g carbohydrates, 1.9-3.73 g lipids and 6.8-15.2 g dietary fiber .Stevia differs in dry and fresh leaves and depends on the method of processing or extraction . Stevia leaves contain a number of phenolic compounds that exhibit strong antioxidant properties. The content of total polyphenols and flavonoids in methanolic extracts was estimated as 25.18 mg/g and 21.73 mg/g, respectively , vitamin B2 (0.43 mg/100 g), folic acid (52.18 mg/100 g) . This hal., 2011). MoreovStevia contains stevial glycosides. Rubus suavissimus also known as sweet tea, contains steviol monoside, rebaudioside A, B, C, D, F, M, stevioside, steviolbioside, and rubusoside . In addal., 1992). Stevia have been studied for over 100 years. Both earlier and current studies not only confirm the safety of Stevia leaf preparations but also find more and more benefits of its consumption for human health. Next, we will summarize current data on the established and potential pharmacological effects of Stevia extracts and its individual components in various medical models .2O2 exposure compared with the control cell group . These al., 2017). One stal., 2012). Anotheal., 2007).Stevia glycosides were found to reduce lipoperoxidation and decrease hydroperoxide and protein carbonyl content in Cyprinus carpio . Stevioal., 2017). In addStevia extracts depend on the methods of extract processing including stages of drying and extraction. Thus, the highest total content of phenols was observed in glycol-aqueous extracts from Stevia leaves, with lower phenol content in aqueous extracts and the lowest levels in ethanol extracts  showed that the best method of drying to keep high antioxidant potential was hot air drying at 180 \u00b0C. Under this regime, the content of antioxidants was 2-3 times higher than when using other drying methods . Comparal., 2015).Cancer is the second leading cause of mortality in the world. The most common forms of cancers in 2017 were breast cancer, colorectal cancer, prostate cancer, and lung cancer. Therefore, the search for agents that may help in cancer treatment or prevention is extremely important .Stevia components in chemotherapy of cancer . High cal., 2005) .Stevia leaves significantly inhibited the NF-\u03baB-mediated gene expression that was stimulated by bacterial lipopolysaccharide (LPS). Such inhibition of NF-\u03baB signaling was closely associated with a decrease in levels of interleukin-6 and monocyte chemoattractant protein-1. It was suggested that Stevia could be used for treatment of immune diseases such as rheumatoid arthritis and lupus . Stevioal., 2010). Stevioal., 2010). Austroal., 2013). The meal., 2011; Arya etStevia also has antibacterial effects in the oral cavity . Dentalras, 2013).Stevia extracts against microorganisms that cause tooth decay. Extracts were obtained from dried S. rebaudiana leaves using hexane, methanol, ethanol, ethyl acetate or chloroform as solvents. The antimicrobial activity of these five extracts against 16 bacterial strains of the genera Streptococcus and Lactobacillus was evaluated by the well-known diffusion method. For the four Lactobacillus species, the inhibition zones obtained between 12.3 and 17.3 mm were somewhat larger with ethyl acetate and chloroform extracts, suggesting that these bacteria were the most susceptible microorganisms. In another study, four groups of rats were fed with stevioside, rebaudioside A or sucrose, which were added to the main diet. There were significant differences in the rates of sulcal caries and Streptococcus sobrinus count between a group fed diet with 30 % sucrose and the other 3 groups. There were no differences between groups fed stevioside or rebaudioside A and groups without additives. Thus, it can be argued that neither stevioside nor rebaudioside A are cariogenic  also stal., 1992). An in zky, 2010). Cariesal., 2013). Due tosma, 2015). Moreoval., 2017).Diabetes is a group of diseases in which insulin is either not produced in sufficient quantities (type 1 diabetes) or cannot be used effectively due to insulin resistance (type 2 diabetes). As of 2019, there were 464 million people with diabetes in the world; for comparison, in 2000, 175.4 million of patients with diabetes was recorded. According to the International Diabetes Federation, by 2040 this number will increase to 642 million . About Stevia has been used not only as a sweetener but also as a medication in the treatment of diabetes and hyperglycemia in traditional medicine in Brazil and Paraguay . The an Figure 4. One stumad, 2018). An incmad, 2018). In addmad, 2018). Glycosmad, 2018). Consummad, 2018). A numbal., 2010; Mehta eal., 2010; Singh aal., 2010; He et aal., 2010). Steviaal., 2017). Moreoval., 2018). The abal., 2018). Groupsal., 2017). Furtheal., 2015). Howeveal., 2008; Ajami eetc. . S. rebaudiana extracts were administered to rats for 20, 40, and 60 days and results showed that rats treated with Stevia extract for 20 days did not significantly differ from the control group in the arterial pressure . The hypotensive effect on both systolic and diastolic blood pressure was dose-dependent for intravenous doses of 50, 100 and 200 mg/kg in conscious SHR. The hypotensive effect lasted for more than 60 min with a dose of 200 mg/kg. Thus, stevioside was effective in blood pressure reduction . In anolis, 1995). Howevelis, 1995). In onelis, 1995). Consumlis, 1995). Rebaudlis, 1995). Systollis, 1995).S. rebaudiana support its anti-obesity properties . Abdomi Figure 4. In one Cha, 2010). In addCha, 2010). Stevia extract was only due to the difference in calorie intake; therefore, consumption of Stevia extract did not affect the feeling of hunger and appetite . It alsStevia extract could prevent the adverse effects of high fat, high sucrose diet on lipid profiles, total antioxidant capacity and histopathologic factors in obese rats . In addal., 2020).The kidneys are one of the most important organs, their main function being to excrete end- and side-products of metabolism. The kidneys are also involved in regulation of blood pressure, water-salt balance and red blood cell formation . DiabetStevia leaves caused systemic and renal vasodilation, hypotension, diuresis and natriuresis . The filis, 1995). Yuajitlis, 1995) investial., 2018). Stevioal., 2018).Stevia dry extract defined by the Scientific Committee on Food of the European Food Safety Authority and Food and Drug Administration is 4 mg/kg body mass . One anal., 2015), but thStevia extract reduced the fertility of rats by up to 21 % compared with control group of rats. Fertility remained reduced by 47 % even after a 50-60 day recovery period . In SteStevia safety is that for over 1500 years of continuous use by Paraguayans, there have been any reports of adverse effects. Additional confirmation of the safety of Stevia consumption is the absence of reports on side effects of any kind in Japanese populations where Stevia has been consumed in large quantities in recent years . The maRao, 2005). In addal., 2010; Nikiforal., 2010; U\u00e7ar etal., 2010). Howeveal., 2016).S. rebaudiana, a perennial plant native to Paraguay, has come to be cultivated around the world as a source of high-potency sweetener with no caloric value. Two main steviol diterpene glycosides, stevioside and rebaudioside A, that are present in high levels in Stevia leaves provide the sweet taste of the plant and are 150-450 times sweeter than sucrose to human taste buds. Pure sweet glycosides and crude Stevia extracts with 50 % of glycosides are actively used in the food market. A number of preclinical and clinical studies suggest potential therapeutic and pharmacological applications for Stevia extracts and their individual compounds because they demonstrate no toxicity in experimental trails and exhibit health-promoting activities. In addition to different glycosides, Stevia leaves contain many other compounds like flavonoids and fatty acids that together provide the diverse biological properties of the plant. Thanks to these components, Stevia products stimulate insulin production in diabetics, improve polycystic kidney disease, have chemotherapeutic action in cancer and possess powerful antibacterial, antioxidant and immunomodulating properties  and a Discovery grant from the Natural Sciences and Engineering Research Council of Canada (#6793).The authors declare that they have no conflict of interest.Victoria Peteliuk and Lesia Rybchuk collected literature and wrote the original draft, prepared the figures and tables; Maria Bayliak performed analysis, review and edited the manuscript, helped to prepare and arrange tables and figures; Kenneth Storey performed review, editing and provided valuable discussion; Oleh Lushchak: provided funding acquisition, idea and design of the article, supervising, review, and editing. All authors read and approved the final manuscript."}
+{"text": "Evidence is limited on how to synthesize and incorporate the views of stakeholders into a multisite pragmatic trial and how much academic teams change study design and protocol in response to stakeholder input. This qualitative study describes how stakeholders contributed to the design, conduct, and dissemination of findings of a multisite pragmatic clinical trial, the COMprehensive Post-Acute Stroke Services (COMPASS) Study. We engaged stakeholders as integral research partners by embedding them in study committees and community resource networks that supported local sites. Data stemmed from formal focus groups and continuous participation in working groups. Guided by Grounded Theory, we extracted themes from focus group and meeting notes. These were discussed as a team and with other stakeholder groups for feasibility. A consensus approach was used. Stakeholder input changed many aspects of the study including: the care model that treated stroke as a chronic condition after hospital discharge, training for hospital-based providers who often lacked awareness of the barriers to recovery that patients face, support for caregivers who were essential for stroke patients\u2019 recovery, and for community-based health and social service providers whose services can support recovery yet often go underutilized. Stakeholders brought value to both pragmatic research and health service delivery. Future studies should test the impact of elements of study implementation informed by stakeholders vs those that are not. A primary goal of the Patient-Centered Outcomes Research Institute (PCORI) is to advance the science of community engagement in research . To dateClinicians, social scientists, and funders have demonstrated increased interest in how to effectively involve stakeholders in all phases of research so that research is relevant, meaningful, and actionable to those receiving the intervention, delivering the intervention, and translating the model into standard practice and policy. Initially, much of the research focused on patient and public involvement in the early stages , including projects focused broadly on the patient experience, or narrowly on specific population groups or specific areas of research \u201313. MoreThis paper describes how stakeholders contributed to the design, conduct, and dissemination of findings of a multicenter pragmatic clinical trial and the changes the academic team made to the study in response to their input. The cluster-randomized COMprehensive Post-Acute Stroke Services (COMPASS) Study investigated the effectiveness of implementing an evidence-based, comprehensive, post-acute stroke transitional care model compared with hospitals\u2019 usual care. The study design and methods \u2013 including methods used to engage stakeholders \u2013 are published \u201323. ThisThe COMPASS Study was a pragmatic cluster-randomized controlled trial conducted in 40 hospitals with approximately 10,000 stroke and transient ischemic attack (TIA) patients in North Carolina. Intervention hospitals employed a novel transitional care model, as well as an additional set of billing codes to provide financial incentives, in order to change provider behavior and increase quality of care and recovery outcomes for stroke and TIA patients. The study provided small supplemental funding to hospitals to offset research-related costs only. The primary trial results are published .The COMPASS model was initially developed in collaboration with the Wake Forest Baptist Health Comprehensive Stroke Center clinical team. It incorporated their prior experience with stroke transitional care through the TRAnsition Coaching for Stroke (TRACS) Program and evidence from the most current scientific literature .. Our primary goal for stakeholder engagement in the COMPASS Study was to be responsive to both patient and caregiver needs, to treat recovery from stroke as a chronic condition, to create a realistic workflow for hospital-based providers, and to link patients to community-based services to address social determinants of health to maximize recovery.Details on the COMPASS Study\u2019s non-traditional research partners and the rationale for their inclusion have been published . BrieflyFig.\u00a0. Our prWe used qualitative methods to investigate stakeholder needs and priorities, which enabled us to more fully capture insights and reactions than would be possible with quantitative methodologies with pre-defined response options. Qualitative methods also allow new areas of inquiry to emerge and can reveal perspectives that researchers may not be able to foresee . TransitEliciting and incorporating stakeholder perspectives involved embedding stakeholders into study committees, assembling resource networks, conducting focus groups, and group discussions. These group interactions encouraged stakeholders to talk to one another, ask questions, and comment on one another\u2019s experiences and perspectives, leading to more nuanced recommendations. Furthermore, the iterative process of holding multiple discussions over time with diverse groups of stakeholders helped refine recommendations and confirm that recommendations correctly reflected their ideas and were feasible with existing resources.We collected input from stakeholders using committees and resource networks, as described below.At the state level, we formed a large group of partners to be both inclusive and to leverage the tremendous expertise across the state. We purposefully included diverse perspectives, including urban/rural lived experiences of patients and providers, as well as patients and caregivers who represented varied income and educational levels. Some stakeholders on this committee were embedded in the study\u2019s Steering Committee and subcommittees, which met weekly, so that they could have continuous input throughout the study. Some stakeholders were consulted outside the regular meeting schedule, most frequently by the study\u2019s Principal Investigator (PI) and the Director of Implementation, both clinicians with extensive familiarity with North Carolina\u2019s stroke system of care. Other stakeholders provided important insights via focus groups and interviews. See Supplement 1 for an example of what one focus group of elder, rural residents revealed to researchers, how that information was used, and how these stakeholders were informed that we had made changes to the study in response to their feedback.At the local level, we guided the post-acute care coordinator at each of the 40 participating hospitals to develop a COMPASS Community Resource Network (CRN). These networks of community-based health and social service providers helped the post-acute care coordinator link patients to resources outside the hospital that could support recovery. The goal was to incorporate local knowledge into the intervention to maximize successful implementation. Each CRN included a representative from aging services, a pharmacist, a home health provider, and a rehabilitation provider. Some CRNs also included a representative from the local health department, a community paramedic, a faith leader, a local stroke survivor, a local caregiver, a transportation service representative, and/or a social worker, reflecting each community\u2019s unique resources and strengths. As part of implementation, each CRN engaged with the study\u2019s Director of Implementation and other implementation and training team members during on-site day-long hospital meetings at the beginning of the study. CRNs also provided feedback to the study team by participating in bi-weekly group conference calls for problem solving. CRNs also participated in two surveys in which they shared challenges they had experienced as well as solutions. These data collection activities allowed the study team to continuously learn from those delivering the intervention.All stakeholder engagement activities were submitted to the Wake Forest University Health Sciences Institutional Review Board (IRB). The IRB classified (and approved) some stakeholder engagement activities as \u201cHuman Subjects Research\u201d and other stakeholder engagement activities as \u201cNot Human Subjects Research.\u201d For IRB-approved research activities , participants provided verbal consent. For activities that did not meet the IRB definition for research , there was no consent process.et al. 2020 for description of tool)  COMPASS has really done for us is identify some holes that are in our program and the speech therapy is a prime example\u2026 I didn\u2019t know before starting COMPASS that these things were getting missed or they weren\u2019t being done or the patients were struggling like they were\u2026. You don\u2019t know what you don\u2019t know, and I certainly had no idea. So we have been able to work through and do some education and set up some processes where we can limit these missed therapies and missed opportunities for incorporating resources for the patient.\u201dImportantly, by bringing together patients, community-based service providers and hospital-based providers, it became clear that there were gaps in care that patients could easily identify and that providers were unaware of but eager to address. As one stroke coordinator shared with us,The cross-sector collaboration in the study also gave community agencies an entry point into their local hospitals which, in the past, they had not been able to establish on their own. There were multiple points throughout the study in which these stakeholders drove engagement activities that clearly strengthened the study. For example, the study pharmacist saw opportunities, knew of an existing network of community-based pharmacies that offered enhanced services, and had critical personal connections that made it possible for the study team to link a community-based specialty pharmacist to each of the 40 hospitals (via their CRNs). These community pharmacies often were able to provide to patients evidence-based interventions . The study team recognized the value that these community pharmacists offered, but, over the course of implementation, they emerged as markedly more critical partners in care than the team had initially expected. If a pharmacist had not been on the study team, the team would not have been aware of the opportunities he identified; nor would the team have had the credibility or social capital that he had in his professional network to forge these statewide partnerships and connect patients with community services to support their recovery. Expanding beyond the hospital perspective enabled us to treat the patient holistically.Not knowing who to call as soon as they recognized they had cognitive and/or physical deficits that were not detected in the hospital.Survival and full recovery require that the patient has an able and willing caregiver, yet many stroke survivors live alone or have ailing spouses who themselves need caretaking.Not having a roadmap to follow to recovery.The study team made several observations after including diverse stakeholders in relation to socioeconomic status, urban/rural location, and racial representation. First, regardless of socioeconomic status, location, or race, patients and caregivers voiced the same problems with usual care after stroke:also assesses the caregiver\u2019s ability to care for the patient. The intervention also calls for a single person, trained in stroke, to be the clear contact person for the patient; and this information is communicated to the patient and/or family in a myriad of ways . The guidance stakeholders gave for a roadmap to recovery (Care Plan) is described in Table\u00a0These unmet needs were universal and shaped the intervention. It was particularly eye opening to hear from highly resourced patients and caregivers that they \u2013 in spite of their social and economic advantages \u2013 were overwhelmed by having to managing post-acute care. They told us that they did not see how people with fewer resources could cope or ever fully recover. Their lived experience pushed the team to design an intervention that assesses the patient comprehensively, and Second, stakeholder diversity in terms of rural/urban and racial representation produced creative solutions to common problems. Rural hospitals had clinical teams that were exceptionally effective at anticipating and successfully addressing implementation problems. They attributed this prowess to knowing most people in the small hospital and community and being able to leverage those relationships. The solutions developed at rural sites were shared with and then adopted by urban sites. For example, a rural site could not identify the protocol-specified RN within the hospital system to serve as the main contact to the patient. But a clinician did know of a community paramedic program, rooted in the African-American community that was already making home visits. The site argued that a community paramedic, who was trusted by community members, could effectively function in the protocol-specified role and the protocol was amended. This solution was then used in other sites.Several clinical stakeholders who were African-American and started as advocates for their African-American patients became trail blazers in implementing adaptations of the intervention after the measurement period (during the sustainability phase) to further address their needs. For example, to address remaining transportation barriers, they consolidated members of the care team to one location, and made the comprehensive assessment of the patient a televisit. The study team\u2019s next study is to test the effectiveness and implementation of a televisit vs in-person visit for comprehensive post-acute stroke care now that Medicare is covering telemedicine during the COVID pandemic and this form of the intervention is sustainable.In this study, we actively elicited and incorporated input from a diverse set of stakeholders in one of the first large-scale pragmatic clinical trials of transitional care in the USA. This qualitative assessment highlighted ways that patients and caregivers shaped the design of the intervention, enhanced caregiver and clinician training, designed ways to improve patient recruitment and participation, and made patient-facing materials more useful to other stroke patients and their caregivers. Furthermore, it revealed ways that engagement of acute care hospitals\u2019 providers and administrators, post-acute care providers, local pharmacists, and primary care physicians facilitated uptake of a complex intervention. Unexpectedly, it also revealed ways that stakeholders themselves benefited from engagement with the research team.The majority of the literature to date on stakeholder engagement in research has provided general guidelines or has focused on the barriers to successfully engaging stakeholders . A commoPatient and family stakeholders were typically delighted when asked to join or advise the study team. Indeed, many patients sought out the study team when they heard about it through the local media. Patients and caregivers were typically motivated to collaborate as partners when learning that the research team wanted to learn from their experience to improve care for others. Community-based health and social service providers were similarly motivated to serve as stakeholders, even those who had no prior research experience, due to the shared mission of improving health and wellbeing of either stroke patients in particular or older individuals more broadly. Patients were open and honest with their input and feedback. At times, patients and families would couch their critiques of the hospital care they received by explicitly praising their providers . Patient and family stakeholders frequently expressed that being able to contribute to the study was critical to their own healing. Specifically, they stated that bringing awareness to gaps in care and being part of the change that they hoped would reach thousands of other patients helped them rebuild their confidence in public speaking, redirect their grief or anger into something productive, make sense of their new life, and fulfill their new purpose in life.This paper has limitations. Due to resource constraints it was simply not feasible for the study team to deeply engage with all stakeholders and also transcribe and tag all data with codes. Engagement activities were tracked but some were captured in less detail, truncated or summarized in REDCap forms. However, in those cases we often uploaded documents that captured rich details about the engagement activities. The strength of this paper is that the team documented the vast majority of engagement activities and systematically engaged stakeholders from design to dissemination and acted on stakeholder advice.https://www.nccompass-study.org/), to education of hospital-based clinicians on what it means to deliver patient-centered care, to strengthened community partnerships, to sharing evidence that informed policymakers about the need for primary and secondary prevention care in stroke. Very importantly, stakeholder involvement in the study produced a new patient-centered consent model for future pragmatic trials [Stakeholder involvement in the COMPASS Study produced lasting benefits to stakeholder groups beyond the scope of the study, from publicly available, patient-friendly educational materials . She changed the language used on the consent form and study brochures because she did not want a single patient to think they would be receiving suboptimal care if assigned to the control group (for fear that perception would undermine their recovery). While the study team could offer language the IRB approved, she could offer language that would not turn patients away from the study.A common charge against stakeholder involvement is the amount of time and resources required. We agree that, for stakeholder engagement to be meaningful, it does require paid research effort, study infrastructure, and payment for the time that patients and community organizations provide to the study. The study budget was established in 2015. It was important to reimburse stakeholders equitably and consistently. See Supplement 4 for our policy and procedures for reimbursing stakeholders. The study paid $20 per hour to patient and caregiver stakeholders for their time spent preparing for meetings, attending meetings, reviewing materials, and travel when necessary, etc. For health professional and corporate stakeholders there was overlap between their established (paid) work and study needs, therefore they were not compensated at an hourly rate. All stakeholders were eligible for compensation for their time in focus groups and interviews which the IRB defined as research. It was necessary to balance compensation across a large stakeholder base while not limiting input from stakeholders or exceeding study budget. It is now 2020, and as our team prepares other grants and associated budgets we have increased the hourly rate to 30\u201340 dollars per hour (depending upon the size of the grant) as we feel that 20 dollars per hour should be increased for the value that stakeholders bring to each study.It should be noted that a collaborating advocacy organization declined reimbursement. A community-based organization negotiated a 10,000 dollar per year flat rate. Reimbursement went to the organization, not to the individuals engaged in the study. Unlike community-based participatory research, stakeholder engagement in research can lie along a continuum of meaningful participation, which provides some flexibility in time and resource investment. We believe that the short-term costs of investing in stakeholder engagement pays off over the long term. For instance, it may take longer to create a consent process and consent form that patients, caregivers, and the IRB approve, but it may support patient recruitment and hospital retention over the course of the study.Future studies should directly test the impact of elements of study design, implementation, and dissemination that were informed by stakeholders vs those that were not to continue to advance the science of engagement in clinical research. Future research should also quantitatively test the effect of stakeholder engagement on patient recruitment, patient or provider behavior, and patient-centered outcomes. Another area ripe for study is understanding how patients personally benefits by contributing to research projects  and if and how that might affect their own recovery. This will require additional time and resources but is critical to strengthening the inclusion of stakeholders in the design and implementation of future studies and programs."}
+{"text": "Protein degradation by the Ubiquitin-Proteasome System is one of the main mechanisms of the regulation of cellular proteostasis, and the E3 ligases are the key effectors for the protein recognition and degradation. Many E3 ligases have key roles in cell cycle regulation, acting as checkpoints and checkpoint regulators. One of the many important proteins involved in the regulation of the cell cycle are the members of the Histone Deacetylase (HDAC) family. The importance of zinc dependent HDACs in the regulation of chromatin packing and, therefore, gene expression, has made them targets for the design and synthesis of HDAC inhibitors. However, achieving potency and selectivity has proven to be a challenge due to the homology between the zinc dependent HDACs. PROteolysis TArgeting Chimaera (PROTAC) design has been demonstrated to be a useful strategy to inhibit and selectively degrade protein targets. In this review, we attempt to summarize the E3 ligases that naturally ubiquitinate HDACs, analyze their structure, and list the known ligands that can bind to these E3 ligases and be used for PROTAC design, as well as the already described HDAC-targeted PROTACs. Proteins inside the cells are subjected to a well meshed quality control system that is comprised of the Ubiquitin-Proteasome System (UPS), autophagic lysosomes, and the endoplasmic reticulum. Misfolded proteins will reach the endoplasmic reticulum where a refolding process will be attempted by the Heat-Shock Proteins (HSPs). Should this process fail, the misfolded proteins will be transported back to the cytoplasm where they will be finally degraded by either the UPS or lysosomes . AutophaC-terminal end of Ub (The UPS system is comprised of the 26S proteasome and an ensemble of three enzymes that carry out substrate ubiquitination in cascade: the ubiquitin-activating enzyme (E1), the ubiquitin-conjugating enzyme (E2), and the ubiquitin ligase (E3) [nd of Ub  7]..C-terminUbiquitination in the substrate protein may happen by either the addition of one Ub molecule on one lysine residue (monoubiquitination) or several lysine residues (multiubiquitination); or the addition of several Ub molecules on one single lysine residue (poliubiquitination) . Poli-UbThe type of E3 ligase will determine what protein is going to be ubiquitinated and which is the E2 ligase that is going to take part in the process, as the E3 ligase has specific recognition domains for both proteins . There a2+ are coordinated to cysteine residues in the RING finger motif that are recognizable by the following sequence: Cys-X2-Cys-X(9\u221239)-Cys-X(1\u22123)-His-X(2\u22123)-Cys-X2-Cys-X(4\u221248)-Cys-X2-Cys .,84.N-terCRBN system can adopt different conformations. The conformational change undergone by CRBN is reminiscent of the opening and closing movement of the thumb: closed when it is near the hand and opened when it is away from the hand. When CRBN interacts with Ikaros, the conformation is opened (PDB code 6H0F), but when it interacts with CK1 the conformation is closed (PDB code 5FQD)   71,84].,84.CRBN C-terminal end and the SPOP protein at the N-terminal end. The SPOP protein, whose name stands for speckle-type POZ proteins due to the dotted pattern it produced in the nucleus of the cells, is the substrate-recognition protein of this Cullin-RING E3 ligase complex that also belongs to the BTB  family (The Cullin-3 protein that works as the scaffold of this system interacts with Rbx1 at the ) family  85,86].,86.C-terDue to the nuclear residence of SPOP, it recruits as substrates different nuclear proteins that are at the end of many cellular pathways. Works carried out by Cuneo M. J. et al. listed a total of 26 SPOP substrates that ranged from nuclear receptors, epigenetic modifiers, transcription factors, and cell cycle modulators, to nuclear phosphatases . SubstraN-terminal end; the BTB domain in the center part of the protein; and a C-terminal BTB and C-terminal Kelch (BACK) domain  domain at the ) domain . This lain  has been shown to regulate the entrance into the metaphase of cell division as it delays chromosome condensation and is considered to be a tumor suppressor ,93. CHFRN-terminal end, the RING domain, and the CRD (Cystein-Rich Domain) at the C-terminal end (CHFR is made up of three domains: FHA (ForkHead-Associated) domain at the inal end a.2+ ions located in four Zn-binding domains, of which the last conforms the PAR-Binding Zinc finger (PBZ). This PBZ is the binding site for PolyADP-ribose (PAR) that constitutes a post-translational modification that rises from DNA damage. Despite not being crystalized in complex with CHFR, Oberoi J. et al. were able to crystalize the CRD of CHFR in complex with PAR-structurally related ligands . . N-termi2+ ions coordinated with cysteine and histidine residues: six located in the N-terminal domain, two in the RING domain and one in the C-terminal domain. The N-terminal domain is formed by the N and C lobe perpendicular to one another, that are made up of small antiparallel \u03b2-sheets and a \u03b1-helix. This N-terminal domain is able to weakly interact with the DNA-binding domain (DBD) of p53, thus contributing to the ubiquitination of this tumor suppressor. On the other side, the C-terminal domain presents a disordered N-terminal end, whereas the C-terminal end presents a small globular structure near the last zinc ion. Additionally, residues Ala249 and Ile256 create an interacting surface with the p53 tetramerization domain (TET) . T. TN-termecessary . Oligometructure  129]. I. IN-term of MDM2 .N-terminal end of these ligases and is comprised of three hydrophobic pockets that interact with residues Phe19, Trp23, and Leu26 which are part of the \u03b1-helix of p53 that interacts with MDM2 and MDMX [The p53 binding site is located at the and MDMX . The intand MDMX . The p53and MDMX ,131. Due to the implication of MDM2 in cancer regulation, there is a great interest in the development of selective inhibitors that impair the binding of the E3 ligase to the oncosuppressor protein p53 favoring cell death ,137,138.C-Terminus (HECTs) E3 ligases is a smaller family of E3 ligases that are involved in a wide range of pathologies such as neurodegenerative disorders, hypertension, and cancer. This type of E3 ligases carry out a two-step ubiquitination mechanism: they first bind the Ub-E2 ligase and catalyze the transfer of the Ub onto a catalytic cysteine; secondly, they bind the substrate protein and transfer the Ub molecule. This type of mechanism voids the substrate specificity of the E2 ligases as the ubiquitination of the substrate protein will be directed by its interaction with the HECT ligase through adaptor proteins. Interestingly, HECT ligases can be hijacked by viral proteins that favor the ubiquitination of proteins that are not the natural substrates of this system [C-terminal end of the protein. This domain is comprised of two lobes connected by a flexible loop: the E2-binding domain at the N-lobe, and the C-lobe that contains the catalytic cysteine that binds to the Ub molecule [The Homologous to E6AP s system . The maimolecule . N-terminal domain: the NEDD4 subfamily that presents WW and C2 domains, the HERC subfamily that presents regulator of chromatin condensation-like domains (RLD); and the \u201cOther\u201d subfamily that have different N-terminal domains that may or may not contain the WW and C2 or the RLD domains [The HECT family can be divided into three subfamilies depending on the characteristics of the  domains . Interes domains . Inhibitors of this family of ligases have been identified using phage libraries, and despite not having a clear understanding of their mechanisms of action, they all alter the Ub transfer from the E2 ligase to the catalytic cysteine of the HECT domain . Smurf1 and Smurf2 are the two members of the Smurf (SMad Ubiquitination-Related Factor) family. The cellular location of the two Smurf family members will mainly depend on their target proteins. Interestingly, Smurf1 is mainly located in the cytoplasm, but can translocate to the nucleus, while Smurf2 acts in the opposite way; it is mainly nuclear but can translocate to the cytoplasm . In normHowever, Smurf2 can either act as tumor promoter or suppressor, depending on various factors such as tumor stage and type, amongst others . Smurf2 The tumor suppressor activity of Smurf2 is related to the ability of Smurf2 to induce cell senescence when telomers are shortened, thus avoiding the accumulation of mutations by degrading Id1 (Inhibitor of DNA binding 1), which leads to the expression of p16 that is the ultimate senescence inducer. Additionally, Smurf2 degrades: RNF20 (RiNg finger protein 20) that is responsible for histoneH2B ubiquitination; TopoII\u03b1 (Topiisomerase II\u03b1) that is involved in chromosomal translocations; SATB1 (AT-rich Sequence-Binding protein 1) that promotes the growth and metastasis of colon cancer; KLF5 (Transcription factor-Kr\u00fcppel-like factor 5) that promotes colon and bladder cell proliferation; and YY1 (Yin Yang 1) that is a Kr\u00fcppel-like zinc finger transcriptional factor expressed in various cancers . N-terminal end, several WW domains, and the HECT domain at the C-terminal end [From a structural point of view, the Smurf subfamily belongs to the NEDD4 subfamily of HECT E3 ligases, as both Smurf1 and Smurf2 present the C2 domain at the inal end . N-terminal end, three WW domains , and the HECT domain at the C-terminal end. The C2 domain presents two main activities: on the one hand, it is responsible for the auto-inactivation of Smurf2 by interacting with the HECT domain [Structurally, Smurf2 presents the C2 domain at the T domain ,151; on T domain . The WW T domain . The intT domain ,150. N-Myc is Lys48-poliubiquitinated by HUWE1 in neuroblastome cells and in embryonic stem cells, thus allowing neuronal differentiation and cell cycle arrest [c-Myc, as the absence or mutation of this E3 ligase results in an observable increase in cell proliferation as a result of increased c-Myc levels [c-Myc, which led to the activation of its transcriptional activity and, in parallel, it also formed Lys48-poliubiquitin chains in MZ1 to induce its degradation. MZ1 is a component of the MYC/Max/MZ1 repressor complex [c-Myc in multiple myeloma, where it can be found overexpressed [HUWE1 is a two-faced ligase with respect to cancer, as depending on the type of cancer it will act either as an enhancer or a tumor suppressor ,152. Wore arrest ,156. Myac levels . On the  complex . In addixpressed . Anotherxpressed . MoreoveHUWEI has also been found to be implicated in an intricated p53-regulating pathway that involved different types of E3 ligases, tumoral suppressors and HDAC2. In fact, p53 and HDAC2 are two targets of this ligase ,153. p14N-terminal end is still being studied. In 2018, Jasper Sliumer and Ben Distel described the N-terminal end to have four domains: ARM (ARMadillo-type fold domain) which is believed to mediate in vesicular transport of many proteins; the UBA domain (UBiquitin Associated domain) which is responsible for binding polyubiquitin chains; the WWE domain (Triptophan and Glutamic acid-rich domain) which is responsible for protein\u2013protein interactions during the ubiquitination phase; and the BH3 domain (Bcl-2 Homology region 3) which specifically recognizes the Bcl2-family member Mcl-1 [C-terminal end of the BH3 domain, they indicated the presence of the UBM, the function of which is yet to be fully elucidated [N-terminal end. According to this study, this end is made up of four Armadillo Repeated Liked Domains (ARLD1\u20134); a WWE domain; and a \u201cTower\u201d and HWA (HUWE1 WWE module Associated) domain [HUWE1 belongs to the \u201cOther\u201d subfamily of HECT E3 ligases whose er Mcl-1 ,160,161.ucidated . Neverth) domain . The ARL) domain . Moreove) domain . N-terminal end interacts with the HECT domain, HUWE1 can either do so in a similar way or by oligomerization. The structural basis of the inhibition of HUWE1 is quite convoluted. The C-terminal domain has been found crystalized, forming an asymmetric dimer, but a small amino acid sequence before the C-terminal domain is responsible for the inhibition impairment of HUWE1. Additionally, tumor suppressor p14ARF works as a HUWE1 inhibitor by interacting with that small amino acid segment and hijacking the enzyme in the auto-inhibited dimer conformation [Interestingly, when other HECT family members present an inhibited conformation in which one of the domains in the ormation ,154,163.CRBN, cIAP1, MDM2, and CRL2VHL, as they present known ligands that can be functionalized to add the needed linker and POI ligand  a linker and a cap group (CG). The ZBG targets the catalytic zinc ion, while the linker establishes interactions with the amino acids lining the sides of the access tunnel to that ion; and, the cap group interacts with the surface of the protein . Despite\u00ae (potent and selective HDAC6 inhibitor [\u00ae (pan-HDACi) [\u00ae-based PROTAC  of 7.1 nM in MM.1S cells [However, despite the amount of described HDACis, only a few have been used as POI ligands in the design of HDAC targeted PROTACs: Nexturastat Anhibitor ), Crebinn-HDACi) , CI-994,n-HDACi) . The desn-HDACi) ,75,168, n-HDACi) ,168. Addn-HDACi) . A similbstrates . As a re50 of 42 nM [Selective, long-lasting, but reversible HDAC3 dose-dependent degradation was achieved by PROTAC V  in MDA-Mof 42 nM ,75. Inteof 42 nM . PROTAC It is noteworthy to highlight that, in the attempt to design a cIAP1-based HDAC directed PROTAC using SAHA as HDAC binding moiety, and bestatin as E3-ligase recruiter, instead of achieving PROTAC degradation, the resulting compounds proved to be strong dual inhibitors. Bestatin is also an approved AminoPeptidase N (APN) inhibitor, and the resulting hybrid molecules showed a greater inhibitory activity against APN than bestatin. Moreover, the inhibitory activity against HDACs 1, 6, and 8 of the hybrids was better than that of SAHA. Decreased HDAC protein levels were found in cellular assays, but this depletion was not due to the PROTAC effect of the hybrid molecules, and was similar to that found when using SAHA .VHL, the length of the PROTAC linker should be longer than if the ligase is CRL4CRBN [Selective HDAC inhibition has become a popular topic in drug discovery, as HDACs are implicated in the development of many types of cancer, diabetes, and inflammatory, neurodegenerative, and cardiovascular diseases. In recent years, many researchers have attempted to address this challenge by the design and synthesis of HDAC-directed PROTACs. The PROTAC strategy requires less selectivity and/or potency to produce HDAC degradation than classical inhibitors. PROTAC I  can induCRL4CRBN . In addiCRL4CRBN . In factCRL4CRBN .This review has attempted to shed light onto the structure of the different E3 ligases that naturally control the HDAC protein levels in the cell, in order to pave the way for the design and synthesis of new HDAC-directed PROTACs.https://pubmed.ncbi.nlm.nih.gov, last accessed on 8 September 2021, Web of Science , or Scopus . The structural information of the different E3 ligases was obtained from the Protein Data Bank  and UniProt .The bibliographic search was carried out using the Google and Google Scholar search engines combined with different databases such as PubMed . The 3D images of the proteins were created using PyMOL , and all of the chemical structures were drawn using ChemDraw 19 (www.perkinelmer.com).The schematic representations were created using BioRender ."}
+{"text": "Clostridium perfringens enterotoxin (CPE)-mediated oncoleaking. This is achieved by CPE suicide gene therapy to treat PC, which overexpresses the claudin-3 and -4 (Cldn3/4) tight junction proteins, which are targets of CPE action. This targeted gene therapy causes rapid eradication of Cldn3/4 overexpressing PC cells via oncoleaking and initiation of apoptotic/necrotic signaling. We demonstrate efficacy of this approach in vitro and after nonviral in vivo gene transfer in cell lines and in patient derived xenograft PC models. This therapy approach has translational potential for treatment of pancreas carcinomas and could also be translated into new combination settings with conventional chemotherapy.Current therapies for pancreas carcinoma (PC) are of limited efficacy due to tumor aggressiveness and therapy resistance. Bacterial toxins with pore-forming (oncoleaking) potential are promising tools in cancer therapy. We have developed a novel, suicide gene therapy treatment, based on Clostridium perfringens enterotoxin (CPE), is a pore-forming (oncoleaking) toxin, which binds to claudin-3 and -4 (Cldn3/4) causing selective cytotoxicity. Cldn3/4 are highly upregulated in PC and represent an effective target for oncoleaking therapy. We utilized a translation-optimized CPE vector (optCPE) for new suicide approach of PC in vitro and in cell lines (CDX) and patient-derived pancreatic cancer xenografts (PDX) in vivo. The study demonstrates selective toxicity in Cldn3/4 overexpressing PC cells by optCPE gene transfer, mediated by pore formation, activation of apoptotic/necrotic signaling in vitro, induction of necrosis and of bystander tumor cell killing in vivo. The optCPE non-viral intratumoral in vivo jet-injection gene therapy shows targeted antitumoral efficacy in different CDX and PDX PC models, leading to reduced tumor viability and induction of tumor necrosis, which is further enhanced if combined with chemotherapy. This selective oncoleaking suicide gene therapy improves therapeutic efficacy in pancreas carcinoma and will be of value for better local control, particularly of unresectable or therapy refractory PC.Pancreatic cancer (PC) is one of the most lethal cancers worldwide, associated with poor prognosis and restricted therapeutic options.  Pancreatic cancer (PC) is one of the leading causes of cancer death in developed countries and one of the most lethal malignancies worldwide ,2. PC haClostridium perfringens enterotoxin (CPE) as well as their encoding gene sequences translated into toxin-based cancer therapy [Apart from all the established treatment modalities, gene therapy might be an alternative for an effective PC therapy. In particular, suicide gene therapy with use of bacterial toxins is attractive. Bacterial toxins are produced and released by bacteria affecting different targets in host cells. An increasing number of in vitro and in vivo studies using different bacterial toxins demonstrate efficacy in cancer cell killing . During  therapy ,12,13,14Clostridium perfringens [2+ influx and consequently to necrotic cell death. Low CPE concentration, however, results in low pore numbers, rather leading to apoptotic cell death [CPE is of particular interest, since it allows effective and targeted attack of cancer cells. The toxin is produced by the Gram-positive, anaerobic bacterium fringens . This prfringens ,17 and tfringens ,19,20,21ll death .Numerous reports showed that compared to normal tissues, particularly epithelial cancers, such as pancreatic, colon, ovarian, breast and prostate cancer possess high Cldn3/4 expression and dysregulation ,24,25. BFor comprehensive and detailed description of all methods see 2. The identity of all cell lines was confirmed by STR-genotyping .Human pancreas carcinoma AsP-1, BxPC-3, Capan-1 and Sk-Mel-5 melanoma cells were grown in RPMI medium , 10% FCS . The human pancreas carcinoma HUP-T3, MIA PaCa-2, PA-TU-8902 and human colon carcinoma HT-29 cells were grown in DMEM (Gibco), 10% FCS (Biochrom). All lines were kept at 37 \u00b0C, 5% COFor in vivo studies, 21 pancreas carcinoma PDX models of stage IV , were used .Total RNA was isolated using GeneMatrix Universal RNA Purification Kit EURx  and reverse transcribed. Quantitative real-time PCR (qPCR) was performed with SYBR GREEN in the LightCycler 480 . They following primers were used for claudin-3: forward 5\u2032-CTGCTCTGCTGCTCGTGTCC-3\u2032; reverse 5\u2032-TTAGACGTAGTCCTTGCGGTCGTAG-3\u2032; for claudin-4: forward 5\u2032-CCTCTGCCAGACCCATATAA-3\u2032; reverse 5\u2032-CACCGTGAGTCAGGAGATAA-3\u2032; for RNA polymerase II: forward 5\u2032-GCACCACGTCCAATGACA T-3\u2032, reverse 5\u2032-GTGCGGCTGCTTCCATAA-3\u2032. Normalization was done with the housekeeping gene glucose-6-phosphate dehydrogenase (G6PDH) using the hG6PDH Roche Kit (Roche Diagnostics). Primers used for G6PDH: forward 5\u2032-GAAGATGGTGATGGGATTTC-3\u2032, reverse 5\u2032-GAAGGTGAAGGTCGGAGT-3\u2032.2O). For isolation of membrane, cytosolic and nuclear fractions the Cell Fractionation kit  was used. Lysates were electrophoresed in 10% precast NuPAGE gels  and transferred to nitrocellulose membranes. Membranes were blocked for 1 h at room temperature in TBS  and washed in TBST (0.05% Tween 20 in PBS). Western blot was performed with primary rabbit anti-claudin-3 antibody , rabbit anti-claudin-4 antibody (Acris), rabbit polyclonal anti-CPE , mouse monoclonal anti-\u03b2-tubulin  or mouse monoclonal anti-\u03b2-actin antibody . As secondary HRP-labeled goat anti-rabbit-IgG antibody , HRP-labeled goat anti-mouse-IgG antibody  or goat anti-mouse IgM/IgG  was added. Detection was done using ECL solution  and exposure to Kodak X-Omat AR film .Cells or tissue cryosections were lysed in RIPA buffer  and the pcDNA3-CPE-GFP (CPE-GFP) plasmids were used ,30. Prep5\u20135 \u00d7 105 cells/well were seeded in 6-well plates and after 24 h transfected with respective plasmid DNA plus transfection reagent  according to manufacturer\u2019s instruction. After 12\u201372 h, cells were washed with PBS and RNA or protein was isolated.For transfection experiments, the pCpG-optCPE (optCPE) or the pCpG-mcsG2 empty vector control (VC) plasmid  was used. A mutated optCPE construct unable to bind Cldn3/4 . Cells were washed with PBS 48 h or 72 h post transfection and RNA and protein was isolated.Knockdown of Cldn3/4 was done with pools of three different iBONi short interfering RNAs (siRNA) for Cldn3 or 4. For siRNA knockdown, 3 \u00d7 103\u20134 \u00d7 105 cells were seeded into 96-well plates and 24 h later 0, 50, 100, 150 ng mL\u22121 recCPE was added and incubated for 72 h. For determination of toxicity of released CPE in supernatants of transfected cells, 6 \u00d7 103 non-transfected cells were seeded into 96-well plates. After 24 h, 100 \u00b5L of supernatants from optCPE-transfected cells were added to respective non-transfected cells and incubated for 72 h. For all cytotoxicity assays, 5 mg mL\u22121 MTT -2,5-diphenyltetrazolium bromide; Sigma) was added 72 h after CPE incubation. Absorbance was measured in triplicates at 560 nm in a microplate reader  and values are expressed as percentage of untreated controls.MTT assay was used to test cytotoxicity of recombinant CPE (recCPE) or of optCPE transfection and to test cytotoxicity of released CPE from transfected cells. For sensitivity testing of cell lines towards recCPE 6 \u00d7 10Clostridium perfringens enterotoxin ELISA  was performed. For this, 4 \u00d7 105 cells were seeded into 6-well plates and transfected with pCpG-optCPE or pCpG-mscG2 plasmid-DNA. Recombinant CPE was used as standard at serial dilutions of 0.4\u201325 ng CPE mL\u22121. Measurements were done in duplicates at 450 nm in the microplate reader (Tecan) and values are expressed as percentage of untreated controls.For quantification of CPE in supernatants 24 h or 48 h after transfection, Ridascreen 5 cells were seeded into 4-well chamber slides and after 24 h washed with PBS, fixed in 4% paraformaldehyde  in PBS for 15 min, permeabilized with 0.5% Triton-X in PBS for 10 min and blocked with 1% IgG-free albumin  and 0.05% Tween-20 in PBS for 1 h. Rabbit anti-human Cldn3 or anti-human Cldn4 antibody (Acris) was added as primary antibody, cells were washed with TBST, then incubated with HRP-conjugated goat anti-rabbit IgG antibody , washed again and incubated with diamino-benzidine . Cells were then washed in ddH2O, counterstained with hemalum (Roth) and evaluated in a light microscope .For immunohistochemistry, 2 \u00d7 105 cells were seeded onto cover slips , washed, fixed in 4% PFA, quenched with 0.1 M glycine for 20 min and blocked with 1% serum-free albumin, 0.05% Tween-20 for 1 h. The respective primary goat anti-claudin-3 rabbit polyclonal IgG , goat anti-claudin-4 rabbit polyclonal IgG  anti-CPE rabbit polyclonal IgG, (BioRad) was added, cells were washed with TBST and incubated with secondary antibody . Nuclei were stained with DAPI (Sigma-Aldrich), counterstained with Alexa 555-phalloidin (Thermo Fisher Scientific) and evaluated in a confocal fluorescence microscope (Zeiss).For immunofluorescence, 2 \u00d7 102O2 for 10 min, washed with PBS, permeabilized by 0.2% Triton X-100 and blocked with 1% IgG-free albumin and 0.05% Tween-20 for 1 h. Steps for staining are similar to aforementioned procedure.For analysis of Cldn3/4 expression or CPE expression after gene transfer in the PDX tumors, 3\u20135 \u03bcm thick paraffin embedded (FFPE) tumor sections were deparaffinized, fixed with 4% PFA, quenched with 0.1 M glycine for 20 min, incubated with 3% H6 cells or pieces of approximately 3 \u00d7 3 mm in size of patient derived pancreas cancer PDX tissue were inoculated into the left flank of female NMRI: nu/nu mice . Animals were randomized at tumor volume of 0.3 cm3 and intratumoral non-viral in vivo jet injection gene transfer  was performed in anesthetized animals [\u22121 PBS in 10 \u00b5L injection volume). Tumor volumes (TV) were measured at indicated time points and calculated using the formula: TV = (width2 \u00d7 length)/2. Animals were sacrificed and tumors were harvested for further analysis. Body weights, clinical signs and behavior were recorded for all mice twice a week. All experiments were performed in accordance with the UKCCCR guidelines and approved by local authorities .For establishment of subcutaneous tumors, 1 \u00d7 10 animals . For thit-test and one way-ANOVA test were used. For the statistical analyses of in vivo experiments the non-parametric, unpaired t-test was used. Error values for the in vitro experiments are S.D. and for in vivo experiments S.E.M.For statistical analyses of the in vitro experiments the Student\u2019s Prerequisite for targeted antitumoral oncoleaking activity of CPE is presence of high affinity CPE receptors, such as Cldn3/4, as the CPE-mediated cytotoxicity requires their accessibility. This was analyzed in a panel of human PC cell lines at mRNA and protein level. By this, Capan-1, PA-TU-8902, AsPc-1 and the positive control human colon cancer HT-29 control cells showed high Cldn3/4 mRNA levels, whereas moderate levels of Cldn3/4 were detected in MIA\u2009PaCa-2 and HUP-T3 cells A. BxPC-3\u22121 were applied for 72 h and cytotoxicity was measured (p = 0.0001) dose dependent sensitivity toward recCPE. Despite high Cldn3/4 expression level, PA-TU-8902 cells showed comparatively low sensitivity toward recCPE, since the highest concentration reduced cell viability only to 60% (p = 0.0019). By contrast, in BxPC-3 and MIA PaCa-2 cells with low Cldn3/4 expression, higher cytotoxicity was measured. In these cells viability was significantly (p = 0.0001) reduced to 40% or 32% compared to control, respectively. However, Cldn3/4 negative cell line SK-MEL-5 was insensitive towards the toxin. RNAi-mediated downregulation of Cldn3/4 expression in MIA PaCa-2 and HUP-T3 cells transfected with siCldn3 and siCldn4 or siCtrl, abolished sensitivity toward recCPE (For sensitivity testing of Cldn3/4 expressing pancreatic cancer cell lines toward recombinant CPE (recCPE) protein, increasing recCPE concentrations from 0 to 250 ng mLmeasured D. High Cd recCPE . All thiTo evaluate antitumoral efficacy of CPE gene transfer, first presence and expression kinetic for CPE was analyzed. After gene transfer, the immune fluorescence in Capan-1, HUP-T3 and PA-TU-8902 cells showed strong cytoplasmic staining for CPE A. Furthep < 0.001; To further prove selectivity of CPE cell killing, RNAi experiments were performed for specific downregulation of Cldn3/4 expression. MIA PaCa-2 and HUP-T3 cells were transfected with a pool of siCldn3 and siCldn4 or siCtrl, respectively D. The do2+ influx due to pore formation, activation of caspase-3 and binding of Annexin-V to apoptotic cells. Furthermore, lactate dehydrogenase (LDH) release and calpain activation was determined.For the improved and more effective use of the pore-forming toxin, the mode of cell death by CPE gene therapy was of interest. We determined timely activation of apoptotic or necrotic pathways in optCPE-transfected pancreatic cancer cells by live cell imaging for apoptotic signaling, CaThe first indication for optCPE action is uncontrolled calcium influx. In MIA PaCa-2 and PA-TU-8902 cells optCPE gene transfer induced rapid calcium influx indicating rapid pore formation between 8 and 14 h after gene transfer, although to different extents in the two lines  induced strong cytotoxicity. The lower toxin amount, released by MIA PaCa-2 cells  resulted in lower cytotoxicity.The transfection experiments revealed much higher optCPE toxicity than anticipated by transfection rates of 10\u201365% of the human PC cell lines. This suggests that non-transfected cells are potentially affected by a bystander effect of released optCPE. To prove this, supernatants of optCPE-transfected cells were examined. First, we analyzed cytotoxicity of the supernatants released 24 h, 48 h and 72 h after optCPE transfection of PA-TU-8902 and MIA PaCa-2 pancreas cancer cells A. By thi\u22121 in supernatant of transfected MIA PaCa-2 and PA-TU-8902 cells and 242.6 and 344.5 ng mL\u22121 CPE in exosomes, respectively  and tetraspanin CD63 in the Western blot B. Both, ectively C. This s\u22121 at 24 h to 290 ng mL\u22121 optCPE after 96 h (\u22121 optCPE), which decreased over time to 2\u201314 ng mL\u22121 optCPE  and tumor volume (p < 0.0001) compared to vector control (VC) treated mice  or VC (p = 0.0003)-transfected tumors (p < 0.00001) and mutCPE (p = 0.0004)-transfected tumors. The mutCPE-mediated effects were not different from the VC-transfected group. This validates the strict Cldn3/4 selectivity of optCPE cytotoxicity after intratumoral in vivo gene transfer as important feature for targeted gene therapy.To address selectivity of in vivo optCPE action, an expression plasmid with mutated optCPE  or VC (p = 0.0009)-transfected tumors. This was particularly seen in areas, with close vicinity to necrotic areas, which could partially be explained by the optCPE-mediated bystander effect  compared to VC-transfected tumors (p = 0.014) compared to VC treated tumors (p = 0.0015), particularly for areas in close vicinity to necrosis (p = 0.0002) compared to VC treated control tumors  was significantly reduced in these tumors compared to VC  is one of the most lethal solid malignancies worldwide . DespiteClostridium perfringens enterotoxin; CPE) revealed their capability for effective cell killing [An increasing number of in vitro and in vivo studies, which use bacterial toxins for cancer treatment (e.g., diphtheria toxin, streptolysin O or  killing ,14. The  killing ,39. The  killing . Elevate killing ,44,45,46 killing . This is killing ,47,48,49Structure-based mutagenesis enabled design of CPE mutants that also target claudins such as Cldn1 or -5 that are not high affinity receptors for CPE wildtype. Local injection of these recombinant CPE mutants strongly reduced growth of Cldn1-expressing thyroid tumors in CDX models . CPE mut2+ influx, activation of caspases and calpain. This suggests, that CPE gene transfer induces different cell death mechanisms, known as \u201capoptosis-necrosis continuum\u201d [2+ influx [Here we focused on the mechanisms mediated by CPE gene transfer for suicide gene therapy. Our analyses revealed that CPE gene transfer induced rapid fragmentation of nuclei, massive cell swelling, membrane blebbing and formation of membrane vesicles, release of LDH, increased Cantinuum\u201d , which a+ influx ,51, whic+ influx ,52,53. D+ influx ,30. Our For efficient cell killing the bystander effect is supportive in gene therapy. Our immunofluorescence analysis in optCPE-transfected cells revealed vesicle like accumulations as indication for exocytosis. Further, membrane budding was observed, representing a key step in vesicular transport, multivesicular body and exosome formation. Indeed, we showed that CPE is released from cells and is also liberated via exosomes after CPE gene transfer and is acting on neighboring cancer cells. The recent study of Shrestha and colleagues also confirmed a bystander killing mechanism of native and recombinant CPE protein . They deOur study evaluated the anticancer potential of CPE gene therapy in different luciferase-expressing CDX and PDX models. Such locally applied toxin-based gene therapy has been successfully tested for diphtheria toxin in human PSA positive prostate xenograft tumors . In our In this study, we also evaluated the potential of CPE gene transfer in combination with drug treatments. In this context, we determined a drug treatment-induced increase of Cldn3/4 expression. Due to this unexpected result, we performed combination studies with gemcitabine and CPE gene transfer, which demonstrated a synergistic effect of this combination. This implied that gemcitabine can induce Cldn expression, which in turn leads to an improved target availability for CPE gene therapy as a basis for new combination approaches in PC therapy.In summary we established the efficient use of oncoleaking optCPE suicidal gene therapy in vitro, and more importantly, in subcutaneous and orthotopic human pancreatic cancer CDX and PDX models in vivo. The study emphasizes the great potential of this novel strategy, as it is selective for therapy of pancreas carcinoma."}
+{"text": "However, the role of SM22\u03b1 in VSMC apoptosis is controversial. Here, we identified that SM22\u03b1 loss contributed to apoptosis of VSMCs via activation of macrophages. Firstly, deficiency of SM22\u03b1 enhanced the interaction of VSMCs with macrophages. Macrophages were retained and activated by Sm22\u03b1\u2212/\u2212 VSMCs via upregulating VCAM-1 expression. The ratio of apoptosis was increased by 1.62-fold in VSMCs treated with the conditional media (CM) from activated RAW264.7 cells, compared to that of the control CM (P < 0.01), and apoptosis of Sm22\u03b1\u2212/\u2212 VSMCs was higher than that of WT VSMCs (P < 0.001). Next, circRasGEF1B from activated macrophages was delivered into VSMCs promoting ZFP36 expression via stabilization of ZFP36 mRNA. Importantly, circRasGEF1B, as a scaffold, guided ZFP36 to preferentially bind to and decay Bcl-2 mRNA in a sequence-specific manner and triggered apoptosis of VSMCs, especially in Sm22\u03b1\u2212/\u2212 VSMCs. These findings reveal a novel mechanism by which the circRasGEF1B-ZFP36 axis mediates macrophage-induced VSMC apoptosis via decay of Bcl-2 mRNA, whereas Sm22\u03b1\u2212/\u2212 VSMCs have a higher sensitivity to apoptosis.Vascular smooth muscle cell (VSMC) apoptosis is a major defining feature of abdominal aortic aneurysm (AAA) and mainly caused by inflammatory cell infiltration. Smooth muscle (SM) 22 Vascular smooth muscle cells (VSMCs) are the main structural cells of blood vessels, and damage or death of VSMCs contributes to multiple vascular pathologies. VSMC phenotypic switching after injury is extensive and has been ascribed to the injury stimulus; in many cases, VSMC phenotypic switching is accompanied by changes in cell proliferation, cell migration, inflammation, and apoptosis. In atherosclerosis, apoptosis of VSMCs has been associated with plaque rupture and aneurysm formation, which are thought to be a result of chronic inflammation . Further\u03b1 and SM \u03b1-actin, that is a prominent feature of VSMC phenotypic switching, has been demonstrated in an advanced human abdominal aortic aneurysm (AAA) and mouse model [Sm22\u03b1\u2212/\u2212 mice develop enhanced inflammatory response and ROS production, which was involved in neointimal hyperplasia through different signaling mechanisms [Sm22\u03b1\u2212/\u2212 VSMCs have transited to an inflammatory phenotype; however, it is not clear if the modulated VSMCs signal to induce apoptosis. A more recent study using AAV carrying SM22\u03b1 siRNA or SM22\u03b1 overexpression plasmid in Ang II-perfused \u2212/\u2212ApoE mice confirmed that the causative role of SM22\u03b1 deficiency in AAA formation occurs partly through enhancing vascular inflammation rather than increasing cell apoptosis [ApoE\u2212/\u2212 mice with AAV-mediated knockdown or overexpression of SM22\u03b1 in vivo are not enough to exclude a potential causative link between disturbed SM22\u03b1 expression and VSMC apoptosis.A decrease in VSMC marker genes, including smooth muscle (SM) 22se model , 5. Our chanisms \u20139, suggepoptosis . HoweverSm22\u03b1\u2212/\u2212 mice signaled to macrophages and displayed higher sensitivity to apoptosis induced by macrophages. Macrophage-derived circRasGEF1B reprograms VSMCs to apoptosis via directing ZFP36 to selectively bind to and decay Bcl-2 mRNA in vitro and in vivo. Our findings suggest that inflammatory VSMCs favor interacting with macrophages and the resulting activation of the circRasGEF1B-ZFP36 axis is a novel mechanism underlying macrophages inducing VSMC apoptosis.In the present study, we demonstrate that VSMCs of \u2212/\u2212Sm22\u03b1 mouse line (B6.129S6-Taglntm2(cre)Yec/J) carrying a Cre-recombinase gene inserted into the endogenous SM22\u03b1 locus was purchased from the Jackson Laboratory. All animal procedures conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health and were approved by the Institutional Animal Care and Use Committee of Hebei Medical University.The \u2212/\u2212Sm22\u03b1 VSMCs were collected at 4\u00b0C, and protease inhibitor cocktail tablet (Roche Inc.) was added to total conditioned media to prevent protein degradation. The protein concentration of each sample was determined using the Bradford assay (Bio-Rad). 200\u2009\u03bcg of protein sample was used for mass spectrometry analysis. A filter-aided sample preparation (FASP) protein digestion protocol was used for sample preparation [\u2212/\u2212Sm22\u03b1, significantly enriched proteins were identified by Gene Ontology (GO) analysis.Total serum-free media obtained from WT and paration , and reaparation . To screRaw sequencing reads are available from the Gene Expression Omnibus under GEO accession number GSE99811, and data analysis was performed as described previously . To scre\u2212/\u2212Sm22\u03b1 and WT mice were used for the experiments. Osmotic minipumps  were filled with saline or angiotensin (Ang) II  at a dosage of 1000\u2009ng/kg/min dissolved in saline. The pumps were placed into the subcutaneous space for 4 weeks. After the mice were sacrificed, the aorta was dissected free from the surrounding connective tissue. Pictures were taken with a digital camera and used to measure the outer diameter of the suprarenal aorta as described previously [Ten- to 12-week-old male eviously . Suprareeviously .\u03b1-actin  at 4\u00b0C overnight, followed by a secondary antibody before staining with the DAB Kit . Nuclei were counterstained with hematoxylin. Sections incubated with species-matched IgG alone were used as negative controls.For immunohistochemical staining, frozen sections were incubated with 3% hydrogen peroxide, followed by blocking with 3% normal blocking serum. The sections were incubated with primary antibodies against CD14  or SM For immunofluorescence staining, frozen aortic sections were incubated with antibodies against CD68 , followed by TRITC-conjugated secondary antibodies. The fluorescence signal was monitored by confocal laser scanning microscopy .\u2212/\u2212Sm22\u03b1 mice  were isolated by collagenase digestion. The isolated cells were maintained in low-glucose Dulbecco's modified Eagle's medium  containing 10% fetal bovine serum , 100\u2009U/mL penicillin, and 100\u2009\u03bcg/mL streptomycin [\u03b1-actin. Cells from passages 3 to 5 only were used for further experiments. The mouse VSMC line MOVAS was purchased from ATCC (CRL-2797) and cultured in high-glucose DMEM containing 10% FBS and 0.2\u2009mg/mL G-418. Before being treated with different stimulations, all of the VSMCs were incubated in serum-free medium for 24\u2009h. RAW264.7 cells were purchased from ATCC (TIB-71\u2122) and cultured in low-glucose DMEM containing 10% FBS, 100\u2009U/mL penicillin, and 100\u2009\u03bcg/mL streptomycin.Primary VSMCs from the aortas of WT or ptomycin , 17. The\u03b1 was cloned into pCMV-FLAG\u00ae-MAT-Tag\u2122-1 Expression Vector . The pAdeno-MCMV-HA-P2A-EGFP was used to pack green fluorescent protein- (GFP-) tagged adenovirus . The VSMCs were infected with 1010\u2009pfu/mL adenovirus for 24\u2009h, washed, maintained in serum-starved medium for 24\u2009h, and then treated with indicated stimulations.Full-length cDNA of SM22The siRNA duplexes targeting mouse circRasGEF1B (si-circRasGEF1B), ZFP36 (si-ZFP36), and scrambled siRNA (si-Con) were designed and obtained from RiboBio ; the siRNAs were transiently transfected into VSMCs using Lipofectamine\u00ae RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer's protocol.The circRasGEF1B sequence was amplified by PCR and constructed into a pLCDH-ciR vector . The different sequences of circRasGEF1B deletion mutants were synthesized and inserted into the pLCDH-ciR vector to overexpress mutant circRasGEF1B. The pLCDH empty vector and pLCDH-circRasGEF1B or pLCDH-circRasGEF1B mutants were transfected into VSMCs with the X-tremeGENE HP DNA transfection reagent  for 24\u2009h according to the manufacturer's protocol and then treated with indicated stimulations.\u03bcm pore filter (Corning). VSMCs were pre-seeded in the lower chamber. After achieving confluence, serum-starved VSMCs were stimulated by Ang II (10\u22125\u2009M) for 24\u2009h. Thereafter, RAW264.7 cells were placed in the upper chamber. After incubating for 6\u2009h, nonmigratory cells on the upper membrane surface were removed, and the cells that traversed and spread on the lower membrane surface were fixed with 4% paraformaldehyde and stained with gentian violet. By utilizing a microscope with a 40x objective, the number of migratory cells per membrane was enumerated. At least three random fields in each filter were examined. Each experiment was performed in triplicate, and migration was expressed as the mean \u00b1 SD of total cells counted per field.Macrophage migratory activity was performed using 24-well transwell plates with a 5\u2009\u22125\u2009M) or indicated treatment, and then, RAW264.7 cells  were added to each well. After 30\u2009min incubation, nonadherent cells were removed carefully by washing with cold phosphate-buffered saline (PBS). The fluorescent intensities were determined by excitation and emission at 490 and 535\u2009nm, respectively. For adenovirus-infected VSMCs, RAW264.7 cells were added to each well, and the adherent cells were counted.VSMCs plated in 96-well culture plates were stimulated with Ang II  according to the manufacturer's instructions.Apoptosis of frozen aortic sections was determined by using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Millipore), VSMC apoptosis transfected with plasmids was determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining, and the fluorescence signal was monitored by confocal laser scanning microscopy .Apoptosis of VSMCs was determined by the Annexin V-FITC/PI Apoptosis Detection Kit  according to the manufacturer's instructions, and the BD LSRFortessa\u2122 flow cytometer (BD Biosciences) was used to analyze the apoptotic index. Alternatively, using the ApopTag Red \u03b2-actin/GAPDH or U6 snRNA levels, using the 2\u2212\u0394\u0394Ct method, respectively. The sequence for each primer is listed in Supplementary Table Total RNAs were extracted using TRIzol Reagent (Life Technologies), following the manufacturer's instructions. To quantify the amount of mRNA or circRNA, cDNAs were synthesized using the M-MLV First Strand Kit (Life Technologies), and quantitative PCR was performed using SYBR Green qPCR SuperMix-UDG (Life Technologies). For microRNA, total RNA was extracted by using the QIAzol Lysis Reagent. Reverse transcription and quantitative reverse transcription PCR were performed with the miRNA Detection Kit by Sangon Biotech . Relative circRNA, mRNA, or miRNA expression was normalized to \u03b1 , anti-ICAM-1 , anti-IGFBP7 , and anti-TNC  at 4\u00b0C overnight. GAPDH  was used as an internal control. This was followed by incubation with an IRDye800\u00ae-conjugated secondary antibody  for 1\u2009h at room temperature and subsequent scanning with the Odyssey Infrared Imaging System (LI-COR Biosciences). The integrated intensity for each detected band was determined using Odyssey Imager software. Data are presented as mean \u00b1 SD from at least three independent experiments.Lysates from cells or tissues were prepared with RIPA lysis. Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred to a polyvinylidene fluoride (PVDF) membrane. Membranes were blocked with 5% nonfat dairy milk and incubated with primary antibodies against anti-VCAM-1 , anti-ZFP36 , anti-Bcl-2 , anti-Bax , anti-cleaved caspase-3 , anti-pro-caspase-3 , anti-SM22\u03bcL RNase inhibitor), and then incubated with 5\u2009\u03bcg ZPF36 primary antibody  at 4\u00b0C for 2\u2009h. 50\u2009\u03bcL Protein A/G PLUS-Agarose (Santa Cruz) was added to each sample, and the mixtures were incubated at 4\u00b0C for 4\u2009h. The pellets were washed with PBS and resuspended in 1\u2009mL TRizol Reagent (Invitrogen). The precipitated RNAs in the aqueous solution were subjected to qRT-PCR analysis to demonstrate the presence of the binding products using respective primers. The experiment was replicated at least three times.VSMCs were washed in ice-cold PBS, lysed in lysis buffer , and then incubated with 3\u2009\u03bcg biotinylated DNA oligo probes  at 4\u00b0C for 2\u2009h. A total of 50\u2009\u03bcL Dynabeads\u2122 MyOne\u2122 Streptavidin C1 magnetic beads (Invitrogen) were added to each binding reaction and further incubated at 4\u00b0C for 4\u2009h. The beads were washed briefly with lysis buffer for three times; then, the enriched proteins were identified by immunoblotting, and enriched RNAs were identified by qRT-PCR. The experiment was replicated at least three times.Eight to ten dishes of 15\u2009cm in diameter of VSMCs were used per RNA pull-down experiment. RNA pull-down assays were performed as described . BrieflyIn Situ Hybridization Kit . Hybridization was performed using fluorescence-labeled probes in hybridization buffer by incubation at 37\u00b0C for overnight. After stringent washing with SSC buffer, cell nuclei were counterstained with DAPI (Invitrogen). Images were acquired using confocal laser scanning microscopy .The VSMCs were washed in PBS, fixed in 4% paraformaldehyde for 30\u2009min, and permeabilized for 15\u2009min. For FISH, the cells were incubated using specific probes of circRasGEF1B according to user manual of the Fluorescent \u03bcg/mL ActD . Total RNA was harvested at indicated time points, and mRNA expression was detected by qRT-PCR. The half-life of ZFP36 mRNA was determined by comparing to the mRNA level before adding ActD.VSMCs overexpressed circRasGEF1B following transfecting with the plasmid for 24\u2009h. Then, de novo RNA synthesis was blocked with 10\u2009t-test for 2 independent groups or paired t-test for 2 dependent groups and the one-way analysis of variance (ANOVA) followed by the post-Bonferroni's multiple comparison test for \u22653 groups. For all statistical comparisons, a value of P < 0.05 was considered statistically significant and denoted with one, two, and three asterisks when lower than 0.05, 0.01, and 0.001, respectively.Data analysis was performed using SPSS version 16.0 or GraphPad Prism 6 software. Data are presented as the means \u00b1 SD from at least three independent experiments, and each independent experiment was repeated three times to obtain the mean. Normally distributed datasets were analyzed by the unpaired Student's \u2212/\u2212Sm22\u03b1 mice infused with Ang II compared to WT mice  of Ang II-induced \u2212/\u2212Sm22\u03b1 VSMCs .To assess a potential causative link between SM22.7 cells  and enha.7 cells . Further/\u2212 VSMCs . Rescue rophages , which drophages  and exprrophages , suggestSm22\u03b1\u2212/\u2212 VSMCs recruit and activate macrophages, we analyzed the complete secretome for the conditional media (CM) of VSMCs from wild-type (WT) and \u2212/\u2212Sm22\u03b1 mice. Putative differentially expressed proteins generated by iTRAQ were identified (1.5-fold change). Using these criteria, there were a total of 267 proteins differentially expressed between Sm22\u03b1\u2212/\u2212 and WT mice. GO biological process (BP) revealed that the molecules related to cell adhesion, TN-C, VCAM-1, and NID-2 were significantly upregulated more than 20-fold in \u2212/\u2212Sm22\u03b1 VSMCs  assay. Fluorescence-stained circRasGEF1B was observed only in the cytoplasm of VSMCs treated with the CM of activated RAW264.7 cells  . Based oIt has been reported that the ZFP36 family promotes mRNA decay via binding to the 3\u2032-UTRs of their target mRNAs with AU-rich element (ARE) to maintain appropriate target transcript and protein levels, including Bcl-2 and ZFP36 itself . As mentG values for RNA-RNA pairs by RNAup Server [G values between circRasGEF1B and Bcl-2 mRNA, compared with binding to ZFP36 mRNA  macrophage-derived circRasGEF1B reprograms VSMC apoptosis via recruiting ZFP36 to selectively bind to and decay Bcl-2 mRNA; and (3) the circRasGEF1B-ZFP36 axis is a novel pathway for communication between macrophages and VSMCs and a new mechanism by which macrophages determine VSMC fate. Thus, perhaps modulating VSMC phenotypes to a differentiated or reparative state by targeting SM22\u03b1 or circRasGEF1B reduces the harmful communication between macrophages and VSMCs and may be beneficial for therapies of aortic aneurysm and its clinical complications.In the current study, we demonstrated that poptosis . Our fin\u03b1 has been considered to be one of the hallmarks of SMC phenotypic switching [\u03b1 is vital in maintaining VSMC contractile phenotype and vascular homeostasis [\u03b1 may provide a vascular environment susceptible to inflammation and predispose the aorta to aneurismal formation [\u03b1 in VSMC apoptosis remains to be not fully studied. Herein, we found that disruption of SM22\u03b1 significantly increased the expression and secretion of VCAM-1 and led to macrophage recruitment in vivo and in vitro under Ang II treatment, which was abolished by rescued expression of SM22\u03b1 or by VCAM-1 neutralizing antibody. Decrease in SM22\u03b1 expression has been well defined in a variety of VSMC-driven vascular diseases. Our and other studies provide further evidence of the key role of SM22\u03b1 in maintaining vascular structural integrity and the pathophysiology of multiple vascular diseases not just as a biomarker of contractile SMC. Although the recent study considered that the effect of SM22\u03b1 deficiency on AAA formation was not mediated by increasing cell apoptosis [ApoE\u2212/\u2212 mouse in vivo study and ignored the effect of ApoE deficiency on VSMC apoptosis. Ang II-infused ApoE\u2212/\u2212mice, as a popular mouse model for aneurysm research, displaying vascular matrix degradation and inflammation can be far more than the changes observed in Sm22\u03b1\u2212/\u2212 mice under the same conditions, and the effect of AAV-SM22\u03b1 in vivo could be not enough to ameliorate these lesions in ApoE\u2212/\u2212mice.SM22witching , 36. Oureostasis  and is deostasis . VSMCs mormation . Howeverpoptosis , this co\u03b1 that is a proapoptotic cytokine was induced in the activated macrophages, we showed that the apoptosis of VSMCs was still higher upon treatment with the macrophage CM that was treated with the TNF-\u03b1 neutralizing antibody. In contrast, the activity of apoptosis reduced in si-circRasGEF1B-treated cells that exhibited increase in Bcl-2 expression. Thus, circRasGEF1B is a novel mediator by which macrophages induce VSMC apoptosis.Involvement of macrophages in the pathogenesis of unstable plaque and aortic aneurysm has been well defined in the past decade. Human macrophages potently induce VSMC apoptosis via direct cell-cell interactions mediated by Fas/Fas-L, promoting plaque rupture . Our preCytoplasmic mRNA decay constitutes an important posttranscriptional mechanism in mammalian cells. The regulation of cytoplasmic mRNA half-life is mediated by mRNA-binding proteins and noncoding RNAs (ncRNAs), such as microRNAs and long noncoding RNAs . The AU-There are several limitations to this study. It has been known that activated macrophages release inflammatory factors to induce VSMC apoptosis via the membrane receptor pathway. Now, it is unknown how macrophage-derived circRasGEF1B and proapoptosis factor-activated pathways interact and converge to regulate Bcl-2 mRNA stability in VSMCs. Is it the same in macrophages? It is necessary to further investigate the crosstalking between this apoptosis pathway and other functions of circRasGEF1B.\u2212/\u2212Sm22\u03b1 VSMCs favor interacting with macrophages and the resulting activation of the circRasGEF1B-ZFP36 axis is a novel mechanism underlying macrophages inducing VSMC apoptosis.In summary, we provide evidence that"}
+{"text": "Background: Tumor stemness is the stem-like phenotype of cancer cells, as a hallmark for multiple processes in the development of hepatocellular carcinoma (HCC). However, comprehensive functions of the regulators of tumor cell\u2019s stemness in HCC remain unclear.Methods: Gene expression data and clinical information of HCC samples were downloaded from The Cancer Genome Atlas (TCGA) dataset as the training set, and three validation datasets were derived from Gene Expression Omnibus (GEO) and International Cancer Genome Consortium (ICGC). Patients were dichotomized according to median mRNA expression\u2013based stemness index (mRNAsi) scores, and differentially expressed genes were further screened out. Functional enrichment analysis of these DEGs was performed to identify candidate extracellular matrix (ECM)\u2013related genes in key pathways. A prognostic signature was constructed by applying least absolute shrinkage and selection operator (LASSO) to the candidate ECM genes. The Kaplan\u2013Meier curve and receiver operating characteristic (ROC) curve were used to evaluate the prognostic value of the signature. Correlations between signatures and genomic profiles, tumor immune microenvironment, and treatment response were also explored using multiple bioinformatic methods.Results: A prognostic prediction signature was established based on 10 ECM genes, including TRAPPC4, RSU1, ILK, LAMA1, LAMB1, FLNC, ITGAV, AGRN, ARHGEF6, and LIMS2, which could effectively distinguish patients with different outcomes in the training and validation sets, showing a good prognostic prediction ability. Across different clinicopathological parameter stratifications, the ECMs signature still retains its robust efficacy in discriminating patient with different outcomes. Based on the risk score, vascular invasion, \u03b1-fetoprotein (AFP), T stage, and N stage, we further constructed a nomogram , which is more practical for clinical prognostic risk stratification. The infiltration abundance of macrophages M0, mast cells, and Treg cells was significantly higher in the high-risk group, which also had upregulated levels of immune checkpoints PD-1 and CTLA-4. More importantly, the ECMs signature was able to distinguish patients with superior responses to immunotherapy, transarterial chemoembolization, and sorafenib.Conclusion: In this study, we constructed an ECM signature, which is an independent prognostic biomarker for HCC patients and has a potential guiding role in treatment selection. Liver cancer (LC) is one of the most prevalent tumors in the world, ranking as the sixth most common cancer and the third cause of cancer-related deaths worldwide . The WorCancer stem cells (CSCs) are a small group of undifferentiated cells in tumor tissue and can induce unlimited self-renewal of heterogeneous tumor cells . A previIn this study, we developed a novel ECM-related signature for predicting the prognosis of HCC using data from the TCGA database. Then we validated its prognostic prediction capacity using data from the GEO database and evaluated its correlation with clinicopathological features, genetic alterations, immune microenvironment, and therapeutic response. This signature is expected to provide potential guidance for personalized treatment of HCC patients.A schematic workflow of this study is present in https://portal.gdc.cancer.gov/). GSE54236 with 161 samples and ICGC-LIRI-JP with 260 samples were retrieved from the GEO (https://www.ncbi.nlm.nih.gov/geo/) or ICGC (https://dcc.icgc.org/) as independent validation datasets. In addition, transcriptome data and calculated tumor volume doubling times of the GSE54236 cohort were used to explore the relationship between the risk score and rapid tumor growth. The tumor volume doubling time was calculated based on imaging data (https://www.proteinatlas.org/).In total, 355 patients with expression data of HCC were obtained from the TCGA database | > 1 as the DEG. Next, we performed a gene set enrichment analysis (GSEA) on the DEGs using GSEA software  and selected key pathways, and genes contained in key pathways were selected as candidate ones.After classifying TCGA HCC patients into two groups based on the median mRNAsi score, the differences in OS and DFS were analyzed by using the \u201csurvminer\u201d R package (v.4.0.3). We compared the gene expression feature of the two groups and selected genes with a false discovery rate (FDR) < 0.05 and |logrisk score =\u03a3 Coefficient (ECMs i) * Expression (ECMs i). Coefficient of gene (i) is the regression coefficient of gene (i) in the LASSO\u2013Cox regression model and Expression of gene (i) is the expression value of gene (i) for each patient.First, we used the LASSO analysis to screen variables from high dimensional data to construct an ECM signature , and theWe divided the HCC patients into high- and low-risk groups based on the median risk score and utilized the Kaplan\u2013Meier (K-M) analysis to compare the survival differences between different risk groups; the prognostic capability of ECMs was then measured by the area under the curve (AUC) of a time-dependent receiver operating characteristic (ROC). Last, we utilized datasets from the validation cohorts to confirm this prognostic prediction capacity.We analyzed the relationship between the risk score and the clinical features of HCC including AFP, vascular invasion, primary tumor (T) stage, regional lymph nodes (N) stage, and distant metastasis (M) stage. To evaluate the stability of the robustness and accuracy of prognostic models, we compared the survival difference between high- and low-risk groups under clinical characteristic stratification.We explored the correlation and independence of ECMs signature and clinical characteristics using a multivariate Cox risk regression analysis. In order to be applicable to the clinic, we integrated the risk score with vascular invasion, AFP, T stage, and N stage to construct a nomogram using the \u201crms\u201d R package. The prognostic predictive ability of nomogram was evaluated by the calibration curve and time-dependent ROC curves. The ROC curves were plotted by using the \u201ctimeROC\u201d R package. The survival net benefits of each variable were estimated by a decision curve analysis (DCA) using the \u201cstdca\u201d R package.https://reactome.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway (https://www.genome.jp/kegg/) analyses were performed by using the \u201cclusterProfiler\u201d R package.To explore biological processes related to the risk score, Reactome pathway (http://tide.dfci.harvard.edu/)  . Patientrd.edu/) .https://asia.ensembl.org/info/genome/variation/prediction/predicted_data.html) database. Subsequently, the data were read and the TMB values were calculated using the \u2018\u2018maftools\u2019\u2019 R package.Genetic mutation data were analyzed and visualized by using the \u2018\u2018maftools\u2019\u2019 R package. We compared the differences of somatic variants in most prevalent mutated genes between high- and low-risk groups. The copy number variant (CNV) data were downloaded from the Affymetrix Genome-Wide Human SNP Array 6.0 platform using the \u201cTCGAbiolinks\u201d package, and abnormal chromosomal regions were detected using the \u201cR/Bioconductor GAIA\u201d package . Non-synhttps://www.cancerrxgene.org/) for analysis. The half-maximal inhibitory concentration (IC50) is an important indicator for evaluating drug efficacy or sample response to treatment. The GDSC database helps in predicting each sample\u2019s response to targeted therapy or chemotherapy based on the sample\u2019s transcriptome. According to the cellular expression profiles in the GDSC database, a ridge regression model was constructed with the \u201cpRRopheticl\u201d R package to calculate the IC50 of the drugs in the two risk groups. Transcriptome data and treatment response information from the GSE104580 cohort were used to test the effectiveness of signature in discriminating TACE treatment responders from non-responders. Transcriptome data and treatment response information from the IMvigor210 cohort were used to examine the effectiveness of the signature in identifying complete/partial responses (CR/PR) or stable/progressive disease (SD/PD) with immunotherapy.In total, four classic drugs were selected from the Genomics of Drug Sensitivity in Cancer (GDSC) database . We used Fisher\u2019s test to compare the categorical variables and the K-M curve to evaluate the differences in survival between different risk groups. The results of the multivariate Cox regression analysis were visualized using the nomogram. The concordance index, time-dependent ROC, and calibration were also important indicators used to assess the nomogram. All tests were two-sided, and p = 0.002; p = 0.0021; p < 0.05, p < 0.05, p < 0.001; According to the median mRNAsi score, we dichotomized HCC patients in the training set into mRNAsi-high and mRNAsi-low groups and identified that HCC patients with high mRNAsi had both significantly shorter OS  to construct a prognostic prediction model  and ARHGEF6  were related to a significantly superior OS; on the contrary, the upregulation of RSU1 was significantly associated with a worse survival  + (\u22120.008 * ExpARHGEF6) + (0.002 * ExpAGRN) + (0.004 * ExpITGAV) + (0.005 * ExpFLNC) + (0.007 * ExpLAMB1) + (0.015 * ExpLAMA1) + (0.043 * ExpILK) + (0.131 * ExpRSU1) + (0.132 * ExpTRAPPC4).Risk score= . In addition, the risk score was significantly higher in the HCC patients presented with macro-vascular invasion, followed by those with micro-vascular invasion  and/or M0  or not (T1+T2), patients in the high-risk group had significantly worse OS . Meanwhip < 0.001; HR = 1.96, 95% CI = 1.17\u20133.3, and p = 0.01; To better predict the 1-, 3-, and 5-year survival of HCC patients, we constructed a nomogram combining the risk score, vascular invasion, AFP, T stage, and N stage. The C-index of nomogram was 0.70 (95% CI: 0.63\u20130.77) . Meanwhip < 0.05, p < 0.05, We performed a pathway enrichment analysis using DEGs between high- and low-risk groups in the TCGA-LIHC cohort to explore the biological processes associated with the risk scores. A Reactome pathway enrichment results showed that DEGs were significantly enriched in the cell cycle and metabolism-related pathways, such as cell cycle checkpoints, cell cycle mitosis, DNA replication, fatty acid metabolism, and peroxisome lipid metabolism pathways (+ memory T cells, resting NK cells, monocytes, macrophage M1, activated myeloid dendritic cells, and activated mast cells (p < 0.0001, p = 0.031; p = 0.026; p = 0.03, We evaluated the tumor-infiltrated immune cell contents and immune checkpoint profile and predicted immunotherapy responses in different risk groups. In total, the high-risk group had a significantly higher abundance of macrophage M0, resting mast cells, and Treg cells and lower abundance of activated CD4st cells . Common st cells  and CTLAst cells  were sigst cells . In addist cells . In addiTP53, MYO18B, JARID2, and HUWE1 alterations in the high-risk group was significantly higher than those in the low-risk group; on the contrary, HTT, PIK3CA, and LRRC7 mutations were more enriched in the low-risk group (p < 0.01, TP53 alterations were mainly located in the P53 domain, and the high-risk group had more mutations than the low-risk group in this domain. In addition, the low-risk group had significantly high frequencies of amplifications and deletions in chromosome 11 and 13, respectively (FDR<0.01, p = 1, There are two figures presenting the top 20 frequently mutated genes in the high-risk and low-risk groups . The prep < 0.0001, p < 0.01, The results of drug sensitivity analysis indicated that the patients in the high-risk group were more sensitive to commonly used drugs such as sorafenib and cisplatin (TRAPPC4, RSU1, ILK, LAMA1, LAMB1, FLNC, ITGAV, AGRN, ARHGEF6, and LIMS2. Previous studies have demonstrated that these 10 ECM-related genes are associated with the prognosis of various types of cancer, especially HCC. In published studies, AGRN (ITGAV (FLNC (ILK (RSU1 (TRAPPC4 is expressed at low levels in HCC tissues, and HCC patients with low TRAPPC4 expression have a shorter survival time than those with high expression (LIMS2 and ARHGEF6 were expressed at lower levels in tumors than in normal tissues in our study and associated with better clinical outcomes. The dysregulation of LIMS2, also known as PINCH2, caused liver enlargement and tumorigenesis (The resistance of HCC to traditional treatments and high tumor recurrence after therapy are pivotal causes of cancer-related deaths ; among tes, AGRN , ITGAV (N (ITGAV , FLNC (QAV (FLNC , ILK (ChLNC (ILK , and RSULK (RSU1  were oveLK (RSU1 . Contrarpression . This diigenesis .Subsequently, we explored the probability of the ECM signature in clinical application. By evaluating the relationship between clinical features and the risk score, we found that ECM signature was closely associated with AFP, vascular invasion, T stage, and N stage. AFP is the most prevalent clinically applied biomarker for the detection and treatment monitor of HCC, associated with HCC differentiation . Previou+ T cells, Treg cells, macrophages M0, and myeloid dendritic cells. It has been reported that the number of Tregs in tumor tissue or peripheral blood of HCC patients is increased compared with healthy individuals (In recent years, immune-based therapies have revolutionized the systematic management of advanced cancers . The appividuals , and Treividuals . Both maividuals . They prividuals . These fividuals . Previouividuals . InteresIn conclusion, this study developed a prognostic signature composed of 10 ECM-related genes that can accurately and robustly predict the prognosis of HCC. These genes have the potential to be developed as therapeutic targets for HCC. Also, this ECMs signature has an important value for HCC in the selection of treatment."}
+{"text": "Hepatocellular carcinoma (HCC) is a serious malignant disease with high incidence, high mortality and poor prognosis. This study aimed to establish a novel signature based on apoptosis-related genes (ARGs) to predict the prognosis of HCC.Expression data of HCC from TCGA database and the list of 160 ARGs from MSigDB were downloaded. The genes included in apoptosis-related signature were selected by univariate Cox regression analysis and lasso Cox regression analysis. Subsequently, a prognostic risk model for scoring patients was developed, and then separates patients into two groups. Kaplan\u2013Meier and receiver operating characteristic analysis were performed to evaluate the prognostic value of the model in TCGA, GEO and ICGC databases. The characteristics of immune cell infiltration between two groups of HCC were investigated. Finally, a nomogram was plotted to visualize the prognosis prediction.Nine genes  were included in the prognostic risk model. Survival was lower in the high-risk group. Surprisingly, the high-risk group was significantly more in immune cell infiltration and with higher immunoscore and stromalscore than in the low-risk group. In addition, the risk score was an independent prognostic factor for HCC.Prognostic signature comprising nine ARGs could be used as a potential prognostic factor for HCC. It also provides an important idea for further understanding the immunotherapy of HCC.The online version contains supplementary material available at 10.1186/s12876-022-02481-w. Primary liver cancer is one of the six most common cancer and the third leading cause of cancer death . In patiApoptosis, also known as programmed cell death, is finely regulated at the gene level resulting in the orderly and efficient removal of damaged cells . Apoptoshttps://gdc.xenahubs.net) [TCGA mRNA-seq data and corresponding clinical data of 368 HCC patients were accessed from the UCSC Xena (ubs.net)  and usedp\u2009<\u20090.01 & |log2 (Fold Change)|>\u20091. David was employed to perform Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis (p\u2009<\u20090.05) [Based on the similarity displayed by the expression levels of ARGs, the \u201cConsensusClusterPlus\u201d package was used to classify patients with HCC into different subtypes  . Princip\u2009<\u20090.05) .In the discovery cohort, the univariate Cox regression analysis was used to screen for prognostic ARGs. Then, the LASSO Cox regression using \u201cglmnet\u201d package in R was applied to develop the ARGs prognostic signature for the HCC patients. The optimal value of the lambda penalty parameter was defined by performing 10 cross-validations. The risk score calculating formula is:i means the expression levels of each ARGs, \u03b2i is the corresponding regression coefficients [The expficients . The patficients . Univarificients . Further2 (Fold Change)|>\u20090.1 was considered as statistically significance.The ssGSEA algorithm was applied to quantify the relative infiltration levels of various immune cells in the TIME of HCC. The gene set for marking each TME infiltration immune cell type was obtained from the study of Charoentong . The immNomograms were widely used for cancer prognosis. Based on age, gender, tumor (T), node (N), metastasis (M) and risk score, a nomogram was constructed using \u201cRMS\u201d package in R. Calibration curves was used to visually predict deviations between actual and predicted survival .p value\u2009<\u20090.05 was set as statistically significant for all the analyses.All statistics were carried out using the R software (version 3.6.3). Wilcox test was used to screen for statistically differentially genes and immune cells . In KaplThe k\u2009=\u20092 had higher intra-group correlation and lower inter-group correlation Fig.\u00a0A\u2013B. ThenAll 160 ARGs were subjected to univariate Cox regression analysis. Then, 18 ARGs significantly associated with the prognosis of HCC were identified Fig.\u00a0A. LASSO To explore the biological behavior between high- and low-risk groups, we conducted ssGSEA analysis. The results indicated that high-risk group was remarkably rich in immune cell infiltration including activated CD4 T cell, activated dendritic cell and natural killer cell Fig.\u00a0E. We hypThen, we investigated the expression of chemokine and cytokine in both two groups. TGRB1, SMAD9, TWIST1, CLDN3, TGFBR2, ACTA2, COL4A1, ZEB1 and VIM were considered to be associated with the transcripts of transforming growth factor (TGF)-\u03b2/epithelial mesenchymal transformation (EMT) pathway. The results indicated that these cytokine and chemokine were significantly up-regulated in high-risk group , M (p\u2009=\u20090.025), stage (p\u2009<\u20090.001) and risk score (p\u2009<\u20090.001) were considerably associated with the OS  and risk score (p\u2009<\u20090.001) remained closely correlated with the OS  is associated with mitosis and necessary for G2/M checkpoint initiation . A case\u2013The ssGSEA algorithm was applied to quantify the relative infiltration levels of various immune cells in the TIME of HCC. The results indicated that high-risk group was remarkably rich in immune cell infiltration. Significantly higher immunescore and stromalscore were observed in the high-risk group than in the low-risk group in the ESTIMATE analysis. However, patients in the high-risk group did not show a matched survival advantage. Tumors with an immune rejection phenotype also displayed a large number of immune cells, and these immune cells stay in the stroma surrounding tumor cell nests rather than penetrating the parenchyma . The actIn order to explore the differences in biological processes between high and low risk groups, GSVA enrichment analysis was performed using \u201cGSVA\u201d R packages. The results showed that the activities of pathways associated with cell proliferation, such as cell cycle, mismatch repair and homologous recombination, etc., were significantly increased in the high-risk group. During cell cycle progression, many regulators may be closely related to the early steps of carcinogenesis . RadiatiNomogram can be used to predict disease risk or prognosis by combining multiple indicators , 46. A sHowever, this experiment also has some limitations. First, the results of this experiment are obtained based on public datasets. Therefore, a large number of clinical samples need to be collected for validation. Second, the underlying molecular mechanisms revealed by this experiment need further study.In conclusion, we constructed a prognostic signature comprising nine ARGs that could be used as a potential prognostic factor for HCC and help in clinical decision making for individualized treatment. The characteristics of TIME cell infiltration, the expression of immune checkpoint expression, and the relationship between immune cells and risk score were also analyzed, which provided important ideas for further understanding the immunotherapy for HCC.Additional file 1. Figure S1. Survival verification and comparison of prediction accuracy of risk score, cluster and AFP. (A) Comparison of survival between high and low risk groups in ICGC database. (B) The ROC curve analysis was used to analyze the 1-year prognosis prediction accuracy of risk score, cluster and AFP. (C) The ROC curve analysis was used to analyze the 3-year prognosis prediction accuracy of risk score, cluster and AFP. (D) The ROC curve analysis was used to analyze the 5-year prognosis prediction accuracy of risk score, cluster and AFP. (E) The DCA analysis was used to analyze 1-, 3- and 5-year prognosis prediction accuracy of risk score, cluster and AFP.Additional file 2. Figure S2. Correlation analysis between immune-checkpoint related gene expression, immune cells and risk score. (A) Difference in the immune-checkpoint related gene expression between low and high risk group. (B) Pearson correlation analysis between risk score and immune cells.Additional file 3. Figure S3. Univariate (A) and multivariate (B) analyses and nomograms (C) and calibration curves (D) in the ICGC database."}
+{"text": "Several limitations are expected to overshadow their use as accurate markers for age prediction. The current study was conducted to determine the influence of immunologic disorders, such as autoimmune diseases and COVID-19, on the accuracy of sjTRECs as molecular markers for age estimation and immunosenescence among living Egyptians. Peripheral blood sjTRECs level was measured by qPCR in 90 autoimmune patients, 58 COVID-19 patients, and 85 healthy controls. The mean dCt values were significantly (p = 0.0002) different between the three groups, with the highest values in healthy subjects, followed by autoimmune and COVID-19 patients. A significant negative correlation was identified between the sjTRECs levels and ages in all studied cases. There were significant positive correlations between chronological age and predicted age for healthy individuals, autoimmune, and COVID-19 patients with mean absolute deviations (MAD) of 9.40, 11.04, and 9.71, respectively. The two patients\u2019 groups exhibited early immunosenescence, which was more noticeable among the young adults with COVID-19 and autoimmune patients of age range (18\u201349 years). Autoimmunity may represent a critical factor impacting the accuracy of sjTRECs quantitation for age prediction.Signal joint T cell receptor excision circles ( Forensic age inference was primarily relied on morphological examination or radiography, and molecular methods were adopted later . Ethnic he blood . Additioimmunity .Immunosenescence is a term used to describe age related involution of the thymus and gradual reduction in T cell number and function. With immunosenescence, people become at higher risk of developing autoimmune diseases, infections, and malignancies ,6.sjTRECs. Hence, various immunologic disorders should be considered during sjTRECs\u2019 quantification. The sjTRECs concentration in the human body can be affected by the thymic functionality, as well as T cell homeostasis, in the peripheral blood [Multiple genetic, pathologic, and environmental factors are known to modulate an individual\u2019s immunologic condition, which is closely related to the levels of al blood ,8.sjTRECs as an age biomarker in healthy, as well as diseased persons of a wide age range, are also required to validate and understand the association between biological and chronological age indicated by this marker [During the search for biomarkers to estimate the chronological age independently from the biological age, the dynamics of the immune system should be considered. It is essential to assess the possible impact of different disease conditions on the process of age estimation in order to expand the approach for clinical applications ,9. Addits marker .The novel pandemic, COVID-19, has been related to significant health consequences such as those caused by systemic autoimmune diseases. Organ damage in COVID-19 has been shown to be mainly immune-mediated. Moreover, disturbance of self-tolerance to host antigens and development of autoantibodies has been detected in COVID-19 .sjTRECs gene expression level, as a molecular marker for age estimation and immunosenescence, in the peripheral blood of Egyptians with COVID-19 and different autoimmune disorders versus age/sex-matched healthy controls.Accumulating evidence from previous studies suggested that the immunologic disorders associated with acute SARS-CoV-2 infection, and the chronic autoimmune disorders, may impact the pace of ageing in these patients\u2019 groups. Thus, the current study was performed to evaluate utilizing Study Design: this comparative cross-sectional study was conducted between 2020 and 2022 on a convenient sample of 90 patients with autoimmune diseases, 58 confirmed COVID-19 patients, and 85 healthy controls. Pregnant or lactating women, and patients with chronic illnesses other than autoimmune diseases, were excluded from the study. Cases were randomly selected. A single peripheral blood sample was collected from each participant. In COVID-19 disease, an example of acute illness, the sample was collected 24 h after confirmed positive SARS-CoV-2 PCR test. In autoimmune diseases, an example of chronic illness, it was collected from previously diagnosed cases (disease duration \u2265 6 month) during follow up visits, regardless of the stage of the disease activity. The current study was approved by the Benha University Research Ethics Committee, and written informed ethical consents were obtained from the participants or their guardians before enrollment in the studyn = 35), and severe (n = 23). The severity assessment was conducted in all cases according to the Chinese Center of Disease Control (CDC) [2 > 93%; PaO2/FiO2 ratio \u2265 300 mmHg) and severe cases .Study Participants: COVID-19 patients were recruited from the Contagious Disease Control Center (CDCC), Internal Medicine and Pediatric Departments, Benha University Hospital, Egypt. All COVID-19 patients were evaluated using complete medical history taking and full clinical examination. Inclusion criteria: according to the triage protocol of the Ministry of Health and Population, a confirmed COVID-19 case is defined as a patient with COVID-19 infection that has been confirmed by PCR test, regardless of the clinical manifestations. Patients were subdivided into mild (ol (CDC) . These in = 30), RA (n = 21), psoriasis (n = 20), Behcet\u2019s Disease (BD) (n = 6), and JIA (n = 13). Inclusion criteria: patients with rheumatoid arthritis (RA) were selected using the American College of Rheumatology (ACR)/European League Against Rheumatism (EULAR) classification criteria for RA published in 2010 [Autoimmune patients were recruited from the inpatients\u2019 ward and the outpatient clinic of the Rheumatology, Rehabilitation, and Physical Medicine Department. All patients were subjected to full medical history taking, as well as general and systemic clinical examination. Patients with different autoimmune disorders include SLE . Following extraction, the DNA concentration was determined, in each sample, by a NanoDrop One Spectrophotometer .sjTRECs by qPCR peripheral sjTRECs levels was assessed by qPCR, using QuantiTect SYBR Green PCR kit , by the StepOnePlus Real-Time PCR System , according to the manufacturer\u2019s instructions. Real-time PCR was performed using 40 ng DNA in 25\u03bcL reaction volumes, containing 400 nM of each primer. PCR conditions were 95 \u00b0C for 15 min , then 94 \u00b0C for 15 sec (denaturation), 54 \u00b0C for 30 sec , and 72 \u00b0C for 20 sec (extension), for 45 cycles. Specific primer pairs were used to amplify the sjTREC (accession no. NT_026437) and TATA box Binding Protein (TBP) (accession no. NG_008165). Primer sequences were as follows: sjTREC forward: 5\u2032-CCA TGC TGA CAC CTC TGG TT-3\u2032, sjTREC reverse: 5\u2032-TCG TGA GAA CGG TGA ATG AAG-3\u2032 [TBP reverse: 5\u2032-AGCTGAAAACCCAACTTCTGT-3\u2032 [sjTRECs in each sample was determined after correction by TBP using the dCT method  [sjTRECs and TBP melting temperatures were around 83 \u00b0C and 76.5 \u00b0C, respectively. PCR reactions were conducted in duplicate for each sample, and average values were used for data analysis. Non-template controls were used in each run to ensure the absence of non-specific amplification for both genes throughout the entire work.Measuring TCTGT-3\u2032 . The lev sjTREC) . The anat-test (t) and the One-Way Analysis of Variance  to detect differences in dCt (CtTBP\u2212CtsjTREC) values between the study groups, as appropriate. The Pearson correlation coefficient (r) was used to evaluate the correlation between dCt values and chronological age. Linear prediction models of chronological age conditioned on dCt values were developed for the different groups. The correlation between predicted ages and chronological ages were tested using the Pearson correlation coefficient (r), and the mean absolute deviation (MAD) of predicted ages from chronological ages were calculated. Statistical significance was accepted at p < 0.05.Statistical analysis via the computerized statistical package STATA/SE version 11.2 for Windows , and MS Excel were used for data entry, presentation, and analysis. Descriptive statistics, mean \u00b1 standard deviation (SD), range, frequency, and percentage were used to summarize data as appropriate. The Shapiro-Wilk W test was used to examine the distribution of numerical data. Categorical data were compared using the Chi-square test and the Student\u2019s p > 0.05).p = 0.0002), with the highest values in healthy subjects, followed by autoimmune and COVID-19 patients , as demonstrated in 2: Chi-square test; F: One Way Analysis of Variance (ANOVA)).There were significant differences in the mean dCt values between the three groups (p < 0.001). There were significant differences in dCt values between healthy individuals, autoimmune patients, and COVID-19 patients for those aged 18\u201334 and 35\u201349 years . There were no significant differences in dCt values between male and female subjects, except for autoimmune patients (p = 0.03).Comparisons of dCt (CtTBP\u2212CtsjTREC) values between the studied healthy individuals, autoimmune patients, and COVID-19 patients of different gender and age group are shown in p = 0.20). Similarly, patients with active autoimmune diseases showed non-significant lower dCt values  when compared to inactive cases, as shown in The average dCt values were lower in patients with severe COVID-19 compared to mild disease. However, the difference was not statistically significant . Significant moderate negative correlations were detected in patients with both active and inactive autoimmune diseases . The correlation between chronological age and dCt values was negative, and high correlation was observed in patients with mild and severe COVID-19 .2) value ranged from 0.26 in autoimmune patients to 0.61 and 0.64 for healthy individuals and COVID-19 patients, respectively.p < 0.001; MAD = 8.79) and severe disease .Correlations between chronological age (in years) and predicted age (in years) in the different study groups are shown in sjTRECs dCt values between RA, SLE, and healthy individuals revealed that there were significant differences as regards age groups (p < 0.001). Additionally, significant differences in dCt values were noticed between healthy individuals and RA and SLE patients, with the highest values in healthy individuals and the least values in RA patients . Data are shown in Comparisons of the age, sex distribution, and the sjTRECs levels with laboratory data of autoimmune patients was studied, and a significant negative correlation between dCt values and anti dsDNA  was detected. Disease duration in patients with autoimmune disorders ranges between six months and 16 years. Insignificant correlation (p = 0.17) was found between dCt values and the autoimmune disease duration, as seen in The correlation of Age markers can be evaluated by looking at how they react to different diseases and environmental conditions that might impair the accuracy of calendar age prediction. In prediction models intended to estimate chronological age, it is not recommended to use such markers, which are altered by the environment sjTRECs expression was significantly decreased due to age progression across the older age groups in cases and controls (p < 0.001). Data from a previous report [Our study population  has been categorized into four age groups . Such stratification revealed that s report  supportesjTRECs levels between the three studied subadults\u2019 groups < 18 years (p = 0.93). The ability of the thymus to replace the apoptotic T lymphocytes is not consistent across the older patients. In children, the effective thymic activity and T cell functions defend them against viral infections, autoimmune disorders, and malignancies. They also play critical roles in SARS-CoV-2 pathogenesis. It was hypothesized that the thymus\u2019s and T cells\u2019 functions defend the children from the SARS-CoV-2 effects [In the current study, all the sub-adults with autoimmune diseases were diagnosed as JIA patients. It was previously reported that the thymic function in children with JIA is equivalent to that of the healthy control children . A findi effects .The latest three coronavirus epidemics were reported with an increased mortality in adults, but, SARS-CoV and MERS-CoV have not caused deaths in infected children, and it was concluded that children usually presented with mild coronavirus infections, including SARS-CoV-2 infection .sjTRECs in young adults and middle age groups with autoimmune disorders and COVID 19 were found to be highly significantly lower than the corresponding control groups . This can be explained by different studies on adults with autoimmune disorders that revealed a reduction in sjTRECs counts, suggesting that the disturbances in sjTRECs dynamics represent a pivotal component in autoimmune disease pathophysiology [The dCT levels of ysiology ,30,31. Oysiology .sjTRECs level when compared to the age matched control group, a relationship which was only significant among the young adults. Such a result may be explained by the peripheral lymphopenia reported in the peripheral circulation of COVID-19 patients [Notably, COVID-19 patients \u2265 18 years included in our study showed reduced patients . Recent patients  and redupatients . Periphepatients . Yet, a patients .sjTRECs levels were nearly matching each other\u2019s in the three groups (cases and control) (p = 0.88). Immunosenescence due to the ageing process may explain the extreme reduction in the thymic function that results in very low sjTRECs level at older age in the three studied groups. Accordingly, inhomogeneity of the thymic function reported in elderly individuals can compromise the accuracy of using sjTRECs quantitation for age estimation [The clinical manifestations seen in COVID-19 patients above the age of 50 years can be attributed to the uncontrollable, weak antiviral response due to immunosenescence and thymic involution . Elderlytimation .sjTRECs showed significant negative correlation with chronological age in all the studied groups, including healthy (r = \u22120.78), COVID-19 (r = \u22120.80), and autoimmune patients (r = \u22120.51). Regarding the control group, our results (R2 = 0.61) are consistent with those of Ibrahim et al. [sjTRECs in peripheral blood as an efficient method for estimating age. Their research also found a highly significant negative correlation between sjTRECs level and individual age (R2 = 0.87). Similar results have been reported by Ou et al. [sjTRECs levels in old bloodstain and blood samples were decreased in an age-dependent manner, with R2 = 0.759 and R2 = 0.835, respectively. Cho et al. [sjTRECs levels and age, with R2 = 0.807. In 2018, Yamanoi et al. [sjTRECs level using SYBR green PCR, and their results indicated that sjTRECs level has declined with age in bloodstains from the Japanese population, with r = \u22120.786 (R2 = 0.617). The minor discrepancies between the results of the diverse studies may be due to the differences in the sample size, genetic, medical, as well as environmental factors [sjTRECs level include variable ethnic groups, using different age groups, storing the samples for a long period, and the detection procedures [The dCT level of u et al.  and otheu et al. , who fouo et al.  confirmei et al.  studied  factors . Other cocedures .sjTRECs between the two genders in both healthy and COVID-19 subjects . This result is consistent with the results of Ibrahim et al. [sjTRECs levels between males and females, in healthy Egyptian and Chinese populations, respectively. Data collected from other studies [sjTRECs than women. Other authors [sjTRECs levels, and they suggested ignoring this effect, since its impact on the predicted age values is minor. Interestingly, our study has identified a significant reduction (p = 0.03) in the mean levels of sjTRECs in female patients with autoimmune disorders when compared to the males of the same group. It is unclear why women have reduced sjTRECs levels, although the majority of the published studies showed either no sex differences or reduced sjTRECs in men. Yet, it may be attributed to differences in patients\u2019 characteristics. Moreover, women are known to be at higher risk of developing autoimmune disorders [In our study, insignificant differences were detected in the mean levels of m et al. , who had studies  have pub authors  have alsisorders .TREC levels are always higher in the CD8+ T-cell subpopulation compared to CD4+ T cells. Besides, previous analysis of data extracted from patients with RA, SLE, psoriatic arthritis, and JIA suggested enrichment and activation of CD4+ T cell subpopulation during disease pathogenesis [sjTRECs level detected could also be influenced by the different effects of sex hormones and sex chromosomes on the immunopathogenesis of such diseases. Whether the course of the autoimmune disease is influenced by sex difference or not is still controversial and needs further investigations to identify the distinct influence of gender on the pathogenesis of each autoimmune disease.It was also reported that ogenesis ,44,45,46ogenesis . Our stusjTRECs significantly, and the sjTRECs expression didn\u2019t show any significant correlation with disease activity among the studied cases. Similarly, Kurosaka et al.\u2019s [sjTRECs level and SLE disease activity. However, our results revealed lower sjTRECs levels in the peripheral blood of patients with active disease, which is consistent with Vieira et al. [sjTRECs counts in CD8+, but not in CD4+ T lymphocytes. Fascinatingly, patients with inactive SLE displayed similar sjTRECs level to healthy controls in CD4+ and CD8+ T cells [sjTRECs level in patients with active autoimmune diseases, such as SLE, to many factors; one of them is the extremely high doses of immunosuppressive drugs and glucocorticosteroids which are well-known to persuade thymus atrophy and to suppress lymphopoiesis [sjTRECs were inversely correlated with the activity of RA. However, the correlation was absent with subsequent follow-up and disease progression.Disease activity in patients with autoimmune disorders didn\u2019t affect the levels of et al.\u2019s  results a et al. , whose w T cells . We may opoiesis . It has opoiesis . It is aopoiesis  revealedp = 0.20). The chronological age and dCt values were correlated in COVID-19 patients, and we found a high negative correlation with R2 = \u22120.84; 0.80 in mild and severe cases, respectively (p < 0.001). Patients with severe COVID-19 are manifested by lymphopenia, particularly T cell loss [The average dCt values were insignificantly lower in patients with severe COVID-19 compared to mild disease , R2 = 0.26. While for COVID-19 patients, the equation was more or less near to the healthy group (Y = \u221241.63\u20136.68 X \u00b1 12.60), R2 = 0.64. The current results indicate that COVID-19 may affect the immune age and thymic function significantly in young adult patients, though the age prediction model does not show such a relationship. The MADs from the chronological age were 9.4, 11.04, and 9.71 years in healthy, autoimmune, and COVID-19 subjects, respectively, with a higher deviation in autoimmune patients when compared to the other two groups. Therefore, it was found that the accuracy of age prediction decreases with higher deviation as an impact of various autoimmune disorders. At older age groups, sjTRECs levels were very low and, thus, sjTRECs levels in older patients with COVID-19 and autoimmune diseases match the controls with the same predicted age. While in patients at the age of 50 and younger, sjTERCs levels in patients with autoimmune diseases match those of older age by around 11.04 years.Y = \u221214.89\u20134.85 X \u00b1 11.42, where the 11.42 refers to the SE and RsjTREC-containing CD4+ T cells was not different in the RA patients compared to the healthy individuals; however, the curves were shifted by approximately 20 years towards a younger age. Therefore, RA patients aged 20\u201330 years old have sjTRECs level equivalent to healthy individuals of 50\u201360 years old. Similarly, sjTRECs level was significantly lower in SLE patients, which supports the idea that T cell subset imbalance and aberrant expression of the key signaling molecules on their surfaces contribute significantly to SLE disease pathogenesis [sjTRECs levels. The follow up process of the recovered COVID-19 patients during the peak of the pandemic and the economic burden was another limitation to study its effect during the convalescence stage.This obvious age reduction in autoimmune patients could be attributed to the alteration of T cell dynamics in RA cases and, possibly, to increased T cells\u2019 turnover as part of the RA disease pathogenesis. Koetz et al.  stated togenesis . A limitsjTRECs in the peripheral blood of Egyptian patients, particularly young adults and middle-aged individuals. Such a finding may affect the reliability of using sjTRECs alone as a marker for age estimation in patients with such chronic immunologic disorders. It is recommended to couple sjTRECs with other age estimate indicators for forensic purposes. Acute infection with SARS-CoV-2 in young adults has a substantial negative influence on the thymic function. Nevertheless, the MAD and the age prediction equations of all COVID-19 patients were more or less near to the healthy individuals, which may oppose the notion that COVID-19 may implicate the age prediction using sjTRECs. Measuring sjTRECs level is an indicator of thymic function and immunosenescence. Consequently, we can also infer that the immune system of the affected age groups also shows signs of an early immunosenescence due to the effect of the disease pathogenesis on the T cell function. Above the age of 50, the marked reduction in sjTRECs levels, and the noticeable similarity in the low thymic functions among the three studied groups, reveal that age-related involution of the thymus and immunosenescence starts around the age of 50 years in the healthy Egyptian population. Though autoimmune disease activity and COVID-19 severity showed significant negative correlation with age, they have slightly reduced the sjTRECs levels as compared to inactive autoimmune and mild COVID-19 cases.Autoimmune diseases have dramatically reduced the levels of sjTRECs and the thymic function in patients\u2019 groups and subgroups by using larger sample size. Using other markers, in addition to sjTRECs such as epigenetic markers, e.g., microRNA (miRNA), may provide insights to comprehend how genes control and maintain the microenvironment of the thymus during the ageing process.Finally, we believe that further longitudinal study is required to assess the dynamic effects of the individual autoimmune diseases and COVID-19 on"}
+{"text": "Cognitive decline, the primary clinical phenotype of Alzheimer\u2019s disease (AD), is currently attributed mainly to amyloid and tau protein deposits. However, a growing body of evidence is converging on brain lipids, and blood\u2013brain barrier (BBB) dysfunction, as crucial players involved in AD development. The critical role of lipids metabolism in the brain and its vascular barrier, and its constant modifications particularly throughout AD development, warrants investigation of brain lipid metabolism as a high value therapeutic target. Yet, there is limited knowledge on the biochemical and structural roles of lipids in BBB functionality in AD. Within this framework, we hypothesize that the ApoE4 genotype, strongly linked to AD risk and progression, may be related to altered fatty acids composition in the BBB. Interestingly, alpha linolenic acid (ALA), the precursor of the majoritarian brain component docosahexaenoic acid (DHA), emerges as a potential novel brain savior, acting via BBB functional improvements, and this may be primarily relevant to ApoE4 carriers. Transport of lipids to the brain is mediated by the major facilitator superfamily domain containing 2A (Mfsd2a) lining the BBB .The BBB is a selective interphase between systemic blood and brain parenchyma with brain endothelial cells as its principal cellular component. Its structural and functional stability is critical to keep a healthy brain. The brain blood capillaries are different from peripheral blood vessels due to the presence of tight junctions, lack of fenestrations, high number of mitochondria, restricted endocytosis and presence of unique transporters . PericytThe capillaries in brain provide the largest endothelial surface for molecular interchange between blood and brain . Even thGrowing evidence points to brain DHA reduced levels ,32 in phNeuroimaging studies in individuals with early AD as well as histological images of postmortem tissue have shown BBB breakdown in different brain areas . IncreasEssential fatty acids (EFA) LA and ALA are precursors of the important brain components arachidonic acid  and DHA (n-3), respectively, through processes of desaturation and elongation. The genes encoding the enzymes involved in those pathways are highly expressed in liver and brain ,43. ImpoAA has been shown to have neurotoxic effects . AA is aDHA is notoriously decreased in the AD human brain , and so The essential ALA n-3 and LA n-6 FA, source of the metabolic PUFA DHA and AA, respectively, come from the diet. The brain is highly enriched in long-chain DHA and AA as structural components of neuronal membranes. These FA are precursors of lipid-derived prostaglandins and resolvins. When derived from DHA, they contribute to reverse inflammatory and other neurodegenerative processes . Neural The conversion of essential ALA and LA to PUFA occurs via the same elongase and \u03946 desaturase enzymes in the metabolic pathway. Higher ALA levels usually overcome the LA substrate competition, allowing for the production of higher n-3 than n-6 PUFA metabolites . ImportaDHA supplementation has shown inconclusive results of both positive and negative effects related to BBB integrity  and imprSaturated FA conversion into MUFA is regulated by \u22069 desaturase activity (SCD1 gene). Curiously, MUFA have been found, in some studies, to be elevated in AD patients brain, and to correlate with cognitive impairment, although the underlying mechanisms beyond this association are unknown . Our recIn addition to the peripheral hepatic EFA metabolism and consequent brain transport, astrocytes have been suggested to be the central neural system providers of PUFA ,65. SurpThe early detection of AD-related brain lipid changes should be considered as a critical point related to the role of nutritional lipids in the prevention/restoration of the BBB during AD development. Based on our previous studies in C57Bl6/J mice , early aDue to the BBB inherent impermeability, brain and peripheral cholesterol synthesis are separated . Brain cApolipoprotein E4 (ApoE4) allele carriers are at increased risk to develop AD compared with those carrying the ApoE3 or E2 alleles . The ApoWe predict that the link between ApoE4 genotype and AD evolution towards cognitive decline emerges, at least for some extent, from the BBB deterioration due to altered nutritional and biochemical FA processes leading to ineffective brain lipid accretion though the BBB.The strong impact of ALA dietary enrichment on hepatic n-3 FA metabolism, may lead to restoration of DHA brain levels, by rescuing BBB disruption through membrane remodeling in brain endothelial cells. We envision that further research will unravel the mechanisms through which ALA enrichment improves BBB functionality, not only by repairing lipid transport, but also by enhancing brain ALA metabolism. In doing so, n-3 PUFA enrichment would comprise whole brain lipid homeostasis supporting restored cognitive functioning. This innovative concept opens the path for exciting prospects on ALA properties related to BBB in various brain diseases. Understanding the role and evolution of lipid modifications from early to old age, specifically in high risk ApoE4 carriers, would promote the discovery of novel nutritional strategies for the prevention, delay or restoration of cognitive decline."}
+{"text": "We focus on two main applications: (i) comparing model predictions with satellite observations, and (ii) temporal evolution of chlorophyll both seasonally and over longer time frames. The Wasserstein distance successfully isolates temporal and depth variability and quantifies shifts in biogeochemical province boundaries. It also exposes relevant temporal trends in satellite chlorophyll consistent with climate change predictions. Our study shows that optimal transport vectors underlying the Wasserstein distance provide a novel visualization tool for testing models and better understanding temporal dynamics in the ocean.Remote sensing observations from satellites and global biogeochemical models have combined to revolutionize the study of ocean biogeochemical cycling, but comparing the two data streams to each other and across time remains challenging due to the strong spatial-temporal structuring of the ocean. Here, we show that the Wasserstein distance provides a powerful metric for harnessing these structured datasets for better marine ecosystem and climate predictions. The Wasserstein distance complements commonly used point-wise difference methods such as the root-mean-squared error, by quantifying differences in terms of spatial displacement in addition to magnitude. As a test case, we consider chlorophyll (a key indicator of phytoplankton biomass) in the northeast Pacific Ocean, obtained from model simulations,  Whether quantifying the agreement between the output of an ocean simulation model ,2 and insurement ,4, or mosurement , one neesurement \u20138; populin situ and using satellites. Further, small spatial mismatches can result in large pixel-wise differences\u2014see \u00a75.3.2 of [These issues are well known and have led to the development of various normalized differences or \u2018cost functions\u2019, which differentially weight differences arising from deviations in quantity or location, or from unresolved scales e.g. ,7,9). Fo,9. Fo7,95.3.2 of \u2014which peIn this paper, we explore the use of the Wasserstein distance , which sTo convey the intuitive appeal of the Wasserstein distance over pixel-wise distance measures, consider the toy example in a shows the optimal transport pattern between the two maps on the left (see \u00a73(a)(i)). These optimal transport patterns are not to be interpreted as \u2018physical\u2019 transport of the underlying quantity. Still, these optimal transport patterns are useful for understanding how the data differ. In this work, we consider two primary types of comparison: (i) comparing two different data sources measuring the same signal on a spatio-temporal region or gridpoints; and (ii) comparing the same data source at different times. In both cases, visualizing the optimal transport can provide a scenario to elucidate the nature of the difference. This can be particularly useful when spatio-temporal differences are related to shifts in patterns that may not be well captured by pixel-wise comparisons.In addition to its merit as a scalar distance, the Wasserstein distance also enables the visualization of the transport that would most efficiently (from the perspective of a person moving the dirt) transform the first ocean map into the second. For example, the rightmost panel of figure 2in situ data is framed in terms of chlorophyll shifts along the depth dimension. Our numerical experiments allowed us to investigate whether the Wasserstein distance can effectively capture deviations in the \u2018deep chlorophyll maximum\u2019 (DCM) between two chlorophyll depth profiles [With this paper, we aim to highlight the usefulness of studying ocean data using the Wasserstein distance, which we show is particularly well suited for evaluation of ocean biogeochemical models, among many other applications. We compare satellite chlorophyll observations from the Eastern North Pacific Ocean and depth profiles from the NPSG with their counterparts from a biogeochemical model coupled to a state estimate of the ocean currents, temperature, and salinity . We showprofiles \u201330. Thes2 (a)Consider two discrete probability distributions optimal transport [base distance between cell The Wasserstein distance, which is also sometimes called earth mover\u2019s distance  as discuransport ,31,32, itransport R package [Throughout, we use the  package , which i package  in whichequation ) is proher space  and in ter space . Also poer space , which ier space .great circle distance between the  coordinates, which we compute using the geodist package in R [R package named omd (https://github.com/sangwon-hyun/omd), which could be used for other ocean studies.A distinctive feature of ocean applications  is that the base distance age in R . Our wor (b)In our analysis, multidimensional scaling (MDS) plots will be used to help us interpret distance matrices, often highlighting seasonality and other relationships across time. Using the Wasserstein distance as described in \u00a72(a), we can take a collection of maps and form a distance matrix ical MDS ,40. This (c)in situ observations. We use a subdomain of the model and remote sensing datasets focused on a latitude\u2013longitude rectangle in the Pacific Ocean directly above\u2014and including\u2014Hawaii. The region is centred around about a, left panels). We also focus on data directly from a fixed location near the south of this region, Station ALOHA  . Through (i)Model data are based on output from a coupled physical-biogeochemical-optical model, modified for the Simons Collaboration on Computational Biogeochemical Modeling of Marine Ecosystems (CBIOMES) project. The CBIOMES-global model simulates the period from 1992 to 2011 .in situ data. The end product is a global three-dimensional configuration state estimate, at a horizontal resolution of The model\u2019s physical component is derived from the Estimating the Circulation and Climate of the Ocean project, v. 4 (ECCOv4) ,7,8. ECCpth . See  for full (ii)Remote sensing (or satellite-derived) data are based on v. 3.0 of the European Space Agency Ocean Colour Climate Change Initiative (OC-CCI) \u201347, a bl (iii)https://hahana.soest.hawaii.edu/hot/dataaccess.html) contains concentrations of chlorophyll collected using a CTD fluorescence sensor. There are 28\u2009583 observations measured between 3 October 1988 and 27 November 2016 in the depth range between 0 and 200\u2009m. This data were downloaded directly from [R package for accessing the CMAP database.We additionally consider shipboard-measured chlorophyll-a from Station ALOHA  of in situ data and model data using the Wasserstein distance. In situ data are sampled irregularly in time, while Darwin data is complete in space and time. In order to compile the two datasets at matching locations in space and time, we colocalize the model data, by taking averages of the chlorophyll measurements in a certain space-time vicinity , we compare . 3 (a)In this section, we show several different data applications of the Wasserstein distance to the ocean setting, each highlighting a different aspect of ocean data comparisons. First, in \u00a73(a)(i), we consider the climatological seasonal changes in chlorophyll patterns in both satellite and model data, and we also perform direct model\u2013satellite comparisons. Here, \u2018climatological\u2019 refers to being based on the 12 average monthly chlorophyll levels (averaging from 1998 to 2006). Next, in \u00a7(ii), we consider the full time series of monthly averages from 1998 to 2006 and focus on using the Wasserstein distance to explore changes in chlorophyll patterns over that time period. Finally, in \u00a7(iii), we use a smaller longitude\u2013latitude rectangle in the NPTZ, and base comparisons on estimated boundaries between regions instead of on the original chlorophyll concentrations. (i)a shows the pixel-wise difference, and portrays both large positive deviations in the northern region and smaller ones in a wider region near the equator. The right-most panel shows an example of the optimal transport pattern from comparing climatology remote sensing data and model data in April. Optimal transport is visualized as blue transparent arrows, and those corresponding to the top 10% are highlighted in bold red. Both plots indicate that the model and remote sensing data differ the most in the northern region, while optimal transport additionally shows a southbound shift in patterns across the whole domain.Our first comparison is between the two climatology data sources\u2014remote sensing and model data. The third panel in figure 2b, from the Next, we form a 24\u2009\u00d7\u200924 distance matrix c), projecting the 24 chlorophyll maps onto a two-dimensional plot. This MDS plot again shows that model data has higher variability than the remote sensing data. It also shows a clear separation between the two data sources. The line connecting the data sources shows a closed loop within each source, which shows seasonality according to the time of year. A careful look reveals that the seasonality pattern is different for the two data sources\u2014the distance between the three months (August through October) and (December through January) is smaller in the model data than in the remote sensing data.We further summarize the distance matrix MDS plot c, projec (ii)calendar months apart if one ignores the years, i.e. We expand the analysis by using time-resolved data based on monthly averages of model and remote sensing data in all months available from 1998 to 2006. An MDS analysis leads to similar conclusions as those from the climatology data . Next, a show the distance from model data in January 1998 to all other months of model data in our date range, measured in two ways (Wasserstein distance and RMSE). Both have regular seasonality, but the Wasserstein distance curve peaks in the summer (around August) of each year, while the RMSE curve peaks in the early spring (around April). We focus on three months\u2014shown as January 1998 (I), April 2002 (II), and August 2002 (III) in panel a\u2014and note that the domain of calculations has been extended further northward as compared with Lastly, b comparing (I) and (II), we see that the RMSE is relatively high due to a few large mismatches in the coastal region, while the Wasserstein distance in this comparison is relatively small because only local shifts exist in the north. On the other hand, panel c comparing (I) and (II) shows that the Wasserstein distance is appropriately large; the rightmost figure shows how optimal transport captures many global southbound shifts in probability mass to the equatorial region. Pixel-wise difference (third figure from the left) fails to capture this visibly large pattern difference, and RMSE is measured to be smaller than from the comparison in panel b. This demonstrates how the Wasserstein distance can be an improvement over RMSE in quantifying such differences between maps.In panel  (iii)Sometimes, rather than comparing the scalar fields directly, we may be more interested in comparing a scientifically relevant derived feature of the fields. For example, one may algorithmically segment the ocean into cohesive regions\u2014\u2018provinces\u2019\u2014based on underlying differences in one or more fields  and blue (remote sensing) lines.We show here how the Wasserstein distance can be used to evaluate how different the boundaries are of such provinces when determined from different datasets or algorithms. Here, we apply a clustering algorithm (t (TZCF) ,53. We db) and the MDS plots (panels c) in It is interesting to compare the distance matrices (panels  (b)in situ and model). In the vertical profile of chlorophyll, a DCM  is obsemum, SCM  at the pmum, SCM ,57. At tmum, SCM \u201360 and tin situ and model\u2014at 226 shared dates between October 1988 and November 2016. Panel (a) shows an example of a single chlorophyll depth profile for the two data sources (for 15 September 2014), while all 226 depth profiles for each data source are shown in (b). For each comparison (i.e. each common date), we also record an estimate of the DCM, measured by the depth at which the maximum concentration of chlorophyll occurs. Panel (c) shows linear regressions of Wasserstein distance and RMSE on the estimated difference in DCM between the two data sources. The higher c suggests that Wasserstein distance is more effective than RMSE at capturing the observed difference in DCM. Additionally, electronic supplementary material, figure S9, shows that the most prominent movement across depth\u2014pooled across all comparisons made\u2014is from approximately 96\u2009m in the in situ data, to 140\u2009m in the model data. This indicates that in aggregate, there is a depth-wise mismatch in the DCM between the two data sources. The Wasserstein distance uncovers the spatial mismatch without the additional step of isolating the DCM.. 4We have demonstrated through a series of examples how the Wasserstein distance can be a useful tool for oceanographers performing the common task of comparing scalar fields in the ocean. Our analyses focused on two time-varying chlorophyll datasets in the Pacific Ocean\u2014a map defined over a longitude\u2013latitude box in the North Pacific and a depth profile at Station ALOHA. In several examples, we found that the Wasserstein distance was able to capture differences in seasonality, distribution shifts, and other scientifically relevant factors in ways that a pixel-wise difference could not. For example, in the depth profile analysis, the Wasserstein distance could more closely track the changes in the DCM than RMSE. A further advantage over RMSE that we did not demonstrate in our examples is that the Wasserstein distance does not require the two sources to be defined on identical sets of spatial cells.patterns, which may help detect long-term trends efficiently and with less uncertainty.Our Wasserstein distance-based analysis also suggested that the differences in chlorophyll data from the model and remote sensing observations can sometimes be larger than the within-source seasonal variability. The optimal transport maps that are generated in the computation of Wasserstein distance allowed us to understand that this difference was driven by a seasonally varying set of global-scale probability mass shifts. We also found that a key feature of these two data sources\u2014the estimated boundary between the subpolar zone and the subtropical gyre\u2014are much more similar in this region than the original chlorophyll maps. Analysis of the Wasserstein distance on remote sensing data  also helped reveal a long-term change from 1998 to 2006 that is not present in the model data. This suggests the usefulness of the Wasserstein distance for examining spatial data over time within a single source. Current studies often establish long-term trend terms of changes in magnitude; the Wasserstein distance detects changes in The demonstrations within this paper are just a starting point for the potential uses of the Wasserstein distance. We envisage this metric being used by many oceanographic data scientists for a variety of comparisons, across a range of dimensions and variables. One particular future development of interest would build on our application of Wasserstein distance to province boundaries with exploration of this technique for more complex applications than the single horizontal TZCF boundary demonstrated here. Defining and testing provinces (biomes) in the ocean is an active area of research ,52, and As demonstrated in our examples, the Wasserstein distance is particularly useful for model-data comparison because models can struggle to get the physical location of some key features in the ocean, such as the Gulf Stream. A pixel-wise comparison will measure the magnitude of difference at rigid locations, while the Wasserstein distance will focus on the pattern change and appropriately measure this discrepancy in the longitude\u2013latitude space.temporal trends in patterns rather than in magnitudes. This shows the Wasserstein distance goes far beyond simple model-data comparison, and can be useful for analysing spatial fields of ocean physical, biogeochemical, and optical quantities over time.Further, the regression analysis in \u00a73(a)(ii) suggests the Wasserstein distance as a powerful tool to examine Developing computational improvements will be important to allow for full global ocean comparisons. One simple extension is to only allow local transports, by directly modifying the base distances. Handling this sparser structured base distance effectively\u2014by building specialized software\u2014may be an important practicality. Faster approximations to optimal transport are popular in computer science and machine-learning applications, and can also be adopted when analysing ocean data.Another methodological extension is to consider optimal transport with unequal masses ; a natur"}
+{"text": "Liver transplantation (LT) is considered the only curative therapeutic option for early, unresectable, and unablatable hepatocellular carcinoma (HCC), particularly in the setting of chronic liver disease. The criteria for selecting patients for LT for HCC have evolved since the description of the Milan Criteria by Professor Mazzaferro. In Australia and New Zealand (ANZ), the choice of criteria has expanded over the last 24 years from the Milan to the University of California San Francisco (UCSF) criteria and, more recently, to Metroticket 2.0 (MT2). This study analysed the overall and HCC-related deaths following LT in ANZ through the last 24 years to clarify the impact of the expansion of these criteria. Our data confirm that overall survival following LT for HCC has significantly improved over time despite expanding criteria from Milan to UCSF. Patients fulfilling the MT2 criteria have a survival comparable to the UCSF cohort. Thus, the expansion of criteria to MT2 is justifiable.Milan era (1997\u20132006) and the UCSF\u00a0era (2007\u2013July 2015). Results: The overall 5- and 10-year cumulative survival rates for the entire cohort of 691 patients were 78% and 69%, respectively. Patients transplanted in UCSF era had significantly higher 5- and 10-year survival rates than in the Milan era . In the UCSF era, the 5-year survival rate for patients transplanted within Milan criteria was significantly better than those transplanted outside Milan but within UCSF criteria . Patients transplanted within the MT2 criteria had a significantly better 5- and 10-year survival rate as compared to those outside the criteria . Conclusion: Overall survival following LT for HCC has significantly improved over time despite expanding criteria from Milan to UCSF. Patients fulfilling the MT2 criteria have a survival comparable to the UCSF cohort. Thus, expansion of criteria to MT2 is justifiable.Background: Expansion in liver transplantation (LT) criteria for HCC from Milan to UCSF has not adversely impacted overall survival, prompting further expansion towards Metroticket 2.0 (MT2). In this study, we compared patient survival post-transplant before and after 2007 and long-term outcomes for LT within Milan versus UCSF criteria (to determine the true benefit of the expansion of criteria) and retrospectively validated the MT2 criteria. Methods: Retrospective analysis of ANZLITR . The entire cohort was divided based on criteria used at the time of listing, namely,  The incidence of hepatocellular cancer is increasing worldwide ,2. It haFollowing the proposal of the Milan  criteriap < 0.001), and AFP French model (p = 0.044) to predict which patients will survive for five years after LT . Similarly, the cumulative incidence of HCC-related death was 58% lower  amongst patients transplanted within the MT2 criteria in the UCSF era compared to those outside MT2 criteria. The 5- and 10-year cumulative incidence of deaths were also significantly lower amongst patients transplanted within the MT2 criteria compared to those outside criteria  . PatienPatient survival has certainly improved over time following LT . This imp = 0.02) [The reduced survival in recipients over 55 years is intriguing. Stratifying age by decade resulted in significantly lower numbers of patients in some decades. Hence, the 55-year cut-off, with 312 patients below the cut-off, and 379 greater than and equal to the cut-off, served as a balanced comparator. Jain et al. noted an overall poor survival amongst LT recipients over 60 years of age  . A simil = 0.02) . Whether = 0.02) . Conside = 0.02)  and 81%  = 0.02) , this as = 0.02)  have recOur data indicate that the overall survival for patients being transplanted outside Milan but within UCSF was significantly lower than for patients transplanted within Milan criteria . DespiteExpansion of criteria for LT for HCC has not always met with success . HoweverThe ANZ Liver and Intestinal Transplant Registry is able to capture every patient who underwent an LT over the study period, and the information entered is valid. However, being a bi-national registry, the number of data entry parameters is restricted as compared to an individual institution, and thus, detailed analyses of subsets of patients are limited. This is why we do not have detailed pre-LT treatment and donor data that may impact on survival. Another shortcoming of the study is the lack of complete pathologic data from 247 patients (36%), leading to the exclusion of these patients from the overall analysis. However, we do not have reason to believe that this would skew the results in any way. Another limitation of our study is that the analysis is retrospective in nature and based on explant histology to stratify patients within the criteria for the manuscript.Overall survival following LT for HCC has significantly improved over time despite expanding the criteria from Milan to UCSF. It is likely that this survival advantage is due to the patients who are listed as UCSF but fall within the Milan criteria. Patients fulfilling the MT2 criteria have a survival comparable to the UCSF group, and further expansion to MT2 appeared justified."}
+{"text": "Thirty-six gilts were randomly assigned to fed control diet (CON), Na2SeO3 diet (0.3 mg Se/kg) or HMSeBA diet (0.3 mg Se/kg). The results showed that HMSeBA and Na2SeO3 supplementation both increased the total selenium content in liver and serum compared with control, while HMSeBA increased the total selenium content in liver compared with Na2SeO3 group. HMSeBA tended to increase the total selenium content in ovary compared with control. HMSeBA and Na2SeO3 supplementation both increased the weight of uteri in gilts at the third estrus. Moreover, HMSeBA supplementation down-regulated the gene expression of growth differentiation factor-9 (GDF-9) and bone morpho-genetic protein-15 (BMP-15) in cumulus-oocyte complexes (COCs). HMSeBA supplementation decreased malondialdehyde (MDA) content in serum, liver and ovary, increased activity of T-AOC in liver, TXNRD in ovary and GPX in serum, liver and ovary, while up-regulated the liver GPX2, SOD1 and TXNRD1, ovarian GPX1 gene expression. In vitro, HMSeBA treatment promoted GCs' proliferation and secretion of estradiol (E2). HMSeBA treatment increased the activity of T-AOC, T-SOD, GPX, TXNRD and decreased MDA content in GCs in vitro. Meanwhile, HMSeBA treatment up-regulated SOD2 and GPX1 gene expression in GCs in vitro. In conclusion, HMSeBA supplementation is more conducive to promoting follicle development by antioxidant pathway.Selenium (Se) is assumed to promote the follicle development by attenuating oxidative stress. The current study was developed to evaluate the effects of dietary 2-hydroxy-4-methylselenobutanoic acid (HMSeBA) supplementation on the follicle development  Model of proposed mechanism of 2-Hydroxy-4-methylselenobutanoic acid (HMSeBA) regulated follicle development by antioxidant pathway. E2 is one of the key ovarian hormones produced by the developing ovulatory follicle. E2 content reflect the differentiation of ovarian GCs. E2 is essential for female reproduction, as evidenced by severe fertility defects when its synthesis or action are suppressed (Ovarian follicular development is the most important event in reproductive performance in the gilt. The proliferation and differentiation of granulosa cells (GCs) determine ovarian follicular development . 17\u03b2-estppressed . With thSelenium (Se) is one of the essential trace elements for animals, which can effectively improve its reproductive performances \u20137. Typesin vitro were examined.Recently, one new organic selenium product named Selisseo\u00ae (SO) has been developed. Selenium in this product is present as 2-hydroxy-4-methylselenobutyric acid (HMSeBA). Studies have shown that HMSeBA is more bioavailable than selenium yeast or sodium selenite in poultry, growing pigs and weaned pigs , 13\u201315. 2SeO3) supplementation diet , (4) 2-hydroxy-4-methylselenobutyric acid supplementation diet . Each treatment had 12 gilts, six repetitions in each treatment and two gilts per repetition. CON diet was corn-soybean meal-based . Thirty-six female piglets  were randomly assigned to three dietary treatment groups: (1) control diet , (2) sodium selenite  of each treatment were randomly selected and slaughtered on the morning of the 19th day after the second estrus after fasting for 12 h. Before slaughter, 10 ml blood sample was collected from jugular vein. To obtaining the serum, blood samples were centrifuged at 3,000 \u00d7 g, 4\u00b0C for 15 min, and then serum was stored at \u221220\u00b0C.One gilt from each repeatment . The number of corpora lutea was recorded, too. Then, the follicle contents of left ovary were aspirated from the follicles with > 5 mm in diameter by a 10-ml syringe. Cumulus-oocyte complexes (COCs) were recovered from the aspirate using a dissecting microscope (40 \u00d7 magnification). Then the rest follicle contents were centrifuged at 2,000 rpm for 5 min. The follicular fluid (supernatant) was collected and stored at \u221220\u00b0C until analysis was conducted.in vitro experiments based on the high homology of swine and mice) at passage 3 or 4 at 2 \u00d7 105 cells  per well were seeded in 6-well tissue culture-treated plate in 2 ml DMEM supplemented with extra 1X antibiotic/antimicotic and 10% FBS. Added sodium selenite or HMSeBA working solution at 1 ng Se/ul according to the final concentration of 0, 2.5, 5, 10 ng Se /ml, respectively. Then the plate incubated in a humidified atmosphere of 5% CO2 at 37\u00b0C for 24 h. The cells should be around 40\u201350 % confluent, aspirated culture medium and washed attached cells once with 1* PBS. Added new culture medium with the final treatment concentration of selenium and incubated for 24 h (about 90 % confluent)  . Then thThe MTT  assay was applied to analysis the GCs' proliferation according to the manufacturer's protocol . Briefly, GCs were cultured with different concentration of sodium selenite or HMSeBA at 96-well tissue culture plates. After cultured for 44 h, the supernatant was removed and replaced by a solution composed of complete medium and MTT salt solution at ratio of 4:1. After 4 h of incubation, supernatant was removed, then added DMSO to each well and shake for 10 min to fully melt the crystals. Finally, the measurements were performed by a microplate reader  with 570 nm interference filters. Each experiment was carried out in triplicate.The concentrations of selenium in serum, tissue and feed samples were detected as previously described . Briefly2) and luteinizing hormone (LH) were detected by porcine enzyme-linked immunosorbent assay (ELISA) Kits . Optical density (OD) values were detected at 450 nm by a MuLtisKan MK3-Thermo Labsystems microplate reader . Serum three iodine thyroid (T3) and thyroxine (T4) were detected by porcine ELISA Kits  according to manufacturer's protocol.Serum and follicular fluid follicle stimulating hormone (FSH), estradiol  based on the manufacturer's protocol. Each experiment was carried out in triplicate for in vitro experiment.GCs were cultured with different concentration of Nain vitro experiment were quantified by the respective assay kits . Briefly, the activities of GPX, GR and SOD were assayed as described by Mou et al. (The activities of glutathione peroxidase (GPX), glutathione reductase (GR), thioredoxin reductase (TXNRD), total antioxidative capability (T-AOC), total superoxide dismutase (T-SOD) and malondialdehyde (MDA) of gilts' serum, liver, ovary, and supernatant and GCs of u et al. . MDA conin vitro experiment using the Trizol reagent . Agarose gel electrophoresis was applied to determine the integrity of RNA. By evaluating the OD260/OD280 ratio to determine RNA purity. Genomic DNA removal and reverse transcription (RT) were performed by PrimeScript RT reagent kit with gDNA eraser  based on the manufacturer's protocol. SYBR\u00ae Premix Ex TaqTM Kits  was appiled for real-time PCR analysis of mRNA expression. The primer sequences of the target genes were showed in Total RNA was isolated from gilt samples and GCs of P < 0.05. A tendency was assumed at P < 0.1.The repeatment was regarded as the experimental units for the animal growth performance. One gilt of a repeatment of three treatments had diarrhea or sick when younger, therefore, that repeatment was excluded from the present study. The gilt was regarded as the experimental units for the animal study except for the animal growth performance. Before using parametric analyses, all data were checked for normality and homogeneity of variance with Shapio-Wilk W test and Levene's test, respectively. All data were analyzed by one-way ANOVA using SPSS Statistics 22  and GraphPad Prism 6.0 . Then multiple comparison by DUNCAN analysis  were used to determine statistical differences between treatment groups. The results were presented as mean with SE. Statistically significant difference was considered at 2SeO3 increased the total selenium content in serum and liver . Dietary supplementation with HMSeBA tended to increase the total selenium content in ovary compared with control treatment in gilts (P = 0.08).Dietary supplementation with HMSeBA and NaP < 0.05, Dietary supplementation with HMSeBA increased the average daily body weight gain (ADG)  and bone morphogenetic protein-15 (BMP-15). The relative gene expression of GDF-9 and BMP-15 in COCs was lower in HMSeBA treatment than that in control treatment  did not change the FSH, LH and estradiol concentration in serum and follicular fluid of gilts compared with control treatment  in HMSeBA treatment compared with Na2SeO3 treatment in the liver of gilts, while the relative gene expression of GPX1 increased in HMSeBA treatment compared with Na2SeO3 treatment in the ovary of gilts (SELENOW and SELENOO decreased (P < 0.05) in Na2SeO3 supplementation treatment compared with control in the ovary. Besides, HMSeBA supplementation significantly increased (P < 0.05) the expression of SOD1 in the liver compared with control and Na2SeO3 groups. The expression of TXN1 increased (P < 0.05) in HMSeBA treatment compared with Na2SeO3 group in the liver of gilts. In addition to the above genes, although the difference was not significant, it was observed a numerical improvement in gene expression with HMSeBA compared to Na2SeO3 for all of the selenoproteines in liver.The relative gene expression of of gilts . The expP < 0.05, 2SeO3 had tendency to increased cell proliferation at 2.5 ng/ml (P = 0.097). Estradiol secretion is an important manifestation of the physiological function of granular cells. HMSeBA significantly increased the E2 concentration compared with control treatment at 5 and 10 ng/ml  and growth differentiation factor-9 (GDF-9) are important oocyte-secreted factors which stimulate GCs proliferation and suppress progesterone production in the early stages of follicular development  and corpora lutea (33.0 vs. 23.2). Bone morphogenetic protein-15 . Fortier et al.  treatment on d \u22121 of peri-ovulatory and no difference among the treatments with other time of the peri-ovulatory. This response might be related to the different sampling time in vivo or the complexity of the in vivo test did not reflect the treatment effect. In our in vitro experiment, HMSeBA significantly increased the E2 concentration compared with control.In present study, consistent with previous study , we founed yeast . There ied yeast . In thisr et al.  found thin vitro experiment suggested that HMSeBA, a new organic selenium, played a regulatory role in GC proliferation and E2 synthesis. These findings are consistent with previous studies reporting that sodium selenite supplementation acts a regulatory role on E2 synthesis and the proliferation of bovine GCs  treatment increased the GR concentration, which was consistent with the results of gene expression. However, no difference in GR in the ovary at the transcription level and translation level in in vivo experiment. This may be due to HMSeBA regulates the expression of GR at the post-transcriptional level or too many cell types in the ovary mask the effect of HMSeBA on granulosa cells in vivo. However, this hypothesis requires more research to verify. The increasing of GR with the supplementation of HMSeBA indicated that the HMSeBA might be beneficial with GCs to increase oocyte viability and the fertility efficiency. In addition, this study found that HMSeBA (10 ng/ml) increased SOD2 mRNA expression in vitro, HMSeBA (5 ng/ml) and Na2SeO3  increased mRNA expression of GPX1 in vitro and HMSeBA group increased mRNA expression of GPX1 in the ovary in vivo. These results were agreed with previous researches, which found that Se might affect cell proliferation by regulating the activity of antioxidant enzymes in testis  is exclusively localized in the mitochondrial spaces, which been demonstrated that high expression in rodent steroidogenic , 43. Oxio et al.  found thsa cells . GPX1 issa cells . Mammalssa cells , 46, whisa cells  to allow75Se, the Se incorporated into TXNRD has been reported to increase with increasing selenium concentration in cancer cell culture medium (2SeO3 significantly increases the activity of TXNRD at the protein level in the GCs in vitro and in the ovary in vivo. These results indicated that HMSeBA might have much more effects on the TXN/TXNRD system to help cells to defense against oxidative stress.Thioredoxin reductase (TXNRD) in mammalian is a member of the selenium-containing pyridine nucleotide-disulphide oxidoreductases family. TXNRD, Thioredoxin (TXN) and NADPH are the components of the TXN/TXNRD system, which have been considered key antioxidant system against oxidative stress , 49. Usie medium . The mRNe medium . The stue medium , 52. In e medium . Similar2SeO3 and HMSeBA both decreased the concentration of MDA thus beneficial to the redox balance in vitro in granulosa cells and in the liver in vivo in gilts. At same time, HMSeBA decreased the concentration of MAD in the serum and ovary in vivo in gilts. Maintenance of redox balance is critical for effective immunity and health, and biomarkers of oxidative stress are linked to cellular function  secretion and enhanced antioxidant capacities in vitro. Therefore, this study proved that HMSeBA promoted follicle development by antioxidant pathway from the in vivo and in vitro data. In future, long-term effect of HMSeBA supplementation on farrowing performance in gilt and exact mechanism of HMSeBA will be further explored.Dietary HMSeBA supplementation increased the selenium deposition, antioxidant capacities and promoted the development of COCs in gilts. HMSeBA promoted follicle development by stimulated GCs' proliferation, estradiol .MK was employed by the company Adisseo France SAS. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Background: Adrenocortical carcinoma (ACC) is an uncommon endocrine malignancy associated with poor clinical outcome. As a novel form of cell death, ferroptosis is reliant on the accumulation of iron and reactive oxygen species and is involved in the pathogenesis of various tumors, including ACC. Our study aimed to identify and characterize the prognostic ferroptosis-related lncRNA signature (FerRLSig) in ACC.Methods: A regulatory network of ferroptosis-related lncRNAs (FerRLs) and mRNAs was constructed based on The Cancer Genome Atlas (TCGA). Univariate and multivariate Cox regression assays were performed to construct the FerRLSig.Results: Twenty-four FerRLs were identified in the prognostic model, and the high-risk FerRLSig was related to the worse overall survival (OS) in ACC . The area under the curve (AUC) value of the FerRLSig was 0.936 according to the receiver operating characteristic (ROC) analyses, superior to other traditional clinicopathological features, further supported the utility in prognosis prediction of ACC. We further established a prognostic nomogram combining clinical factors with the FerRLSig, which showed favorable efficacy for survival prediction. Next, gene set enrichment analysis (GSEA) revealed that gene sets were involved in many immune regulatory biological processes related to malignancies. T-cell function of type II INF response and the immune checkpoints, including CD40, CD276, IDO2, NRP1, and CD80, were expressed with a significant difference between the low- and high-risk groups.Conclusion: This study offered new insights into the pathogenesis of ACC. The novel FerRLSig could be useful in predicting survival and may provide information of immunological research and treatment for ACC patients. Adrenocortical carcinoma (ACC) is an aggressive endocrine malignancy with a rare incidence but high mortality . AlthougPast decades have seen a growing number of research studies to investigate the function of ferroptosis in malignancies. As a novel form of cell death, ferroptosis is reliant on the accumulation of intracellular iron and reactive oxygen species, distinguished from other forms of cell death such as apoptosis and autophagy . ImbalanAs a subset of RNA molecules, a long noncoding RNA (lncRNA) has the length of over 200\u00a0nt and is involved in gene regulation . In addihttps://portal.gdc.cancer.gov/). https://www.gencodegenes.org/). We obtained 382 ferroptosis-related genes  from the FerrDb database, which is a data network with comprehensive and timely updates, covering the latest progress of ferroptosis-related genes along with their regulatory molecules and related diseases  + (coefficient of lncRNA2 \u00d7 lncRNA2 expression) + + (coefficient of lncRNAn \u00d7 lncRNAn expression). Taking the median value as the cut-off point, the lncRNAs were divided into two groups: high-risk group and low-risk group. Differentially expressed genes (DEGs) between the low- and high-risk groups were identified and statistically significant was considered at a false discovery rate (FDR) < 0.05 and |log2FC|\u22651. A Kaplan\u2013Meier survival analysis was then performed to evaluate the clinical correlation of risk stratification and patient prognosis. The FerRLSig was present as a risk plot, including the distribution of risk scores and survival status in ACC patients. We further calculated the area under the curve (AUC) value in the receiver operating characteristic (ROC) curve to evaluate the prediction accuracy of OS in ACC patients. Sensitivity and specificity of the FerRLSig were compared with other clinical and pathological factors via ROC curves and decision curve analysis (DCA)  . CytoscaFunctions of DEGs were compared between the low-risk group and the high-risk group. We evaluated the associated biological functions using gene ontology (GO), including biological processes (BPs), molecular functions (MFs), and cellular components (CCs). Based on the data in the Kyoto Encyclopedia of Genes and Genomes (KEGG), we further analyzed the biological pathways using the ggplot2 package in R 4.1.2.p-value <0.05 (GSEA 4.2.2). Statistical significance was expressed by the normalized enrichment score (NES) and FDR  to define the enriched terms in the KEGG. Significant gene sets were achieved at  and FDR . A nomoghttp://timer.comp-genomics.org/)  . The difcs.org/) .p < 0.05.R software (version 4.1.2), along with its appropriate packages, was used to perform the statistical analysis. The Wilcoxon test and unpaired Student\u2019s t-test were used to analyze the non-normally and normally distributed variables, respectively. Differentially expressed genes between the low- and high-risk groups were identified using the Benjamini\u2013Hochberg method. The association between FerRLs and clinicopathological characteristics of ACC patients was assessed by logistic regression analysis, presented in a cluster heatmap. Statistical significance was achieved at According to the Pearson correlation analysis, a total of 85 FerRLs were identified from the 382 ferroptosis-related genes in TCGA-ACC dataset . SubsequThe regulatory network of FerRLs, mRNAs, and pathways is shown in n = 437 for the high-risk group, Overall, 540 genes were identified to be differentially expressed between the low- and high-risk groups (n = 103 for the low-risk group and p < 0.001). In addition, the AUC value for the FerRLSig was 0.936 according to the ROC curve, significantly higher than that for traditional clinicopathological factors such as gender, age, and tumor stage  of the risk scores in the univariate analysis and multivariate Cox regression analysis were 1.975 (1.527\u20132.533) and 1.936 (1.484\u20132.526), respectively (p < 0.001), p53 signaling pathway , small-cell lung cancer , pancreatic cancer , homologous recombination , pyrimidine metabolism , pathogenic Escherichia coli infection , TGF-beta signaling pathway , primary bile acid biosynthesis , and drug metabolism cytochrome P450  signaling pathways . Most of the identified FerRLs were involved in tumor-related and immunological pathways including cell cycle (NES = 2.07; pathways . Taken tACC is an uncommon endocrine malignancy associated with high mortality . Early dvia the PRR11/PI3K/AKT pathway, predicting a poor prognosis in hepatocellular carcinoma (via the miR-135b-5p/CSF1 axis, indicating poor survival (Overall, 24 FerRLs were identified in the prognostic FerRLSig. In review of the literature, cell types that predominantly express these FerRLs along with the potential mechanisms are presented in arcinoma . In a rearcinoma . In addiarcinoma . Upregularcinoma . LINC015arcinoma . Wu et aarcinoma . Knockdosurvival . On the survival . In cervsurvival . HoweverNext, the present study identified 540 ferroptosis-related DEGs and stratified them by the novel FerRLSig. KEGG-based analyses further revealed that the genes of the high-risk group mainly participated in the Hippo signaling pathway, p53 signaling pathway, cancer-related pathway, ECM\u2013receptor interaction, cellular senescence, and cell cycle. Recently, Lin and colleagues revealed that recurrent breast tumors are highly sensitive to ferroptosis, and upregulated expression of DDR2 could promote ferroptosis through the Hippo signaling pathway . Wen-HsuAnother significant contribution of the current study is the uncovering of the association between the FerRLSig and tumor immune microenvironment. Increasing evidence suggests that T-cells could promote tumor ferroptosis to enhance antitumor activity, which might be a potential therapeutic target for cancers combining with an immune checkpoint blockade . FunctioAs a novel form of cell death, ferroptosis provides a new way for tumor development and treatment . HoweverIn conclusion, a FerRLSig was established to predict the survival of ACC. Additionally, this model might be related to immune infiltration, providing potential immune targets for the control of ACC."}
+{"text": "The search for the \u201cHoly Grail\u201d in clinical diagnostic microbiology\u2014a reliable, accurate, low-cost, real-time, easy-to-use method\u2014has brought up several methods with the potential to meet these criteria. One is Raman spectroscopy, an optical, nondestructive method based on the inelastic scattering of monochromatic light. The current study focuses on the possible use of Raman spectroscopy for identifying microbes causing severe, often life-threatening bloodstream infections. We included 305 microbial strains of 28 species acting as causative agents of bloodstream infections. Raman spectroscopy identified the strains from grown colonies, with 2.8% and 7% incorrectly identified strains using the support vector machine algorithm based on centered and uncentred principal-component analyses, respectively. We combined Raman spectroscopy with optical tweezers to speed up the process and captured and analyzed microbes directly from spiked human serum. The pilot study suggests that it is possible to capture individual microbial cells from human serum and characterize them by Raman spectroscopy with notable differences among different species.IMPORTANCE Bloodstream infections are among the most common causes of hospitalizations and are often life-threatening. To establish an effective therapy for a patient, the timely identification of the causative agent and characterization of its antimicrobial susceptibility and resistance profiles are essential. Therefore, our multidisciplinary team of microbiologists and physicists presents a method that reliably, rapidly, and inexpensively identifies pathogens causing bloodstream infections\u2014Raman spectroscopy. We believe that it might become a valuable diagnostic tool in the future. Combined with optical trapping, it offers a new approach where the microorganisms are individually trapped in a noncontact way by optical tweezers and investigated by Raman spectroscopy directly in a liquid sample. Together with the automatic processing of measured Raman spectra and comparison with a database of microorganisms, it makes the whole identification process almost real time. Even in the modern world, bloodstream infections are associated with high morbidity and mortality rates. Together with myocardial infarction, they are among the most common causes of hospitalizations. Patients with an increased risk of bloodstream infections include immunocompromised patients, patients with chronic infections, and elderly patients. Bloodstream infections frequently have a nosocomial origin: they are often associated with intravenous catheters. Another clinically significant and common type of bloodstream infection is infectious endocarditis, which occurs mainly in patients with preexisting heart disease, immunocompromised patients, or patients with artificial heart valves , 2.Staphylococcus aureus). However, the number of Gram-negative bacteria has been increasing, with Escherichia coli at the top. Also, other members of the family Enterobacteriaceae play a role. Other common causative agents of bloodstream infections include enterococci and yeasts of the genus Candida  (\u2013Numerous bloodstream infections are caused by staphylococci (both coagulase-negative staphylococci and lbicans) \u20135. Due tbicans) \u2013.Bloodstream infections often lead to sepsis, a life-threatening organ dysfunction caused by the deregulated response of a host organism to infection . Therefoin situ hybridization- or DNA microarray-based methods, the Accelerate Pheno system, and the Verigene system, which significantly shorten the time necessary for identification; however, they still require subcultivation. A breakthrough in this diagnostic process came with matrix-assisted laser desorption ionization\u2013time of flight mass spectrometry (MALDI-TOF MS), an effective, quick, and relatively inexpensive method based on protein fingerprinting of microbes  , 10. In microbes , 12. In microbes \u201318. Seveicrobes \u2013, but eitRaman spectroscopy belongs to optical methods with multiple applications in clinical medicine, such as measurements of inflammatory markers, including C-reactive protein (CRP) , 21; mea23\u201327\u201339\u201342\u2013This study presents the possibility of differentiating microbes causing bloodstream infections by Raman spectroscopy. Furthermore, it describes a pilot study aiming to identify microbes directly from human serum. It compares the results obtained by Raman spectroscopy to the results obtained by MALDI-TOF MS.We acquired Raman spectra from 305 strains belonging to 28 microbial species from colonies grown on Mueller-Hinton agar plates. Pseudomonas aeruginosa\u2019s peaks associated with pyoverdine include vibrations at 715, 830, 1,355, 1,488, and 1,611\u2009cm\u22121. In staphylococcal species, we can detect carotenoid pigments visible at wavenumbers of 1,110, 1,160, and 1,525\u2009cm\u22121, corresponding to C-C-(CH3), =C-C=, and -C=C vibrations  and support vector machine (SVM). Although the two classification methods have different principles, both approaches lead to similar results, with an accuracy of 93.5 to 93.8% for both 1NN and SVM using both centered and uncentered principal-component analyses (PCAs). The accuracy values were obtained by 5-fold cross-validation applied to the testing data. The results of cross-validation may be presented in the form of a confusion matrix , where tSubsequently, using the \u201csemaphore\u201d , we independently evaluated our method\u2019s performance by classifying 71 testing strains with five possible outcomes. The green and orange species were either correctly or incorrectly identified as the true class identification , with indistinguishable species being the fifth outcome. The results comparing the 1NN and SVM methods, which use features extracted by centered or uncentered PCAs, are summarized in Candida and Staphylococcus). The remaining incorrectly classified strain is the one strain of Klebsiella oxytoca, which was identified as Escherichia coli.Finally, Rows (true class) correspond to identifications by MALDI-TOF mass spectroscopy plus biochemical methods; columns (predicted class) correspond to identifications predicted by the SVM method. Numbers in the cells show correctly identified spectra on a green background  and incorrectly identified spectra on a red background . The colors of the numbers represent the confidence of the identification based on the semaphore scheme, with the indistinguishable samples (red semaphore) placed into the rightmost column. Moreover, gray rows depict the bacterial strains used in the training process, but no samples were present in the testing data set. Squares with a light-blue background depict bacterial species of the same genus.The cultivation step significantly slows the identification of pathogens in clinical diagnostic processes. Especially for life-threatening infections, the time to proper treatment is an essential component of treatment success. To shorten the time necessary for the identification of the causative agent, we performed a pilot study on spiked human sera using Raman tweezers, aiming to skip the cultivation step. The goal of this experiment was to test the feasibility of this application. In this case, optical tweezers attract microbes from the illuminated volume of the serum, catching them in an optical trap . Since the laser beam is tightly focused, microbial cells cover most of the volume from which Raman spectra are acquired. In this way, the signal of the surrounding serum is suppressed , 48. TheOur study shows that Raman spectroscopy can differentiate among pathogens causing bloodstream infections. We achieved approximately 94% correctly identified strains within the training set. Using the SVM classification method on the testing set and the \u201csemaphore\u201d approach, ~3% and 7% of the strains were incorrectly classified, with 86% and 88.7% correctly identified strains for centered and uncentered PCA feature extractions, respectively. These results closely correspond to those of previous studies using Raman spectroscopy to identify microbes , 38, 48.Proteus vulgaris, the spectra of which were repeatedly classified as Escherichia coli, suggesting a high level of similarity in their Raman profiles. Unsatisfactory results were also obtained for Candida tropicalis (identified as other Candida species in some instances), Enterococcus faecium , Staphylococcus warneri and Staphylococcus lugdunensis , and Streptococcus oralis . This led to a relatively high false discovery rate for Enterococcus faecalis (29%). Although these isolated problems occurred in the training set, all strains belonging to the species mentioned above from the testing set were identified correctly.When training the artificial intelligence (AI) classifier, the most problematic species was P. aeruginosa, Micrococcus luteus, S. aureus, and S. lugdunensis, the problems occurred with only one strain of P. aeruginosa and several individual spectra of S. lugdunensis. The set of S. aureus strains included 13 nonpigmented strains, 9 slightly pigmented strains, and 38 pigmented strains. Although the peaks associated with carotenoids are very intense, the machine learning algorithms did not consider them as the base for identifying S. aureus, so we can presume that this variability is suppressed by the rest of the characteristic spectral features.For the species with considerable observed variance in pigment production reflected in Raman spectra, namely, 2 slides and aluminum, etc.). Sample preparation for Raman tweezers depends on the sample; in the case of complex samples, preprocessing steps might be necessary. However, when the object of interest is in a liquid medium without other particulate matter or the particular matter is well defined, the objects can be directly captured and analyzed. Based on the principle of Raman tweezers, objects in the liquid medium are attracted by Raman tweezers and captured and can be subsequently analyzed. This allows the analysis of microbes in very low concentrations: the analysis is performed with one to four cells captured at once, so when the concentration is low, it takes more time to capture the object from the sample. The capture of an object is visible by the change in the laser beam appearance.We can conclude that despite some problematic strains, Raman spectroscopy offers an elegant, rapid approach to identifying microbes. It is noninvasive and nondestructive. Sample preparation is easy and does not require expensive consumables. When analyzing microbial colonies, it is sufficient to use a grown culture directly on a suitable culture medium . Alternatively, the colonies/microbial pellets after centrifugation and similar samples can be transferred to any Raman-inactive substrate or Raman-grade substrate with a defined low-interference signal  and acquires their Raman spectra \u2014it might, after repeated measurements, give some indication of a possible mixed infection . Moreover, recent studies by Bernatov\u00e1 et al. , Pil\u00e1t eAltogether, this novel approach could significantly accelerate the identification of pathogens and their antimicrobial susceptibility/resistance profiles, leading to the timely and accurate treatment of a patient. Upon this pilot testing, we plan to perform a more extensive study to include more strains/species as well as more microbial species in the testing of the method.Identifying and characterizing pathogens from tiny sample volumes rapidly and reliably are the crucial first steps in the diagnosis of microbial infections. Thus, we can envision the following wishful scenario in clinical practice. A sick person enters a hospital emergency ward with what appears to be an infection. Next, the doctor on duty collects a specimen  from them. Consequently, in an ideal case, the doctor could quickly and simply analyze the sample in the examination room. This analysis should give the doctor enough information for quantitative and conclusive pathogen identification. In this scenario, a point-of-care (POC) instrument that quickly identifies the pathogens in minutes is required. Thus, the clinician could prescribe tailored antibiotics, which improves the prognosis for a patient, shortens the time to proper treatment, and decreases problems with ever-increasing drug resistance. Since Raman spectroscopy and Raman tweezers have many possible applications in clinical medicine (as described above), they can provide a clinician with complementary information like the CRP level, the presence of inflammatory markers, and/or the presence of other conditions, including cancer. It could make the device suitable for complex clinical diagnostics.Currently, the main limitations of Raman spectroscopy include the relatively high input costs necessary for purchasing the highly optimized instrumentation and the need for staff specifically trained in the acquisition of Raman spectra. Since microbial samples are heterogeneous, and variability can be expected, manual measurements are necessary at the current stage. They involve finding the object of interest , focusing on the sample, and analysis (preferably more measurements/strain). The training necessary for personnel should include mostly the finding and focusing phases, as they are essential for the outcome. The analysis can be performed with the same (or very similar) settings for most of the microbial samples of the same type , with some basic adjustments for specific situations. Therefore, we believe that the necessary training would not be more complicated than the training required for MALDI-TOF MS analyses.Specially engineered portable systems could overcome these limitations of POC diagnostics in the future. Also, the absence of a large-scale database of microbial Raman fingerprints poses a problem for potential future clinical use. This is partially covered by our current (305 strains/28 species) and previous , 28, 48 34\u201364\u2013Beyond the limitations mentioned above, Raman spectroscopy has numerous advantages, proving its high potential to become a clinical diagnostic tool. It is noninvasive and nondestructive, so the samples (cells) can be used for further/complementary testing. It has a broad spectrum of applications across scientific fields to be used for numerous purposes in clinical diagnostics. It does not require any expensive consumables. Sample preparation is easy and quick. Therefore, we believe that Raman spectroscopy could become a valuable diagnostic tool in the future, significantly improving the management of infections and helping to reduce the speed of the ever-growing propagation of antimicrobial resistance. This would save the lives of patients as well as save costs for the management of infectious diseases.The current study on 305 microbial strains belonging to 28 microbial species shows that Raman spectroscopy can reliably differentiate among microbes causing bloodstream infections, with only 2.8 to 7% incorrectly identified strains depending on the approach used. Moreover, the pilot study based on Raman tweezers suggests that it is possible to locate microbes directly in human serum; their Raman fingerprints are distinguishable among each other and the serum itself. Therefore, we believe that Raman spectroscopy and Raman-based techniques (Raman tweezers) could significantly contribute to the development of rapid approaches for the diagnosis and management of infectious diseases.(i) Sample preparation. We measured 3,127 Raman spectra originating from 305 microbial strains of 28 species of 14 genera  (Czech Republic) and 1 reference strain from the National Collection of Yeast Cultures (NCYC) (United Kingdom) . Three SThe strains were identified by biochemical methods and MALDI-TOF MS using the extended direct transfer method according to the manufacturer\u2019s instructions  or blood agar with 5% sheep erythrocytes (streptococci), which do not have a significant influence on Raman microbial fingerprints .(ii) Experimental setup. We acquired Raman spectra from colonies grown on Mueller-Hinton agar plates after 24\u2009h of cultivation at 37\u00b0C using a commercial Raman spectrometer  equipped with a Leica N Plan EPI microscope objective . Spectral acquisition was performed using a 785-nm single-mode diode laser. The spectra were acquired in the range of 614 to 1,724\u2009cm\u22121  for 10\u2009s.We conducted at least 10 measurements of each microbial strain from 3 different colonies at a minimum, aiming the laser beam on the colonial surface. Before each spectral acquisition, the laser was refocused onto a colony surface, ensuring that the collected signal originated within the focal depth of the laser excitation and imaging optics. Considering the above-described geometry ensuring the collection of the Raman signal over an axial range of about 8\u2009\u03bcm, we can neglect the contribution of the cultivation medium to the Raman spectra .Measurements and sample preparations were performed in the same way on all measurement days. The high reproducibility of microbial Raman fingerprints acquired in this way was validated in our previous work .(iii) Data analysis. We processed all acquired spectra using custom-written routines implemented in MATLAB software  (Acinetobacter ursingii and Citrobacter koseri), all spectra were assigned to the training data set. MA, USA) , 28, 48.\u22121) . The high fluorescence background present in microbial spectra was removed by a rolling-circle filter (RCF)  . The speFor the extraction of the main spectral features, an aid for the identification of microbial strains, we employed centered and uncentered principal-component analysis (PCA) variants. The extracted features (PCA scores) were used as the inputs for the one-nearest-neighbor (1NN) and support vector machine (SVM) classification methods. The 1NN method is based on identifying the closest data point of the known class , and theHowever, for testing the classification performance, we used the testing data set consisting of 741 spectra belonging to 71 strains that were not used for training our classifier. As each sample consists of multiple spectra, the classifiers are trained to provide results based on one spectrum only; we introduce a \u201csemaphore\u201d scheme to evaluate the testing results. The \u201csemaphore-like\u201d colors green, orange, and red represent the confidences of species classifications of high-confidence-level, low-confidence-level, and indistinguishable species. For this, we introduce the following set of rules: (i) at least 50% of the spectra must be classified as a single species, or the sample is indistinguishable; (ii) if the number of spectra belonging to the most probable species is at least three times the number of spectra of the second most probable species, the result is obtained with a high confidence level, i.e., green; (iii) if the number of spectra belonging to the most probable species is at least two times the number of spectra of the second most probable species, the result is obtained with a lower confidence level, i.e., orange; and (iv) otherwise, the sample is indistinguishable (red).For example, let us assume that we take 10 spectra to classify one sample. We will obtain results with a high confidence level if 8 to 10 spectra belong to one species but also if the most populous species contains 6 or 7 spectra, assuming that the second most populous species has just 2 spectra, and also if 5 spectra are classified as a single species while the remaining 5 spectra are split, each of which gives a different species. On the other hand, we will obtain a low level of confidence of the classification if spectra are divided into groups according to 7-3, 6-3-1, and 5-2-2-1. The whole process is summarized in Fig. S1 in the supplemental material.(i) Sample preparation. We used pooled anonymized serum samples from the Department of Microbiology, St. Anne\u2019s University Hospital, Brno, Czech Republic. First, aliquots of the serum samples (1\u2009mL) were spiked with S. aureus CCM 3953, Staphylococcus epidermidis CCM 4418, E. coli CCM 3954, and Candida albicans CCM 8261  and mixed thoroughly for at least 1\u2009min using a vortex mixer. Ten microliters of the suspension was transferred to a glass chamber (one coverslip separated by a 120-\u03bcm spacer from a 200-\u03bcm thin CaF2 slide). This setup allowed us to obtain approximately 50 to 70 cells within the microscope field of view (approximately 100\u2009\u03bcm by 100\u2009\u03bcm).(ii) Experimental setup. Freely moving microbial cells in spiked human serum were trapped by using a custom-built experimental Raman tweezers system: a combination of a Raman microspectrometer and optical tweezers using the same laser for trapping and Raman scattering . This experimental setup achieves a full lateral width of the excitation region of ~0.8\u2009\u03bcm. Therefore, only a few cells can be trapped and analyzed simultaneously (one to four cells), and the background (serum) signal is almost suppressed. Trapped cells were exposed to the laser beam only during spectral acquisition (50\u2009s), and the laser was then blocked. Afterward, different cells were trapped in a new location within the sample, and we acquired their Raman spectra. Further details on the experimental setup and the procedure can be found in recent articles by Bernatov\u00e1 et al.  Data analysis. In the case of Raman tweezers experiments, the strong Raman signal of the medium (human serum) was suppressed according to the essential principle of optical tweezers: confining microbial cells in a focal volume of a laser beam, leading to the filling of almost the whole Raman scattering area by microbial cells. The acquired Raman spectra were processed using the Savitzky-Golay filter  and an advanced rolling-filter background removal routine . The data were further analyzed using custom-written routines in MATLAB software  using an uncentred PCA. PCA was also used to present results from Raman tweezers-based experiments. Ellipses around principal components were plotted using a Mahalanobis distance of 2.15 .https://osf.io/6t5r4/?view_only=3ec09e05ff5145639e1079ee772450a5 .Raw data are available at"}
+{"text": "Tinospora cordifolia (Guduchi/Giloy) is a relatively common herbal supplement whose use has recently become prominent in Southeast Asia. It was promoted to the public in India as an immunity booster, especially against the novel COVID-19. There have been reports, mostly from India, of an association between Guduchi/Giloy and liver injury. We present a 50-year-old female with a history of Hashimoto thyroiditis, who presented with abdominal discomfort and nausea of two weeks duration, which coincided with starting HistaEzeTM supplement containing Tinospora cordifolia. The vital signs upon presentation showed no significant abnormalities. Labs were significant for severely elevated transaminases; however, viral panels, autoimmune serologies, and imaging studies were unremarkable. Roussel Uclaf causality assessment method (RUCAM) score was at 6, which was indicative of probable drug/herb-induced liver injury. HistaEzeTM was discontinued, and the patient took a three-day course of oral steroids with significant interval improvement in clinical status, as evidenced by progressive normalization of the transaminases level. The transaminases decreased by greater than 50% within two weeks of discontinuation and trended back to baseline within three months. This case highlights the worldwide availability and use of Tinospora cordifolia, which can cause liver injury that appears to be idiosyncratic and possibly immune-mediated. Further research on the precise mechanism of its hepatotoxicity is warranted. Tinospora cordifolia, commonly described as heart-leaved moonseed , is an Ayurvedic herbal supplement used as an immune booster mostly in India, especially during the COVID-19 pandemic [Tinospora cordifolia-induced liver injury in the United States.Dietary and herbal supplements are known to be significant contributors to acute liver injury in the United States, accounting for about 15.5% of drug-induced liver injury (DILI), and are also a major cause of fulminant hepatitis in the Western world . It\u2019s knpandemic . Here, wTM, which contains 900 mg of\u00a0Tinospora cordifolia\u00a0extract (stem)/Giloy supplement for immune support against COVID-19 infection. Other than the reported symptoms above, the patient denied weight changes, regurgitation, heartburn, jaundice, skin rash, pruritus, change in stool or urine color, recent travel, exposure to blood or body fluids, needle stick injuries, or change in bowel habits. The patient reported a family history of autoimmune diseases; however, she was unsure of the specific type. She denied a history of smoking or alcohol intake and had no recreational drug use. Active medications at presentation include levothyroxine sodium, progesterone, estradiol patch, and HistaEzeTM\u00a0supplement.\u00a0A 50-year-old female with a past medical history of Hashimoto thyroiditis on levothyroxine replacement therapy presented with mild abdominal discomfort of two weeks duration. Abdominal pain was constant, graded 3-4/10 in severity, located in the right upper quadrant and epigastrium region, non-radiating, and had no known aggravating or relieving factors. The pain was associated with generalized fatigue, loss of appetite, nausea, and rare vomiting. Four to five weeks prior to presentation, the patient started taking 1 tablet of HistaEzeOn presentation to the gastrointestinal/liver clinic, her vitals were unremarkable. Physical examination noted mild discomfort to palpation in the right upper quadrant without rebound tenderness or guarding. Labs were notable for elevated alanine transaminase (ALT) 1336 IU/L and aspartate aminotransferase (AST) 375 IU/L . Alkaline phosphatase (ALP) was 57 IU/L (reference range: 45-117 IU/L), which was normal. Likewise, albumin, bilirubin, thyroid function tests, and the coagulation panel were all within normal limits. The hepatotropic and non-hepatotropic viral panels,\u00a0autoimmune serologies, and imaging were also unremarkable. The Roussel Uclaf causality assessment model (RUCAM) score was 6, indicating probable drug-induced liver injury.\u00a0TM, and counseled on liberal oral fluid intake. The patient received a three-day\u00a0course of prednisone 40 mg daily during the first week of the presentation, with interval improvement in symptoms noted. Table The patient was managed as an outpatient in the gastroenterology clinic, advised to stop taking HistaEzeHerbal supplements, although used quite frequently for improving health, have been associated with damage to the body, especially the liver. However, many patients do not fully volunteer this information as they feel it is harmless and can be misdiagnosed as acute viral hepatitis, autoimmune hepatitis, or alcoholic liver disease . Its effTM\u00a0contains quercetin 600 mg, stinging nettle (Urtica dioica) 600 mg, and sodium bicarbonate in addition to\u00a0Tinospora cordifolia\u00a0extract (stem). There are no case reports of liver injury from quercetin or\u00a0Urtica dioica\u00a0which have both been widely used all over the world for many years. Hence, we suspect that the liver injury is from\u00a0Tinospora cordifolia\u00a0extract [HistaEze\u00a0extract .\u00a0Tinospora cordifolia-induced\u00a0liver injury remains unclear, its mechanism of toxicity appears to be an idiosyncratic liver injury, or immunomodulatory mechanism, or the unveiling of subtle autoimmune hepatitis. Autoimmunity has been thought to play a role as liver histology shows some similarities with atypical autoimmune features like hepatic plasma-lymphocytic infiltrations but without explicit features of autoimmune hepatitis and negative anti-smooth antibodies [Although the precise pathophysiology of\u00a0tibodies . Hence, Tinospora cordifolia\u00a0to symptom onset is about 46 days [Herb-induced liver injury shares similarities with DILI regarding manifestations, which may depend on frequency, dosage, duration, and associated risk factors like autoimmunity and chronic liver disease. The median time from intake of\u00a0 46 days . The pat 46 days ,7. The s 46 days .\u00a0Before diagnosing HILI, it is imperative to thoroughly rule out other causes of liver injury by obtaining a liver and coagulation panel, viral hepatitis panel, autoimmune serologies, and imaging. The RUCAM\u00a0score, which is used as a grading system for clinical diagnosis of DILI, could be utilized for HILI as well: <1 excluded; 1-3 unlikely; 3-5 possible; 6-8 probable, and >8 highly probable . A liverTreatment entails discontinuing the offending agent and monitoring liver enzymes weekly or biweekly for a gradual decline in transaminase levels. Steroid therapy may be considered as there are some features of drug-induced autoimmune hepatitis with this herbal supplement and reports of faster improvement of liver labs and spontaneous resolution . The proTinospora cordifolia-induced liver injury, whose use has become prevalent since the COVID-19 pandemic. A high level of suspicion is needed due to its close similarities to other forms of liver injury. Early identification and discontinuation of the offending medication provide critical diagnostic and prognostic value. Further studies are needed to define the prognosis of patients with underlying liver disease and co-morbidities.\u00a0There is also a critical need to raise public awareness of the dangers of herbal supplements, which are not well-regulated, unlike allopathic medications.This case highlights a case of"}
+{"text": "Atorvastatin is a commonly used statin for the treatment of hypercholesterolemia in people at high risk for coronary, cerebrovascular, and peripheral artery disease. However, fatal liver failure due to atorvastatin treatment has been rarely reported, especially during the very short incubation period.A 63-year-old male patient was admitted due to unexplained chest pain. After admission, his liver function had decreased < 24 hours after taking 20\u2009mg tablets of atorvastatin due to lacunar infarction, which was improved after drug withdrawal. The treatment regimen was restarted 15 days later, but within 16 hours, the patient developed multiple organ failure, including liver failure and renal failure.The pathological results after 7 days indicated focal inflammatory necrosis, virus and autoimmune correlation tests were negative, which did not rule out drug-induced liver injury. Interventions: receiving artificial liver therapy, continuous renal replacement therapy and other organ support treatment.The patient died 18 days after admission.Statin idiosyncratic liver injury is very rare, but the consequences can be serious. A large proportion of commonly used medications, in addition to herbal and dietary supplements, can cause liver injury. The most important drug groups are antibiotics, antituberculous medications, nonsteroidal anti-inflammatory drugs and immunosuppressants. Because many elderly and frail patients have basic cardiovascular and cerebrovascular diseases, severe infection is more common and more often complicated by other conditions requiring medication treatment. Once a drug-induced liver injury occurs, it is sometimes difficult to determine which drug is responsible for the injury. Statins are commonly used to treat hyperlipidemia, coronary artery disease and other atherosclerotic diseases because of their ability to lower cholesterol. Side effects limit the wide application of these drugs to a certain extent. Common side effects include neurological and neurocognitive effects, hepatotoxicity, renal toxicity, gastrointestinal, urogenital, reproductive, etc. A DILI is a relatively important side effect, with an incidence of approximately3%. A statin-induced liver injury is generally dose-and time-dependent and can be relieved after drug withdrawal, thus the probability of chronic hepatitis is very low. Although an idiosyncratic liver injury has a 75% risk of death or need for liver transplantation, itis not generally dose-dependent. Therefore, clinicians should be aware of and suspect fatal liver failure induced by atorvastatin.A drug-induced liver injury (DILI) is an important but rare adverse event that can lead tomild liver enzyme elevations, liver failure, the need for transplantation or even death.A 63-year-old male farmer was admitted for \u201cchest pain for 8 hours\u201d. More than 2 years ago, the patient underwent thoracolaparoscopic radical resection of an esophageal carcinoma under general anesthesia, was treated with 2 courses of gimeracil and oteracil potassium capsules and followed up regularly. Eight hours before admission, the patient reported he experienced chest pain without obvious inducement, which was aggravated with respiratory movement and relieved after rest. No chest distress, shortness of breath, nausea, cough, expectoration, abdominal pain, or abdominal distension was reported nor observed at admission. Physical examination showed the following: body temperature, 38.0\u00b0C; pulse, 101 beats/minutes; respiration rate, 18 breaths/minutes; blood pressure,123/67\u2009mm Hg; NRS score for left shoulder and back pain, 2 points; stable breathing; no icteric skin or sclera or bilateral supraclavicular lymph node enlargement; old surgical scars on the neck and chest, clear breath sounds in both lungs, with no obvious rales; flat and soft abdomen, no tenderness; and the liver and spleen were not palpable under the ribs. Chest CT showed the following: Postoperative changes in the esophagus; Arcuate gas shadow in front of the heart (suspected pneumomediastinum); A small amount of pericardial effusion, and; A patchy shadow in the anterior segment of the right upper lobe , which has been rarely reported, with this being the second report to my knowledge. Early Li et al reported a case of mild-to-moderately impaired liver function 12 hours after the application of fluvastatin drugs, and the prognosis was good after drug withdrawal. The mechanism of statin-induced liver injury is unknown, and the possible cause may be autoimmune hepatitis induced by this class of drugs, but we examined autoimmune-related parameters and found no abnormalities. Thus, hepatic impairment due to this cause was tentatively excluded. It has also been suggested that a statin liver injury is associated with oxidative stress. However, because we lacked previous knowledge of this aspect, no relevant examinations were performed. A liver injury occurs very early in the course of treatment, is apparently not dose-dependent and is individual specific, similar to amoxicillin and clavulanate potassium. Therefore, a clinically significant statin-induced liver injury may have idiosyncratic and immune allergic mechanisms. The specific mechanism of statin-induced liver failure in this patient is still unclear. It is likely that individual susceptibility to statins, genetics and polymorphisms play an important role in the hepatotoxicity of statins.A liver injury occurs very early in the course of treatment, is apparently not dose-dependent and is individual specific. Therefore, although statins are considered safe medications, it is still necessary to be aware of a potentially fatal liver injury based on this case and previous literature reports, especially for patients with acute liver disease, decompensated liver disease, or a history of suspected drug liver damage, for whom the use of these drugs should be avoided as much as possible. There is currently a lack of evidence supporting the reinitiation of a statin regimen or a reduced dosage regimen, and some data even suggest that it is relatively safer to replace statins with other drugs than to continue a statin regimen, but this hypothesis requires validation through more observational studies. However, due to insufficient attention in the early stage of treatment, a statin-induced liver injury was once mistaken for an infection-related liver injury, so the severity of a heterogeneous liver injury caused by atorvastatin was not fully recognized. In this patient, the later stage of liver failure progressed rapidly, with abnormal coagulation function and unstable vital signs, and liver transplantation was unfortunately not performed.As the proportion of aging adults within the general population increases, the incidence of cardiovascular and cerebrovascular diseases is increasing yearly. Statins have been confirmed to significantly reduce serum cholesterol and triglyceride levels, reduce lipids in atheromatous plaques, reduce inflammation and improve endothelial function to effectively reduce the incidence and mortality of cardiovascular and cerebrovascular diseases, despite unknown side effects. They are considered to be relatively safe drugs and have become one of the most prescribed drugs in developed countries.In conclusion, statin idiosyncratic liver injury is very rare, but the consequences can be serious.We thank the staff and patients for their contributions and participation in the study.Formal analysis: Ye Fu.Investigation: Shiyi Liu, Chenjie Zhou.Methodology: Shiyi Liu.Writing \u2013 review & editing: Huajun Wang."}
+{"text": "To assess the functionality of our BBB models, we analysed the crossing efficiency of adeno-associated virus (AAV) vectors and peptide-conjugated antisense oligonucleotides, both currently used in genetic approaches for the treatment of rare diseases. We demonstrated superior barrier crossing by AAV serotype 9 compared to serotype 8, and no crossing by a cell-penetrating peptide-conjugated antisense oligonucleotide. In conclusion, our study shows that iPSC-based models of the human BBB display robust phenotypes and could be used to screen drugs for CNS penetration in culture.The blood\u2013brain barrier (BBB) is the specialised microvasculature system that shields the central nervous system (CNS) from potentially toxic agents. Attempts to develop therapeutic agents targeting the CNS have been hindered by the lack of predictive models of BBB crossing. In vitro models mimicking the human BBB are of great interest, and advances in induced pluripotent stem cell (iPSC) technologies and the availability of reproducible differentiation protocols have facilitated progress. In this study, we present the efficient differentiation of three different wild-type iPSC lines into brain microvascular endothelial cells (BMECs). Once differentiated, cells displayed several features of BMECs and exhibited significant barrier tightness as measured by trans-endothelial electrical resistance (TEER), ranging from 1500 to >6000 \u03a9cm The blood\u2013brain barrier (BBB) is primarily composed of highly specialised brain microvascular endothelial cells (BMECs) sharing the basal lamina with pericytes and end-processes of astrocytes . Althoug+ and Cl\u2212 [Recent advances in iPSC technologies have made it possible to reliably produce cell lineages of interest in culture. Development of a reproducible protocol for differentiation of iPSCs into BMECs by Shusta\u2019s group  has enab and Cl\u2212 . Permeab and Cl\u2212 ,13. The  and Cl\u2212 .Gene therapy approaches for treating human disease have recently accomplished significant successes. In particular, the development and marketing approval of antisense therapeutics  and adeno-associated virus (AAV) gene therapy  for the treatment of spinal muscular atrophy (SMA) have represented an important milestone . NusinerIn vitro models to screen and investigate BBB crossing by such potential therapeutics would significantly aid development and contribute to reducing reliance on animal experiments in the pre-clinical settings. Patient-specific iPSC-derived BBB models have been very useful to understand mechanisms of disease and screening therapeutics . Althoug\u00ae permeable polyester inserts  were coated with collagen I before seeding hCMEC/D3 cells. Human fibroblast-derived iPSC clone 4603  and clones 19-9-7T and AD3-CL1  were maintained on Matrigel  in mTeSR1 medium . iPSCs were differentiated to brain BMECs using the protocol by Lippmann et al. [Unless otherwise stated, all chemicals were purchased from Merck . hCMEC/D3 cells were maintained on 0.1 mg/mL rat tail collagen I -coated tissue culture flasks in endothelial cell growth medium . Coverslips, culture plates and Transwelln et al. . In ordeCells were fixed with 4% paraformaldehyde for 15 min at room temperature and washed twice with ice-cold phosphate buffered saline , then permeabilised with 0.25% Triton X-100 for 10 min at room temperature and washed with PBS three times for 5 min. This was followed by blocking in 1% bovine serum albumin (BSA) in PBS-Tween for 30 min at room temperature, and incubation with Alexa Fluor 488 conjugated occludin or claudin\u20135 monoclonal antibody  diluted 1:100 with 1% BSA in PBS-Tween for 1 h at room temperature in the dark. Cells were washed three times with PBS for 5 min and nuclei were stained with 1 \u03bcg/mL DAPI for 1 min at room temperature. Finally, cells were washed with PBS before mounting the slides. Images were captured with a Zeiss Axio Observer D1 fluorescence microscope using Zen software .+ and PECAM\u20131+ cells were analysed with reference to unstained cells.Cells were dissociated with accutase, spun down and washed with PBS. FACS buffer (PBS containing 1% BSA and 0.1% sodium azide) was used to resuspend the cell pellet. Around 500,000 cells were incubated with 1:10 diluted GLUT\u20131 antibody conjugated to fluorescein  and PECAM\u20131 antibody conjugated to PE  for 30 min at room temperature. Cells were washed twice with FACS buffer, resuspended in 200 \u03bcL FACS buffer and analysed on a BD FACS Canto II flow cytometer . GLUT\u20131\u00ae permeable polyester inserts  with 1.12 cm2 area and 0.4 \u03bcm pore size were coated with either collagen I (hCMEC/D3) or collagen IV and fibronectin (iPSC-derived BMECs). Cells were seeded at a density of 900,000 cells/cm2 for 48 h. The TEER of the cell monolayer and the inserts coated with collagen IV and fibronectin or collagen I was measured using an EVOM voltohmmeter with STX2 electrodes . The resistance of the coated inserts was subtracted from the resistance of the cell monolayer and then multiplied by the surface area of the insert (1.12 cm2) to calculate the TEER in \u03a9cm2. Cells were equilibrated to room temperature for 20 min before the TEER measurements and allowed to recover for at least 30 min before further experimentation.Transwell\u00ae inserts 30 min after TEER measurements. Stocks were prepared by dissolving LY and Na-F to a concentration of 0.1 mg/mL in Ringer HEPES buffer -1-piperazineethanesulfonic acid, pH 7.4). Medium was aspirated from both apical and basal chambers. Ringer HEPES buffer was pre-warmed to 37 \u00b0C, 1 mL of Ringer HEPES buffer was added to the basal chamber and 0.5 mL of stock (0.1 mg/mL) of LY or Na-F in Ringer HEPES buffer was added to the apical chamber. Cells were incubated at 37 \u00b0C for 60 min. A total of 150 \u03bcL from each basal chamber was transferred to a 96 well plate, along with 0.1 mg/mL stock solutions of LY and Na-F and a blank solution of Ringer HEPES buffer. Fluorescence intensity was measured immediately using a SpectraMax Gemini XS microplate reader . The percentage of permeability was calculated from the relative fluorescence units using the following formula:Permeability assays were performed using cells in TranswellThe values obtained were doubled to compensate for the 2-fold increase in volume in the basal chamber compared to the apical chamber.g for 10 min. The AAV vector in the supernatant was concentrated by overnight precipitation at 4 \u00b0C with a final concentration of 8% (w/v) Poly(ethylene glycol) 8000 (PEG 8000)/0.5 M NaCl solution. The precipitated vector was then centrifuged at 2500\u00d7 g, at 4 \u00b0C for 30 min. The vector-containing cell pellet and the precipitated vector pellet were resuspended in lysis buffer , combined and subjected to three freeze/thaw cycles to lyse the cells. The virus particles were purified on an iodixanol gradient of layered 60%, 40%, 25%, and 15% iodixanol  and centrifuged at 350,000\u00d7 g, at 18 \u00b0C for 2 h. The AAV vector-enriched, 40% iodixanol layer was desalted and concentrated using 1X PBS-MK  and Amicon Ultra-15 . Several centrifugation steps were carried out at 4500\u00d7 g, at 4 \u00b0C for 20 min per step until the volume was reduced to 250 \u00b5L. The AAV vector genome concentration, expressed in vector genomes (vg)/mL, was determined using real-time quantitative PCR (qPCR).ssAAV9-CBA-eGFP was custom-produced by Atlantic Gene Therapies. ssAAV8-Spc512-eGFP and scAAV9-CMV-eGFP vectors were produced in house by transfection of adherent HEK293T/c17 cells in Corning roller bottles  with a two-plasmid system using polyethylenimine (PEI). Cells and supernatant were harvested 3 days post-transfection and centrifuged at 3000\u00d7 \u00ae inserts at a density of 900,000 cells/cm2 and cultured for 48 h, after which 7.7 \u00d7 1010 vector genome (vg) units of ssAAV9-CBA-eGFP were added to the apical chamber of the Transwell\u00ae. Next, 20 \u03bcL samples were taken from the basal chamber at 4, 24, 48 and 72 h post-vector treatment. To compare the crossing of AAV8 and AAV9 vectors, 7.7 \u00d7 1010 vg units of ssAAV8-Spc512-eGFP or scAAV9-CMV-eGFP were added to the apical chamber of the Transwell\u00ae using only 4603-derived BMECs. At 72 h post-vector treatment, 20 \u03bcL samples were taken from the basal chamber. DNA was extracted using DNeasy kit  following DNase I  and proteinase K  treatment. qPCR was performed using 500 nM primers for CBA promoter in ssAAV9-CBA-eGFP  or primers for the inverted terminal repeat (ITR) in ssAAV8-Spc512-eGFP and scAAV9-CMV-eGFP  and SensiMix\u2122 SYBR\u00ae No-ROX Kit . DNA from viral stock was serially diluted and 5 \u00b5L of each dilution was used in qPCR to prepare the standard curve.To assess the crossing of AAV vectors through the iPSC-derived BBB models, differentiated cells were seeded on Transwell\u00ae inserts at a density of 900,000 cells/cm2 and SMA type I fibroblasts were cultured in the basal chamber of the Transwell\u00ae at a density of 26,000 cells/cm2 for 48 h. PMOs enhancing SMN2 pre-mRNA exon 7 inclusion [\u00ae insert with BMECs. As a control, 2.5 \u03bcM PMO was added directly to the SMA type I fibroblast cells. The SMA type I fibroblasts were harvested 24 h later and RNA was extracted using the RNeasy mini kit . cDNA was synthesised using High-Capacity cDNA Reverse Transcription Kit  with 1 \u03bcg of RNA. qPCR was performed using SensiMix\u2122 SYBR\u00ae No-ROX Kit  with 20 ng of cDNA per reaction in a total volume of 20 \u03bcL. Primers for GAPDH, \u22067 SMN2 and full-length SMN2 were used at a concentration of 500 nM . Data were normalised to the housekeeping gene GAPDH, standardised to levels in mock fibroblasts and analysed using the 2\u2212\u2206\u2206CT method. Data were expressed as full-length to \u22067 SMN2 mRNA ratio.For the PMO permeability studies, 4603-derived BMECs were seeded on Transwellnclusion  were incp values of less than 0.05 were considered statistically significant.Experiments were performed in triplicate as a minimum. Data are presented as mean \u00b1 standard error of the mean (SEM). Graphpad Prism Version 6.07  was used to analyse data. Statistical significance was analysed by using one-way or two-way analysis of variance (ANOVA) followed by Tukey post-hoc analysis. 2 and cultured for 48 h. hCMEC/D3 cells were similarly seeded on collagen I-coated coverslips and kept for 48 h. BMECs derived from iPSC clones 4603 and 19-9-7T exhibited uniform expression of both claudin\u20135 and occludin. Although BMECs derived from AD3-CL1 showed less widespread expression of both claudin\u20135 and occludin, this was still in contrast with hCMEC/D3, where these proteins were undetectable.The BBB phenotype is characterised by very tight junctions between BMECs. Several proteins are involved in forming the tight junctions and the presence of two of them, occludin and claudin\u20135, was assessed using immunocytochemistry A. Three GLUT\u20131 is responsible for glucose transport to the brain and is considered a key marker of BMECs. Platelet Endothelial Cell Adhesion Molecule\u20131 (PECAM\u20131) is involved in angiogenesis, leukocyte migration and integrin activation. The analysis of both proteins can easily be performed using flow cytometry and we used this technique to further characterise the iPSC-derived BMECs B. Cells 2 for monolayers under static conditions and around 1000 \u03a9cm2 under dynamic flow, but the TEER can rapidly decrease when flow is discontinued [2. At 48 h, TEER values positively correlated with cell density up to 800,000 cells/cm2, reaching a maximum of around 80 \u03a9cm2  and sodium fluorescein (Na-F) are widely used fluorescent tracers with molecular weights of 550 Da and 376 Da, respectively. iPSC-derived BMECs and undifferentiated iPSCs were seeded on collagen IV and fibronectin-coated Transwellound 16% A. A simiound 16% B. Permea10 vg particles of ssAAV9-CBA-eGFP were added to the apical chamber of the Transwell\u00ae. Medium samples were harvested from the basal chamber at 4, 24, 48 and 72 h. Vector genomes were quantitated using qPCR in the basal chamber samples. We observed crossing of the AAV9 vector in a BMEC clone- and time-dependent manner. AAV9 showed crossing capability in all three models, with a maximum of around 5.8 \u00d7 109 vg at 72 h in AD3-CL1-derived BMECs  has shown positive effects in a severe SMA mouse model [SMN2 mRNA (We further investigated BBB crossing by another type of genetic treatment for SMA, a cell-penetrating peptide-conjugated morpholino. A high concentration of systemically administered Pip6a-PMO able to promote the inclusion of se model . TherefoMN2 mRNA C. The adEfforts to model the BBB in vitro have included the use of primary animal BMECs, primary human BMECs from biopsies, co-cultures of BMECs with different combinations of other BBB cells, and commonly, the immortalised human cerebral microvascular endothelial cell line hCMEC/D3. Animal cell-derived systems are not ideal to model the human BBB and the use of primary human cells is not sustainable. The use of hCMEC/D3 cells was a significant advance, but this cell line has several limitations, such as low TEER and reduced expression of tight junction proteins . The dev2, using iPSC-derived BMECs in serum-free medium including B27 supplement [2 [2 and venous vessels around 900 \u03a9cm2 [2 for rats [2 has previously been reported for a co-culture system involving iPSC-derived BMECs, pericytes and astrocytes [2 [2 [2, over 70-fold higher than in hCMEC/D3 cells, while for 19-9-7T-derived BMECs it was over 5000 \u03a9cm2. TEER values of AD3-CL1 BMECs were lower, at around 1500 \u03a9cm2.The maximum in vitro TEER value reported to date is around 8000 \u03a9cmpplement . The aveement [2  whereas 900 \u03a9cm2 . The higfor rats . A TEER trocytes . The maxcytes [2 . A recenes [2 [2 . In our Furthermore, 4603 and 19-9-7T BMECs were also consistently more proficient than AD3-CL1 BMECs in relation to other features of the BBB, including expression of occludin and claudin\u20135, and low permeability to para-cellular markers. hCMEC/D3 was less efficient in all these tests, suggesting that the TEER of all these iPSC-derived BBB models correlates well with other BBB features and depends on the iPSC clone they were differentiated from. Inter-individual variation in cell maturation and functionality of iPSC-derived BMECs has been previously reported . In our 9 vg at 72 h. Crossing was greatest through AD3-CL1-derived BMECs and lowest through 4603-derived BMECs. This suggests an inverse correlation between the tightness of the barrier and AAV9 crossing, indicating the involvement of para-cellular transport of AAV as well as other mechanisms such as transcytosis [Many serotypes of AAVs have been tested for proficiency to cross the BBB . Facial scytosis ,40. DireSMN2 mRNA ratio, Pip6a-PMO added to the BBB model did not have any significant effect on full-length/\u22067 SMN2 mRNA ratio in SMA type I fibroblasts in the basal chamber, indicating no BBB crossing. It should be noted that when assessing BBB crossing of gene therapies such as AAV vectors and antisense oligonucleotides, the potential effect of these therapeutics on the BMECs should be considered. These drugs could affect the phenotype of BMECs, for example, by altering the expression of BBB junction and transporter proteins, thus possibly modifying TEER values and permeability of the BBB.Cell-internalising peptide-conjugated PMOs have been designed to improve cell uptake of PMOs in several diseases, including spinal muscular atrophy ,18. SystThe purpose of this study was to assess several iPSC-derived BMEC lines for the generation of simple and reproducible models of the BBB, and to compare them to the most widely used and characterised human in vitro model, hCMEC/D3, with the ultimate goal of testing therapeutics. All three iPSC-derived BBB models were superior to hCMEC/D3, and the quality of the barrier was dependent on the iPSC clone used. Our study demonstrates that hCMEC/D3 has reduced expression of tight junction proteins and GLUT\u20131, which is in line with the findings reported after transcriptional profiling . hCMEC/D"
\ No newline at end of file