diff --git "a/deduped/dedup_0972.jsonl" "b/deduped/dedup_0972.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0972.jsonl"
@@ -0,0 +1,46 @@
+{"text": "An Oriental and Colourpoint Shorthair cat pedigree segregating for albinism was analysed for association with TYR by linkage and sequence analyses. Microsatellite FCA931, which is closely linked to TYR and TYR sequence variants were tested for segregation with the albinism phenotype. Sequence analysis of genomic DNA from wild-type and albino cats identified a cytosine deletion in TYR at position 975 in exon 2, which causes a frame shift resulting in a premature stop codon nine residues downstream from the mutation. The deletion mutation in TYR and an allele of FCA931 segregated concordantly with the albino phenotype. Taken together, our results suggest that the TYR gene corresponds to the colour locus in cats and its alleles, from dominant to recessive, are as follows: C (full colour) > cb (burmese) \u2265 cs (siamese) > c .Albino phenotypes are documented in a variety of species including the domestic cat. As albino phenotypes in other species are associated with  To confirm that albinism is a TYR allele in cats, an analysis of an Oriental and Colourpoint Shorthair cat pedigree that segregates for albinism .Tyrosinase exons were sequenced as previously described , which was confirmed by sequence and restriction fragment length polymorphism (RFLP) analyses , burmese (cb) and siamese (cs), suggesting the allelic series C > cb \u2265 cs > c based on mutations in TYR. However, sufficient breeding studies have not been performed to confirm the allelic series in cats, specifically, the interaction of full colour and burmese with the albino allele.In our previous study  and in cattle  albinism, but the difference in the tapetal reflex suggests that the single report of a red-eyed albino cat may be in error.Albino cats have been reported in the literature (TYR at position 975 in exon 2 is associated with albinism in cats. This mutation could be used in a DNA test to detect carriers and assist with breeding programmes. This finding also supports the use of the cat as a model for human TYR-associated albinisms.In conclusion, we propose that a cytosine deletion in"}
+{"text": "Objective: To test whether special training of general practitioners alters the care of dementia patients through their systematic recommendation of caregiver counseling and support groups.More than 90% of dementia patients are cared for by their general practitioners, who are decisively involved in the diagnosis, therapy and recommendation of support services. 129 general practitioners enrolled 390 dementia patients and their informal caregivers in a prospective, three-arm cluster-randomized 2-year study. Arm A constituted usual care, in Arm B and C support groups and caregiver counseling  were recommended by the general practitioners. The general practitioners received arm-specific training. Diagnostic and therapeutic behavior of physicians was recorded at baseline. Informal caregivers were questioned in follow-up after 2 years about the utilization of support services.The diagnostic behavior of the general practitioners conforms to relevant guidelines. The procedure in newly-diagnosed patients does not differ from previously diagnosed patients with the exception of the rate of referral to a specialist. About one-third of the newly-diagnosed dementia patients are given an anti-dementia drug. The utilization of support groups and counseling increased five- and fourfold, respectively. Utilization of other support services remained low (< 10%), with the exception of home nursing and institutional short-term nursing.Trained general practitioners usually act in conformity with guidelines with respect to diagnosing dementia, and partly in conformity with the guidelines with respect to recommended drug therapy. Recommendations of support services for informal caregivers by the general practitioner are successful. They result in a marked increase in the utilization rate for the recommended services compared to offers which are not recommended by the general practitioner.ISRCTN68329593 Medical care of elderly people in Germany is given by general practitioners in the majority of cases. This applies also to dementia patients: more than 90% are diagnosed and cared for by the general practitioner . He is rVarious studies have thus far investigated the diagnostic behavior of general practitioners toward dementia patients ,7-9. StoIn the literature, a guideline-supported care rate of patients with Alzheimer's disease (AD) with evidence-based anti-dementia drugs of 26% ,16 or evFor diagnostics, the International Guideline of the National Institutes for Health and Clinical Excellence (NICE) recommend thorough exploration, including the medical history, a physical-clinical examination, and performance of a cognitive screening. Moreover, a laboratory series  should be part of the basic screening. Other procedures  should only be performed after careful consideration. Imaging procedures are recommended for diagnostics of dementia subtypes . The diaFor the treatment of AD patients, the German \"Dementia\" Guideline for general practitioners recommends drug therapy  and non-drug therapy , whereby the use of anti-dementia drugs is subject to critical discussion . The criIn addition to treating dementia patients, the aim is to support informal caregivers with appropriate support and respite services which have been found to be effective -28, suchInitiative Demenzversorgung in der Allgemeinmedizin: Dementia Care Initiative in Primary Practice) presented here, the care of dementia patients living at home and their informal caregivers was to be optimized with respect to diagnostics, therapy and support services. This took place on the basis of training of general practitioners and systematic recommendation of support groups in the form of peer groups and actively approaching caregiver counseling of informal caregivers.In the German IDA-Study  be increased by recommendation of the general prac-titioner?What effect does the utilization of family caregiver counseling have on the utilization of other available support services?This was a three-armed cluster-randomized controlled longitudinal study of patients with dementia living at home with at least one care-giving informal caregiver. Patients in the study region of Middle Franconia, Bavaria, Germany, were included if they had mild or moderate dementia (MMSE 10-24) according to the diagnosis criteria of DSM-IV  respectiGeneral practitioners in all study groups participated in a training course on dementia diagnosis. In the two intervention groups B and C, they additionally received training on evidence based dementia treatment. They also recommended support groups and actively approaching family counselling to caregivers beginning either at baseline (study Arm C) or after the 1-year follow-up (study Arm B).http://www.controlled-trials.com/. A detailed description of the study design has already been published elsewhere , par, par29]]General practitioners behave largely in conformity with guidelines in their diagnostic procedures in dementia patients. The therapeutic behavior with respect to prescription of anti-dementia drugs was in the majority less in accordance with guideline recommendations. However, there are some hints that behavior in conformity with guidelines could be promoted by means of training. Utilization of support services by informal caregivers remains low, as long as the informal caregivers are not intensively motivated to use such services. The role of the general practitioners as a motivator for informal caregivers is very significant, since the mediation of support services through the general practitioner led to a clear increase in utilization. For research, it is important to investigate the efficacy of further concepts in overcoming barriers to utilization among the informal caregivers of dementia patients.The sponsors have commissioned two academic research institutions with the scientific evaluation of the IDA project by giving unconditional research funds. A contract between the sponsors and academic researchers ensures that the latter have the full scientific responsibility and have the right to publish the results. Members of the sponsoring organizations closely cooperate in design and conduct of the project, but only the academic researchers have full access to all of the data in this study and take complete responsibility for the integrity of the data and the accuracy of the data analysis. CD, EG, MGS, RH and PMe are independent scientists who have received funding for this study as described above. CD received an honorarium for presentation of the IDA-study results at a public symposium from Eisai GmbH. Sponsoring organizations: SW is employee of the AOK Bavaria - Health insurer, JL is employee of the Federal Association of the AOK, HM is employee of Eisai GmbH, PMa is Head of Market Access of Pfizer Germany and SR is a former employee of Pfizer Germany. The IDA project was initiated and financed by the four partners with equal rights in conception, development and implementation: the AOK Bavaria - Health insurer and the Federal Association of the AOK - one of the largest statutory health insurances in Germany - and the research-based pharmaceutical companies Eisai and Pfizer. The aim of this public-private-partnership is to improve the care of dementia patients and the support of their informal care-givers.CD carried out the statistical procedures, interpretation of the data and wrote the manuscript. RH is principal statistical investigator, participated in the design of the study and gave advice concerning data analysis. EG is principal clinical investigator, participated in the design of the study and helped to draft the manuscript. PMe contributed to the data analysis by calculating cluster-effect adjusted measures. MGS carried out the data management and quality assurance of the data. JL planned and supervised the project and gave advice concerning structuring the manuscript. HM, PMa, SR planned and accompanied the research project and revised the manuscript. SW was the head of the local project team and revised the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/10/314/prepub"}
+{"text": "Current guidelines for dementia care recommend the combination of drug therapy with non-pharmaceutical measures like counselling and social support. However, the scientific evidence concerning non-pharmaceutical interventions for dementia patients and their informal caregivers remains inconclusive. Targets of modern comprehensive dementia care are to enable patients to live at home as long and as independent as possible and to reduce the burden of caregivers. The objective of the study is to compare a complex intervention including caregiver support groups and counselling against usual care in terms of time to nursing home placement. In this paper the study protocol is described.The IDA (Initiative Demenzversorgung in der Allgemeinmedizin) project is designed as a three armed cluster-randomized trial where dementia patients and their informal caregivers are recruited by general practitioners. Patients in the study region of Middle Franconia, Germany, are included if they have mild or moderate dementia, are at least 65 years old, and are members of the German AOK (Allgemeine Ortskrankenkasse) sickness fund. In the control group patients receive regular treatment, whereas in the two intervention groups general practitioners participate in a training course in evidence based dementia treatment, recommend support groups and offer counseling to the family caregivers either beginning at baseline or after the 1-year follow-up. The study recruitment and follow-up took place from July 2005 to January 2009. 303 general practitioners were randomized of which 129 recruited a total of 390 patients. Time to nursing home admission within the two year intervention and follow-up period is the primary endpoint. Secondary endpoints are cognitive status, activities of daily living, burden of care giving as well as healthcare costs. For an economic analysis from the societal perspective, data are collected from caregivers as well as by the use of routine data from statutory health insurance and long-term care insurance.From a public health perspective, the IDA trial is expected to lead to evidence based results on the community effectiveness of non-pharmaceutical support measures for dementia patients and their caregivers in the primary care sector. For health policy makers it is necessary to make their decisions about financing new services based on strong knowledge about the acceptance of measures in the population and their cost-effectiveness.ISRCTN68329593 Dementia care is one of the most important challenges for health care systems in the greying societies of \u2013 for example \u2013 the US or Europe. Based on epidemiological prognoses they will have to cope with doubled or tripled figures of dementia patients until 2050 -3. In GeLooking at current clinical dementia guidelines, there seems to be sufficient evidence for the efficacy of some drugs (e.g. cholinesterase inhibitors) in symptomatic therapy aiming at the delay of the disease progress. However, the scientific evidence concerning non-pharmaceutical interventions for dementia patients and their informal caregivers remains inconclusive -15. ReasBecause in Germany general practitioners (GPs) play the key role in health care of the elderly, they automatically come into focus when introducing new services in dementia care. In most cases GPs are primarily faced with essential tasks like detecting and diagnosing dementia, information of patient and family members, drug therapy, and linking to further counselling and supportive measures. Especially in the care of non-institutionalized dementia patients, the GPs' influence on the help seeking behaviour of patients and caregivers can be decisive for families' willingness to accept external support and expert counselling. A systematic interdisciplinary collaboration between GPs, medical specialists and professionals in the field of social and psychological dementia care will be a key issue in the future .In current practice the context of dementia care is difficult and study results -31 hint On the societal level, dementia is a stigmatized disease surrounded by influences of ageism. Patients and caregivers often deny dementia symptoms, experience difficulties in accepting the diagnosis, and react to the disease with social withdrawal and depression. They have a lack of disease specific knowledge and of information on regional support and counselling services. This lack of knowledge is often shared by their GPs  who haveAll these above mentioned factors in sum lead to delayed and insufficient care with regard to diagnostics, treatment, counselling and social support for many dementia patients ,26. TherThe IDA study aims to combine several treatment options including training of GPs concerning diagnosis and treatment of dementia, out-patient specialist support for GPs, the offer of support programs and counseling for informal caregivers of patients with dementia.The main research questions of the IDA project, from the perspectives of health care and health economics, are: (1) Is a complex intervention for community dwelling dementia patients, their caregivers and doctors more effective than usual care with respect to postponement of nursing home placement? (2) Does the intervention have an effect on disease progression and on caregiver burden? (3) Is the intervention cost-effective compared to usual care when assessed from the societal perspective? The objective of this paper is to describe the study protocol of the cluster-randomized IDA study. Recruitment and follow-up of all study patients have ended and the analysis phase has started by spring 2009. The detailed description of the study background and protocol is published as a reference for forthcoming papers describing the study results.The IDA study is designed as a three-armed cluster-randomized trial. The main research hypothesis is that for dementia patients still living at home a complex intervention consisting of an initial training of GPs in evidence based diagnosis and treatment, of the provision of caregiver support groups, and of actively approaching family counselling, can prolong time to nursing home placement in comparison to usual care. In comparison to usual care (study arm A), one intervention group receives additional training of GPs in medication and non-medication based therapies for dementia, and caregivers are offered to participate in caregiver support groups (study arm B), whereas in the second intervention group actively approaching family counselling is additionally implemented (study arm C). The duration of the intervention phase is two years. However, a change of study design became necessary due to the unexpected slow recruitment of patients (18 months instead of 6 months) and the very low participation rates of caregivers in the caregiver support groups. The main focus of the study was shifted towards the comparison of groups A and C. In group B, the actively approaching family counselling was implemented after the 1-year follow-up. Thereby, patients in arm B can serve as an intermediate intervention group in the first year and as an additional full intervention group in the second year. The new study design is shown in Figure The study region Middle Franconia is a mixed urban rural area around Nuremberg in Bavaria, Germany.All GPs in the study region in Middle Franconia (about 1200) were contacted with an information leaflet and invited to participate in the project. GPs willing to participate had to sign a contract with the AOK sickness fund. The training sessions (one for each GP) took place with groups of 10 to 30 GPs.After the training, the GP identified all dementia patients in his or her practice who fulfilled the following selection criteria. Patients were included if they had mild to moderate dementia as defined by an MMSE  between 10 and 24 , if theySigned informed consent of study participants and their informal caregivers was required before patients could be entered into the study. The study protocol as well as the amendment necessitated by the change in study design has been approved by the Ethics Committee at the Bavarian Chamber of Physicians. . Furthermore, the study is conducted in accordance to German privacy law and in compliance with the Helsinki Declaration. Recruitment of patients started in June 2005 and ended in December 2006.The IDA project is a cluster-randomized study where the general practices are the clusters and thus the units of randomization. If two or three GPs from the same group practice wanted to participate in the study and attended the training course, they were randomized into the same study arm. The randomization was done by the statistics and data centre, usually one day before each training course when the full list of registered participants was available. We applied the randomization method of permuted blocks within strata, where stratification was done with respect to study region and type of practice (single vs. group). The allocation ratio was 1:1:1. The GPs were informed about their assigned study arm during the training course.The study arm A serves as a control group where patients receive usual care. However, since GPs served as mediators of the intervention in IDA, all participating GPs received at least basic information concerning dementia diagnosis and about study procedures.The obligatory training course for all participating GPs consisted of a dementia-specific part and a part concerning the study. and the therapy recommendations of the Pharmaceutical Commission of the German Medical Association were used as the basis of the training. The therapeutic and diagnostic part of the training was given by five neurologists or psychiatrists with proven gerontopsychiatric expertise who are active in out-patient care in the study region.The dementia-specific part of the training consisted of dementia diagnostics including execution of the Mini-Mental Status Examination (MMSE) with a video demonstration and a section about patient and caregiver information (120 minutes). Afterwards, the GPs were informed to which study arm they were randomized. GPs of study arm A were separated from B and C and received study-specific information. Group A physicians were trained in early detection and diagnosis of dementia only. Their knowledge of non-medical treatment options and drugs was not part of the initial training. As a comparator this level of knowledge could serve as a proxy for the general status quo. The diagnostic training contained basic information about dementia , anamnesis and physical examination, laboratory diagnostics, and psychometric tests. The additional training for group B and C physicians on treatment of dementia (140 minutes) consisted of information about interfaces in the German health care system, non-medication based treatment, information and counselling of caregivers, medical treatment options, therapy of non-cognitive disorders and specific problems. The dementia guideline for GPs, published by the Witten-Herdecke University All doctors received a folder containing written information specific to groups A, B, or C of the study including the slides of the training, the current dementia guideline and the baseline documentation forms for 10 patients.The medical experts involved in the training offered out-patient consultant support to the GPs in groups B and C. In the case of acute deterioration or problems with therapy, appointments were available for dementia patients at short notice. Additionally a weekend telephone consultant on-call service was set up for the GPs.In groups B and C, the GPs suggested that caregivers should attend a family caregiver support group. The caregiver received an information sheet from the GP with contact details of 17 family caregiver support groups within the study region, all of which had been set up independently from the IDA project. The groups were required to have three qualifying characteristics: (1) professional supervision, (2) hold at least ten formal meetings per year, and (3) contain a psycho-educational element to improve the competencies of the family caregivers. After the consultation, the GP sent a fax to the chosen family caregiver support group, so that it would be possible to verify later which relatives attended a support group following the GP's offer. The family caregiver alone decided whether the visit actually took place or not.The family caregivers in Group C (and in group B after one year as well), were offered a special type of family caregiver counselling which would be recommended to them by their GP. After receiving the registration fax from the GP, the counsellor (now referred to as the \"IDA counsellor\") contacted the family caregiver by phone and tried to establish personal contact in form of a home visit, if possible. The IDA counsellor used elements of case and care management in educating and supporting the family caregivers psychologically and socially, to improve their competences in all facets of care. The aim was to support the family caregiver to the extent that the dementia patient was able to remain in the domestic environment as long as possible. Guidelines were developed for choosing those supportive measures that were expected to have a positive effect in specific situations. The IDA counsellor was also available by phone on weekends.Four IDA counsellors worked in the project. Their professional competence consisted of training and several years of experience in nursing. They were expected to be able to empathise with the family caregivers and they received regular training in subjects important for the counselling process. Because of the large study area, the care managers were assigned to the patients regionally.The study outcome variables concern potential effects of the intervention on the patient and on the caregiver level. In addition, economic outcomes from a societal perspective are registered.The primary endpoint of the study is the remaining time the patient lives at home. This is defined as time from study entry until either nursing home placement (for at least 8 weeks) or death. In an additional analysis, death will be treated as a censoring event.Secondary endpoints are:1. Cognitive functioning of the patients (MMSE)2. Patients' ability to perform ADL and IADL measured by the Barthel-Index  and the 3. Subjective burden of informal caregivers measured by the Burden Scale for Family Caregivers (BSFC) 4. Quality of life of the patients (EQ-5D) -475. Time to death6. Number and duration of hospital stay7. Direct medical and non-medical costs 8. Use of formal care and support services0), follow-ups at six months (only for patients in arm B and C if they receive an antidementive drug) (t6), at twelve months (t12) and after 24 months (t24). If the patient was admitted to nursing home, no further assessments took place but GPs and caregivers were asked about the reasons for the institutionalization.Table 0) consisted of the documentation by the GP including test results and a telephone interview with the primary caregiver. In accordance with a naturalistic study design, documentation was restricted to an essential set of variables. The computer-aided telephone interview with the informal caregiver was conducted by trained interviewers. Apart from the Barthel-Index, NOSGER, and BSFC items, the telephone interview contains detailed assessment of informal care time and the use of formal care by home care services. If the interviewees refused to respond by telephone, they were asked to answer a written version of the questionnaire.The baseline assessment -instrument ,49. FormIntervention costs will be estimated, these include costs for care managers (including labour costs and overhead costs) and for caregiver support groups. Study specific costs, which would not occur in routine application, will not be considered.The study is unblinded with respect to the GPs, the patients, and their caregivers. However, the assessment by telephone interview after one and two years is done by students who are not informed to which study arm the patient belongs.From the methodological point of view, the main problem with cluster randomized trials is the potential for selection bias . AlthougTo address the problem of selection bias, we asked the participating GPs to initially provide a list of all dementia patients in their practice whom they considered eligible for the study. These lists will allow comparison of the basic characteristics of patients participating vs. those not included in the study overall and between study arms.The confirmatory analysis of the study concerns the comparison of the three study groups with respect to the primary endpoint. To account for multiple testing, we plan to apply a closed testing procedure, which consists of testing the global null hypothesis of no difference between all three groups, and, in case of rejection, three subsequent pairwise comparisons with a significance level of 5%. Since the primary endpoint is a censored failure time variable, survival models adapted for clustered data will be applied . All anaFor the sample size calculation, we had to consider a multiple test procedure for a three-group comparison with respect to a censored outcome variable and with allowance for a cluster effect. The calculation was based on an error probability \u03b1 = 0.05 and a statistical power 1-\u03b2 = 0.90 for each of the pairwise comparisons. As a clinically relevant effect we considered a difference of 15% or more in the probability a patient is still living at home after two years. The AD2000 Collaborative Group reported that 25% of the dementia patients had to be moved to a nursing home after two years . This raThe primary economic evaluation will be a cost-effectiveness analysis from the societal perspective. The results will be presented as incremental cost per additional year living at home. We will use the bootstrap approach to calculate confidence intervals for incremental cost-effectiveness ratios. In a secondary cost-utility analysis, quality-adjusted life years (QALYs) will be calculated based on EQ-5D values.In this paper we describe the study design of an innovative cluster-randomized trial evaluating the cost-effectiveness of a complex intervention for GPs and family caregivers of patients with dementia living at home. The IDA study aims to combine several treatment options including training of GPs concerning diagnosis and treatment of dementia, out-patient specialist support for GPs, and support programs and counseling for informal caregivers of patients with dementia. The counseling for caregivers is the main intervention of the IDA study.Particular strengths of the study design are the relatively large sample size, the cluster randomization, the long follow-up of two years, and the availability of complete health insurance data for all patients over the whole study period. Since we planned this study as a so-called pragmatic  trial, we tried to aim at maximum generalizability by recruiting a large number of GPs who cover a mixed urban and rural region typical for Germany. We motivated participating GPs to include all suitable patients in the study. Formal inclusion and exclusion criteria for patients, such as availability of caregiver, were necessary and do not pose a threat to external validity. Restriction of patients to those from the AOK sickness fund seemed necessary, since we wanted to obtain complete health insurance data. This is no severe threat to external validity, since the regional AOK sickness funds have the largest share of insured patients in Germany. In 2005, about one million people or 49.6% of the population aged over 65 of the statutory health insurance market in Bavaria was insured by the AOK.The major problem with respect to selection bias is the exclusion of patients whose caregivers are not willing to participate, either because of fear of stigmatization or other reasons. Some GPs may be more willing and able to convince patients and caregivers to participate than others, and in a cluster randomized trial this may also be related to the treatment group. In order to investigate selection bias, we plan to compare groups with respect to baseline data. In addition, we asked all GPs to initially provide a list of patients they would approach. In a subsample of about 50% of all GPs we conducted interim telephone interviews to ask them about progress of recruitment and reasons for non-inclusion.Since patients with dementia may not be able to give correct information, we collected all data via GPs or caregivers or from the sickness fund. The only exception is assessment of quality of life, which was also collected from patients.We chose time to nursing home referral as the primary endpoint because the main concept was to help caregivers to care for their relatives suffering from dementia as long as possible in their living environment. In a recent meta-analysis only studies were selected that reported this endpoint . We discTwo year follow-up was considered to be necessary in order to register enough events within the duration of the study. In our sample size calculation we expected to observe 50% events within two years based on estimations from the AD2000 study .There was no additional validation of the dementia diagnosis as we decided to choose a naturalistic design. However, all participating GPs had a training unit in standardized application of the MMSE.Physicians prescribe the drug that they consider as the right one for their patient, reflecting their knowledge of the disease, the diagnosis and the characteristics of the patient. In contrast to study arm A, GPs randomized in study arm B and C were trained in treatment of anti-dementive drugs. The aim of the training was to improve the knowledge of the physicians so that the treatment follows the guideline for GPs (Witten-Herdecke University) and the therapy recommendations of the Pharmaceutical Commission of the German Medical Association. Therefore drug treatment followed evidence-based guidelines and drugs were prescribed according to their approval. Differential drug prescription may have an additional intervention effect which cannot accurately be distinguished from the effect of the non-medical interventions. However, the prescribing pattern of the GPs in the three study arms will be known from the health insurance data and will be considered in the analysis.To prevent intervention effects depending on the family counsellor we implemented a guideline for the counsellors. However, the process of counselling is individual and depends on many different factors such as the caregiver situation, the patients' health status, the living arrangement etc. Therefore, we cannot guarantee a unique counselling effect for all counsellors.We experienced some specific unforeseen problems in the implementation of the study design that we were able to solve in a pragmatic way. During recruitment the question arose how to deal with caregivers who care for two people meeting the inclusion criteria. We decided that both patients could take part in the study. Questions within the telephone interview relating to the informal caregiver were only assessed once.It was planned to recruit the primary informal caregiver of the patient that is the person who carries out the largest part of informal care. However, sometimes it was not the primary informal caregiver who signed the written consent. In those cases we refrained from contacting the primary caregiver and involved the non-primary caregiver. It might be possible, that their statements on resource use are less valid as they are not as strongly involved in the caring process as the primary informal caregiver.Some informal caregivers preferred to answer the print version of the questionnaire. If the written questionnaires had values missing, we refrained from contacting these subjects again. Answers of the written questionnaire might differ from those of the telephone interview as caregivers have not the possibility to pose clarification questions.The resource use of informal care is measured since it plays a substantial role in caring for patients with dementia living at home -59. OmisHowever, this kind of valuation does not consider possible positive effects of care giving for the informal caregiver ,63. HoweDue to the extension of the recruitment and intervention time the counselling will be offered to some caregivers for more than 2 years. This will allow us to analyze effects of the intervention on nursing home admission beyond the planned 2-year follow-up. Furthermore, patient and caregivers agreed to provide their health care insurance data for a period of four years after study entry which allows additional long-term analysis concerning the primary end point as well as cost from a health care perspective.From a public health perspective the IDA trial should lead to evidence based results with regard to the community effectiveness of non-medical support measures for dementia patients and their caregivers in the primary care sector. For health policy makers it is necessary to make their decisions about financing new services based on strong knowledge about the acceptance of measures in the population and their cost-effectiveness.The sponsors have commissioned two academic research institutions with the scientific evaluation of the IDA project by giving unconditional research funds. A contract between the sponsors and academic researchers ensures that the latter have the full scientific responsibility and have the right to publish the results. Members of the sponsoring organizations closely cooperate in design and conduct of the project, but only the academic researchers have full access to all of the data in this study and take complete responsibility for the integrity of the data and the accuracy of the data analysis.RH, EG, and SK are independent scientists who have received funding for this study as described above. MB and OP have received funding for cooperation in the design of the study. JL, SR, SW, PM, and HM are or have been employees of the sponsoring institutions.RH is principal statistical investigator, participated in the design of the study, and drafted the manuscript. EG is principal clinical investigator, participated in the design of the study, and helped to draft the manuscript. JL, HM, SR and PM conceived of the study, and participated in its design and coordination and helped to draft the manuscript. SK participated in the study design and coordination and performs the economic evaluation. SW is responsible for the local coordination of the study. OP and MB both helped to conceive of the study and contributed to the study design. All authors contributed to the manuscript and have read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The possibility that ingredients added to tobacco contribute to the addictiveness of cigarette smoking was evaluated by comparing cessation rates of smokers of traditional blended cigarettes to those of smokers of flue-cured cigarettes. Such a comparison is a valid means of assessing cigarette ingredients as traditional blended cigarettes contain ingredients (>20), whereas flue-cured cigarettes contain no or very few ingredients. Separate analysis of 108 treatment groups and 108 control groups from randomized clinical trials of nicotine replacement therapy (NRT) were performed by multiple logistic regressions. The results of these analyses demonstrated slightly higher quit rates for smokers of blended cigarettes .The control groups were also investigated using classification tree analysis from which no difference in quit rates were observed for smokers of either type of cigarette. Further analyses showed that studies that utilized a high level of psychological support in conjunction with NRT produced at least a two-fold increase in quit rates compared to studies that utilized a low level of psychological support. It was also demonstrated that there is a large difference when results were reported by sustained abstinence compared to point prevalence. Additional meta-analyses found the pooled OR for NRT treatment to be in exact agreement with a recent review that assessed the effectiveness of NRT. Overall these results strongly suggest that ingredients used in the manufacture of traditional blended cigarettes do not increase the inherent addictiveness of cigarettes. The causal relationship between cigarette smoking and a large number of cancers as well as other diseases, particularly cardiovascular disease and chronic obstructive pulmonary disease (COPD), is well established, and there are no rational grounds on which this relationship can be debated . A key aIndeed there are two major types of cigarettes world-wide: flue-cured cigarettes, which use very few ingredients, and traditional blended cigarettes, which use a number of ingredients. Furthermore, different cigarette markets tend to be heavily dominated by one or the other of these two cigarette types . Traditional blended cigarettes utilize three different types of tobacco \u2013 flue-cured, burley, and oriental \u2013 that are blended together during the manufacturing process, whereas flue-cured cigarettes contain only flue-cured tobacco. Flue-cured tobacco is cured over a generally short period of time at elevated temperatures, while burley and oriental tobaccos are cured at ambient temperatures during a period of about 6 weeks. A major consequence of the difference in curing practices for these two types of tobaccos is that the elevated temperatures used in flue-curing rapidly denature the enzymes in tobacco responsible for sugar metabolism leaving the tobacco with high sugar levels, whereas these sugars are lost during the curing of burley tobaccos. In addition to differences in curing regimens, burley and oriental tobaccos are genetically different both from each other and from flue-cured tobacco. These distinctions are responsible for somewhat different profiles in both the chemical constituents of the tobacco and the smoke constituents when the tobaccos are burned .As indicated above, the difference between flue-cured and traditional blended cigarettes, crucial to the subject of this paper, is the fact that flue-cured cigarettes generally contain no flavoring ingredients, although a small number of substances may be added as humectants and processing aids, whereas traditionalblended cigarettes do use a number of different types of ingredients. One country which consumes almost exclusively flue-cured cigarettes is the United Kingdom. A representative of British American Tobacco testified to the Select Committee on Health of the UK Houses of Parliament that only six ingredients were used in most of the cigarettes they manufactured for sale in the United Kingdom . Furtherhttp://www.pmintl-technical-product-information.com/pages/eng/default/aspx). Other manufacturers publish similar lists for their own brands on their own websites. Country-specific data provide maximum use levels, whereas specific product data include the actual level of major ingredients. For example, major ingredients in the German Marlboro Red Box include humectants, such as glycerol (1.7%) and propylene glycol (1.3%); casings, such as sugars , cocoa and cocoa products (0.085%), licorice extract (0.4%), and carob bean and/or extract (0.071%), and binders, such as guar gum (0.3%). In addition, the total amount of natural and artificial flavors used in the German Marlboro consists of only 0.004% by weight, and this includes approximately 20 different substances. The one flavor for which the exact level is specified is menthol. Full-flavored Marlboro menthol in Germany contains 0.4% menthol by weight. Although blended cigarettes differ in terms of the exact recipe of ingredients used, both among different countries and among different brands within the same country, the quantitative differences are minor, at least with respect to cigarettes manufactured by the large multinational cigarette companies, which comprises the great majority of cigarettes marketed in the countries considered in this paper.Manufactured traditional blended cigarettes contain a number of different types of ingredients, including a mixture of flavors, although each flavor makes up a very small percentage of the total cigarette by weight. PMI lists all ingredients added to cigarettes sold in 92 different countries by both country and specific product  to those containing few or no ingredients and no flavors (flue-cured), who participated in randomized clinical trials evaluating the effectiveness of NRT intervention. Therefore, initially all such randomized clinical trials should serve as the basis of the data sets to be included. It was assumed that all studies published prior to 2007 were identified in the Stead et al. review, and these studies were supplemented by a literature search focused on identifying additional trials that had been published subsequent to the Data sets in which the subjects did not volunteer. The reason for that was to ensure that only individuals who demonstrated a commitment to quit smoking were included. Therefore, data sets, for example, in which individuals were enrolled by their physician were excluded.Data sets in which mentally ill subjects were preselected given that their ability to stop smoking may be significantly different from individuals without mental impairment.2 confirmed only 74% of the self-reported quitting status, whereas salivary cotinine confirmed only 55%. The misrepresentation of smoking cessation is also confirmed by a number of studies that were included in the Stead et al. data set, such as Hilberink et al. (2010) and Data sets in which no biochemical validation of smoking cessation was conducted. It has been known for a considerable period of time that self-reported quit status is often exaggerated. For example, Data sets that were conducted outside of Europe, the United States, or the four flue-cured countries .Data sets that used any type of pharmaceutical intervention, such as bupropion or varenicline. The effectiveness of this type of intervention would appear to be significantly better than any form of NRT; therefore, inclusion of these studies could bias the results.Data sets that did not compare a NRT intervention group with an untreated control group or data sets in which there were differences between the intervention group and the control group besides NRT. Since one of the types of analysis used in this report was meta-analysis on NRT effectiveness, studies without an appropriate control group can not be used.Multicenter data sets where the subjects were chosen from different countries some of which were blended countries and some of which were flue-cured countries.Data sets that did not report the level of smoking cessation for a period of at least 24 weeks. The rationale was that, since smoking cessation rates in such studies will generally decrease over time, including studies that determined these rates at only very short time periods would clearly bias the results. For similar reasons, results available for periods of longer than 16 months were not used.Data sets that did not report the data for the total sample, such as data sets that stratified subjects on the basis of, for example, smoking intensity, but reported results for only heavy smokers.Any data set that did not define the type of abstinence, namely, sustained abstinence or point prevalence.Data sets for which cessation was not the endpoint.In order to identify further data sets published after the Stead et al. review, a thorough search of both the Cochrane data base and MEDLINE was made using the keywords \u201cnicotine replacement therapy,\u201d \u201cNRT,\u201d and \u201csmoking cessation\u201d from 2006 through July 2010, resulting in a total of 54 potentially relevant articles.Data were extracted from the publications meeting the inclusion and exclusion criteria independently by two researchers. Any observed differences were then resolved. In addition to first author, publication year and country where the study was conducted, size of NRT and control groups, and number of successful cessations per group were recorded. The study-specific definition of cessation , and the period after which abstinence was determined  was recorded, as well as type of NRT  and level of psychological support. The support level \u201chigh\u201d was assigned to data sets where more than just reading materials on smoking cessation were distributed to study participants, in which case the recorded support level was \u201clow.\u201d Study quality ratings, as provided by Stead et al., were also recorded and, where data sets were not considered in the Stead et al. review, assigned according to the same criteria (based on effectiveness of randomization procedures as well as their description in the publication). Three categories were adopted, with category A being designated when data sets reported allocation procedures in sufficient detail to ensure that treatment status could not be known or predicted until a participant was enrolled and assigned to a condition; category B being designated when data sets either did not report how randomization was performed or reported it in insufficient detail to ensure that no selection bias had occurred; and category C being designated for data sets that clearly used inferior randomization procedures, such as using the day of the week in which subjects were enrolled.2 statistic, and pairwise comparisons of log-transformed effects estimates were assessed using Z-tests based on a testwise alpha level of 5%.Meta-analysis of cessation rates was performed based on study-level NRT effect and precision estimates using MetaAnalyst  were conducted by means of logistic regression of cessation rates using SAS (version 9.1). To identify relevant main effects, the following potential predictor variables were considered in forward selection and backward elimination stepwise multiple logistic regression analyses with a testwise alpha level of 5%: cigarette type , study size (\u2265150 versus <150 subjects), study duration (6 versus 12 months), level of psychological support (high versus low), type of abstinence , study decade , and study quality . Based on the identified main effects model, for which adjusted OR were calculated in both control and treatment groups data sets separately, screening for interactions was undertaken in control group data. The interaction screening was restricted to the control group to eliminate the potential effect of NRT, which should in principle lead to a simpler interpretation of those interactions that are found. Stepwise multiple logistic regressions (both forward and backward) with all main effects variables and all bivariate interaction terms were undertaken. According to the interaction structure of the final interaction model, effects estimates and confidence intervals based on the covariance matrix were calculated for both predictors participating in a particular interaction, each at the reference level of the other, as well as for the non-reference level(s) of the predictor of primary interest at the non-reference level(s) of the other predictor involved in the interaction. For control and treatment group data combined, conditional multiple logistic regression analysis based on the identified main effects model and additionally including an indicator variable for group (with control group as reference) was performed, taking into account the clustering of pairs of cessation rates within studies.Classification tree analysis (CTA)  in conjuApplication of the stated exclusion criteria was carried out on both those data sets considered by Stead et al., and the 54 papers identified through searching the literature following the publication of this review. Of the 130 publications (133 data sets) identified as being relevant by Stead et al., 53 (54 data sets) were eliminated as a consequence of the above exclusion criteria. Specifically, one publication was eliminated as a consequence of criterion 1; 1 as a consequence of criterion 2; 19 as a consequence of criterion 3; 7 as a consequence of criterion 4; 3 as a consequence of criterion 5; 18 as a consequence of criterion 6; 3 as a consequence of criterion 7; and 1 as a consequence of criterion 8. It should be noted that data sets from 16 of these publications were not included by Stead et al., in their main analysis that assessed the effect of NRT treatment on smoking cessation. In addition, the publications by All of the data sets used for the meta-analyses are summarized in For the logistic regression analysis of cessation rates, the analysis was conducted independently on the treatment groups and the control groups. The number of data sets used was slightly greater than the list shown in 2 value (p = 0.006 on 103 degrees of freedom)  , and in p = 0.066 on 83 degrees of freedom. However, the results for flue-cured countries remained heterogeneous, with p = 0.007 on 19 degrees of freedom. This comparison suggests that NRT intervention in smokers of cigarettes containing ingredients may be about 12% more efficacious than in smokers of cigarettes containing minimal ingredients, although this difference is clearly not statistically significant (p = 0.39).An important comparison, particularly from the standpoint of this analysis, is the effect of NRT intervention between countries in which blended cigarettes (contains added ingredients) are primarily smoked compared to countries in which flue-cured cigarettes (no or few added ingredients) are primarily smoked. For the 84 studies reported from the United States and Europe excluding the United Kingdom (blended cigarettes), the pooled random effects OR estimate was 1.80 , while the pooled random effects OR estimate forflue-cured countries was 1.61 . The estimate for blended cigarettes did not indicate heterogeneity, with p = 0.03).Model selection based on both forward and backward selection through stepwise logistic regression, carried out in control group data, resulted in study duration and study quality not being retained in the final main effects model. The final main effects model contained the variables cigarette type (blended versus flue-cured as reference), cessation type , support , decade , and study size (\u2265150 versus <150 as reference). Screening for bivariate interactions among the variables contained in the final main effects model resulted, in both forward and backward selection, in the following four additional interaction terms being retained in the final model: cigarette type versus support, cigarette type versus decade, study size versus decade, and study size versus cessation type. To account for the effect of study decade on cessation rates not being linear, the ordinal variable was replaced by a pair of dummy variables with period 1980\u20131989 as reference. As the effect estimates of the main effects model using control group data demonstrate, cessation rates were about 30% higher in countries where predominantly blended cigarettes (ingredients) were smoked, as compared to countries where predominantly flue-cured cigarettes (limited ingredients) were smoked. Cessation rates were lower by a factor of two when determined through sustained abstinence, as compared to point prevalence. High levels of psychological support were associated with an almost 140% increase of the chances of successful cessation, compared to low support levels. Compared to the 1980\u20131989 period, chances of successful cessation were reduced by about 70% compared to the 1990\u20131999 decade and by more than a factor of two compared to the most recent decade. In larger data sets, the probability of cessation was about 40% lower than in smaller data sets.Overall, this pattern of effects of the variables of the main effects model was replicated in the treatment group data set. While, here, the effect related to cigarette type was more pronounced (OR 1.90 for treatment group compared to OR 1.32 in the control group), the cessation type  as well as the level of psychological support was of somewhat less importance. The estimates related to study period and study size were essentially equivalent to those obtained in the control group data.per se did not seem to have an impact on cessation rates in flue-cured countries based on results from small studies.The interaction structure identified by screening for bivariate interactions poses considerable restrictions on what effects can be estimated in a meaningful way, which implies a rather complicated pattern of effect estimates. It needs to be noted that assessing the estimates obtained for the interaction model is conditional to the restrictions as contained in Restricted to point prevalence data, large study size did not have an impact on cessation rates in the 1990\u20131999 and 2000\u20132010 decades, compared to the 1980\u20131989 decade, where cessation rates in large data sets were higher by almost 120% compared to small studies. No effect of study size on cessation rates was observed in the 1980\u20131989 decade when the outcome was sustained abstinence. When assessed in small data sets, sustained cessation rates were lower by about 30% as compared to point prevalence rates.A combined analysis of control and treatment groups data was undertaken by means of conditional logistic regression based on the main effects model, with study number as strata and a variable indicating type of group (treatment versus control). The obtained treatment effect, that is, adjusted for all variables of the main effects model as contained in Lastly, to explore the effects of different types of nicotine replacement therapies, the analysis of the treatment group data set was repeated by adding a set of reference-coded dummy variables to the main effects model, which coded different types of nicotine replacement against nicotine spray as reference. The estimates of the main effects model variables changed by <3%, except for the 1990\u20131999 period effect, which was 0.66 (data not shown) instead of 0.62, as shown in Because of the complexity of the interaction structure that was obtained when using stepwise logistic regression, it was decided to also analyze the data using a CTA approach to see if a simpler picture emerged. Only two factors were found to be differentiated when this analysis was applied to the control group, namely, the study size, and the level of support. The results for level of support was found to be significantly differentiated in the CTA, with quitting being higher in data sets where subjects received a high level of psychological support (14%) than in those where subjects received a low level of support (8%), which was in line with the multiple logistic regression analysis. Also consistent with the main effects logistic regression model was the fact that the quit fraction was statistically higher in small data sets  than in large data sets . No difference in cessation rates was detected between smokers in blended countries (ingredients) compared to smokers in flue-cured countries (few or no ingredients). In addition, there was no difference in quit rates with respect to whether results were reported by sustained abstinence or point prevalence. Both of these results are in contrast with the multiple logistic regression results. Although there was no effect of decade, there was an interaction between decade, study size and level of support. The main analysis reported here has looked at 108 data sets derived from similar control groups from clinical trials on NRT performed over the last three decades in seven different countries. If the use of ingredients would have increased the addictiveness of cigarettes, a lower success rate for cessation in these trials would have been expected in the countries where the addition of ingredients to cigarettes predominates . This was clearly not the case for the analysis reported here. The results of the main effect model obtained from multiple logistic regression analysis of the 108 data sets indicate that cessation rates were generally higher in countries with cigarette ingredients (blended) than those with limited or no ingredients (flue-cured). Although this finding seems to be fairly robust, in that it is also reflected in a similar group of data sets derived from the treatment groups, and remains significant through a number of interaction models as well, it would seem implausible to suggest that it is the presence of ingredients that make it easier to quit. It is, however, clear that the data reported here do not in anyway support the suggestion that ingredients could increase the addictiveness of cigarettes.p = 0.09). Small data sets reported a greater extent of smoking cessation than did large data sets, and this result was statistically significant for both the treatment and the control groups in the main effects model. This difference may well reflect an effect of more focused psychological support: individuals in small data sets are more likely to receive individual attention than individuals in large data sets. The results for the method of reporting cessation, sustained abstinence, or point prevalence, are completely in line with expectations, in that reported cessation rates were lower when sustained abstinence was reported than when point prevalence was used. It is important to note, as it is detailed in p = 3.3 \u00d7 10\u221215). Why such a difference emerged between the NRT group and the control group with respect to reporting method is certainly not obvious.A number of variables were identified as influencing cessation rates as shown in Considering that all the trials were conducted between 1980 and 2010, it seemed logical to divide the data sets into three time periods, namely 1980\u20131989 (24 data sets), 1990\u20131999 (46 data sets), and 2000\u20132010 (34 data sets). Therefore, decade is a ternary variable, while all the other variables are binary. For both the treatment and control group cessation rates declined as a function of decade. The result shown in The fraction of those who have ever smoked but have successfully quit increased dramatically over the last half-century to the point at which approximately one-half of those who have ever smoked are currently former smokers. However, declines in per capita consumption slowed dramatically during the middle of the 1990s, and the CPS data show a decline in cessation attempts and abstinence between the 1992/93 and 1995/96 surveys (see Chapter 8). These observations raise a concern that those smokers who could easily quit, or who could be influenced by existing tobacco control approaches to quit, have done so, leaving behind a residual population of smokers who are more heavily addicted and who need new or more individualized cessation interventions.A number of statistically significant interactions were identified in the stepwise logistic regression analysis, two of which involved decade . Of partNot only did the interaction screening produce a very complex picture but it was also observed that small corrections to the data set resulted in noticeable changes in the interaction structure. As a consequence, the control group data were also investigated using a CTA. The advantage of CTA is that a much simpler picture is produced. In that the data are split in a recursive fashion, each split determines what can be split in the subsequent stages. Since this process is a one-variable-at-a-time analysis, combinations of variables are not considered during the splitting but rather emerge based on the tree structure. This implies that when a certain split is undertaken \u2013 due to the superior effect size of a particular variable at any particular stage \u2013 the possibilities to detect interactions further down are very much limited. This is also a weakness of CTA, since effects that might be detected by a technique, such as multiple logistic regression analysis, may not emerge as being significant. This issue as well as others is discussed in detail in a recent review . Indeed,Perhaps not unsurprisingly, given the properties of CTA noted above, only two variables that had a statistically significant effect on cessation rates were identified by this analysis. Cessation rates in studies with a high level of psychological support were 80% higher than those with a low level of psychological support. This result is in agreement with the multiple logistic regression analysis, although the magnitude is somewhat less . Also coThe meta-analysis conducted on the 104 data sets listed in p = 0.47), a finding in agreement with the conclusions of Stead et al. This lack of difference as a function of level of psychological support demonstrates that a subgroup analysis within a meta-analysis designed to measure the effect of one intervention on cessation rates, in this case NRT, does not predict cessation rates with respect to differences for other factors. As calculated by the multiple logistic regression analysis, cessation rates increase by a factor of about two when data sets with high support are compared to those with low support. However, because this increase in cessation rates occurs to about the same extent for both treatment and control groups, no statistically significant difference is observed in the meta-analysis.All of the variables that were evaluated as potential confounders in the multiple logistic regression analysis were also tested by meta-analysis . The levp = 3.5 \u00d7 10\u22126). This difference was not observed by Stead et al., although they assessed the effect of type of abstinence using a different approach. The explanation for this apparently counter-intuitive finding can be seen from the results of the multiple regression analysis, which clearly show that there is a significant difference between the control group and the treatment group when comparing sustained abstinence to point prevalence, with the control group showing much lower cessation rates when assessed by sustained abstinence. This translates into a higher estimate for sustained abstinence than that for point prevalence by meta-analysis. This example once again demonstrates that the results of a meta-analysis cannot be used to assess the effect of a confounding factor on cessation rates.A second interesting meta-analytical result involved the type of abstinence reported. A total of 72 data sets reported sustained abstinence; that is, continuous abstinence since the date that the individual reported having stopped smoking. The remaining 32 studies reported cessation by point prevalence. This type of evaluation utilized a fixed period of time, usually 1 week, during which a subject was abstinent just before being evaluated. As a consequence, lapses during which the subject may have been smoking were ignored. Therefore, itwouldbe anticipated that a greater success of NRT intervention would appear to have been obtained when cessation was determined by point prevalence, which was clearly demonstrated to be the case by logistic regression . However2 values for both of these factors were not significant . As a consequence, it was of interest to determine the pooled ORs for smokers of blended cigarettes and flue-cured cigarettes, which was not differentiated in the meta-analysis, as a function of this variable. As noted above, although no heterogeneity had been observed in the pooled OR for blended data sets, the pooled OR for flue-cured data sets was heterogeneous. When this calculation was carried out, no significant heterogeneity was observed in any of the pooled ORs with p = 0.32 on 54 degrees of freedom for blended and sustained abstinence; p = 0.65 on 28 degrees of freedom for blended and point prevalence; p = 0.15 on 16 degrees of freedom for flue-cured and sustained abstinence; and p = 0.31 on 2 degrees of freedom for flue-cured and point prevalence. The relevant ORs are listed in A final point regarding this comparison is that the heterogeneity observed in the meta-analytic estimates can be explained by type of abstinence reported, since Ip = 0.39). There were also no statistical differences for all other potential confounding factors that were evaluated in the logistic regression analysis, including the decade during which a study was conducted, study size, the time period at which abstinence was checked (6 months or 1 year), and study quality.As indicated, although the pooled OR for smokers of blended cigarettes was greater (1.80) than that for smokers of flue-cured cigarettes (1.61), the difference was not statistically significant (The main conclusion resulting from this analysis is that there is no evidence that cessation rates for smokers of blended cigarettes, which contain a numbers of ingredients, including a mixture of flavorants, are any lower than those for smokers of flue-cured cigarettes, which contain few ingredients and no flavorants. Despite the fact that multiple logistic regression analysis did indeed determine that there was a small but statistically significant difference in cessation rates that favored smokers of blended cigarettes, it would be difficult to consider this result as being a real effect. At this time, there is no rational explanation that would suggest that addition of a number of ingredients to cigarettes would increase the ease of smoking cessation. However, all the data are consistent with the conclusion that the presence of ingredients currently being added to tobacco does not increase inherent cigarette addictiveness.The major strength of this study is that three different approaches were utilized to analyze the data, providing considerable confidence in the final conclusions. Second, the data sets analyzed allow comparison of at least some of the results of this study with already published results, thereby also supporting the conclusions reached in this analysis. However, the choice of these data sets is also a weakness of this study. Due to the restriction of the data sets to those investigating only the use of NRT, as well as the fact that the control group had to be matched to the treatment group with the exception of NRT use, there were undoubtedly a number of data sets that could have been included in the multiple logistic regression analysis that were not included. On the other hand, there were 108 control data sets included in the multiple logistic regression analysis with more than 100,000 subjects. It is highly unlikely that inclusion of additional data sets would have changed the conclusions reached by this analysis. Another possible limitation of this study is that there were a number of other factors that could have contributed to differences in cessation rates; for example, methods of recruitment and study setting that could not be evaluated. It should be noted that there could be cultural differences that could influence smoking cessation rates between countries in which cigarettes without ingredients are smoked compared to those in which cigarettes with ingredients are smoked. Every attempt was made to minimize such cultural differences in that the studies that were used were all drawn from developed countries with generally similar cultural backgrounds.This analysis also confirms a number of other factors of importance with respect to smoking cessation that have been previously reported. The results clearly demonstrate that NRT is effective, at least in the setting of a clinical trial, in increasing the probability of quitting smoking. The pooled ORs for all types of NRT is in exact agreement with the Stead et al. review when the same meta-analytic methodology is used, even though there was not a complete overlap of data sets used in the two analyses. Second, this analysis demonstrates that a high level of psychological support provides a clearly significant benefit with respect to smoking cessation above and beyond the effect of NRT. The role that various types of psychological or behavioral support can play with respect to smoking cessation has been known for many years , and the"}
+{"text": "In the crystal, O\u2014H\u22efN hydrogen bonds link the mol\u00adecules into zigzag chains along [010].The title mol\u00adecule, C \u00c5b = 26.5565 (6) \u00c5c = 10.3983 (2) \u00c5\u03b2 = 98.123 (1)\u00b0V = 1164.92 (4) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 296 K0.50 \u00d7 0.20 \u00d7 0.04 mmBruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 1996Tmin = 0.955, Tmax = 0.996Absorption correction: multi-scan (22041 measured reflections2899 independent reflectionsI > 2\u03c3(I)1862 reflections with Rint = 0.067R[F2 > 2\u03c3(F2)] = 0.047wR(F2) = 0.118S = 1.032899 reflections167 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.16 e \u00c5\u22123\u0394\u03c1min = \u22120.25 e \u00c5\u22123\u0394\u03c1SMART  used to solve structure: SHELXTL  I, global. DOI: 10.1107/S1600536811056212/cv5218Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536811056212/cv5218Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "Chronic kidney disease (CKD) is an independent risk factor for the development and severity of coronary artery disease (CHD) and endothelial dysfunction. There is an increase in the circulating angiogenesis inhibitors endostatin (END), thrombospondin-2 (TSP), angiopoietin-2 (ANG) and the nitric oxide (NO) inhibitor asymmetric dimethyl arginine (ADMA) in CKD patients. The aim of this study was to evaluate associations of the serum level of these factors and of the related angiogenesis inhibitor, endoglin (ENG), with burden of coronary atherosclerosis.2) and the presence of coronary collaterals were quantified using quantitative coronary angiography (QCA). Serum levels of angiogenesis inhibitors were measured by ELISA , Luminex assay (TSP), or HLPC (ADMA), respectively. Associations with plaque burden and coronary collateral supply were analyzed in multi-variable linear and logistic regression models.One hundred twenty-two patients undergoing coronary angiography were recruited from the cardiac catheterization lab at a single center. The total burden of coronary plaque (mmThere was no significant association found between levels of circulating ADMA, ENG, END, ANG, or TSP and coronary plaque burden or collateral formation.Our findings suggest that associations of circulating END, ENG, TSP, and ANG with cardiovascular mortality are unlikely to be mediated via direct effects on coronary plaque formation or by inhibition of collateral formation. Whether associations of these factors with mortality are mediated via local concentrations, myocardial tissue, or intra-plaque expression of these factors or by an effect on plaque vulnerability merits additional investigation. Despite dramatic therapeutic advances in the recent years, ischemic heart disease remains the leading cause of death worldwide . AlthougUnder normal conditions, the vascular endothelium plays a key role in maintaining homeostasis, and it functions to promote vasodilation, inhibit luminal and vascular wall coagulation, and prevent the proliferation of smooth muscle and foam cells. However, these functions may be perturbed, particularly when the bioavailability of nitric oxide (NO) is low, leading to a state favoring vasoconstriction, thrombosis, vascular smooth muscle cell proliferation, and the generation of atherosclerotic plaque . In the In addition to playing a direct role in endothelial homeostasis , 6, NO iThere were 122 subjects who met the inclusion criteria and were enrolled (Table\u00a0P\u2009=\u20090.03) and diabetes were more prevalent in those with a higher burden of atherosclerosis (P\u2009=\u20090.01) while hemoglobin was lower (P\u2009=\u20090.02). Other characteristics aside from alternative measures of plaque burden  were not significantly different in quartiles of plaque burden. Although there were numerical differences in the level of END, ADMA, TSP, ENG, and ANG across quartiles of plaque burden . Results were similar in analyses using the Gensini score in place of the percent area stenosis (data not shown). There was no evidence of a significant association between factor level and atherosclerotic burden, in analyses adjusted for renal function, acute coronary syndrome on presentation, age, sex, race, diabetes, hyperlipidemia, smoking, hypertension, history of heart failure, and peripheral vascular disease (Table\u00a0Atherosclerotic plaque burden varied widely with a median atherosclerotic burden occupying 5.0\u00a0% (inter-quartile range (IQR) 3.8, 6.4) of the total area of the coronary circulation. When analyzed according to quartiles of plaque burden Table\u00a0, prior MP\u2009=\u20090.03) and peripheral vascular disease (P\u2009=\u20090.04) were more frequent among those with compared to those without collaterals  subjects. A history of prior MI , ADMA was correlated with the proportion of the length of the coronary tree occupied by luminal irregularities, but not with number of diseased vessels or the Gensini score . AnotherP\u2009=\u20090.001) [The association of collateral formation and ADMA has been less well studied. However, in a small study of 61 patients, ADMA concentration was not associated with collateral formation . In cont=\u20090.001) .Our analysis is consistent with the largest prior studies which similarly failed to demonstrate an association between ADMA level and coronary atherosclerosis or collateral formation , 26. OurWe also studied additional angiogenesis inhibitors\u2014specifically END, TSP, ANG, and ENG, each of which has been shown to be induced by or to modulate the response to changes in NO bioavailability \u201313, 30\u2014wElevated levels of TSP , ANG 3737, and EOur study extends prior reports by assessing associations of END, ENG, TSP, and ANG with both plaque burden and collateral supply in a single cohort. As noted above, the use of QCA techniques and a fully quantitative measurement of plaque burden represent other unique features of our study. The larger sample size of our study compared to most prior analyses of these factors allowed us to correct for potential confounders, but we did not identify any significant associations in either crude or adjusted models. Our findings suggest that associations of circulating END, ENG, TSP, and ANG with cardiovascular mortality are unlikely to be mediated via direct effects on coronary plaque formation or by inhibition of collateral formation. Whether local concentrations, myocardial tissue expression, or intra-plaque expression plays a more important role or whether these factors could impact plaque vulnerability is unknown. Additional studies in larger cohorts with the ability to analyze tissue and pericardial expression are clearly warranted.Our findings should be interpreted within the context of our study design. Power to rule out small differences in concentration between groups was limited. Our findings did not particularly suggest trends across groups in measured concentration although there were non-significant differences across groups in END concentration. Larger studies are needed to definitively rule out differences. The sample sizes used allowed us to correct for the most important factors in multi-variable models but did not permit simultaneous adjustment for all potential confounders\u2014particularly in the analysis of collaterals, where the overall number of collaterals was low. Lastly, our subjects came from a single center, and our results may not be fully generalizable to populations with different genetic backgrounds or indications for angiography. Lastly, we were unable to measure tissue concentrations or localized blood concentrations for the measured factors. Thus, larger, multi-center studies with the ability to measure tissue or local factor concentrations should be considered.In conclusion, we used QCA to analyze associations of a broad panel of related NO and angiogenesis inhibitors with plaque burden and collateral formation using quantitative coronary angiography. We did not find any significant associations between the severity of atherosclerosis or collateral formation and the circulating concentrations of ADMA, END, ENG, ANG, or TSP. Our findings suggest that the circulating concentration of these factors may not be important determinants underlying the development of atherosclerosis or the formation of coronary collaterals. Further studies to confirm our findings and to investigate the impact of tissue or local concentrations of angiogenesis and NO inhibitors on coronary atherosclerosis and plaque vulnerability should be considered.This study was approved by the Partners Human Research Committee and institutional review board of the Beth Israel Deaconess Medical Center . All research was in compliance with relevant regulation and the Helsinki declaration. Written informed consent for participation, phlebotomy, and analysis of biologic samples and data was obtained from all participating subjects.g, and stored at \u221280\u00a0\u00b0C. Serum creatinine and blood counts were measured on the day of the procedure in the clinical laboratory, and cholesterol measurements within 6\u00a0months prior to enrollment were recorded. Glomerular filtration rate (eGFR) was calculated using the pre-procedure creatinine and the modified MDRD equation [Individuals between 18\u201380\u00a0years of age were recruited from the cardiac catheterization suite at a single center. Subjects with a history of coronary bypass surgery or undergoing emergency angioplasty in the setting of acute myocardial infarction (MI) were excluded as were individuals with acute kidney injury, those receiving anti-angiogenic or immunosuppressive medications, and individuals with a history of thoracic radiation or cancer. Subjects underwent a brief interview and physical exam, and additional clinical data were extracted by chart review. Serum and plasma were collected before angiography, centrifuged within 20\u00a0min at 1000\u00d7equation .Endoglin (ENG), serum END, and ANG were measured using Quantikine\u00ae ELISA (R&D Systems) with intra- and inter-assay coefficient of variations (CVs) <7.0 and <13.2\u00a0%, respectively. A Luminex assay (R&D Systems) was used to measure TSP with CVs <8.7 and 16.4\u00a0%, respectively. Plasma ADMA was measured by HPLC according to the method of Teerlink  . Foreshortening and measurement variability were minimized by utilizing a standard sequence of angiographic views  and by cTwo-dimensional plaque area was quantitatively measured within each coronary artery segment Fig.\u00a0. The difCoronary collateral formation was assessed using the Rentrop classification \u2014a four-pn (%), or median (IQR). In unadjusted analyses, differences were compared using ANOVA or Kruskal-Wallis tests for continuous data and Chi-square tests for count data. Adjusted outcomes were assessed using multi-variable linear regression  or logistic regression  with logarithmic transformation of outcome variables as needed to preserve normality. In a secondary analysis using collateral supply to each individual coronary artery as the unit of analysis, we used robust standard errors and clustering by individual to account for the correlation in the propensity to form collaterals between multiple arteries  within a given individual. Model fit was tested graphically, by inspecting residuals and by testing model specification. The analyses were performed in STATA 13.0 (STATA Corp.) with P\u2009<\u20090.05 considered significant.Data are presented according to their distribution as mean\u2009\u00b1\u2009standard deviation (SD),"}
+{"text": "RIOK1 has recently been shown to play important roles in cancers, but its posttranslational regulation is largely unknown. Here we report that RIOK1 is methylated at K411 by SETD7 methyltransferase and that lysine-specific demethylase 1 (LSD1) reverses its methylation. The mutated RIOK1 (K411R) that cannot be methylated exhibits a longer half-life than does the methylated RIOK1. FBXO6 specifically interacts with K411-methylated RIOK1 through its FBA domain to induce RIOK1 ubiquitination. Casein kinase 2 (CK2) phosphorylates RIOK1 at T410, which stabilizes RIOK1 by antagonizing K411 methylation and impeding the recruitment of FBXO6 to RIOK1. Functional experiments demonstrate the RIOK1 methylation reduces the tumor growth and metastasis in mice model. Importantly, the protein levels of CK2 and LSD1 show an inverse correlation with FBXO6 and SETD7 expression in human colorectal cancer tissues. Together, this study highlights the importance of a RIOK1 methylation-phosphorylation switch in determining colorectal and gastric cancer development. Colorectal cancer (CRC) is the second leading cause of cancer-related deaths and one of the most common malignancies in the Western world . Over thS. cerevisiae) Rio1p and Rio2p, respectively (C. elegans (Rio (right open reading frame) kinase is a relatively conserved family of atypical serine/threonine kinases . RIOK1 aectively . A thirdectively . Althougectively . Recentlectively . RIOK1 kectively . Functioectively . Additio elegans . However elegans , and are elegans . One new elegans . However-1\u03b1, TAF10, and Suv39h1  of proteins is well-known to dynamically change protein function by fine-tuning protein stability, localization, or interactions . PTMs of Suv39h1 . This meradation . Besidesradation . Althougradation , the enzGiven that many kinases are largely regulated by PTMs , we specmRNA levels in CRC and metastasis lymph node samples versus normal tissues, with an average 4.03-fold and 6.15-fold increase respectively  RNAs knockdown or by overexpression of a RIOK1 cDNA. It was observed that the levels of endogenous RIOK1 were significantly higher in CRC cell lines than in normal intestinal epithelial cells (IECs) . Then thInterestingly, a notable change was the expression of epithelial-mesenchymal transition (EMT) proteins in RIOK1-overexpressing cells. Cells with relatively high RIOK1 expression displayed a mesenchymal-like phenotype, and the expression of vimentin  was enhanced, while RIOK1 knockdown strongly upregulated the expression of E-cadherin  .very similar phenotypes in GC cell lines , abrogated the inhibitory effects of RIOK1 knockdown on proliferation and invasion when compared with of empty vector, or the domain-negative Akt (DN-Akt) transfected cells . And theGiven that the activity and biologic role of many kinases are largely dependent on its PTMs , and thaFirstly, we estimated their physical interaction using an immunoprecipitation (IP) assay in cultured cells. The interaction between GFP-tagged-SETD7 and His-tagged-RIOK1 was detected physiologically in RKO cells by using an anti\u2013His antibody followed by Western blot analysis with an anti-GFP antibody . Again, To further map the domains of SETD7 for RIOK1 binding, we constructed and purified the Full length (FL) and several fragments of GST-SETD7 and then performed a GST pull-down assay. It was observed that both the N-terminal and middle fragments of SETD7 bound to RIOK1 . Next, tSetd7\u2212/\u2212 and Setd7+/+ MEFs. Consistent with findings described above, co-IP of native RIOK1 from Setd7+/+ MEFs cultured at high density confirmed that SETD7 was in a complex with RIOK1 , wild-type SETD7 (HEK293T-SETD7-WT), or methylase-deficient mutant SETD7 (HEK293T-SETD7-H297A), and endogenous RIOK1 from the cell lines was immunoprecipitated and subjected to Western blot analysis with an anti\u2013pan-methyl-lysine antibody. The protein levels of the methylated RIOK1 were significantly increased in the HEK293T-SETD7-WT cell line, but the same phenomenon was not observed in the HEK293T-SETD7-H297A cell line  in RIOK1. The amino acid sequence of RIOK1 was compared with the sequences surrounding the SETD7 methylation sites of several known substrates . It was To easily find whether methylation of RIOK1 occurred in cells, we prepared a modification-specific antibody, anti-RIOK1-K411me1, which specifically recognized monomethylated RIOK1-K411 but not the unmethylated peptide . This anS-adenosylmethionine , also known as KDM1A, one component of a BRAF\u2013HDAC complex (BHC) histone deacetylase complex , was preKdm1a+/\u2212 MEFs, those in Kdm1a\u2212/\u2212 MEFs were found to be greatly decreased , but was significantly less noticeable in cells cotransfected with the FBXO6-derived FBA , demonstWe next investigated whether FBXO6 mediates SETD7-induced RIOK1 degradation. Western blot analysis confirmed that knockdown of FBXO6 by two different shRNAs blocked RIOK1 degradation induced by SETD7 , suggestNext question was how SETD7-induced RIOK1-K411me is functionally linked to FBXO6. When V5-SETD7 was co-expressed, Flag-FBXO6 was found to associate with HA-RIOK1. FurtherGiven that the full-length FBXO6 only bound specifically to the K411me peptide, not the peptide phosphorylated at T410 (T410p), and especially threonine residue at 410 is exactly located within the consensus sequences of SETD7, we reasoned that T410 phosphorylation of RIOK1 might influence the biological functions of SETD7 \u2013mediated K411 methylation of RIOK1. To test this idea, we firstly aimed to identify the kinase responsible for the phosphorylation of threonine residue at 410 (T410) on RIOK1. The residues surrounding T410 of RIOK11 (RTKEER), with acidic residues at\u00a0+1 and +4, conform to a putative protein kinase CK2 phospho-motif (S/TXXE/D), which makes T410 an optimal site for phosphorylation by CK2 . Thus, wCK2 is a constitutively active serine/threonine kinase that is ubiquitously expressed . Its tetWe next investigated the effect of CK2 on RIOK1. When co-expressed with CK2\u03b1, but not CK2\u03b1-K68A, a kinase-inactive mutant of CK2\u03b1 , RIOK1 wGiven the close proximity of T410 and K411 residues, we analyzed whether T410p by CK2 could affect K411me by SETD7. Indeed, knockdown of CK2\u03b1 in HCT116 cells led to a substantial reduction of RIOK1 protein and p-T410, and a significant increase of RIOK1 K411me . ConsistTo confirm that RIOK1 stability is CK2 dependent, HCT116 cells were treated with the CK2 inhibitor TBB . RIOK1-pNext, we investigated how CK2 influences RIOK1 ubiquitination. While overexpression of SETD7 in RKO cells led to increased K411me and RIOK1 ubiquitination, overexpression of CK2\u03b1 significantly increased p-T410 and inhibited RIOK1 ubiquitination . ImportaNext, we tested whether the T410A mutation promoted ubiquitin-induced degradation of RIOK1. Unsurprisingly, in the presence of MG132, transfection with V5-SETD7 and Flag-RIOK1-WT led to less ubiquitination than transfection with V5-SET7 and Flag-RIOK1-T410A , suggestCollectively, our data demonstrate that p-T410 by CK2 blocks K411me by SETD7, which protects RIOK1 from ubiquitination and degradation. Furthermore, we also proved that CK2\u03b1, LSD1, and RIOK1 were in the same immunocomplex , suggestnon-phosphorylatable mutation T410A, and an unmethylatable plus phosphomimetic mutation (K411R/T410E) of RIOK1 on CRC cell proliferation, migration, invasion, tumor growth and metastasis. MTT assays showed increased growth in cells stably expressing RIOK1-K411R and RIOK1-K411R/T410E, but attenuated growth in cells with RIOK1-T410A compared to cells with RIOK1-WT expression . Furthermore, to our knowledge, we for the first time reveal that RIOK1 is specifically monomethylated at the K411 site by SETD7 in vitro and in vivo. This SETD7-mediated methylation recruits FBXO6 E3 ligase and significantly contributes to RIOK1 instability. However, LSD1-mediated demethylation of RIOK1 at K411 or CK2-mediated phosphorylation of RIOK1 at T410 reverses RIOK1 degradation by FBXO6. Importantly, functional experiments indicate that the RIOK1 demethylation or phosphorylation signals might be a prerequisite for enhanced CRC and GC growth and metastasis. Clinically, our current data indicate that RIOK1 expression is associated with CRC and GC patient prognosis. However, a further test of the PTM antibodies on CRC and GC tissues is needed in the future work. Together, these results provide a novel mechanism through which the crosstalk of PTMs regulates the function of RIOK1, supporting the notion that RIOK1 may serve as a valuable biomarker to monitor human CRC and GC development.The most striking finding is that a methylation-phosphorylation switch dictates RIOK1 stability and function in CRC and GC. Consistent with our data, a previous study reported a similar methylation-phosphorylation switch in regulating the stability of Sox2. In that paper, AKT1 was found to phosphorylate Sox2 at T118, which blocked K119me by Set7 and stabilized Sox2 . IndepenCompared with the plethora of information about histone methylation, our understanding of non-histone protein methylation is very limited. Although RIOK1 has been shown to directly associates with the protein arginine methyltransferase 5 (PRMT5), RIOK1 was not a substrate of PRMT5 . RIOK1 jInterplay with other PTMs is another main mechanism by which lysine methylation regulates protein function . TherefoRecently, it has been demonstrated that LSD1 physically interacts with endogenous CK2 in vivo and is potentially phosphorylated by CK2 on three serine residues  in vitro . And S13Previous study suggested that the proteasome has a pivotal role in the regulation of RIOK1 degradation . HoweverClinically, LSD1 and CK2 activation are associated with poor outcome in cancer . InteresIn summary, we show that RIOK1 is up-regulated in CRC and GC, which results in a significantly reduced survival and a more malignant phenotype by enhancing proliferation and migration of CRC and GC cells. Most importantly, we show for the first time that methylation and phosphorylation control the stability of RIOK1 and its role in CRC and GC progression. Therefore, targeting these PTMs of RIOK1 could be a very promising novel treatment option for CRC and GC.2 and 95% atmosphere, 37\u00b0C). Using a lentiviral system, stably transfected cells were created. Lentiviral vectors encoding the human RIOK1 gene and its mutants or shRIOK1, or empty vector (LV-control), or Non-specific shRNA were transfected into CRC or GC cells with a multiplicity of infection (MOI) of 40 to 50 in the presence of polybrene (5 \u03bcg/ml). At 48 hr after transfection, transfected cells were selected for 2 weeks with 2.5 \u03bcg/ml puromycin (Sigma). Pooled populations of knockdown cells and overexpression cells, which were obtained 2 weeks after drug selection without subcloning, were used in both in vitro and in vivo experiments.Colorectal cancer cell lines LOVO, RKO, M5, LS174T, HCT116, DLD1, SW480, SW620, HEK293T, MKN45 and SGC-7901, MEFs and a normal human intestinal epithelial cells (IECs) were obtained from the Cell Bank of the Chinese Academy of Sciences . The cells were authenticated by STR profiling according to the cell bank, and have been checked by Universal Mycoplasma Detection Kit (ATCC 30\u20131012K), and have no mycoplasma contamination. All cells were cultured in Dulbecco\u2019s Modified Eagles Medium  supplemented with 10% fetal bovine serum (FBS)  and maintained in standard conditions  or MTT assays according to the manufacturer's instructions.Lsd1 forward: 5\u2032- CGGCATCTACAAG AGGATAAAACC \u22123\u2032, Lsd1 reverse: 5\u2032- CGCCAAGATCAGCTACATAGTTTC \u22123\u2032. Indicated genes\u2019 mRNA expressions were normalized to GAPDH level.Total RNA was extracted from tissues or cells using TRIzol reagent (Takara) according to the manufacturer's instructions. RNA reverse transcription to cDNA was performed with a Reverse Transcription Kit (Takara). Quantitative real-time PCR (qRT-PCR) analyses used SYBR Green I (Takara) in triplicate. The results were normalized to the expression of GAPDH. The primer sequences used for qRT-PCR are listed as follows: Human SETD7: 5\u2032-AGTTCTCCAGGGCACGTATG-3\u2032 (forward); 5\u2032-TCTCCAGTCATCTCCCCATC5\u2032\u22123\u2032 (reversed); Human GAPDH: 5\u2032-ACA GTC AGC CGC ATC TTC TT-3\u2032 (forward) and 5\u2032-GAC AAG CTT CCC GTT CTC AG-3\u2032 (reversed); Human RioK1: 5\u2032-GGCTAAACACAGCAGAGATACC-3\u2032 (forward); 5\u2032-AACTCCCGAGCCTTGGATTCT-3\u2032 (reversed); The full-length open reading frames of RioK1 and SETD7 was amplified by PCR using the following primers: RioK1,5\u2032-CGGACGTCGACATATGGACTACCGGCGGCTTCTCATG-3\u2032 and 5\u2032-CTGATGCGGCCGCCTATTTGCCTTTTTTCGTCTTGGC-3\u2032 and confirmed by DNA sequencing. Target DNA fragments were then subcloned into pEGEX6P-1  and pHA vector . Different truncated fragments of RioK1 were generated by PCR and subcloned into pEGEX6P-1 and pHA, respectively. The primer for cloning different truncations was as following, , which was described as previously reported . Three R5 cells per well) were resuspended in the migration medium without FBS, and placed in the upper compartment of transwell chambers. The lower compartment was filled with 500 \u03bcl medium containing 10% FBS as a chemoattractant. Cells were fixed in 4% formaldehyde, and stained with 0.1% crystal violet after 24 hr. Ten random fields were counted under a light microscope . However, cell invasion (3.0\u00a0\u00d7\u00a0105 cells per well) was evaluated in 24-well matrigel-coated invasion chambers after 48 hr.6.5 mm diameter Boyden chambers with pore size of 8.0 \u03bcm (Corning) was used for migration assays. Briefly, the stable cell lines . Anti-FBXO6 antibodies were generated against KLH-coupled synthetic peptide corresponding to amino acids 262 to 284 of human FBXO6, which lie very close to the C terminus. Antiserum from peptide-injected rabbits was affinity purified using the AminoLink Plus Immobilization Kit (Pierce).Cells were harvested and lysed on ice for 30 min in 1\u00a0\u00d7\u00a0RIPA as described above. Cell lysates were analyzed by SDS-PAGE and transferred to PVDF memebrane. Membranes were washed and incubated with indicated antibodies at 4\u00b0C overnight respectively. Antibody against RIOK1 was raised by injection of recombinant RIOK1 comprising aa 1\u2013242, and affinity-purified on columns with the respective covalently linked antigen. Then membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibodies (BIO-RAD) according to the manufacturer's instructions. The protein of interest was visualized using ECL Western blotting substrate (Pierce). Or samples were resolved by SDS-PAGE and further analyzed by silver staining and Coomassie staining. Other antibodies are: Anti-HA , anti-FLAG , ubiquitin from Santa Cruz, and V5 from Invitrogen. The homemade rabbit anti- SETD7 polyclonal antibody was raised against recombinant GST- SETD7 protein. The mouse anti- SETD7 monoclonal antibody was purchased from Millipore and Cell Signaling. Rabbit polyclonal antibodies used in this study including anti-HA (A190\u2013208A), anti-MYC (A190\u2013205A), anti-LSD1 (A300\u2013215A), (A300\u2013272A), anti-CK2\u03b1 (A300\u2013198A), anti-CK2\u03b1\u2019 (A300\u2013199A), anti-CK2\u03b2 (A301\u2013984A), anti-GAPDH (A300\u2013643A) were purchased from Bethyl. RIOK1- K119me, p-T410 and 400\u2013414 antibodies were generated by immunizing rabbits with K411-monomethylated, T410-phosphorylated and unmodified 400\u2013414 peptides conjugated with keyhole limpet hemacyanin (KLH), respectively. Briefly, rabbits were immunized by keyhole limpet hemocyanin\u2013conjugated peptides. The sera were tested and collected after four more antigen boosters. To eliminate nonspecific recognition of nonmethylated antigen, the sera were precleaned by incubating with nonmethylated peptide and examining with affinity chromatography. The specific polyclonal antibodies were finally purified by methylated peptide affinity chromatography 3VO4, 10 \u03bcM cold ATP, 50 mM HEPES (pH 7.4), 10 mM MgCl2, and 5 \u03bcCi [\u03b3-32P]-ATP. The GST pulldown after kinase assay was performed by adding 500 \u03bcl of NETN buffer into the reaction after the in vitro kinase assay was completed. In all, 25 \u03bcg of RIOK1 peptides were used in similar reactions prior to direct spotting onto nitrocellulose for immunoblot.In vitro kinase assays were performed as described before  except tFor immunofluorescent staining, indicated cells plated on poly-l-lysine-coated glass coverslips in DMEM and 10% FCS were washed once in PBS, then were fixed with 4% formaldehyde, permeabilized with 0.2% Triton X-100 and blocked in 1% BSA in PBS. cells were incubated for 1 hr with indicated primary antibodies at 4\u00b0C overnight. Following staining with rhodamine-conjugated secondary anti-rabbit antibodies, cells were analyzed with a 63\u00a0\u00d7\u00a0oil immersion lens on a Zeiss Axiovert 200 m microscope. Indicated cells transfected with indicated plasmids were directly analyzed after 48 hr without fixation. The fluorescent staining was recorded using an inverted fluorescence microscope .From January 2008 to May 2014, a total of 104 pairs of CRC and 20 pairs of GC and non-tumor samples were collected from patients who had CRC or GC resection performed at Third Affiliated Hospital of Harbin Medical University.The samples were used for subsequent RNA extraction or immunohistochemistry (IHC) stained for RIOK1, FBXO6, CK2, LSD1, SETD7. All human materials were obtained with informed consent and approved by the ethics committee of Hospital of Harbin Medical University(Protocol Number: 20150526). The tissue specimens were frozen in liquid nitrogen and stored at \u221280\u00b0C. All tissues were confirmed as adenocarcinoma. CRC tissue microarray (TMA) was purchased form US Biomax (BC051110b) and IHC stained for RIOK1. The slides were scored for the percentage of positive epithelial cells as well as intensity and protein staining was subsequently quantified using the a scoring system based on the Allred score for immunohistochemistry . Based o7 cells per mouse) were injected subcutaneously into the left or right flank of NOD/SCID mice (n\u00a0=\u00a010 per group).. After 8 weeks, the remaining mice were sacrificed, and lungs were isolated for examination of the number of metastatic tumors. Tumor volume (V) was estimated from the length, width (w), and height (h) of the tumor. We analyzed primary tumor growth by the formula (length \u00d7 width2)/2. For the metastasis model, 2\u00a0\u00d7\u00a0106 cells were injected into the tail vein of NOD/SCID mice (n\u00a0=\u00a010 per group); eight weeks later, the mice were sacrificed, and their lungs were removed and formalin fixed for haematoxylin and eosin (HE) staining.All animal experiments were performed in accordance with NIH guidelines for the use of experimental animals. Male nonobese/severe combined immunodeficiency (NOD/SCID) mice between 4 and 6 weeks of age, obtained from the Experimental Animal Center of Shanghai Institute for Biological Sciences (SIBS). All animal work was conducted according to Institutional Animal Care Guidelines, and all animal experiments were approved by the ethical committee of the Harbin Medical University (Protocol Number: 20150619). HCT116-pLV-shRIOK1 and HCT116-PLV-shNC and other indicated cells  was added to each dish. Two weeks after plating, single colonies were fixed and stained by haematoxylin. Then colonies were counted and measured using the Nikon Nis Elements for windows software. Each assay was performed three times in triplicate.2 test. Survival curves were plotted by Kaplan\u2013Meier method and compared by log-rank test. In vitro cell growth assay was tested using factorial design ANOVA. Comparisons between groups were performed with a 2-tailed paired Student's t-test. The correlation between the expression levels of two proteins was determined using Spearman's correlation analysis. In all samples, p<0.05 was considered to be statistically significant. Statistical significance was concluded at *p<0.05, **p<0.01, ***p<0.001; # represents no statistical significance.All statistical analyses were performed using the SPSS 16.0 statistical software package . Quantitative values of all experiments are expressed as the mean\u00a0\u00b1SD. The significance of correlation between the expression of indicated proteins and histopathological factors was determined using Pearson \u03c7Please see the supplementary materials and methods for additional experimental procedures. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Randy Schekman as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Tilman Brummer (Reviewer #1).Thank you for submitting your article \"Targeting posttranslational modifications of RioK1 inhibits the progression of colorectal and gastric cancers\" for consideration by Here, the authors have explored the function of the RIOK1/2 atypical protein kinases in colorectal cancer (CRC) and gastric carcinoma (GC), showing that high levels of RIOK1 correlated with poor outcome, and by knockdown and overexpression that RIOK1 promoted proliferation, migration and invasion of CRC cells, in a manner dependent on PI3K/AKT pathway signaling, which reportedly acts upstream and/or downstream of RIOK1. Analysis of RIOK1-associated proteins identified the SETD7 Lys methylase, and SETD7 was shown to methylate Lys 411 in RIOK1 leading to decreased RIOK1 stability. This was shown to be a result of specific recognition of K411 methylated RIOK1 by the SCF/FBX06 E3 ligase leading to its ubiquitylation and degradation. Conversely, demethylation of K411me by the LSD1 demethylase increased RIOK1 stability. The effect of K411 methylation was counteracted by CK2-mediated phosphorylation of T410 lying next to the methylation site, possibly as a result of its blocking K411 methylation. By expressing K411R, T410A, and K411R/T410E mutant RIOK1 in RKO CRC cells, SETD7 methylation of K411 was shown to negatively regulate proliferation and tumor growth, in manner reversed by phosphorylation of T410.Rather little is known about RIOK1/2, although RIOK1/2 overexpression has been implicated in cancer, and its direct targets if any remain largely unknown. In this regard, the present insights into how RIOK1 activity is regulated by posttranslational modifications in the context of CRC are of relevance.The two reviewers have discussed the reviews with one another, and the Reviewing Editor has drafted the following letter to aid you in submitting a revised version. The reviewers found your observations on the regulation of RIOK1 levels by the pT410/K411me modifications and the correlation between RIOK1 protein levels and colon carcinoma to be of interest, but they each raised issues that need to be addressed in a revised version.Essential revisions:1) Are levels of RIOK1 regulated in CRC and GC cells by the pT410/K411me switch?Most of the experiments on SETD7/LSD1/FBXO6 mediated RIOK1 modifications and binding were done in 293T cells, typically with overexpression of epitope-tagged constructs, or in MEFs, and only in one or two cases was analysis of the endogenous SETD7/LSD1/FBXO6 proteins in RIOK1-overexpressing CRC or GC cells or tumor tissues carried out. In order to validate the physiological relevance of the phosphorylation/acetyl switch and establish that these modifications are important in the context of cancer, the authors need to use the anti-pT410 and K411me antibodies to test if pThr410 and Lys411me modifications of RIOK1 are also observed in additional CRC and GC cell lines, and assess how their levels correlate with RIOK1 protein expression levels. For instance, the authors could reproduce their findings by manipulating SETD7/LSD1/FBXO6 levels in HCT116 CRC cells, as it is known from various independent studies that they express detectable levels of endogenous RIOK1 and that its depletion has clear biological effects. Likewise, most of the interaction studies were carried out in overexpressing 293T cells, but it is not clear whether the levels of RIOK1 overexpression in transfected 293T cells are equivalent to the levels observed in CRC or GC cells, and additional data showing that these interactions occur between endogenous proteins in CRC cells need to be added to the manuscript .2) Better validation of the relevance of the pT410/K411me switch to human cancer is needed.Does RIOK1 expression or SETD7, LSD1, FBX06, and/or CK2 expression or status in CRC or GC cells correlate with any other tumor relevant features or mutations, such as RAS, AKT or tyrosine kinase mutation or activation status? To further support their conclusions, the authors should use their anti-pT410 and anti-K411me antibodies on blots of CRC and GC tissues and/or for IHC on CRC and GC tissues to correlate with RIOK1 protein levels. In this regard, since only a narrow region of the immunoblot was shown in In 3) The authors should discuss whether the only function of T410/K411 modification is to regulate the stability of RIOK1, or whether either of these modifications, which lie outside the kinase domain, have an independent effect on RIOK1 activity. In this regard, although elucidating the mechanistic connection between RIOK1 and AKT would be beyond the scope of the paper, it would be worth testing whether AKT inhibition leads to changes in the T410/K411 modifications or binding to any of the regulatory partners, e.g. using their antibodies to probe lysates from CRC/GC samples in the context of AKT inhibition.4) The authors carried out validation of the specificity of the anti-pT410 and anti-K411me antibodies using unmodified and singly and doubly modified synthetic peptides , but some concerns still remain about the specificities of the pT410 and K411me antibodies when used to detect these modifications in full length (endogenous) RIOK1 protein in cells/tissues. It was demonstrated that phosphorylation of T410 did not affect recognition of K411me in a synthetic peptide by the anti-K411me antibodies , but this is rather artificial because of the high concentration of peptide, and it remains possible that a phosphate at T410 affects the affinity of the anti-K411me antibody for K411me-modified RIOK1 protein. In fact, given what we know about the 3D structure of the CDR binding sites of antibodies that recognize linear peptide sequences, it would be surprising if a large negatively charged phosphate right next to the K411me residue does not affect binding affinity; after all pT410 prevented recognition by the SETD7 Lys methylase  Are levels of RIOK1 regulated in CRC and GC cells by the pT410/K411me switch?Most of the experiments on SETD7/LSD1/FBXO6 mediated RIOK1 modifications and binding were done in 293T cells, typically with overexpression of epitope-tagged constructs, or in MEFs, and only in one or two cases was analysis of the endogenous SETD7/LSD1/FBXO6 proteins in RIOK1-overexpressing CRC or GC cells or tumor tissues carried out. In order to validate the physiological relevance of the phosphorylation/acetyl switch and establish that these modifications are important in the context of cancer, the authors need to use the anti-pT410 and K411me antibodies to test if pThr410 and Lys411me modifications of RIOK1 are also observed in additional CRC and GC cell lines, and assess how their levels correlate with RIOK1 protein expression levels. For instance, the authors could reproduce their findings by manipulating SETD7/LSD1/FBXO6 levels in HCT116 CRC cells, as it is known from various independent studies that they express detectable levels of endogenous RIOK1 and that its depletion has clear biological effects. Likewise, most of the interaction studies were carried out in overexpressing 293T cells, but it is not clear whether the levels of RIOK1 overexpression in transfected 293T cells are equivalent to the levels observed in CRC or GC cells, and additional data showing that these interactions occur between endogenous proteins in CRC cells need to be added to the manuscript .Thanks for the comments, actually we have repeated all key data in CRC and GC cell lines. Due to the large amount data already existed in this manuscript, we selectively put relevant data as suggested by the reviewers. We added 2) Better validation of the relevance of the pT410/K411me switch to human cancer is needed.Does RIOK1 expression or SETD7, LSD1, FBX06, and/or CK2 expression or status in CRC or GC cells correlate with any other tumor relevant features or mutations, such as RAS, AKT or tyrosine kinase mutation or activation status? To further support their conclusions, the authors should use their anti-pT410 and anti-K411me antibodies on blots of CRC and GC tissues and/or for IHC on CRC and GC tissues to correlate with RIOK1 protein levels. In this regard, since only a narrow region of the immunoblot was shown in In We didn\u2019t check the indicated proteins expression with the status of RAS, AKT or tyrosine kinase mutation or activation status. Since we already have a lot data in this manuscript, it\u2019s beyond the scope of current manuscript. However, it would be interesting to see these potential connections in the following manuscripts. As suggested by the reviewers, we probed pT410/K411me in CRC tissue as shown in 3) The authors should discuss whether the only function of T410/K411 modification is to regulate the stability of RIOK1, or whether either of these modifications, which lie outside the kinase domain, have an independent effect on RIOK1 activity. In this regard, although elucidating the mechanistic connection between RIOK1 and AKT would be beyond the scope of the paper, it would be worth testing whether AKT inhibition leads to changes in the T410/K411 modifications or binding to any of the regulatory partners, e.g. using their antibodies to probe lysates from CRC/GC samples in the context of AKT inhibition.As suggested by the reviewers, we detected pT410/K411me in the context of AKT inhibition, which indicates that AKT inhibition doesn\u2019t affect the modifications of RioK1 as shown in 4) The authors carried out validation of the specificity of the anti-pT410 and anti-K411me antibodies using unmodified and singly and doubly modified synthetic peptides .We added how these experiments were exactly carried out and what was blotted in the different lanes/strips \u2013 immobilized peptide in the figure legends of Figure 3F1 and But some concerns still remain about the specificities of the pT410 and K411me antibodies when used to detect these modifications in full length (endogenous) RIOK1 protein in cells/tissues.We also checked these two antibodies both in cell lines and human samples, as shown in It was demonstrated that phosphorylation of T410 did not affect recognition of K411me in a synthetic peptide by the anti-K411me antibodies , but this is rather artificial because of the high concentration of peptide, and it remains possible that a phosphate at T410 affects the affinity of the anti-K411me antibody for K411me-modified RIOK1 protein. In fact, given what we know about the 3D structure of the CDR binding sites of antibodies that recognize linear peptide sequences, it would be surprising if a large negatively charged phosphate right next to the K411me residue does not affect binding affinity; after all pT410 prevented recognition by the SETD7 Lys methylase  could be tested by the consequences of dephosphorylating RIOK1 protein on the blot prior to antibody detection compared to a control untreated blot \u2013 there are examples in the literature of this approach .As suggested by the reviewer, we validated the antibody endogenously in HCT116 and MKN45 cell lines. Prior to development with anti-RioK1 antibodies, these cell lines were either incubated with or without \u03bb-PPase ."}
+{"text": "In gastric cancer (GC), the main subtypes  differ in pathological characteristics, with diffuse GC exhibiting early disseminative and invasive behaviour. A distinctive feature of diffuse GC is loss of intercellular adhesion. Although widely attributed to mutations in the CDH1 gene encoding E-cadherin, a significant percentage of diffuse GC do not harbor CDH1 mutations. We found that the expression of the actin-modulating cytoskeletal protein, gelsolin, is significantly higher in diffuse-type compared to intestinal-type GCs, using immunohistochemical and microarray analysis. Furthermore, in GCs with wild-type CDH1, gelsolin expression correlated inversely with CDH1 gene expression. Downregulating gelsolin using siRNA in GC cells enhanced intercellular adhesion and E-cadherin expression, and reduced invasive capacity. Interestingly, hepatocyte growth factor (HGF) induced increased gelsolin expression, and gelsolin was essential for HGF-medicated cell scattering and E-cadherin transcriptional repression through Snail, Twist and Zeb2. The HGF-dependent effect on E-cadherin was found to be mediated by interactions between gelsolin and PI3K-Akt signaling. This study reveals for the first time a function of gelsolin in the HGF/cMet oncogenic pathway, which leads to E-cadherin repression and cell scattering in gastric cancer. Our study highlights gelsolin as an important pro-disseminative factor contributing to the aggressive phenotype of diffuse GC. Gastric cancer (GC) is one of the most prevalent cancer types worldwide. Despite a trend of decreasing incidence in developed countries in recent decades , GC remaCDH1 [The repression of E-cadherin expression, a \u2018master programmer\u2019 of Epithelial Mesenchymal Transition (EMT), is a critical event in tumor invasion . E-cadheCDH1 , loss ofCDH1 , 13. E-cCDH1 . In contActivation of the HGF-MET signaling pathway promotes cell scattering in cancer, and modulates other cellular behaviors such as cell invasion, motility, proliferation and cell survival -20. The via the PI3K-Akt pathway. Our findings reveal a novel function of gelsolin in the mediation of HGF-induced PI3K/Akt activation, which leads to E-cadherin repression and scattering of GC cells. Hence, gelsolin functions as an important pro-disseminative protein in GC cells.Gelsolin is required for cytoskeletal turnover through its actin-severing and capping activities. By virtue of these properties, combined with the ability to regulate protease secretion, gelsolin promotes cell invasion and migration in various carcinoma cell types -32. It ip = 0.03), based on unpaired student's t-test analysis  . Microarray analysis was conducted on mRNA from 160 gastric tumors, of which 68 samples were classified under diffuse-type and 92 under intestinal-type GC based on Lauren's classification. The comparison between the 2 GC subtypes showed higher gelsolin mRNA expression in diffuse-type GCs  Figure . Overallp = 0.004, Paired t-test) (Recently we reported that gelsolin expression was increased in the liver metastases of a subset of colon cancer patients . We soug t-test) . Our datE-cadherin, an important protein encoded by CDH1 gene to mediate cell adhersion, has been reported to be commonly mutated in diffuse-type gastric cancer to contribute to cancer dissemination . We examined the association of gelsolin and E-cadherin expression. Three gastric cancer cohorts from GEO and TCGA were analysed Figure . There wSince diffuse GC tissues and metastatic GC cell lines revealed a possible correlation between gelsolin and tumor progression and invasiveness, we examined the effect of gelsolin on invasion in two gastric cancer cell lines with high gelsolin expression, MKN28 and AGS. We used siRNA knockdown of gelsolin to decrease protein expression in both cell lines by > 95% , and thiThe loss or reduction of intercellular adhesion is a hallmark of malignancy which is closely associated with a propensity for invasion and distant metastasis . To deteThe loss of intercellular adhesion is frequently attributed to the downregulation and/or dyslocalization of cell adhesion molecules such as E-cadherin , 37. We via transcriptional activation, we examined the effect of gelsolin depletion on the expression of well-known E-cadherin transcriptional repressors, namely Snail, Slug, Twist1, ZEB-1 and ZEB-2. We observed that gelsolin depletion reduced the mRNA levels of Snail, Twist and ZEB-2, concordant with an increase in E-cadherin mRNA expression upon gelsolin depletion in both MKN28 and MKN74 cells  mediating E-cadherin repression in MKN28 and TMK-1 cells, including the PI3K-Akt and MEK-MAPK pathways which have been previously implicated in the downregulation of E-cadherin , 26, 39.To determine if the increased expression of gelsolin stimulated by HGF is dependent on PI3K, LY294002 was used as a specific inhibitor of PI3K. The increase in gelsolin expression upon HGF stimulation was abrogated by dose-independent increases in LY294002. Phosphorylation of Akt was used as a measure of the inhibitory effect of LY294002, where increasing doses inhibited the levels of p-Akt Figure . Simultain situ, we observed an increased association between gelsolin and PI3K in MKN28 cells upon HGF treatment  according to the instructions of the manufacturer and hybridized to Affymetrix Human Genome U133 plus Genechips . Raw data obtained after chip-scanning was pre-processed using the MAS5 algorithm (Affymetrix). Data were subjected to Log 10 transformation followed by median-centered across all probe sets for each sample (primary tumor). The centering is such that the median of expression in each sample is zero. 160 were classified by pathological diagnosis into diffuse-type GCs (68 cases) and intestinal-type (92 cases).Formalin-fixed and paraffin-embedded (FFPE) primary tumor and matched normal tissue samples from 118 patients with gastric cancer were obtained from the Department of Pathology at the National University Hospital System, Singapore, under an institutionally approved protocol.T-test was used for statistical analysis.Briefly, 5\u03bcm thick tumor sections were deparaffinized, boiled in Antigen Unmasking Solution  at 95\u00b0C for 10 minutes and blocked with hydrogen peroxide for 5 minutes before primary antibody incubation overnight at 4\u00b0C. Both primary anti-gelsolin  and anti-E-cadherin  monoclonal antibodies were used at a dilution of 1:500. The antibody used was previously determined to be specific for gelsolin by western blots of protein lysates from several human cell lines, as well as cell lines transfected with a gelsolin-expressing plasmid. All other steps were performed using the avidin-biotinylated horseradish peroxidase complex method . Samples were incubated with DAB+ chromogen  for 3 minutes and subsequently counterstained with hematoxylin. Gelsolin expressions was quantified as described previously , 57. Thehttp://www.ncbi.nlm.nih.gov/gds) and TCGA (https://tcga-data.nci.nih.gov/tcga/). The two GEO datasets with the GEO accession numbers of GSE15460 and GSE65801 [Three gastric cancer cohorts were taken from GEO database  was purchased from Sigma while PI3K inhibitor LY294002 and was purchased from Promega, Madison, WI, USA.Cell lines MKN7, MKN 28, MKN74 and AGS were cultured in RPMI-1640  and TMK1 in DMEM, supplemented with 10% fetal bovine serum  and 1% penicillin streptomycin (Gibco). All cell lines are maintained in a humidified 37\u00b0C incubator with 5% COAggregation assays were performed as described previously . After 22 for 24 hours. Cells in the upper chamber were then removed and the upper side of the membrane thoroughly cleaned. Invading cells were fixed and stained with either crystal violet or propidium iodide. Invaded cells stained with propidium iodide were counted using the inverted fluorescent microscope in at least 10 representative fields.BD Matrigel basement membrane matrix  was diluted and coated onto the upper chamber of transwells  according to manufacturer's instructions. Cells were transfected with siRNA duplex for 24 hours, then cultured in serum-free medium for 24 hours. Next, they were seeded onto the upper chamber of the matrigel-coated transwell containing serum-free medium. Complete medium with 10% FBS was added to the lower chamber. Cells were allowed to migrate at 37\u00b0C in a humidified incubated supplemented with 5% COCells were harvested and protein extracted using RIPA lysis buffer with protease inhibitor cocktail mix . Proteins were separated by electrophoresis under denaturing and reducing conditions. Monoclonal antibodies against gelsolin (Abcam), E-cadherin (Millipore), AKT and phosphorylated Akt, Erk and phosphorylated Erk  and GAPDH  were used.Cells were transfected with siRNA duplex for 24 hours, then re-seeded in a 96-well plate in the medium at a density of 1000 cells/well and left overnight to attach. The following day, BrdU were added to each well. Cells were fixed and stained after 24 hours according to the manufacturer's instructions . Colorimetric analysis was performed with an ELISA plate reader .Cells were transfected with siRNA duplex for 72 hours, and then trypsinized and resuspended in PBS, followed by fixation in ice-cold 70% ethanol. Cellular DNA was stained with propidium iodide solution  and analyzed using FACS Vantage SE Flow Cytometry system .Stealth siRNA targeting gelsolin was purchased from ThermoFisher Scientific (HSS104526 of siGel1 and HSS104524 of siGel2. siGel1 was used as gelsolin siRNA unless otherwise stated). 10nM of the Stealth siRNA, complexed with lipofectamine, was used to silence gelsolin expression in cells. Medium GC control siRNA which matched the GC content of the gelsolin siRNA used was included as controls. Cells were harvested at 72 hours and treated as used in other assays as described.Total RNA from cell lines were isolated from cultures of each experiment group with the Qiagen RNeasy kit as described by the manufacturer. 500-1000ng of cDNA was used for amplification, carried out on the 7500 Fast Real-Time PCR System. The thermal cycling conditions were as follows: one cycle at 95\u00b0C for 10 minutes, followed by 40-50 cycles of denaturation at 95\u00b0C for 15 seconds and annealing extension at 60\u00b0C for 1 minute. The specific primers used were designed by manufacturer to detect Gelsolin, E-cadherin, Snail, Slug, Twist, ZEB-1 and ZEB-2. Glyceraldehyde-3-phosphate (GAPDH) was including as an internal control. All reagents are from Applied Biosystems .The mouse/rabbit red starter Duolink kit  was used for this experiment. The cells were seeded on glass slides and treated with 10ng/ml HGF for one hour. Cells were then fixed with 4% paraformaldehyde for 15 minutes at room temperature and permeabilized with 0.25% Triton in PBS for 10 minutes at room temperature. After permeabilization the cells were incubated in the blocking buffer (provided with the kit) for 30 minutes at 37\u00b0C. Cells were then incubated with the primary antibodies against gelsolin (Abcam) and PI3K  diluted in the antibody diluents for overnight at 4\u00b0C. On the next day, cells were washed in Buffer A 3 times for 15 minutes and incubated with the PLA probes for one hour at 37\u00b0C. This was followed by a 10 and 5 minutes wash in Buffer A. Ligation was carried out at 37\u00b0C for one hour followed by a 10 and 5 minutes wash in Buffer A. The cells were then incubated with the amplification mix for two hours at 37\u00b0C in a darkened humidified chamber. After washing with 1x Buffer B for 10 minutes followed by a 1 minute wash with 0.01X buffer B, the cells were stained with DAPI for 2 minutes and mounted onto microscope slides using mounting media. Cells were then viewed under a fluorescence microscope.t-test was used to compare the means of two groups and P < 0.05 was considered statistically significant.Non-paired Student's"}
+{"text": "Over the last few years, the ETS transcription factor ERG has emerged as a major regulator of endothelial function. Multiple studies have shown that ERG plays a crucial role in promoting angiogenesis and vascular stability during development and after birth. In the mature vasculature ERG also functions to maintain endothelial homeostasis, by transactivating genes involved in key endothelial functions, while repressing expression of pro-inflammatory genes. Its homeostatic role is lineage-specific, since ectopic expression of ERG in non-endothelial tissues such as prostate is detrimental and contributes to oncogenesis. This review summarises the main roles and pathways controlled by ERG in the vascular endothelium, its transcriptional targets and its functional partners and the emerging evidence on the pathways regulating ERG's activity and expression. ERG regulation of endothelial function and homeostasis. ERLike many transcription factors, ETS proteins control gene expression by combinatorial interaction between transcription factors and their binding motifs on DNA. Wilson et al. carried out a genome-wide analysis of the binding sites of ten key regulators of blood stem/progenitor cells and identified a combinatorial functional interaction between a heptad of transcription factors, including ERG ; the stuA similar repression mechanism of interference was observed in prostate cancer cells, where Yu et al. found that ERG disrupts androgen receptor (AR) signalling by binding to and repressing AR downstream targets at gene-specific loci Recent studies have shown ERG's association with proteins that mediate its post-translation regulation see also . Selvara6In the developing mouse embryo, ERG is expressed from embryonic day (E)8.5 in mesodermal tissues, such as the endothelium, myocardium, pre-cartilage and haematopoietic tissues, but not in the epithelium or lymphocytes Comprehensive characterization of ERG subcellular localization has shown that ERG is localized in the nucleus of endothelial cells 7The activity of many ETS factors is regulated by signal transduction cascades, which alter their sub-cellular localization, DNA binding activity, and/or transcriptional activity through post-translational modification. Little is known about the post-translational modifications of ERG in endothelial cells. In myeloblast cells, ERG is phosphorylated on a serine residue by an activator of the protein kinase C pathway Two recent studies have suggested that dysregulation of the SPOP ubiquitin ligase complex in ERG-overexpressing prostate cancer cells reduces ERG ubiquitination, and that stabilized ERG was responsible for the enhanced migration and invasion activities of cells carrying SPOP mutations 8ERG regulates the expression of multiple EC genes with roles in key cellular functions such as survival, junction stability and cell migration; acting as a key regulator of endothelial homeostasis. A summary of ERG target genes and their role in endothelial cell function and homeostasis is shown in 8.1Wythe et al. described a role for ERG in arterial specification, by demonstrating that ERG mediates VEGF-dependent expression of arterial Dll4, the earliest Notch ligand gene expressed in arterial precursor cells, during vascular development 8.2ERG plays a key role in maintaining junction integrity through its transcriptional regulation of multiple junction molecules. ERG binds and transactivates the promoters of the endothelial junctional adhesion molecules VE-cadherin 8.3Erg-knockout embryos in vivo Canonical Wnt signalling promotes EC survival, junction stabilization, proliferation and pericyte recruitment and is essential for vessel stability . The bal8.4Transcriptome profiling of ERG-deficient EC identified \u223c\u00a080 genes involved in cell migration as candidate ERG targets, including many regulators of the small GTPase Rho family ERG has been shown to regulate the endothelial cytoskeleton through the activity of histone deacetylase-6 (HDAC6) 99.1Xenopus showed a role for ERG in endothelial differentiation, where ectopic expression of the Xenopus homolog of ERG drove ectopic endothelial differentiation in the ventral region of Xenopus embryos ERG drives the expression of genes that define the endothelial lineage, such as VE-cadherin A further line of evidence for the key role ERG plays in endothelial differentiation comes from developmental studies of differentiation of embryoid bodies, which show that ERG is required for the differentiation of embryonic stem cells along the endothelial lineage 9.2Xenopus embryo, ERG transcripts are detected in the vitelline veins, posterior cardinal veins, blood vessels of the head, along with strong ERG expression in the intersomitic blood vessels Xenopus embryo resulted in developmental defects and ectopic endothelial differentiation. In zebrafish embryos, ERG antisense morpholino caused defective intersomitic vessel patterning and haemorrhage in the head The role of ERG in vascular development has been demonstrated in multiple in vivo models. In the developing Erg floxed mice with Tie2-Cre mice Erg in the mouse embryo (ErgcEC-KO) caused embryonic lethality between E10.5 and E12.5, with severe disruption to the cardiovascular system, associated with defective vascular remodelling and haemorrhaging  caused embryonic lethality at a later stage (E13.5) Interestingly, a previous transgenic model where ERG's function was disrupted by a mutation in the DNA binding ETS domain  have demonstrated that postnatal deletion of ERG results in defective retinal angiogenesis -\u03b1, lipopolysaccharide (LPS) and interleukin-1\u03b2 (IL-1\u03b2) 1010.1Endogenously expressed ERG is found in megakaryocytes 10.2A role for ERG in limb skeletogenesis has been described. Dhordain et al. provided the initial evidence that ERG is expressed at sites of future synovial joint formation in chick embryo limbs 10.3Accumulating evidence points to ERG as a lineage-determining transcription factor; therefore its ectopic expression can be detrimental. Indeed, ERG ectopic expression has been linked to the pathogenesis of multiple cancers.10.3.1Chromosomal translocations that result in the expression of oncogenic ERG fusion proteins have been identified in multiple malignancies. In Ewing sarcoma and acute myeloid leukaemia, chromosomal translocations result in fusion of ERG with the RNA binding proteins EWS and FUS, respectively, producing chimeric proteins 10.3.2More than 50% of all prostate cancers harbour a chromosomal translocation that results in the fusion of the androgen receptor-regulated gene promoter of transmembrane protease serine (TMPRSS)-2 and ERG 10.3.2.1Several studies have examined correlation between ERG and micro-RNAs (miRNAs) in prostate cancer. Hart et al. showed that miR-145, which is down-regulated in prostate cancer, inhibits ERG expression by directly targeting its 3\u2032UTR 10.3.3ERG has been shown to be both a sensitive and specific marker for endothelial cells in vascular malignancies, including angiosarcoma, haemangioma, lymphangioma, Kaposi sarcoma, and haemangioendothelioma 11The study of the role of ERG in vascular development and angiogenesis has had an upsurge in recent years. It is now clear that ERG is essential for differentiation and maintenance of the endothelial lineage, and therefore for the development and maintenance of healthy vasculature. This is in striking contrast with its role in promoting oncogenesis when ectopically expressed. Although substantial progress in understanding the function of ERG has been made, much remains to be discovered. Upcoming areas of study will include the identification of binding partners that regulate ERG activity, the regulation of ERG function by post-translational modifications and by upstream signals. Understanding the homeostatic function of ERG in endothelial cells will provide insight into novel approaches to promote vascular health, as well as possible therapeutic options to selectively target the oncogenic function of ERG in cancer.British Heart Foundation (RG/11/17/29256).GMB and AMR are supported by the"}
+{"text": "Clinical studies have suggested a survival benefit in ovarian cancer patients with type 2 diabetes mellitus taking metformin, however the mechanism by which diabetic concentrations of metformin could deliver this effect is still poorly understood. Platelets not only represent an important reservoir of growth factors and angiogenic regulators, they are also known to participate in the tumor microenvironment implicated in tumor growth and dissemination. Herein, we investigated if diabetic concentrations of metformin could impinge upon the previously reported observation that platelet induces an increase in the tube forming capacity of endothelial cells (angiogenesis) and upon ovarian cancer cell aggressiveness. We demonstrate that metformin inhibits the increase in angiogenesis brought about by platelets in a mechanism that did not alter endothelial cell migration. In ovarian cancer cell lines and primary cultured cancer cells isolated from the ascitic fluid of ovarian cancer patients, we assessed the effect of combinations of platelets and metformin upon angiogenesis, migration, invasion and cancer sphere formation. The enhancement of each of these parameters by platelets was abrogated by the present of metformin in the vast majority of cancer cell cultures tested. Neither metformin nor platelets altered proliferation; however, metformin inhibited the increase in phosphorylation of focal adhesion kinase induced by platelets. We present the first evidence suggesting that concentrations of metformin present in diabetic patients may reduce the actions of platelets upon both endothelial cells and cancer cell survival and dissemination. Thromboe system . In a pre system . These ie system , 9.in vitro and in vivo studies are several times higher than maximum plasma concentrations that would be achieved with the doses of metformin used by diabetic patients [Metformin is widely used to treat type 2 diabetes and pre-diabetic syndromes modulating glucose metabolism and fatty acids. Its primary action is to inhibit hepatic glucose production, but it also increases the sensitivity of peripheral tissues to insulin . To datepatients . Thus, tpatients , 16.Currently, few studies are available regarding the effects that would have metformin on platelet function. Several studies indicate that in patients with type 2 diabetes mellitus, metformin would be beneficial in maintaining hemostasis in these patients . SeveralOur published results have shown that the use of metformin in concentrations approved for use in diabetics (micromolar range) has no effect on cell proliferation, but can allow ovarian cancer cells to overcome resistance to carboplatin . FurtherPublications have demonstrated that platelet interaction with the endothelium promotes the process of angiogenesis  inhibition-independent blockade of Akt/mTOR pathway is also reported to be a selective inhibitor of bone morphogenetic protein (BMP) type I receptors and an activator of the protein kinase A (PKA)-dependent MEK-ERK1/2 signaling pathway [It is extensively reported that the pleiotropic actions of metformin can be inhibited by compound C  . This co pathway \u201326.In the angiogenesis assay, the co-addition of compound C is able to abrogates the inhibitory effect of metformin over the action of platelets, as confirmed in both the endothelial cell line EA.hy926 and in primary cultured Human Umbilical Vein Endothelial Cells (HUVEC)   was assessed by flow cytometry. Figure The central focus of this investigation was to determine the role of platelets upon ovarian cancer cells  with endothelial cells on matrigel. The coincubation of platelets in solely culture medium for the same period before incubation with endothelial cells did not result in changes in angiogenesis, most likely due to the short half-life of the growth factors released by platelets. Interestingly, the presence of metformin reduced this angiogenic potential in both cell lines tested and three of the four cultures of cancer cells isolated from the ascites of high-grade serous papillary ovarian cancer. In one culture, metformin did not reduce platelet-increased angiogenesis. While in the sphere forming assays and the migration assay we clearly see an effect of metformin upon the cancer cell (inhibiting the platelet-effect of the latter two processes) we cannot fully rule out the possibility that Metformin remains in the conditioned medium and thus inhibits angiogenesis by a direct effect upon endothelial cells. However, an anti-angiogenic effect of metformin occurring only upon endothelial cells is unlikely as patient number 4 Figure  showed nIn another assessment of cancer aggressiveness, metformin abrogated platelet-increased migration in both ovarian cancer cell lines and very strikingly in a primary culture (patient 5) despite having no effect on this same process in endothelial cells . This may suggest that cancer cells are heavily reliant on the AMPK pathway and possibly its role in autophagy for survival. Whether metformin exerts its effects in cancer cells through AMPK is still the subject of ongoing investigation, however, alternative pathways to the effect of compound C have been reported . HoweverCancer spheres or spheroids are present in the ascitic fluid of ovarian cancer patients, and these are believed to be the key in both chemoresistance and the formation of metastasis , 52. In Previous studies with metformin as a single agent reported a reduction in sphere formation in osteosarcoma , pancreaThe ovarian cancer cell lines SKOV3 and UCI101 were maintained in Dulbecco's modified Eagle medium (DMEM)/F12 supplemented with 10% fetal bovine serum . HUVEC were isolated from umbilical cords obtained with patient consents and approved by the ethical committee at the Hospital Cl\u00ednico Universidad Cat\u00f3lica de Chile. HUVEC were obtained by collagenase treatment and maintained in Human Endothelial SFM medium  supplemented with 10% fetal bovine serum (FBS) and endothelial cell growth supplement  . These cells were used until passage five. Endothelial EA.hy926 cells were maintained in Iscove's Modified Dulbecco's Media (IMDM) supplemented with 10% fetal bovine serum. For all experiments, endothelial cells were used until passage six. Metformin was solubilized in water , and Compound C (Dorsomorphin) was solubilized in DMSO .All ovarian cancer samples used in primary cultures were obtained from patients with high-grade ovarian carcinomas, with signed informed consent and with institutional ethical committee approval from the Pontificia Universidad Cat\u00f3lica de Chile and all of the participating Chilean hospitals. The hospitals included the Cancer Center at the Pontificia Universidad Cat\u00f3lica, Hospital Gustavo Fricke, Hospital S\u00f3tero del R\u00edo, and Hospital Luis Tisn\u00e9. For all the experiments, primary cultures were used until passage two.5 platelets/\u03bcL) containing already seeded cell lines SKOV3, UCI101, EA.hy926, HUVEC, and the human ascites primary culture. After 12 hours or 24 hours of incubation, the cell monolayer was washed three times with PBS to eliminate the platelets in suspension.The human platelets extraction was performed as previously described by Orellana et al., 2015 [The tube formation assay was performed using EA.hy926 and HUVEC cells as described . BrieflyAngiogenic score = number of branches \u00d7 total branch length5 platelets/\u03bcL) and or metformin (20 \u03bcM). In the case of EA.hy926, the culture medium was replaced with fresh DMEM/F12 in the absence of FBS. Wound closure was assessed by photography at 5, 10 and 24 hours, and quantified using the Infinity Analyze v6.3 .SKOV3, UCI101 and EA.hy926 cells were cultured in 6 well plates until 100% confluence, and then a vertical and horizontal wound (scratch) was introduced through the cell monolayer using a fine pipette tip. The culture medium was replaced with fresh DMEM/F12 containing 5% charcoal treated serum in the presence or absence of platelets  was performed at Cl\u00ednica Tabancura, Chile. Briefly, cells were collected and washed 2 times with cold phosphate-buffered saline. The cells were fixed and permeabilized with 70% cold ethanol and incubated with RNase A and propidium iodide (0.5 mg/ml) buffer. Cells pertaining to a sub-G1 fraction, G0/G1 phase, G2/M and S phase were determined as a percentage of the total cell population using the Cell-Quest program . The sub- G1 fraction was considered as a marker of cell death (apoptosis). Results were gathered from 3 independent experiments.250,000 cells were seeded in 6 cm plates. Total proteins from cell lines were extracted using 150 mM Tris-HCl lysis buffer containing NaCl 1.5 M, Sodium orthovanadate 0.2 mM and Triton X-100 0.5%. Lysed cells were left for 20 minutes on ice, centrifuged at 7,000 rpm for 7 minutes at 4\u00b0C, then cells were sonicated and centrifuged at 7,000 rpm for 7 minutes at 4\u00b0C. The resulting protein content of the supernatant was determined by the Bradford method and stored at \u221280\u00b0C. Equal amounts of protein (50 \u03bcg/lane) were separated using 12% SDS-PAGE or 10% SDS-PAGE under reducing conditions and transferred to nitrocellulose membranes , blocked with BSA 5% in TBS-0.1% Tween-20 and incubated overnight at 4\u00b0C with the primary antibodies anti-FAK  and anti-phospho (Tyr397) FAK . Anti-\u03b2-actin  and anti-Histone H3  both used as load control. All the antibodies were diluted in blocking buffer. The membranes were washed two times for five minutes in TBS-T buffer, incubated with HRP-conjugated anti-rabbit secondary antibody -HRP Conjugate; Cat. N\u00b0170-6515, USA) for two hours at room temperature and developed with chemiluminescence reagent . Membranes were exposed to MyECL  and equal protein loading was initially assessed with Ponceau-S red staining . The integrated optical density of bands was quantitated using the Image J v.1.6 software. The optical densities were expressed as the ratio of treatment/control.Briefly, transwell inserts containing membranes with 8 \u03bcm pore size (Nunc) were coated with matrigel  as per the manufacturer's instructions. Cells  were spread over the matrigel (1:5) in 200 \u03bcl of medium with no serum, and 800 \u03bcl of culture medium with 5% of serum was added to the lower chamber. Cell invasion was studied under the effect of platelets, metformin or both. These treatments were added on the lower chamber of the invasion well. For assessing the number of invaded cells, the filters were fixed with PFA for 30 minutes at room temperature and stained with crystal violet. The filters were mounted on cover slides with Kaiser\u2019s, glycerin-gelatin (Merck). Each experiment was performed in duplicate and was repeated at least 3 times. The inserts were examined using a microscope (Nikon Eclipse E200) with attached camera; photographs of 10 fields at 40X, were obtained per insert, and the number of cells in the underside of the filter was counted. Results were expressed as cell number per field, corresponding to the average of the cells photographed for the correspondent treatment.5 platelets/\u03bcL / metformin (20 \u03bcM), in 6 well low attachment plates  in DMEM/F12 medium supplemented with FGF 50 \u03bcg/ml; EGF 0.2 mg/mL; insulin 5 g/ml and 5% of Bovine serum albumin. Images of spheres were taken at 4\u00d7 and 10\u00d7 and were counted at day 2, 4 and 6 by microscopy at 10 \u00d7, using 17 fields. The number of spheres was around 2-8 per field. In the case of primary cultures spheres, 15,000 cells were cultured in 12-well low attachment plates  in DMEM/F12 medium supplemented with FGF 50 ug/ml; EGF 0.2 mg/ml; insulin 5 g/ml. It should be mentioned that on several occasions, especially after 2 days of culture (data not shown), the co-incubation with platelets of the spheres from cell lines gave rise to large aggregates formed by several spheres trapped within a mesh of platelets. These mesh structures often made quantification difficult and for this reason, quantification was recorded at day 2 of culture.Ovarian cancer sphere formation assay was performed as previously described by Orellana et al., 2015 [t-test . When two variables were analyzed a two-way ANOVA with the Bonferroni post-test was utilized . All HUVEC and cell line experiments were performed a minimum of three times. P < 0.05 was considered as significant.Experiments were one variable was present were analyzed using ANOVA with the Tukey posThe published literature is now showing an irrefutable distinction between patient-approved pharmaceutical and super pharmaceutical doses of metformin in the field of oncology. These observations reflect the diversity of action of metformin, further emphasizing that there are still many mechanisms of action upon the cancer cell that need to be identified. This study adds further argument that metformin research should be separated into two disciplines. Firstly, the use of concentrations below 50 micromolar would help elucidate how metformin lowers the cancer incidence and improves outcome in patients taking the drug. Secondly, the use of higher (millimolar) concentrations will evaluate if metformin alone, or when incorporated into future cancer therapeutic regimes, could be beneficial to patient outcome.in vitro angiogenesis, migration and sphere formation capacity and these processes are inhibited by micromolar metformin, raising the possibility that platelets simply increase cancer cell proliferation, while metformin decreases proliferation. The co-incubation of platelets with ovarian cancer murine cells has been reported to increase cancer cell proliferation [in vitro model we observed no change in proliferation or cell cycle in the presence of platelets. Furthermore, we previously reported that micromolar metformin did not alter the proliferation of SKOV3 or A2780 ovarian cancer cells, which was reaffirmed by Zhang and colleagues [We have observed that platelets promote feration . Howeverlleagues , 57. HerThe results presented in this paper show a protective action of metformin upon platelet-mediation processes involved in cancer progression. This may help us to understand the beneficial clinical effects shown by this drug in patients with ovarian cancer. This anti-platelet action of metformin may not just be limited to cancer. Metformin use has been demonstrated to reduce mean platelet mass and volume in patients at risk for atherosclerotic disease . Thus, i"}
+{"text": "During routine post-kidney transplant care, most European transplant physicians screen patients for asymptomatic bacteriuria. The usefulness of this strategy is debated. To make screening cost-effective, asymptomatic bacteriuria should be prevalent enough to justify the expense, and antibiotics should improve patient outcomes significantly if asymptomatic bacteriuria is detected. Regrettably, the prevalence of asymptomatic bacteriuria among kidney transplant recipients is not well defined.5 CFU/mL were asked to provide a confirmatory urine specimen. Asymptomatic bacteriuria was defined per Infectious Diseases Society of America guidelines.To determine the prevalence of asymptomatic bacteriuria among kidney transplant recipients, we did a cross-sectional study among kidney transplant recipients undergoing routine surveillance in three outpatient transplant clinics in Belgium and France. We excluded patients who were in the first two months post-transplantation and/or had a urinary catheter. Asymptomatic participants who had a urine culture with one organism isolated at \u2265 10Escherichia coli isolate carried the globally disseminated mcr-1 gene.We screened 500 consecutive kidney transplant recipients. Overall, the prevalence of asymptomatic bacteriuria was 3.4% (17/500 patients). It was similarly low among kidney transplant recipients who were between 2 and 12 months after transplantation  and those who were farther after transplantation . Asymptomatic bacteriuria was significantly associated with female gender  and older age . One participant\u2019s colistin-resistant Among kidney transplant recipients who are beyond the second month post-transplant, the prevalence of asymptomatic bacteriuria is low. Further studies are needed to ascertain the cost-effectiveness of a screen-and-treat strategy for asymptomatic bacteriuria in this population. According to a recent European survey, more than 90% of transplant physicians systematically screen for asymptomatic bacteriuria when kidney transplant recipients attend the outpatient clinic for follow-up care . Most phClostridioides difficile-associated diarrhea.Among kidney transplant recipients, graft pyelonephritis is common and may present with few typical manifestations of kidney infection due to graft denervation and use of immunosuppressive agents , 4. AlthThe effectiveness of the screen-and-treat strategy for asymptomatic bacteriuria is controversial primarily after the first two months post-kidney transplant. By contrast, during the first two months post-transplant most transplant physicians systematically treat asymptomatic bacteriuria, due to patients' typically high level of immunosuppression and routine use of urinary catheters during the immediate post-transplant period  . It seemFor any screening program to be cost-effective, two criteria must be satisfied: (i) the targeted condition should be sufficiently prevalent in the screened population to justify the expense and possible hazards of screening, and (ii) an intervention should be available that significantly and cost-effectively improves patient outcomes when the condition is detected. To address the first criterion in the context of a screen-and-treat approach for post-kidney transplant asymptomatic bacteriuria, it is necessary to know how frequently asymptomatic bacteriuria is detected in the screened population, i.e., kidney transplant recipients undergoing post-transplant follow-up surveillance.To our knowledge, the prevalence of asymptomatic bacteriuria among kidney transplant recipients remains to be precisely determined. In contrast, its cumulative incidence has been reported to be between 4 and 51%, depending on duration of follow-up and other variables , 12\u201318. Additionally, several of the cited studies did not use the Infectious Diseases Society of America (IDSA) definition for asymptomatic bacteriuria, and most were retrospective\u2013creating uncertainty regarding whether the diagnosis of asymptomatic bacteriuria was based on a urine collection technique that reduces contamination by bacteria colonizing the distal urethra and genital mucosa  . MoreoveAccordingly, we performed a cross-sectional study to determine the current prevalence of asymptomatic bacteriuria among kidney transplant recipients at our centers after the first two months post-transplant.We performed a cross-sectional study at two transplant centers in Belgium  and one in France . Our primary objective was to determine the prevalence of asymptomatic bacteriuria among kidney transplant recipients attending the outpatient clinic for routine post-transplant care. We took advantage of the fact that, at all study sites, a urine culture to screen for asymptomatic bacteriuria is done routinely at each post-transplant visit. The Erasme Hospital ethics committee provided approval before study initiation (ref: P2018/439). Need for written consent was waived by the Erasme Hospital ethics committee given the nature of the study. All data used in this study were anonymized prior to access and analysis. The reporting of this study conforms to the STROBE statement .We prospectively assessed for study participation all adult (\u2265 18 years old) kidney transplant recipients who attended our outpatient clinics for routine post-transplant care. We excluded patients who were early (< 2 months) post-transplantation and/or currently had an indwelling urine catheter or performed intermittent catheterization; all other patients were included. For patients who attended the outpatient clinic more than once during the study period, only the first visit was included.5 colony-forming units (CFU)/mL were considered not to be bacteriuric, so were not asked to provide a confirmatory sample. By contrast, those whose screening culture yielded one organism(s) at \u2265 105 CFU/mL were considered as possibly bacteriuric, and were asked to provide a second urine specimen within seven working days. For this confirmatory sample, participants were re-instructed by the study team regarding the preferred contamination-minimizing urine collection technique, i.e., midstream collection after cleansing of the urethral meatus.Kidney transplant recipients provided a urine specimen before their post-transplant follow-up visit, per routine clinical practice. Kidney transplant recipients whose screening urine culture yielded < 10Pneumocystis jirovecii pneumonia. At all three centers, post-transplantation patients were followed regularly at the outpatient clinic. For patients with asymptomatic bacteriuria, use of antibiotic therapy was left to the physician\u2019s discretion. All three study centers are currently participating in a multicenter randomized controlled trial comparing antibiotics versus no therapy in kidney transplant recipients with asymptomatic bacteriuria (https://www.thelancet.com/protocol-reviews/14PRT-5447).During the study period, the three participating centers together performed around 340 kidney transplants annually (range: 50 to 210 per center). Bladder catheters usually were removed within the first week post-transplant, and ureteral stents were removed between 10 days and 6 weeks post-transplant. Cotrimoxazole was used for from three months post-transplant to lifelong, depending on the center, to prevent 3). Participants were assessed directly by the local study investigators for the presence of signs/symptoms compatible with acute cystitis  or pyelonephritis , using pre-determined definitions. Participants whose initial urine culture yielded \u2265 105 CFU/mL were queried regarding their adherence to the recommended sample collection method when obtaining their initial urine sample  and were asked to submit a second (confirmatory) urine sample.Collected data included: date of the follow-up visit, age, gender, date of transplantation, presence of diabetes requiring therapy, serum creatinine and estimated glomerular filtration rate (using CKD-EPI formula) at time of study enrolment, culture results , and urinary leucocyte counts  was used to quantify urine leukocytes. Urine cultures were performed using either cysteine-lactose-electrolyte-deficient agar (bioM\u00e9rieux) or UriSelect 4 agar (BioRad), depending on study site. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry was used for microbial identification. Asymptomatic bacteriuria isolates underwent antimicrobial susceptibility testing using either the VITEK-2 system (bioM\u00e9rieux) or the disk diffusion method and current European Committee on Antimicrobial Susceptibility Testing breakpoints. Colistin resistance (if suspected) was confirmed using broth microdilution.http://www.openepi.com/). We therefore decided to include a total of 500 participants.A pre-study sample size calculation was done to estimate the needed number of participants. Based on related data from non-transplant studies , we projAfter all data were verified, statistical analysis was performed using STATA 15. No data were missing. We opted to present categorical variables as numbers and frequencies, and continuous variables as means (\u00b1 standard deviation) or medians (interquartile range), as appropriate. To estimate the prevalence of asymptomatic bacteriuria, the Wilson method was used to compute the confidence interval (CI) of the proportion. Categorical variables were compared using a chi-square test or Fisher\u2019s exact test, as appropriate. Normally distributed continuous variables were compared using a t-test. Non-normally distributed continuous variables were compared using the Mann-Whitney test. A two-tailed p-value < 0.05 was considered statistically significant.We screened 579 unique patients during 614 consecutive outpatient visits at our centers for routine care after kidney transplantation. We enrolled the 500 unique participants who met all inclusion criteria (303 men and 197 women), and excluded 114 visits  of the initially detected pathogen (n = 3) or no growth (n = 2); one of the latter participants had received antibiotics from her provider despite lacking symptoms of urinary tract infection.Among the 500 kidney transplant recipient participants, 22 (4.4%) were asymptomatic and had a first urine specimen that yielded one bacterial pathogen isolated at \u2265 105 CFU/mL . Nearly The prevalence of asymptomatic bacteriuria was significantly higher among female participants  than among male participants . The prevalence of asymptomatic bacteriuria was not significantly different between kidney transplant recipients who were between 2 and 12 months after transplantation  and those who were farther after transplantation .Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa , and Enterococcus faecalis . Among the 15 Enterobacteriaceae  isolates, resistance was documented to ciprofloxacin in 2 (13%), extended-spectrum cephalosporins in 3 (20%), cotrimoxazole in 9 (60%), and amoxicillin in 11 (65%). Additionally, in one participant asymptomatic bacteriuria was due to a colistin-resistant E. coli strain (MIC 16 \u03bcg/mL) that by PCR-based detection carried the globally disseminated mcr-1 geneThe organisms causing these 17 episodes of asymptomatic bacteriuria included As compared with other participants, those with asymptomatic bacteriuria more commonly were female  and had pyuria . They also were older . Consequently, the prevalence of asymptomatic bacteriuria was significantly higher among female participants > 50 years old  than among male participants \u2264 50 years old . No other study variable was associated with asymptomatic bacteriuria .This study, which to our knowledge provides the first prospective point-prevalence assessment for asymptomatic bacteriuria among kidney transplant recipients, identified asymptomatic bacteriuria in only 3.4% of kidney transplant recipients attending the outpatient transplant clinic after their second month post-transplantation. This value was much lower than anticipated. Consequently, and because in a prospective study < 10% of kidney transplant recipients with untreated asymptomatic bacteriuria developed pyelonephritis during a median follow-up period of 17 months , the valOur cross-sectional study aimed at determining the point prevalence of asymptomatic bacteriuria among kidney transplant recipients who are after their second month post-transplantation , which is important for evaluating the cost-effectiveness of a screen-and-treat strategy. In contrast, previous studies focused on the cumulative incidence of asymptomatic bacteriuria . The cumulative incidence of asymptomatic bacteriuria has been reported to be between 4 and 51%, depending on duration of follow-up and other variables  , 12\u201318. Clostridoides difficile-associated diarrhea, adverse drug effects, and antimicrobial resistance).Although post-transplant symptomatic urinary tract infections such as pyelonephritis are costly, the strategy of screening for and treating asymptomatic bacteriuria in kidney transplant recipients also has costs, and has not been shown to prevent symptomatic urinary tract infections . Not scrE. coli strain carrying the globally disseminated mcr-1 gene. The plasmid-borne mcr-1 gene was described first in 2016, in a study from China [E. coli isolates carrying mcr-1 were found on all continents. This gene's dissemination may threaten our future ability to treat extensively multidrug-resistant infections. Asymptomatic carriage of plasmid-mediated colistin resistance by an outpatient in our center\u2019s post-transplantation clinic raises concerns about possible future patient-to-patient transmission of this genetic element and a corresponding need for special preventive measures in the outpatient setting [Antimicrobial resistance is an especially concerning threat to kidney transplant recipients. After the dissemination in the 1990s of organisms that produce extended-spectrum \u00df-lactamases , and the subsequent dissemination of carbapenem-resistant organisms and the responsible genetic elements, we now face a similar process with organisms resistant to \u201clast resort\u201d antibiotics such as colistin . This isom China . Followi setting .Our study has notable limitations. First, the lower-than-expected prevalence of asymptomatic bacteriuria limited power for identifying predictive factors. However, we found two demographic factors to be significantly associated with asymptomatic bacteriuria, i.e., female gender and older age. If ongoing randomized controlled trials show effectiveness for antibiotic therapy of asymptomatic bacteriuria in kidney transplant recipients , these tOur study also has notable strengths. First, systematic screening for asymptomatic bacteriuria at multiple centers in consecutive outpatients presenting for routine post-transplantation care likely provided a sample representative of the population of interest . Second, conformity with the IDSA guidelines definition of asymptomatic bacteriuria limited the risk of misclassifying contaminated urine samples as episodes of asymptomatic bacteriuria. Third, the prospective design allowed us to ensure that urine specimens were collected using a contamination-minimizing technique, i.e., midstream collection after cleansing of the urethral meatus.In conclusion, the point prevalence of asymptomatic bacteriuria was only 3.4% among kidney transplant recipients beyond the second month post-transplantation, according to cross-sectional screening with rigorous confirmation. This low prevalence, together with recent evidence that antibiotic therapy for post-transplantation asymptomatic bacteriuria may fail to improve patient outcomes, calls into question the usefulness of a screen-and-treat strategy for asymptomatic bacteriuria among kidney transplant recipients after the second month post-transplantation. Ongoing randomized controlled trials should further clarify the value of a screen-and-treat strategy for post-transplantation asymptomatic bacteriuria .S1 Table(XLSX)Click here for additional data file."}
+{"text": "Young workers are in particular need of occupational safety and health (OSH) services, but it is unclear whether they have the necessary access to such services. We compared young with older workers in terms of the access to and awareness of OSH services, and examined if differences in employment conditions accounted for age-differences. We used survey data from Italy , with a sample of 8000 employed men and women aged 19 to 65 years, including 732 young workers aged under 30 years. Six questions measured access to services, and five questions assessed awareness of different OSH issues. Several employment conditions were included. Analyses revealed that young workers had less access and a lower awareness of OSH issues compared with older workers. For instance, odds ratios (OR) suggest that young workers had a 1.44 times higher likelihood [95%\u2014confidence interval 1.21\u20131.70] of having no access to an occupational physician, and were more likely (2.22 [1.39\u20133.38]) to be unaware of legal OSH frameworks. Adjustment for selected employment conditions  substantially reduced OR\u2019s, indicating that these conditions contribute to differences between older and younger workers. We conclude that OSH management should pay particular attention to young workers in general and, to young workers in precarious employment, and working in small companies in particular. Young workers are in particular need of occupational safety and health (OSH) services ,2. It isA focus on young workers is a well justified political objective, but this requires that OSH programs are equally effective at protecting both young and older workers ,9. This Precarious employment conditions, such as short-term employment contracts or low-wage work ,20, are Age-related segregation also affects access to certain types of employment. Young people, especially in economies with high youth unemployment rates, such as Italy or Greece, have little opportunity to gain employment in public sector jobs or occupations with larger companies with higher OSH standards. Instead, they are overrepresented in occupations in construction work, elementary occupations, or in small businesses where OSH management is often less developed than in larger companies ,35,36,37In sum, there are reasons to assume that age-differences in OSH service access and quality exist and that they are, at least partly, explained by the specific employment conditions of young workers in contemporary economies. Yet, there is a striking lack of theoretical literature and empirical research on the relationship between OSH service provision and worker age ,13. TherHypothesis\u00a01.Young workers have less access to occupational safety and health services, and are less aware of OSH issues compared to older workers.Hypothesis\u00a02.If age-differences in access and awareness exist, they are partly explained by a selection of young workers into occupations and employment conditions that are related to lower OSH management standards, such as precarious employment.We will study the hypotheses in a representative sample of Italian workers, a country particularly affected by the recent financial crisis and with a high rate of youth unemployment.We used data from a sample (INSuLA 1) of 8000 employed Italian men and women from 2014, which has been conducted by the Italian workers compensation authority (INAIL). The cross-sectional survey was conducted in collaboration with TNS Italia, who carried out the interviews, and with the National Institute for Statistics (ISTAT), who assisted in calculating the strata/quota for the sampling. The aim of the INSuLA 1 survey was to collect comprehensive information on issues of occupational safety and health at work, including working and employment conditions and perceptions of occupational safety and health services ,39.A quota sampling was applied. The source population were all workers in Italy employed for at least 2 months for at least an hour a week in the last 6 months, and whose employment is regulated by the national legal framework for health and safety . Since there was a lack of official national data, ISTAT extracted representative data of around 17,000 workers from their last national workforce survey . This inA random sample  was drawn and respondents were classified according to the stratification characteristics. Sampling was continued until the fixed proportion of each strata was reached. The final sample consisted of 8000 workers (item non-response is quantified in the respective tables). The distribution of the strata characteristics matched the pre-set quota well, however, weighting was applied to reach the proportion of the source population exactly.Data was collected using a standardized questionnaire. The interview was carried out by trained interviewers using the Computer Assisted Telephone Interview (CATI) methodology. The questionnaire was tested through a pilot study to check its compatibility with the CATI methodology in regard to the duration of the interview and clarity of the questions.Dependent variables: We measured self-reported access to OSH services and awareness about OSH with several indicators. Access to OSH services was measured with six items. Thereby, five items assessed the availability of: (a) An environmental health and safety manager at the workplace, (b) an occupational physician, (c) an occupational health and safety workers\u2019 representative, (d) any OSH related training programs provided by the company in the past 5 years, and (e) any information about health and safety provided by the company in the past five years. Workers who reported they had no access or did not know if the respective service was provided were defined as having no access. Additionally, we recorded if the respondent had a least one medical examination by the occupational physician in case this service was provided in the company. Awareness about OSH norms was measured by five items: (a) Awareness of the existence of the national health and safety regulatory framework, (b) awareness of fire and emergency procedures, (c) awareness about basic first aid procedures, (d) awareness of the legal obligations of the employee for OSH, and (e) an autonomous search for OSH information by the respondent . All items were coded using a dichotomous (yes/no) scale to indicate an awareness/lack of awareness of the respective topic.Covariates: The following employment information was also collected to assess if these factors impacted on OSH service availability and awareness: As an indicator of occupational position we ascertained whether participants had a manual or non-manual job, and an additional category for those in vocational training or others. In addition, the type of contract, mean weekly working hours, economic sector, and size of the company were included. Details on each variable and used categories are shown in p-values based on chi-square tests) (Hypothesis 1). Although young workers are often defined as workers younger than 25 years we used a broader age span of 19\u201329 years as previously recommended by other initiatives [The aim of this study is mainly explorative, and we first applied bivariate statistics to compare OHS services between young (<30 years) and older (30+ years) workers. Specifically, we calculated the prevalence of each OSH service in the two age groups, including tests of significance .A pronounced age gradient was found for all six indicators of access to OSH services. Young people worked less frequently in companies that provided access to OSH services, such as an occupational health physician, a safety and health manager, a workers\u2019 representative for OSH, or safety training . AccordiTo further investigate the impact of employment conditions on age-differences in OSH access, we estimated additional regression models where we included each employment-related variable separately and compared the observed changes of age-differences before and after adjustment. The rationale for this procedure was to identify the single factors with the largest relative impact on the effect estimator for the association between age and the respective OSH indicator. Adjustment started with the employment condition with the lowest relative impact. The results of this study suggest that young workers have less access to occupational safety and health services and are less aware of OSH issues compared with older workers (Hypothesis 1). Differences were mostly medium to high, and were consistent for men and women. Results also indicate that that the precarious employment situation of younger workers in times of high youth unemployment contributes to the differences between younger and older employees in this study (Hypothesis 2). Temporary employment and employment in small companies were, in particular, related to lower OSH access and awareness in young workers.There are only a few empirical studies that have examined how the age of an employee is associated with OSH service provision and quality, and our findings align with these previous findings. Breslin and colleagues (2005) reported that an adjustment for the type of occupation significantly reduced effect estimates for the association between work injury and younger employees in a large study of Canadian workers. They concluded that higher injury risks in young workers are due to their selection into more dangerous jobs in smaller-companies with less efficient systems of OSH protection. In a previous analysis presented by our working group using data from the European Working Conditions Survey, we found that young workers were less well informed about safety issues than older workers . This stThe finding that a selection of young people with precarious employment in occupations with less developed OSH management systems explained disadvantages in OSH protection points to the importance of considering structural factors in OSH research and practice . EmphasiHowever, alternative explanations for age-differences have to be considered and it should also be pointed out that employment conditions did not fully account for age-differences in our study. A lack of awareness can also be driven by the comparably good health status of young persons, which may blur the need for informing oneself about OSH issues. Many age-related diseases and the impact of repeated exposure to occupational stressors are not necessarily factors that affect younger workers . AccordiMethodological limitations must be considered when interpreting our findings. The quantitative design of the study does not allow us to explore the underlying reasons for differences in OSH service access and awareness in more detail as information about the particular workplaces was limited . Next, the variables were all self-reported and based on single items. While this is not a problem in the case of awareness where the subjective view is of interest, it is possible that the reports about access to OSH services were biased and did not reflect true differences in objective access. Thus, we cannot conclude whether services were not provided by the employers or if young workers were not aware of their presence. It is evident at this point that additional  research is needed to further explore the underlying reasons of age-differences from the employee\u2019s perspective. Another source of possible bias is an underrepresentation of young people working in particular precarious conditions, such as workers without an employment contract. It is likely that their participation rate in a survey aiming at formally employed persons was low. Also, data is limited to Italy, and results are possibly not transferable to other countries. Another issue is gender differences. Age-dependency of awareness and access were comparable for male and female workers. However, this does not imply that, on a general level, no gender differences exist. For instance, access to OSH services may differ between men and women irrespective of age. Lastly, to investigate our second research question in more detail, future investigations may investigate the direct and indirect effects of age on OSH outcomes with more refined statistical methods, for example, structural equation modelling .Limitations are balanced by a number of strengths. First, we had information about many indicators for several core OSH services and for different aspects of awareness of OSH. This allowed us to demonstrate the consistency of findings across different dimensions. Second, although the number of young workers in this study was limited due to the low labour market participation of the population under 30 years, the sample was large enough to study age-variance in relation to a number of important employment conditions.To conclude, occupational safety and health (OSH) protection is an essential pillar of primary and secondary prevention. Access to and the quality of occupational safety and health protection for young workers does not appear equivalent with older workers, and, therefore, constitutes an important challenge for OSH systems. Young workers are not only more vulnerable in terms of injury risk and other health consequences related to their work, but may potentially also exhibit a lower awareness of OSH issues throughout their later working career."}
+{"text": "Leptospirosis is a common bacterial disease in tropical regions of the world due to greater exposure to rodents and domestic animals; however, this condition can also occur in US urban areas, though it often goes unrecognized. Gastrointestinal symptoms are very commonly seen, and icteric leptospirosis is often confused for other conditions resulting in delayed diagnosis and worse outcomes. As mortality increases with more extensive hepatic involvement, gastroenterologists should be aware of the constellation of gastrointestinal symptoms related to leptospirosis, as it can occur in the absence of classic exposure history. Leptospira. A number of mammals serve as natural hosts, with human infection occurring after exposure to animal or environmental contact. The disease is most common in tropical regions of the world, with an incidence in tropical climates being an estimated 10 times higher than in more temperate climates. However, cases of human infection in urban settings within developed countries such as the US have also been reported [Leptospirosis is a prevalent zoonotic disease caused by the spirochete bacteriareported . Expertsreported .Making a timely diagnosis of leptospirosis is challenging as its presentation can be diverse and nonspecific. The majority of affected individuals 75-100%) will suffer from fever, rigors, myalgias, and headache after an average incubation period of 10 days. Gastrointestinal symptoms such as nausea, vomiting, and diarrhea occur in up to 50% of cases, with less common symptoms including cough, sore throat, arthralgias, conjunctival suffusion, skin rash, abdominal pain, and aseptic meningitis \u20137.5-100% wiIt is important for gastroenterologists to recognize key features of leptospirosis, which commonly presents with gastrointestinal (GI) symptoms. Presented here is a case of icteric leptospirosis characterized by intrahepatic cholestasis and renal failure, highlighting the often key role gastroenterologists play in the care of these patients.A 56-year-old healthy man presented to the emergency department in the summer season with three days of fatigue and bilateral thigh pain. He was born in Puerto Rico but resided in the Northeast Region of the US, where he worked as a chef in a major metropolitan city. He had no sick contacts, recent travel, or alcohol or drug use.3/\u03bcL with initially normal liver function tests (LFTs). The patient was admitted for treatment of acute kidney injury from presumed rhabdomyolysis of unclear cause but subsequently developed low-grade fevers, leukocytosis, and worsening thrombocytopenia over the following days. His Cr worsened despite hydration and conservative management for which the patient underwent a renal biopsy on hospital day 4, with findings of acute tubular necrosis, interstitial hemorrhage, and capillaritis.Laboratory data on presentation demonstrated a creatinine (Cr) of 1.73\u2009mg/dL, creatinine kinase (CK) of 3494\u2009U/L and platelet count of 68x10In addition to worsening renal function, he had an impressively rapid rise in his total and direct bilirubin with development of clinical jaundice over the subsequent days with laboratory values on hospital day 8 as follows: Cr of 4, total bilirubin of 41\u2009mg/dL, and direct bilirubin of 38\u2009mg/dL . The GI An abdominal ultrasound and MRI liver protocol/MCRP showed a normal hepatobiliary system. Given his impressive rise in bilirubin out of proportion to other LFTs in combination with renal failure and rhabdomyolysis, the GI service recommended antibody testing for leptospirosis, for which serum IgM antibodies were checked on hospital day 5. The following day, he was started on empiric doxycycline in liaison with infectious disease consultation at 100\u2009mg intravenously twice daily. In the interim, a liver biopsy was done showing liver parenchyma with marked canalicular and intracellular cholestasis, accentuated in perivenular zone, and rare foci of bile duct injury and ductular proliferation. There was no evidence of significant steatosis, fibrosis or intracellular iron deposition with trichrome, reticulin, PAS-D, and iron stains being unrevealing.On hospital day 10, the Leptospira IgM returned positive, consistent with the diagnosis of icteric leptospirosis. He was continued on doxycycline 100\u2009mg twice daily with subsequent normalization of leukocyte and platelet counts . In viewThe patient completed a 10-day course of doxycycline but unfortunately suffered from bile cast nephropathy from severe hyperbilirubinemia with continued rise in Cr , for whiLeptospirosis is the one of the most prevalent zoonotic diseases globally but is rare and often under recognized in developed countries. It is important for clinicians to be aware that sporadic cases of leptospirosis can be seen in urban areas where the disease is spread through the urine of rodents and domestic animals . While sRecognizing the clinical manifestations of leptospirosis is critical for initiating treatment in a timely fashion. While the overall median mortality rate of leptospirosis is 2.2%, it is significantly more fatal once renal failure or jaundice develops, with mortality rates rising to 12% and 19%, respectively . GastroeOur patient's presentation highlights the fact that leptospirosis can cause isolated direct hyperbilirubinemia or direct hyperbilirubinemia out of proportion to other LFT values. Jaundice in leptospirosis is a unique feature that remains incompletely understood; however intrahepatic cholestasis, duodenitis resulting in ampulla of Vater obstruction, and indirect hyperbilirubinemia from hemorrhage have all been described as causes of jaundice with this condition . In mousTreatment of leptospirosis depends on its clinical severity. Mild cases can be treated as an outpatient with penicillin, doxycycline, or azithromycin, with intravenous doxycycline, ceftriaxone, or cefotaxime recommended for more severe cases in hospitalized patients. Although not found to impact mortality, antimicrobial therapy may be associated with faster clinical resolution of symptoms . Our patOur case is unique in that Weil's disease developed in a patient residing in an urban city in the US without obvious exposure history. Icteric leptospirosis can be confused for other hepatic conditions such as viral hepatitis, malaria, and sepsis  and shou"}
+{"text": "One of the major features of cancer is Otto Warburg\u2019s observation that many tumors have increased extracellular acidification compared to healthy tissues. Since Warburg\u2019s observation, the importance of extracellular acidification in cancer is now considered a hallmark of cancer. Human MAP3K4 functions upstream of the p38 and JNK mitogen activated protein kinases (MAPKs). Additionally, MAP3K4 is required for cell migration and extracellular acidification of breast cancer cells in response to HER2/HER3 signaling. Here, we demonstrate that GIT1 interacts with MAP3K4 by immunoprecipitation, while cellular lactate production and the capacity of MCF-7 cells for anchorage independent growth in soft agar were dependent on GIT1. Additionally, we show that activation of HER2/HER3 signaling leads to reduced expression of lactate receptor (GPR81) mRNA and that both, GIT1 and MAP3K4, are necessary for constitutive expression of GPR81 mRNA. Our study suggests that targeting downstream proteins in the HER2/HER3-induced extracellular lactate signaling pathway may be a way to inhibit the Warburg Effect to disrupt tumor growth. The importance of extracellular acidification in cancer has become more widely recognized and is now considered a hallmark of cancer2. It has been shown that glycolysis is increased in many tumor cells through expression of the lactate dehydrogenase-5 (LDH-5) isoenzyme favoring increased conversion of pyruvate to lactate4. Lactate metabolism is one of the main drivers of extracellular acidification5 and an important source of energy for tumor cells7. The most studied lactate transporters are the Monocarboxylate Transporter1 (MCT1) and MCT4. Both are highly expressed in white muscle tissue while most other tissues only express MCT19.Extracellular acidification is frequently increased in cancer due to a shift from aerobic to anaerobic glycolysis which results in increased lactate production and secretionIn vitro studies by Roland et al. with pancreatic cancer cells have shown that addition of lactate to the culture media induced the expression of genes involved in lactate metabolism such as MCT1, MCT4, CD147, and peroxisome proliferator activated receptor \u03b3 coactivator 1-\u03b1 (PGC-1\u03b1). siRNA knockdown of GPR81 disrupted the lactate induced expression of these lactate metabolism genes. GPR81 is highly expressed in cancer cell lines, with the MCF-7 cell line having one of the highest levels of GPR81 expression among the cell lines tested. Furthermore, Roland et al. reported that siRNA knockdown of GPR81 results in decreased survival of pancreatic cancer cells cultured in low glucose supplemented with lactate10. These findings indicate that lactate, presumably by functioning as a GPR81 ligand, can function as a signaling molecule in cancer.In addition to the use of lactate as an energy metabolite by cancer cells, lactate can act as a signaling molecule as a ligand for G-protein coupled receptor 81 (GPR81). mitogen-activated protein kinase kinase kinase 4 (MAP3K4), is activated by different types of cellular stress, i.e. pro-inflammatory cytokines, ultraviolet light, wound stress and osmotic stress14. The catalytic activity of MAP3K4 has been shown to be important in mouse heart development by regulating the epithelial to mesenchymal cell transformation in the heart atrioventricular canal and ventricle15. On the other hand, MAP3K4 has been shown to have a scaffolding function in the developing neuroepithelium of the mouse brain17. Additionally, we showed that MAP3K4 is regulated through activation of cytokine receptor  and the angiotensin II G protein coupled receptor19. These results demonstrate the importance of MAP3K4 in diverse signaling pathways through both scaffolding and catalytic activities.MAP3K4, also known as MEKK4 or G-protein-coupled receptor2interacting protein 1 (GIT1) is a member of the GIT family of proteins, which were discovered while screening for proteins that interact with G-protein-coupled receptor kinases (GRKs). The initial role ascribed to GIT1 was as a scaffolding protein20. GIT1 is comprised of a variety of domains owning to its scaffolding role. In the amino-terminal domain there is an ADP-ribosylation factor (ARF) GTPase-activating protein (ARF-GAP) domain. In the middle section, there are three Ankyrin (ANK) repeats, a Spa2-homology domain (SHD), and a coiled-coil domain with the carboxyl-terminus, containing a paxillin-binding site (PBS). GIT1 has been shown to play an important role as a scaffold in both the RTK pathway and MAPK pathway23.24. These results demonstrate the importance of HER2/HER3 signaling in the regulation of lactic acidosis.Previously, we demonstrated that heregulin (HRG) stimulation leads to association of MAP3K4 with activated HER3, extracellular acidification and cell migration in MCF-7 breast cancer cellsIn this study, we identified constitutive association of MAP3K4 with GIT1 and that HER2/HER3 signaling leads to increased extracellular lactate concentrations. We show that GIT1 expression is necessary for HER2/HER3 induced-extracellular lactate and anchorage independent growth in soft agar. Additionally, we show that HER2/HER3 signaling downregulates the expression of the lactate receptor (GPR81) mRNA and that both GIT1 and MAP3K4 are necessary for the constitutive expression of GPR81 mRNA.24. Additionally, we showed that MAP3K4 interacts with the HER3 receptor in response to HRG stimulation. Thus, we hypothesized that the increase in extracellular acidification was driven by the signaling of a complex downstream of HER3 comprised of MAP3K4 and other proteins resulting in increased glycolysis and lactic acid secretion. Previous research by Cavet et al. showed that the interaction between GIT1 and sorting nexin6 promotes the degradation of the epidermal growth factor receptor (EGFR) in response to EGF25. Additionally, Haendeler et al. demonstrated that EGF stimulation of aortic cells results in GIT1 mediated Src-dependent activation of Phospholipase C\u03b326. These findings demonstrate that GIT1 can act as a scaffold in downstream signaling of EGFR, leading us to hypothesize that GIT1 functions downstream of HER3.Previously, we showed that HRG stimulation of MCF-7 cells induces extracellular acidification27. Our results showed that the MAP3K4 (P) antibody co-precipitated GIT1 with MAP3K4. The association between the two proteins was independent of growth factor and osmotic stress. Interestingly, the MAP3K4 (A) antibody failed to precipitate GIT1 suggesting that the MAP3K4 (A) antibody and GIT1 associate with MAP3K4 at overlapping sites (lanes d\u2013f). We further confirmed the specificity of the interaction between MAP3K4 and GIT1 with a similar experiment as described above. We used the rabbit polyclonal antibodies MAP3K4 (P) and MAP3K328, both prepared using the same procedures but different antigens and affinity columns28 ) . A report showed that 10\u2009mM lactate was sufficient to induce a GPR81-mediated antilipolytic effect in mice after injection of lactate but not in GPR81 deficient mice24. Furthermore, siRNA knockdown of MAP3K4 significantly inhibited HRG induced extracellular acidification in MCF-724. In this study, we observed HRG stimulation increases extracellular lactate concentrations suggesting that HRG stimulation upregulates glycolysis in the MCF-7 cells. Additionally, we can add GIT1, in addition to HER3, as a MAP3K4 associated protein that is necessary for HRG induced extracellular lactate in MCF-7 breast cancer cells.Previously, we reported that MAP3K4 associates with tyrosine phosphorylated HER3 in response to HRG stimulation of MCF-7 and T-47D breast cancer cells and, we showed that HER2 activity was required for the association between MAP3K4 and HER3, but HER2 was not present in this complex of proteins6, suggesting that extracellular lactate may be an indicator of tumor growth. While a knockdown of about 50% of GIT1 was sufficient to impair anchorage independent growth in MCF-7 cells, loss of 75% of MAP3K4 expression appeared insufficient to disrupt anchorage independent growth of MCF-7 cells . In order to test this hypothesis, we stimulated the MCF-7 cell lines with lactate and HRG. We observed that treatment with HRG decreased the mRNA expression of GPR81 Fig.\u00a0. Interes38. In addition to the serine/threonine kinase domain, MAP3K4 is characterized as having a GADD45 binding domain, an autoinhibitory domain, a dimerization domain39, and a Cdc42/Rac interactive binding (CRIB) domain40. The dimerization domain of MAP3K4 consists of amino acids 982\u20131012, mediates trans autophosphorylation of MAP3K439, and is adjacent to the alanine-rich antibody epitope recognized by the MAP3K4(A) antibody . Prior to experimental procedures, MCF-7 cells were cultured in DMEM supplemented only with 1% penicillin-streptomycin for 16 hrs. Cells were stimulated with 10\u2009nM heregulin-\u03b23 (HRG) EGF-Domain (Millipore #01-201) for 10\u2009minutes unless otherwise indicated or with 0.3\u2009M sorbitol for 30\u2009minutes.MCF-7 cells were cultured in Dulbecco\u2019s modified Eagles medium high glucose (DMEM) pH 7.4, supplemented with 1% P/S, 10% fetal bovine serum (FBS), 44\u2009mM NaHCO6 or 1.72\u2009\u00d7\u2009105 of each cell line were plated in 10\u2009cm plates or 6 well plates respectively and cultured in DMEM supplemented only with 1% penicillin-streptomycin for 16 hrs. Cells were stimulated with 10\u2009nM HRG for 10\u2009min unless otherwise indicated.Knockdown cell lines were cultured in DMEM pH 7.4, supplemented with 1% P/S, 10% FBS and 10\u2009\u03bcg/ml insulin (Thermo #12585014). Prior to experimental procedures, 3.0\u2009\u00d7\u2009102, 1% Triton X-100, 10% glycerol, 1\u2009mM EDTA, 1\u2009mM dithiothreitol) with protease inhibitors: 0.5\u2009mM phenylmethylsuflonyl fluoride and 0.5\u2009mM sodium orthovanadate.Mice were housed in a specific pathogen-free room with food and water ad libitum at the University of Arizona Animal Care facility. Protocols were approved by the UA Institutional Animal Care and Use Committee and all experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. Mouse muscle tissue extract (60\u2009\u00b5g) was used as a positive control for MCT4 Western blotting. A female B6 strain mouse (4 months old) was euthanized and quadriceps femoris muscle was collected to prepare protein extracts. After being weighted, the muscle tissue was homogenized (111.11\u2009mg tissue/1\u2009ml lysis buffer) at 12,000\u2009rpm for three pulses, 10\u2009seconds each, at 4\u2009\u00b0C with lysis buffer . Membranes were blocked with 5% non-fat dry milk in 25\u2009mM Tris-HCl, pH 7.4, 137\u2009mM NaCl, 2.7\u2009mM KCl, and 0.15% Tween 20 (TBS-T). Immunostaining was performed in 5% non-fat dry milk in TBS-T and detected using chemiluminescence reagent . Images were obtained using ChemiDocTM XRS\u2009+\u2009(BIO-RAD) and quantification was performed with Image Lab Software. Antibodies were purchased from Cell Signaling , Santa Cruz Biotechnology Inc. , Thermo Scientific (actin #MA1-744), and MAP3K4 antibody was developed as previously described19.Cells were lysed in lysis buffer  with protease inhibitors: 0.5\u2009mM phenylmethylsulfonyl fluoride, 10\u2009\u00b5M leupeptin, 2\u2009mM MgCl19. Immune complexes were recovered using Protein A-Sepharose beads (Sigma #P3391) and were washed twice with ice cold lysis buffer and denatured with Laemmli sample buffer.Cell extracts of MCF-7 cells (2\u2009mg) were immunoprecipitated for 1\u2009hr at 4\u2009\u00b0C with rabbit anti-MAP3K4 polyclonal antibodies2, 37\u2009\u00b0C for 16 hrs. The cells were then transfected with a mixture of plasmids, 2.5\u2009\u03bcg psPAX2, 2.5\u2009\u03bcg pMD2.G, 5\u2009\u03bcg pLKO.1-TRC containing the target shRNA sequence and 20\u2009\u00b5g of jetPRIME Polyplus transfection reagent (Polyplus #114-07) as per the manufacturer\u2019s instructions. The sense primer sequence for GIT1 was 5\u2032 CCGG AGG CTG GTT GAG TGC CAA TAT CTC GAG ATA TTG GCA CTC AAC CAG CCT TTT TTG-3\u2032, and the antisense sequence was 5\u2032-AATT CAA AAA AGG CTG GTT GAG TGC CAA TAT CTC GAG ATA TTG GCA CTC AAC CAG CCT-3\u2032. The MAP3K4 shRNA sense primer sequence was 5\u2032 CCGG GCC AGC CAG TCG GTC TAA TTT CTC GAG AAA TTA GAC CGA CTG GCT GGC TTT TTG 3\u2032, and the antisense primer sequence was 5\u2032 AATT CAA AAA GCC AGC CAG TCG GTC TAA TTT CTC GAG AAA TTA GAC CGA CTG GCT GGC-3\u2032. The transfected HEK 293\u2009T cells were then incubated with DMEM with 10% FBS and 1% P/S for 16 hrs. The media was then replaced with DMEM (7.5\u2009ml) with 2% FBS without antibiotics and incubated for 16 hrs. The media was collected and stored at 4\u2009\u00b0C. Additional media was added to the cells and incubated for another 16 hrs. The media was collected and combined with the previously collected media and then concentrated to 4\u2009ml using the Millipore Amicon Ultra 15 centrifugal filters (Millipore #UFC900324). Concentrated virus (1\u2009ml) was then mixed with DMEM 10% FBS, 1% P/S, 10\u2009\u03bcg/ml insulin, 16\u2009\u03bcg/ml polybrene (Millipore #TR-1003-G), and added to a well of 70% confluent MCF-7 cells in a 6 well plate and incubated 48\u2009hours. The virus containing media was then aspirated, replaced with DMEM 10% FBS, 1% P/S, 10\u2009\u03bcg/ml insulin and incubated 24\u2009hours. Puromycin dihydrochloride (2\u2009\u03bcg/ml) (Millipore #540411) was added and the cells were incubated for 7\u2009days with 5% CO2, and 37\u2009\u00b0C. During the 7 day period of selection with puromycin, the cells were split when the plate reached 90\u2013100% confluency.Six cell culture plates (10\u2009cm) were coated with poly-L-lysine (Sigma #P8920) by incubating the plates for 5\u2009min with 0.01% poly-L-lysine. The plates were then washed twice with sterile milliQ water and let dry. HEK 293\u2009T cells were seeded in the poly-L-lysine coated plates to 20% cell density and incubated in 5% COcyano-4-hydroxycinnamic acid (CHC) and then stimulated with HRG for 0, 1, 4, 8, and 16 hrs. The media was taken at each corresponding time point and frozen. The samples were then thawed and diluted 20-fold in PBS. The samples were incubated for 30\u2009min in the assay kit\u2019s L-lactate detection solution and read at 570\u2009nm. Significance was assessed with the Student\u2019s t-test.The L-Lactate assay kit II (Eton Bioscience #1200052002) was used for lactate measurements. Cells were seeded  in a 96 well plate in triplicate, media without cells was added in six wells to use as a blank. The cells were cultured overnight for 16 hrs, then starved for 4 hrs in DMEM (A14430-01) supplemented only with 1% P/S, L-glutamine (2\u2009mM) and glucose (25\u2009mM). The cells were then pretreated with \u03b1-2, 37\u2009\u00b0C for one week. The media was changed, and the cells were incubated at 5% CO2, 37\u2009\u00b0C for another week. The media was aspirated and 1\u2009ml of crystal violet 0.005% was added to each well. The cells were incubated for 1\u2009hr at 37\u2009\u00b0C and then pictures taken with the Coomassie filter of the ChemiDoc XRS+. Cells were counted with the ImageJ software running the colony counter add-on downloaded from the NIH plugins for the ImageJ website. The circularity function was set to 0.85 to 1.00, with the pixel count set to 40\u2013600. Significance was assessed with the Student\u2019s non-paired t-test with an n\u2009=\u20096.A 3% noble agar solution was prepared and allowed to cool in a 48\u2009\u00b0C water bath. DMEM with 1% P/S, 10% FBS, and 10\u2009\u03bcg/ml insulin was heated in a 37\u2009\u00b0C water bath. The 3% noble agar solution was mixed with DMEM (37\u2009\u00b0C) to make a 0.6% agar/DMEM (48\u2009\u00b0C) mixture and 4\u2009ml was added per well of a 6 well plate and left 1\u2009hr to solidify at room temperature. Cells were counted and mixed with the 0.6% noble agar/DMEM mixture prepared above to a final concentration of 10,000 cells/well/2\u2009ml of 0.3% noble agar DMEM and let solidify on top of the 0.6% agar/DMEM layer for 1\u2009hr. DMEM (2\u2009ml) was added per well and the cells were incubated at 5% CO5) were seeded in 6 well plates as indicated above for the MCF-7 and incubated for 40 hrs at 37\u2009\u00b0C and 5% CO2. The cells were then starved for 5 hrs in DMEM (Thermo #A14430-01) supplemented only with 1% P/S, L-glutamine (2\u2009mM) and glucose (25\u2009mM). The glutaminase inhibitor bis-2-ethyl sulfide (BPTES) was then added to a final concentration of 10\u2009\u03bcM. The inhibitor CHC was added to a final concentration of 100\u2009\u03bcM. The cells were incubated for 1\u2009hr at 37\u2009\u00b0C and 5% CO2 then lactate and HRG were added or not to a final concentration of 10\u2009mM and 10\u2009nM respectively. Cells were incubated for 16 hrs at 37\u2009\u00b0C and 5% CO2 then harvested with RiboZol (VWR #97064-948). mRNA was purified with the nucleospin kit (Takara #740955.50) as per manufacturer instructions. The purified mRNA (1000\u2009ng) was converted to cDNA using the qScript cDNA SuperMix (QuantaBio #101414-106) as per manufacturer inscrutions. The qRT-PCR reaction was performed with SYBR Green\u2009+\u2009ROX reagent (VWR #101414-278). GPR81 mRNA levels were assessed using the primer sequences as reported by Jeninga et al. 42. GAPDH and RPL13A mRNA levels were used as housekeeping genes to normalize GPR81 mRNA levels44. Conditions were set as following: 1. 95\u2009\u00b0C for 10\u2009min, 2. 95\u2009\u00b0C for 15\u2009sec, 3. 63\u2009\u00b0C for 15\u2009sec (read), 4. 72\u2009\u00b0C for 15\u2009sec (read) go to 2 (40 cycles), 5. 95\u2009\u00b0C for 15\u2009sec, 6. 60\u2009\u00b0C for 1\u2009min, 7. 95\u2009\u00b0C for 15\u2009sec (read). Experiments were performed each in technical duplicates and biological triplicates. Significance was assessed with the Student\u2019s non-paired t-test with an n\u2009=\u20093.Cells (1.72\u2009\u00d7\u2009105) were seeded in 6 well plates as indicated above for the MCF-7 and incubated for40 hrs at 37\u2009\u00b0C and 5% CO2. The cells were then starved for 5 hrs in DMEM (Thermo #A14430-01) supplemented only with 1% P/S, L-glutamine (2\u2009mM) and glucose (25\u2009mM). The glutaminase inhibitor bis-2-ethyl sulfide (BPTES) was then added to a final concentration of 10\u2009\u03bcM. The inhibitor CHC was added to a final concentration of 100\u2009\u03bcM. The cells were incubated for 1\u2009hr at 37\u2009\u00b0C and 5% CO2 then lactate and HRG were added or not to a final concentration of 10\u2009mM and 10\u2009nM respectively. Cells were incubated for 48 hrs at 37\u2009\u00b0C and 5% CO2 then harvested with lysis buffer as indicated in the Western blotting and antibodies section.Cells (1.72\u2009\u00d7\u200910SUPPLEMENTAL FIGURES"}
+{"text": "Saccharomyces yeasts in winemaking due to their positive attributes. The non-Saccharomyces yeast Hanseniaspora vineae is an apiculate yeast that has been associated with the production of wine with good fermentation capacity and an increase in aromatic properties. However, this yeast represents a concern in mixed culture fermentation because of its nutrient consumption, especially nitrogen, as its mechanisms of regulation and consumption are still unknown. In this study, we analyzed the nitrogen consumption, as well as the nitrogen catabolism repression (NCR) mechanism, in two genome-sequenced H. vineae strains, using synthetic must fermentations. The use of synthetic must with an established nitrogen content allowed us to study the NCR mechanism in H. vineae, following the amino acid and ammonia consumption, and the expression of genes known to be regulated by the NCR mechanism in S. cerevisiae, AGP1, GAP1, MEP2, and PUT2. H. vineae exhibited a similar amino acid consumption and gene expression profile to S. cerevisiae. However, the wine strain of S. cerevisiae QA23 consumed ammonia and valine more quickly and, in contrast, tyrosine and tryptophan more slowly, than the H. vineae strains. Our results showed a similar behavior of nitrogen regulation in H. vineae and S. cerevisiae, indicating the presence of the NCR mechanism in this Hanseniaspora yeast differentiated before the whole genome duplication event of the Saccharomyces complex. Future study will elucidate if the NCR mechanism is the only strategy used by H. vineae to optimize nitrogen consumption.There is increasing interest in the use of non- Saccharomyces cerevisiae. The inoculation of commercial strains of S. cerevisiae is a common practice in wineries to ensure the completion of the fermentation and the quality of the final product. However, the elaboration of uniformed wines is not always desired, and winemakers are becoming more interested in obtaining characteristic and differential wines. Considering this fact, in recent years, much effort has been focused on the use of non-Saccharomyces yeasts to obtain wine with new organoleptic characteristics , are comprised of the ammonia and the amino acids present in the grape juice  that selects the best nitrogen sources for growth. The NCR mechanism consists in the reduction of proteins responsible for utilization and uptake of non-preferred nitrogen sources in the presence of preferred nitrogen sources. This mechanism acts at two levels to assure the consumption of preferred nitrogen sources. The first consists in the inactivation and degradation of the existing non-preferred nitrogen source permeases, and the second consists in the repression of genes encoding for non-preferred nitrogen source permeases , GAP1  and PUT4 (Proline UTilization). In addition, other non-permeases proteins like PUT2 (Delta-1-pyrroline-5-carboxylate dehydrogenase), which is a key enzyme for the conversion of proline into glutamate in the mitochondria once it has entered the cell through PUT4, are also nitrogen-regulated , like GAP1, PUT4, PUT2, and MEP2 genes  mechanism in Saccharomyces cerevisiae QA23 . The apiculate yeast strains used, Hanseniaspora vineae T02/5AF and Hanseniaspora vineae T02/19AF, were both isolated from Uruguayan vineyards  form. The rehydration process was performed according to the manufacturer\u2019s instructions . Both strains of H. vineae, T02/5AF and T02/19AF, were in fresh paste form, and both were prepared in the same way as QA23 using warm water.Yeast strain 6 cells/mL of the yeast strain was inoculated into an Erlenmeyer flask with 100 mL of yeast nitrogen base (YNB) media without amino acids (DifcoTM) with 150 mg/L of (NH4)SO4 and 20 g/L of glucose (AppliChem Panreac\u00ae) for 24 h at 120 rpm and 28\u00b0C. The YNB medium was used to exhaust the yeast nitrogen reserves.To determine the uptake and metabolism of nitrogen, yeast strains were grown at 28\u00b0C during 24 h in a solid yeast extract-peptone dextrose (YPD) medium . A colony from the yeast culture was inoculated in 50 mL liquid YPD media for 24 h in Erlenmeyer flasks at 120 rpm and 28\u00b0C. A population of 1 \u00d7 106 cells/mL. The cells were washed and resuspended with synthetic must before inoculation to remove the nitrogen residues.After a microscopic counting of the cells using a Neubauer chamber, 1,500 mL of synthetic must was inoculated to a final concentration of 2 \u00d7 10The fermentations were performed in synthetic must . The fermentation activity was assayed by the juice density every day using a portable density meter (Mettler Toledo).In the laboratory-scale fermentations, cell population monitoring was established by measuring the absorbance at 600 nm. The samples were measured every 4 h during the first 48 h after inoculation and once a day from 48 h to the end of the fermentation.TM Advantage A10), centrifuged  and after removal of the supernatant, it was frozen in liquid nitrogen and stored at \u221280\u00b0C.The evaluation of the gene expression affected by the nitrogen catabolite repression (NCR) was performed during the first hours on the synthetic must fermentation. Sampling every 4 h during the first 24 h and every 6 h from 24 to 36 h was followed by centrifugation  and removal of the supernatant. The pellet was washed with cold sterile MilliQ water (Millipore Q-POD\u00ae Mini kit (QIAGEN\u00ae) and RNase-Free DNAse Set (QIAGEN\u00ae) according to the manufacturer\u2019s instructions. The RNA obtained was then measured using a Nano Drop (NanoDrop 1000 Thermo\u00ae Scientific) and diluted to a final concentration of 320 ng/\u03bcL in a total volume of 11 \u03bcL. The cDNA synthesis of each sample was performed using the corresponding RNA, 1 \u03bcL of oligo-dT primer (InvitrogenTM), 1 \u03bcL of dNTPs (10 mM) and 1 \u03bcL of transcriptase (SuperScript\u00ae II Reverse Transcriptase-InvitrogenTM) and amplified using a 2720 Thermal Cycler (Applied Biosystems) according to the manufacturer\u2019s instructions.The RNA was extracted from these samples using an RNeasyAGP1, GAP1, MEP2, and PUT2 and their orthologous in H. vineae. Annotation of putative orthologous was based on BLASTx searches using H. vineae predicted CDS and the proteome of S. cerevisiae. A hit was considered significant if: (i) e-value threshold was less than 1e-10 (ii) the alignment length covered more than 90% of the length of both sequences, and (iii) both sequences presented the same pfam domain. In case of multiple hits we selected the H. vineae prediction with higher percentage of amino acid identity (Supplementary Table ACT1) and Inorganic PyroPhosphatase 1 (IPP1) from S. cerevisiae and H. vineae were used to normalize the amplification curves of the selected genes considering their stability ], 0.4 \u03bcL of ROX Reference Dye (SYBR\u00ae Premix Ex Taq II), 0.8 \u03bcL of each specific primer (10 \u03bcM) and 6 \u03bcL of sterile MilliQ water (Millipore Q-PODTM Advantage A10). The amplification process was conducted using a 7300 Real Time PCR System (Applied Biosystems) as follows: 50\u00b0C for 2 min, 95\u00b0C for 10 min and 40 cycles at 95\u00b0C for 15 s, 60\u00b0C for 2 min and 72\u00b0C for 30 s.In all the samples, the Real-Time Quantitative PCR reaction was performed using 10 \u03bcL of SYBR Green  and B solvent (stationary phase) [80% acetonitrile and 20% methanol]. The analytical temperature was 20\u00b0C, and the flow rate was 0.9 mL/min. The concentration of each amino acid and ammonia was calculated using an external calibration curve of each component and expressed as mg N/L. The software used for the integration was Agilent ChemStation Plus .The solvent system was as follows: A solvent (mobile phase) [4.1 g of sodium acetate anhydrous diluted in 250 mL of MilliQ water, adjusted to pH 5.8 with glacial acetic acid and 0.4 g of sodium azide brought to a final volume of 2 L with MilliQ water  using XLSTAT Software. The results were considered statistically significant at a H. vineae, T02/5AF and T02/19AF, were evaluated, and S. cerevisiae strain QA23 was used as a control. Media density, cell growth and nitrogen content were assessed along with alcoholic fermentation. Both H. vineae strains showed a similar behavior in fermentation kinetics, cell growth and YAN consumption . The YAN was completely consumed by all the strains during the exponential growth phase that coincides with the initial stages of the fermentation . Two strains of H. vineae strains and S. cerevisiae. In all cases, lysine, glutamic acid, cysteine, isoleucine, leucine, and phenylalanine were completely assimilated during the first 24 h. As for the previous amino acids, histidine was also exhausted during this period solely by the H. vineae strain T02/5AF. The slowest consumed amino acids, arginine, and valine, were still available in very small amounts after 30 h in both S. cerevisiae and H. vineae. The remaining amino acids were consumed between 24 and 36 h in every case.The consumption of each amino acid and ammonia was measured during the first 36 h of the different strain fermentations. Figure H. vineae including three permeases , one dehydrogenase (PUT2) and four transcriptional factors . Except from DAL80, all the other genes had their homologous in H. vineae suggesting the presence of this nitrogen regulation mechanism in this yeast  and one gene related to proline utilization (PUT2) were selected to analyze their expression pattern during the first fermentation hours. These genes have been described and used in S. cerevisiae as markers for nitrogen limitation , when the amino acid concentration is also higher, and decreases as the amino acids are consumed. The other three genes started to be up-regulated at different time points along the fermentation depending on the yeast species. Therefore, both H. vineae strains activated the GAP1 and MEP2 expression after 24 h, and PUT2 after 16 h of fermentation. Finally, S. cerevisiae QA23 expressed GAP1, MEP2, and PUT2 after 16, 20 and 24 h of fermentation, respectively. Despite the differences between the yeast strains, the gradual activation or repression of the different genes coincided with the progressive consumption of the amino acids and ammonia during fermentation.Figure H. vineae, a non-Saccharomyces yeast of oenological interest, displays the NCR mechanism under fermentation conditions. This metabolism has been thoroughly studied in S. cerevisiae during alcoholic fermentation (H. vineae exhibits an NCR mechanism similar to that of S. cerevisiae.In this study, we aimed to determine if entation , and it S. cerevisiae finished the fermentation more quickly, because of its oenological abilities to resist the fermentation conditions. In addition, H. vineae, as well as S. cerevisiae, exhausted all the available YAN in 36 h even though S. cerevisiae consumed all the ammonia in 30 h, 6 h sooner than H. vineae (Figure S. cerevisiae and H. vineae. The similar consumption of the nitrogen of these two yeasts observed in this study would explain the competition for this nutrient noted by Fermentations using synthetic must with 140 mg YAN/L allowed us to evaluate ammonia and amino acid consumption together with the analysis of the expression of NCR-regulated genes during the first hours of fermentation. First, the nitrogen content of the synthetic must used in this study was not limiting, and it is considered to be the minimum concentration needed for yeasts to complete the alcoholic fermentation . In facte Figure . Medina S. cerevisiae, the strains evaluated exhausted all the YAN during the growth phase demonstrating how nitrogen availability plays a role as a limiting fermentation factor (S. cerevisiae strains and conditions in different studies. S. cerevisiae strains: prematurely consumed, early consumed and late consumed. We classified the nitrogen compounds considering the time it took for them to be completely exhausted by each yeast strain (Table 4+ are the later ones to be completely exhausted, which belong to the late consumed compounds group established by H. vineae has a similar behavior to S. cerevisiae in nitrogen uptake, and the variability of nitrogen compound preferences in H. vineae appear to also depend on the strain coinciding with previous studies on different S. cerevisiae strains (In the same way as previous studies performed in n factor . In addiin Table . However strains .GAP1. In this study, the highest arginine consumption coincided with ammonia depletion in S. cerevisiae. However, in H. vineae, arginine intake is simultaneous to that of ammonium, which may indicate that this yeast species uses a different way to store or consume this amino acid. The lower preference of H. vineae for ammonium is consistent with the reported poor effect of ammonium addition to agave juice fermentations compared to other nitrogen sources (H. vineae strains produced significantly lower levels of isobutyl alcohol derived from valine (Interestingly, arginine was the slowest amino acid to be consumed in all cases. This amino acid is known as a non-preferred nitrogen source, since its support to yeast growth is very poor , and it  sources . In addim valine , which cGAP1, MEP2, and PUT2 evolved from nitrogen-repressed to nitrogen-activated conditions as nitrogen was consumed in all cases. Between 16 and 30 h after inoculation with the different yeast strains, the gene expression of GAP1, MEP2, and PUT2 began to be significantly activated. On the other hand, AGP1 began to be repressed after 8 and 12 h of fermentations. As described before, AGP1 acts as a sensor for amino acids, and its expression is induced by extracellular amino acids via SPS system, and down-regulated when the amino acids are consumed (GAP1 and PUT2, the transcription of these genes is known to be activated under limiting nitrogen conditions (MEP2 expression, which is notably higher than other ammonium permeases (S. cerevisiae have observed the activation of both GAP1 and MEP2 when ammonium is depleted (The gene expression of consumed , which inditions , and thiermeases . Previoudepleted , 2005. HH. vineae and S. cerevisiae, as well as the similarity in nitrogen consumption and the regulation of NCR genes, suggested the presence of the NCR mechanism in this non-Saccharomyces yeast. In addition, similarly to what has been described in S. cerevisiae (H. vineae wine yeasts evaluated entered the stationary phase coinciding with the exhaustion of nitrogen and consequently, the upregulation of the NCR genes. However, further research would be necessary to fully understand nitrogen metabolism in H. vineae and to elucidate if other mechanisms not regulated by NCR are responsible for nitrogen transport in this yeast.The homology found on the NCR related proteins between revisiae , the H. H. vineae, a non-Saccharomyces yeast of oenological interest, exhibits the NCR mechanism. Since nitrogen is one of the most limiting factors during alcoholic fermentation, knowing how it is metabolized gains importance. For that reason, we performed fermentations using synthetic must with an established nitrogen content, and we analyzed the nitrogen consumption and the expression of the NCR-regulated genes. The observed pattern of gene expression and nitrogen intake for the H. vineae strains and S. cerevisiae was similar, suggesting the presence of this regulatory mechanism in H. vineae. This study contributes to a better understanding of nitrogen metabolism in the most active species in terms of the fermentation capacity of the genus Hanseniaspora, yeasts differentiated before the whole genome duplication event of the Saccharomyces group. In addition to our results, more studies are needed to completely understand nitrogen metabolism in this species.Finally, the aim of this study was to determine if JL performed and designed the experiments, wrote the manuscript, and discussed and analyzed the results. VM, FG, and FC analyzed and discussed the results. MP analyzed and discussed the results, and wrote the manuscript. GB and AM designed the experiments, analyzed and discussed the results, and wrote the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Temperature sensors with a communication capability can help monitor and report temperature values to a control station, which enables dynamic and real-time evacuation paths in fire emergencies. As compared to traditional approaches that identify a one-shot fire evacuation path, in this paper, we develop an intelligent algorithm that can identify time-aware and temperature-aware fire evacuation paths by considering temperature changes at different time slots in multi-story and multi-exit buildings. We first propose a method that can map three-dimensional multi-story multi-exit buildings into a two-dimensional graph. Then, a mathematical optimization model is proposed to capture this time-aware and temperature-aware evacuation path problem in multi-story multi-exit buildings. Six fire evacuation algorithms  are proposed to identify the efficient evacuation path. The first three algorithms that do not address human temperature limit constraints can be used by rescue robots or firemen with fire-proof suits. The last three algorithms that address human temperature limit constraints can be used by evacuees in terms of total time slots and total temperature on the evacuation path. In the computational experiments, the open space building and the Taipei 101 Shopping Mall are all tested to verify the solution quality of these six algorithms. From the computational results, TABFS, TASP and TADBF identify almost the same evacuation path in open space building and the Taipei 101 Shopping Mall. BFS, SP DBFS can locate marginally better results in terms of evacuation time and total temperature on the evacuation path. When considering evacuating a group of evacuees, the computational time of the evacuation algorithm is very important in a time-limited evacuation process. Considering the extreme case of seven fires in eight emergency exits in the Taipei 101 Shopping Mall, the golden window for evacuation is 15 time slots. Only TABFS and TADBFS are applicable to evacuate 1200 people in the Taipei 101 Shopping Mall when one time slot is setting as one minute. The computational results show that the capacity limit for the Taipei 101 Shopping Mall is 800 people in the extreme case of seven fires. In this case, when the number of people in the building is less than 700, TADBFS should be adopted. When the number of people in the building is greater than 700, TABFS can evacuate more people than TADBFS. Besides identifying an efficient evacuation path, another significant contribution of this paper is to identify the best sensor density deployment at large buildings like the Taipei 101 Shopping Mall in considering the fire evacuation. Fire detection and evacuation are an important issue in today\u2019s multi-floor building construction. In the existing evacuation approach, evacuees in the building are evacuated by following the evacuation sign on the wall to the emergency exits. However, evacuees following the fixed evacuation sign to the nearest emergency may be stuck on the route when the fire spread to the emergency route. This calls for an intelligent evacuation path that can bypass the fire zone to the emergency exit in a timely manner. In a contemporary multi-floor building, temperature sensors and smoke sensors are deployed to detect and issue an alarm when there is a fire or smoke in the building. These sensors are connected by wired or wireless networks to enable the IoT capabilities in monitoring and capturing the fire signal in the buildings. When the fire signal is detected, the most important thing is to identify the evacuation path in the buildings.The temperature data collected by the temperature sensors deployed in the building can provide useful information for planning the evacuation path. Basically, the temperature sensors will periodically sense, collect and transmit the temperature data back to the control station, also known as the sink node. Instead of a traditional fixed evacuation path, a temperature-aware evacuation path should be designed to provide a safer evacuation route by using the temperature data collected by the sensors. In a fire zone that has a very high-temperature or is full of inflammable materials , the fire spreading can be very fast so as to increase the temperature dramatically in a very short period of time. In addition, evacuation in a large multi-floor building should adapt to the temperature changes because of longer evacuation time. Hence, the evacuation path should be re-calculated and rerouted at every time slot to acquire the most recent temperature data.Evacuation path planning has been studied in recent years; most focus on the evacuation path planning in a two-dimensional graph. However, these algorithms are not applicable to the three-dimensional multi-floor buildings. In addition, most of the previous research calculates the evacuation path based on one-shot temperature data captured by the sensors. This one-shot temperature data calculated evacuation path is not valid in the large multi-floor buildings where the temperature can change dramatically in the fire environments during evacuation.According to the fire research in , fire prNote that most injuries and deaths are caused by smoke in the fire. Human exposes to toxic gases  within one or two minutes will become incapacitated in movement . In 5],,5], theyIn In this paper, we first propose the mathematical models to capture this evacuation path planning problem in the multi-story multi-exit buildings and then develop the temperature-aware and time-aware algorithms based on the temperature data periodically captured by the temperature sensors. In the proposed mathematical models and evacuation path algorithms, we generalized the path cost metric to address the time cost and the temperature cost. When using the total time slots as the cost metric, the proposed evacuation path algorithm identifies the path that can evacuate people as fast as possible and in-the-meantime to bypass the fire zone. When using the total temperature on the evacuation path as the cost metric, the proposed evacuation path algorithms identify the comfortable evacuation path with the minimum total temperature on the evacuation path.The contribution of this paper is the proposed multi-time-slot-aware evacuation algorithm that can help the evacuees to evacuate in the most efficient way. To distribute the calculated evacuation path to the evacuee on a timely basis, another three components should be constructed in the system. The first is the temperature sensors that will report the sensing temperature data back to the control center. The second is the control center that calculates the evacuation path by using the proposed algorithms for each user and distribute the evacuation path to the user\u2019s app. The third is the user\u2019s app that shows the evacuation path from the control center and reports his/her location to the nearby Wi-Fi APs.We summarize the contributions of this paper.Novel time and temperature aware evacuation path (TTAEP) model: We propose a rigorous mathematical model, TTAEP, to capture the evacuation path planning problem in the multi-story multi-exit building with addressing to the temperature changes in different time slots.Novel time aware and temperature aware evacuation path planning algorithm: Six evacuation algorithms are devised to tackle the TTAEP problem where the objective is to identify the evacuation path with minimum evacuation time and minimum total temperature on the path. The basic idea of the proposed algorithms is to identify the multi-staged best paths to adapt to the temperature changes at each stage. By using the most recent sensed temperature data return from the sensors, the proposed algorithms identify the multi-staged evacuation path.Helps to determine the density of deploying temperature sensors in the building: From the computational experiments in the Taipei 101 Shopping Mall, we observe that the density of deployed temperature sensors in the building plays a non-negligible role in determining the efficiency of the evacuation paths and the best sensor density should consider the tradeoff between evacuation speed and fire spreading speed. The computational experiments of the proposed algorithms can help to determine the best density of deployed temperature sensors in the building.Helps to determine the maximum people capacity in the building: From the computational experiments in the Taipei 101 Shopping Mall, we observe that at most 800 people can be successfully evacuated within 15 time slots in the extreme case of seven fires. The computational experiments of the proposed algorithms can help to determine the maximum people capacity in the building in considering the evacuation process.With the rapid development of sensor technologies and IoT technologies, temperature aware evacuation services are possible in state-of-the-art IoT buildings. Home-based fire detection and alert system prototype were built in  by adoptAn evacuation route planning algorithm has been proposed in recent studies. In ,13, a shEvacuation in the open space from disaster or terrorist attack has been proposed in . As compEvacuee\u2019s behavior is an important factor in the evacuation success rate. In , they foFire and evacuation simulation models have been proposed in recent research. In , fire anThe fire evacuation problem is a complex and highly dynamic problem. Until now, there are no international standards on the verification and validation of building fire evacuation models . In 33]33], theyTo summarize, even though there are many evacuation algorithms proposed in the literature, most of these algorithms are a one-shot algorithm where they do not address the temperature changing problem in the evacuation. In particular, how to identify a temperature-aware evacuation path in the multi-story multi-exit building is still not explored yet. In this paper, we capture the temperature changes at each time slot and propose a novel mathematical model and algorithms to identify the efficient evacuation path in a multi-story multi-exit building.To successfully develop the evacuation path in a multi-floor building, it is important to capture the building\u2019s information in the three-dimension structure at the first stage. The floor plan information  at each floor must be captured. In addition, the staircase that connects each floor also must be identified. As it is known that it is easier to develop the evacuation path algorithm in a two-dimensional graph. We first develop a graph mapping scheme that transforms the three-dimensional multi-floor building into a two-dimensional graph.i, j) on floor k where I indicates the set of X-axis locations; set J indicates the set of Y-axis locations and set K indicates the set of floor locations in the multi-floor building. Then the total number of locations to deploy the sensors is i, j) on floor k and First, let i is associated with a node ID, then next move to the positions in row Next, we assign the node ID number k floor that is neither the highest floor nor the first floor  and the above arguments, the node ID number for the left staircase at the In addition, the node ID number for the right staircase at the In k. Let set After getting the node ID, the next step is to set up the links to connect the nodes in the planar graph. Basically, for any location in The reason why we have Based on Equations (5)\u2013(10), the total number of links in the planar graph is calculated in Equation (11). In Equation (11), the first term is to calculate the total links for all four directions of every node. The second term is to deduct the number of links that the nodes do not have their neighbors. The third term is to add the number of links that connect the staircase locations. For the three-floor building example shown in Based on the Equations (1)\u2013(4) to determine the node ID and Equations (5)\u2013(10) to determine the link ID, we successfully transform the multi-floor building locations to the planar graph. In the next section, we will describe the algorithms to identify the efficient evacuation path in the multi-story multi-exit building.In this section, we propose the mathematical model to capture the evacuation path planning in the multi-floor building. The set of nodes and links in the planar graph constructed in the previous section are used as the input parameters to the following mathematical models. The basic idea of this mathematical model is to identify the minimum cost evacuation path in the multi-floor building. We generalize the model to identify the cost-efficient evacuation path. The cost can be the number of steps to evacuate from the building or the total temperature along the evacuation path. By setting the cost to be the number of steps to evacuate from the building, it is to minimize the time to evacuate. By setting the cost to be the total temperature along the evacuation path, it is to identify the evacuation path that can avoid the fire zone.In the following, we first propose the mathematical model to capture the evacuation path planning in the multi-floor building.Input values:L: the set of possible links on the planar graph;E: the set of emergency exit nodes on the planar graph;M: the upper limit of human temperature tenability ;Decision variables:: =1 if evacuation path p is selected where : =1 if link l is on the selected evacuation path where ; =0, otherwise.First, we give the notations used in the formulation as follows:The EP mathematical model formulation is proposed as follows:1):Problem (PSubject to:1), the objective function is to minimize the total cost on the evacuation path. Constraints (14) and (16) enforce that there is an evacuation path for every user l is on the evacuation path. Constraint (13) enforces for the temperature on any selected link cannot exceed the upper limit of human temperature tenability M. This constraint is very important that people can survive on the evacuation path. Without this constraint, people may be hurt or even die on the evacuation path. Constraint (15) enforces that the evacuation path should traverse through at least one evacuation exit node. This is to ensure that every user can find the evacuation path to the emergency exit. Note that if the evacuation path for any user traverses through more than one emergency exit node, the traverse route after the first emergency exit node can be deleted to have a lower objective function value without violating the constraints in problem (P1). Hence, at the optimal solution, each user will traverse only one emergency exit.In problem (P1), when setting , the objective function is to minimize the number of steps to reach the destination . By adopting this link cost setting, it is to identify the fastest evacuation path to reach the destination. When , the objective function becomes to minimize the total temperature on the evacuation path to reach the destination. By adopting this link cost setting, it is to identify the lowest temperature evacuation path to reach the destination. In other words, the proposed TAEP model can be used to identify the fastest evacuation path model or the lowest temperature evacuation path model by changing the link cost setting.In problem .However, this EP model is only valid to a slow fire progression area or a small area where the people can run to the emergency exit quickly without the temperature changes on the evacuation path. In a multi-floor building, the people need minutes of evacuation time to run to the emergency exit. In this case, the temperature on the evacuation path may significantly increase so that people may be stuck at the evacuation path because the temperature is already over the upper limit of human temperature tenability Next, we consider the mathematical model to address the temperature changes during evacuation in the multi-floor building. The basic idea is that the temperature sensors will report the temperature in a fixed interval  so that the link cost will be adjusted to address the temperature changes at the link\u2019s termination node.Input values:T: the set of time slots during evacuation;ttDecision variables:: =1 if link lt; =0, otherwise.Besides the notations given in The TTAEP mathematical model formulation is proposed as follows:2):Problem (PSubject to:2), the objective function is to minimize the total cost in addressing the time aware temperature changes on the evacuation path. The reason why we introduce the tttIn problem (P2), constraints (22) and (25) enforce that there is an evacuation path for every user l is on the evacuation path. Constraint (21) enforces that when people traverse link tM. Constraints (19) and (27) enforce that for any link ll is on the evacuation path, people must traverse this link at least one time slot  is to enforce that people can only traverse every link In the next section, we propose the algorithms to solve the TTAEP mathematical models.2) contains a constrained shortest path problem, and it is proven to be an NP-hard problem in [2). We propose two sets of algorithms to tackle this multi-floor evacuation path problem. The first set is the three shortest path-based algorithms without addressing the temperature constraint (21). In this first set, the first algorithm is the shortest path (SP), which is leveraged on Dijkstra\u2019s shortest path algorithm. The second algorithm is the best-first search (BFS) that is leverage on the A* algorithm. The third algorithm is dynamic best-first search (DBFS) that is leverage on the D* algorithm. The second set is the three shortest path-based algorithms with addressing the temperature constraint in (21). They are temperature aware best-first search (TABFS), temperature aware shortest path (TASP) and temperature aware dynamic best-first search (TADBFS) algorithms. Note that only the three algorithms in the second set  identify the feasible solutions to the TTAEP problem in problem (P2), which can be used to evacuate the evacuees. Three algorithms  that do not address the human\u2019s temperature limit constraint can be used by the rescue robots or fireman with a fire-proof suit.Problems . The basic idea of the SP algorithm is to leverage Dijkstra\u2019s algorithm to identify the shortest path to every exit based on the temperature data acquired by sensors at each time slot N is the set of nodes in the networks. Then the time complexity for the SP algorithm is In the SP algorithm, the time complexity is determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, Dijkstra\u2019s shortest path algorithm must be performed for every emergency exit. The time complexity of Dijkstra\u2019s shortest path algorithm is t. The A* algorithm is an iteration-based algorithm to identify the shortest path from the start node to the destination node. At each iteration of extending the path to the destination node, A* identifies the next node n that minimize the f(n) = g(n) + h(n), where g(n) is the cost from the start node-to-node n and h(n) is the heuristic function that estimates the cost from node n to the destination node [h(n) to be the Euclidean distance from node n to the destination node. Because the Euclidean distance is smaller than the actual distance, the A* algorithm can identify the shortest path from the source node to the destination node.The second algorithm is the BFS algorithm. By changing Dijkstra\u2019s shortest path algorithm to A* algorithm at Step 2 in the \u201cwhile\u201d loop, the above algorithm becomes the BFS algorithm. The basic idea of the BFS algorithm is to leverage on A* algorithm  to idention node . Here weN is the set of nodes in the networks [In the BFS algorithm, the time complexity is determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, A* shortest path algorithm must be performed for every emergency exit. When using the binary heap data structure, the time complexity of A* shortest path algorithm is networks . Then tht. In the DBFS algorithm, the time complexity is determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, D* shortest path algorithm must be performed for every emergency exit. The time complexity of D* shortest path algorithm is The third algorithm is the DBFS algorithm. By changing Dijkstra\u2019s shortest path algorithm to D* algorithm at Step 2 in the \u201cwhile\u201d loop, the above algorithm becomes the DBFS algorithm. The basic idea of the DBFS algorithm is to leverage on D* algorithm  to identlgorithm ,39. ThenM is removed from the set L and then perform Dijkstra\u2019s algorithm to identify the shortest evacuation path. With this operation, the temperature on all the links selected by the identified evacuation path will not exceed the upper limit of human temperature tenability M. Hence, constraint (21) is captured and satisfied.Algorithm 2: TASP AlgorithmBeginInitialize the value of all the decision variables to be zero, and the node position of the evacuating person be the start node;\u2003\u2003Construct the nodes and links in the 2-D planar graph;\u2003\u2003Let the node position of the evacuating person be the start node;\u2003\u2003Whilet\u2003\u2003BeginCollect the temperature data at each node and the link cost data at each link at time slot Remove the link L from set L if the link temperature is over the upper limit of human temperature tenability M; //avoiding traverse to a node with temperature more than M on the evacuation pathCalculate the shortest path from the start node to every exit node by using Dijkstra\u2019s algorithm; //Step 3LetFor every exit BeginIf there is the best path to exit BeginLetEnd //ifEnd //For\u2003\u2003\u2003If . As compared to the SP algorithm, the link temperature that is over the upper limit of human temperature tenability N is the set of nodes in the networks. Then the time complexity for the TASP algorithm is In the above TASP algorithm, the time complexity is also determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, Dijkstra\u2019s shortest path algorithm must be performed for every emergency exit. The time complexity of Dijkstra\u2019s shortest path algorithm is N is the set of nodes in the networks [The next algorithm is the TABFS algorithm. By changing Dijkstra\u2019s shortest path algorithm to A* algorithm at Step 3 in the \u201cwhile\u201d loop, the above algorithm becomes the TABFS algorithm. In the TABFS algorithm, the time complexity is also determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, the A* algorithm must be performed for every emergency exit. The time complexity of the A* algorithm is networks . Then thN is the set of nodes in the networks [The next algorithm is the TADBFS algorithm. By changing Dijkstra\u2019s shortest path algorithm to the D* algorithm at Step 3 in the \u201cwhile\u201d loop, the above algorithm becomes the TADBFS algorithm. In the TADBFS algorithm, the time complexity is also determined by the \u201cwhile\u201d loop for each time slot. Inside the \u201cwhile\u201d loop, D* algorithm must be performed for every emergency exit. The time complexity of the D* algorithm is networks ,39. ThenM. These three algorithms can be used by the rescue robots or fireman with a fire-proof suit. The other algorithms  do address the constraint (21) so that the people can move safely on the evacuation path. These three algorithms can be used by the evacuees. For the computational experiments in the next Section, we are particularly interested in the results from TABFS, TASP and TADBFS because they can identify the feasible solutions to problem (P2).To summarize, the basic idea of the proposed algorithms is to identify the best path based on the temperature data at the current time slot and the evacuee move M is set to 100 \u00b0C.To verify the solution quality of the proposed six algorithms, we perform computational experiments on two networks. The first network is an obstacle-free and wall-free building, and the second network is a big shopping mall building with walking paths and walls. In an obstacle-free and wall-free building, the user can move to the neighboring node in four directions  if the user\u2019s position is not at the edge of the graph. In a building with walking paths and walls, users can only move on the walking path and cannot go through the wall. The experiments on the first network are to verify the solution quality of these six algorithms of evacuating people in the open space building . The experiments on the second network are to verify the solution quality of these six algorithms of evacuating people in a building with many rooms . In these two sets of experiments, the upper limit of human temperature tenability Basically, the fire spreading grows like a diamond shape, as shown in We first show the open space network with obstacle-free and wall-free in aE on the first floor. In cE on the first floor. In aE on the first floor. Because fire spreads one hop distance at each time slot, it can be expected that the fire will spread to the emergency exit aE at the third time slot. In this case, the temperature for two emergency exits  are all over threshold M. Instead of going down the staircase to the emergency exit aE on the first floor, the evacuation path should be re-directed to the emergency exit bE on the first floor. In other words, in this scenario, we want to know how well these six algorithms can adapt to the temperature changes in different time slots.In aE in bE due to the human\u2019s temperature limit constraint in constraint (21). Similarly, we also observe that the total temperature on the evacuation path for SP, BFS and DBFS are much lower than the total temperature on the evacuation path for TASP, TABFS and TADBFS when the number of floors is less than five in In Based on the results in To capture the walls and walking paths at the Taipei 101 Shopping Mall, a graph mapping scheme in We first test the case when there are four fires on the first floor in the Taipei 101 Shopping Mall. These four fires are located at the four emergency exits on the first floor, which is shown in In the next tested case, we consider there are seven fires on the first floor in the Taipei 101 Shopping Mall. These seven fires are exacted located at the seven emergency exits on the first floor, and there is only one emergency exit that does not have a fire, as shown in Based on the sensor deployment density experiments in In the above experiments, the solution quality comparison between these six algorithms is examined for a single evacuee. In the next experiments, we test the solution quality of six algorithms for a group of evacuees. One difference between evacuating a single evacuee and evacuating a large number of people in the evacuation capability in one time slot. The other difference is the computational time of the evacuation algorithm is required to be faster than the fire spreading speed when evacuating a group of people. In In In A fixed emergency evacuation path is not a valid solution for a fire emergency in the building because of the dynamic fire spreading. The failure probability of evacuation path blocking by the fire is even higher in large buildings because people need more time to evacuate. In this paper, leveraging an IoT sensor to capture the real-time temperature data from the environment, the mathematical model and six algorithms are proposed to identify efficient time-aware evacuation paths in multi-story multi-exit buildings. Three algorithms  do not address the human\u2019s temperature limit constraint, which can be used by the rescue robots or fireman with a fire-proof suit. The other three algorithms  do address the human\u2019s temperature limit constraint, which is to evacuate the evacuees.In the computational experiments, experiments on evacuating a single evacuee and evacuating a group of evacuees are performed. When evacuating a single evacuee in the open space building and the Taipei 101 building, it is observed that TABFS, TASP and TADBFS identify almost the same evacuation path. Without human temperature limit constraints, BFS, SP and DBFS identify marginal better solutions in terms of total time slots and total temperature on the evacuation path. Another interesting observation is that too low or too high sensor density deployment will incur longer evacuation time and larger temperature on the evacuation path in the Taipei 101 Shopping Mall. TABFS, TASP and TADBFS can help to determine the best sensor density on each floor of the Taipei 101 Shopping Mall.Computational experiments on evacuating a group of evacuees at the Taipei 101 Shopping Mall are also performed from 100 evacuees to 1200 evacuees. First, the maximum allowable evacuation time is tested in the Taipei 101 Shopping Mall in the extreme case of seven fires. The results show that at most, 15 time slots are allowed to evacuate the people in the building. After 15 time slots, all the eight emergency exits on the first floor will be on fire so that no evacuees can evacuate safely. Considering the case that one time slot is one minute, then the golden window to evacuate the evacuees is 15 min. This is to enforce the computational time of the selected evacuation algorithm should be less than 15 min. Then, only TABFS and TADBFS are qualified because the computation time for these two algorithms is about 10 min to evacuate 1200 people. Next, the experiments on determining the maximum capacity in the Taipei 101 Shopping Mall are also conducted. The results show that there is a capacity limit for the Taipei 101 Shopping Mall where at most 800 evacuees can be successfully evacuated. TABFS can evacuate more people than TADBFS when there are more than 700 people in the building. When the number of people in the building is less than 700, TADBFS should be selected as the evacuation algorithm to evacuate more people than TABFS."}
+{"text": "We identified 2654 reports and included 84 articles reporting 57 trials . In random effects meta-analyses, the MD resulted in greater beneficial changes in 18 of 28 MetSyn components and risk factors  index, total-, low-density lipoprotein (LDL)- and high-density lipoprotein (HDL)-cholesterol, triglycerides, alanine transaminase, hepatic fat mass, C-reactive protein, interleukin-6, tumour necrosis factor-a, and flow-mediated dilatation) and lower risk of cardiovascular disease incidence (risk ratio (RR) = 0.61, 95% confidence intervals (CI) 0.42\u20130.80; I2 = 0%), and stroke . Only six studies reported effects on pharmacotherapy use, and pooled analysis indicated no differences between diet groups. Lack of consistency in comparator groups and other study characteristics across studies resulted in high heterogeneity for some outcomes, which could not be considerably explained by meta-regressions. However, a consistent direction of beneficial effect of the MD was observed for the vast majority of outcomes examined. Findings support MD\u2019s beneficial effect on all components and most risk factors of the MetSyn, in addition to cardiovascular disease and stroke incidence. More studies are needed to establish effects on other clinical outcomes and use of pharmacotherapy for MetSyn components and comorbidities. Despite the high levels of heterogeneity for some outcomes, this meta-analysis enabled the comparison of findings across studies and the examination of consistency of effects. The consistent direction of effect, suggesting the MD\u2019s benefits on metabolic health, supports the need to promote this dietary pattern to adult populations.The Mediterranean diet (MD) may provide metabolic benefits but no systematic review to date has examined its effect on a multitude of outcomes related to metabolic health. This systematic review with meta-analysis  aimed to examine the MD\u2019s effect on metabolic syndrome (MetSyn) incidence, components and risk factors (primary outcomes), and incidence and/or mortality from MetSyn-related comorbidities and receipt of pharmacologic treatment for MetSyn components and comorbidities (secondary outcomes). We searched Pubmed, Embase, Cumulative Index to Nursing and Allied Health Literature (CINAHL), and Web of Science for controlled trials published until June 2019, comparing the MD with no treatment, usual care, or different diets in adults. Studies not published in English and not promoting the whole MD were excluded. Two authors independently extracted data and assessed risk of bias using the Cochrane Collaboration\u2019s and Risk of Bias in non-randomised studies (ROBINS-I) tools. Reporting followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Random-effects meta-analyses, subgroup analyses and meta-regressions were performed, and heterogeneity was quantified using the I The prevalence of the metabolic syndrome (MetSyn) is increasing worldwide , with apThe Mediterranean diet (MD) is characterised by high intake of olive oil and plant foods , low-to-moderate intake of dairy products, fish and poultry, moderate intake of alcohol, and low intake of red meat and sweets . Two metTo address this gap, and answer the research question \u2018What is the effect of the MD on metabolic health in adults?\u2019, we conducted a systematic review and meta-analysis of evidence from controlled trials of the effect of the MD, compared to no treatment, usual care, or different diets, on MetSyn incidence, MetSyn components (used in defining the MetSyn), and additional risk factors (primary objectives). Secondary objectives were incidence and/or mortality from MetSyn-related comorbidities and intermediate markers of these comorbidities, as well as changes in use of pharmacologic treatment for MetSyn components and comorbidities. This work updates and broadens the scope of earlier meta-analyses ,13,14,15The protocol for this systematic review and meta-analysis was registered with the International Prospective Register of Systematic Reviews . Reporting followed the Preferred Reporting Items for Systematic reviews and Meta-Analyses (PRISMA) guidelines  [19].The systematic search Studies were included if they were controlled trials (randomised and non-randomised) reporting pre- and post-intervention findings, and: (1) Participants were adults who were non-pregnant, non-lactating, and free of conditions that might affect their ability to eat certain foods; (2) the intervention promoted the whole MD or MD-style diet, with or without physical activity , and; (3) the MD was compared with no treatment, usual care, or advice to follow a different diet. Eligible studies focused on outcomes commonly assessed in everyday clinical practice in order to enhance relevance and translational potential to healthcare practitioners. Studies were included if they reported at least one of the following: (1) MetSyn incidence; (2) MetSyn components -cholesterol, triglycerides, and glucose), and additional risk factors ; (3) incidence and/or mortality from MetSyn-related , and/or intermediate  comorbidities, and; (4) outcomes related to pharmacologic treatment for MetSyn components and the aforementioned comorbidities.The titles and abstracts of identified papers were independently screened by two reviewers and the full text of all relevant papers was reviewed against the inclusion and exclusion criteria . DisagreData extracted included study and population characteristics, and outcomes, including baseline, post-intervention, and follow-up values, as well as between-group changes in outcomes, where available. Studies were assessed as having low, high, or unclear risk of bias using the Cochrane risk of bias tool for randomised controlled trials . For papFor each included paper, effect sizes were summarised for each outcome by: (1) Calculating risk ratios (RRs) or hazard ratios (HRs) from the reported data , and; (2) calculating the mean difference between the intervention and control condition from the pre-intervention to the post-intervention period . Data on outcomes were transformed, where applicable, into the same measurement units using standard conversion factors, to allow comparisons between studies, and a pooled analysis. If an included paper reported multiple outcomes of interest to the current review, each outcome was evaluated and reported independently. If an eligible and included paper reported on the follow-up measurements of an intervention study , and both papers reported on the same outcome, findings from the follow-up were reported in the qualitative synthesis, but only the post-intervention findings were meta-analysed. If a paper was based on a study that had two comparison groups, we included the control condition where another diet was promoted .2 statistic, with values >50% indicating substantial heterogeneity [As heterogeneity between studies was expected, a random-effects meta-analysis was used to summarise intervention effect estimates, expressed as RRs, HRs, or mean differences (inverse variance) with 95% confidence intervals (CIs). Heterogeneity between studies was assessed using the Iogeneity . Papers ogeneity . Where aogeneity , but it ogeneity . If the ogeneity .As the inclusion of non-randomised trials might introduce bias, particularly relating to confounding , a posthEighty-four papers  were included in the qualitative synthesis  27,28,2,110,111,n = 55); an energy-controlled MD (n = 1), a low-energy MD (n = 15), and a low-energy MD (if required) (n = 3); a low-energy, low-carbohydrate MD (n = 4); an Indo-MD (n = 2); and a low-glycaemic index MD (n = 2). The control groups received no treatment (n = 11); usual care (n = 1); and received advice to change their dietary habits in 72 papers   .Compliance to the intervention was assessed via conventional dietary assessment methods  in 53 papers; a combination of dietary assessment methods and biomarkers in 21 papers; compliance checklists in three papers; diet history interviews in two papers, and; biomarkers only in one paper. Three studies ,73,102 dOnly one paper (reporting on two comparisons in 5801 participants)  examined2 = 0%; two studies), and stroke incidence , compared to a control condition. There were no between-group differences in CVD mortality , sudden cardiac death , heart failure incidence , type 2 diabetes incidence , and fatal , and non-fatal MI , despite effect estimates in the expected direction , lipid-lowering agents , anti-platelet therapy , insulin , or oral anti-diabetic agents . Evidence from one study in 1000 participants suggested a beneficial effect of the MD, compared to a control condition, on the use of nitrates , \u03b2-blockers , and disopyramide  [Six studies reported on the effect of the MD on pharmacologic treatment of MetSyn components and/or related comorbidities ,68,91,9313\u20130.60)  in 215 p13\u20130.60)  (Supplemp < 0.001), waist circumference , systolic  and diastolic blood pressure , total cholesterol , and triglyceride concentrations . For other outcomes, Egger tests did not suggest publication bias. Based on the ROBINS-I tool, two non-randomised controlled trials were evaluated as having serious risk of bias and one as having critical risk of bias, whereas there was no information on which to base a judgment about risk of bias in remaining studies  and body mass index  when interventions were not supplemented with foods, compared with the subgroups of studies that provided foods. There was also a greater effect of the MD on blood glucose when studies did not supplement foods , were conducted in Mediterranean, compared to non-Mediterranean, countries , and when intervention duration was \u22656 months, compared to <6 months . A greater reduction in body weight  and body mass index  was also observed in studies where the MD was promoted alongside another dietary component, compared to alone. Food supplementation accounted for approximately 18%, 55%, 17%, and 19% of the heterogeneity observed for body weight, body mass index, diastolic blood pressure, and blood glucose, respectively, whereas intervention duration accounted for 27% and 19% of the variance in blood glucose and C-reactive protein concentrations, respectively. However, high levels of within-group heterogeneity were observed for most subgroups, suggesting these findings might be uncertain.The subgroup analyses based on meta-regression are presented in 2 = 100%; 24 studies), HDL-cholesterol , and alanine transaminase , whereas reduction of glycosylated hemoglobin (HbA1c) was larger in the MD, compared to a control condition . In addition, results were largely similar when cross-over trials [2 = 97%; 15 studies) and hepatic fat mass . Results remained unchanged when studies with \u22651000 participants [Sensitivity analysis, by excluding the non-randomised controlled trials ,101,102,r trials ,108,109 icipants ,93,103 wThis systematic review of 84 papers and 57 controlled trials aimed to evaluate the effect of the MD, compared to usual care, no treatment, or a different diet, on MetSyn incidence, MetSyn components and risk factors, in addition to related comorbidity outcomes and treatment for these health outcomes. To our knowledge, this is the most comprehensive list of MetSyn-related outcomes systematically assessed. We moved beyond evaluating effects on the factors used to define the MetSyn, to examining additional risk factors, such as markers of obesity, oxidative stress, inflammation, endothelial function, insulin resistance, and NAFLD, allowing for a more comprehensive metabolic health assessment. We found no evidence that the MD leads to lower incidence of the MetSyn, but there were greater beneficial changes in the majority of the MetSyn factors examined, in addition to lower risk of CVD incidence, and incidence of stroke. The qualitative synthesis also suggested that the MD lowers the risk of angina, pre-diabetes, and breast cancer, and results in lower need for the use of hyperglycaemic drugs, nitrates, \u03b2-blockers, and disopyramide, albeit from a small number of studies. There was no evidence for an effect on other comorbidity endpoints or use of other medications. Nevertheless, effect estimates for most of these outcomes favoured the MD. However, findings from this work should be viewed in light of the small number of studies for some outcomes, the considerable bias identified within a proportion of the included studies, and the substantial between-study heterogeneity found for most pooled analyses.To our knowledge, this is the first study to examine the effect of the MD on MetSyn incidence. Results from only one study in 5801 participants showed no evidence of reduction in incidence risk . An earl2 = 98.6%), although results were slightly attenuated when the MD was promoted alone  vs. alongside other dietary components, such as energy restriction . The impact that adhering to the MD would have on caloric intake and body weight, stemming from e.g., the MD\u2019s recommendation to have olive oil with every meal and nuts every day [It is noteworthy that, consistent with an earlier meta-analysis of clinical trials in 3436 participants reporting a decrease in body weight of 1.75 kg (95% CI \u22122.86\u2013\u22120.64) , our anavery day , has beevery day , and aduvery day . Given avery day , whethervery day . Qualitavery day ,115. Simvery day . This wiConcomitant to concerns about the type of support that Americans and other non-Mediterranean populations might need to adopt the MD, are issues regarding the potential need to provide MD foods for free to facilitate dietary adherence. Our findings showed, for the first time, that while supplementing dietary advice with foods from the MD led to beneficial changes in some MetSyn factors, subgroup analyses revealed there is no evidence it leads to greater health benefits beyond those obtained by advice alone. Indeed, studies not providing foods led to greater changes in body weight, body mass index, and blood glucose concentrations, compared to those supplementing MD advice with foods. It might have been that participants consumed supplemented foods as an addition to, instead of substituting them for other foods in their diet, which might have affected health outcomes. However, this is challenging to confirm due to the varying levels of reporting of compliance with the dietary prescriptions across the reviewed studies. Also, the types and amounts of foods provided in the reviewed studies varied widely, from providing some components of the MD  to the majority ,73,83,88Our results are overall consistent with earlier meta-analyses showing that the MD reduces risk of CVD, stroke , and breTo our knowledge, no other review has systematically evaluated the MD\u2019s effect on the need for pharmacologic treatment for MetSyn components and related comorbidities. Only six studies reported on the changes of the need for treatments, and of these, only one reported treatment as a primary outcome, showing that the MD reduced the need for antihyperglycemic drug therapy at four years ; maintaiStrengths of the current review include the use of rigorous methodology, according to current guidelines of conduct and reporting ,20, to sA further limitation is that significant and substantial between-study heterogeneity was observed for most MetSyn components and risk factors, particularly for outcomes with a large number of studies included. We accounted for this by applying random-effects models to account for variations across studies, and further assessed sources of heterogeneity by conducting subgroup analyses and meta-regressions, when the number of studies per health outcome allowed . This leThis review of controlled trials provides evidence that the MD beneficially affects several outcomes implicated in metabolic health, including MetSyn components and several metabolic risk factors, in addition to incidence of CVD and stroke. Nevertheless, pooled findings should be interpreted with caution due to the substantial between-study heterogeneity found for most analyses and the small number of studies for some outcomes. Trials with appropriate comparator groups and more homogeneous designs are needed to help confirm whether the MD results in greater health benefits if combined with other intervention components, such as energy restriction, or if foods are provided to participants alongside advice to follow the diet, over and above those acquired separately by MD advice. More studies are also needed in non-Mediterranean populations, such as the United States of America, Northern Europe, and Australasia, to establish the feasibility and acceptability of the MD in these regions. Finally, more high-quality and adequately powered trials are needed to provide robust evidence on the effect of the MD on MetSyn incidence, other related comorbidities, such as NAFLD, and use of pharmacotherapy for MetSyn components and comorbidities, and delineate the biological mechanisms responsible for any health benefits. This would help establish whether the MD should form part of dietary guidelines globally, be widely promoted by healthcare practitioners and adopted by the general population for metabolic health benefits. Nevertheless, given the high health and economic burden of the MetSyn, its comorbidities, and the resulting need for pharmacotherapy to treat these, in conjunction with the consistent direction of beneficial effects observed in the current report, practitioners should not abstain from recommendingthe MD as a whole, and its food components, in intakes illustrated in the updated Mediterranean Diet Pyramid , to thei"}
+{"text": "On January 23, 2020, China quarantined Wuhan to contain an emerging coronavirus (COVID-19). We estimated the probability of transportation of COVID-19 from Wuhan to 369 cities in China before the quarantine. The expected risk is >50% in 130 (95% CI 89\u2013190) cities and >99% in the 4 largest metropolitan areas of China. In December 2019, a novel coronavirus (COVID-19) emerged in Wuhan, China ,8 initiaOn January 22, 2020, China announced a travel quarantine of Wuhan and by January 30, expanded the radius to include 16 cities, encompassing a population of 45 million. At the time of the quarantine, China was already 2 weeks into the 40-day Spring Festival, during which several billion people travel throughout China to celebrate the Lunar New Year  Appendi. The lowWe estimated the probability of transportation of infectious COVID-19 cases from Wuhan to cities throughout China before January 23 by using a simple model of exponential growth coupled with a stochastic model of human mobility among 369 cities in China . Given tBy fitting our epidemiologic model to data on the first 19 cases reported outside of China, we estimate an epidemic doubling time of 7.31 days (95% CrI 6.26 \u2013 9.66 days) and a cumulative total of 12,400  infections in Wuhan by January 22, 2020 . Both eshttps://heat.qq.com), a major social media company that hosts applications, including WeChat (\u22481.13 billion active users in 2019) and QQ (\u2248808 million active users in 2019)  . We expein 2019) . However1"}
+{"text": "This paper deals with a numerical simulation of fractional conformable attractors of type Rabinovich\u2013Fabrikant, Thomas\u2019 cyclically symmetric attractor and Newton\u2013Leipnik. Fractional conformable and  Fractional derivatives, which are a generalization of classical derivatives have been extensively used in describing and solving integral equations, ordinary and partial differential equations in applied sciences such as fluid mechanics, diffusive transport, electrical networks, electrodynamics, nonlinear control theory, signal processing, nonlinear biological systems, astrophysics, among others ,17,18,19Several definitions exist regarding the fractional derivatives, and some fundamental definitions are Coimbra, Riesz, Riemann\u2013Liouville, Hadamard, Weyl, Gr\u00fcnwald\u2013Letnikov, Marchaud, Liouville\u2013Caputo, Caputo\u2013Fabrizio, Atangana\u2013Baleanu ,21,22. Borted in ,33,34,35Recently, in , new fraIn this work, we propose a numerical algorithm based on the Adams\u2013Moulton scheme together with the Runge\u2013Kutta method to get a numerical solution and chaotic behaviors of the fractional conformable and Let us recall known definitions of fractional derivatives.Definition\u00a01.The Riemann\u2013Liouville operator (RL) is the derivative of the convolution of a given function and a power-law kernel. The RL fractional derivative with order  follows :Definition\u00a02.The Liouville\u2013Caputo operator (C) is the convolution of the local derivative of a given function with power-law function. The Liouville\u2013Caputo fractional derivative with order  follows :Definition\u00a03.Let given by for all We shall present some properties of this new derivative:Definition\u00a04.The \u03b2-derivative is another type of conformable derivative. Let given by where Definition\u00a05.Let Regiven by Definition\u00a06.Let Regiven by Definition\u00a07.Let Regiven by Definition\u00a08.Let Regiven by Fractional Adams\u2019 method ,39,40 isN steps in an interval of To get a numerical solution for Equations  and 7),,7), we pNow, the new Adams\u2013Moulton method ,39,40 foIn this work, we use the conformable derivative proposed by Khalil in Equation 14)D*\u03b1fD*\u03b1f(14)DRabinovich\u2013Fabrikant attractor. The model of Rabinovich\u2013Fabrikant [a and b, but for abrikant  was initbrikant [x\u02d9=yz\u22121+xIn this section, we consider some numerical experiments for different fractional-order values.Conformable sense:l scheme , we reprle sense:0c\u03b2Dt\u03b1x=1\u03b2-conformable sense:l scheme , we reprle sense:0AC\u03b2Dt\u03b1x=Observation. In the case when If we replace the time derivative of the system  by the cEquation , then weTo develop the simulations shown in the To develop the simulations shown in Thomas\u2019 cyclically symmetric attractor. Thomas in [x, y, and z and considers a frictional damping b. The Thomas\u2019 cyclically symmetric attractor is described by the following equations:b can be considered a frictional damping for a particle moving in a three-dimensional lattice [homas in  proposed lattice . This atSelf-excited attractors can be visualized numerically, in which, after a transient process a trajectory, starting from a point of a neighborhood of unstable equilibrium, attracted to the attractor. According to the election of the orders of derivation, we have illustrated that the system may possess multiple topologically different chaotic attractors.Applying the operator Equation , we getObservation. In the case when Applying FCAMM to Equations  and 25)25), we s systems  and (25)To develop the simulations shown in the To develop the simulations shown in the b that controls the damping and that is a natural bifurcation parameter for studying the route to chaos. For this example, the figures show that when Newton\u2013Leipnik attractor. The Newton\u2013Leipnik system model was obtained by modifying Euler\u2019s rigid body equations with the addition of a linear feedback in 1981. For this example, we consider a 3D system of fractional order nonlinear autonomous differential equations known as Newton\u2013Leipnik attractor [ttractor ,48:(26)The Thomas\u2019 cyclically symmetric attractor has a single parameter Replacing the time derivative in Equation  by the cObservation. In the case when We assume that the systems represented in Equations  and 28)28) generEquation  considerTo develop the simulations shown in the To develop the simulations shown in the The simulation results demonstrate that chaos indeed exists in the fractional-order system with order a, b, c and d.In the x as a vector whose relation to the Euclidean space is natural and isomorphic. With this distance, we can perform a sensitivity analysis to the variation of initial conditions in the Newton\u2013Leipnik system [The Euclidean distance is like an index of similarity between two points in the Euclidean space; hence, we represent the dynamic of the state k system ,50.n-dimensional Euclidean space as a result of the dynamics of the Newton\u2013Leipnik system with initial conditions: X and Assuming that If the distance between two points is larger than 0e system  are diffThe distance between two points is equal to 0, if and only if two points are overlappedBy using Equation , EuclideThe spatial display is illustrated in the Within the framework of the fractional conformable differentiation, a modification of the Adams\u2013Moulton method was suggested to solve fractional conformable differential equations, in particular chaotic systems of type Rabinovich\u2013Fabrikant, Thomas\u2019 cyclically symmetric attractor and Newton\u2013Leipnik. The numerical scheme based in the Adams method permits solved numerically fractional conformable differential equations in the Liouville\u2013Caputo sense. The modified numerical method is a mixture of the Adams\u2013Moulton and the Runge\u2013Kutta method. The method is accurate and efficient, direct, concise and converges quickly to the exact solution. At this point, to the best of the authors\u2019 knowledge, there is no known or published numerical methods for solving fractional conformable differential equations in the Liouville\u2013Caputo sense.The dynamics of the Rabinovich\u2013Fabrikant, Thomas\u2019 cyclically symmetric attractor and Newton\u2013Leipnik chaotic systems using fractional order conformable derivatives and In the cases when Our graphical representations explicitly reveal the complete reliability and efficiency of the presented method with a great potential in scientific applications. The new fractional conformable operators have become an important mathematical tool, motivated by the potential use for physicists and engineers working in various areas of the natural sciences. The chaos control of chaotic systems, the theoretical analysis of the dynamics of the fractional-order system, and the synchronization between pair of fractional order chaotic systems assume considerable significance in the study of nonlinear dynamics. This investigation should also be considered in the near future."}
+{"text": "This study aimed to explore the sentinel lymph node (SLN) identification rate in breast cancer by subcutaneous and intradermal injection of ultrasound contrast agent in the mammary areola region, compared to the results achieved with methylene blue (MB).A total of 390 breast cancer patients with planned sentinel lymph node biopsy from our breast surgery department from July 2017 to February 2019 were enrolled. All patients were subjected to preoperative contrast-enhanced ultrasound (CEUS), that involved an intracutaneous injection of 1 mL ultrasonic contrast agent (UCA) at 3 and 6 o \u2018clock, as well as a subcutaneous injection of 1 mL UCA at 9 and 12 o\u2019clock. The enhanced lymph nodes along the enhanced lymphatic vessels from the mammary areola were traced. The number of enhanced lymph nodes were recorded, and an ultrasound-guided injection of 1:10 diluted carbon nanoparticles were used to mark all first site enhanced lymph nodes . An intraoperative dye method (MB) was used to track the SLNs and the results were compared with the CEUS findings.P\u2009=\u20090.016). And among the 390 patients, a total of 808 enhanced lymph nodes were traced by preoperative CEUS, with a median of 2 . A total of 971 blue-stained lymph nodes were traced using the intraoperative MB, with a median of 2 , indicating a statistically significant difference (p\u2009<\u20090.001).Among the 390 cases of breast cancer, enhanced SLNs were observed in 373 patients after an injection of UCA with an identification rate of 95.64\u2009% (373/390), compared to the identification rate of 92.05\u2009% (359/390) using the intraoperative MB. The difference between the two methods was statistically significant (Intradermal and subcutaneous injections of UCA in the mammary areola region may have clinical application value for the identification and localization of SLNs in breast cancer patients. The identification rate is higher than that of blue dye method, which can be used as a new tracer of sentinel lymph node biopsy and complement other staining methods to improve the success rate. Breast cancer is the most common malignant tumor with the highest morbidity in women; however, breast cancer has a relatively good prognosis and prolonged survival time due to the development of recent treatment methods, such as radiotherapy, chemotherapy, endocrine therapy, and molecular targeted therapy . DespiteThe SLN is the first site of mammary lymphatic drainage, and the risk of other lymph node metastasis is extremely low in the presence of SLNs without cancer metastasis. Moreover, patients without SLN metastasis can avoid ALND, which can improve their quality of life without having a significant impact on the long-term survival rate , 7. TherSome studies , 10 haveIn this study, by referring to the previous literature on serching for SLN via CEUS, analyzing the influence of different injection sites and dose of UCA on the identification rate, a new injection method of UCA was developed to improve the identification rate of SLN by CEUS.This study was approved by the ethics committee of Sichuan Academy of Medical Sciences & Sichuan Provincial People\u2019s Hospital.Patients diagnosed with malignant breast tumors by biopsy from the Department of Breast Surgery at Sichuan Provincial People\u2019s Hospital were recruited to the present study. According to the SLNB indications mentioned in the guidelines and norms for the diagnosis and treatment of breast cancer by the Chinese anti-cancer association (2017)  and the All of the patients received CEUS the day before or the day of surgery using a Philips iU Elite. The assistant first extracted 5 mL of normal saline, which was injected into the UCA (59\u00a0mg SF6) and was fully mixed prior to the injection. Then, 0.9 mL normal saline and 0.1 mL carbon nanoparticles were extracted to prepare the dyes for future injection. Each patient was placed in the supine position, the upper limb of the affected side was lifted up into the same position as the intraoperative position, and the breast and axilla of the affected side was fully exposed. An intradermal injection of 1 mL UCA at 3 and 6 o \u2018clock and a subcutaneous injection of 1 mL UCA at 9 and 12 o \u2018clock of the mammary areola region was performed following disinfection. The injection site was then massaged gently until the lymphatic vessels began to enhanced to ensure adequate absorption of the UCA by the lymphatic vessels. A Philips iU Elite was set to contrast-mode, and 360\u00b0 scanning of the areola area was performed to detect enhanced lymphatic vessels and trace the enhanced lymph nodes along the enhanced lymphatic vessels with a L9-3 high frequency linear array probe. 0.1ml prepared 1:10 diluted carbon nanoparticles was injected into the first SLN site in CEUS, and the number of lymph nodes traced by CEUS were recorded and the lymphatic vessel routes as well as the lymph node location were marked using a marking pen  and upper and lower quartiles  were used if they were not normally distributed. The identification rate was defined by the proportion of patients with SLNs identified using either method. The comparison of the SLN identification rate between the two methods was subjected to a \u03c7A total of 390 breast cancer patients from our breast surgery department from July 2017 to February 2019 were analyzed in the present study. Table\u00a0P\u2009=\u20090.016). The details of these identification are shown in Tables\u00a0Among the 390 cases of breast cancer, enhanced SLNs were observed in 373 patients after the injection of UCA, with an identification rate of 95.64\u2009% (373/390). And the identification rate of the intraoperative dye method was 92.05\u2009% (359/390), The difference between the two methods was statistically significant (P\u2009<\u20090.001). Please refer to Table\u00a0A total of 808 enhanced lymph nodes were traced in CEUS, with a median of 2 . And 971 blue-stained lymph nodes were traced by intraoperative injection of MB, with a median of 2 , which could observe significantly more lymph nodes (Grade 1 evidence of evidence-based medicine (EBM) shows that SLNB can safely and effectively replace ALND in patients without SLN metastasis, and the survival rate of SLNB was not worse than that of ALND after receiving standardized adjuvant therapy, dispite one or two SLNs metastasis , 12. TheSome studies have found that CEUS has the potential to identify SLNs, While these studies have failed to reach a consensus regarding the injection site and dose of UCA. Some of the studies have shown that intra-tumor, peritumor, and areola injections have similar identification rate of SLNs , 14. SomThere were 9 out of 17 patients who did not have enhanced SLN with CEUS, in which interrupted lymphatic vessels and no dyeing of the lymph node was observed using the intraoperative dye method, 8 cases of the pathological results from ALND revealed ALN with cancer metastasis. It is possible that metastatic cancer cells may completely obstruct the lymphatic vessels, resulting in the inability of UCA and MB to drain to the lymph nodes [There were 351 cases out of the 373 patients in which enhanced SLNs observed by CEUS displayed dyeing of the lymph nodes using the intraoperative dye method. In another 22 cases, interrupted lymphatic vessels and no dyeing of the lymph node was observed with the intraoperative dye method, of which 9 cases displayed lymph node metastasis. Thus, CEUS can identify some SLNs that cannot be detected using the dye method. This is consistent with the findings of Xie et al.,  in whichRegarding the number of observed lymph nodes, more lymph nodes were observed with MB than CEUS, which is consistent with the results of some previous studies , 18\u201321. Previous reports have shown that the identification rate of SLN by CEUS was 70\u2009%~100\u2009% . The injMB is prone to allergic reactions, local skin flap and adipose tissue necrosis in previous study , and oneIntradermal and subcutaneous injections of UCA in the mammary areola region may have clinical application value for the identification and localization of SLNs in breast cancer patients. And it can identify some SLNs which cannot be identified using the dye method, which can be used as a new tracer of SLNB and complement other staining methods to improve the success rate."}
+{"text": "Phosphorus (P) is an important element in terrestrial ecosystems and plays a critical role in soil quality and ecosystem productivity. Soil total P distributions have undergone large spatial changes as a result of centuries of climate change. It is necessary to study the characteristics of the horizontal and vertical distributions of soil total P and its influencing factors. In particular, the influence of climatic factors on the spatial distribution of soil total P in China\u2019s forest ecosystems remain relatively unknown. Here, we conducted an intensive field investigation in different forest ecosystems in China to assess the effect of climatic factors on soil total P concentration and distribution. The results showed that soil total P concentration significantly decreased with increasing soil depth. The spatial distribution of soil total P increased with increasing latitude and elevation\u00a0gradient but decreased with increasing longitude\u00a0gradient. Random forest models and linear regression analyses showed that the explanation rate of bioclimatic factors and their relationship with soil total P concentration gradually decreased with increasing soil depths. Variance partitioning analysis demonstrated that the most important factor affecting soil total P distribution was the combined effect of temperature and precipitation\u00a0factor, and the single effect of\u00a0temperature factors had a higher explanation\u00a0rate compare with the single effect of precipitation factors. This work provides a new farmework for the\u00a0geographic\u00a0distribution pattern of soil total P and the impact of climate variability on P distribution in forest ecosystems. During the past 20\u00a0years, numerous studies have revealed that ecosystems are affected by the lack of P resources6. Recently, a global meta-analysis research showed that there is significant P limitation in aboveground plant production and that the magnitude of the P limitation is driven by ecosystem properties, climate and fertilization regimes4. Limited plant growth is known to directly reduce biodiversity and ecosystem productivity7, change carbon\u2013nitrogen cycles8, and affect other ecological processes9. It is thus critical to understand the spatial distribution of soil total P and its driven factors to evaluate soil productivity, improve biodiversity, guide nutrient management, and understand biogeochemical cycles.Phosphorus (P) has been an indispensable element of Earth\u2019s biological systems since the beginning of life2. The total amount and chemical forms of P change systematically during soil development10. In the initial stages, soil P exists mainly as primary minerals such as apatite. In mid-stage soils, the reservoir of primary apatite is diminished, and less-soluble secondary minerals and organic P constitute an increasing fraction of soil P. In developed soils, soil P is partitioned mainly between refractory minerals12. We know from chrono sequence data, that P accumulation has occurred in the soil over thousands of years during pedogenesis, whereby the distribution of soil total P is driven largely by abiotic and biotic factors13. The climate of a particular area changes over decades and centuries, resulting in large-scale biome migrations14. Variations in P distribution patterns and P concentrations are both linked to shifts in climate and biome migrations15. Thus, further study is required to understand the characteristics of the horizontal and vertical distributions of soil total P and its influencing factors.Soil total P mainly originates from minerals in the lithosphere that are freed by weathering and chemically transformed within the pedosphere to finally enter the food chain in a dissolved form via plant roots17. These factors, which drive the spatial distribution of soil total P differ significantly at local, regional, and global scales20. For example, a study on black soils in the northeast of China revealed that the vertical distribution of soil total P showed irregular variations in forests21. In contrast, another study in the Yingwugou watershed of the Dan River showed that soil total P decreased with soil depth22. In addition, climatic factors  also directly or indirectly affect soil total P concentration and distribution by affecting soil properties, plants, and soil microbial activities24. Recently, Hou et al.\u00a0research found that soil total P decreased significantly with\u00a0increasing annual mean precipitation and temperature24. Liu et al. explored the pattern of plant nitrogen and P stoichiometry and found that soil total P concentrations decreased along with decreasing\u00a0mean annual temperature25. In general, climatic factors drive the spatial distribution of soil total P in natural forest terrestrial ecosystems24.During soil development, the spatial distribution of soil total P is mainly affected by the parent material, the biota present, climatic factors and soil biogeochemical processesIn this study, we performed an intensive field investigation in forest ecosystems of China. We investigated 4293 forest plots and obtained 19 bioclimatic variables to analyze the distribution of soil total P in different soil layers and their relationships with geographic patterns and climate factors. The objectives of this study were: (1) to analyze the spatial distribution pattern of soil total P in China\u2019s froest ecosystem; (2) to quantify the relationship between soil total P and bioclimatic variables; and (3) to explain the main factors affecting the distribution of soil total P. Our final aim was to improve our understanding of the role of climate in shifting soil total P distribution as this knowledge is critical in improving our ability to accurately predict soil total P storage in terrestrial ecosystems    was generally stronger than the relationship between soil total P and latitude  or longitude   Fig.\u00a0a\u00a0and 4c,Regarding soil total P distribution, random forest models revealed that the amount of variation explained by the 19 bioclimatic factors were gradually decreased with soil depth; these factors explained 56.26%, 55.55%, 51.34%, 48.22%, and 44.98% of variation in soil total P in 0\u201310\u00a0cm, 10\u201320\u00a0cm, 20\u201330\u00a0cm, 30\u201350\u00a0cm, and 50\u2013100\u00a0cm, respectively  p\u2009<\u20090.05)The result of variance partitioning analyses performed to identity the percentage of variance of in the soil total P concentrations that was explained by temperature and precipitation are shown in Fig.\u00a027. Consistent with this result, we found that soil total P concentrations declined with soil depth across China\u2019s forest ecosystems  because of the typical spatial autocorrelation between the two componentsWe evaluated nationwide field data to reveal the distribution of soil total P across forests in China and identified the factors controlling this distribution. Our results showed that the soil total P concentration gradually decreased from north to south. In all soil layers, the concentration was higher in the topsoil than in the subsoil. In terms of its vertical distribution soil total P gradually decreased with soil depth. Soil total P was significantly different among the different regions in our study, and the highest soil total P concentrations were predominantly distributed in the temperate forest and the edge of Tibetan Plateau. In addition,\u00a0soil total P significantly increased along increasing latitudinal and altitudinal gradients across all soil depths considered but significantly decreased along an increasing longitudinal gradient. Climate greatly affected the distribution of soil total P. The amount of variation explained by19 bioclimatic factors gradually decreased with increasing soil depth, and amount of variation explained by temperature and precipitation converged along the soil profile to become approximately equal in the deepest soil layer we examined. The effect sizes of extreme or limiting environmental factors were higher than those of seasonality factors, and the combined effect of the temperature and precipitation variables was one of the most important factors affecting soil total P distribution. Overall, improving the understanding of the horizontal and vertical distribution of soil total P the factors influencing these distributions is of great significance in the study of nutrient cycles to efforts to improve the sustainable utilization of soil nutrients.50. Detailed information on the forest plots and soil samples were provided in Tang et al. (2018)51. In short, based on the integrity of the soil samples and the distribution of China\u2019s forests, 4293 forest plots were selected , soil sampling investigation, and the determination of soil total P from 2011 to 2015, in accordance with a standard protocol53 (http://chelsa-climate.org/). We selected 19 bioclimatic variables, including 11 temperature variables\u2014annual mean temperature (AMT), mean diurnal range (MDR), isothermality (ISO), temperature seasonality (TSEA), maximum temperature of warmest month (MTWARM), minimum temperature of coldest month (MTCOLM), temperature annual range (TRANGE), mean temperature of wettest quarter (MTWETQ), mean temperature of driest quarter (MTDRIQ), mean temperature of warmest quarter (MTWARQ), mean temperature of coldest quarter (MTCOLQ)\u2014and eight precipitation variables\u2014annual precipitation (AP), precipitation of wettest month (PWETM), precipitation of driest month (PDRIM), precipitation seasonality (PSEA), precipitation of wettest quarter (PWETQ), precipitation of driest quarter (PDRIQ), precipitation of warmest quarter (PWARQ), and precipitation of coldest quarter (PCOLQ).Climate data for all sites were obtained from Climatologies at high resolution for the Earth\u2019s land surface areas (CHELSA)Soil total P distribution pattern We used data for soil samples  to compare the spatial distribution of soil total P among the different soil layers. ArcGIS 10.6 was used to determine and map the pattern in soil total P distribution for the different soil layers.General linear modeling We used simple linear regressions to test the relationships between soil total P concentration and latitude, longitude, and altitude gradients. We also performed Pearson correlations between soil total P and the 19 bioclimatic variables. The statistical significance level was set to p\u2009<\u20090.05.Random forest modeling We conducted a classification random forest analysis to identify the main temperature and precipitation actors that predicted the soil total P concentration. Random forest analysis allowed us to identify the most important drivers of soil total P among the 11 temperature and eight precipitation variables. Random forest analysis alleviates multicollinearity problems in multivariate analyses by building bagged tree ensembles and including a random subset of features for each tree (9999 trees). These analyses were conducted using the randomForest package54 in R version 3.5.2 (R Core Team (2018) (http://www.R-project.org/)).Variation partitioning modeling The main goal of this analysis was to quantify the relative importance of temperature and precipitation bioclimatic variables at different periods as predictors of soil total P concentrations. To compare the relative effects of the 11 temperature and eight precipitation variables in shaping the spatial distribution of soil total P, we separated the single effect and combined effect of each variable using a Venn diagram55 that numbered the relative contribution of each variable to soil total P concentrations in different soil layers. In all cases, variation partitioning analyses were conducted with the \u201cVarpart\u201d function in the\u00a0R vegan package56."}
+{"text": "FT) processes affect soil salinisation in cold and arid regions. Therefore, understanding the mechanisms behind soil salinisation during winter and spring is crucial for management strategies effectively alleviating this. This study aimed to explore the soil FT characteristics and their influences on soil water and salt migrations to clarify the underlying mechanism of the springtime soil salinisation in the western Songnen Plain, China. The spatiotemporal distributions of soil water and salt, frozen depths and soil temperatures were examined at depths of 0\u2013200\u00a0cm in three typical landscapes  Tzvel (LT) grassland and alkali-spot (AS) land) from October 2015 to June 2016. Results indicated that the strongest freezing process occurred in AS land, which was characterised by the deepest frost depth (165\u00a0cm) and highest freezing rate (3.58\u00a0cm/d), followed by LT grassland, and then farmland. The freeze-induced upward redistribution and enrichment of soil water and salt caused the rise and expansion of the soil salification layer, which was the main source of explosive accumulations of surface salt in springtime. Therefore, the FT processes contributed to the surface soil salinisation and alkalisation. Landscapes also affected soil water and salt migrations during FT processes, with the trend being AS land\u2009>\u2009LT grassland\u2009>\u2009farmland.Seasonally freeze-thaw ( FT) cycles is a constantly repeating process of material exchange and energy transfer that occurs in the surface soil and also extends downward into the deeper soil layers2. Understanding these cycles in cold regions is crucial owing to their vital roles in agricultural and ecological environments, because they have profound influences on soil water distribution, heat balance, and spring farming and plant germination3.\u00a0To enhance the collective knowledge of soil FT processes, a more comprehensive monitoring regime of hydrological variables, such as soil water content (SWC), soil salt content, soil temperature, frost depth, groundwater levels, are required. In turn, FT cycles also influence these hydrological variables. Several researchers examined the interactions between hydrological variables and FT cycles in cold and arid regions. For example, the analysis by Bing et al. (2015) indicated that FT processes acted as a controlling mechanism for the redistribution of soil water and salt through analyzing the factors that influence soil water and salt migrated behaviours in the Qinghai\u2013Tibet Plateau of China4. More recently, some researchers used a CoupModel to investigate the interactions between soil FT cycles and salinisation as well as other possible causes of salinisation during three winters from 2012 to 2015 in an irrigation district in northern China5. Wan et al. (2019) conducted laboratory tests to simulate salt transfer in a real-world cold sodium sulphate soil6. Their findings indicated that the maximum salt transport level occurred in the frozen fringe zone of the soil, and the salt expansion had an accumulative effect, which was positively correlated with the number of FT cycles. Another study also pointed out that the FT processes could lead to more water migrating to interdune than that to sand dunes in the rhizosphere of Horqin Sandy Land, northern China1, as supported by Wang et al. (2019) in dam and slope farmland on the Loess Plateau, China3. It is worth noting that these aforementioned studies indicated that soil water-salt migrations were closely related to soil FT processes and also highlighted the importance of understanding the migrated behaviours of soil water and salt in responses to soil FT processes in ensuring effective agricultural managements.Soil freeze\u2013thaw 14 reviewed\u00a0the causes of soil alkalisation in the Songnen Plain and emphasised that winter freezing led to latent salt accumulations that induced further soil salinisation during the subsequent spring. This was consistent with the findings of Zhang and Wang (2001)12, who demonstrated that soil salinisation occurred as a strong response to freeze\u2013thaw, yet which has been ignored by some studies8. However, these abovementioned studies on soil salinisation related to FT processes in the studied region have far been limited to theoretical speculations and qualitative descriptions. Consequently, there is a lack of quantitative experimental investigations into the soil water and salt migration behaviours in response to FT processes, spatiotemporal characteristics of soil water and salt and their related conditions. Therefore, the FT mechanism behind soil salinisation remains unclear. Furthermore, appropriate land use and management approaches can maintain and decrease the soil salinity and alkalinity, thereby improving the soil quality and health. Minimal information, however, is available on how soil water and salt are migrated during the soil FT period in saline-sodic soils of different landscapes.However, there are disparities in the literatures regarding the impact of FT processes as influenced by different landscapes, (2) explore the influences of FT processes on water-salt migration in saline-sodic soil and (3) elucidate the underlying mechanism of soil salinisation-alkalisation during the spring in the western Songnen Plain, China.Therefore, this study aims to (1) determine the characteristics of soil FT cycles with freezing beginning at the end of October and thawing occurring in June of the following year. The soils of the study area are alkali-saline, and are classified as Solonetz in the World Reference Base for Soil Resources . The groundwater depth fluctuates between 1 and 3.2\u00a0m.The study area is located at the Saline-alkaline Wetland Ecological Experiment Station   Tzvel (LT). Some of this grassland has degraded into alkali-spot land because of the soil salinisation-alkalisation that has resulted from\u00a0natural\u00a0and anthropogenic causes, and other grasslands have been reclaimed as maize fields since 2000 to reduce the need for arable land resources15. Thereby, three typical plots of LT grassland, farmland and AS land were selected for field monitoring. The 20\u00a0m\u2009\u00d7\u200930\u00a0m monitoring sites were centrally located in these representative landscape units with a total area of approximately 200\u00a0m\u2009\u00d7\u2009300\u00a0m. Three replicates of each monitoring location at intervals of 15\u00a0m were selected in each landscape to minimize errors caused by soil heterogeneity. Table The main vegetation in the studied area is natural grassland dominated by +, Mg2+, K+, Ca2+, CO32\u2212, HCO3\u2212, Cl\u2212, SO42\u2212, EC and pH values. The total soluble salt content was calculated by summing the contents of soluble Na+, K+, Ca2+, Mg2+, CO32\u2212, HCO3\u2212, Cl\u2212and SO42-16. The soil organic content, the cation exchange capacity (CEC) and exchangeable Na+ were determined by the dichromate oxidation method, sodium acetate and CaCO3\u2013CO2 exchange neutral titration method, respectively16. The soil texture was determined using a laser diffraction particle size analyser .The 1:5 soil to water extracts were used for the analyses of soluble NaSAR) ((mg/L)1/2) was calculated as follows:+], [Ca2+] and [Mg2+] are cation concentrations (mg/L).The sodium adsorption ratio (ESP) was calculated using the ratio of the exchangeable [Na+] to the CEC defined as follows:Nas] is the content of exchangeable sodium (cmol/kg), and CEC is the cation exchangeable capacity (cmol/kg).The exchangeable sodium percentage (WSCR) (cm/d) of different soil layers was calculated as follows:d) is the time interval between two measurements of SWC (cm3/cm3), and The water storage change rate (FTR) (cm/d) was calculated using Eq.\u00a0(t (d) is the time interval between two measurements of the soil frost depth (FD) (cm).The freeze\u2013thaw rate . Pearson correlation analyses were applied to determine the correlation between soil salinity, alkalinity, water, soil temperature, groundwater table and frost depth. Significant differences were evaluated at the 0.05 levels.FT processes versus soil depth associated with soil temperature. As the ambient temperature decreased below 0\u00a0\u00b0C in late October 2015, soil temperatures decreased accordingly, and then the soil began to freeze from the topsoil down into the deep layers and entered a frozen state. Until the temperature increased to above 0\u00a0\u00b0C in mid-March of 2016, the soil temperature also rose, and the surface soil began to thaw; However, the deeper soil layer remained frozen. When the temperature of the subsoil also rose above 0\u00a0\u00b0C, the upper and lower layers of the frozen soil begin to thaw, both downwards and upwards until the soil thawed completely in June 2016. The freezing rate was the largest for the AS land, followed by the LS land, and then the farmland . Accordingly, the soil freeze durations were 184, 205 and 220\u00a0days with the maximum frost depth at 148, 155, and 165\u00a0cm, respectively, for the farmland, LT grassland and AS land , mid-May (at 110\u2013113\u00a0cm depth) and late-May (at 120\u2013125\u00a0cm depth), respectively. The date of thawed bi-directionally on farmland was about 21\u00a0days earlier than that for the LT\u00a0grassland and AS lands.Figures\u00a0and Fig.\u00a0. The maxFT processes were accompanied by water and heat transfers. Figure\u00a0SWC under FT conditions for all the three landscapes. The SWC (0\u2013200\u00a0cm) in the LT grassland and AS land increased by 9.70% and 17.43% during freezing, respectively, and decreased by 4.03% and 11.46% during thawing, respectively. Conversely, the SWC in farmland decreased by 1.59% during freezing and increased by 5.63% during thawing. The average SWC (0\u2013200\u00a0cm) of the farmland, LT grassland and AS land increased by 1.15%, 1.93% and 3.56%, respectively, during the FT period. Furthermore, SWC varied with the soil profiles in the different landscapes , and the SWC of 50\u201390 and 130\u2013200\u00a0cm decreased (-14.99% and -11.76%). In the thawing period, the SWC of 0\u201350 and 100\u2013130\u00a0cm of farmland decreased (-14.64% and -11.94%), and the SWC of 50\u2013100 and 130\u2013200\u00a0cm increased (29.25% and 9.36%). In addition, the SWC change rate of the upper soil layer was greater than that of the deeper soil layer  than those at other soil layers  in the upper soil than those in the deeper soil. Thus, soil salt accumulated in the frozen layer mainly came from the deeper soil profiles. In contrast to those observed before freezing, at the end of thawing period, the surface soil salt contents had increases of 16.73%, 50.80% and 52.20% in the farmland, LT grassland and AS land, respectively, except that in the 10\u201330\u00a0cm deep layer in LT grassland, which reduced by 32.6% (Table P\u2009<\u20090.05) than that in the subsurface soil, and the subsurface soil was desalinised  within the three landscapes. The correlation between the soil salinity and soil temperature was negatively correlated. A significant negative correlation also occurred between soil salinity and the groundwater table (P\u2009<\u20090.01). Furthermore, a significant negative correlation was also found between the soil frost depth and soil temperature (P\u2009<\u20090.01).The relationships between soil salinity, alkalinity, FT characteristics exhibited certain differences among the three landscapes. AS land had the largest frost depth and the longest freeze duration, followed by LT grassland, and then farmland 20, who clearly demonstrated that the reduction in a snow cover deposition could cause a dramatic increase in the frost depth, as well as those of Fu et al. (2018)2 who reported that the decrease in snow cover strengthened the actions of soil temperature on freezing front. In addition, the higher SWC in the LT grassland (0.21 cm3/cm3) and AS land (0.32 cm3/cm3) would slow down soil temperature changes21, because more heat release from the soil when soil freezes, or more heat is needed when soil thaws. Consequently, the wetter conditions in the LT grassland and AS land would postpone the freeze\u2013thaw processes, as indicated by other researches17. Similar results were obtained in the study of Yi et al. (2014) on soil freeze\u2013thaw characteristics of different landscapes in the Heihe River Basin, Gansu, China22.In this study, the and Fig.\u00a0. These d24. However, during the spring thawing, soil water in the upper soil layer and the deeper soil layers decreased and increased, respectively 14 and Bing et al. (2015)4. Furthermore, this freeze-induced soil water enrichment in the frozen zone can facilitate to soil water conservation by reducing evaporation and seepage, thus maintaining a high water content22, which can be helpful to farming and plant germination in the following spring. However, in this study there were obvious differences in profiled water redistributions upon freezing in different landscapes. The SWC in the AS land at a depth of 0\u20135\u00a0cm decreased during freezing and increased during thawing. This may be attributed to fierce regional winds, no plant residue on the surface, lack of snow cover and frequent heat exchanges between the surface soil and air during winter in the study area. Furthermore, because of the higher initial moisture content, the greater frost depth and intensity in the AS land, the water in the frozen layer continuously replenished the surface soil, and even produced internal runoff during spring thawing, despite an intensification of evaporation. This occurrence thereby increased the surface SWC, which proved the conclusions of Iwata et al. (2010)20, Nagare et al. (2012)25 and Wu et al. (2019)21. In addition, the profiled soil water migration rates in the farmland, LT grassland and AS land were substantially different during the FT processes. It was the highest in the LT grassland, whereas the lowest in the farmland. This is because the LT grassland was less salinised than the AS land and surface soil of the former had the highest organic matter content   and soil compaction caused by farming activity over many years inhibited soil water migration. Furthermore, the FT affect soil physical properties, such as soil structure, soil cracking, soil thermal properties and heat flux, which were also an important reason explaining the difference of water migration in soil profiles of different landscapes. For example, frozen soils are divided into layered and reticulate\u00a0structures by ice, resulting in a higher soil water permeability coefficient; thus, water can be quickly discharged from cracking during soil thawing26. Additionally, the groundwater table declined during freezing and rose during thawing, thus suggesting that a mutual transport occurred between the soil water and groundwater in deeper soil.In this study, the freezing process led to an upward enrichment in soil water within different landscapes in the study area Fig.\u00a0. One pos27 and Wang et al. (2009)14. A possible explanation for these results was that the soil salt along with water in the deeper unfrozen layer and groundwater both moved upward towards the frozen layer because of temperature gradient between the frozen and unfrozen layer. In fact, the freeze-induced soil salt migration was exceedingly complex and could not be solely attributed to the temperature gradient. Instead, this dynamic represented the integrated result of many factors, such as land use, initial soil water, soil salinisation, soil temperature, groundwater level. Furthermore, our results also showed that the salinised ratio in the upper soil profile was substantially higher than that in the deeper soil profile during freezing. This behavior may be attributed to the liquid water occurring in the frost layer and temperature gradient forcing the liquid water to carry the salt upwards. Some researchers\u00a0have\u00a0observed that it is possible for liquid water to exist as membrane water, wherein its thickness gradually becomes thinner from the deep soil to the upper soil, thereby causing salt to move upwards along with water28.According to the data obtained from this study, the profiled soil salinity distributions were characterised by an accumulation of soil salt towards the frozen layer with soil water during the freezing. Consequently, the salt content obviously increased throughout the entire frozen layer, which experimentally verified the findings of Stahli and Stadler (1997)LT grassland and AS land during spring thawing. This appears to experimentally explain the phenomenon of topsoil salt explosive increases that resemble an \u2018eruption\u2019 during spring thawing14.\u00a0The results were in accordance with Han et al. (2010)29, who pointed out that the surface soil salinity increased rapidly in spring because of strong evaporation, more FT cycles and longer freezing durations. This is because the quantity of evaporation is five times higher than the amount of rainfall in the western Songnen Plain; thus, this intense soil evaporation induces a redistribution of the accumulated salt in the frozen layer, and transports a large quantity of salt upwards to the surface. More importantly, these findings revealed that FT processes were mainly responsible for the obvious soil salinisation in our study, which aligns with the analysis of Bing et al. (2015)4, who determined that FT processes are the main driving force of soil water and salt movement and are responsible for soil salinisation during the spring in cold and arid regions. However, these results slightly contradicted the findings of Wang. (1993)8, who noted that the surface soil salt \u2018eruption\u2019 in spring was controlled by \u2018the critical depth of ground water\u2019 rather than FT actions, yet which contradicted the local practical condition of using phreatic water as the only water source influencing the soil salinisation in this study area. The water exchanges were blocked by the frozen layers between the soil surface and underground water; therefore, soil salinisation during the spring was not related to groundwater12. However, their findings slightly contradicted with the results observed in our study that suggested that bi-directional thawing also possibly caused the salt under the freezing layer to accumulate in the middle soil profile. This was because the thawed water carrying salt infiltrated towards the deeper soil into\u00a0the\u00a0groundwater, which implied that the profiled salt distributions had a relationship with the groundwater. Moreover, the results from our study also revealed that landscapes affected the salification of the soil surface and the desalinisation of the subsurface soil, with the trend being AS land\u2009>\u2009LT grassland\u2009>\u2009farmland. This discrepancy may be interpreted by four aspects. Firstly, the initial soil salt content of AS land was 19.3 times higher than that of the LT grassland, consequently causing a higher accumulation ratio of soil salt, as indicated by Wan et al. (2019)6, who observed that the salt crystallisation increased the salt migration during the freezing process, and that salt migration was positively correlated with the salt content. Secondly, LT grassland had a larger coverage area and a higher litter amount reduced the quantity of ground evaporation and avoided surface salt accumulation. Thirdly, the improved soil structure of the LT grassland, with its larger root system and higher organic content was beneficial to increase infiltration and promote the downward movement of salt from the upper soil layers30. Finally, the soil of AS land started to thaw earliest because of its lowest freezing point resulted from its highest salt content at corresponding depths, which accelerated the consumption of soil water by evaporation. Additionally, the salinised ratio of the farmland was weaker than that of AS land and LT grassland, which was attributed to its lower initial salt content (64.73\u00a0mg/kg), initial water content (0.11 cm3/cm3), lower frost depth and intensity in farmland25.Furthermore, our study showed that the salification layer moved upwards and expanded, and the surface soil exhibited the significant salt accumulations in the SAR and ESP have been recommended the sensitive indicators of soil alkalisation for a soil alkalisation assessment in the Songnen grassland31. In this study, FT cycles induced the increases in the SAR and ESP in the upper soil layers for all three landscapes 14 also reported that soil FT were one of the most important causes of soil salinisation and alkalisation in the western Songnen Plain and further proved that the influence of groundwater could not be ignored. Groundwater in the study area comprises a weak mineralised water of NaHCO3 type, where Na+, CO32\u2212 and HCO3\u2212contents can be up to 853.55\u00a0mg/L, the salinity is as high as 1.21\u00a0g/L\u00a0and the SAR can reach 88.65. Accordingly, groundwater migrating upwards due to soil freezing induced soil both salinisation and alkalisation, which accelerated soil degradation13. Conversely, some studies have reported that FT cycles had no significant effects on soil CEC or exchangeable Ca2+ and Mg2+ but significantly decreased the exchangeable K+32 that indicated that FT cycles can possibly reduce the soil alkalisation, which was different from our results. The cause of this difference is not clear that is the integrated result of various factors, such as soil types, vegetation\u00a0types, microbial activity, ground level, and so on. The experimental conditions in this study were different\u00a0from Hinman (1970)32 in which soils were fumigated and sterilize without groundwater exchange and vegetation. Furthermore, the influences of soil FT on soil alkalisation varied with soil types and soil depths. In this study, the FT-induced soil alkalisation in the AS land was more pronounced than that in the farmland and LT grassland  Tzvel grassland, and then farmland. Deeper soil water and groundwater moved towards the frozen layer, therefore resulting in the migration and redistribution of soil water and salt during freezing under the temperature gradient and hydraulic gradient. The key finding of this study demonstrates that freeze\u2013thaw processes led to the soil salification layer rising and expanding for all three landscapes. The explosive surface accumulation of salts during the spring thawing originated from the enriched salt in the frozen layers. Therefore, the freeze\u2013thaw processes contributed to the surface soil salinisation and alkalisation in spring. Furthermore, the freeze\u2013thaw-induced soil salt migration was related to land use, whereby that the salt upward migrating intensities exhibited an order of alkali-spot land\u2009>\u2009Leymus chinensis (Trin.) Tzvel grassland\u2009>\u2009farmland.In conclusion, the highest frost depth and longest freezing duration occurred in the alkali-spot land, followed by the"}
+{"text": "Carya cathayensis Sarg.) plantation to clarify the spatial and temporal variation of soil properties and its influencing factors, and to evaluate the change of soil fertility. The results showed that the soil pH and soil organic carbon (SOC) significantly increased from 2008 to 2018, while available nitrogen (AN) significantly decreased from 2008 to 2018. The semi-variance revealed that except available phosphorus (AP), the spatial dependencies of soil properties increased from 2008 to 2018. An increasing south-north gradient was found for soil AN, AP, available potassium (AK) and SOC and a decreasing south-north gradient was found for soil pH. The average soil fertility in the whole area was increased from 2008 to 2018. Our findings demonstrated that the changes of the management measures were the reason for the change of soil properties from 2008 to 2018. Therefore, rational fertilization strategies and sod cultivation are recommended to maintain the long-term development of the producing forest.Monitoring the temporal and spatial variation of soil properties is helpful to understand the evolution of soil properties and adjust the management method in time. Soil fertility evaluation is an urgent need to understand soil fertility level and prevent soil degradation. Here, we conducted an intensive field investigation in Chinese hickory ( From this perspective, long-term monitoring of changes in soil physiochemical properties contributes to make informed decisions for sustainable land use. However, extensive characterization of soil properties are difficult, as many studies demonstrated that soil properties were spatially and temporally different5. The spatial variation of soil properties in ecosystem are mainly related with the combined effects of geological, climatic, human activities and so on10. Globally, soil organic carbon (SOC) and total N are positively correlated with precipitation and negatively correlated with temperature12.\u00a0Soils with a high proportion of clay produce more biomass and protect more organic matter through the association of soil aggregates and organic minerals, resulting in an increase in SOC content in the soil8. However, the influence of natural factors on soil properties are relatively slow, but human activities have dramatically altered the rate of supply of many major nutrients and have thus led to rapid soil property changes14.Soil is the foundation of life and biodiversity in the ecosystem, and plays an important role in nutrient cycling. Proper soil management can improve food quality and safety, maintain or improve soil fertility levels and avoid soil degradation15. Since the 1960s, forest plantations have been expanding in order to meet the population's growing demand for forest products and ecological services. By 2000, the total area of forest plantation was 20.57 million ha, which contributed about 90% of the forest area expansion and 49.3% of forest carbon sink17. Thus, production forests are critical to promoting economic development and participating in C balance at regional and national scales18. Intensive management  is a way of managing production forests to drive growth in plantation productivity and economic returns19. Unfortunately, long term intensive management have led to soil degradation, reduced microbial diversity and soil nutrients imbalances23. Previous study showed that human activities have significantly changed the spatial pattern of soil nutrients in Torreya grandis plantation, resulting in uneven spatial distribution of soil fertility24. Under the long-term intensive management, the soil texture of moso bamboo forest had clear spatial heterogeneity, which affected the productivity of moso bamboo forest25. Spatial variation of soil properties also appeared in the soil of Malus pumila (apple), Camellia sinensis (tea), Hevea brasiliensis (rubber), Eucalyptus robusta  and Castanea mollissima (Chinese chestnut) plantations30. Therefore, it is necessary to understand the spatial variation of soil properties and identify areas with low or high soil fertility, which could further guide site-specific land management strategies.China, the largest developing country in the world, has experienced a rapid shift from natural forests into production forests32. Because of its ability to quantify and reduce sampling uncertainty and minimize survey costs. As the important indicators of soil fertility, the spatial distribution of soil pH, soil available nitrogen (AN), soil available phosphorus (AP), soil available potassium (AK) and soil SOC has been widely studied. In this regard, Liu et al.33 identified the determinants of SOM distribution in an intensive agricultural region of northeastern China by kriging methods. Liu et al. (2009) studied the spatial distribution characteristics of soil properties, and guided the fertilization and management at specific sites34. In addition, geostatistics can also be used to investigate the spatial patterns of soil properties\u2019 change over time35. These published papers have analyzed the heterogeneity of soil properties in farmland, cultivated land and Loess Plateau region39, while less attention is focused on soil properties in plantation forests of Southeastern China.Geostatistical studies have proved to be useful tools for analyzing spatial and temporal variability of soil physicochemical propertiesCarya cathayensis Sarg.) is a unique edible nut and woody oil species that distributed in the Tianmu mountain in Zhejiang province of southeastern China. Because of its unique taste and high nutritional value, the area of Chinese hickory has reached 93,300\u00a0ha with a total yield of 31,500 t in 201841. For the purpose of improving the yield of Chinese hickory, farmers have adopted intensive agricultural management with extensive application of chemical fertilizer46. In addition, it was necessary to remove undergrowth  in order to harvest Chinese hickory fruits  . From 2008 to 2018, the AN concentration declined by 38%  Table . The coe8% Table . The varP\u2009<\u20090.05). The local Moran's I result identified high-high spatial clusters of soil pH in the middle region of the study area, while low-low clusters of soil pH were distributed in the northwest region of the study area (Daoshi town) from 2008 to 2018  maps Fig.\u00a0 indicate0/C0\u2009+\u2009C) for soil pH, AN, AK and SOC were moderate and strong for AK in 2008 and 2013. The spatial autocorrelation for SOC was improved from 2008 to 2018  of Chinese hickory plantation, and the results were shown in Fig.\u00a0In this study, we monitored the temporal and spatial variability of soil properties and soil fertility in hickory plantations under intensive management for 10\u00a0years. Geostatistical studies have determined the degree of variability of soil properties in different regions and the degree of spatial dependence of soil properties. Kriging interpolation and exploratory spatial analysis can provide data support for regional soil management policies.49. Long-term monitoring showed that the soil pH decreased significantly from 2008 to 2013  bound on the soil surface, making it easier to leach from the soil and reducing its buffering effect on acidification. In addition, when an NH4+ ion is absorbed by the crop, an H+ ion is released into the soil solution, causing soil acidification. More serious, Al3+ increases in concentration in more acidic soils53. For hickory, soil acidification increased the risk of canker diseased, leading to mass mortality of hickory plantations54. This may be the reason that the decrease of soil pH in 2013.The global problem was recognized by local governments, which instructed farmers drastically reduced the amount of inorganic fertilizer applied, and added soil conditioners  to raise the pH of the hickory soil in 201055. Our study also found that precipitation had a significant effect on soil pH 58, the concentration of AN more than 120\u00a0mg\u00a0kg\u22121 can be considered as high level. At the same time, Kriging interpolation analysis showed that high levels of AN were observed in almost the whole study area in 2008 and 2013 . According to LISA map, the distribution of AP presented a serious polarization phenomenon, while the high-high clusters were mainly distributed in the northeastern and the low-low clusters were mainly distributed in the southeastern of study area  of 12\u00a0cm and an average tree height of 8 m80. The area is characterized by subtropical monsoon climate with four distinct seasons, with the annual average temperature of 16\u00a0\u00b0C and annual precipitation of 1628\u00a0mm. The annual average daylight hours are 1774\u00a0h with 235 d frost-free81. It has undulating topography with an elevation range of 150\u20131000 m82. The forest ages range of hickory plantations from 30\u2013100\u00a0years. According to Geology online map of Zhejiang Province, China (https://www.osgeo.cn/map/m02cd) and Dong et al.83, the soil is derived from 7 major types of parent material, which include sandstone, sand shale, slate, phyllite, rhyolite, granite and quartz porphyry. During the period of 2008\u20132010, 600\u2013800\u00a0kg\u00a0ha\u22121 of a compound fertilizer  was applied every year41. And herbicide application and mowing were the main methods for controlling understory vegetation. In order to reduce agricultural non-point source pollution, reduce soil erosion and phosphorus pollution, improve soil fertility, the local government issued a document, the application of compound fertilizer was reduced to 150\u2013300\u00a0kg\u00a0ha\u22121 per year, herbicide was banned, and grass was planted under the forest after 2010.The study area is located in Lin\u2019an city , Zhejiang province, southeastern China Fig.\u00a0. It is tAccording to the f distribution characteristics of China hickory plantations of Lin 'an district, a grid of 1\u00a0km\u2009\u00d7\u20091\u00a0km were set up. And the grids containing the hickory plantations was taken as sample plots. A total of 209 sample sites were established in 2008. For each site, a 20\u00a0m\u2009\u00d7\u200920\u00a0m plot was set in the center of each sample plot. Five subsoil samples with a depth of 0\u201330\u00a0cm were collected at 2\u20132.2\u00a0m from the tree trunk (the main distribution area of hickory root system) according to the \"Z\" shape, which were further mixed into one soil sample with a weight of 1\u00a0kg, and brought back to laboratory. For each sampling year, 209 soil samples were collected in situ in July of 2008, 2013 and 2018, respectively Fig.\u00a0. A porta59. Soil pH was determined using a pH meter at soil/water (w/v) ratio of 1:2.5. The soil AN was measured by a diffusion method. Soil AK was extracted with 1\u00a0mol L\u22121 NH4Ac, and then measured by an atomic absorption spectrometer. The AP was extracted using 0.5\u00a0mol L\u22121 NaHCO3 (pH\u2009=\u20098.5) and the P concentration in the extract was determined using the molybdenum-blue method. SOC was determined by the K2Cr2O7\u2013H2SO4 digestion, and titration with ammonium sulfate iron (Fe (NH4)2(SO4)2\u00b76H2O) solution.After all soil samples were air-dried, the visible root debris was removed and sieved through 2-mm nylon mesh. A portion of each soil sample was ground with an agate mortar to pass the 0.149\u00a0mm nylon mesh, and sealed in an enclosed polyethylene bag. The air-dried samples were prepared for physicochemical analysis. All experimental methods were referred to Lu84. None of the data were normally distributed. Therefore, the Box-Cox transformation of soil properties were performed to meet the assumption of normality using Matlab r2019a software. Kernel density estimation was used to estimate the distribution of the soil properties in all sample plots . One-way ANOVA was used to compare the differences in soil properties in 2008, 2013 and 2018. Pearson correlation analysis was used to identify the correlations between soil pH, AN, AP, AK and SOC47. An alpha level of 0.05 for significance testing was used in all statistical analyses, unless mentioned otherwise.The maximum, minimum, range, mean, standard deviation (SD), CV, kurtosis, skewness and significance test of sample indexes for 2008, 2013 and 2018 were presented. Test of normality for soil pH, AN, AP, AK, SOC was performed by the Kolmogorov\u2013Smirnov (K-S) test85. Moran's I is a commonly used index of spatial autocorrelation, which reflects the similarity between adjacent samples86. The global Moran\u2019s I was used to describe the soil properties autocorrelation feature over the entire regions  is widely used in geostatistics to quantitatively describe the spatial variability of environmental variables, and this relationship was expressed through an effective variogram model, which can further provide input parameters for spatial interpolation of kriging88. The models that fit the semivariogram best according to the regression coefficient were determined. For the kriging interpolation, the transformed soil properties data were used. The ordinary kriging method was used to draw a spatial distribution map of soil properties and soil fertility index with ArcGIS desktop 10.7 (https://www.esri.com/en-us/arcgis/products/arcgis-desktop/resources).The ordinary Kriging method can be used to derive the optimal linear unbiased estimate of spatial variablesi), and (3) the calculation of IFI. The soil pH, AN, AP, AK and SOC were used in the calculations. To calculate the IFI the following equation was used:i is the individual fertility index; x is the measured value of each attribute89; xa xb and xc are the upper and lower limits of each classification standard based on forest soils in Zhejiang. In the process of carrying out the cultivated land soil survey and evaluation project, soil scientists developed the soil property classification standard of Zhejiang Province. Soil properties such as pH, SOC, AP and AK are the main controlling factors of soil fertility, while AN is not considered to be the main controlling factor59. And according to the requirements of nut species on soil acidity, soil nutrient. The classification criteria and separate weights were determined as shown in Table S190.The calculation of Integrated Fertility Index (IFI) comprises three steps: (1) the selection of indicators, (2) the calculation of the individual fertility index (IFIiave is the average values for the individual fertility indices; IFIimin is the minimum value for the individual fertility indices; n is the number of soil properties91. The degree of IFI was classified as follows: IFI\u2009<\u20090.9; low, 0.9\u2009\u2264\u2009IFI\u2009<\u20091.8; moderate, 1.8\u2009\u2264\u2009IFI\u2009<\u20092.7; high, and IFI\u2009\u2265\u20092.7; very high.The final step was to calculate IFI using the improved Nemerow Quality Index equation:Supplementary Information."}
+{"text": "The inbred \u201cSJ11-3\u201d pepper was cultured in yellow brown soil, paddy soil, fluvo-aquic soil, and pastoral soil, and the factors affecting the absorption of trace elements and fruit quality were analyzed. The results showed that the physicochemical properties of the soils were significantly different, which led to differences in the nutritional quality of pepper fruits. The pH value had a significant effect on the absorption of trace elements in pepper. The increase of pH promoted the absorption of magnesium and molybdenum but inhibited the absorption of zinc, copper, manganese, and iron. The stepwise multivariable regression analysis showed that the amount of molybdenum in soil was the main factor affecting the total amino acid content of pepper. Total nitrogen, zinc, and copper were the main factors that contributed to the soluble sugar content of pepper, and the available potassium was the major determinant of the vitamin C content of pepper. This study provides new insight on the pepper fruit quality grown on different types of soil with varying levels of trace elements. The total economic output is more than 70 billion CNY per year, illustrating its economic significance in many provinces and cities in China  has received increasing attention . Bao et At present, the traditional cultivation of peppers is mainly based on the theory of \u201cmore water and more fertilizer.\u201d Its practice probably can deteriorate the soil structure, reduce the function, waste resource, and cause water pollution and other issues that affect the nutritional quality and safety of pepper. Therefore, in this study, the relationship between different soil conditions and the quality of pepper was investigated by examining the physical and chemical properties, nutrient content, soil microbial and enzyme activities, the nutrient quality, and mineral nutrient absorption of different soil types. These results provide guidance for the improvement of pepper planting soil, proper fertilization, and the enhancement of the quality of pepper.This experiment is based on the inbred line \u201cSJ11-3\u201d provided by the Hunan Provincial Vegetable Research Institute. It has long, spirally shaped fruit, good taste, and high vitamin C content, which is widely used in the breeding of screw pepper. It was planted from April to September 2016 in the yellow brown soil , paddy soil , pastoral soil , and fluvo-aquic soil , and each soil was divided into three plots. The four soil types are distributed in the central and northern parts of Hunan Province with little difference in geographical location: longitude and latitude. Therefore, the temperature change, light intensity, and precipitation during the planting period were generally consistent, and there was no significant climate difference.4-H2SO4 digestion molybdenum ruthenium colorimetric method. The content of available phosphorus was calculated by sodium bicarbonate extraction-molybdenum ruthenium colorimetry. The total potassium content was determined by H2SO4-H2O2 digestion-flame photometric method. The available potassium content was quantified by ammonium acetate extraction-flame photometry.The pH value of soil was determined by potentiometric electrode method. The bulk density was quantified by the ring knife method. The contents of zinc, copper, manganese, and molybdenum in soil and pepper fruit were measured by inductively coupled plasma mass spectrometry method. The total nitrogen content in soil was determined by semi-micro Kay method. The content of nitrogen was examined by the alkali diffusion method. The content of total phosphorus was measured by HClOThe urease activity of soil was determined by sodium phenolate-sodium hypochlorite colorimetric method. The phosphatase activity was measured by the phenyl phosphonate colorimetric method. The invertase activity was quantified by 3,5-dinitrosalicylic acid colorimetric method. The catalase activity was examined by potassium permanganate titration. The enzyme activities are expressed as the amount of substance produced by the unit weight of air-dried soil during the culture period.The soluble sugar of pepper fruit was determined by the anthrone colorimetric method. The total amino acid, vitamin E, and vitamin C were quantified by kit (Nanjing Institute of Bioengineering).The total soil microbial DNA was extracted with Soil DNA Extraction Kit . The integrity of DNA was verified with 1% agarose gel electrophoresis. The concentration and purity of the extracted DNA were measured with Mini-Drop .The extracted total DNA was used as the template for PCR amplification. Primers targeting V3 + V4 regions of bacterial 16S rDNA gene  and primers targeting fungal ITS1 region  were designed by Biomarker Science and Technology Service , and V3 + V4 regions and ITS1 region were amplified with PCR, respectively. The PCR reaction system was as follows: pre-denaturation at 95\u00b0C for 5 min, followed by 25 cycles of denaturation at 95\u00b0C for 30 s, annealing at 50\u00b0C for 30 s, extension at 72\u00b0C for 40 s, and the final extension at 72\u00b0C for 7 min. The amplified DNA products were purified, quantified, and uniformed to form the sequencing library. The PCR-amplified DNA products were sequenced using Illumina MiSeq 2500 by Biomarker Science and Technology Service .(1) Merge of PE Reads: The merger of the original sequences obtained was conducted with FLASH v1.2.7 software. According to the minimum overlap length of 10 bp, the maximal mismatched ratio that was allowed in the overlapping region was 0.2. Merge of reads of each sample was conducted, and the merger sequences were obtained, i.e., the original Tags data (Raw Tags). (2) Filtration of Tags: the Raw Tags obtained by merger were filtrated with Trimmomatic v0.33. The parameter was set as the 50 bp window. If the mean quantity value was lower than 20, the back-end nucleotide bases starting from the window were removed. After filtration and quantity control, the length of DNA fragments was shorter than 75% of the Tags. The high-quality Tags (Clean Tags) were obtained. (3) Removal of Chimera: the chimera sequences were identified and removed with UCHIME v4.2 software. Finally, the effective tags were obtained. UCLUST in QIIME (version 1.8.0) was used to conduct cluster analysis of Tags at the level of 97% similarity. OTU and RDP classification for all the sequences was conducted to obtain OTUs based on the bacterial and fungal taxonomic databases, and the numbers of OTU were calculated for statistical tests.In this study, the results were expressed as \u201cmean \u00b1 standard error,\u201d and data analysis was performed using Excel 2010 and SPSS 17.0. The significance of multiple comparisons was determined by Duncan\u2019s test.p < 0.05), and the range was 4.20\u20136.42, all of which were acidic soils (p < 0.05). Also, the overall bulk density of the four soils is relatively high, considered as compact or semi-compact. The fluvo-aquic soil has the highest compactness, with no significant difference with the paddy soil, but is 11.53% higher than the yellow brown soil with the lowest bulk density.According to the soil pH and bulk weight grading standards, we found a significant difference in pH among the four types of soil: yellow brown soil, paddy soil, fluvo-aquic soil, and pastoral soil (ic soils . The padThe fertility of rhizosphere is significantly dependent on the soil type . The conp < 0.05). The urease activity was the lowest in paddy soil, which was only 26.01% of that in pastoral soil. No significant difference in urease activity was observed between yellow brown soil and fluvo-aquic soil (p < 0.05). Fluvo-aquic soil exhibited the highest activity of sucrase among the four types of soil, which was 36.19% higher than that of pastoral soil, which showed the lowest activity of sucrase. Soil phosphatase displayed the highest activity in fluvo-aquic soil and yellow brown soil, followed by paddy soil, and no significant difference was detected among the three (p < 0.05), with the lowest phosphatase activity in the pastoral soil. However, catalase activity was the highest in the pastoral soil, followed by yellow brown soil, and the lowest in the paddy soil, which was only 17.23% of the activity in the pastoral soil.There were significant differences in enzyme activities among the four soils . The soip < 0.05) was observed among the peppers grown in fluvo-aquic soil, paddy soil, and yellow brown soil. The content of soluble sugar was the highest in the pepper grown in the pastoral soil, followed by the pepper planted in the fluvo-aquic soil. There was no significant difference between the two (p < 0.05). The content of soluble sugar was the lowest in the pepper grown in the paddy soil, which was 19.92% lower than that in the pastoral soil. The highest vitamin E content was determined in the pepper grown in the pastoral soil, and there was no significant difference among the other three soils (p < 0.05). The content of vitamin C was the highest in the paddy soil, followed by the fluvo-aquic soil and pastoral soil. The pepper planted in the yellow brown soil showed the lowest vitamin C content, which was only 79.68% of the paddy soil.The nutrient composition of pepper varied due to the type of soil . The totp < 0.05), among which the content of pastoral soil was the highest, and the content of yellow brown soil was the lowest, which was 28.85% lower than that of pastoral soil. The content of zinc in pepper was the highest in the pastoral and paddy soils, which is significantly higher than that in pepper planted in the fluvo-aquic and yellow brown soil (p < 0.05). The content of copper was the highest content in the pastoral soil and the lowest in the yellow brown and fluvo-aquic soils, and there was no significant difference between the two (p < 0.05). The copper content in the pepper was the highest in the paddy soil, followed by the yellow brown soil, while the amount of copper in pepper grown in the pastoral soil and fluvo-aquic soil was the lowest. The content of magnesium in fluvo-aquic soil and yellow brown soil was the highest and was the lowest in paddy soil, which was only 61.48% of that of pastoral soil. The magnesium in pepper was the highest in fluvo-aquic soil, but it is not significantly different from that in yellow brown soil and pastoral soil (p < 0.05). The content of manganese in the soil was the highest in the pastoral soil and fluvo-aquic soil, and the lowest in the paddy soil, which was significantly lower than that in all the other soils (p < 0.05). In the pepper, the content of manganese in the paddy soil was the highest, which was 172.56% higher than that in the lowest yellow brown soil. The content of molybdenum was the highest in pastoral soil, which was significantly higher than all the other soils (p < 0.05), and the lowest in fluvo-aquic soil and yellow brown soil,; there was no significant difference between them (p < 0.05). The content of molybdenum was the highest in peppers planted in the pastoral soil, while the peppers planted in the yellow brown soil were the lowest, which was only 17.40% of that in the pastoral soil. The content of iron in the pastoral soil was the highest, which was significantly higher than that in the other soils. The content of iron in pepper was the highest in the paddy soil, which was significantly higher than that in the other soils (p < 0.05).The contents of trace elements zinc, copper, magnesium, manganese, molybdenum, and iron were significantly different among different soil types and pepper fruits . The conAlphaproteobacteria, Acidobacteria, Gammaproteobacteria, Betaproteobacteria, Gemmatimonadetes, and Actinobacteria, which accounted for more than 60% in number. Among them, \u03b1-proteobacteria, acid bacillus, and \u03b2-proteobacteria were mostly identical in number, while \u03b3-proteobacteria was the most diverse in paddy soil and the least diverse in yellow brown soils. Gemmatimonadetes were the most enriched in pastoral soil, while is the lowest in number in fluvo-aquic soil. Actinomycetes were the most abundant in paddy soil and fluvo-aquic soil, and the rarest in pastoral soil. The Shannon index of bacterial community in Pastoral soil and yellow brown soil was 6.58 and 6.39, which were significantly higher than those in paddy soil and fluvo-aquic soil , bulk density (X2), bacterial Shannon index (X3), fungal Shannon index (X4), total nitrogen (X5), total phosphorus (X6), total potassium (X7), alkaline hydrolyzed nitrogen (X8), available phosphorus (X9), available potassium (X10), urease (X11), invertase (X12), phosphatase (X13), catalase (X14), zinc (X15), copper (X16), magnesium (X17), manganese (X18), molybdenum (X19), and iron (X20), were treated as independent variables, and the total amino acid content (Y1), soluble sugar (Y2), vitamin E (Y3), and vitamin C (Y4) of pepper were considered as the dependent variables. We eliminated the least influential factor in the objective function by stepwise multiple regression. The stepwise multiple regression function between the nutrient composition of the pepper and the main soil factors was determined as follows: Y1 = 12.145 + 0.974 \u00d7 X19, R2 = 0.949; Y2 = 13.784\u20130.981 \u00d7 X5 + 0.301 \u00d7 X15 + 0.013 \u00d7 X16, R2 = 0.908; and Y4 = 786.235 + 0.876 \u00d7 X10 + 0.154 \u00d7 X15\u20130.058 \u00d7 X7, R2 = 0.984, while the valid function for Y3 was not obtained. These results showed that the main factor affecting the total amino acid content of pepper was the content of molybdenum in soil, the main factors determining the content of soluble sugar were the contents of total nitrogen, zinc, and copper in soil, and the main factor controlling the content of vitamin C is the contents of available potassium, zinc, and total potassium in soil.2+ and Mn2+, and reduced the concentration of these ions in the soil. Moreover, it decreased the available zinc and manganese which are conducive to the absorption of plants and vice versa in the paddy soil with a low pH. In general, the absorption of molybdenum and magnesium by plants is positively correlated with the content of the elements in the soil, but the molybdate is barely soluble in acidic soils .The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found at: ZL: formal analysis and writing\u2014original draft. LO: funding acquisition, project administration, supervision, and writing\u2014review and editing. ZL and YH: investigation. ZL and FT: methodology. WC: resource. All authors have read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In contrast, no significant difference was found for other physicochemical properties. (2) The SBD, STN, SAK, soil porosity, and soil clay content were significantly different (p < 0.05) under different vegetation cover types, but the influence of vegetation on other soil physicochemical properties seemed to be limited. The results reveal that trees have a stronger ability to reduce soil grain sizes and enhance SAP contents than shrubs or herbs; however, the beneficial effects of herbs on the physicochemical properties of shallow soil are more obvious than those of trees and shrubs. (3) This study indicates that more shrubs and trees should be planted in the areas with low vegetation coverage, and more measures should be taken to improve soil physicochemical properties in order to prevent the occurrence of large-scale degradation. The reconstruction of soil structure should be preferentially considered in the process of soil reconstruction and revegetation in areas under similar conditions. Herbs should first be planted in the early reclamation stage. At the same time, shrubs or trees can be adopted in the middle and late stages of vegetation reconstruction in order to achieve comprehensive revegetation.Soil construction and revegetation are essential for ecological restoration in mining areas. The influence of vegetation on the horizontal and vertical distribution patterns of soil properties should be fully understood. However, most studies on reconstructed soils in mining areas only concentrate on the surface soil, without exploring the vertical variations in soil properties. Overall, this study aims to explore the potential mechanisms by which surface vegetation exerts some influence on the spatial distribution of soil physicochemical properties, and to provide some insight into revegetation and soil reclamation in mining areas. Descriptive statistics and one-way analysis of variance (one-way ANOVA) were employed to evaluate the differences in the soil physicochemical properties in horizontal and vertical directions under different land-use types in the south dump of Antaibao opencast mine in Pingshuo, Shanxi Province, China. The main results of this study are as follows: (1) In the horizontal direction, except for the strong variation (variation coefficient \u2265 100%) in soil organic matter (SOM) content at some depths, the degree of variation in other soil physicochemical properties at various depths was moderate or weak (variation coefficient < 100%). The soil physicochemical properties gradually remained constant after years of reclamation. In the vertical direction, the soil bulk density (SBD), soil porosity, SOM content, soil C/N ratio, soil total nitrogen (STN) content, soil available phosphorus (SAP) content, and soil available potassium (SAK) content showed significant variations ( According to the \u201cStatistical Review of World Energy 2020\u201d , the worSoil construction and revegetation are essential steps for ecological restoration in mining areas ,12,13. ORobinia pseudoacacia can effectively improve soil quality. Hu et al. [Additionally, the effects of different vegetation on soil properties are different, for which numerous studies have been carried out to explore the mechanisms by which vegetation cover types exert influence on the reconstructed soil properties in mining areas ,34,35,36u et al.  found thu et al.  applied u et al. . Some scu et al. . The SOMu et al. ,44. The u et al. , and revu et al. ,47.In order to figure out the evolution laws of soil physicochemical properties in mining areas, it is essential to explore the spatial distribution differences in soil physicochemical properties, as well as the effects of vegetation cover on soil properties. However, most studies on reconstructed soil properties in mining areas are limited to surface soil, without exploring the influence of vegetation on soil properties at different depths ,48. In t2; it has coal reserves of ~12.6 billion tons, and the main coal type is gas coal. Antaibao opencast mine is located in the gentle slope of the Loess Plateau, which is characterized by an arid climate, sandy soils, poor water retention ability, and serious soil erosion. The study area  is an early external dump; the dumping time was 1985\u20131989, the altitude is 1360\u20131465 m, and the slope is 20\u201340\u00b0 [Robinia pseudoacacia, Ulmus pumila, Pinus tabuliformis and Hippophae rhamnoides are the main vegetation [As of the end of the 20th century, Pingshuo Mine was the largest opencast coal production base in China, located in the east of the Loess Plateau and the north of Shanxi Province . Locateds 20\u201340\u00b0 . The surs 20\u201340\u00b0 , and thes 20\u201340\u00b0 . At presgetation . The ecoA total of 24 sample sites in the study area were chosen for sample collection, and soil samples were separately collected in mid-May 2018 and mid-August 2018 . For the(1) Tree/shrub coverage measurement: Two diagonals of the large sample were selected for visual estimation of tree/shrub coverage, and then the average value was employed as the tree/shrub coverage;(2) Herb sample collection: A small sample of 1 m \u00d7 1 m was randomly selected from each large sample square to collect herb samples on the surface. A total of 24 herb samples were collected, which were stored in sealed and numbered bags. Then, the herbs\u2019 biomass was weighed after drying in a laboratory oven at 65 \u00b0C for ~10 h to constant weight;(3) Soil sample collection: Soil profiles were dug at each sample site, and then soil samples were collected at the 10 cm interval with a ring knife (\u03c6100). The average depth of soil profiles at each site was 80 cm; however, due to the difficulty of sampling and the shallow soil barrier layer at some sample sites, all sample sites (except for S7 and S15) were sampled to a depth of 60 cm below the surface . A totalIn order to ensure data accuracy, the Grubbs test was applied to exclude sample points containing outliers, for which 8 sample points were excluded and only 16 sample points (90 soil samples) were adopted in the following analyses . Soil physicochemical properties in the study area are shown in First, we analyzed the horizontal and vertical differences in reconstructed soil physicochemical properties in the study area by using descriptive statistical analysis and one-way ANOVA . Then, wMicrosoft Office Excel was used to calculate the variation coefficients of soil physicochemical properties at different depths. Then, we analyzed the horizontal differences in soil physicochemical properties. The results are shown in As shown in p > 0.05). Therefore, the original values of the soil physical properties and the normalized values of the soil chemical properties were adopted for the following analyses. Considering the limitation of the small sample size, the S\u2013W test (Shapiro\u2013Wilk test) was used to check the normality of soil physicochemical properties in IBM SPSS Statistics 22. The results showed that the original values of the soil physical properties, the reciprocals of STN, SOM, soil C/N, and the square root of soil pH, SAK, SAP conformed to normal distribution (p < 0.05). Other soil physicochemical properties had no significant difference between depths. The results are shown in In order to research the vertical differences in soil physicochemical properties in the study area, one-way ANOVA was employed in order to evaluate the differences in the soil physicochemical properties, with depth as the impact factor when the variance was homogeneous. Welch analysis was used when the variance was not homogeneous. The results showed that the SBD, soil porosity, SOM, soil C/N, STN, SAP, and SAK had significant differences between depths  and the \u201cNutrient Classification Standard of the Second National Soil Survey\u201d , the quaIn conclusion, for the study area, we suggest that the revegetation should be carried out according to local conditions, and that soil quality improvement should be carried out according to the soil physicochemical properties in different areas in the future. In areas where only trees grow (Group 1 and 2), shrubs could be appropriately replanted to improve the SOM of shallow soil. The area of Group 2 should be replanted with trees, such as elms, in order to improve SBD and increase regional vegetation coverage. Herbs should be replanted in the areas of Groups 1 and 3 in order to improve the fertility of shallow soil. In addition, coal gangue or other organic fertilizers can be used to improve the fertility of reclaimed soil. Finally, monitoring of each soil index of the dump should be strengthened in order to prevent large-scale degradation.In the future, in areas with similar conditions, soil reconstruction and revegetation should first pay attention to the reconstruction of soil architecture. During soil reconstruction processes, it is necessary to ensure the uniformity of the soil in each area during dumping, and to reduce the differences in soil physicochemical properties. Given the differences in vertical distribution patterns, the shallow topsoil in the original land can be dumped separately in advance, and then be covered on the surface after the deep soil is dumped, in order to reduce the difficulty of revegetation and soil improvement in the later stages and improve the reclamation efficiency. At the same time, it is necessary to prevent the soil barrier layer from being set too shallow to affect the vegetation growth. The restoration of soil function should be emphasized during soil reconstruction processes, and it is a necessary role of microtopography construction in the restoration of soil function. Herbs should be mainly planted in the early stage of reclamation, and shrubs or trees suitable for the local environment should be introduced in the middle or late stages of revegetation, in order to realize the comprehensive revegetation modes of shrub grass, arboreal grass, or arboreal shrub grass, and improve the restoration of soil quality.(1) In the horizontal direction, except for the strong variation in SOM at 0\u201310 cm and 20\u201340 cm, the degree of variation of other soil physicochemical properties at various depths was moderate or weak. The soil physicochemical properties gradually remained constant after years of reclamation. In the vertical direction, the SBD, soil porosity, SOM, soil C/N, STN, SAP, and SAK showed significant differences between depths; other physicochemical properties showed no significant difference between depths;(2) Under different vegetation cover types, soil clay contents show significant differences between groups at 30\u201350 cm; the SBD and soil porosity show significant differences between groups at 30\u201360 cm; the STN shows significant differences between groups at 0\u201310 cm and 40\u201350 cm; and she SAK shows significant differences between groups at 0\u201350 cm. Other soil physicochemical properties had no significant difference between groups at different depths. The results show that trees have a stronger ability to reduce soil grain sizes and enhance SAP contents than shrubs or herbs. The beneficial effects of herbs on the physicochemical properties of shallow soil are more obvious than those of trees and shrubs;(3) In the later management and conservation of the study area, more shrubs or trees should be planted in the areas with low vegetation coverage, and soil indices in some areas should be improved. Meanwhile, more environmental monitoring should be carried out regularly in order to prevent the large-scale degradation of the land. In the process of soil reconstruction and revegetation in areas with similar conditions, attention should be preferentially paid to the reconstruction of soil structure. At the same time, herbs should be mainly planted in the early stage of reclamation, and shrubs or trees should be adopted in the middle and late stages of vegetation reconstruction, in order to achieve comprehensive revegetation."}
+{"text": "Study on the microscopic structure of saline\u2013alkali soil can reveal the change of its permeability more deeply. In this paper, the relationship between permeability and microstructure of saline\u2013alkali soil with different dry densities and water content in the floodplain of southwestern Shandong Province was studied through freeze\u2013thaw cycles. A comprehensive analysis of soil samples was conducted using particle-size distribution, X-ray diffraction, freeze\u2013thaw cycles test, saturated hydraulic conductivity test and mercury intrusion porosimetry. The poor microstructure of soil is the main factor that leads to the category of micro-permeable soil. The porosity of the local soil was only 6.19\u201311.51%, and ultra-micropores (<\u20090.05\u00a0\u03bcm) and micropores (0.05\u20132\u00a0\u03bcm) dominated the pore size distribution. Soil saturated water conductivity was closely related to its microscopic pore size distribution. As the F\u2013T cycles progressed, soil permeability became stronger, with the reason the pore size distribution curve began to shift to the small pores (2\u201310\u00a0\u03bcm) and mesopores (10\u201320\u00a0\u03bcm), and this effect was the most severe when the freeze\u2013thaw cycle was 15 times. High water content could promote the effects of freeze\u2013thaw cycles on soil permeability and pore size distribution, while the increase of dry density could inhibit these effects. The results of this study provide a theoretical basis for the remediation of saline\u2013alkali soil in the flooded area of Southwest Shandong. Soil salinization will impoverish the land, which is not conducive to the health maintenance of the local ecosystem3. Salinization leads to low agricultural production capacity5, which has become one of the major problems restricting the development of global agricultural production and environmental construction. Studies have shown that soil salinization is essentially soil degradation, which will increase soil bulk density and electrical conductivity, and reduce soil permeability and water retention capacity7. On this basis, in order to improve this bad property, the current improvement methods are generally accepted to add desulfurization gypsum, biomass charcoal and fly ash to the saline\u2013alkali soil11. However, the problems of cost control and environmental pollution cannot be ignored13. In order to explore a new idea of saline\u2013alkali soil improvement, our study is devoted to studying the relationship between soil microstructure and its physical properties (this paper mainly refers to soil permeability) after freeze\u2013thaw (F\u2013T) cycles.The problem of soil salinization is distributed in more than 100 countries and regions around the world. At present, the salinized soil has reached 1 billion hectares in the world and is gradually increasing every year2 of saline\u2013alkali land in China, accounting for 25.2% of the country's arable land area. These saline\u2013alkali lands are mainly distributed in northern China, especially in the Yellow River Basin14. The Yellow River floodplain in the southwest of Shandong Province in China is a seasonal permafrost region. The saline\u2013alkali land in this region is scattered and widely distributed, covering an area of more than 163\u00a0km2, accounting for 45.96% of the unused land15. The region relies mainly on water conservancy measures to control the saline\u2013alkali land, but because of its inland location, fresh water resources are scarce. Although people in the area have been using straw returning to improve the saline land, the effect is still poor. Thus, it is urgent to develop a new saline\u2013alkali land improvement measure.At present, there are about 340,000\u00a0km19 analyzed the connection mode of particles in the skeleton of salinized soil and found that the cement of salt crystals in the skeleton would affect the mechanical strength of salinized soil. Zhang et al.20 by means of SEM (scanning electron microscope), MIP (mercury intrusion porosimetry) and NA (nitrogen adsorption test) to conduct a complete qualitative and quantitative evaluation of the pore characteristics of clay in coastal areas, and found that the colloid bonding and disordered open flocculating structure of the clay in Zhanjiang area contributed to the poor physical and mechanical properties of the clay in this area. Jha and Sivapullaiah21 studied the microstructure of clay by SEM and analyzed the physical properties of lime treated montmorillonite. MIP, which is a relatively straightforward method that can be used to quantitatively obtain reproducible values of pore size distribution. Nowadays, MIP analysis has gradually been introduced into the study of the microstructure of saline soil, and has become a common microstructure analysis method. Liu et al.22 successfully analyzed and explained the changes of microstructure of lime-stabilized saline soils by MIP analysis. Liu et al.23 used MIP to analyze the pore distribution of farmland saline\u2013alkali soil in the Yellow River Delta, providing guidance for remediation, utilization and development of coastal saline\u2013alkali soil in the Yellow River Delta. In addition, as one of the physical properties of soil, soil water permeability is used to characterize soil permeability and internal pore characteristics, and it is an important parameter in agricultural irrigation25. It has been proved that the microstructure of saline\u2013alkali soil is closely related to its physical properties, especially its permeability26. Therefore, in the field of civil engineering, soil microstructure has gradually become one of the criteria for determining soil physical properties. However, research mainly focuses on loess and clay, and researches in the field of saline\u2013alkali soil are relatively scarce. Therefore, the researches on the microstructure of saline\u2013alkali soil can provide a new idea for the restoration of such degraded soil.Many scholars have proved that there is a close relationship between the physical properties and microstructure of soils27. F\u2013T cycles increased soil porosity and saturated water conductivity, change soil physical properties, and there is at least one cycle time threshold (between 5 and 20 cycles)28. Liu et al.22 found that the freeze\u2013thaw cycles would destroy the coarse particles in lime solidified saline\u2013alkali soil, collect fine particles and increase the diameter of macropores. Moreover, many researchers have studied the relationship between F\u2013T cycles and soil permeability, and it is believed that dry density and water content are important factors affecting freeze\u2013thaw cycles31. Meanwhile, the previous studies on soil after F\u2013T cycles mostly focused on its mechanical properties and mostly qualitative research33. However, there are no comprehensive studies on the permeability and microstructure of saline\u2013alkali soil in the southwest of Shandong Province after freeze\u2013thaw cycles.Recently, many scholars have found that F\u2013T cycles can lead to changes in soil physical properties and microstructure. For unsaturated dispersed soils with different salinity, the F\u2013T cycles could change their instantaneous water conductivity and matric suction, and the effects were not monotonic with the increase of the number of F\u2013T cyclesInspired by the above studies, particle-size distribution (PSD) analysis, X-ray diffraction (XRD) analysis, freeze\u2013thaw (F\u2013T) cycle test, saturated hydraulic conductivity (SHC) test and mercury intrusion porosimetry (MIP) analysis were performed on the saline\u2013alkali soil remolded according to different dry densities and water content in the flooded area of Southwest Shandong Province. The objective of this study is to determine the saturated hydraulic conductivity and microscopic pore size distribution of saline\u2013alkali soil in the floodplain of Southwest Shandong Province after F\u2013T cycles. It is expected to find the relationship between the microstructure and permeability of the saline\u2013alkali soil in this area, so as provide a new theoretical basis for its treatment.\u22121, and the average wind speed from January to April is 2.33\u00a0m\u00a0s\u22121. The annual average evaporation is 874.82\u00a0mm, the maximum value appears in June, and the minimum value appears in January. The area is inland and lacks fresh water, so the Yellow River is the only source of irrigation water.The test soil samples were collected in He-ze City, Shandong Province, which is located in the Yellow River Basin at an altitude of 50\u00a0m in the southwest of Shandong Province, and is a typical Yellow River flooding area in Shandong Province. Its region has a warm temperate monsoon continental climate with strong seasonality in temperature, rainfall, wind and evaporation. The average annual temperature in this region is 13.7\u00a0\u00b0C, the extreme minimum temperature is \u2212\u00a016.5\u00a0\u00b0C, and the extreme maximum temperature is 40.5\u00a0\u00b0C. It belongs to the seasonal frozen soil region. The annual frost-free period is 210\u00a0days, and the annual average precipitation is 625\u00a0mm, which is concentrated in June to September. The annual average wind speed is 1.95\u00a0m\u00a0s1:5 reached 1.44\u00a0dS\u00a0m\u22121, PH\u2009<\u20098.5, belonging to weakly alkaline soil. At the same time, exchange sodium percentage (ESP) reaches 31.14%, far more than 15%, so these poor soils are usually classified as \u201csaline\u2013alkali soil\u201d  of 0, 1, 5, 10, 15, 20 were set. The water content was 13%, 16%, 19%, and the dry density of remolded soil was 1.48\u00a0g\u00a0cm\u22123, 1.53\u00a0g\u00a0cm\u22123, 1.58\u00a0g\u00a0cm\u22123, a total of 54 groups of samples  and curvature coefficient (Cc). Uniformity coefficient is used to reflect the distribution of different particle groups, and Cc is used to judge the continuity of slope of cumulative curve of soil particle size distribution, and it is also an important index to judge whether soil particle size distribution is good. The expressions are as follows:d10 is effective grain size, d30 is median grain size, and d60 is control grain size. d10, d30, d60 represent the percentage of particles of the corresponding size that are 10%, 30%, and 60% smaller than the sample.The PSD analysis of soil can facilitate us to understand the composition of soil particles and the uniformity of particle size distribution. The BT-9300S laser particle analyzer  was used to complete soil PSD analysis, and two grading indexes were used to analyze the uniformity of soil particles, namely uniformity coefficient . The semi-quantitative analysis of soil minerals was carried out using Jade 6.5 software.The mineral composition of soil affects the physical and chemical properties of soilFigure\u00a039 of soil. F\u2013T tests were carried out in a closed system and no moisture was supplied to the sample during the test for providing conditions similar to field conditions40. In this study, the freeze\u2013thaw cycles were split into six: the initial state (no cycle) and sets ending after the 1st, 5rd, 10th, 15th and 20th cycle. The soil samples were subjected to a freezing temperature of\u2009\u2212\u200915\u00a0\u00b0C for 12\u00a0h in order to obtain complete frost penetration. After freezing, they were allowed to thaw at a room temperature of about 10\u00a0\u00b0C for 12\u00a0h before being subjected to the next cycle. An ultra-low temperature refrigerated storage tank (DW-HL290) manufactured by Zhongke Meiling Cryogenics Co., Ltd was used for this purpose. On the basis of no more than 0.5\u00a0\u00b0C error, the refrigerated storage tank has a temperature adjustment range of\u2009\u2212\u20095 to\u2009\u2212\u200987\u00a0\u00b0C and the temperature is visible.Freezing and thawing will change the physical properties and internal structureKs) represents the upper limit of water migration rate for soil, and it is one of the crucial hydraulic properties of soil41. Soil permeability is closely related to its microstructure42. In this study, according to the code for geotechnical testing43, variable head osmotic apparatus (TST-55) was used for the SHC test. Before the test, the soil samples were placed in a vacuum saturator for 24\u00a0h to ensure that the soil samples reached the saturation state. The flow rate was measured under the condition of variable head. Considering the effect of temperature on water viscosity, the water temperature was monitored in real time during the test. The expression of Ks is as follows44:Ks is the saturated hydraulic conductivity (cm\u00a0s\u22121), a is the cross-sectional area of the standpipe (m2), L is the length of the sample (m), A is the cross-sectional area of the sample (m2), h1 and h2 are the initial and final water head with respect to the outflow (m) and t is the time for the hydraulic head difference to decrease from h1 to h2.Saturated hydraulic conductivity . Mercury will be injected into the soil sample under a certain degree of pressure. Therefore, according to the pressure applied to mercury and the volume of mercury invasion, the pore distribution of the soil sample can be obtained through the Washburn equation20. In order to facilitate the pore size classification of saline\u2013alkali soil in the Yellow River floodplain of Southwest Shandong, China. Our study based on the Shear pore size division theory47, and other scholars49, combining with the pore characteristics of the local saline\u2013alkali soil  and after freezing and thawing cycle (N\u2009>\u20090) of soil samples have significant differences. When N\u2009=\u20090, the Ks was hardly affected by the water content changes. After freezing and thawing cycle, Ks of soil had approximate linear relationship with the increase of water content, the F\u2013T cycle test with us observed is consistent with the regular pattern of soil sample surface broken. However, the soil water content increased from 13 to 19%, and the increase of Ks was relatively small. Under the three dry densities, the maximum elevation of Ks was 31.68%  and 10 times (N\u2009=\u200910), with the increase of dry density, the saturated water content curves of both will present a crossover phenomenon, and this crossover phenomenon is more obvious with the increase of water content.The relationship between \u22123 dry density had more ultra-micropores (<\u20090.05\u00a0\u03bcm) and micropores (0.05\u20132\u00a0\u03bcm) and less macropores (\u2265\u200920\u00a0\u03bcm) after F\u2013T cycles, but the results were higher than those of the soil samples without freezing\u2013thawing cycle (N\u2009=\u20090). We found that the peak value of pore size distribution curve shifts to the right and increases with the freeze\u2013thaw cycle. After 10 F\u2013T cycles, the curve presents a bimodal distribution, and the pore size distribution of the second peak is more than 10\u00a0\u03bcm. When the freeze\u2013thaw cycle reaches 15 times (E1), the peak value reaches the highest, and the porosity reaches 32.39%  only accounts for 4.95% in saline\u2013alkali soil, and the proportion of clay minerals is 9.55%, both of which account for less than 10% of the total proportion.Soil particle composition is an important factor determining soil structure characteristics53, and added Yellow River sediment to change the particle size distribution to remediate the saline\u2013alkali soil. In addition, high clay mineral content can reduce soil permeability, and soil weathering degree is low when clay mineral content is less than 15%23. The soil samples used in this study had low content of clay particles and clay minerals. Based on these, we focused on the microstructure of soil and explored the microstructure of soil. Thus, MIP analysis is very necessary in our research.A study found that the permeability of saline soil in the Yellow River basin decreases with the increase of clay particle content54, in which the transport of water and salt will lead to changes in soil grain size and structure50. The degree of soil weathering by freezing is related to the number of freeze\u2013thaw cycles and water content. After the initial freeze\u2013thaw cycles, the crushing of coarse particles and the aggregation of fine particles in the soil will lead to a significant increase in porosity. After more freeze\u2013thaw cycles, the soil structure will gradually aggregate and the particle size distribution tends to be stable50. According to the local daily freezing and thawing times, we set a total of 6 freeze\u2013thaw cycles (including N\u2009=\u20090). It was found that the soil permeability coefficient increased non-linearly with the increase of the number of cycles. The reason is that ice lenses gradually form during freezing, and ice melts in the frozen soil during thawing, creating cavities that act as channels and increase soil permeability55. When the number of F\u2013T cycles reaches 15 times, it reaches the peak value. Compared with N\u2009=\u20090, the Ks increases by 209.77%.The freeze\u2013thaw cycle is a process of energy input and output29, and the initial dry density of soil affects the initial porosity. Water to ice produces a volume change of about 9%, which affects the volume expansion of the pores during freezing56. Therefore, according to the standard compaction test, we determined the maximum dry density of the saline\u2013alkali soil of 1.58\u00a0g\u00a0cm\u22123 and the optimal water content of 16%, and the floating value can meet the conditions of the test area coverage. After the F\u2013T cycles, soil is coupled by salt heave and frost heave, and soil pores change, resulting in more internal seepage channels, which means that soil porosity is the main influencing factor leading to the change of saturated water content. Freeze\u2013thaw soils with high water content produce more expansive ice, which breaks the bonds between particles, in contrast, when soil water content is low, ice crystals only grow in soil pores58. This is consistent with our research results, the Ks of soil is significantly affected by changes in dry density and water content. Among them, compared with B7 and B9, C7 and C9, D7 and D9, E7 and E9, and F7 and F9, the Ks decreased by 42.25%, 53.52%, 57.36%, 49.80% and 41.15% respectively. Compared with B7 and B1, C7 and C1, D7 and D1, E7 and E1, and F7 and F1, the Ks increased by 17.0%, 22.57%, 7.83%, 9.26% and 24.07% respectively. In addition, it has been shown that external stress of up to 2\u00a0MPa can be generated during soil freezing53. Under the action of contact stress, the joints and frozen water in the soil will continue to grow and expand. As the circulation goes on, the growing ice crystals will produce pressure on the surface of the adjacent matrix and reduce the internal porosity of the soil59. Therefore, when the F\u2013T cycle reaches 20 times, the Ks of the soil decreases instead. At the same time, the formation of ice-penetrating crystals increases the pore water pressure, compressing the soil, which in turn increases the pore water pressure. During the F\u2013T cycle test, the soil was always inside the constraint ring, and with the increase of soil internal pressure, the constraint of the ring on the soil was strengthened. Considering that high water content promotes frost heave, this explains the crossover in the saturation conductivity curve.The initial porosity of soil plays a decisive role before F\u2013T cycles62. The poor structure of saline\u2013alkali soil is closely related to the low water conductivity and permeability of soil63, these are consistent with our experimental results. Soil microstructure is closely related to its Ks and is strongly affected by freeze\u2013thaw cycles. In the test, A1, A2 and A3, as soil samples without freeze\u2013thaw cycles, have porosity of only 6.19\u201311.51%. The low porosity resulted in the low saturated water conductivity of the soil sample, which was only 1.48\u2009\u00d7\u200910\u20135\u00a0cm\u00a0s\u22121. This makes it difficult for agricultural irrigation water to penetrate the soil, and the remaining water forms surface runoff, which accelerates soil nutrient loss. In addition, the dense soil structure and low porosity promoted soil capillarity in the floodplain of southwestern Shandong Province, and the salt remained on the surface with the evaporation of water after the rise of groundwater, which was extremely unfavorable to the development of agricultural production.Soil structure is an important factor affecting water conductivity49. The F\u2013T cycle can reduce the content of ultra-micropores and micropores in soil samples. After 10 F\u2013T cycles, a new peak value appears at 10\u00a0\u03bcm, indicating that freeze\u2013thaw cycles have a strong effect on soil macropores. When the number of freeze\u2013thaw cycles reaches the threshold (N\u2009=\u200915), the pore water and ice crystals undergoing the freezing and thawing process applied pressure on the surrounding soil and ring knife. In addition, ice-permeable crystals formed during freezing and thawing, which can exacerbate the effects of pressure. Pressure caused particles to condense, which made the pore volume and diameter smaller at N\u2009=\u200920. These also caused the aperture distribution curves of D1 and F1 to coincide.The MIP results showed that there were a lot of ultra-micropores in the soil samples in this area. However, more ultra-micropores in the soil were not conducive to the remediation of saline\u2013alkali soil64, resulting in the deviation of the pore content and the increase of soil porosity. Therefore, we can determine that the increase of water content will shift the peak value of the curve to the right and increase the content of the intrusion volume, which is consistent with the results obtained from the saturated water conductivity test. In addition, the increase of dry density will strengthen the cementation between soil particles, and reduce the porosity in the soil. The growth of ice crystals and the formation of ice-penetrating crystals in the soil are further inhibited, the intrusion volume of pores is correspondingly reduced, and the saturated water conductivity of the soil is reduced.Water content and dry density have great influences on F\u2013T cycle. The water transport process becomes more complex under freeze\u2013thaw cycles, and the complexity increases with the increase of water content. In the soil sample, the water was almost completely frozen into ice during the freezing process, and the soil particles were displaced due to volume expansion, and the soil particles were not completely restored to the original position during thawingKs would increase. After the freezing\u2013thawing cycle reached 10 times, the impact of freezing\u2013thawing cycle intensified, leading to the crushing of large soil particles. The second peak of pore size distribution curve appeared. When N\u2009=\u200915, the pore volume reached the maximum, and then Ks reached the maximum. When N\u2009>\u200915, the pressure generated by ice crystals increase continuously, and the counterforce generated between the ice crystals and the soil matrix began to compress the soil interior. The internal pore channels of the soil were compressed, the pore volume and pore diameter correspondingly decreased, and Ks decreased. In addition, high water content could enhance the effect of ice crystals on soil, thereby increasing pore distribution. The higher dry density resulted in a denser interior of the soil sample, which reduced the flow of water through the channels.Under the action of freezing\u2013thawing cycle, the saline\u2013alkali soil was affected by the coupling of salt heaving and frost heaving, pore water and ice crystals, then pore channels were generated in the soil, which facilitated the flow of water and the frost heaving of ice. Therefore, in the early stage of freeze\u2013thaw cycle, soil particles were broken, and the pore diameter and volume of soil became larger, correspondingly, 65. On this basis, we try to find a new ameliorating measure of saline\u2013alkali soil. The former proposed that high soil porosity would improve its permeability66, and our research supports this view. The results show that the appropriate freeze\u2013thaw cycle can greatly improve the pore distribution, soil porosity and saturated water conductivity of saline\u2013alkali soil in the southwest of Shandong Province. This is also due to the weak internal cohesion of natural saline\u2013alkali soil, and irreversible plastic deformation will occur after several times of frost heave, which will not be affected by the change of salt content. In a certain range, the increase of water content can enhance the effect of freeze\u2013thaw cycle. Considering the natural water content of 14.07% and the optimal water content of 16% in the experimental area, this idea is feasible.In recent years, some scholars have tried to change the microstructure of saline\u2013alkali soil with different ameliorants51, which requires that we need to broaden the channels of water circulation in the soil and let the salt go with the water. Therefore, we can take the freeze\u2013thaw cycle as the basis for the salt discharge in the saline\u2013alkali soil project in this area. Based on the above research, in order to achieve the effect of improving the local soil microstructure and considering the influence of dry density on the pore distribution, we suggest that local farmers should properly plough the cultivated land in winter. Besides, burette can be used to increase the soil water content, in order to achieve the effect of promoting the freezing and thawing cycle.The extreme temperature in winter reaches \u2212\u00a016.5\u00a0\u00b0C in the Yellow Flood area of Southwest Shandong Province, which is a seasonal frozen soil area. Soil samples were taken from the topsoil layer (0\u201325\u00a0cm), which is included within the freezing depth of the soil in the area. Therefore, the F\u2013T cycles can significantly improve the pore distribution and microstructure of crop surface soil. It is well known that after soil moisture evaporates, most of the salt and alkali remain in the surface of the soilKs under F\u2013T cycles. The main reason of low permeability of saline\u2013alkali soil is not the influence of grain size distribution and mineral composition. The low permeability of surface saline\u2013alkali soil is closely related to its microstructure, and its pores are mainly composed of ultra-micropores and micropores. Under the action of F\u2013T cycles, soil pores transition from micropores and ultra-micropores to small pores. When N\u2009=\u200910, mesopore particles begin to be broken, and such fragmentation is the most obvious when N\u2009=\u200915, which is consistent with the law presented by soil saturated hydraulic conductivity curve. High water content can improve the crushing effect of freeze\u2013thaw cycle on soil particles, and then improve soil permeability, while the increase of dry density will play a certain inhibiting role. The results show that the permeability of saline\u2013alkali soil is closely related to its microstructure, and the freeze\u2013thaw cycle can improve the microstructure of saline\u2013alkali soil to further improve its permeability, which provides a certain reference direction for the restoration of saline\u2013alkali soil. Although the relationship between the microstructure of saline\u2013alkali soil and the saturated hydraulic conductivity has been comprehensively analyzed by various methods in this experiment, there are still some limitations. In future studies, we need to consider the restoration effects of F\u2013T cycles on other soil textures, and consider the coupling effects of F\u2013T cycles on salt content, temperature and other factors in combination with soil microstructure.The existence of saline\u2013alkali soil seriously endangers the agricultural production and development in the floodplain of southwest Shandong Province. In this experiment, MIP and SHC test were used to explore the relationship between soil microstructure characteristics and"}
+{"text": "It is well-established that prolonged exposure to real or simulated microgravity/disuse conditions results in a significant reduction in the rate of muscle protein synthesis (PS) and loss of muscle mass. Muscle protein synthesis is largely dependent upon translational capacity (ribosome content), the regulation of which is poorly explored under conditions of mechanical unloading. Glycogen synthase kinase-3 (GSK-3) (a negative regulator of PS) is known to be activated in rat soleus muscle under unloading conditions. We hypothesized that inhibition of GSK-3 activity under disuse conditions  would reduce disuse-induced downregulation of ribosome biogenesis in rat soleus muscle. Wistar rats were randomly divided into four groups: (1) vivarium control (C), (2) vivarium control + daily injections (4 mg/kg) of AR-A014418 (GSK-3 inhibitor) for 7 days, (3) 7-day HS, (4) 7-day HS + daily injections (4 mg/kg) of AR-A014418. GSK-3beta and glycogen synthase 1 (GS-1) phosphorylation levels were measured by Western-blotting. The key markers of ribosome biogenesis were assessed via agarose gel-electrophoresis and RT-PCR. The rate of muscle PS was assessed by puromycin-based SUnSET method. As expected, 7-day HS resulted in a significant decrease in the inhibitory Ser9 GSK-3beta phosphorylation and an increase in GS-1 (Ser641) phosphorylation compared to the C group. Treatment of rats with GSK-3 inhibitor prevented HS-induced increase in GS1 (Ser641) phosphorylation, which was indicative of GSK-3 inhibition. Administration of GSK-3 inhibitor partly attenuated disuse-induced downregulation of c-Myc expression as well as decreases in the levels of 45S pre-rRNA and 18S + 28S rRNAs. These AR-A014418-induced alterations in the markers of ribosome biogenesis were paralleled with partial prevention of a decrease in the rate of muscle PS. Thus, inhibition of GSK-3 during 7-day HS is able to partially attenuate the reductions in translational capacity and the rate of PS in rat soleus muscle. Skeletal muscle disuse/mechanical unloading occurring during real or simulated microgravity, bedrest, limb immobilization, mechanical ventilation causes a significant reduction in muscle mass, force production and overall function ,2,3,4,5.The rate of PS is largely dependent upon translational capacity (amount of ribosomes per unit tissue), the regulation of which is poorly explored under conditions of mechanical unloading/disuse. Ribosome biogenesis plays a key role in driving increased translational capacity in skeletal muscle following resistance training ,9,10. InGlycogen synthase kinase 3 (GSK-3) is a multifaceted Ser/Thr protein kinase known to phosphorylate several hundred substrates , therebyMean body weight did not significantly differ between groups . One-weeAs expected, one-week HS induced a significant reduction in the mean CSA of both slow-type (I) and fast-type (II) muscle fibers . The meaA period of 7 days of mechanical unloading resulted in a significant 37% decline in GSK-3\u03b2 Ser9 phosphorylation (indicative of GSK-3\u03b2 activation) in rat soleus muscle compared to control values a. AdminiTotal RNA content  in rat soleus muscle following 7-day HS significantly declined by 44% compared to the C group . AdminisOne-week mechanical unloading resulted in a significant decrease in 18S rRNA content (\u221245%) and 28S rRNA content (\u221253%) relative to the C group . TreatmeMature 18S and 28S rRNAs are generated by a complex processing of 45S pre-rRNA. As shown in One-week mechanical unloading resulted in a significant decline in both total rpS6 content and phospho-rpS6/total rpS6 ratio compared to the C group a,b. TreaMechanical unloading for 7 days induced a profound decline in the rate of protein synthesis (\u221282%) in rat soleus muscle relative to the weight-bearing control rats . TreatmeIn this study, we questioned if GSK-3 inhibition by AR-A014418 treatment would impact translational capacity  in rat postural muscle during mechanical unloading (7-day HS). The present study shows that GSK-3 inhibition ameliorates HS-associated reduction in ribosome biogenesis in rat soleus muscle. In particular, daily treatment of rats with GSK-3 inhibitor AR-A014418 during 7-day HS attenuated a decrease in such markers of ribosome biogenesis as c-Myc, 45S pre-rRNA, total RNA and 18S + 28S rRNAs in rat soleus muscle. Moreover, GSK-3 inhibition partly rescued a HS-induced decline in the global rates of PS in rat soleus muscle, as evidenced by puromycin-based SUnSET method.One-week HS resulted in a significant decrease in GSK-3\u03b2 (Ser 9) phosphorylation in rat soleus muscle, which was indicative of the enhancement of GSK-3\u03b2 enzymatic activity. GSK-3\u03b2 activation after 7-day HS was confirmed by a significant increase in GS-1 Ser 641 phosphorylation and downregulation of \u03b2-catenin content, key substrates of GSK-3\u03b2. The finding of decreased Ser 9 GSK-3\u03b2 phosphorylation in rodent soleus muscle during the first week of HS is consistent with a number of previously published studies ,18,31,34Treatment of rats with AR-A014418 (a selective GSK-3 inhibitor acting in an ATP competitive manner) during 7-day unloading prevented an increase in GS-1 (Ser641) phosphorylation and \u03b2-catenin degradation, which was indicative of GSK-3 inhibition. One possible mechanism connecting GSK-3 activity and ribosome biogenesis may involve a repression of RNA polymerase I transcription by GSK-3\u03b2. In epithelial cells transformed with oncogenic RAS, Vincent et al. (2008) have demonstrated that GSK-3\u03b2 associates with promoter and coding region of the rDNA and GSK-3\u03b2 inhibition is able to upregulate 18S and 28S rRNA synthesis . FurtherIt is interesting to note that c-Myc is able to enhance protein synthesis during tumorigenesis by activating mechanistic target of rapamycin complex 1 (mTORC1)-dependent phosphorylation of 4E-BP1 , a key pThe findings of the present study pertaining to disuse-induced changes in the markers of translational capacity and muscle protein synthesis are in good agreement with previous reports involving rodents as well as humans. Specifically, a substantial decrease in total RNA content observed in our study following 7-day HS is corroborated by a recent study by Figueiredo et al. (2021) in which middle-aged men (50 \u00b1 3.54 years old) underwent 2 weeks of unilateral limb immobilization and male Brown Norway/F344 rats (10 months of age) were subjected to 1- and 7-day HS . FurtherIt is noteworthy that although inhibition of GSK-3 during 7-day unloading partly attenuated downregulation of the markers of translational capacity and the rate of protein synthesis, decreased soleus muscle mass was not rescued, despite partial protection of the CSA of slow-type muscle fibers. One possible explanation of this result is that an increase in the size of exclusively slow-type muscle fibers in the 7HS + AR group vs. the 7HS group was not enough to attenuate a decrease in the whole muscle mass.Male Wistar rats  were randomly divided into the following 4 groups (n = 8 per group): (1) vivarium control  (C), (2) vivarium control plus daily intraperitoneal (i.p.) injections of GSK-3 inhibitor (AR-A014418) for 7 days (C + AR), (3) 7-day hindlimb suspension  (7HS), and (4) 7-day hindlimb suspension plus daily i.p. injections of GSK-3 inhibitor (AR-A014418) (7HS + AR). Mechanical unloading/disuse was performed via tail suspension (hindlimb suspension), as previously described by Morey-Holton and Globus (2002) . AR-A014Cross-sections from the mid-belly of the muscles were cut at 10 \u03bcm in a cryostat  maintained at \u221220 \u00b0C. The sections were then warmed to room temperature for 15 min and rehydrated by incubating in PBS for 20 min. The rehydrated sections were then incubated for 1 h at 37 \u00b0C with primary antibodies against slow myosin heavy chains (MyHC I (slow), 1:400, M8421, Merck, Darmstadt, Germany). After washing with PBS, the sections were incubated with the appropriate fluorophore-conjugated secondary antibodies  for 40 min in the dark at room temperature. After washing in PBS, the stained sections were mounted using the mounting medium for microscopic analysis. The sections were examined and photographed using a Leica Q500MC fluorescence microscope with an integrated digital camera , 20\u00d7 magnification. Image analysis was performed using ImageJ 1.52a software. At least 150 fibers were analyzed in each muscle sample.In vivo global rates of muscle protein synthesis were detected using a nonradioactive puromycin-based surface sensing of translation (SUnSET) method as previously described . PuromycWestern blot analysis was performed as described in our previous studies ,50,51. IFrozen muscle tissue was cut using Leica CM 1900 cryostat  and weighed on electronic laboratory balance. Total RNA was extracted from muscle samples using RNeasy Micro Kit  according to the manufacturer\u2019s instructions. The concentration of isolated RNA was determined with a NanoPhotometer N50 Touch  at 260 nm. The amount of total RNA was calculated by multiplying the RNA concentration by the total volume of RNA solution. This value was divided by the tissue sample weight to obtain \u03bcg of total RNA per mg muscle tissue sample used for RNA isolation. RNA samples from equivalent amounts of tissue were run on gels in order to assess the content of 18S and 28S rRNAs. RNA quality of purification was evaluated according to 260/280 and 260/230 ratios. All RNA samples were mixed with equal value of denaturing buffer  and heated for 10 min at 70 \u00b0C. The electrophoresis was performed in 1.2% agarose gel with ethidium bromide staining in TBE buffer  at 10 V/cm. RiboRuler markers  were used for RNA molecular weight analysis. The measurements of the 28S and 18S rRNA were performed by Gel Doc EZ Imager .To perform reverse transcription and real-time PCR, we determined raw RNA concentration, after which we selected from each sample a volume containing 1 \u00b5g of RNA. For reverse transcription to be provided, 1 \u03bcg RNA, oligo(dT)15, random hexamers d(N)6, dNTPs, RNase inhibitor, and Moloney Murine LeukemiaVirus (M-MLV)  reverse transcriptase (60 min at 37 \u00b0C) were used. For each target RNA, 1 \u03bcL cDNA was amplified in a 25 \u03bcL SYBR Green PCR reaction containing Quantitect SYBR Green Master Mix  and 10 \u03bcM of each primer: c-Myc-forward 5\u2032-ttgatggggatgaccctgac-3\u2032, c-Myc-reverse 5\u2032-ctcgcccaaatcctgtacct-3\u2032; 45S Pre-rRNA-forward 5\u2032-gcctgtcactttcctccctg-3\u2032, 45S Pre-rRNA-reverse 5\u2032-gccgaaataaggtggccctc-3\u2032; RPL19-forward 5\u2032-gtacccttcctcttccctatgc-3\u2032, RPL19-reverse 5\u2032-caatgccaactctcgtcaucag-3\u2032. The annealing temperature was based on the PCR primers\u2019 optimal annealing temperature. The amplification was monitored in a real time using the iQ5 multicolor real-time PCR detection system . The identification of the PCR products was confirmed by melting-curve analysis after amplification. Quantification of the target genes was performed by using relative expression software tool (REST) software  which is based on an efficiency corrected mathematical model for data analysis as described by Pfaffl et al. (2002) . In briep value less than 0.05 was regarded as statistically significant.Body/muscle weight, muscle fiber CSA and total RNA data are shown as mean \u00b1 SEM. Western blot, rRNA and mRNA data are shown as median and interquartile range (0.25\u20130.75) \u00b1 the minimum and the maximum. Sample medians in the boxplots are expressed as % of the control group. SigmaPlot 12.5 software package was used for statistical analysis. Since the normal distribution of the sample was not confirmed in all cases, a nonparametric Kruskal\u2013Wallis test with Dunn\u2019s multiple range test was applied. A In conclusion, the present work revealed that GSK-3 activity during 7-day mechanical unloading/disuse can be involved in the regulation of ribosome biogenesis in rat postural soleus muscle. Inhibition of GSK-3 under unloading conditions partially attenuated a reduction in both ribosome biogenesis markers and the rate of muscle protein synthesis."}
+{"text": "Humoral immune responses were significantly higher in vaccinated than in unvaccinated recovered individuals, with a 43-fold increase in the mean pVNT50 values. However, there was no significant difference in the pVNT50 and IFN-\u03b3 ELISpot values between the single- and double-dose regimens. In SARS-CoV-2-na\u00efve individuals, antibody responses varied according to the vaccine type: BNT162b2 and mRNA-1273 induced similar levels of S1-IgG to those observed in vaccinated, convalescent individuals; in contrast, pVNT50 was much lower in SARS-CoV-2-na\u00efve vaccinees than in vaccinated recovered individuals. Therefore, a single dose of ChAdOX1, BNT162b2, or mRNA-1273 vaccines would be a good alternative for recovered individuals instead of a double-dose regimen.In the face of a global COVID-19 vaccine shortage, an efficient vaccination strategy is required. Therefore, the immunogenicity of single or double COVID-19 vaccination doses  of SARS-CoV-2-recovered individuals was compared to that of unvaccinated individuals with SARS-CoV-2 infection at least one year post-convalescence. Moreover, the immunogenicity of SARS-CoV-2-na\u00efve individuals vaccinated with a complete schedule of Ad26.CoV2.S, ChAdOX1, BNT162b2, mRNA-1273, or ChAdOX1/BNT162b2 vaccines was evaluated. Anti-SARS-CoV-2 S1 IgG antibody (S1-IgG), pseudotyped virus-neutralizing antibody titer (pVNT Since the first case of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection was reported in December 2019, there have been more than 318 million confirmed cases of coronavirus disease (COVID-19) as of January 2022, including 5.5 million deaths worldwide ,5,6. HowRecently, several reports have demonstrated that recovered individuals exhibit better immune responses, including cross-protective immunity against variants, than infection-na\u00efve individuals with a single dose of an mRNA COVID-19 vaccine ,13,14,15In order to evaluate the humoral and cellular immune responses elicited by ChAdOX1, BNT162b2, and mRNA-1273 vaccines in recovered individuals, we performed age-, sex-, and initial symptom onset (ISO)-matched case\u2013control studies between a single-dose-vaccinated group and an unvaccinated group of recovered individuals. Moreover, we compared the immunogenicity of mRNA and viral vector vaccines in SARS-CoV-2-na\u00efve individuals.To evaluate vaccine-induced immunity in recovered and infection-na\u00efve healthy individuals, we selected 52 participants from the YUMC-COVID-R02 study (IRB No. YUMC-2020-04-009), an ongoing longitudinal immunogenicity evaluation study of COVID-19-convalescent individuals, and 62 healthy SARS-CoV-2-na\u00efve individuals were newly enrolled (IRB No. YUMC-2021-03-012). COVID-19-convalescent patients had been diagnosed using RT-PCR during the first wave of COVID-19 (from February 2020 to April 2020) [To detect anti-SARS-CoV-2 S1 and nucleocapsid protein (NCP) IgG antibodies, plasma samples were tested with EUROIMMUN ELISA SARS-CoV-2 IgG  coated with recombinant SARS-CoV-2 spike protein (S1 domain) or NCP. ELISA was performed according to the manufacturer\u2019s instructions. Optical density (OD) was measured at a wavelength of 450 nm with a reference wavelength of 620 nm using a microplate reader . The results were evaluated semiquantitatively by calculating the ratio between the extinction of the control or sample and that of the calibrator. The ratio was calculated using the following formula:Samples with a ratio of <0.8 were interpreted as negative, 0.8\u2013<1.1 were borderline, and \u22651.1 were positive.TM transfection reagent . The plasmid pLV-Luc was constructed by PCR cloning with specific restriction enzyme primers . pLV-Luciferase was constructed by subcloning the firefly luciferase gene insert from pGL3 \u2014digested with BamHI and SalI \u2014into the respective site in the pLV-eGFP vector (Addgene #36083). At 48 h post-transfection, the culture media (SARS-CoV-2 pseudovirus) were harvested. After centrifugation, supernatants were collected as pseudoviral particles. The SARS-CoV-2 pseudovirus was stored at \u221280 \u00b0C until use. The plasma samples were heat-inactivated for 30 min at 56 \u00b0C and serially diluted 2-fold in Dulbecco\u2019s modified eagle medium  supplemented with 10% heat-inactivated FBS . Diluted plasma samples were mixed with an equal volume of SARS-CoV-2 pseudovirus for 1 h at 37 \u00b0C. One hundred microliters of diluted plasma/virus mixture, media/virus mixture (positive control), or medium alone (negative control) were inoculated into angiotensin-converting enzyme 2-(ACE2)-expressing HEK 293 T cells  in a 96-well clear-bottom white plate . After 48 h of infection, the supernatant was discarded. To each well, 20 \u00b5L of 1\u00d7 passive lysis buffer (Promega) were added, followed by the addition of 100 \u00b5L of luciferase assay reagent (Promega). Luciferase activities of SARS-CoV-2 pseudovirus were detected using a Molecular Devices L-Max II Luminescence Microplate Reader  and expressed as relative luminescence units (RLU). The inhibition rate (%) of samples was calculated as follows:HEK-293T cells  were transfected with psPAX , pLV-Luc, and pcDNA3.1-SARS-CoV-2-Spike  using Solfect50) was determined by non-linear regression using GraphPad Prism 9.3.0 . pVNT50 below the detection limit was recorded as 10 and was considered the cutoff titer.Then, 50% of the SARS-CoV-2 pseudovirus-neutralizing antibody titer  for 18 h at 37 \u00b0C in an atmosphere of 5% CO2; cells stimulated with anti-CD3 mAb  were used as positive controls; cells stimulated with the medium  alone were used as negative controls. IFN-\u03b3 spot-forming counts (SFCs) were detected using a human ELISpotPRO kit (MABTECH) according to the manufacturer\u2019s instructions. The number of spots was counted using an ImmunoSpot Counter .The cryopreserved PBMCs were thawed, and 2.5 \u00d7 10p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).Data were analyzed and plotted using GraphPad Prism 9.3.0 . All datasets were tested for statistical normality, and this criterion was used to decide the appropriate (parametric or nonparametric) statistical test. The Mann\u2013Whitney test and Wilcoxon matched-pairs signed-rank test were used to compare the differences between the experimental groups. Multiple comparisons were performed using two-way ANOVA, one-way ANOVA, and Kruskal\u2013Wallis tests for statistical analysis (significance levels: not significant (ns): To evaluate vaccine-induced immunity in SARS-CoV-2-recovered individuals, 35 individuals were selected for a nested case\u2013control study fromYUMC-COVID-19-R02, a longitudinal immunogenicity follow-up study of COVID-19-recovered patients . Eighteep > 0.05, p < 0.0001, 50 was 131 \u00b1 124 vs. 97 \u00b1 133, 100 \u00b1 98 vs. 52 \u00b1 46, 86 \u00b1 84 vs. 106 \u00b1 235, and 77 \u00b1 95 vs. 3333 \u00b1 2322 at visits one, two, three, and four, respectively, in the unvaccinated and single-dose-vaccinated groups (p < 0.0001). The cellular immunity measured based on the levels of IFN-\u03b3 SFCs was not different between the unvaccinated and single-dose-vaccinated SARS-CoV-2-recovered individuals during all the visits , by 4- and 43-fold, respectively. At the same time, the counts of IFN-\u03b3 SFCs were only 1.9-fold higher in the vaccinated group than in the unvaccinated group of SARS-CoV-2-recovered individuals  gradually decreased in most individuals from visit one  to visit three   and double-dose- (n = 17) vaccinated SARS-CoV-2-recovered individuals   , Table 3To evaluate vaccine-induced immunity in SARS-CoV-2-na\u00efve individuals, 62 individuals who neither had been diagnosed with COVID-19 nor had any related symptoms were enrolled. Fifty-six individuals were vaccinated with a complete schedule of Ad26.CoV.S, ChAdOX1, BNT162b2, or mRNA-1273, and six individuals were cross-vaccinated with primary ChAdOX1 and secondary BNT162b2 doses . Accordi50 was also the highest in mRNA-1273 (406 \u00b1 200), followed by BNT162b2 (355 \u00b1 384), ChAdOX1/BNT162b2 combination (206 \u00b1 111), ChAdOX1 (96 \u00b1 90), and Ad26.CoV2.S (31 \u00b1 56)  (p > 0.05). However, the IFN-\u03b3 ELISpot counts were significantly different pre- and post-vaccination . There were no differences in the counts of IFN-\u03b3 SFCs between each group post-vaccination (p > 0.05).The anti-SARS-CoV-2 nucleocapsid antibody titer evaluated in all the SARS-CoV-2-na\u00efve individuals tested negative, suggesting that no previously infected individuals were included in the study . After C31 \u00b1 56) . Among t%, 8/10) a,b. Ther%, 8/10) a,b. The 50, and IFN-\u03b3 spot counts before vaccination (from visits one to three). However, the humoral immune response, especially the neutralizing antibody, was significantly increased after a single-dose vaccination compared to the unvaccinated, recovered group. Therefore, protective immunity seems to be significantly strengthened by COVID-19 vaccination in SARS-CoV-2-recovered individuals. A single dose of BNT162b2, mRNA-1273, or Ad26.COV2.S induced higher anti-S antibody titers in the recovered individuals than in the unvaccinated convalescent individuals, regardless of the vaccine type [Here, we performed an age-, sex-, and ISO-matched nested case\u2013control study between a single-dose-vaccinated group and an unvaccinated group of SARS-CoV-2-recovered individuals, in addition to a comparison with infection-na\u00efve individuals. Case\u2013control groups showed similar S1-IgG, pVNTine type . In our ine type , no signine type . TherefoIn COVID-19-na\u00efve individuals, the humoral immune response vastly differed according to the vaccine type. Ad26.CoV2.S induced the lowest, and mRNA-1273 induced the highest immune responses compared to the other vaccines . In part50, and IFN-\u03b3 ELISpot counts differed significantly between the unvaccinated infection-na\u00efve group and the previously unvaccinated, infection-na\u00efve vaccinated, and recovered vaccinated groups , but not in the recovered individuals, even though the mean IFN-\u03b3 spot counts were increased after vaccination. These data demonstrate significant variations in the immunogenicity of the currently used COVID-19 vaccines in Korea and suggest a different vaccination strategy in infection-na\u00efve and recovered individuals."}
+{"text": "The cytotoxic activity of all compounds was assessed against HeLa , MCF-7 (breast carcinoma), and HuH-7 (liver carcinoma), as well as normal HEK-293 (human embryonic kidney) cell lines. Among all compounds, IST-02 and 04 were found to be cytotoxic against HuH-7 cell lines with percentage cell toxicity of 75% and 66%, respectively, at 500 ng/\u00b5L dosage. Moreover, HEK-293 cells exhibit tolerance to the increasing drug concentration, suggesting these two compounds are less cytotoxic against normal cell lines compared to cancer cell lines. Hence, both DNA binding and cytotoxicity studies proved imidazolidine (IST-02) and thiazolidine (IST-04)-based isatin derivatives as potent anticancer drug candidates among which imidazolidine (IST-02) is comparatively the more promising.Imidazolidine and thiazolidine-based isatin derivatives (IST-01\u201304) were synthesized, characterized, and tested for their interactions with ds-DNA. Theoretical and experimental findings showed good compatibility and indicated compound\u2013DNA binding by mixed mode of interactions. The evaluated binding parameters, i.e., binding constant (K Cancer, the second leading cause of death globally, is basically related to the abnormal functioning of deoxyribonucleic acid (DNA). Drugs are considered to destroy the cancerous cells or reduce their size . DNA of Among various organic classifications, heterocyclic compounds play an important role in medicinal chemistry and in rational drug design . Isatin \u00ae) is FDA approved for GIST  and RCC  chromen-2-yl)thiazol-2-yl)hydrazono) indolin-2-one(IST-03); and (Z)-ethyl 2-(2-(1-benzyl-5-chloro-2-oxoindolin-3-ylidene)hydrazinyl)thiazole-4-carboxylate(IST-04) which contain three substituted 1-benzyl-5-chloro-indolin-2-one nuclei. Here, we report on their synthesis, characterizations, and anticancer potential as investigated by DNA binding and cytotoxicity studies.Four new hydrazonoindolin-2-one compounds (IST-01\u201304) were synthesized with a general formula of [3-(hydrazono)1-benzyl-5-chloro-indolin-2-one]. Three different strategies were adopted to produce such derivatives . In the The final products were obtained by performing the reactions as shown in \u22121, C-H aromatic at 3119 cm\u22121, C=O of carbonyl at 1738 cm\u22121, and C=N of imine at 1549 cm\u22121. The 1H-NMR spectra of IST-01 showed NH proton at 13.34 ppm, coumarin proton at 8.63 ppm, thiazoline proton at 8.10 ppm. For IST-02, the 1H-NMR spectra showed isatin proton at 8.03 ppm, phenyl proton as a multiplet at 7.34\u20137.28 ppm, thiohydantoin proton at 4.97 ppm. For IST-03, 1H-NMR spectra showed N-H proton at 12.88 ppm, thiazolidine proton as a multiplet at 7.58\u20137.25 ppm. For IST-04,1H-NMR spectra showed N-H proton at 13.24 ppm, thiazoline proton at 7.79 ppm. 13C-NMR  in \u03b4 (ppm), for IST-01 showed 165.61 , 161.63 (coumarin C=O), 152.99 (isatin C=O), 145.08 . For IST-02, spectra showed 172.00 , 171.36 , 166.21 (ester C=O), 163.97 , 148.08 . For IST-03, spectra showed 180.00 , 161.63 (coumarin C=O), 160.80 (isatin C=O), 141.33 . For IST-04, spectra showed 166.80 , 161.35 , 161.27 (isatin C=O), 144.21 . All FT-IR, 1H-NMR, and 13C-NMR data was in good arrangement. The respective spectra are provided in FT-IR analysis revealed that all synthesized compounds expressed characteristic absorption band for N-H at 3233 cmg) is the difference between the ground (S0) and excited state (S1) rather than the difference between orbital energies of HOMO and LUMO. Experimentally, the optical band gap (Eg) obtained from the spectra is excitation or the lowest transition energy from the ground state to the excited state (first dipole state), considering only an electron, which is stimulated from the HOMO to the LUMO. The HOMO\u2013LUMO energy gap decreases in the order as: IST-01 = IST-03 > IST-04 > IST-02.The density functional theory (DFT) is an important theoretical method that could help in a better understanding of chemical and optical properties of compounds and their complexes. The electron density distributions and energy levels of isatin complexes with HOMO and LUMO are given in 0 and S1 are shown in The optimization energy and DH-L energy for IST-02 is the least, which demonstrates that it is the most reactive complex amongst other. The energy values for the SbK) calculated through molecular docking, it can be established that hydrogen bond interactions along with hydrophobic interaction are responsible for the highest bK value of the IST-02. When the MOE predicted conformation of IST-02, IST-03, and IST-04 was matched with the conformations obtained from an X-ray diffractometer, the hydrogen bonding mode with DNA was found to be the same.To grasp the idea of modes of DNA binding and to identify the sites where a compound could bind in major or minor grooves of DNA, molecular docking is implemented as a valuable technique in theoretical drug design ,34. MolebK values for IST-02 demonstrated its greater interaction with DNA base pairs.IST-01 did not show any hydrogen bonding with the DNA helix. However, the most important DNA base pairs, i.e., DT7, DT8, DC9, DG10, DA17, DA18, DT19, DT20, and DC21, could interact with IST-01 and might be responsible for its better biological role. IST-02 depicted hydrogen bonding between its =O and \u2013H atom of the base pairs guanine DG (B16). Other important residues that interacted with IST-02 included DC(A9), DG(B10), DC(A11), DG(B12), DA(B17), DA(B18), and DT(B19). A portion of IST-02 intercalated between DA(B17) and DA(B18) base pairs of the DNA. IST-03 depicted 2 hydrogen bonds: one with DA(B17) and the second with DG(B16). Other important residues responsible for binding of IST-03 within the groove included: DC(A9), DG(B10), DC(A11), DG(A12), DA (B18), and DT(B19). IST-04 displayed two hydrogen bonds associated with \u2013H atom of IST-04 with \u2013O of adenine DA (B17) and \u2013N atom of IST-04 with \u2013H atom of guanine DG(B16). Other important interacting sites included DG(B14), DC(A11), DC(B15), and DA(B18). A visualization of interactions showed partial intercalation and groove-binding modes for all isatin compounds. Based on scoring functions obtained for best docking pose, the binding constant was calculated. The binding strength order in term of binding constant was evaluated as: IST-02 > IST-04 > IST-03 > IST-01. The values are shown in UV-visible spectrophotometry is a prime procedure to investigate compound\u2013DNA binding. The variations in the UV-visible spectrum of a compound upon DNA addition could help identify the interactions involved between a compound and DNA.\u22121cm\u22121) were evaluated from the slopes and the values obtained for IST-01\u2013IST-04 were found to be 38,933, 20,750, 42,767, and 14,533, respectively. These values predicted \u03c0-\u03c0* transitions in all compounds in the \u03bbmax range of 380\u2013590 nm.The four isatin derivatives (IST-01\u2013IST-04) have been evaluated spectrophotometrically to obtain an understanding of their interactions with ds-DNA. The spectra of all the derivatives were recorded, separately, at different concentrations and shown in For DNA binding interactional studies, DNA titrations were performed, separately, into the fixed concentrations of each compound under physiological pH (7.4) and temperature (37 \u00b0C). The spectral responses before and after DNA titrations are shown in The resultant hypochromic effect was found to be 84.94% for IST-01, 65.88% for IST-02, 83.22% for IST-03, and 75.50% for IST-04 followed by a blue shift of magnitude 4.5 nm, 1 nm, and 5.5 nm for IST-01, IST-03, and IST-04, respectively, and a red shift of magnitude 10 nm for IST-02. Generally, hypochromism and a significant blue/red shift are the parameters that arise due to the change in the structure of DNA, with it reported for the intercalation mode of compound\u2013DNA binding ,37,38,39Generally, the Benesi\u2013Hildebrand and van\u2019t Hoff equations were used to evaluate the binding constant and Gibbs free energy change, respectively.oA and A are the absorbance of the compound in the absence and presence of DNA, respectively, and G\u03b5 and H-G\u03b5 are the molar extinction coefficients of free compound and the compound\u2013DNA complex, respectively. The binding constant (bK) was calculated from the intercept-to-slope ratio from the plot of o/AA \u2212 oA vs. 1/[DNA] (bK and \u0394G) are provided in bK was evaluated to be 103 which reflects spontaneous and substantial binding of the compounds with DNA, with the same order of binding constant reported for some intercalating molecules  . The binolecules ,39.Similar DNA titrations were carried out under identical conditions pH 7.4, 37 \u00b0C) as those set for UV-visible experiments. All compounds were found to be luminescent; hence, their fluorescence spectra were recorded separately and then DNA titrations were carried out by adding different DNA concentrations directly into the fixed concentration of each compound. The fluorescence responses are shown in 7 \u00b0C as tFluorescent enhancement also indicated that the molecule is strictly shackled at the binding site and there is no hydrophobic interaction between the nitrogenous bases of the DNA and water molecules. So, after excitation, the masking of the fluorophore and the interaction between stacked nitrogenous bases of the DNA decreases the vibrational modes that contribute towards the increase in fluorescence peak intensity .bK\u2019 and \u2018n\u2019 are the binding constant and binding site size, respectively. From the plots of log [F \u2212 o/FoF] vs. log [DNA], logFg [DNA], , \u2018Kb \u2019anbK\u2019 values were calculated in the same order as done in UV-visible spectroscopy, i.e., IST-02 > IST-04 > IST-03 > IST-01. This confirmed the relatively more stable and stronger interaction of IST-02 with DNA. As the binding site size for all compound\u2013DNA complexes was greater than 1 (n > 1), it showed that along with intercalation, other types of reversible interactions such as groove binding or electrostatic interaction may be present due to more site availability. Gibbs free energy changes  could further be complemented by cyclic voltammetry that describes compound\u2013DNA interaction in terms of changes in fundamental electrochemical parameters . The variations in the cyclic voltammograms of all compounds after DNA titrations, at physiological conditions , are shown in poI and pI represents the peak current in the absence and presence of DNA, respectively. The binding constant (bK) was determined by using the above equation in a graph of pI2 vs. poI2 \u2212 pI2/[DNA] Ip2=p2/[DNA] . The evaDNA) in the following equation, in place of the concentrations ratio of the compound\u2013DNA complex (Cb) and free compound (Cf), the binding site sizes (n) were calculated for all compounds [DNA/IDNA vs. [DNA], the binding site sizes (n) were evaluated from the slope values after substituting the values of the binding constant bK  and with DNA  obtained spectroscopically and electrochemically complimented each other and indicated that all compounds have a significant attraction for DNA via mixed mode, with preferably greater binding interactions of compound IST-02 and then IST-04 with the DNA.All binding parameters (o) of all compounds and their DNA-bound complexes.To further assure the compound\u2013DNA complex formation, the irreversible redox activity of all compounds were scanned at different scan rates (0.1\u20130.13 V/s), with and without DNA. The overlay of cyclic voltammograms at various scan rates are provided in The calculated values of the diffusion coefficient are presented in Another method to investigate compound\u2013DNA interaction is to determine the viscosity of DNA in the presence of a compound\u2019s concentration. Viscosity of DNA increases when the planar portion of a drug/drug-like molecule is inserted into the DNA binding pockets and stacked between the base pairs resulting in the widening of the DNA helical structure. This insertion of the planar part is referred as intercalation and the increase in DNA viscosity arises due to the interaction of electronic density of the intercalating part of a compound with the stacked DNA base pairs. DNA is a natural biopolymer, hence the changes in DNA viscosity will be in minute fractions due to the smaller size of the inserted molecule in comparison to DNA. A mixed binding mode is predicted if a constant behavior is observed after a linear rise in DNA viscosity . On the o)1/3 vs. [Compound]/[DNA] plots for all compounds , MCF-7 (breast carcinoma), and HuH-7 (liver carcinoma). None of the compounds showed significant cytotoxic activity against cervical (HeLa) and breast cancer cells (MCF-7), suggesting that these drugs might not be potent against these specific cancers . Howeverp < 0.001) for both the compounds on HEK-293 cell line. At the same concentrations, the percentage cytotoxicity on the HuH-7 cancer cell lines was greater than 50%, indicating the potential of these drugs being selectively cytotoxic against hepatocellular carcinoma cells  cell line, with both compounds also showing dose-dependent cytotoxic activity against normal HEK-293 cells . Howeverma cells .50) values, as given in 50 values indicate that a specific dose of a compound is essential to kill 50% of the cancerous cells. Most of the time, IC50 values for a cancerous cell line are less, indicating that a lower concentration of drug is needed to kill the cancerous cells, whereas larger values of IC50 on a healthy cell line indicate that a higher dose of drug is needed for the death of healthy cells. This type of phenomenon corresponds to the least side effects of a drug. In the present research, IST-02 and IST-04 had IC50 value of 3.07 \u00b1 9.47 and 14.60 \u00b1 2.49 \u00b5M, respectively, which suggests that these drugs are sufficiently powerful enough to kill cancerous cells at lower concentrations. For healthy cells, the values of IC50 for these drugs were 488.30 \u00b1 2.44 and 197.80 \u00b1 8.75 \u00b5M, respectively, which indicates lesser cytotoxicity for healthy cell.The half maximal inhibitory concentration  were reported as 28.19 \u00b1 3.59, 13.90 \u00b1 3.91, and 22.26 \u00b1 6.21\u03bcM, respectively, against HuH-7 [50 values were evaluated as 13.66, 6.73, and 19.36 \u03bcM, respectively, for the same cell line [Isatis indigotica leaves and indole alkaloids  were tested on the same cell line and the IC50 values were reported as 58 \u03bcM [50 values evaluated for isatin derivatives in current studies have been low compared to the literature cited above, especially for the compound IST-02. These results indicate that our compounds are more potent than previously reported derivatives/compounds against liver cancer. To further validate these in vitro results and to authenticate the anticancer potential of tested compounds, in vivo experiments on animal models of respective cancers are required in future.The ICst HuH-7 . In anotell line . The extas 58 \u03bcM  and 4.88as 58 \u03bcM , respectmax of 260 nm on a UV-visible spectrophotometer. The Beer\u2013Lambert law was used , and the concentration of DNA was determined to be 5 \u00d7 10\u22125 M. The absorbance ratio A260/A280 was calculated as 1.6, which ensured that the DNA solution was free of other cell organelles including proteins and hence was pure for DNA binding studies [Analytical grade reagents and chemicals were used throughout the experimental procedures. Solvent purification and drying were performed using standard methods. Tetramethyl silane (TMS) was used as an internal reference and each compound and TMS were dissolved, separately, in deuterated solvents to record NMR spectra. For the expression of chemical shift values, the parts per million (ppm) unit was used. For binding studies, salmon sperm DNA was used as received from Sigma-Aldrich. To prepare the stock solution of DNA, deionized water was used. The DNA solution was further diluted to record its absorbance at \u03bb studies . The des1H-NMR of the synthesized compounds, a Bruker 300 MHz NMR spectrometer was used. A 75MHz NMR channel was used to obtain 13C-NMR decoupled spectra of compounds using proton decoupling frequency. For DNA binding titration experiments, a UV-visible spectrophotometer , fluorescence spectrophotometer F-7000 model FL2133-007, and AUTOLAB PGSTAT-302  version 4.9 of GPES software were used. The cell temperature of each instrument was controlled at 37 \u00b0C with the help of a temperature monitoring device. Wavelength scan, emission scan mode, 2400 nm/s scan speed, 0.0 s time delay, 400 V PMT voltage, 0.5 s response time, 5.0 nm each EX-slit and EM slit, 200.0 nm EM start wavelength, and 900 nm EM end wavelength were the instrumental parameters used in the fluorescence spectrophotometer. For cyclic voltammetric investigations, a conventional double-walled cell was used containing 99.9% pure platinum wire with 0.5 mm diameter as the counter electrode, glassy carbon with diameter 0.3 mm as the working electrode, and a saturated calomel (SCE) filled with 3.5 M potassium chloride  as the reference electrode. To obtain a shiny surface of glassy carbon electrode, soft rubbing of the electrode was performed on alumina slurry. It was later washed with distilled water and further sonicated for 30\u201345 s to remove any type of contamination. A digital viscometer bearing model no. AVS 310 (Schott Gerate automated) was used for viscosity measurements.Gallenkamp melting point apparatus was used to determine the melting point via open-end capillary technique. IR analysis was performed on a Bruker FT-IR Bio-Rad-Excalibur spectrometer bearing series mode no. FTS 300 MX. To acquire 1) was treated with benzyl bromide (2) to synthesize the product (3) which was further reacted with thiosemicarbazide (4) to obtain Schiff base product (5). In the last step, Schiff base product was reacted with alpha-halogenated compounds to yield desired compounds 1-benzyl-5-chloro-3-(2-heteroarylhydrazono) indoline-2-ones . The first reaction was carried out in anhydrous DMF under an inert atmosphere with a constant reflux of 12 h, while the second step was accomplished in the presence of dry ethanol and under controlled temperature and reflux of 3 h. The problem of side products formation in the final step was minimal as the reaction was carried out in dry distilled ethanol. The reactions were supervised by aluminum TLC plates having silica gel coated with F254 indicator using mobile phase ethyl acetate:n-hexane (4:6). All synthesized derivatives were analyzed by FT-IR, 1H NMR, and 13C NMR spectroscopic techniques.The synthesis protocol for the preparation of 5-chloroisatin-based heterocycles is shown in oC;Rf = 0.79 ;FT-IR (ATR) in cm\u22121, 3233 (H-N), 3119 , 1738 (C=O), 1671 (C=O), 1549 , 1441 ; 1H-NMR ; in \u03b4 (ppm), 13.34 , 8.63 , 8.10 , 7.67, 7.64 , 7.59\u20137.53 , 7.41\u20137.32 , 7.23 , 5.01 , 13C-NMR  in \u03b4 (ppm), 165.61 , 161.63(coumarin C=O), 152.99 (isatin C=O), 145.08 , 139.77, 139.18, 134.86, 131.50, 129.61, 129.50, 129.04, 128.89, 128.47, 128.13, 127.34, 124.66, 120.42, 119.58, 116.38, 113.85, 110.84, 43.58 ; MS (m/z): 512.07 (100%).Yield = 89%; Light yellow powder; M.P = above 300f = 0.58 ;FT-IR (ATR) in cm\u22121, 3057 , 2905 (C-H SP3 Stretching), 1721 (C=O), 1691 (C=O), 1650 , 1509 ; 1H-NMR ; in \u03b4 (ppm), 8.03, 7.34\u20137.28 , 7.26 , 7.22 , 4.97 , 4.70 , 4.30 , 4.01, 1.31, 13C-NMR  in \u03b4 (ppm), 172.00 , 171.36 , 166.21 (ester C=O), 163.97 , 148.08 , 143.16, 135.03, 132.23, 128.94, 128.63, 128.10, 127.95, 127.37, 118.00, 110.53, 62.38, 44.29, 43.84, 32.80, 14.18; MS (m/z): 453.13 (100%).Yield = 45%;Brownish powder; M.P = 200\u2013201 \u00b0C;Rf = 0.81 ;FT-IR (ATR) in cm\u22121, 3188 (H-N), 3012 , 1691 (C=O), 1508 (C=O), 1455 , 1434 ; 1H-NMR ; in \u03b4 (ppm), 12.88 , 7.81 , 7.67, 7.58 , 7.31 , 7.36\u20137.29 , 7.28\u20137.25 , 6.74 , 4.96 , 13C-NMR  in \u03b4 (ppm), 180.00 , 161.63(coumarin C=O), 160.80 (isatin C=O), 141.33 , 139.07, 139.01, 134.86, 134.47 133.31, 131.50, 131.06, 130.88, 130.09, 129.79, 129.50, 129.04, 128.89, 128.47, 128.13, 127.34, 126.43, 124.66, 121.98, 120.82, 120.42, 119.58, 116.38, 113.85, 63.22, 43.71 ; MS (m/z): 562.09 (100%).Yield = 86%;Light yellow powder; M.P = above 300 \u00b0C; Rf = 0.81 ;FT-IR (ATR) in cm\u22121, 3232 (H-N), 3119 , 2970 (C-H SP3 Stretching), 1738 (C=O), 1671(C=O), 1637 , 1549 ; 1H-NMR ; in \u03b4 (ppm), 13.24 , 7.79 , 7.61, 7.38\u20137.26 , 7.21 , 7.18 , 4.97 , 4.44 , 1.43, 13C-NMR  in \u03b4 (ppm), 166.80, 161.35 , 161.27(isatin C=O), 144.21 , 140.10, 134.73, 130.35, 129.83, 129.00, 128.78, 128.08, 127.32, 121.19, 121.06, 120.44, 110.97, 61.55, 43.54, 14.42; MS (m/z): 440.07 (100%).Yield = 80%;Yellow powder; M.P = 192\u2013193 \u00b0C;RIn this study, all calculations were performed with the Gaussian 09 program using its default criteria . The equDocking studies were performed on the crystal structure of berenil\u2013dodecanucleotide complex at a resolution of 2.5 \u00c5, as obtained from Protein Data Bank (PDB) code 2DBE. Structure energy was minimized by using Amber10 forcefield. The active site of DNA was selected using MOE 2015. The selected binding region contained all the residue of the active site reported in the up-to-date literature. Moreover, the compounds were also prepared by refining the chemical correctness (3D protonation), ionization, and stereo-chemical variation. The energy minimization was achieved at physiological pH of 7.4. Molecular docking of inhibitors within the active site generated maximum 5 poses per ligand where each pose was assigned a score by MOE. The pose having highest score has the most favorable conformation for the ligand. The best pose based on the score was selected.\u22126 M), then DNA (10\u201380 \u00b5M) titrations were carried out with each compound, separately. Prior to each spectral run, the establishment of an equilibrium for compound\u2013DNA adduct was assured by keeping the reaction mixture in a cuvette to rest for at least 4\u20135 min at physiological temperature (37 \u00b0C).UV-visible and fluorescence spectrophotometric investigations were performed for each compound (IST-01\u201304), individually, and then in presence of DNA concentrations at physiological pH (7.4) and temperature 37 \u00b0C) [ \u00b0C 37,4,41,42. TCyclic voltametric (CV) experiments were run under similar conditions as set in photophysical titration experiments. CV responses of the tested compounds before and after DNA titrations were recorded within the potential range of \u22121.5 to +1.5 V at 100 mV/s scan rate. For the diffusion coefficient calculation of each compound and its compound\u2013DNA complex, the scanning of the CV responses was performed in the scan range of 30\u2013150 mV/s, with a difference of 20 mV/s. Oxygen was completely flushed out from the system by bubbling argon gas for 5\u20138 min, while to maintain the cell at 37 \u00b0C, a continuous water circulation within the double wall of the cell was provided by a water-circulating bath at this temperature.o) was measured at a fixed concentration of 10 \u00b5M. In contrast to UV-visible, Flu- and CV experimental work, the titration was carried out by using varying concentrations of each compound, separately, in the DNA solution. Changes in DNA viscosity were measured as (\u03b7). The relative viscosities were calculated from \u03b7o and \u03b7 values and their cube roots were plotted against compound and DNA concentration ratios.DNA viscosity (\u03b7Cell line studies of tested compounds IST-01\u201304) were carried out on three cancerous cell lines, namely cervical cancer (HeLa), breast cancer (MCF-7), and liver cancer (HuH-7), and one normal human embryonic kidney cell line (HEK-293). The percentage cytotoxicity of all compounds for cancerous as well as healthy cell lines were evaluated by dose-dependent MTT analysis  were car,32. The bK, \u0394G), indicated that among all compounds, IST-02 and IST-04 have greater and more spontaneous binding affinity for DNA. Binding site size (n) calculations from Flu- and CV data depicted more sites\u2019 availability for interactions and confirmed a mixed type of interactions, as predicted in docking analysis. DNA viscosity measurements in the presence of tested compounds further authorized our findings of mixed binding mode, as assured from theoretical and experimental DNA binding studies. In vitro cell line studies of the compounds revealed that IST-02 and IST-04 have better and selective anticancer potential on hepatocellular carcinoma cells (HuH-7) compared to normal cell lines. Furthermore, these compounds have lower IC50 values compared to previously reported derivatives of the same class, indicating their high potency as potential anticancer drug candidates. All findings were in good agreement with each other and thus merit further in vivo testing of these compounds. The overall DNA binding and cytotoxicity results were found to be more significant for the compound IST-02.Four new isatin derivatives, IST-01\u201304, have been synthesized and characterized for their structures by various spectroscopic techniques and further examined for DNA binding and cytotoxicity activities for their anticancer potential candidacy. Results obtained from molecular docking and DFT exhibited the receptive nature of IST-02 and IST-04 and their relatively greater binding nature than IST-01 and IST-03. The computed electronic parameters predicted higher charge transfer and hence reactivity for IST-02 and IST-04 due to smaller HOMO\u2013LUMO gap. Theoretical findings were further confirmed by experimental DNA binding investigations by spectroscopies  and cyclic voltammetry (CV) under physiological pH of 7.4 and at 37 \u00b0C. The trends in spectral and voltametric responses, as well as evaluated binding parameters ("}
+{"text": "Quality of Life (QoL) and its determinants are significant in all stages of life, including pregnancy. The physical and emotional changes during pregnancy affect the QoL of pregnant women, affecting both maternal and infant health. Hence, assessing the QoL of pregnant women is gaining interest in literature. We, therefore, aimed to describe the QoL of pregnant women during physiological pregnancy and to identify its associated predictors in women attending a public healthcare institute of Quetta city, Pakistan.p < 0.05 was taken significantly.A cross-sectional study was conducted at the Obstetrics and Gynecology Department of Sandeman Provincial Hospital Quetta city, Pakistan. The respondents were asked to answer the Urdu (lingua franca of Pakistan) version of the Quality of Life Questionnaire for Physiological Pregnancy. Data were coded and analyzed by SPPS v 21. The Kolmogorov\u2013Smirnov test was used to establish normality of the data and non-parametric tests were used accordingly. Quality of Life was assessed as proposed by the developers. The Chi-square test was used to identify significant associations and linear regression was used to identify the predictors of QoL. For all analyses, p = 0.006, \u03b2 = 2.157). On the other hand, trimester was reported as a negative predictor of QoL .Four hundred and three pregnant women participated in the study with a response rate of 98%. The mean QoL score was 19.85 \u00b1 4.89 indicating very good QoL in the current cohort. The Chi-Square analysis reported a significant association between age, education, occupation, income, marital status, and trimester. Education was reported as a positive predictor for QoL (Improving the QoL among pregnant women requires better identification of their difficulties and guidance. The current study highlighted educational status and trimester as the predictors of QoL in pregnant women. Health care professionals and policymakers should consider the identified factors while designing therapeutic plans and interventions for pregnant women. Pregnancy and transition to motherhood is a wonderful experience. For a woman, where pregnancy brings self-fulfillment and indulgence, the fear of the upcoming events in life are also expected . As the In today's world, the reproductive rights of women are assured in different public policies , 6. For the position and perception of individuals in life, in the context of value systems and culture they live in with respect to their expectations, goals, concerns and standards\u201d , Pakistan. Sandeman Provincial Hospital was established in 1939 and is centrally located in the city. Being a public healthcare teaching institute, SPHQ is the facility of choice for most of the population. It has a well-established Obstetrics and Gynecology department with daily consultation of 500 patients per day .The sample size was calculated by the formula proposed by Daniel . By keepPregnant women attending the Obstetrics and Gynecology Department of SPHQ were approached by the first author. The respondents were informed about the nature of the research and their rights to confidentiality. Respondents not willing to participate, having mental disorders, and immigrants from other countries were excluded from the study.As discussed above, the only specific instrument available for the assessment of QoL in physiological pregnancy is the Quality of Life Questionnaire for Physiological Pregnancy (QOL-GRAV). The tool was developed by Vachkove et al., and the authors concluded that QOL-GRAV can sensitively and accurately capture the experiences of pregnant women that significantly affect their QoL . For assThe Institutional Review Board of Faculty of Pharmacy and Health Sciences, University of Balochistan, Quetta approved the study [UoB/Reg/67]. In addition, written consent was also taken from the respondents before the data collection. The participants and attendants/care givers were informed about their rights of participation in the study and the right of withdrawal at any time without compromising their consultation at the healthcare institute.p < 0.05 was taken significantly.The data were coded and entered into SPPS v 21 for formal analysis. The Kolmogorov\u2013Smirnov test was used to establish the normality of the data and non-parametric tests were used accordingly. Frequencies and percentages were used to explain the demographic variables. Quality of Life was measured as proposed by the developers . The ChiFour hundred and three pregnant women participated in the study with a response rate of 98%, whereas 11 participants were dropped out due to the reason that 5 questionnaires had duplicate responses and 6 questionnaires were incomplete. The description of socio-demographic variables and frequency distribution of the respondents are summarized in The QOL-GRAV-U is a 9-item questionnaire where three items out of nine  are reverse coded and are presented in a 5-point Likert format. The Likert rating of 1 represents the best and 5 the worst state of QoL. Lower mean scores reflect high QoL and vice versa. According to the developers, QoL is measured as excellent [mean score of 9\u201318], very good [mean score of 19\u201327 points], good [mean score of 28\u201336 points], and not very good [man score of 37\u201345 points]. In the current study, the mean QoL score was 19.85 \u00b1 4.89 indicating very good QoL in the current cohort .F = 20.82, p < 0.001]. Furthermore, the predictors managed to explain 55.5% of the variance (R2 = 0.55). Education was reported as a positive predictor for QoL  indicating that for every 1 unit increase in education, there is a possibility that QoL will increase by 2.157 times. On the other hand, trimester was reported as a negative predictor of QoL  indicating that as trimester increases, QoL decreases by 1.123 as shown in A simple linear regression was carried out to identify the predictors of QoL in the current cohort. The variables that were significantly associated with QoL were entered into the regression model. The scatter plot showed that there was moderate to strong positive linear relationships between the variables which was confirmed with acceptable Pearson's correlation coefficient (>0.40). Results of the multiple linear regression indicated that there was a collective significant effect between the dependent and independent variables [Over the past decades, the assessment of QoL in both clinical and non-clinical settings have gained immense significance. Accordingly, different assessment tools were developed to measure psychological, physical, and social QoL among patients and the general population. However, in comparison to other conditions maternal QoL is least studied in the literature. A possible reason is attributed to the lack of established measures while assessing QoL in pregnant women . As a reOur study involved a cohort of 403 pregnant whereby 59% of the respondents were in the age range of 25\u201335 years. Other studies conducted in Brazil and China also highlighted the similar age group i.e., 26 \u00b1 6.4 and 27.3 \u00b1 4.0 years, respectively , 25. TheThe mean QoL scores of the current study respondents were 19.85 \u00b1 4.89 which indicated very good QoL. Our results are parallel to what was reported by studies conducted in Serbia and Slovenia , 29. TheOur study managed to identify various significant relationships between demographics and QoL . The pubA simple linear regression was carried out to identify the predictors of QoL. The variables that were significantly associated with QoL were entered into the regression model. Education was reported as a positive predictor for QoL indicating that for every 1 unit increase in education, QoL improves by 2.157 times. In connection to our findings, a study conducted in Thailand on older pregnant women concluded that education had a direct link with QoL, and women with higher educational status had better QoL . A studyOn the other hand, trimester was reported as a negative predictor of QoL indicating that as trimester increases, QoL decreases by 1.123 times. Zarei et al. also reported similar findings and highlighted gestational age as a negative predictive factor for maternal QoL . Zahedi Summarizing our results, QoL was very good in most of our respondents. The findings of this study will assist health care professionals in establishing interaction and resolving associated problems that affect QoL during pregnancy. Pregnant women are influenced by various bio-psycho-social factors therefore, it is essential to have a care plan that fulfills the actual needs of this group during the gestational period.Improving the QoL among pregnant women requires better identification of their difficulties and guidance. Therefore, frequent assessment of QoL, including its dimensions, of pregnant women can clarify women's health status. In this context, results of this study identified some predictors of QoL that can provide insights for better understanding of factors affecting QoL. Because educational status and trimester appeared as predictors of QoL, healthcare professionals should consider the identified factors while designing therapeutic plans or planned interventions for pregnant women. Despite the positive results, it is crucial to screen the Quality of Life of pregnant women and to pay special care to pregnant women who have a lower Quality of Life.Relationship between pregnancy and woman's QoL is least reported in the literature. Therefore, the current study is pioneer study from Pakistan.The study was conducted in the Quetta city of Pakistan, which is not representative of the whole country. A comprehensive study is recommended throughout the country to generalize the result. We also recommend that pregnant women visiting private healthcare institutes should be added into the study to underline possible differences of QoL between public and private healthcare facilities.The study was single cantered, consequently targeting other public and private healthcare institutes may bring diversity of findings. Moreover, assessing QOL in specific trimesters can also bring interesting outcomes. Therefore, a study on different healthcare settings with individualized trimesters is hereby recommended.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.The studies involving human participants were reviewed and approved by Faculty of Pharmacy & Health Sciences. The patients/participants provided their written informed consent to participate in this study.RI, MS, NB, and AS conceptualized and designed the study. AR, SR, FB, and SH collected the data while ZH, FS, and NA analyzed and interpreted the data. The study was supervised by FS, QI, and AHK. All authors have met the criteria for authorship and had a role in preparing the manuscript and also, approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Women of Refugee Background (WoRB) have been repeatedly identified as an extremely vulnerable population. Within an Australian context, WoRB are increasingly resettled to non-metropolitan locations, otherwise known as regional locations. Despite this, to date, no research has focused on the lived experience and challenges associated with the resettlement of WoRB to regional contexts. This study aimed to address this gap in the literature by investigating the resettlement experience of WoRB resettled in Tasmania\u2014a state in Australia classified as a rural and regional location. Qualitative interviews were conducted with a group of 21 individuals (nine WoRB and 12 service providers). Thematic analysis identified four overarching themes\u2014Communication Barriers and Lack of Fluency in English, Challenges Accessing Everyday Basic Needs, Loss of Connection to Culture of Origin and Inability to Access Mainstream Mental Health Services for Help. Participants also highlighted a number of unique gender-related vulnerabilities experienced during resettlement, which were exacerbated in regional locations due to health services being overstretched and under-resourced. Results of the current study are discussed in regard to policy and practical implications, taking into consideration the unique vulnerabilities experienced by WoRB, which, to date, are often overlooked. In 2019, the United Nations estimated that 79.5 million individuals had been forcibly displaced globally, with approximately 1.4 million individuals of refugee background in urgent need of resettlement . AlthougAustralia has a long history of accepting refugee and humanitarian entrants, being formally involved in the United Nations High Commissioner for Refugees (UNHCR) resettlement program since 1977 . HoweverTraditionally, the vast majority of individuals of refugee background resettled in Australia are placed in major metropolitan cities, where services are more readily available and accessible ,11. HoweThe emerging body of research focusing on rural and regional resettlement in Australia indicates that individuals of refugee background resettled in regional locations are not only at greater risk of experiencing mental health symptomology than the general population ,15, but Mainstream services in rural and regional Australia are experiencing a critical shortage of skilled health professionals , with heOne particularly vulnerable group that is increasingly represented in regional resettlement in Australia is Women of Refugee Background (WoRB) . WoRB faThe current study was conducted in Tasmania, an island south of mainland Australia, which has a population of 509,965 , with ruResearch involving individuals of refugee backgrounds poses a number of ethical challenges . In partA qualitative methodological framework was utilised, consisting of individual semi-structured interviews guided by a set of open-ended questions .Purposive sampling techniques were employed in the initial stages, with participants being consciously selected on the basis of their capacity to contribute to the research and comprised of both individuals who identified as WoRB, as well as volunteers and service providers who support WoRB. Service providers and volunteers were invited to participate in the current study as they play a key role in supporting WoRB during the early stages of resettlement, and influence factors associated psychological well-being, including meeting daily living needs and gaining awareness of, and access to, support services , thus thSubsequent participants were identified via snowball sampling techniques. All participants needed to be over the age of 18 and speak a level of conversational English which allowed the interview to be completed in English. The location and time of the interview were determined by a conversation occurring via telephone. Interviews were conducted in sites of service delivery, participant homes and private study rooms at public libraries, with only the participant and researcher present. WoRB who agreed to participate in this study were offered a $20 gift voucher as compensation for their time. All interviews were conducted between May 2019 and August 2020. Data collection was paused between February 2020 and June 2020 due to the COVID-19 pandemic. Data collection was re-commenced in July 2020 following ethics approval. At the time of recommencement, Tasmania had not had a community acquired case of COVID-19 for 40 days, and borders were closed to other states and territories in Australia as well as international arrivals, with hotel quarantine being mandatory for all people entering the state.A total of 21 individuals participated in the interviews\u2014nine WoRB and 12 service providers . Further participant demographic information was not collected, and hence is not reported in the current study. This is to ensure confidentiality and anonymity of participants and an ethical requirement, due to the regional location, and the participants having unique characteristics , which increases the likelihood that they would be more identifiable to local stakeholders than members of the general population.All interviews were conducted by the first author, a female clinical psychologist who had completed a two-year, Masters\u2019 level degree in clinical psychology and two additional years of supervised practice by a Psychology Board of Australia-approved supervisor. In addition to this, the first author has over 10 years of experience working with vulnerable and culturally diverse populations locally and internationally.Interviews ranged from 45 to 75 min in length, and were audio recorded. Each participant was interviewed once, and individually, resulting in a total of 21 interviews being conducted. No participants were known to the researchers prior to meeting, and time was spent developing rapport prior to commencing the research interview. The aims and goals of this study were explained to all participants, who were also provided with a plain-language information sheet prior to giving informed consent.Audio-recordings from interviews were transcribed verbatim and interviewees were provided the opportunity to review the transcript for comment and/or correction.Data saturation, the point where no new interview themes emerged, determined the final number of interviews required for this study. To identify when saturation occurred, data were continuously analysed throughout the data collection period using Nivo 12 software. An audit trail was kept throughout the research process to aid the researcher in identifying when data saturation was reached. Within the current study, by interview 17, the audit trail entries illustrated that the list of new themes began to decline, until there were no new themes identified from the 21st interview, hence this was deemed the last interview.As the current research focused on reporting the experiences and reality of participants, transcripts were analysed utilising the Braun and Clarke  six-stepFour overarching themes were identified within the data\u2014Communication Barriers and Lack of Fluency in English, Challenges Accessing Everyday Basic Needs, Loss of Connection to Culture of Origin and Inability to Access Mainstream Mental Health Services for Help.Overall, communication barriers and lack of fluency in English were identified as a significant acute and chronic stressor during resettlement for WoRB which impacted their ability to express their needs and form relationships in their new communities. WoRB also face additional barriers when in terms of attending language classes, including taking on the primary caregiving role for their children, and never participating in an educational setting before, making the experience of learning a new language in a novel environment incredibly stressful. In addition to this, WoRB often arrived in the regional locations with such a low level of English that the allocated government-funded English classes were insufficient. Language and communication derived from the socio-cultural challenges of resettlement create additional challenges for meeting everyday life and livelihood needs.The WoRB respondents emphasised the challenges and stressors associated with language, and in particular the capacity to communicate their needs in the English language, which was highlighted as a vital factor in helping them settle.I think your ability to go out and learn English is a huge factor that helps people settle in because then you\u2019re able to communicate with people it\u2019s a lot easier, and you\u2019re able to fit in a lot easier\u2019\u2018\u2014WoRB 1WoRB identified difficulty in communicating not only practical needs but also affective experiences and differing social and cultural conventions as a significant stressor, which had ongoing implications in regard to their mental health during resettlement, and limited their capacity to express their needs.It was hard, and maybe it was because of the language, and the language differences, we were not able to express how we felt, and we couldn\u2019t tell people what we wanted\u2019\u2018\u2014WoRB 6It is very difficult, even though we can feel inside in our mind and heart, if we don\u2019t have the language, if we don\u2019t know what to say and what to do, it\u2019s very very hard\u2026 and it\u2019s kinda a mental pressure that you don\u2019t get to express what you wanted to say to people\u2026\u2019\u2018\u2014WoRB 7Because most of our people are, how do you say, not illiterate, but they don\u2019t know how to speak or read English, so they find it hard \u2026 and that can also make it very stressful and they don\u2019t know how to speak and how to talk to the teachers about their children\u2019s progress that is happening in the school. So that can also make them feel more stressed\u2019\u2018\u2014WoRB 9Having limited English proficiency was also expressed as having ongoing impacts in other areas of WoRB lives, including the ability to gain employment.I think the language is the most common issue that most of our people have experienced and also after going to school and getting some language skills, I think the job is also one of the biggest issues from within our community. Because even though they can actually perform the task, they can\u2019t express that. So it all comes down to language. So even though they can perform the skill, and do all the tasks like other people do, the communication is making them behind and prevents them from getting a job\u2019\u2018\u2014WoRB 6I know a lot of the women probably don\u2019t feel capable of being able to find work due their language barriers\u2019\u2018\u2014Service Provider 2In regard to learning English during resettlement, WoRB expressed having additional barriers to overcome, due to childcare obligations, and limited exposure to being in an educational context prior to resettlement.They need help, but especially the women who have many kids at home\u2026 the little little kids \u2026 and they really need to have help with their English\u2019\u2018\u2014WoRB 5For me it was when I delivered my baby, for me it was hard because that kept me busy at home, yes, but for another family, they don\u2019t have enough education, and they don\u2019t know things like the alphabet and do not have even very simple English, so for them it is very hard\u2019\u2018\u2014WoRB 6I think learning English is one of the big ones for a lot of the women I work with; especially if they aren\u2019t used to putting their kids in childcare. Also, I think, for some of the women I know, they\u2019re not used to, sort of, speaking up and being assertive, so the whole classroom experience is quite traumatising for them. Like, they feel that people might be judging them, and so, I\u2019ve worked with women who just refuse to go to English classes, because they, they just don\u2019t feel safe in that classroom, having to speak up in front of others; and also [they] struggle, you know, to leave their children in childcare with a stranger while they go to English classes\u2019\u2018\u2014Service Provider 5There are often cultural barriers in place so that refugee women aren\u2019t encouraged to attend English conversation classes to improve their English. Low English proficiency comes along with isolation as it can be difficult therefore to communicate with services such as Centrelink, Medicare, the bank, and navigate the health system, public transport, school enrolments, and housing\u2019\u2018\u2014Service Provider 3Despite language being identified as one of the biggest challenges during resettlement in regional areas of Australia, particularly for WoRB due to additional barriers, service providers expressed that the current services available are not enough to address the need.We\u2019ve got a lot of really low-level English women that have exhausted all their formal English hours, and they\u2019re still really low-level of English\u2026 but they\u2019re not even eligible for our programs anymore\u2019\u2018\u2014Service Provider 12Overall, accessing basic needs, in particular accommodation, was identified as a stressor during resettlement for WoRB. WoRB also expressed that they experienced significant financial stress due to dependence on government support and difficulty finding additional income through paid employment. This in turn caused significant distress and ongoing instability in WoRB daily lives. Due to this difficulty in accessing housing and financial security, many WoRB identified that members of their own community of origin were leaving regional areas, in hope of greater stability and support.The WoRB interviewees emphasised that a key stressor in resettlement was performing basic everyday tasks, and having access to essential everyday needs and social connection.I needed help just getting used to doing basic things, because I would feel anxious because it\u2019s a new place, and so you know, if someone had been there to, like, take me around, show me shops, make me feel a little more comfortable, that would have been great\u2019\u2018\u2014WoRB 1In particular, one of the core stressors identified by WoRB was accessing stable accommodation, with many of them waiting for an allocation to an appropriate house and spending prolonged periods in crisis and temporary accommodation.Living in temporary accommodations for 12 months at the beginning was difficult. The uncertainty was very difficult\u2019\u2018\u2014WoRB 4The lack of stability was also emphasised as a significant stressor by service providers supporting WoRB during resettlement.Our biggest challenge from a counselling perspective is the myriad of needs that come into the counselling space and they are, dare I say, in Maslow\u2019s Hierarchy of Needs\u2014it\u2019s housing, it\u2019s shelter, it\u2019s food\u2019\u2018\u2014Service Provider 1They can\u2019t even stabilise\u2014stability being a big one and whether that\u2019s accommodation, financial\u2019\u2018\u2014Service Provider 3If mums you know, a single mum, she\u2019s overwhelmed, -the whole family is basically on a crash course towards being homeless because of the stress of housing\u2019\u2018\u2014Service Provider 12WoRB faced particular difficulties accessing basic everyday needs due to financial stress and ongoing dependence on government support due to limited job opportunities.In Tasmania, there are not many jobs and you have to pay a lot of money\u2019\u2018\u2014WoRB 3You know a lot of the women probably don\u2019t feel capable of being able to find work due their language barriers or confidence or just being mums and having kids to look after. Ah not having a driving licence all of those things. So there\u2019s this I guess, worry, constant worry that they\u2019re having to live off such a low income and really dependant on their Centrelink, and that financial stress which is just sitting in the back of their heads all the time knowing that there\u2019s so much to do with that little amount of money\u2019\u2018\u2014Service Provider 2A lot of the women who came here on the Women At Risk visa, single mums with five or six children, I mean, trying to get a rental here, is nearly impossible. So, the stress of that \u2026 I mean, I think every day, I must be talking to someone distressed; housing is probably one of the biggest stresses for a lot of people at the moment\u2019\u2018\u2014Service Provider 5This inability to access basic needs, such as housing and employment, resulted in WoRB relocating from regional areas to metropolitan locations.Many of them are moving because they cannot find a job\u2019\u2018\u2014WoRB 5Many of my friends, they say, I\u2019m not supported. I\u2019m not feel\u2014Like this isn\u2019t the right environment for me\u2019 and then they move to somewhere else\u2019\u2018\u2014WoRB 8A lot of people are moving interstate because there\u2019s a lot more flattering options for employment and housing\u2019\u2018\u2014Service Provider 4Overall, WoRB identified that they experienced stressors during resettlement associated with a loss of connection to their culture of origin. WoRB expressed particular stress and concerns associated with their children losing a connection with their culture of origin, as their children developed an increase in connection to the Australian culture. Particular gender-related stressors were also identified for WoRB, due to the resettlement culture providing them with alternative options surrounding social, employment and family-based roles, and relationship options, which were traditionally dictated by their gender within their country of origin and deviated from their traditional cultural norms.WoRB expressed the impact that a loss of connection to their culture of origin can have during resettlement, and in particular the stress associated with their children losing a connection with their culture of origin.For single women who are raising their kids on their own, who are on a Women at Risk visa, there is always a lot of stress and anxiety about them not wanting their kids to lose connection with who they are or where they\u2019ve come from. And yeah it is hard for them to understand that their kids are growing up in a Western sort of culture now\u2019\u2018\u2014WoRB 2When the kids grow up and become teenager, they don\u2019t like to come back to their religion and culture, and they thinking, this is for past memory and they are like \u2018mum, mum, don\u2019t think about past memory\u2019, and I tell them, no, you must listen\u2019\u2018\u2014WoRB 5Kids forget the home language\u2026 for example, my daughter ask me what these things in [language removed], and I was like \u2018My god, you forget everything\u2019\u2018\u2014WoRB 9The concern around children losing a connection with their culture of origin was highlighted as creating intergenerational tension, and significant stressors within the family unit.It has big impacts on family dynamics, particularly for a lot of the single mums. Women [on] at risk visas have been in particularly tough situations, often they have, like quite a few children, some of them might be older boys, like older sons and then they\u2019re struggling as well with how to settle in a new country, how to support their family, the traditional roles, maybe having to be the man of the house and maybe that is not quite working in a new country where there might be different values\u2019\u2018\u2014Service Provider 4I think there\u2019s a lot of family conflict, I think creates a lot of mental distress for many of the women I work with, especially if they\u2019re single parents. So it\u2019s very challenging, the roles have changed, and if their adolescent kids, become more, you know, involved in Australian culture; so I\u2019ve seen a lot of distressed and upset women because it\u2019s just so challenging for them to manage that role, and in a new country\u2019\u2018\u2014Service Provider 5These intergenerational tensions within the family unit were also emphasised as being particularly pertinent for younger WoRB, as the resettlement culture often provided them greater opportunity for development and growth than their culture of origin, which deviated from traditional expectation surrounding gender-based roles and marriage.The young people want to start to make their own choices, and have a say in who they get involved with and get married, but parents still align with those older traditions, and in accordance of keeping blood, you know, within the family, and so yeah, so I feel as though, that \u2026 what do we call it? Cultural adaptation, you know, when learning \u2026 coming into a new culture, so I think that that\u2019s always that stress\u2019\u2018\u2014Service Provider 8These opportunities which are afforded to younger WoRB can also cause a deeper level of conflict in older WoRB as they feel torn between their daughters following in their footsteps, and aligning with traditions in their culture of origin, and having access to more opportunities in the host country.It is interesting, seeing the mothers, you know, coming to terms with that stuff, too, because the only options for them, and what was always expected of them is, no, you marry whoever you\u2019ve been chosen to marry; that\u2019s your responsibility, that\u2019s just what you need to do, to honour your family, and for them, it was like, well, there wasn\u2019t opportunities for me to go and get a career, or study, and for them to now come to terms with that, whilst them being really keen for their kids to get [an] education. It\u2019s a tricky, tricky space\u2019\u2018\u2014Service Provider 12Overall, accessing services for mental health support during resettlement was highlighted as a stressor for WoRB. It was identified that support offered via mainstream services was insufficient for WoRB due to their level of need. Mainstream services were also identified as being difficult to access due to services having limited training in working in a culturally sensitive framework. This resulted in services rejecting a referral on the basis of the women being identified as being from a refugee background, and not using interpreters, resulting in children acting as interpreters in situations which can result in vicarious trauma for the child , or self-censorship by the parent. The ability for mainstream services to provide appropriate services to WoRB resettled in the regional location was further compounded by systematic issues, including the mental health service in general being pushed to the extreme in the regional location, due to being general under-resourced and under-funded. This in turn resulted in bi-cultural peers workers supporting WoRB with mental distress, which they felt underprepared for.WoRB and service providers emphasised how stress in resettlement was exacerbated due to the difficulty associated with accessing mainstream services in Tasmania for support.Mainstream services here try very hard, and that\u2019s something to be appreciated, but I feel like the bigger problems that services face here are structural, so limitations in funding. So, like, for me, when I try to access a mental health service, I only have six sessions with a service\u2026 like, with a counsellor, and once those six sessions are over, then I\u2019m expected to [pay] out of pocket. And, six sessions is not enough for someone to address, like, all the trauma that they have experienced up to that point, if they are a refugee, or a migrant\u2019\u2018\u2014WoRB 1It\u2019s all reactive stuff that we\u2019re dealing with. Mainstream services really need to be skilled up. There\u2019s been some really, really full-on situations in the last couple of years, and I\u2019ve tried to refer people on. And as soon as they hear multicultural background, or a refugee woman, or someone who\u2019s English is not great, they very quickly hand them back to me\u2019\u2018\u2014Service Provider 8I had to help a young person go into sheltered accommodation, and I was dealing with the services here and, trying to refer her on, it kept getting sent back to me. So, you know that was a real learning experience\u2019\u2018\u2014Service Provider 10The difficulty in accessing mainstream services was highlighted in the interviews as stemming from larger systemic issues, including mental health services in regional areas being generally under resourced and pushed to extremes.We\u2019ve got a pretty broken Mental Health system anyway, so, it\u2019s not necessarily unique to the refugee cohort, so, how do they rub up against it? like it\u2019s a system under so much stress and turnover and whatever. I would say that is a really high-risk environment for our [refugee] cohort\u2019\u2018\u2014Service Provider 12Even though they\u2019re funded by state and federal governments, there\u2019s a big barrier to accessing mental health supports because a lot of services just say, well, we don\u2019t have a budget; and I\u2019ll say, well you should have one because you\u2019re funded by the government, but it\u2019s not a priority to look after culturally diverse communities\u2019\u2018\u2014Service Provider 5The community services are so stretched they don\u2019t engage. They\u2019ll do a certain amount of effort and then they\u2019ll close. But there\u2019s people with like cultural, language and kind of conceptual understanding barriers, so it\u2019s kind of predictable what happens really\u2013they don\u2019t get the service\u2019\u2018\u2014Service Provider 1Mainstream services were also identified by participants as having limited training and funding in working with refugee populations, in particular having limited understanding surrounding working within a culturally sensitive framework, including providing WoRB access to interpreters.One of the biggest complaints we get from community members is that staff either don\u2019t use an interpreter, or insist on them using family, or they don\u2019t know how to work properly with an interpreter\u2019\u2018\u2014Service Provider 5I just think mental health services here, generally, aren\u2019t going so well: we\u2019re at a bit of a crisis as well, so \u2026 and, one of the biggest things is if you have a mental health issue, and you present to [service name removed], they will force your children or family members to interpret for you. They will not get you a professional, unbiased, interpreter to interpret for you\u2019\u2018\u2014Service Provider 10we\u2019ve had cases of a suicidal mother, and her son being forced to interpret her mental health crisis. And I just think that\u2019s criminal. So, the damage that services are doing by not using interpreters is incredible\u2019\u2018\u2014Service Provider 12that\u2019s a really big issue here in Tasmania because we find a lot of the non-government organisations, you know, governments are outsourcing things, um, often they don\u2019t have a budget for interpreters\u2019\u2018\u2014Service Provider 6The inability to access mainstream services, and the lack appropriate training for workers to work in a culturally sensitive framework to support diverse groups also had significant ongoing ramifications for WoRB mental health.As a refugee woman, myself, I guess the impact of mental health is epic. It\u2019s huge. I guess I can mostly speak from my own experience, when I arrived, I wasn\u2019t eligible for the settlement services\u2026 and I fell through the system\u2019\u2018\u2014WoRB 2Not being able to access mainstream mental health services, or experiencing culturally inappropriate responses resulted WoRB turning to bi-cultural and peer workers to support them with their mental distress.A bi-cultural worker plays a huge role in making the individual feel more comfortable. I have seen people expressing their issues freely and openly to a bi-cultural worker then the other people, so I have experiencing that one aswell\u2019\u2018\u2014WoRB 8having someone from the community can speak the same language as our people can make them more comfortable in opening up about their feelings and all that\u2019\u2018\u2014WoRB 6However, this came with additional challenges for bi-cultural peer workers, as they were often not trained mental health professionals.Basically, I have not been given the training that can help us [with mental health]. So I think gaining more training in that area will play a huge role in helping bi-cultural workers think of a way that will help people from the community. I think more training should be provided\u2019\u2018\u2014WoRB 7To our knowledge, this is the first study to investigate resettlement stressors in WoRB resettled in a regional location of Australia , which aConsistent with research conducted by Watkins, et al. , which iWoRB and service providers identified how the lack of access to basic needs caused significant stress during resettlement in regional areas. In particular, WoRB experienced difficulty accessing stable accommodation, experienced financial strain, and experienced difficulty finding employment, which resulted in ongoing and chronic instability. Gaining successful and stable employment has been identified as a significant indictor of successful resettlement in refugee populations . ResearcThe ongoing difficulties in accessing basic needs was also identified by service providers supporting WoRB during resettlement. This included stress related to accessing food, accommodation and employment being identified as key factors for WoRB seeking services and mental health support. These findings build on previous research which has highlighted that individuals of refugee background seek support for social and practical needs over other needs such as treatment for mental health through talk therapies ,42,43. TWoRB identified the impact that losing a connection with their culture of origin had during resettlement. The complex process of cultural identity during the migration process has been extensively researched, stemming from the seminal work of Berry . Losing Within the current study, the stress associated with a loss of connection with their culture of origin was derived from WoRB\u2019s concerns surrounding their children losing a connection with their culture of origin as they acculturated to the Australian culture. Children\u2019s agency has been identified as having significant impacts on well-being during resettlement in refugee families , with thWoRB in the current study further identified that novel opportunities, including education, employment, family and marriage options, available to their gender within the country of resettlement created stress, and often tension, within the family unit. The stressors associated with divergence from traditional role expectations for daughters and wives in regard to family and marriage roles has been identified as negatively influencing WoRB experiences of depression and poor self-esteem during resettlement , as wellFinally, consistent with research by Ziersch, Miller, Baak and Mwanri , the curOn the service level, WoRB struggled to access mainstream services for support due to mainstream services having a limited understanding of working within a culturally sensitive framework This finding is consistent with previous research that has identified that individuals of refugee background have difficulty accessing mainstream mental health services due to services having limited cultural competency and responsiveness ,41,57, wThe current study also highlighted the significant ramifications that having a limited understanding of working within a culturally sensitive framework can have not only on WoRB, but also on their children. In particular, participants highlighted how often children were used as interpreters for their mothers, particularly in crisis or emergency situations. This is consistent with research by Smith, Hoang, Reynish, McLeod, Hannah, Auckland, Slewa-Younan and Mond , which iThe current study has several limitations, some of which are inevitable when researching minority and diverse populations. Firstly, all WoRB who participated in the current study were required to have an adequate level of conversational English, as all interviews were conducted in English. This limited the opportunity for recently resettled WoRB to participate in the interviews, as they are less likely to have developed strong enough English language skills to participate in the interview. This reduces the likelihood that the current study captured information representative of the entire resettlement process. Future research should aim to address this through the use of longitudinal designs, which would assist in determining whether stressors occurring during the resettlement process change as a function of time and phase of adaptation. The current study also used convenience sampling, which may detract from the representativeness of the sample, and therefore the overall generalisability of the findings.The current study is the first to investigate resettlement stressors in WoRB resettled in a regional location of Australia and addresses a significant gap in literature by providing new insights into the specific gendered challenges associated with regional resettlement . This re"}
+{"text": "This study aimed to address a significant gap in the literature by investigating how Women of Refugee Background (WoRB) conceptualise resilience and identify factors that WoRB endorse as contributing to their wellbeing and coping during resettlement. Qualitative interviews were conducted with a group of 21 individuals (nine WoRB and 12 service providers). Thematic analysis identified that WoRB struggled to define resilience, with endorsed factors not fitting with current hegemonic Western understandings and theoretical understandings of resilience. The findings also highlighted how religious practice, finding a community and having a sense of meaning and contribution in their daily life were significant coping and wellbeing factors during resettlement, however, were difficult to access in regional resettlement locations. Results of the current study are discussed regarding theoretical and practical implications, taking into consideration the unique vulnerabilities experienced by WoRB resettled in regional locations of Australia. Women of Refugee Background (WoRB) are continually identified as a highly vulnerable refugee population . ThroughApplications for the \u2018Women at Risk\u2019 visa have risen significantly over the past decade. Within an Australian context, there has been a substantial increase in the resettlement of WoRB. In the Australian 2019\u20132020 humanitarian program, 48.8% of visas were allocated to WoRB, with 20.4% of these being in the \u2018Women at Risk\u2019 category . This inThe majority of research focusing on WoRB mental health needs has been conducted through a psychopathology lens, focusing on diagnosable mental health conditions, symptomology, stressors and their determinates which increase the likelihood of WoRB experiencing mental distress during resettlement . This reGaining a deeper understanding of wellbeing and positive adaptation in WoRB has been deemed an important area of future enquiry as it not only holds the potential to depathologise the mental health narratives of WoRB during resettlement  but alsoResilience is a term that is associated with ongoing debate within psychological literature surrounding its definition and generalisability to cross-cultural populations . While tA recent review  identifiTherefore, the current study aimed to explore the concept of, and factors contributing to, resilience, wellbeing and coping in WoRB resettled in a regional location of Australia. In doing so, this work holds the potential to inform future policy and practices that can more realistically seek to increase the likelihood of positive adaption and enhanced and sustained wellbeing in WoRB during resettlement and beyond. The two main questions explored in the current study are as: (1) how do WoRB define and understand resilience? and (2) what factors contribute to the wellbeing and coping of WoRB resettled in regional Australia?Research in Western resettlement countries involving refugee populations poses several ethical challenges . InformeEthical challenges in the current study were also minimised by the selection criterion: being able to speak English at a level where the interview could be conducted in English and providing the participants the opportunity to give either written consent, oral consent or both . The application of these selection criteria aimed to increase the likelihood that the WoRB participating understood the purposes of the study, the associated risks and benefits, and thus allowing them to provide informed consent. Ethics approval for the current study was obtained through the Tasmanian Social Sciences Human Research Ethics Network  and Human Research Ethics Committee at Charles Darwin University .The current study used a qualitative methodological framework consisting of individual semi-structured interviews guided by a set of open-ended questions . All parAs discussed below in the results section, \u2018resilience\u2019 was a term that many WoRB participating in the current study struggled to define or understand. Due to this, time was spent exploring similar terms which could be used as a substitute before the interview starting. All participants identified the terms \u2018coping\u2019 and \u2018wellbeing\u2019 as terms that they understood. As such, these terms were substituted for the term \u2018resilience\u2019 for WoRB who identified that they did not know what the term \u2018resilience\u2019 meant.via snowball sampling techniques. Participants were consciously selected based on their capacity to contribute to the goals of the research and included both individuals who identified as WoRB, as well as volunteers and service providers who provide support to WoRB. Service providers and volunteers were invited to participate as they play a key role in supporting WoRB during the initial stages of resettlement and influence factors associated with psychological wellbeing . Further, participant demographic information was not collected, and hence not reported. This was to ensure the confidentiality and anonymity of participants and meet ethical requirements. This is due to the research being conducted in a regional location, and the participants having unique characteristics , which increases the likelihood that they would be more identifiable to local stakeholders, than members of the general population.All interviews were conducted by the first author , face to face, ranging from 45\u201375min in length and were audio-recorded. Each participant was interviewed once, and individually, resulting in a total of 21 interviews being conducted. No participants were known to the researcher before meeting, and time was spent developing rapport prior to commencing the interview. Audio recordings from interviews were transcribed verbatim and interviewees were provided the opportunity to review the transcript for comment and/or correction.st interview; hence, this was deemed the last interview.Data saturation, the point where no new interview themes emerged, determined the final number of interviews required for the study. Data were continuously analysed throughout the data collection period using NVivo 12 software . An audiAs the current research focused on reporting the experiences and reality of participants, transcripts were analysed utilising Within the preliminary research plan, it was anticipated that interviews from WoRB and service providers would need to be analysed and reported separately. However, throughout the iterative analysis process, it became evident that interviews from both WoRB and service providers fitted under the same emerging themes. Therefore, all interviews were analysed and reported together, as has been done in similar research involving service providers and refugee populations .Two major overarching themes were identified within the data; proactive strengths-based approaches to dealing with adversity and factors contributing to wellbeing and coping during resettlement.Several WoRB expressed that although they heard the term \u2018resilience\u2019 used often, it was a concept that they did not have a clear understanding of\u2018Resilience \u2013 that\u2019s a term I hear used all the time but I do not know what it means\u2019 \u2013 WoRB 3Other WoRB identified that for them, \u2018resilience\u2019 was an entity that helped them \u2018cope\u2019 and continue to move forward\u2018Yes I have heard about it, and I think it is something that makes us deal with and cope with\u2019 \u2013 WoRB 7\u2018Well, resilience, to me, is to have the strength to keep looking forward, if I were to, like, sum it up\u2019 \u2013 WoRB 1\u2018It\u2019s almost just like that onefoot in front of the other, and looking forward\u2019 \u2013 WoRB 8This ability and strength to keep moving forward were highlighted as being within the day-to-day tasks, as WoRB faced daily struggles and challenges during resettlement\u2018Their capacity to continue to overcome the challenges that they face in their every day \u2013 it\u2019s in the practical\u2019 \u2013 Service Provider 1\u2018They [WoRB] are incredibly resilient because to face this every single day. I do not know many people who actually could face that level of adversity\u2019 \u2013 Service Provider 10Resilience, and the capacity to continue moving forward, within the resettlement context was expressed as stemming from their past experiences\u2018I\u2019ve encountered things that no basic 20-year-old should have to. You know, like, I made the decision to seek asylum for my own safety with my partner at the age of, maybe, 23, but that was one of the hardest things to do. And then while we were waiting for asylum, which was 1year, we did not know anything about whether, you know, we were going to be able to stay, or that we were going to be safe \u2013 That\u2019s resilience\u2019 \u2013 WoRB 4\u2018We all come here looking for a better life, and that\u2019s where\u2026 I guess, for me, that\u2019s where that resilience comes from, you know, knowing that, you know, I\u2019ve come here, I\u2019ve made it, I\u2019m safe, and that this is my opportunity to make a better life for myself\u2019 \u2013 WoRB 6\u2018I feel like experience contributes a lot. I know that\u2019s where I get a lot of my strength from, knowing that, you know, I\u2019ve been in that situation, and it\u2019s so much different now\u2019 \u2013 WoRB 1Overall, resilience was a difficult concept to define for many WoRB who participated in the current study to define. For the WoRB who had heard of resilience, it was a concept which encapsulated moving forward and coping. This was highlighted as not being isolated to the \u2018big events\u2019 but rather was something that WoRB pulled upon every day as they faced adversity in everyday basic tasks during resettlement. WoRB also highlighted how their past experiences play a large role in their present-day \u2018resilience\u2019, and how their past experiences of adversity play a pivotal role in moving forward.The WoRB interviewees expressed several factors which contributed to their wellbeing and coping and resilience during resettlement, falling under three sub-themes: engaging in religious practice, finding a community and sense of meaning and contribution.WoRB emphasised the importance of their religious practice during resettlement, and how engaging in religious practice provided them with meaning, strength and community\u2018Religion, especially religion. Religion is very important in our family\u2019 \u2013 WoRB 5\u2018When I am feeling down, I pray\u2019 \u2013 WoRB 4\u2018Our people often get together in someone\u2019s house, or maybe book a hall, so they are able to get together to celebrate important festivals and religious event and that is also how they are able to get more connected with each other\u2019 \u2013 WoRB 7Service providers supporting WoRB during resettlement also emphasised the importance of engaging in religious practices during resettlement, which may not be initially conceptualised as an important coping or resilience factor from a western perspective\u2018Spirituality, they are fiercely attached to their religious beliefs and I suspect that underpins their resilience\u2019 \u2013 Service Provider 12\u2018They turn to the few things that are their strengths, so faith \u2013 unbelievably strong and that\u2019s something in our western world that\u2019s \u2026 I\u2019m sure it must be challenging for them because we are all a bit \u2013 \u2018hah, religion!\u2019. It must be really hard because it is a key for survival. So turning to God, whatever that god might be, turning to their scriptures, playing to their strengths\u2019 \u2013 Service Provider 1Despite religion being identified as a key factor in coping and wellbeing during resettlement for WoRB, interviewees highlighted that often there was no placed of worship attached to their faith in the regional location which they were resettled\u2018There is no mosque here, so we have to go to a community centre, so we have time to pray\u2019 \u2013 WoRB 5\u2018Saturday, Sunday, no church\u2026 it\u2019s full stress\u2019 \u2013 WoRB 2\u2018We cannot go and practice our religion because there is no mosque\u2019 \u2013 WoRB 6The lack of places of worship for some religious denominations in regional resettlement locations was expressed as a gross oversight in government policy, suggesting that there is limited consideration surrounding what factors will assist WoRB cope and achieve wellbeing during regional resettlement\u2018[Practicing Religion] is what\u2019s going to actually give us the wellbeing we need, and give us the opportunity and our children to be able to keep that practise ongoing, which will help us settle \u2013 WoRB 1\u2018It\u2019s that acknowledgement and opportunity to regularly practise their cultural experiences or traditions. As a counter to that, in Launceston, for example, we have a small number of Muslim communities. There is no prayer centre in Launceston so they come here and they are allocated to Launceston and there is nowhere they can go to pray and there are no faith leaders\u2019 \u2013 Service Provider 1The WoRB and service providers emphasised that finding a community as imperative for WoRB is ongoing wellbeing during resettlement.\u2018To have a community, sense of community, anyway, because you leave that behind\u2019 \u2013 WoRB 1\u2018Everyone here is my community\u2026 it does not matter where they come from. They are my community\u2026I am happy here in my country\u2026 I decide yes, I stay here\u2019 \u2013 WoRB 2\u2018Building linkages with either their own ethnic group, or with a wider community. So, some sort of collective support\u2019 \u2013 Service Provider 12\u2018I think it\u2019s important they find a community: whether it\u2019s, you know, their ethnic community, or a new Australian community, like a neighbourhood group, or an interest group. I just think they need to find others who can provide them with support and encouragement\u2019- Service Provider 5For many WoRB, this sense of community stemmed from a connection with a community from their country of origin. Ongoing connection with a community from their country of origin provided the WoRB with connection to their culture and language of origin\u2018It makes me so happy like for example, the first time we were in hospital, when I hear <language of country of origin>, I was like what? you are from <country of origin>, I was so happy, here are my people, I have people, because we do not have enough English to say the truths\u2026 but when people can understand your language it can make you happy\u2019 \u2013 WoRB 2\u2018We were kinda an early family, it got easier once more people started to be resettled from the background that we come from, and so then we could share each other\u2019s issues with each other and get help if needed\u2019 \u2013 WoRB 6\u2018Now we have much more people who are from our background and who can speak our language, so we often gather up and do lots of activities, like social events and different festivals and getting together. This helps us feel really connected with each other\u2019 \u2013 WoRB 9Despite identifying that having a connection with individuals from the same community of origin is important for wellbeing and coping during resettlement, WoRB expressed that this is often difficult due to a lack of critical mass, particularly if individuals of refugee background leave regional areas due to lack of support and limited job prospects\u2018When we came, we came with just 4 families, without any other people from [identified country of origin] but two families have gone, and one family last year have gone, and we are still here\u2019 \u2013 WoRB 5\u2018I think particularly in Tasmania, like community \u2013 small community groups is really hard. We see a lot of people transferring interstate recently actually. There has been a big pull to the big city, more work, bigger community means, um, bigger support networks. So the support networks in Hobart are limited\u2019 \u2013 Service Provider 4\u2018And the lack of numbers sometimes at the end of the day and a lot of people are moving interstate because there\u2019s a lot more flattering options for employment and housing, whatever the draw card might be. They might have been here for 2months, maybe here for 20years and they are packing up because the mainland\u2019s offering better options \u2013 Service Provider 12.via connecting with their host community, with some WoRB choosing to engage with the host community for support due to experiencing ostracism from their own community of origin during resettlement.The lack of critical mass meant that many WoRB found a new community and support \u2018I used to think that it was important that people got together with people from their community they could support each other. And it did not take long for me to realise that many individuals actually do not want to be part of their ethnic community here in Australia for lots of reasons. But, at the time, you know, I remember being a bit na\u00efve about that\u2019 \u2013 Service Provider 2\u2018I made the assumption that she had adequate social supports because there we had a nice sort of, a number of other families from [her country of origin], but then down the track I realised that she was actually vilified or ostracised a bit by the other women because she\u2019d been a widow, and alone with children, so I sort of asked her, I said, \u201cDo you want me to find supports from Australian women?\u201d and she was almost like, she looked at me like, \u201cAh, finally, yes that is what I want\u201d\u2019 \u2013 Service Provider 12This connection with the host community was identified as initially stemming from the support of a volunteer, who not only provided practical support during the initial resettlement stages but often were a key source of connection and social support\u2018The volunteers were very helpful. When we first came to Australia, we do not have a car, and we did not know where to go, so they came and picked us up, or helped us, and helped deliver people to hospital, school, anywhere\u2019 \u2013 WoRB 5\u2018Volunteers is such a huge part of like someone\u2019s settlement journey, so having that kind of \u2013 I guess, volunteer or host family or a person in the community who is not of your culture, necessarily, to kind of walk you through and be with you\u2019 \u2013 Service Provider 3\u2018They become\u2013they become friends really, you know\u2019 \u2013 WoRB 2.WoRB emphasised that contributing to the community in their resettlement location provided them with a sense of meaning and belonging, which in turn improved their wellbeing and coping during resettlement.\u2018In my opinion, you only really start to feel settled when you get into a regular rhythm every day, so for me, I feel like I\u2019m only starting to feel settled now, because I have work and I\u2019m making some income, so that makes me feel a lot better about things, and feeling a little more normal\u2019 \u2013 WoRB 1The WoRB in the current study highlighted that this sense of belonging and contribution stemmed from gaining employment, which not only provided them with additional income, but connection and social support from the wider community.\u2018Getting a job, and not for money, like for killing time, so your not sitting idle, so you can get up in the morning and get dressed and say, \u2018oh I have a job\u2019, it is very important for your mind, and it is good\u2026. Like for me, it is important that I am not in the house for 24h \u2013 WoRB 2\u2018A job \u2013 for the money, but also connection, so I am able to talk with people and feel useful. So I am able to meet people and I am not lonely and alone during the day\u2019 \u2013 WoRB 4\u2018A job is really important, because of income, but also it gives us a sense of meaning and something to do\u2019 \u2013 WoRB 7Overall, WoRB resettled in regional Australia identified several key factors which contributed to their coping and wellbeing during resettlement, including engaging in religious practices, finding a sense of community and having a sense of meaning and way to contribute within the community. Despite this, it was also identified that WoRB often struggled to access and engage in these factors, due to significant government oversights, lack of critical mass and lack of ongoing job opportunities.This study explored the concept of resilience, and factors that contributed to wellbeing and coping in WoRB resettled in regional Australia. Twenty one interviews were conducted with WoRB and service providers supporting WoRB, with thematic analysis used to analyses the data. Results revealed insight into not only how WoRB understand resilience, but also factors that are critical to coping and wellbeing during resettlement.The results from the first section of the study highlighted the difficulty of studying the concept of \u2018resilience\u2019 in WoRB, as the majority of the WoRB whom participated expressed their lack of understanding what \u2018resilience\u2019 was. This finding builds on research conducted by The WoRB who participated in the current study who showed an understanding of \u2018resilience\u2019 identified it as a concept associated with coping and moving forward. This challenges the traditional conceptualisation of resilience, which includes elements of \u2018bouncing back\u2019, absorbing or recovering , and aliOverall, future research should be mindful of the non-critical application of \u2018resilience\u2019 in research focusing on refugee populations, and minority, non-Western populations in general . DevelopThe second section of this study investigated factors that enhance coping and wellbeing in WoRB resettled in regional Australia. WoRB emphasised how a connection to their faith and ability to practice their religion was a core factor in their wellbeing and coping during resettlement. This is consistent with a growing body of research which has highlighted that religion and faith are the most commonly endorsed factor contributing to resilience and coping in WoRB during resettlement see .\u2018Finding a community\u2019 was identified by WoRB as playing an integral role in their coping during resettlement in regional Australia. For many WoRB, it was identified that connecting with a community from their country of origin provided them with an ongoing connection with their culture and language of origin. This is consistent with previous research by Service providers highlighted that WoRB also found a \u2018community\u2019 by developing relationships with the host community. Developing social supports and \u2018community\u2019 with the host community were identified as the preference for some WoRB due to being ostracised by their community of origin during resettlement. WoRB resettled without male partners have been identified as being at particular risk of being ostracised by members of their community of origin due to social tensions stemming from cultural values . For theWoRB also identified that a \u2018sense of belonging and contribution\u2019 enhanced their wellbeing during resettlement, gained particularly through employment. The benefits of gaining employment are multifaceted, and included the opportunity to earn extra income, but also provide WoRB a sense of purpose, routine and social support. Despite this, securing employment in regional locations has been identified as a significant barrier for refugee populations, despite this being a core objective of the regional resettlement scheme by the Australian government  cannot be made public. Public availability would compromise participant confidentiality and privacy. Requests to access the datasets should be directed to The study was conducted according to the guidelines of the Declaration of Helsinki by the Institutional Review Board (or Ethics Committee) of Charles Darwin University  and University of Tasmania . The patients/participants provided their written informed consent to participate in this study. Informed consent was obtained from all subjects involved in the study.CH, KN, JJ, and DP: conceptualization, methodology and writing \u2013 review and editing. CH: formal analysis, writing \u2013 original draft preparation and project administration. KN, JJ, and DP: supervision. All authors have read and agreed to the published version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "We treated these CAM networks as a series of directed graphs and examined the extent to which their structural properties  are predictive for the perceived coronavirus threat (PCT). Across multiple models, we found consistent and significant relationships between these network variables and the PCT in both the Canadian and German sample. Our results provide unique insights into individuals' thinking and perceptions of the viral outbreak. Our results also demonstrate that a network analysis of CAMs' properties is a promising method to study the relationship between human thought and affective connotation. We suggest that CAMs can bridge several gaps between qualitative and quantitative methods. Unlike when using quantitative tools , participants' answers are not restricted by response items as participants are free to incorporate any thoughts and feelings on the given topic. Furthermore, as compared to traditional qualitative measures, such as structured interviews, the CAM technique may better enable researchers to objectively assess and integrate the substance of a shared experience for large samples of participants.We tested a novel method for studying human experience (thoughts and affect). We utilized Cognitive-Affective Maps (CAMs)\u2013an approach to visually represent thoughts and their affective connotations as networks of concepts that individuals associate with a given event. Using an innovative software tool, we recruited a comparative sample of ( Cognitive-Affective Maps (CAMs) are a direct mental modeling approach for visually depicting the content of belief systems  and German (n = 100) subjects to create CAMs encoding their experiences with the COVID-19 pandemic, we then assessed the resulting mental models, using a stepwise analysis of their network properties.Developed by the cognitive scientist and philosopher Paul Thagard, Thagard, . While CCAMs are visualized networks consisting of nodes and links that connect affective and cognitive elements. The nodes represent various content in text form, including goals, events, people, ideas or concepts, emotions, factual knowledge, or conclusions. Each node also conveys an emotional value, which is represented by the color and shape of the node. These valences or affects are broad assessments in terms of \u201cpositive\u201d or \u201cnegative\u201d and they can be related to emotion, mood, and motivation Thagard, . CAMs alCAMs contain a number of significant opportunities not provided by other research methods. In contrast to questionnaires, CAMs can directly capture the connection between the elements of interest to a specific individual participant. Furthermore, because they use an open response visualization tool, as opposed to structured survey items, their content is less susceptible to instrument biases. For example, CAMs' less structured response format provides participants an opportunity to elaborate on factors which are potentially overlooked or discounted by structured response items. Compared to qualitative interviews, larger amounts of data can be collected with less effort as participants are able to draw the CAMs themselves and the data analyses does not require a detailed transcription of the interview. Finally, CAMs can be combined with survey, interview, and experimental methods to generate richer datasets, conduct robustness checks or cross method comparisons, and explore causal relationships.We investigate the feasibility of using CAMs' network properties to study similarities in individuals' experiences with a shared emotional life event. To meet this objective, we administered an incentivized online study during the 2020 COVID-19 pandemic. We asked samples of Canadian and German participants to visually depict their experience with the ongoing viral out-break as a CAM, using the Valence application  which capture both the emotional and latent properties of CAMs . Based oIn reporting our results, across multiple models, we found a consistent and significant relationship between these network variables and the PCT in both the Canadian and the German sample. However, in the German sample we found an unexpected relation between valence and PCT. Our results demonstrate that a network analysis of CAM properties is a promising method to study the relationship of the overall assessment of a situation e.g., in terms of threat and the detailed assessment of the experience in terms of thoughts/concepts and their affective assessment.Outlined in Thagard , the rulThese different nodes are connected through lines . There are two different kinds of links to choose from: solid and dashed. Solid links indicate that the two elements are positively correlated, whereas dashed links mean that the two elements are negatively correlated. According to Thagard's  rules foThe COVID-19 pandemic has brought about a global health emergency  predict the perceived threat of the coronavirus?Do the latent network properties of CAMs  predict the perceived threat of the coronavirus?If so, to what extent are the network properties that predict the perceived threat of the coronavirus consistent across samples?n = 106) Canadian and (n = 110) German participants from Prolific, an online participants recruitment tool for academic research. Due to the exploratory nature of the study, two independent samples (Canadian and German) are used to increase the generalizability and reliability of our findings. Study sample size was set by the availability of research funds. To demonstrate that our study is sufficiently powered, a separate one-sided post-hoc power analysis using the results of the conditioned statistical model (Model 2) is conducted for Canadian and German samples. Summarized in Initially, we recruited (n = 93) Canadians and (n = 100) Germans. Due to the 2020 coronavirus pandemic, it was necessary to conduct our data collection online. The Prolific data collection platform was selected because it provides transparent information about the demographic composition of its subject pools by country and because it maintains subject pools in both Canada and Germany, representing the nationalities of the research team. The sample was restricted to Canadian and German residents over the age of 18 who had access to a laptop, notebook, or desktop computer. We further restricted participation to participants who speak fluent English (in Canada residents) or fluent German (in German residents). To incentivize participation, each participant was given a direct \u00a38.50 payment for their participation. British pounds are the standard currency on Prolific, this payment converts to $14.50 CAN/ \u20ac9.50 GER. Participant compensation is based on an hourly minimum wage in Canada and Germany. The estimated length of the study was indicated with 60 min. Most participants completed the study in <60 min.During data cleaning, the data of 12 participants were dropped because they indicated that they prematurely stopped the CAM exercise, 11 additional participants were dropped for failing an attention check. For the purposes of the network analysis, we also restricted observations to participants whose CAM contain a minimum of three nodes or two links, this results in the exclusion of 1 additional participant. The final sample is , and June 21st to June 24th (2), 2020. During this time number of cases per 100,000 inhabitants differed greatly. According to Johns Hopkins University Medicine .The completion rates, measuring all participants who opened the study as compared to participants who completed the study, were 61.8% (CAN) and 64.4% (GER). All demographic data and questionnaire measures  were coln = 93) is 44.09% female, 53.76% male, 1.00% non-binary, and 1.00% prefer not to say. The mean age category of the sample is 26\u201332 years (SD = 1.17), and it is 58.84% White, 45.16% other groups; 58.06% of the sample obtained a minimum of a college undergraduate, and 48.08% of the sample identifies religion as being \u201cVery important\u201d or \u201cSomewhat important\u201d in their life. The German sample (n = 100) is 34.00% female, 65.00 % male, 1.00% non-binary. The mean age is 26\u201332 (SD = 0.83), 76.00% of the sample indicate that both of their parents are of German ancestry, 12.00% have at least one parent of German ancestry, and 12.00% have no parent of German ancestry; 80.00% of the sample obtained a minimum of a college undergraduate, and 24.00% of the sample identifies religion as being \u201cVery important\u201d or \u201cSomewhat important\u201d in their life.The Canadian sample (Perceived Coronavirus Threat (PCT) Questionnaire with three itemsneed for affect  with robust standard errors. A GLM is used, as opposed to an Ordinary Least-Squares (OLS), to account for the non-normal distribution of errors in several network measures as well as the non-normal distribution of the measures themselves. The dependent variable in these regressions is the standardized measure of the PCT. For each regression we reported the Akaike Information Criterion (AIC) and Residual Deviance (D), deviance adjust for degrees of freedom. The independent variables are the emotional and latent network measures . To minip-value is at, or below, p \u2264 0.250. In addition to social and demographic characteristics Canada and Germany also differ in several direct factors which may influence the perceived threat of COVID-19 include the number of active cases, spread of the pandemic, and government response. To take account of these differences, we report our results with combined and separate Canadian and German samples. Cluster robust standard errors by country are used in the combined sample.As an exploratory study, we had limited evidence on which to base assumptions about the expected significance of each network measure. Consequently, we conducted our regression model using a stepwise approach. We began by including all network measures as covariates and then iteratively dropping the item with the lowest significance until all terms in the model are meaningful. Following Hosmer Jr et al.  a meaninp \u2264 0.250 significant threshold.As a robustness measure, we ran the stepwise analysis with conditioned and unconditioned models for both the combined (German and Canadian) and the separate samples, these were labeled models 0, 1, 2, and 3. Model 0 was applied only in the combined sample and displayed the unconditioned correlations between the network measures and the PCT. Model 1 displayed unconditioned correlations between the network measures and the PCT, expect in the combined sample where model 1 included a control covariate for country. Model 2 included control covariables for age, education, gender. Model 3 included controls for: (i) need for affect, and (ii) need for structure. Need for affect and need for structure were included to rule out the possible mediating effects of traits previously associated with the sensitivity to threat or to life disruptions. In models 0, 1, 2, and 3, the control covariates were retained regardless of whether they met the We found several consistent and significant correlations between network measures and the PCT. We focus on summarizing the meaningful and significant results with the full pattern of results reported in the p < 0.0001)., are more likely to perceive the virus as threatening. Similarly, in models 0, 1, and 3 density was negatively and significantly correlated with the PCT, indicating that higher levels of interconnectedness are associated with lower PCT. In model 2, the number of nodes was positively and significantly correlated with the PCT however, this variable was not retained in any of the other models. Finally, in model 3, triadic closure was positively and significantly correlated with PCT.Looking at the latent measures, in models 0, 1, and 3, density, an alternative measure of connectivity, had an opposing relationship to PCT as compared to both number of nodes and triadic closure is important to the interpretation of our results. We discuss the limitation of the density measure in our discussion section.Overall, these results support the conclusion that latent properties are meaningful predictors of individual experience, however, the exact nature of this relationship remains unclear. For example, the observation that average valance was negatively and significantly correlated with PCT , , . Lastly,number of nodes was positively correlated with the PCT in models 1\u20133. This indicates that participants who included more content into their CAMs were more likely to perceive the virus as threatening. In models 1\u20133 the number of links is negatively correlated with the PCT. This indicates that from a certain perspective the interconnectedness of a network is negatively correlated with the PCT, however, a limitation of this measure is that it does not correct for the total number of possible links. By comparison, triadic closure, which does correct for the total number of possible links, was positively correlated with the PCT, however, this measure was only retained in models 2 and 3, and was only marginally significant in model 2. Finally, in models 1\u20133 diameter is negatively correlated with the PCT, indicating that participants, whose networks are more expansive, are less likely to see the coronavirus as threatening. However, this term fails to reach significance in model 3. In summary, the results indicate that the latent properties of CAMs are a meaningful predictor of individual experience. Specifically, for the Canadian sample we see that CAMs that are expansive and more interconnected are associated with a greater perceived coronavirus threat. However, the relationship is not straight forward as the opposite relationship is observed in CAMs of the German sample.Looking at the network properties, the density of the network and the number of nodes were both positively correlated with the PCT in model 1\u20133. While density remained marginally significant across all three models, the number of nodes reached significance at the 95% confidence level. Consistent with the combined and Canadian samples, this indicates that the amount of content and the interconnectedness of this content are significantly associated with the PCT in Germany. Taken together, the results provide good evidence that network properties of CAMs capture information significant to the larger study of individual experience (thought and connotation).In contrast to the combined and Canadian sample, no significant correlations were observed between the emotion-oriented network measures and PCT in the German sample. Looking at the latent measures, the p < 0.100. The same p \u2264 0.250 retention criterion was applied to individual covariates, except where a covariate contributed to a significant interaction. In general, we found similarities between the initial and interaction models, with both models including the same basic covariates. The largest difference was the retention of variables not included in the three previous regression models.Noted in the discussion of our research questions , page 9,centrality and valence of the central node. Contrary to expectations, this indicates that as networks become more dependent on the central node and more positive, the PCT increases. Second, the interaction between density and valence of the central node was positive and marginally significant. Once again contrary to our expectations, this indicates that as CAMs become denser (more interconnected) and more positive, the greater the PCT.Looking at the combined sample, two interaction terms were retained. First, there was a positive and significant interaction between number of nodes and percentage of negative nodes. Difficult to interpret, this indicates that as the number of nodes and percentage of negative nodes increase, PCT decreases. Also observed was a significant negative correlation between number of nodes and valence of the central node. Consistent with our expectations this indicates that as the number of nodes increases, and the central node becomes more positive, the lower the PCT.Looking at the Canadian sample, there was a significant negative correlation between density and valence of the central node. Once again, and contrary to expectations, this indicates that as CAMs become more interconnected and the central node becomes more positive the PCT increases. Second, and contrary to expectations, there is a positive interaction between number of nodes and valence of the central node indicating that as the number of nodes increases, and the valence of the central node becomes more positive the greater the PCT. This is the opposite correlation as observed in the Canadian sample. Third, consistent with our expectations there was a negative interaction effect between triadic closure and valence of the central node indicating that as CAMs become more connected and the central node becomes more positive the lower the PCT.Three interactions are observed in the German sample. First, there is a significant positive interaction between the network properties of CAMs  can be used to study similarities in individuals' thinking and experience surrounding an emotional life event? To meet our objective, we operationalized and compared 14 network properties for each individual CAM. Our results yielded several interesting and significant network properties.Using the COVID-19 pandemic as a case study, we tested CAMs as a novel method for studying human experience (thought and affect). Specifically, we asked whether One immediate observation was a difference in significant emotional network measures between the Canadian and German sample. Looking at n = 99) of the sample coded their central node as neutral, including 52 participants whose central node referenced the coronavirus, and a further 14 participants whose central node referenced restrictions, social distance, or stress concepts which might be otherwise expected to be defined as negative  were only periodically significant, these measures were highly correlated , the category \u201cCoronavirus\" is the most frequent in both samples, i.e., a large proportion of participants placed the term \u201cPandemic\u201d or \u201cCoronavirus\u201d directly in the middle. Other frequent central nodes were \u201cQuarantine\u201d (Canada) and \u201cRestrictions\u201d (Germany), assumably also negative concepts. Future studies should elaborate more the valence of central nodes, as well as the content of all concepts of the CAMs. We suggest that CAMs are a very helpful tool to dive deeper into a research topic such as the corona virus pandemic and allow participants to elaborate complex impressions, including affective connotations while at the same time CAMs give the possibility to collect large samples and apply network analyses. Yet, to enable this more work is needed to develop a content wise automated analyses which can be directly applied to CAM data.A further consideration is the role of density in the PCT. As a measure of the CAM's interconnectedness, density was negatively and significantly correlated with the PCT in the combined sample but positively correlated with PCT in the German sample . Also challenging is that the interaction between density and valence of the central node was also positive and significant in the combined and German sample. This indicates that as graphs become denser and the central node becomes more positive, PCT increases. While this result is not easily interpreted, two statistical tendencies in the data are meaningful to its explanation. First, across the data we observed a large negative correlation between density and the number of nodes and links. This correlation indicates that dense CAMs have lower numbers of nodes (content) rather than a large number of highly interconnected nodes . Second,We explored Cognitive-Affective Maps (CAMs) as a tool to capture peoples' experiences with the ongoing coronavirus pandemic and to predict their perceived coronavirus threat (PCT) across the Canadian and German samples. Our findings showed consistent and significant relationships between emotional and latent network variables and PCT in both samples. The average valance of a CAM reliably predicted PCT. Also, there were consistent correlations between PCT and the latent structural variables centrality and density. The Canadian and German samples differed in their PCT value, which prevents a statement about the equality of correlation with network properties across samples. Further studies are needed to make clearer statements about differences and similarities of network measures between samples. It is currently difficult to draw specific psychological conclusions from the network data of the CAMs. In the future, methods should be found to automatically evaluate the contents of the CAMs and to relate them to the network properties. Yet, we suggest that CAMs can bridge several gaps between qualitative and quantitative methods. Unlike when using quantitative tools , participants' answers are not restricted by response items as participants are free to incorporate any thoughts and feelings on the given topic. Furthermore, as compared to traditional qualitative measures, such as structured interviews, CAMs may better enable researcher to objectively assess and integrate the substance of a shared experience for large samples of participants.https://osf.io/8mxcz/?view_only=750d8048ed6a4c629d03f11bcc03c454.The raw data supporting the conclusions of this article is available through OSF: Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.JM was primarily responsible for the statistical analysis and results. LR was primarily responsible for the study programming and implementation. CR was responsible for the administration of the Valence software tool. AK was responsible for overseeing the project development and direction. All authors contributed to the study design, statistical analysis, and preparation of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The transparency of the cornea along with its dense sensory innervation and resident leukocyte populations make it an ideal tissue to study interactions between the nervous and immune systems. The cornea is the most densely innervated tissue of the body and possesses both immune and vascular privilege, in part due to its unique repertoire of resident immune cells. Corneal nerves produce various neuropeptides that have a wide range of functions on immune cells. As research in this area expands, further insights are made into the role of neuropeptides and their immunomodulatory functions in the healthy and diseased cornea. Much remains to be known regarding the details of neuropeptide signaling and how it contributes to pathophysiology, which is likely due to complex interactions among neuropeptides, receptor isoform-specific signaling events, and the inflammatory microenvironment in disease. However, progress in this area has led to an increase in studies that have begun modulating neuropeptide activity for the treatment of corneal diseases with promising results, necessitating the need for a comprehensive review of the literature. This review focuses on the role of neuropeptides in maintaining the homeostasis of the ocular surface, alterations in disease settings, and the possible therapeutic potential of targeting these systems. Corneal transparency is vital for vision, and there are various anatomical and physiological factors that contribute to the maintenance of corneal transparency. The human cornea consists of three major cellular layers with anterior and posterior limiting laminae among them . The outOcular immune privilege was first described by Medawar as the phenomenon of the prolonged survival of a skin allograft placed in the anterior chamber of a rabbit eye . Because\u2212, CD80\u2212 and CD86\u2212) central and peripheral cDCs were also discovered -enkephalin, and one copy of [Leu5]-enkephalin ,550,551.The biosynthesis of MENK involves the proteolysis and peptide cleavage of the proenkephalin prohormone within the secretory granules of the Golgi apparatus . The bio+ and Ca2+ influx in the cells. The G\u03b1 subunit hyperpolarizes the cell via direct interactions with inward-rectifying K+ channels and reduces the cAMP-dependent Ca2+ influx by inhibiting AC activity and cAMP formation. The Ca2+ influx is further reduced by the direct binding of the G\u03b2\u03b3 subunit to the Ca2+ channels [The binding of enkephalins to opioid receptors dissociates the G\u03b1 and G\u03b2\u03b3 subunits, which results in reducing Kchannels . The reschannels ,560.+ T cell activity, the inhibition of Treg activity, the stimulation of macrophage phagocytosis, enhancing antigen processing capacity of DCs, the proliferation of CD4+ Th1 cells and B cells, and the stimulation of NK cell responses [Opioid receptors have been detected in the membranes of immune cells, including T cells, NK cells, macrophages, and dendritic cells. Studies have shown that MENK and/or its active metabolites have neuroendocrine functions in modulating pain sensitivity and immunomodulatory roles, including the upregulation of CD8esponses ,564,565.esponses . MENK and its receptors have been shown to be present in the corneas of various species, including humans, mice, rats, and rabbits, and MENK is derived in an autocrine manner . StudiesNT belongs to the neurotensin family of peptides, with various neuromodulatory effects on both the central and peripheral nervous systems . NT was NT is encoded by the neurotensin gene, which encodes a common precursor for two peptides: neuromedin N and NT . The conNT is derived from precursor protein preproneurotensin following excision by prohormone convertases . NT-NTR1Studies have shown that NT can modulate pain transmission both as a facilitator and an inhibitor ,579. FurNT receptors localize both in the cornea and the trigeminal ganglia , suggestAs discussed above, neuropeptides in the cornea play an important role in immunomodulation and inflammation, and their levels are altered in ocular injuries/diseases . The tarSP is the most well-studied neuropeptide in corneal wound healing as it enhances epithelial cell migration, adhesion, and the phosphorylation of cytoskeletal proteins . SeveralDED is a multifactorial disorder of the ocular surface characterized by chronic inflammatory features. The pathogenesis and progression of DED also involves an enhanced SP release from sensory terminals, which promotes pathological corneal lymphangiogenesis, Treg dysfunction, the maturation and activation of antigen-presenting cells, and induces the Th17 phenotype in the ocular surface . VariousNeuropeptides such as CGRP and NPY are reduced in the tears of DED patients and are associated with the severity of the disease . Given tThe application of \u03b1-melanocyte-stimulating hormone (\u03b1-MSH) twice a day to the ocular surface of a scopolamine-induced, aqueous-deficient dry eye model in rats improves tear secretion, tear film stability, and corneal integrity; restores the number and size of conjunctival goblet cells; and corrects overexpression of proinflammatory factors such as TNF-\u03b1, IL-1\u03b2, and IFN-\u03b3 .Herpes simplex virus type 1 (HSV-1) keratitis is associated with higher levels of SP in the corneal stroma, and the subconjunctival administration of spantide I significantly reduces IL-6 and CCL3 proteins and the influx of neutrophils and CD4 T cells, leading to reduced corneal opacity and angiogenesis .SP is also associated with the increased severity of Pseudomonas aeruginosa keratitis ,600, andThe application of exogenous VIP also promotes healing in experimental Pseudomonas aeruginosa keratitis by regulating pro- and anti-inflammatory cytokines, growth factors, and Toll-like receptors .+ stromal cells from the bone marrow to the injured tissue to accelerate wound healing in an alkali-burn model of mouse and rabbit eyes [SP production increases after injuries to the corneal epithelium from alkali burns and in suture-induced corneal neovascularization animal models . The admbit eyes . Significant amounts of SP impair Treg functions necessary for an allograft\u2019s survival, and SP antagonists can restore corneal immune privilege . StudiesThe neuropeptide modulation of immune cells is quite complex, and at times, studies have found pro- and anti-inflammatory properties for the same neuropeptide. While in some cases these differing effects may be due to differences in the expression of neuropeptide receptor isoforms and/or cell-type specific differences in downstream effectors, a further nuance to consider is that of the microenvironment. Likely, the ultimate effects of neuropeptide signaling are influenced by the presence of additional neuropeptides, cytokines, and the rest of the microenvironment. However, despite these gaps in knowledge, which warrant further study, there remains great promise for the potential to harness this signaling in the development of new therapies. Thus, the therapeutic effects and treatment outcomes of neuropeptides warrant the translation of the animal studies into clinical trials for the development of novel and effective interventions for ocular surface injuries and diseases."}
+{"text": "Children with autism spectrum disorder (ASD) and developmental delay  have more severe clinical symptoms than those with ASD without DD (ASD-only). However, little is known about the underlying neuroimaging mechanisms. The aim of this study was to explore the volumetric difference between patients with ASD + DD and ASD-only and investigate the relationship between brain alterations and clinical manifestations.A total of 184 children with ASD aged 2\u20136 years were included in this study, who were divided into two groups according to their cognitive development: ASD + DD and ASD-only. Clinical symptoms and language development were assessed using the Autism Diagnostic Observation Schedule (ADOS), Childhood Autism Rating Scale (CARS), and the Putonghua Communicative Development Inventory. Of the 184 children, 60 age-matched males (30 ASD + DD and 30 ASD-only patients) with high-resolution structural neuroimaging scans were included for further voxel-based morphometry analysis to examine the relationship between clinical symptoms and gray matter volumes.The ASD + DD group had higher CARS and ADOS scores, lower gesture scores, and poorer performance in \u201cresponding to joint attention\u201d (RJA) and \u201cinitiating joint attention\u201d than the ASD-only group. Larger gray matter volumes in the temporal poles of the right and left middle temporal gyri were associated with the co-occurrence of DD in patients with ASD. Moreover, temporopolar volumes were correlated with CARS and ADOS scores, gesture scores, and RJA ability. Pre-language development significantly mediated the relationship between temporopolar volumes and both CARS and ADOS scores; RJA ability, but not gesture development, contributed to this mediating effect.In this study, we found that temporopolar volumes were enlarged in patients with ASD who had comorbid DD, and these patients showed an association between symptom severity and language ability during the pre-language stage. Offering early interventions focused on RJA and the temporal pole may help improve clinical symptoms. Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder characterized by social communication deficits, repetitive behaviors, and restricted interests. The previous several decades have seen a significant increase in the prevalence of ASD. The most recent report in 2021 suggested that the prevalence of autism had reached 1/44 in the United States  and ASD-only and identify brain volume differences between these two groups. We also examined the relationship between behavioral heterogeneity and brain structural alterations. It provides an important complement to previous related research. This study serves as an important step toward parsing factors that influence neuroanatomical heterogeneity in ASD and is a potential step toward establishing precise medical biomarkers.Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-V)  or ASD-only according to whether they presented with DD/ID . Since the sex/gender differences in ASD have been observed in previous neuroimaging studies , 18, andThe parents or guardians of all participants provided written informed consent according to the Declaration of Helsinki. This study was approved by the Ethical Committee of Shanghai Jiao Tong University School of Medicine, affiliated with Xinhua Hospital.Autism Diagnostic Observation Schedule and CARS were used for the diagnosis of ASD alongside the DSM-V and ADI-R by a qualified and experienced assessor. These scales were also used to evaluate the clinical severity of autistic symptoms, where a higher ADOS score and CARS total score indicated more severe symptoms. For ADOS, a calibrated ASD severity score (CSS) was also calculated in the social affect (SA) domain to represent the severity of social communication.The average DQ in children aged 2\u20134 years was evaluated using the Gesell Developmental Diagnosis Scale (GDDS), whereas the IQ of children aged 4\u20136 years was assessed using the Weschler pre-school and primary scale of intelligence . We haveThe Putonghua Communicative Development Inventory (PCDI), adapted for Mandarin Chinese, was used to assess the early language and communication development of children aged 8\u201330 months, and it can be used to assess older children with developmental disorders , 21. The\u201cResponding to joint attention\u201d (RJA) and \u201cinitiating joint attention\u201d (IJA) were evaluated within the ADOS assessment. For the scenario of RJA, the evaluator assessed the child\u2019s response to the use of gaze coordinated with facial orientation, vocalization, and pointing to draw attention to a distant object. When rating the IJA item, the evaluator assessed whether the child used eye-tracking or oral language to draw adults\u2019 attention. Scores  represented different degrees of engagement  and initiation  .Participants were scanned using a Siemens Version 3.0-Tesla MRI scanner  with a 32-channel head coil and a four-channel neck coil. Given their young age and inability to cooperate during the examination, our subjects were under sedation . Additionally, earplugs, earphones, and extra foam padding were provided to the participants to reduce the impact of the sound of the scanner during the scan. Through these efforts, the images of all patients were clear and usable. The high-resolution anatomical T1-weighted magnetization-prepared rapid gradient echo image  was acquired.1 and the CAT12 toolbox, which incorporates the DARTEL toolbox. Pre-processing steps included segmentation, registration, normalization, and smoothing. Notably, customized tissue probability maps (TPMs) of children were created using the Template-O-Matic Toolbox.2 These customized TPMs were used for the initial spatial registration and segmentation processes. We used the standard optimized method for iterative tissue segmentation and spatial normalization, which uses both linear (12-parameter affine) and non-linear transformations. To ensure that the residuals in later analyses conform to a Gaussian distribution and to account for individual differences in brain anatomy, the modulated gray matter images in Montreal Neurological Institute (MNI) space were smoothed using an isotropic Gaussian kernel of 8 mm full width at half maximum. The resulting voxel size was 1.5 \u00d7 1.5 \u00d7 1.5 mm3.T1-weighted images were processed using SPM12t-tests. Classification data, such as sex, RJA, and IJA item scores, are expressed as numbers and were compared using \u03c72 tests. A p-value <0.05 was considered significant.The SPSS version 21.0 statistical software  was used for clinical data analysis. After testing for data distribution and variance homogeneity, we calculated the means \u00b1 standard deviations for all measurement data, which included age, the GDDS average DQ, the ADOS social + communication score, the CARS total score, and the scores of the PCDI. Comparisons between the two groups were conducted using independent-sample A linear regression model was used to investigate the relationship between gray matter volume (GMV) and ASD with/without DD, with age and total intracranial volume as covariates of no interest. For the neuroimaging analysis, we conducted a permutation-based cluster-level correction  for multiple comparisons . At the 3 to test the mediation (indirect) effect. The indirect effect was considered significant if the bootstrap CI did not include zero.We tested the mediating effect of language development scores on the association between significant GMVs and clinical symptoms of autism while controlling for age and total intracranial volume as covariates of no interest. We applied a bootstrap procedure provided by PROCESS in SPSSt = \u22120.045, p = 0.964) or sex  between the two groups. The CARS total score, ADOS social + communication score differed significantly between the ASD + DD and ASD-only groups . The ASD + DD group  had higher CARS, and ADOS scores than the ASD-only group . In addition, compared with ASD-only, higher ADOS-SA CSS were observed in patients with ASD + DD  .A total of 184 participants were enrolled from the Shanghai Xinhua Registry, which consisted of 103 patients with ASD + DD and 81 patients with ASD-only. There was no significant difference in age (= 0.029) . The lanp < 0.05). Compared with the ASD-only group, the ASD + DD group\u2019s scores for early, later, and total gestures were lower . For the RJA scores, 3.9% of patients in the ASD + DD group and 17.3% of patients in the ASD-only group had a score of zero.The comparisons of RJA and IJA ability showed that the ASD + DD group was poorer than the ASD-only group  and the left middle temporal gyrus (TPOmed.L) .r = 0.343, p = 0.008) and the CARS total score . A marginally significant association was observed between TPOmed.L volume and clinical symptoms .For the association between the volumes of these two regions and clinical symptoms, we found that a larger TPOmed.R volume was correlated with greater severity of autistic symptoms as measured by both the ADOS score  and RJA ability , whereas no correlation was observed between TPOmed volume and IJA ability .We also found that a larger TPOmed volume was correlated with a poorer gesture score  or eye-tracking , 41, wouTemporopolar volumes were significantly enlarged in children with minimal language children and ASD + DD, and were related to ASD severity and language ability during the pre-language stage. Our findings suggest that volumetric differences in the temporal pole may provide a biological basis for autism severity before the onset of clinical symptoms and offer clues for developing interventions targeting the temporal pole, which may improve the prognosis of ASD.The data of this study are available under reasonable and ethically approved request to the corresponding authors.This study involving human participants was approved by the Ethical Committee of Shanghai Jiao Tong University School of Medicine Affiliated Xinhua Hospital. The parents or guardians of all participants provided written informed consent according to the Declaration of Helsinki in the study.LZa, FL, YJ, and MX designed the study. YJ, XL, YD, and LZo collected the clinical information and brain imaging data. YJ and LZa carried out the analysis. YJ, MX, and LZa interpreted the results and wrote the manuscript. LZa and FL guided and supervised all work. YJ, MX, XL, YD, LZo, FL, and LZa read, provided the feedback, discussed and approved the final manuscript."}
+{"text": "It appears that up to 80% of females with autistic spectrum disorder (ASD) have not been diagnosed by the age of 18. This translates to a prevalence of about 5\u20136%, and if true, has serious implications for female mental health. One way of finding the true value is to use Bayes\u2019 Theorem with a comorbid condition as a more easily recognizable flag. An obvious choice is anorexia nervosa (AN), but it transpires that the proportion of women with ASD who develop AN is unknown. This study uses published data in novel ways to provide two methods of estimating a range for this variable, and gives a median value of 8.3% for AN in ASD and, with four other methods, a median prevalence of 6% for female ASD. The clinical implications of the diagnosis and management of ASD and its comorbidities are discussed and, as an example, a solution is provided for the rate of ASD in symptomatic generalized joint hypermobility. It is probable that one in six women with a mental health condition is autistic. Autistic spectrum disorder (ASD) is a life-long neurodevelopmental condition with problems in socialization and communication, restrictive interests and repetitive behaviors. It is highly genetically determined and underdiagnosed in females with negative long-term consequences . In a prThe aim of the study is to explore the use of AN epidemiological data with Bayes\u2019 theorem to more firmly establish the true prevalence of female ASD and thereby improve the clinical management of these complex comorbidities. To this end, it will include a discussion on the current aetiology and structure of mental health conditions and clinical approaches to the problems of ASD management.An essential intermediate step examines data detailed in current peer-reviewed literature, to find solutions to the proportion of females with ASD who develop AN at some time in their lives, designated P(AN|ASD). P stands for probability, in this case, a conditional probability, but it is equivalent to prevalence in the population of interest. Proportion, in context, may be a synonym for both. P(AN|ASD) would provide further information on the true prevalence of ASD in females, designated P(ASD). The study provides new epidemiological information from the patient dataset detailed previously . It lookMost literature on ASD epidemiology does not report gender-specific data in sufficient detail. ASD is very diverse and gender-related issues require gender-specific approaches. Gender-nonspecific data in ASD is generally as useful as the observation that the average human has one ovary and one testis. You cannot average different entities, and for virtually all practical purposes, female and male ASD are sufficiently different, so averaging is meaningless. An underlying criterion, such as poor reciprocal communication, will be shared but the pattern of responses will be different in quality and quantity. The gender data should be reported separately and combined in the few instances where this is applicable.There is virtually no published data on P(AN|ASD), and none clearly specific to females. P(AN|ASD) could be an important intermediate step in clarifying P(ASD) because AN in females is much easier to recognize as a problem than in female ASD and can act as a flag for finding P(ASD). This will be a major theme of this paper.Since female ASD is cryptic, it is likely that AN will be diagnosed first in a clinic dedicated to its usually urgent treatment. Whether ASD is diagnosed prior to or subsequent to AN, it is likely to be managed by the mental health arm of that clinic. There is not going to be the denominator of a representative ASD population to provide the overall proportion of AN cases. It is not then surprising that there is virtually no published value for P(AN|ASD).The only published quantitative estimates of bias in ascertaining P(ASD) are in the recent paper  and therThere is a lot of confusion in reporting epidemiological information as outlined in challenge 1) above. This section will hopefully clarify the issues and provide context for the study. It will focus on female ASD and provide data from my patient database of 1711 children 1\u201318 years of age outlined in reference [ above. TThe second major group is siblings. These are all children with the same carer who are diagnosed after the proband. It will include half-siblings and occasionally step-siblings or foster siblings because the issue is recognition, not genetic relatedness. The assumption is they are easier to recognize than singletons due to family experience of ASD.A small number of children did not have a settled core gender identity and were classified by their current sex of assignation. Only those assigned as female are counted in this study. The first problem is that overall prevalence is generally reported as either up to 8 years or over the entire child and adolescent period, and while the value up to age 8 may be useful for subgroup comparisons, The total singleton graph  is fairlThe sibling group is compared to the singleton group in 2 for proportions. \u03c72 = 5.087 DF = 1 \u03c6c 0.089 p = 0.024.The difference in proportions of singletons diagnosed by 96 months of 39.7% and siblings diagnosed of 48.6% was significant by \u03c7While the proportion P(AN|ASD) of females with autistic spectrum disorder who develop anorexia nervosa at some time in their lives is not known, the reverse conditional probability P(ASD|AN) has recently received a lot of attention and current estimates vary from about 20\u201330% ,7. This Bayes\u2019 theorem gives a general method of determining the prevalence of conditions that may be difficult to detect clinically. If there is a more easily identifiable condition associated with the cryptic one, three components of the simplest form of the theorem have the visible condition within them. In the case of cryptic ASD these are:The prevalence of the visible condition P(AN). Prevalence estimates should be reliable.The proportion of the visible condition AN in the population of the cryptic condition ASD P(AN|ASD). Despite AN being visible, P(AN|ASD) is unknown as per challenge 3. The proportion of the cryptic condition ASD in the population of the visible condition AN: P(ASD|AN). Because AN is visible, ASD can be carefully sought and therefore, P(ASD|AN) is reliable.Bayes\u2019 theorem connects the two conditional probabilities P(AN|ASD) and P(ASD|AN) and the respective prevalences of the two conditions P(ASD) and P(AN). The visible condition acts as an identifiable flag to determine the prevalence of the cryptic condition with Bayes\u2019 theorem:Definitions of mental health conditions can be tricky to interpret but as long as the interpretations are reasonably consistent in each variable, P(ASD) will be reasonably accurate. The assessment time frame is very important if the diagnostic timing is different, as is the case here, and so, results are going to be more accurate with data, at least into the third decade to give time for AN to evolve and be found. This study will use three forms of Bayes\u2019 theorem with two different though overlapping datasets to find P(AN|ASD). The first form is based on the simple algebraic relationship of probabilities used as a guide in clinical medicine. This first version provides an exact result for the unknown variable P(AN|ASD) if the other three are known. While there may be multiple underlying estimates of each independent variable, each needs to be reduced to a single number for each individual calculation. Plausible ranges will be dealt with in What the theorem does is look at the intersection of the conditions, patients who have both ASD and AN, and assign each element of this pair as a proportion of the other underlying condition. These conditional probabilities depend on the relative proportions of each condition in the population, i.e., the prevalences of AN and ASD. The condition with the greater prevalence has a lower comorbid proportion of the other condition. If as shown in The study will use data for lifetime prevalences, as far as these are known, but the extent of both AN and ASD over the lifetime is still not well characterized, and in practice, this does not extend much beyond the third decade.Since AN is far easier to recognize than ASD in females, the clinical value of P(ASD|AN) is high. The proportion of ASD is clinically significant  and therThe second form of Bayes\u2019 theorem employed is the 2 \u00d7 2 table , commonlThe 2 \u00d7 2 table also provides likelihood ratios. The positive likelihood ratio (LR+) is the ratio of the probability that the positive test result is a true positive for the condition present and the probability that the positive test result is a false positive for the condition absent, given by: The positive likelihood ratio, also known as the Bayes\u2019 factor, will be employed in a novel way in When searching the literature for the required values of the independent variables, we find they are very variable indeed. There may be some variation between the study populations but there are also wide variations within populations that are likely fairly homogeneous. The problem is that there are variations both in the criteria for diagnoses, the interpretation of those criteria for a given diagnosis  and in the age ranges which are assessed. The aim of method one is to model this reality and see where it leads. The three independent variables needed to establish the dependent variable P(AN|ASD) are P(ASD|AN), P(AN) and P(ASD). Information was sought in the literature to establish reasonable ranges for these variables which would then be put into a matrix representing the variation in estimates that would accrue if direct clinical estimates of P(AN|ASD) were ever done. If these ranges are reasonably accurate this would model a very large number of potential studies with widely varying results, and the median would likely not be too far off a consensus value that might take many years to establish by direct observational studies. My selected ranges were, of course, educated guesses but were based on the current available data for AN lifetime prevalence , P is shown in The median value (in red) is not in the centre of the numerical range and so the values were then plotted as percentages on a histogram to establish the pattern of results .The median is skewed to the lower end of the range. Plotting intermediate independent variables for a total of 125 estimates smoothed the peaks and reinforced the skew to the left.It appears about 9% of females with ASD will develop AN at some stage. The weak link in this assessment, of course, is the absence of bias-free assessments of P(ASD) independent of my study. There are two approaches to this problem. The first is to see what P(AN|ASD) values would arise compared to the value of 0.091 using current literature estimates of P(ASD) and decide whether they are plausible. The second is to seek any literature at all that can establish conditional probabilities in both directions and might produce another estimate of P(ASD).A recently published estimate of P(ASD) is 0.0125 . Used wiA Danish study in 2015  looked aThe registers were the Danish Psychiatric Central Research Centre (from 1969) and the Danish National Patient Register (from 1977). The classification systems were the International Classification of Diseases (ICD-8) until the end of 1993 and then ICD-10. The study period was from 1981 until 2008. The study population was large, with 4684 females with AN and 2594 females with ASD. The ASD females were probands, i.e., the first child in the family diagnosed. AN included atypical anorexia and ASD included infantile autism, atypical autism and Asperger\u2019s syndrome. These latter three would likely be now subsumed into ASD as defined in the Diagnostic and Statistical Manual version 5 (DSM-5) . Since bMethod two will give a measure of the proportion of AN diagnosed as representative of a population of ASD as possible since it was effectively a census of the entire Danish population. This then overcomes the problem of finding P(AN|ASD) in a representative ASD population. It assumes that the rate of AN in the diagnosed population of ASD is representative of the rate in the entire ASD population. This is probably largely true, since the major reason for the failure to ascertain female ASD appears to be non-recognition of the possibility of ASD prior to referral, rather than failure of the diagnostic process itself . A hazard ratio looks at how the rates of occurrence of the two conditions compare over time. The study adjusted for multiple variables in eight consecutive cohorts to arrive at a final single numerical hazard ratio of 5.22 for individuals with ASD getting a second diagnosis of AN, compared to individuals without ASD getting a diagnosis of AN. Having allowed for the variability in the hazard ratio with large numbers over time, this would be similar to a relative risk. If the estimated range of prevalences of AN is 1\u20133% this would give a range of P(AN|ASD) of 5.22\u201315.66%. In There appears to be a very symmetrical overlap of the ranges. Is it possible to establish a comparable value in method two to the matrix median in method one?The hazard ratio was defined in the study as the ratio of getting a diagnosis of AN with ASD compared to getting a diagnosis of AN without ASD. This is:With a 2 \u00d7 2 table, the ratio of getting a true positive result with a test compared to getting a false positive result with the test is the Bayes\u2019 factor or positive likelihood ratio. The general 2 \u00d7 2 table, including the positive likelihood ratio, is shown in If we say AN is a visible flag for cryptic ASD, this is analogous to saying the presence of AN is a test for the presence of ASD and we can construct a 2 \u00d7 2 table to examine the relationship. We use the second condition (AN) as a test for the first condition (ASD). It is the mathematical equivalent of any other test. The sensitivity of AN as a test for ASD is mathematically P(AN|ASD). It is the probability of getting a true positive result when performing the test which translates to the probability of developing AN if you have ASD. The false positive rate of the test is P(AN|not ASD). The likelihood ratio is:Mathematically, the hazard ratio and the positive likelihood ratio are equivalent. Providing the single value of the hazard ratio is a valid measure over the total data-collection period and the relation of ascertainment of ASD and AN has not changed significantly since the data were collected, we can use the hazard ratio as a likelihood ratio with the current estimates of the independent variables. There has probably been little change in female diagnostic bias during this time . We willP(ASD|AN) is, mathematically, the positive predictive value and in its odds form is the posterior odds used with the Bayes\u2019 factor (LR+) to find the prior odds and thus the ASD prevalence P(ASD). The positive likelihood ratio for the matrix method relationship is 5.73. This is quite similar to the hazard ratio and implies that the relative recognition of ASD and AN has been similar over time. Then, with a \u201clikelihood ratio\u201d of 5.22 our new result for P(AN|ASD) should be a little lower than 0.091. As can be seen, the \u201csensitivity\u201d of the test is very low, but the \u201cspecificity\u201d is so high (0.984) that the \u201clikelihood ratio\u201d is a significant number. The constant independent variables for each method are the current best-established mid-point estimates in the literature, i.e., the prevalence P(AN) of 0.02 and P(ASD|AN) of 0.25. To find the new P(AN|ASD) we need to adjust the prevalence of ASD. This will give a new estimate of this variable. The derivation is shown in The value for P(ASD) can be confirmed using the odds form of Bayes\u2019 theorem:As discussed, we use the equivalence of the likelihood and hazard ratios and the equivalence of probability and prevalence. The conversion equations for probability P and odds O are:Prior odds of ASD in the general population = posterior odds of ASD in the AN population/hazard ratio:The two ranges for P(AN|ASD), the method one median and hazard ratio-derived values are shown in An important result of this study was the two new derivations of the prevalence of female ASD. The results for P(ASD) from the previous study  were useIn the first method, values from the previous study using my own data were derived from the application of the total bias against diagnosing girls in two groups, first diagnosed and only diagnosed. This would be similar to the Danish group in method two of this study. Another estimate by the same method uses the fact that siblings are easier to recognize than the first child diagnosed in a family, due to parental experience, and this means fewer siblings are missed and reduces the overall bias. The calculation of the revised proportion missed is shown in The second method compares values for girls missed which were found by other methods against the latest ASD prevalence value published at the time  of 1.25%This study and the previous one  have givOutline summary of the methods used to derive female P(ASD).Find the biases in three different populations with ASD , calculFind the proportion of girls missed in methods 1,3 and 6 and compare the average biased male-to-female odds ratio (MFOR) calculated from these proportions  to calcuCalculate the true prevalence of borderline personality and ASD data with Bayes\u2019 theorem ,20,21.Use the hazard ratio as a likelihood ratio with the best published average estimates of P(ASD|AN) and P(AN) to calculate the true prevalence with Bayes\u2019 theorem.Model clinical studies ,11,12 toCalculate the true MFOR  and compWe can use the plausible range of P(ASD|AN) in its odds form together with the hazard ratio of 5.22 to estimate a plausible range of P(ASD) as shown in On a different axis, we can use the 95% confidence interval for the hazard ratio of 4.11 to 6.64  togetherThese P(ASD) ranges are remarkably consistent with the range derived from the total of six methods in During the manuscript preparation, new US data on increased ASD prevalence for 2019 and 2020 became available , from thThe matrix method (5) was adjusted because with the reported estimated male and female ASD prevalence increase, the revised approximate range of true female P(ASD) became 0.055\u20130.065 . The newThe period of data collection for my study closely matched that of the consecutive US studies ,22. AddiA recent study  looked aDespite the changes, the overall median value of P(ASD) has only moved from 0.0595 to 0.060, so there has not been any significant change in P(ASD) estimation with the new information. The final values of P(ASD)  give:NumFour methods were used to calculate the median value of P(ASD) as 0.060.1(c). MFOR and bias calculations from my database and updated male ASD prevalence .Hazard ratio and P(ASD|AN) ,6,7,16.P(ASD) calculations from my study and AN data ,5,6,7,13These three did have some overlapping independent variables.3ASD and BPD ,20,21. TThe methods used in 3., 4. and 5. were versions of Bayes\u2019 theorem.The overall process has been to start with a Bayesian prior P(ASD) centred on 0.055, a value at the conservative end of the range found in the study determining the biases against female ascertainment . DiffereDefining ASD by DSM-5 we found a Male Female Odds Ratio (MFOR) of 3:4 . The diaWhile the study designs are different, the populations are essentially the same, as is the aim to establish the true female prevalence of ASD. If we take the view that the 1:1 result may reflect the true MFOR for the very young then the result from their study and the latest US result  which giAll these results are complementary and are converging on a much higher value of P(ASD) than current estimates.The Danish study also provides a hazard ratio for female ASD of 12.82 compared to 5.22 for female AN. We can then reverse the 2 \u00d7 2 table with ASD as a \u201ctest\u201d for AN. P(AN) and P(ASD|AN) remain constant because they can be reliably measured. P(ASD) will be falsely low due to ASD bias relative to AN as a flag. If ASD is an inferior test for AN for this reason we would expect a falsely low P(ASD) and a falsely high P(AN|ASD) to result. The 2 \u00d7 2 table is shown in One publication  gave infA second report  listed 4A third study  looked aIt has been known for some time that ASD is associated with joint hypermobility and associated pain. At one extreme is Ehlers\u2013Danlos Syndrome (EDS), predominantly hypermobile EDS (EDS3), but there now appears to be a continuum termed hypermobility spectrum disorder (HSD) ,36 and iTo complete the comorbid circle there is good evidence ,39 that The general method of using Bayes\u2019 theorem to find the true prevalence of a cryptic condition is simple in principle. Find an associated condition which is more visible as a flag and easier to define and count. The difference in reliability of AN and ASD as a flag is shown by the difference between Unfortunately, most mental health conditions do not have precise definitions, genuinely overlap and have varying diagnostic interpretations. The estimates often have wide ranges and do not report enough gender-specific results. My point estimates for calculations have used mid-range reported values in the hope that the data is sufficiently consistent and comparable to produce approximately normal ranges. A specific problem for female ASD is the dearth of available data for females. However, the results we have obtained for P(ASD), using different methods and multiple data sources, do converge on a value of 6.0% which is very different from current estimates and does have very real clinical significance. The results show that there is a definite increase in the prevalence of AN in the population of women with ASD to about 8.3%, though it is a smaller proportion than the prevalence of ASD in the population of women with AN of about 25%. Since the occurrence of both in families was first reported by Gillberg in 1983 , the relThe most important result of this paper is the probability that the prevalence of ASD in women is much higher than previously thought. Pediatric clinicians know we are missing girls before they pass out of our care, but we may be missing a frightening number of girls. If we have an accurate estimate of both P(ASD) and the prevalence of the comorbidity we only need one of the conditional probabilities to establish the complete quantitative relationship. This was demonstrated by the first outcome of this paper, establishing the unknown P(AN|ASD). The only range of unbiased values for P(ASD) was from my first paper, but the current study has led to two further methods of establishing P(ASD), for a total of 14 estimates by six methods. These strongly suggest a prevalence of about 6%. Unrecognised ASD has a large number of psychiatric comorbidities ,54, and Medical nosology, including psychiatry, has a history of being categorical. This makes general sense in terms of simplifying diagnosis, management and prognosis, but there is increasing evidence that most mental health conditions are strongly polygenic, and that the genes tend to be pleiotropic, i.e., a single gene affects multiple phenotypic traits, to the extent that many, if not most, conditions overlap ,56,57. GThe diagnostic field of mental health is multidimensional and has a continuous rather than a categorical landscape. There are interactions within and between different levels. The hierarchy of complexity consists of genes, genetic modifiers such as copy number variations, single nucleotide polymorphisms and epigenetic alterations , the phyThe autistic spectrum is not one-dimensional like the electromagnetic spectrum. It is multidimensional starting with a complex of ASD phenotypes which then combine with comorbid conditions, such as ADHD, mood disorders, borderline personality disorder, psychoses and eating disorders. These then interact in different ways over time , as outlFemale ASD is then cryptic, common and comorbid with mental health conditions (MHC) in general and other relevant disorders, such as S-GJH. While the proportion of ASD comorbidity will vary with condition, age and circumstance, it is useful to look at the overall picture to get a feel for the extent of the problem. The lifetime prevalence of MHC is about 30% for both sexes . LiteratOn average 16%, or one in six women who have a mental health condition, have comorbid ASD. Consider the conditions we have looked at in this paper .Half of all individuals with a mental health disorder have their onset by 18 years, 62.5% by age 25 . This isHow this information translates into an overall model is currently a matter for debate . How, thSince female ASD is cryptic and common, it poses specific challenges for management. It is critical that the ASD signal is not missed in the phenotypic noise. If the criteria for ASD are met within the complex phenotype of an individual patient, the diagnosis should be made. Even if the features are \u201csubdiagnostic\u201d, they should be considered in tailoring management since therapeutic success is going to be more difficult than if the features are absent. The complexity and fluidity of an individual\u2019s phenotype mean the therapist should show considerable humility in making a diagnostic formulation, which then needs to be kept under review. It also means that management needs to be pragmatic. Management of these overlapping conditions requires self-knowledge by the patient, a supportive environment and appropriate interventions, often including medication ,67,68,69A paradigm of pediatric training is that the medical history, particularly that of the mother, is discounted at your peril. The parents of children with disabilities are routinely disbelieved, in particular in conditions which have no overt physical signs, such as high-functioning autism . This is\u201cThe reward for trying hard to be normal was to be ignored because you were acting normal and I look at stories online of kids who were going off the rails and I think, I should have just burnt more cars.\u201d .Girls, for example, show evidence of camouflaging behavior at school in 88% of cases .\u201cI was unbearable with my mother, but at school I was perfect.\u201d .The maternal history is even conflated with fabricated illness and can become a child-protection issue. This is causing serious distress in the families and the neurodivergent community . The diaIn a gray area, you need to establish a default position and have a plan to manage it. However, you need to be clear where the actual gray area is, and there are two.In the absence of corroboration, how reliable do you believe a convincing history to be?Is the overall picture including the history equivocal? My own practice in area one is to go with my pediatric training. The history will include a careful family history due to the high genetic content for ASD and its comorbidities. It is unfortunate that social and mental health issues in the family often count against the perceived veracity of the history when in Bayesian terms they actually reinforce the probability of ASD due to the mental health comorbidities. If in the future, the diagnosis is not sustained, no real harm is done since either the \u201cdisorder\u201d is no longer present or a more viable mental health diagnostic formulation will be being treated. However, be mindful that ASD may have been successfully converted to ASC by prior intervention.In area two, a second opinion and testing by a skilled psychologist will be helpful. If things remain equivocal, offer ongoing surveillance. If a crisis point is reached, then reassess.While testing may be useful as an adjunct to diagnosis, a recent report implies that, despite ADOS testing being regarded as a necessary part of a \u201cgold standard\u201d diagnosis, it is neither necessary nor sufficient in children under 6 years of age . At all The distinction between ASD and ASC is confusing. They may be thought synonymous but used to convey different philosophies of autistic neurodiversity . A more The study by Burrows et al.  implies A long-term strategy guided by patience is essential. A diagnostic formulation and a way forward need to be negotiated with a communication style that the autistic person is comfortable with, including, for example, close-ended questions, a support person if needed and adequate time to respond, including written responses. The effect of comorbid anxiety must never be underestimated. A useful analogy may be trying to get by in a foreign language and the languages of \u201cneurotypical\u201d and \u201caspie\u201d are often barely mutually intelligible.Consider the problem from the perspective of the autistic person. Obviously, the better you can handle a foreign language the less stressed you will be. If you can only just cope it is exhausting work. Body language and cultural norms are different. Reading is easier than conversation because you have the time to process it. You hope the foreigner does not think you are intellectually impaired or mentally ill. It might be safer to shut up (if I feel in control) or shut down (if I do not feel in control) and say nothing. Where the analogy fails, is the foreigner will usually allow for the fact that you are not a local, but with ASD you are desperately pretending to be a local and the other party is often unsympathetic, \u201cAnd the shouting really hurts my brain!\u201d.We all camouflage depending on the social situation but imagine having to do it in a foreign language and culture you do not really understand when interacting in your own society every day.Intrafamilial clashes are common since ASD is highly genetic. The adults need to understand this and adapt. The therapists need to listen , not onlIn particular, a top-down approach does not work in autism therapy. This applies both to the patient, and if appropriate, to the family, who have to implement the plan. The wise clinician, personifying the Art of management, will adopt the following approach, adapted from Chapter 17 of the Tao Te Ching, attributed to Lao Tzu :The best therapist values her words and uses them sparingly.When she has accomplished her task the patient says:\u201cAmazing! I did it all by myself!\u201d.One clinician can drill down deeply into qualitative aspects and quantitative variables of individual patients. These may include gender, referral patterns and details of where they fit in families, especially blended families. Comparative studies can be very finely focused. Due to the personal relationship between the clinician and the patient/family, it is easy to get a study population which reflects the local drainage population. My experience has been that the families are very aware of the difficulties that autistic females have to deal with, and the participation rate where needed has been 100%. However, there is a greater risk of systematic errors, such as diagnostic bias or local patient variation not reflecting a larger population. Absolute prevalence studies cannot be done and smaller numbers make time-based comparisons inaccurate. The weaknesses can be overcome if there are sufficient published studies but in mental health, they are often sparse in terms of gender specification and age range, and the results are widely variable due to the imprecision of diagnostic specificity and comorbid overlap.Be gender specific in epidemiological and clinical reporting. Try to think of more ways to establish female ASD variables: epidemiology, clinical features, diagnosis and management. If the greater true prevalence of female ASD is confirmed, take it much more into consideration in clinical management. Take advantage of comorbid variables to use Bayes\u2019 theorem to fill multiple knowledge gaps. It appears that mental health conditions are continuous and not categorical, and this is going to be a challenging task. While the method is important for overlapping mental health conditions, it will also apply to any comorbid condition. For anorexia nervosa, rigorously search for comorbid ASD and improve management techniques in the short and long term to improve prognosis.There appears to be a prevalence of about 8\u20139% of anorexia nervosa in female ASD by about the fourth decade.There are at least four factors contributing to it not having been quantified:Female ASD is cryptic.Adult female ASD services are fragmentary.Peak AN time of diagnosis coincides with the adolescent to adult transition.The proportion of AN in ASD is elevated above AN prevalence but not dramatically so.There appears to be a prevalence of about 6% of female ASD by about the third decade.The data for both conditions is still sparse, and the lifetime prevalences are likely to be even higher as the diagnosis of adults improves.Autistic neurodiversity in females is common. The prevalence is unknown but is likely to be significantly greater than 6%.Female ASD is still poorly recognized and it appears to be a common comorbidity in mental illness with one in six females only partially diagnosed at best. This would be a common causal factor of treatment failure in these illnesses. Most females camouflage their ASD. Our best diagnostic guide for girls is the mother\u2019s history. Our best diagnostic guide for women is to think of it. The key skill in diagnosis and therapy is listening."}
+{"text": "Autism spectrum disorder (ASD) is a group of clinically heterogenic neurodevelopmental disorders, with intellectual disability being one of its common comorbidities. No large-sample, multicenter study has focused on the neurodevelopmental aspect of preschoolers with ASD. This study investigated the neurodevelopmental characteristics of preschoolers with ASD in China and explored the association between them and the core symptoms.We enrolled 1019 ASD preschoolers aged 2\u20137\u2009years old from 13 cities around China between May 2018 and December 2019, and used the revised Children Neuropsychological and Behavior Scale (CNBS-R2016) to assess their neurodevelopment. Their autistic core behaviors were evaluated based on their Social Responsiveness Scale (SRS), Autism Behavior Checklist (ABC), Child Autism Rating Scale (CARS), and communication warning behavior (CWB) scores in the CNBS-R2016.Based on general developmental quotient (GQ) <\u200970, 68.4% of the preschoolers with ASD had a developmental delay (DD), rated mild in 32.7% of them. The highest DD rate (>\u200970%) was found in language and personal-social skills, followed by fine motor skills (68.9%). Gross motor skills had the lowest DD rate (34.0%). We found that fine motor, language, and personal-social developmental quotients (DQs) were significantly lower than gross motor skills in no DD (GQ\u2009>\u200970), mild DD (GQ 55\u201369), and moderate and below DD groups (GQ\u2009\u2264\u200954). Furthermore, the DQs for language and personal-social skills were significantly lower than for gross and fine motor skills in both DD groups. The ABC, SRS, CARS, and CWB scores in the no DD group were the lowest, moderate in the mild DD group, and highest in the moderate and below DD group. Besides, negative correlations were found between the DQs of the four domains and the ABC, SRS, CARS, and CWB scores, of which the language and personal-social skills DQs had the strongest correlations.Preschoolers with ASD had unbalanced neurodevelopment domain patterns and their neurodevelopmental levels were negatively correlated with the autism core symptoms. Hence, pediatricians should actively evaluate the neurodevelopment of children with ASD and conduct long-term follow-up during their early childhood to promote early diagnosis and develop personalized intervention plans.ChiCTR2000031194, registered on 03/23/2020. Autism spectrum disorder (ASD) is a group of neurodevelopmental disorders characterized by social communication deficits, restricted interest in the surroundings, and stereotyped repetitive behaviors . The repID may adversely affect the social interaction and behavior of individuals with autism. The greatest difficulty of children with ASD and ID is in developing social competence . Lower iEarly childhood is characterized by brain plasticity and neurodevelopmental instability. When an individual under the age of 5 years fails to meet the expected intellectual function developmental milestones, a global developmental delay (DD) will be diagnosed rather than ID . Hence, To date, no multi-center large-scale study analyzed the characteristics of preschool children with ASD and ID or the association between their neurodevelopmental levels and core symptoms in China. Hence, we conducted this large-scale, multi-center cross-sectional study. We aimed to investigate the distribution of neurodevelopmental characteristics in preschool children with ASD in China and explore the relationship between their neurodevelopmental levels and core symptoms. Our study could improve our understanding of these features in this young population and provide a useful reference for early identification, diagnosis, and accurate intervention in ASD.This study is part of the China Multi-Center Preschool Autism Project (CMPAP) . ParticiParticipation was voluntary, and the primary caregiver of all participants signed informed consent forms. The Ethics Committee of the Children\u2019s Hospital of Chongqing Medical University approved the study [Number: (2018) IRB (STUDY) NO. 121], and the study was registered in the Chinese Clinical Trial Registry .The caregivers of the participants completed a questionnaire that included the name, age, sex, and ethnicity of the patient, and parental education status. The ASD symptoms were evaluated using the Autism Behavior Checklist (ABC), Social Responsiveness Scale (SRS), and Childhood Autism Rating Scale (CARS). The ABC assesses autism-related behavioral problems using five subscales: sensory, relating, stereotypic behavior, language, and social independence, with the score for normal children <\u200953 points . The SRSp-value <\u20090.05 was considered statistically significant.The Shapiro\u2013Wilk test was used to assess data normality. Continuous variables are presented as means\u2009\u00b1\u2009standard deviations (M\u2009\u00b1\u2009SD). Categorical variables are presented as counts (%) and were compared using the chi-squared test, followed by the Bonferroni correction for multiple comparisons. Missing values in the ABC, SRS, and CARS scores were substituted by multiple imputation. The DQs in the CNBS-R2016, ABC, SRS and CARS had skewed distribution, so the Kruskal-Wallis test compared the data, and the results are presented as medians and interquartile ranges (IQRs). Spearman\u2019s rank correlation coefficient explored the association between the neurodevelopmental levels and core symptoms in children with ASD. Statistical analysis was performed using the IBM SPSS Statistics for Windows, Version 19.0 . Figures were generated using the GraphPad Prism software, Version 8.0.2.263 . A The participant characteristics are presented in Table\u00a0A GQ under 70 indicates DD. Among the participating children, 322 (31.6%) were at a normal neurodevelopmental level (GQ\u2009\u2265\u200970), and 697 (68.4%) showed DD (GQ\u2009<\u200970). Of these, the DD of 333 (32.7%) was mild , and it was moderate  in 269 (26.4%), and severe and extremely severe (GQ\u2009\u2264\u200939) in 95 (9.3%). Overall, the prevalence of DD in our cohort was 68.4%, of which most (32.7%) showed mild DD (Table\u00a0p\u2009<\u20090.001). The DQ of the gross motor skill  was the highest, followed by fine motor , personal-social , and language  skills . The DQ of the fine motor skills was significantly higher than of the language and personal-social skills .The DD in gross motor, fine motor, language, and personal-social skills in children with ASD are shown in Table p\u2009=\u20090.14, 1.00, respectively) but significantly higher in the other two groups (p\u2009<\u20090.001). These findings indicate that the neurodevelopmental level structure in preschool children with ASD is uneven regardless of whether they had DD or not. Besides, language and personal-social skill development was most affected, especially in those with DD, followed by fine motor skills. Gross motor development was the least affected.We divided the participants into three subgroups based on their GQ: no DD, mild DD, and moderate and below DD. As can be noted from Table\u00a0To explore the associations between the neurodevelopment levels and core symptoms in children with ASD, we compared the ABC, SRS, CARS, and CWB scores in the CNBS-R2016 of the no DD, mild DD, and moderate and below DD groups. We found that the moderate and below DD group had the highest ABC, SRS, CARS, and CWB scores, followed by the mild DD and no DD groups Table\u00a0.Table 5Cp\u2009<\u20090.01) included language  and personal-social  as the strongest, followed by fine motor  and gross motor . These results suggest that the lower the neurodevelopmental level the children with ASD had, the more severe the autism core symptoms were. The neurodevelopmental levels appear to be most strongly associated with the CARS scores.Spearman\u2019s rank correlation coefficient (rs) analyzed the associations between the neurodevelopment quotients of the four subscales  and the ABC, SRS, CARS, and CWB scores, shown as a correlation heat map in Fig.\u00a0ASD clinical heterogeneity is considerable, and it often co-exists with other diseases such as ID, which can adversely affect the symptoms, quality of life, and prognosis. However, few large-scale studies explored the neurodevelopmental characteristics of preschool children with ASD. This study investigated the characteristics of the neurodevelopmental domains and the association between them and autistic symptoms in preschool children with ASD.Intellectual status assessment in children with ASD is critical. For example, the DSM-5 requires clarifying if ASD is associated with ID . Baird eMany studies have consistently shown that ASD was associated with an irregular intellectual profile. It scored high on the Perceptual Reasoning Index and low on the Verbal Comprehension Index, Working Memory Index, and Processing Speed Index , 25. In The ABC, SRS, CARS, and CWB scores in the no DD group in our study were the lowest, followed by mild DD and moderate and below DD. This was consistent with reports showing that individuals with ASD and low mental age exhibit more severe symptoms than the children with ASD and high mental age , 28. HinOur study had several limitations. First, our participants came from special education institutions and outpatient clinics, restricting our ability to enroll children with ASD in the entire DQ spectrum. Therefore, the rate of ASD with DD in this study was relatively high. Second, this was a cross-sectional study; therefore, we cannot indicate how the DQ and core symptom profiles changed through childhood.DD was detected in 68.4% of the participating preschool children with ASD, showing an uneven pattern in the neurodevelopment domains. The DD in the language and personal-social skills were the worst, followed by fine motor, with gross motor being the least affected skill. The neurodevelopmental levels were negatively associated with core autism symptoms, of which language and personal-social skills had the strongest correlations. These results suggest that a comprehensive neurodevelopmental level assessment should be part of the regular evaluation process of patients with ASD visiting the clinic, and long-term follow-up should be enacted. These could promote early diagnosis and intervention and help develop personalized intervention plans for children with ASD."}
+{"text": "Autism spectrum disorder (ASD) is a lifelong neurodevelopmental disorder, with only a small proportion of people obtaining optimal outcomes. We do not know if children with ASD exhibit abnormalities in the white matter (WM) microstructure or if this pattern would predict ASD prognosis in a longitudinal study. 182 children with ASD were recruited for MRI and clinical assessment; 111 completed a four-year follow-up visit . Additionally, 72 typically developing controls (TDC) were recruited. The microstructural integrity of WM fiber tracts was revealed using tract-based spatial statistics (TBSS) and probabilistic tractography analyses. We examined the neuroimaging abnormality associated with ASD and its relationship to ASD with optimal outcome. The ASD+ and TDC groups were propensity score matched to the ASD\u2212 group in terms of age, gender, and IQ. TBSS indicated that children with ASD exhibited abnormalities in the superior longitudinal fasciculus (SLF), inferior longitudinal fasciculus (ILF), and extending to the anterior thalamic radiation (ATR) and cingulum; whereas the ASD+ group showed more severe abnormalities than the ASD- group. Probabilistic tractography analysis revealed that ASD+ group exhibited lower Fractional Anisotropy (FA) of the\u00a0left superior thalamic radiation (STR L) than ASD\u2212 group, and that FA value of the STR L was a significant predictor of optimal outcome (EX(B), 6.25; 95% CI 2.50\u201415.63; p\u2009<\u20090.001). Children with ASD showed significant variations in SLF_L and STR_L, and STR_L was a predictor of \u2018ASD with optimal outcome\u2019. Our findings may aid in comprehension of the mechanisms of \u2018ASD with optimal outcome\u2019. The prevalence of ASD is estimated to be 1\u20132%2. With considerable long-term impairments across multiple domains3, the recommended treatment for ASD is behavioral training, while medication treatment utilized mostly to control comorbid disorders4. Currently, there is no specific treatment for the core symptoms of ASD.Autism spectrum disorder (ASD) is a neurodevelopmental disorder, characterized by deficits in social interaction, social communication, and restricted, repetitive patterns of behavior and interests5. ASD is regarded as a spectrum term that encompasses a plethora of possibly complex etiopathogenic processes6. Brain structure and function abnormalities have been implicated in the neurology of ASD8. The diffusion MRI (dMRI) study using tract-based spatial statistics (TBSS) analyses revealed that ASD is associated with several long fiber tracts10. The fractional anisotropy (FA), mean diffusivity (MD), radial diffusivity (RD), and axial diffusivity (AD) were all commonly used dMRI metrics. The most usually used metric was FA. Typically, a breakdown in WM integrity resulted with a decreased FA11. TBSS is a voxel-based methodology that provides a quick and automated means of assessing diffusion data12; nevertheless, determining a differentiation between adjacent, differently oriented fiber bundles with similar FA values is challenging, which results in an undesired loss of tract anatomical topology. Probabilistic tractography is beneficial for dealing with complex fiber architectures, such as crossing fibers and signal noise13. Previous tractography studies on ASD have shown abnormal WM integrity in the cingulum14, thalamus pathway15, and in the association fibers, including: superior longitudinal fasciculus(SLF)17, inferior longitudinal fasciculus(ILF)19, inferior frontal-occipital fasciculus (IFOF)20, uncinate fasciculus (UF)20. The breakdown in WM integrity typically generally resulted in a lower FA21, which is sensitive to fiber coherence, myelination, and fiber density. In addition, other dMRI metrics also measure axonal integrity and are sensitive to alteration of brain tissues and axonal damage22. Several meta-analyses reviewed the dMRI studies of ASD. One study found that ASD suffers from reduced FA in the right occipito-temporal, inferior occipital and lingual gyrus, fusiform and inferior temporal gyrus23; Another study indicated that the uncinate fasciculus(part of SLF) and frontal and temporal thalamic projections were responsible for complex socio-emotional functioning of ASD24; and the splenium of corpus callosum and the cerebral peduncle were found to be associated with ASD25. Above all, brain WM microstructure abnormality (impaired WM fiber integrity) has been confirmed in ASD; yet, no consensus on the exact tract has been obtained. Diverse ASD subgroups may exhibit distinct brain structural abnormalities, as well as distinct cognitive profiles, clinical profiles, and prognoses.The etiologies of ASD have been extensively studied27. The 'optimal outcome' was defined as the absence of significant autism symptoms and a normal range of social functioning; nevertheless, additional issues, such as impaired cognition or susceptibility to other mental diseases, may still persist. The developmental trajectory of children with ASD between the ages of two and fourteen years might be divided into six distinct categories, according to a large longitudinal study (n\u2009=\u20096975)28. The reported stability rates for ASD vary greatly, when socially adapted functioning is chosen as a criterion32. 3\u201325% of the children with ASD lose their ASD diagnosis later in life, according to Helt et al.33. The diagnosis of ASD remains persistent, and only a tiny proportion of children with a history of ASD have obtained the optimal outcomes, according to various longitudinal studies26. At the present, understanding about the mechanisms underlying the \u2018optimal outcome\u2019 is inadequate.Individuals with a history of ASD who, over time, no longer meet the diagnostic criteria for ASD are referred to as \u2018ASD with optimal outcome\u201935. Alternatively, the concept of 'neural compensation' has been proposed, in which behavioral normalization is accomplished through the recruitment of alternative brain pathways rather than through the normalization of processing pathways. In this paradigm, brain activation in ASD with optimal outcome would be considerably different from control and current diagnosis ASD36. A reasonable assumption is the 'residual ASD' pattern, which shows that the ASD associated with optimal outcome continues to reflect the individual's ASD background. As a result, brain activation of \u2018ASD with optimal outcome\u2019 is comparable to that observed in ASD with current diagnosis37. Furthermore, we wondered whether ASD with optimal outcome exhibited distinct neuroimaging pathways from the outset in comparison to ASD with a persistent diagnosis? Previous longitudinal study found that processing speed abnormality of ASD in adulthood might partially attributable to WM microstructural integrity38. The anatomical asymmetry of the fusiform gyrus may have significant consequences for the severity of symptoms in ASD and demonstrates a developmental trajectory distinct from that of controls39. However, no cohort study has explored WM microstructure abnormality associated with ASD with optimal outcome.The neuroimaging disparity between ASD with current diagnosis and ASD with optimal outcome has revived renewed interest in retrospective cohort studies. According to one concept, 'neural normalization' can account for behavior normalization in ASD; in this scenario, the ASD with optimal outcome should resemble controlsThe study aimed to explore the neuroimaging differences between ASD with optimal outcome, ASD with persistent diagnosis, and healthy controls. We wondered whether individuals who achieved optimal outcome exhibited a distinct WM microstructure, and whether this pattern might be used to predict clinical behavioral normalization. Our hypothesis were that (i) children with ASD had altered WM fiber integrity in the thalamus pathway, the association fibers, and other brain areas, as evidenced by previous studies; (ii) It was expected that the patients with optimal outcome would exhibit distinct brain WM abnormalities when compared to ASD with persistent diagnosis, and that the abnormalities would be associated with prognoses.The study was conducted from September 2014 to September 2021, with participants drawn from West China Hospital of Sichuan University and local community. The neuroimaging mechanism of ASD with optimal outcomes is analyzed as part of another study in this collection: The National Natural Science Foundation of China (NO. 81371495). The primary goal of the original research was to explore the biomarkers of ASD, and the current study is a follow-up study involving the same cohort. A total of 254 participants were recruited online and offline . Off-line method was conducted in the West China Hospital outpatient. Our online recruitment advertises were on the main social platforms including WeChat as well as the official accounts of the schools and hospitals involved. All patients were medication-naive and met the criteria of DSM-5. ASD subjects were excluded if they had a history of head injury, other neurodevelopmental or psychiatric disorders, and metabolic or genetic disorders such as Fragile-X Syndrome. TDC had never used psychotropic medications and had no history of neurodevelopmental, cognitive, learning, or neuropsychiatric problems. To confirm that they were typically developing, all of them had extensive testing, including the IQ and psychiatric testing. After a thorough explanation of the study, parents of participants provided the written informed consent for study participation, which was approved by the Medical Ethical Committee of West China Hospital of Sichuan University.40) and the Autism Diagnostic Observation Schedule (ADOS41) to confirm ASD diagnosis, as well as the Chinese version of the Schedule for Affective Disorders and Schizophrenia-Parent Long Version (K-SADS-PL) interview to exclude comorbidities; third, after receiving their diagnosis, participants were required to take an IQ test and have an MRI scan. Around four years after registration, participants were requested to take part in a follow-up assessment . In Fig.\u00a0All participants completed the diagnosis at time 1 (September 2014\u2013September 2017): First, the child should be diagnosed by one professional child psychiatrist based on the DSM-5; second, a parent interview and a child assessment should be conducted using the Autism Diagnostic Interview-Revised (ADI-R3). dMRI scans were acquired using a two-dimensional diffusion-weighted echo planar imaging sequence .All brain imaging was performed on a 3.0-T imaging system  at the Tibet Chengban Branch of Sichuan University West China Hospital. Three-dimensional T1 images were acquired using a spoiled gradient recalled echo planar imaging sequence 12 and Global Probabilistic Tractography13.The dMRI data were processed using FSLVoxelwise analyses were subsequently conducted using TBSS, with mean FA skeleton created by aligning each participant\u2019s FA image to the Montreal Neurological Institute (MNI) 152 space and FA threshed at 0.2 to suppress areas of low fractional anisotropy. Secondary dMRI metrics were analyzed using the mean FA skeleton. Multiple comparison correction was performed using TFCE with identical settings (5000 permutations) in the Randomize program as for the TBSS and further analyses. The p-value threshold for statistical maps was set to 0.05, with TFCE FWE fully corrected.44, we worked to define standard space \u201cseed\u201d, \u201ctarget\u201d, \u201cstop\u201d and \u201cexclusion\u201d ROIs, and mapped in individual native space based on anatomical landmarks. Then, tractography was performed for each subject and for each structure in native space with final set consisting of 27 tracts45. Low probability voxels were rejected at a threshold of 0.5%, similar to previous study. Only those reconstructed single trajectories present in 70% of the participants in each group were left for subsequent analysis. For each individual separately, we created an average fiber bundle at group level for the 27 major fiber tracts. As a final step, tract density images in subject native space were warped to common space, and then dMRI metrics were exported and averaged across the whole fiber tract for further analysis.Separately, after quality control, a probabilistic tractography was fitted for each voxel using BEDPOSTX (the probabilistic distribution of diffusion parameters at each voxel was built up by Bayesian estimation of diffusion parameters). First, based on the protocols described byWe applied propensity score matching (PSM) to balance the IQ, age, and gender characteristics of the groups in order to avoid bias. We utilized the most common PSM approach of Nearest Neighbor Matching with a 1:1 matching ratio. PSM was performed using the SPSS plug-in psmatching 3.04. After PSM, the categorical and dimensional analysis were performed. A one-way ANOVA was used for each statistic, with post-hoc pairwise group comparisons. The Boneferroni multiple comparison test was employed for multiple comparisons. Pearson correlation was used to explore the association with dMRI metrics and autism symptoms. Multivariate logistic regression analysis was conducted by fitting a logistic regression model to identify neuroimaging risk factors for ASD with \u2018optimal outcome\u2019. A statistically significant difference was defined as p\u2009<\u20090.05 (two-tailed).This study was approved by the ethics committee of Medical Ethical Committee of West China Hospital of Sichuan University, and written informed consent was obtained from all participants in accordance with the Declaration of Helsinki.Using PSM, ASD+ and TDC groups were matched on age, gender, and IQ to ASD\u2212 group. Each group  had a total of 30 participants. , corticospinal tract (CST), cingulum, inferior fronto-occipital fasciculus, superior longitudinal fasciculus (SLF), and forceps major) in ASD+ versus TDC group. The results also indicated that the ASD\u2212 group exhibited reduced FA in the bilateral ATR, CST, cingulum, forceps major; and the right hemisphere of inferior fronto-occipital fasciculus, inferior longitudinal fasciculus (ILF), and SLF, when compared to TDC. However, we did not identify any significant differences in brain area between the ASD\u2212 and ASD+ groups, which may be due to confounding variables .  whereas the MD/RD correlated positively  than ASD+ and TDC. As the FA values of the traced antegrade fibers were extracted to indicate the integrity of the epicenter white matter. It suggested that the ASD with optimal outcome had the most intact WM integrity among the three groups. The compensation theory may explain this phenomenon36. This finding contradicts prior research indicating that ASD had a reduced FA in Fma57. Similarly, previous tractography studies have also reported inconsistent results indicating that individual with ASD did not exhibit WM abnormality in Fma58. The inconsistent results may be due to the heterogeneity of ASD. Moreover, Fma integrity impairment (MD increased) predicted ASD with optimal outcome. The finding was not replicated by other dMRI metrics in this study, thus the conclusion must be interpreted cautiously.The splenium of the corpus callosum connects with the occipital lobes to form the Forceps major (Fma). The Fma plays roles in several ASD related cognitions, such as semantic processing27. Our cohort's recovery rate is 27%, which is consistent with prior research (1\u201332%)59. We observed a high recovery rate of ASD, maybe because we included all high-functioning autism. Additionally, our criteria for \u2018optimal outcome\u2019 are clinical judgement, further objective measures such as social adaptive scales may be adopted in the future. The concept of \u2018optimal outcome\u2019 has led to a controversial topic: can ASD be cured? Longitudinal cohort studies of ASD have consistently found that some patients with ASD no longer meet the diagnostic criteria for ASD in adulthood61. Further analyses63 have identified common characteristics in ASD with \u2018optimal outcome\u2019: normal intelligence, impaired social cognition, unsatisfied intimate relationships, poor neurocognitive functioning. Studies have also identified some risk factors associated with ASD prognosis, including: intelligence66, language ability67, symptom severity68, gender69, etc. The effect of symptom severity on prognosis is well established68. In this study, there was no difference in baseline symptom severity between ASD+ and ASD\u2212 groups, allowing us to evaluate the effects of neuroimaging features on ASD prognosis. Additional research is required to determine the predictors of ASD prognosis.The term \u2019optimal outcome\u2019 referred to individual with ASD history who no longer fit the diagnostic criteria for ASDThis study contains some limitations. To begin, our sample was limited to individuals with high-functioning ASD to ensure compliance with scanner guidelines. Additionally, we excluded ASD with comorbidities from this investigation, which may limit its generalizability to the broader clinical ASD community. The rigorous inclusion/exclusion criteria were implemented to avoid bias; additional research was required to include a larger sample size with stratified analyses. Second, our original study sample size was moderate, which likely increased our type II error rate. Third, a four-year follow-up is insufficient, as parts of ASD with persistent diagnosis will develop to adapt to social life over time. Larger samples and longer follow-up periods will enable future research on WM microstructure in ASD with optimal outcome. Finally, because we did not rescan the participants at timepoint 2, we cannot assess developing trajectory of neuroimaging anomalies in ASD.We found that children with ASD showed significant differences in brain WM microstructure in SLF_L and STR_L fibers. STR_L fiber integrity differed between optimal outcome group and persistent diagnosis group, and STR_L was a predictor of behavioral normalization. Our findings may help understand the mechanisms of optimal outcome in ASD and develop therapeutic targets to overcome the new conundrum of heterogeneity impeding ASD pathogenesis research.Supplementary Information."}
+{"text": "M = 33 years old; SD = 11), 70% of whom were females. Participants were surveyed for specific type of Internet use severity, appearance anxiety, self-compassion, and image and use of performance-enhancing drugs (IPEDs). Results were compared cross-culturally. The mean time spent online was 5 h (SD = \u00b13) of daily browsing during the pandemic. The most commonly performed activities included social networking, streaming, and general surfing. A strong association between these online behaviours and appearance anxiety, self-compassion, and IPEDs use was found after adjustment for possible confounders, with higher scores being associated with specific online activities. Significant cross-cultural differences also emerged in terms of the amount of time spent online during the initial stages of the COVID-19 pandemic.This cross-sectional study aimed to explore specific online behaviours and their association with a range of underlying psychological and other behavioural factors during the COVID-19 pandemic. Eight countries  participated in an international investigation involving 2223 participants ( Problematic usage of the internet (PUI) encompasses a variety of problematic behaviours, including excessive general internet surfing, video gaming, pornography watching, shopping online, gambling online, social networking, cyberchondria, and digital hoarding . In 2020M = 28; SD = 9 years old) and collecting self-reported behavioural change highlighted that 46.8% of the participants reported an increased internet dependence, with 16.6% of them showing a prolonged duration of internet use and 4.3% manifesting more severe dependence, measured by the internet addiction test (IAT) ), together with demographic indicators  and PUI risk and protective factors , all concerning specific online activities. Bonferroni corrections were adopted to reduce Type I error probability due to multiple comparisons.p-value was divided by the number of dependent variables (05/12 = 0.0042). Thus, a p < 0.004 was required for a factor to later be considered in the multivariable analysis. The multivariable analysis was needed to determine whether appearance anxiety, self-compassion, IPEDs use, and activity level remained independently associated with online activities after adjustment for demographic, self-reported history of mental illness, PUI risk factors, and country . The multivariable regression models included only of those variables that had been significantly associated with their respective online activity after adjustment in the Pearson\u2019s or Spearman\u2019s correlation analyses.As 12 different online activities were presumed to be associated with various psychological, demographic, and PUI risk factors, the SD = 3.4) of daily browsing during the pandemic. The most commonly performed activities included social networking, streaming, and general surfing. The sample\u2019s mean score for appearance anxiety was 16.83 (SD = 5.54) out of 40, ranging from 10 to 39, with approximately 21% (n = 461) of participants scoring over the cut-off score of 21, indicating severe anxiety towards one\u2019s body image. The group\u2019s mean score in the Self-Compassion Scale was 30.95 (SD = 6.04) out of 60, ranging from 12 to 48, with 22% (n = 489) of participants scoring less than the cut-off score of 27, indicating low self-compassion.Across the entire study sample, the mean time spent online was 5.2 h . Among all the surveyed participants, 724 (32.6%) reported IPEDs use  = 81.611, p < 0.001 (effect size d = 0.37). The Dunn\u2013Bonferronni method-based post-hoc analysis showed that the total daily duration of internet use among Spanish participants was considerably lower than with participants in Italy (effect size d = 0.50), Portugal (effect size d = 0.42), Brazil (effect size d = 0.26), and the UK (effect size d = 0.57) (p < 0.001). Significant differences among countries were observed in the prevalence of online behaviours. A detailed analysis on this and other characteristics is provided in Differences among countries were observed for the duration of internet use, \u03c7r(2221) = 0.12 p < 0.001), gambling (r(2221) = 0.08 p < 0.001), sports (r(2221) = 0.09 p < 0.001), pornography (r(2221) = 0.12 p < 0.001), streaming (r(2221) = 0.08 p < 0.001), digital hoarding (r(2221) = 0.07 p < = 0.001), and cyberchondria (r(2221) = 0.11 p < 0.001).Correlation analyses showed that age, gender, and duration of internet use were correlated with specific online behaviours. Appearance anxiety and self-compassion were correlated with almost all online activities, with the exception of online gambling and online sports activities, which were uncorrelated with self-compassion scores. Positive correlations were also observed between IPEDs use and online shopping (r(2221) = \u22120.09 p < 0.001), while there was a positive correlation between physical activity and online sports (r(2221) = 0.14 p < 0.001). Self-reported anxiety correlated positively with general surfing (r(2221) = 10 p < 0.001), massively multiplayer online role-playing games (r(2221) = 0.12 p < 0.001), skills games and time wasters (r(2221) = 0.08 p < 0.001), internet gaming (r(2221) = 0.14 p < 0.001), online shopping (r(2221) = 0.07 p = 0.001), social networking (r(2221) = 0.13 p < 0.001), pornography (r(2221) = 0.07 p = 0.001), streaming (r(2221) = 0.13 p < 0.001), digital hoarding (r(2221) = 0.09 p < 0.001), and cyberchondria (r(2221) = 0.19 p < 0.001). Self-reported depression correlated positively with general surfing (r(2221) = 0.09 p < 0.001), internet gaming (r(2221) = 0.08 p < 0.001), pornography (r(2221) = 0.08 p < 0.001), streaming (r(2221) = 0.10 p < 0.001), digital hoarding (r(2221) = 0.08 p < 0.001), and cyberchondria (r(2221) = 0.09 p < 0.001). Self-reported addiction behaviours (including smoking) were associated with more than half of the online activities surveyed, including general surfing (r(2221) = 0.07 p = 0.001), multiplayer online role-playing games (r(2221) = 0.10 p < 0.001), skills games and time wasters (r(2221) = 0.13 p < 0.001), internet gaming (r(2221) = 0.08 p < 0.001), online gambling (r(2221) = 0.07 p = 0.001), pornography (r(2221) = 0.20 p < 0.001), and streaming (r(2221) = 0.07 p = 0.001). Correlation analyses are provided in Engaging in any type of sporting activity was negatively associated with skills games and time wasters (p < 0.001), online shopping , social networking , pornography use , digital hoarding , and cyberchondria . Self-compassion scores were negatively associated with higher levels of skills games and time wasters , streaming , digital hoarding , and cyberchondria . IPEDs use was associated with online shopping , online gambling , pornography , streaming , and cyberchondria . Negative associations remained between engaging in any type of sporting activity and skills games and time wasters , while positive associations were observed between sporting activity and online sports . Several associations remained between self-reported addiction (including smoking) and massively multiplayer online role-playing games , skills games and time wasters , online gambling , and pornography . The multivariable model is provided in In order to explore the specific factors associated with different online activities, we adjusted for the possible overriding effects of age, gender, country, and duration of internet use. After theseadjustments, appearance anxiety remained associated with general surfing , online shopping (f2 = 0.07), internet gaming (f2 =.09), digital hoarding (f2 =.10), and skills games and time wasters (f2 =.10); small for cyberchondria (f2 =.11), massively multiplayer online role-playing games (f2 =.16), and general internet surfing (f2 =.18); moderate for streaming (f2 = 0.25) and social networking (f2 = 0.31); to large for pornography use (f2 = 0.65).We used post-hoc power analysis to determine the effect size (as measured by Cohen\u2019s f) of our findings. The effect sizes ranged from very small for online gambling , social media positively facilitated self-management of physical activity and diet and contributed to increased health and well-being.Appearance anxiety was found to be associated with the following online activities: general surfing, online shopping, online gambling, social networking, pornography use, digital hoarding, and cyberchondria. Individuals may use these activities to try to achieve and maintain a body image that corresponds to the valued ideas of beauty, sometimes with devastating effects . Modern In this study, IPEDs use was associated with increased online shopping, pornography, streaming, and cyberchondria. Engaging in any type of live sporting activity was negatively associated with increased levels of skills games and time-wasters. However, being engaged in live sports activities was associated with increased levels of online sports. The increased preference for live sports activities could be generalised to online sports and promote the belief that the mastery and knowledge of live sporting activities can benefit online activity. The associations found are new, and no other studies explored general physical activity and its association with online behaviours from a cross-cultural perspective.specific online behaviour. Our findings support the idea that self-compassion could be a positive coping recourse in adverse life circumstances. Previous research indicates that self-compassion could be boosted with relatively simple interventions, including online training [Higher self-compassion was negatively associated with increased skills games and time wasters, streaming, digital hoarding, and cyberchondria. Several previous studies showed negative associations between self-compassion and PUI ,49,50. Htraining . Thus, iHowever, we have to acknowledge that the magnitude of the associations for appearance anxiety, self-compassion, IPEDs use, and general engagement in sporting activity ranged from being very small  to small/moderate  and to large . These findings indicate a complexity of different online behaviours, as well as different factors that contribute to the development of particular online behaviours. Thus, more research is needed focusing on specific online behaviours rather than on PUI in general. Therefore, we further discuss the four most robust models explaining online activities during the initial COVID-19 period.Our data showed that general internet surfing, consisting of any unstructured online activities, was associated with appearance anxiety. Specifically, we found that PUI correlated with AAI, which is in line with the recent meta-analysis that showed small\u2013moderate correlations between PUI and body dissatisfaction in both men and women. In our study, appearance anxiety as well as PUI were self-reported. Therefore, stronger relationships between the proposed factors might be expected in clinically relevant online addictions. However, the idea that variables such as appearance anxiety may contribute to the general level of online activities creates a possibility for a better understanding of the formation of addictive online behaviours and, therefore, earlier targeted interventions.Online streaming, including music or video, on any platform, was associated with lower levels of self-compassion, more IPEDs use, younger age, and greater duration of internet use. A survey of 490 video streaming service users found that excessive use was associated with low self-control and self-esteem . HoweverN = 23,533) conducted within the Norwegian population confirmed the association between general anxiety and the addictive use of social media [The association between social networking and appearance anxiety is consistent with the research literature in the field to date ,56,57,58al media . Furtheral media . This noEngagement in online pornography activity during the initial phases of the COVID-19 pandemic was associated with almost all variables examined in the current study. Specifically, online pornography use was associated with higher levels of appearance anxiety, IPEDs use, younger age, male gender, self-reported addictions (including smoking), and duration of internet use. Various studies have confirmed associations between pornography use frequency and younger age, male gender, and self-reported addiction ,62,63,64Despite these novel results, our study has some limitations. Due to the large sample size and statistical power of the analyses, the associations of a small effect would have been detected, but such associations may not be of practical relevance, i.e., such findings may pose no clinical significance for psychological or health interventions or ecological significance. Another limitation concerns the cross-sectional design that prevented any conclusions concerning causality in the significant associations. The study was advertised online as seeking to find out the impact of COVID-19 on individuals\u2019 lifestyle behaviours. This type of advertisement might result in possible recruitment and responder bias . As the survey contained questions about PUI and related behaviours , this must be taken into consideration, given that the nature of the variables may have resulted in the over- or under-reporting of these kinds of behaviours.Our analysis also included a standard set of factors for each online behaviour model. However, several additional factors such as motivation, escapism tendencies , impulsiThe large sample size enabled us to observe minor effects. Thus, replication is required for the findings presented. Appearance anxiety, self-compassion, IPEDs use, and general engagement in sporting activity were all associated with different online activities, and the significance of these associations remained strong even after controlling for possible confounders, suggesting several modelling approaches for a better understanding of the factors contributing to different types of online behaviours. Based on the effect sizes, the models relevant for further investigation should include general internet surfing, streaming, social networking, and pornography use.In conclusion, our study showed the relationship between appearance anxiety, self-compassion, IPEDs use, and engagement in any sporting activity and various online activities. The strongest effects were observed for general internet surfing, streaming, social networking, and pornography use. Particularly, models including AAI, IPEDs use, age, gender, self-reported addiction, and duration of internet use factors were among the strongest predicting pornography use. Importantly, our study findings imply that not only well-known sociodemographic and mental distress factors are associated with engagement in online activities, but also appearance anxiety, self-compassion, IPEDs use, and general engagement in sporting activity are related to the various forms of online behaviour.Main contributionsCross-national differences are present in time spent online and the intensity of various forms of online behaviours.We found that specific novel psychological and behavioural factors such as appearance anxiety, self-compassion, IPEDs use, and engagement in any sporting activity and various online activities might contribute to various forms of online behaviours.General internet surfing, streaming, social networking, and pornography-use-prediction models should include appearance anxiety, self-compassion, IPEDs use, age, gender, self-reported addiction, and duration of internet use."}
+{"text": "Congenital diaphragmatic hernia (CDH) is an uncommon but potentially life-threatening surgical condition in neonates. Surgery can be performed by either open or thoracoscopic techniques. In this study, we compared the clinical efficacy, safety, and effectiveness of thoracoscopic and open CDH repair.A retrospective review of neonates with CDH who underwent operations at our hospital from 2013 to 2021 was performed. The various perioperative parameters were compared between neonates undergoing thoracoscopic and open surgery.p\u2009<\u20090.001); shorter duration of postoperative mechanical ventilation ; early feeding ; and shorter time to reach optimal feeding . There was one postoperative death in the open group and no death in the thoracoscopic group. The median follow-up time of the two groups was 23.8 months (20.5 months in open group and 25.0 months in thoracoscopic group). Thoracoscopic surgery was associated with lower recurrence rates, but the difference was not statistically significant .There were 50 neonates in this study (37 in the thoracoscopic group and 13 in the open group). Thoracoscopic surgery was associated with significantly shorter hospital stay (13.32 vs. 18.77 days, Thoracoscopy CDH repair, a safe and effective surgical technique for neonates, has better cosmesis, faster postoperative recovery, and a lower recurrence rate than other procedures. It can be considered the first choice for CDH treatment for neonates among experienced surgeons. Congenital diaphragmatic hernia (CDH) is a structural defect in the diaphragm due to the lack of closure of the pleuroperitoneal folds of the embryo within 4\u201310 weeks after fertilization. The defect can be unilateral or bilateral and partial or complete. Due to higher intra-abdominal pressure, the abdominal organs  enter the thoracic cavity through the defect and compress the adjoining lung parenchyma. CDH is a potentially life-threatening condition in neonates, with an incidence of 2\u20134/10,000 births .Open surgery: The neonates were placed in the supine position under general anesthesia. To enter the thoracic cavity, a transverse incision of 5 cm\u201313 cm was made in the sixth intercostal space on the side of the diaphragmatic defect. Then, the hernial contents were reduced, and the diaphragmatic defect was exposed. The defect was closed by intermittent \u201c8\u201d sutures using suture material (Ethicon 2\u20130 non-absorbable sutures), and a thoracic drainage tube was placed. Postoperatively, the neonates were shifted to the neonatal ICU, where they received ventilator support, intravenous antibiotics, anti-inflammatory drugs, and fluid supplements. The neonates were gradually weaned off the ventilator, and enteral nutrition was started after the recovery of intestinal function.2) with a pressure of 4\u20136 mmHg. Then, two 3\u20135 mm trocars were placed in the anterior axillary line of the sixth intercostal space and at the midpoint of the line between the subscapular angle and the spine. With the aid of pneumothorax pressure and grasping forceps, the hernial contents were gradually placed back into the abdominal cavity. Intermittent \u201c8\u201d sutures with 2\u20130 non-absorbable sutures were used to repair the diaphragm defect, and the thoracic drainage tube was inserted after the operation  test/Fisher\u2019s exact test was used for categorical data. p\u2009<\u20090.05 was considered statistically significant.SPSS v20.0 statistical software was used for the analysis. The measurement data were expressed as mean\u2009\u00b1\u2009standard deviation (X\u2009\u00b1\u2009SD). A n\u2009=\u20092) and incomplete medical records (n\u2009=\u20091). During the study period, open surgery was the main method between 2013 and 2016, and laparoscopic surgery was the main method between 2017 and 2021. Among these, 13 neonates underwent open surgery, and 38 cases underwent thoracoscopic surgery. One patient in the thoracoscopic group was excluded due to conversion to open surgery. No patient died in the thoracoscopic group, and one patient died during the perioperative period in the open group. In all cases, no polyester patches were used during the operations. The general characteristics of the two groups were similar, as shown in A total of 53 neonates with CDH were treated during the study period. Among these, 3 cases were excluded due to incomplete treatment   .The wound infection rate and recurrence rate in the thoracoscopic group was lower than that of the open group, the survival rate was higher in the thoracoscopic group compared to the open group but not statistically significant, but all not statistically significant .p\u2009<\u20090.05, Duration of hospital stay, postoperative mechanical ventilation, time to start postoperative feeding, and time to reach target feeding in the thoracoscopic group were significantly less than in the open group  found that A standardized clinical practice guideline to manage patients with CDH decreased ECMO utilization and improved survival to 85% . Lewit R2, there were no structural, neurodevelopmental, or behavioral changes in adulthood  showed that mechanical ventilation time after thoracoscopic surgery was significantly reduced compared with open surgery (3 days vs. 6 days) . Szavay. Our resThe early intubation allowed early resumption of breastfeeding and shortened the time to reach the target feeding, which reduced the need for parenteral nutrition and the risk of associated infections. ) found that the initiation of breastfeeding after thoracoscopic surgery was significantly earlier compared to open surgery (5 days vs. 12 days), with reduced time to reach the target feeding (13 days vs. 16 days), resulting in shorter hospital stay (17.5 days vs. 20 days) . BawazirTherefore, compared with open surgery, the advantages of thoracoscopic surgery are becoming more obvious. However, this study was a single-center retrospective study with a small sample size and limited follow-up. Hence, randomized controlled trials with longer-term follow-ups are needed to verify our results. In addition, endoscopic surgery requires professional training and it has a steep learning curve. Therefore, it is difficult to promote its widespread use.In summary, thoracoscopic CDH repair is a safe and feasible technique with the advantages of a clear surgical field, less trauma, smaller incision, faster recovery, and fewer complications compared to open CDH repair. It is believed that with advancements in endoscopic technology and the accumulation of experience, thoracoscopic surgery will become the preferred treatment for CDH."}
+{"text": "Shewanella oneidensis MR-1 offer great promise for sustainable energy/chemical production, but the low rate of electron generation remains a crucial bottleneck preventing their industrial application. Here, we reconstructed a genome-scale metabolic model of MR-1 to provide a strong theoretical basis for novel BES applications. The model iLJ1162, comprising 1,162 genes, 1,818 metabolites and 2,084 reactions, accurately predicted cellular growth using a variety of substrates with 86.9% agreement with experimental results, which is significantly higher than the previously published models iMR1_799 and iSO783. The simulation of microbial fuel cells indicated that expanding the substrate spectrum of MR-1 to highly reduced feedstocks, such as glucose and glycerol, would be beneficial for electron generation. In addition, 31 metabolic engineering targets were predicted to improve electricity production, three of which have been experimentally demonstrated, while the remainder are potential targets for modification. Two potential electron transfer pathways were identified, which could be new engineering targets for increasing the electricity production capacity of MR-1. Finally, the iLJ1162 model was used to simulate the optimal biosynthetic pathways for six platform chemicals based on the MR-1 chassis in microbial electrosynthesis systems. These results offer guidance for rational design of novel BESs.Bioelectrochemical systems (BESs) based on  Growing concerns over the depletion of fossil resources and associated environmental problems have motivated the development of sustainable and renewable energy/chemical production using bioelectrochemical systems (BESs) . BESs arShewanella oneidensis MR-1 has been used as a model EAB for EET research due to its remarkable respiratory versatility, which allows the bacterium to gain energy through the reduction of a variety of terminal electron acceptors, including oxygen, fumarate, nitrate, trimethylamine N-oxide (TMAO), metal oxides and electrodes  aim to capture a systems-level representation of the entirety of metabolic functions using a stoichiometric matrix, which enables sophisticated mathematical analysis of metabolism at the level of whole-cell metabolism . GEMs ha in 2010 . The oth in 2010 . However in 2010 . Moreovefunction , which cS. oneidensis MR-1, the multi-data and multi-quality-control genome-scale metabolic network model (GEM) iLJ1162 was reconstructed with significantly increased coverage of ORFs as well as accurate simulation of the accepted spectrum of substrates and electron acceptors. We employed iLJ1162 to simulate electricity generation in MFCs using different carbon sources, and identify the optimal pathways as well as overexpression targets for efficient electricity production. Finally, the production of six high-value-added chemicals in MESs using MR-1 as the chassis cell was simulated. These results offer new possibilities for the rational design of BESs.In order to facilitate internal electron generation and transfer in S. oneidensis MR-1 was obtained from GeneBank (GCA_000146165.2) and annotated using RAST, version 2.0  were not restricted. The gapfilling algorithm developed based on weight-added pFBA was as follows:The biomass composition was adapted from the experimental data of n iSO783 . To simuThe gap filling process consists of three steps. Firstly, identifying biomass compositions that cannot be synthesized. The demand reaction of each biomass composition was added and set as the optimization target for FBA calculation. If the result is 0, it means that the biomass composition cannot be synthesized, and there are gaps in its synthesis pathway. Then, the gaps for each composition were filled using the weight-added pFBA gapfilling algorithm \u20135. The aS. oneidensis MR-1 used in this study was obtained from our laboratory. The strains were stored at \u221280\u00b0C and revived by growing at 30 \u00b0Con LB agar plates containing (per liter): 10\u00a0g tryptone, 5\u00a0g yeast extract, and 10\u00a0g NaCl. The Biolog phenotype microarray was used to evaluate the utilization capabilities of different carbon, nitrogen, sulfur and phosphorus sources in MR-1. The PM1, PM2A, PM3B, PM4A (A-E), PM4A (F-H) plates consist of 190 carbon sources, 95 nitrogen sources, 59 phosphorus sources and 35 sulfur sources, respectively. All these plates were inoculated with cell suspensions at 100 \u03bcL/well. The plates were placed at 30\u00b0C and monitored for 72\u00a0h with readings taken at 15\u00a0min intervals. The kinetic information was recorded and quantified using OmniLog OL_FM_12 kinetic software  followed by data analysis. In the event of substrate utilization, photographic readings of color intensity resulted from dye reduction were represented in OmniLog units (OU). The substrates that were 1.5-fold higher or 0.8-fold lower than the control were selected as positive or negative results, respectively.The wild-type strain Gapfilling was conducted for those substrates that could be used in the Biolog experiment but not in the model. Two categories were found: 1) Substrates that lack the exchange reactions (From extracellular to intracellular). These gaps were filled manually; 2) Substrates that lack utilization pathway. These gaps were filled using the gap-filling method described above.2O, O2, NH3/NH4+, sulfite, phosphate and metal ions. The uptake rate of the chosen carbon source was set to 4.06\u00a0mmol/gDW/h, while rates for other carbon sources were set to zero. For the simulation of terminal electron acceptors, ATPM (\u201crxn00062_c0\u201d) was set as the objective function with an l-lactate uptake rate of 4.06 mmol/gDW/h. All the exchange reactions for terminal electron acceptors were turned off, but those for the chosen one ware not restricted. The metabolic model testing suite (MEMOTE) was used to evaluate the consistency and annotation of the model   is used 3H6O3 = 3*4 + 6*1 + 3*(-2) = 12.Coulombic efficiency (CE) is commonly used to quantify the performance of MFCs and is defined as the ratio of electrons actually transferred to the anode to that theoretically present in the starting carbon source . For eleubstrate . For exaThe theoretical maximum yield was calculated according to the ratio of reduction degrees of substrate and product.S. oneidensis MR-1, the genome of MR-1 was annotated by RAST, then uploaded into ModelSEED to generate a draft metabolic model. Charges and formulas of metabolites provided by ModelSEED were added into the draft model. The temporary gene IDs  in the draft model were transformed into specific gene IDs of S. oneidensis MR-1  by local Blastp which was utilized for homology matching under the criteria: e-value < 1E-30; identity = 100%. The results of Blastp are listed in l-lactate (4.06\u00a0mmol/gDW/h) was used as sole carbon and energy source. The draft model contained 866 genes, 1,436 metabolites and 1,524 reactions  of the annotated ORFs. Some genes, which have been reported/annotated with clear metabolic functions, were not annotated by RAST. For example, SO_4706 was annotated as malate synthase (EC: 2.3.3.9) in KEGG, but it was missed in the draft model. In order to compensate for these genes and their corresponding reactions, manual extension of the draft model was performed based on the public biochemical databases KEGG and UniProt, in combination with the published model iMR1_799. Moreover, further protein annotation from DeepEC , which iAs shown in S. oneidensis MR-1, with known electron transport pathways confirmed by experimental data, were chosen for in silico simulations (in silico. The agreement of growth between the simulated results of iLJ1162 and in vivo results achieved 100% (16/16) of all tested electron acceptors. Nevertheless, 62.5% (10/16) and 56.25% (9/16) concordance was obtained by iMR1_799 and iSO783, respectively. This can be explained by the key reactions missing in these models. For instance, the electron transfer reaction for the conversion of AsO4\u2212 was missing in iMR1_799 and iSO783, but was successfully annotated to be associated with genes SO_4591, SO_1777, SO_1778 and SO_1779 in iLJ1162. Notably, when using metal ions such as Fe3+ and Co3+ as terminal electron acceptors, S. oneidensis MR-1 obtained the highest energy synthesis efficiency in silico. This may be due to the reduction of these electron acceptors to generate the proton driving force and resulting energy production.After these modifications, the optimal generation rate of ATP was changed from 1,000 to 31.3 mmol/gDW/h. The P/O of the aerobic respiratory chain in Model_01 was 1.5, which is lower than the 2.5 from iSO783 based on literature . Thus, aulations . If the S. oneidensis MR-1 cultured in minimal medium was 0.085\u00a0h\u22121, and the corresponding l-lactate consumption rate was 4.06\u00a0mmol/gDW/h under aerobic conditions  and 157 true negative (substrates that cannot be used in both the in vivo experiments and simulations) results were obtained by iLJ1162  87.2%, significantly higher than (471/781) 60.3% of iSO783 and (477/781) 61.1% of iMR1_799 , which might be strictly regulated and unexpressed in MR-1. As for false-positive results, it is likely caused by the incomplete annotation  in iLJ1162. For example, SO_4234 was annotated as 3-isopropylmalate dehydratase and participates an essential role in l-leucine synthesis in all the three models. If the results of the experiment are accurate, MR-1 may have potential isoenzymes for 3-isopropylmalate dehydratase or alternative pathways for leucine synthesis.Essential genes are an important characterization of model quality . TherefoiMR1_799 . This ca3+ . Many substrates obtained high CE values over 95%, which means that the electrons of these substrates can practically to be fully transferred to the electrode by the metabolic network of MR-1  was introduced into the model and used as the optimization objective to calculate the optimal pathways for NADH regeneration from NAD+. In addition, since there is low or no measurable activity of the pyruvate dehydrogenase (PDH) encoded by SO_0424 and SO_0425 in S. oneidensis MR-1 under anaerobic conditions , pyruvate formate-lyase (Pfl) and NAD+ dependent formate dehydrogenase (Fdh) were consistent with previously reported experimental results . It has been reported that electrical current production or growth rate with NAG as the substrate under anaerobic conditions would be extremely inhibited by knocking out NDHs (d-lactate or l-proline) (An important approach for increasing EET rates based on high intracellular regeneration of NADH is the transfer of electrons from NADH to the respiratory chain. The first step of the respiratory chain is the dehydrogenation of NADH by NADH dehydrogenases (NDHs) to release electrons, which are important for energy supply and cell growth . Three tout NDHs . Howeverout NDHs ; 2) ProCout NDHs . The forout NDHs , while tproline) . Thus, oS. oneidensis MR-1 can be summarized as NADH generation by receiving extracellular electrons and protons using NAD+ (\u2212 + H_p + NAD_c \u2192 NADH_c) and \u2018Sink_e\u2212\u2019 (\u2192 e\u2212) were added to represent the electron receiving process. Six high value products were chosen for simulation in MESs, including 3-hydroxypropanoate (3HP), isopropanol (2ppoh), 3-hydroxybutanoate (3HB), acetoin (Actn), succinate (Suc), and 2,3-butanediol (23btdl). All these products require no more than two heterologous reactions in MR-1. The cell growth was omitted to simplify the complexity of biosynthesis pathways for different products, which is also consistent with that EAB almost did not grow in MESs  was chosen as an example for MESs simulation using iLJ1162. As shown in l-lactate as the sole electron source, which is only 64% of the theoretical maximum yield calculated from reducing degrees. This can be explained by the fact that the key intermediate metabolite formate cannot be further converted to 3HB by the metabolic network of MR-1, resulting in the loss of one third of total carbon in l-lactate. Moreover, to obtain NADPH for 3HB synthesis, a part of carbon fluxes was directed into the serine bypass and PP pathway, and oxidized to release electrons for NADPH generation.The simulation results of these six products in MESs using ondition . Thus, wl-lactate, which was 57% higher than the its theoretical maximum yield. This can be explained by the significantly increased fluxes of the threonine bypass  With inward electrons, the product yields using glycerol or l-lactate are equivalent, which means that extra electron supplying might eliminate the difference caused by different reducing degree in substrates. 3) The requirement of inward electrons for the same product is significantly lowered when using glycerol rather than l-lactate. This indicates that glycerol might still be a better substrate in MESs, which lowers the demand for the electron uptake rate of S. oneidensis strains.Since glycerol turns out to be the best substrate for election generation , we alsoS. oneidensis MR-1, a model EAB with applications in energy-generation and bioelectrochemical product synthesis. The model iLJ1162 comprised 1,162 genes, 1837 metabolites and 2078 reactions located throughout the extracellular, periplasm and cytosol compartments. GPRs extracted from various databases were used to extend the model, so that iLJ1162 can cover 27.8%  of the annotated ORFs, which is significantly higher than the 19% of iMR1_799 (799/4196) and 18.9% of iSO783 (783/4196) , which are the closest to the experimental data (0.085\u00a0h\u22121), indicated that iLJ1162 could accurately simulate the growth and metabolism of S. oneidensis MR-1. Furthermore, 289 substrates that were screened based on phenotypic assays were used to elevate and validate the model. The results of iLJ1162 reached 86.9% concordance with the wet-lab results, while iMR1_799 and iSO783 reached 62.3 and 61.9% respectively. This demonstrated that iLJ1162 could more accurately simulate substrate utilization than earlier models. Throughout the model construction process, the quality and accuracy of the model was gradually enhanced, and it achieved a high score of 90 in the MEMOTE evaluation. This not only proves the high quality of iLJ1162, but also indicates the rationality and comprehensiveness of the model construction process.Genome-scale metabolic modeling is a systematic biology approach for the construction of a framework for the integrative analysis of metabolic functions of a microorganism. In this study, we reconstructed a well-curated genome-scale metabolic model for the facultative dissimilatory metal-reducing bacterium 83/4196) . In addiS. oneidensis MR-1, was predicted to be the optimal substrate for electron generation. Moreover, the FSEOF algorithm was used to find targets for increasing the ratio of NADH/NAD+. When using l-lactate as electron donor, PflB, FDH and MDH were predicted as engineering targets for efficient electricity generation, which was consistent with previous experimental results . The function of d-lactate was confirmed by Watanabe et al. . These works open up the possibility to develop efficient MESs based on MR-1 chassis. Here, we used the iLJ1162 to profile the optimal biosynthesis pathways for six different chemicals in MESs. Notably, these optimal pathways are quite different with those without inward electrons. Taking 3HB as an example (2 and formate fixation through the threonine bypass. Thus, the simulated yield with inward electrons exceeded its maximum theoretical yield (E. coli in our previous work (MESs represents a sustainable platform that converts waste into resources, using microorganisms within an electrochemical cell . As init example , the NADal yield . It is wous work . TherefoS. oneidensis MR-1. The model, named iLJ1162, is more comprehensive in scope than previous models and updated based on the latest gene annotations, databases and literature. The model validation was achieved by comparing model predictions to experimentally obtained results or the literature, and demonstrated a high degree of concordance. As a genome-scale metabolic network model, iLJ1162 was used to simulate and analyze the performance MR-1 in BESs from a systems perspective. Particularly in MFCs, iLJ1162 was used to analyze the electricity production capacity of 20 substrates. The model identified more than 31 genetic modification targets and two alternative NDHs pathways, which could enhance the electricity production capacity and EET rate of MR-1 in MFCs. In addition, iLJ11621 was also successfully used to simulate and analyze the synthesis of six high-value chemicals in MESs, offering preliminary theoretical exploration to guide the feasible direction of bioelectrochemical synthesis using MR-1. This advanced and comprehensive genome-scale metabolic model offers a new platform for a better understanding the metabolic features of S. oneidensis MR-1 at a systems-level, enabling the development of improved strains for BESs applications.In this study, we reconstructed a high-quality metabolic model of"}
+{"text": "The relationship between hometown attachment (HA) and corporate social responsibility (CSR) is a topic to be explored in depth. We measured the HA by the Chinese diaspora background and the immigrant culture of the ultimate controllers of the firm and employed the sample of Chinese non-financial private-listed companies in Shanghai and Shenzhen from 2003 to 2019 to investigate the impact of the HA on overseas Chinese entrepreneurs on CSR. We found that the HA of the overseas Chinese ultimate controller significantly increases the level of CSR, and this promoting effect rises when the firm ultimately held by the overseas Chinese entrepreneur is registered in the expatriate hometown. Our further analysis found that the personal characteristics of overseas Chinese entrepreneurs and regional cultural differences have a moderating effect on the above relationship. In particular, we found that overseas Chinese entrepreneurs who are women or with lower academic qualifications have a stronger sense of CSR. Moreover, in areas with low marketization or a high level of social trust, HA of overseas Chinese entrepreneurs plays a more active role in CSR. The results remain robust after the robustness test and the endogenous test. The conclusion of this study not only highlights the impact of psychological factors on the level of CSR but also provides a reference for the study of the decision-making behavior of overseas Chinese entrepreneurs. Corporate social responsibility (CSR) is in the spotlight as a corporate strategy for sustainable development and competitiveness of companies  is a prevalent psychological factor among immigrants  regression analysis, we developed two linear regression models to examine the effects and mechanisms of HA on CSR. First, we empirically examined the relationship between HA and CSR among ultimate controllers who emigrated overseas, using a sample of Chinese non-financial private-listed companies from 2003 to 2019. Furthermore, we implemented heterogeneity tests for the ultimate controller characteristics  and regional characteristics .The Tongzhi Charter. The other is a dummy variable when Christian and Roman Catholic missionaries opened Western-style universities throughout China as of the 1820s. We documented that the greater the number of open coastal ports of commerce and the opening of Western-style universities were more likely to increase the number of locals emigrating overseas. In addition, we performed robustness tests using proxy variables for key variables and excluding the effect of the economic crisis.Finally, to address possible endogeneity issues, we used the 2SLS instrumental variable method for endogeneity testing. Specifically, we selected two instrumental variables. One is the number of coastal ports of commerce that China was forced to open between 1840 and the end of the 19th century under unequal treaties as well as under The contributions of our study to the literature are mainly in three aspects. First, this study enriched the study of CSR drivers. We extended the psychological factor HA to CSR research and explored new drivers of CSR from the perspective of the ultimate controller who migrates overseas. In this study, we further examined the influence of the personal traits of the ultimate controller and the external environment on CSR. Second, we further expanded on the economic consequences of attachment psychology. Some research studies focused on the impact of hometown ties on corporate managers. However, in exploring how early migration abroad shapes individual character, this study contributes to a more comprehensive understanding of how attachment psychology from managers' migration experiences affects firm strategy. Third, we promoted interdisciplinary research by combining psychology with business management. Specially, we complemented the impact of psychological factors brought about by the immigrant experience on business practices.The rest of the paper is organized as follows. Section Literature review and hypothesis development discusses the relevant literature and presents our hypotheses. Section Data, variables, and methodology describes the sample, the main variables, the research design, and the descriptive statistics. Section Empirical results and analysis presents the empirical results and analysis. Section Robustness tests presents the endogeneity test and the robustness test. Section Conclusions and discussions presents the conclusion and discussion.Overseas immigrants have an attachment to their home countries  because they had significant operational problems. Finally, to ensure the continuity and comparability of sample information, we excluded the sample of companies with less than 3 years of data. Thus far, the effective sample size is 12,385, including 1,465 listed firms whose ultimate controller is an individual. To reduce the effect of outliers, we carried out winsorization of our sample at 1% on the continuous variable in each tail.Our sample includes private firms listed on both the Shanghai and Shenzhen securities exchanges in the period from 2003 to 2019. First, we downloaded the annual reports of listed companies from the website of Moreover, we manually supplemented key information on nationality and permanent residency abroad (including a residency in Hong Kong and Macau) through the websites of National and provincial federations of returned overseas ChineseHA_hqhr, defined to be equal to 1 when the ultimate controller of the firm is overseas Chinese and 0 otherwise.Following Hu et al. , we emplHA_qx, which is defined to be equal to 1 when the registered place of the firms with overseas Chinese ultimate controller is located in expatriate hometown, that is, Guangdong, Fujian, Guangxi, Hainan, and Zhejiang, and 0 otherwise.Considering regional culture, we set the second dummy variable as CSR_rate, to measure CSR. In detail, CSR_rate is calculated as /average total assets. This indicator evaluates the fulfillment of social responsibility to stakeholders such as the government, employees, investors, and communities using the company's financial data. The higher the CSR_rate the better the CSR performance.Following Song and Li , we usedWe controlled for a number of factors that could potentially affect CSR, including firm level, individual level, and regional level.Referring to Chen et al.  and Ren Size). We used the natural logarithm of total assets to measure firm size.Firm size (Leverage). We employed the total debt divided by total assets to measure financial leverage.Financial leverage (Growth). We introduced the ratio of operating revenue growth to measure a firm's growth.Growth (Cash). We used the net of operating cash flows divided by total assets to measure the operating cash flows of the firm.Operating cash flows (Roa). We used return on assets to measure the firm's profitability.Profitability (Firmage). We used the current year minus the IPO year to measure the firm's years of listing.Years of listing (Roe). We introduced return on equity to measure firm performance.Firm performance (Manho). We employed the number of shares held by management scaled by the total number of shares to measure management shareholding.Management shareholding (Mtnum). We used the number of supervisors to measure the size of the board of supervisors.Size of the board of supervisors (Ucpd). We introduced a dummy variable to measure whether the ultimate controller is the chairman or general manager and it equals 1 if the ultimate controller concurrently serves as the chairperson or CEO, and 0 otherwise.Whether the ultimate controller is the chairperson or general manager (Wedge). We employed a dummy variable to measure the separation of powers and it equals 1 if the control right and ownership of the ultimate controller are separated, and 0 otherwise.Separation of powers . We employed a dummy variable to measure the ultimate controller's gender and if the ultimate controller is male it equals 1, and 0 otherwise.Ultimate controller's gender (Ucsage). We introduced the age of the ultimate controller divided by 100 to measure the ultimate controller's age.Ultimate controller's age (Ucsedu). We used a continuous numerical proxy for the education level of the ultimate controller. Specifically, 1 = technical secondary school or below, 2 = junior college, 3 = undergraduate, 4 = master, 5 = doctor, and 6 = other.Ultimate controller's education . GDP divided by the total population of the province where the firm is located is employed for this measurement . This variable is measured by the number of award-winning religious places in the province where the firm is located . We introduced the number of chambers of commerce in the province where the firm is located to measure this variable  is the level of CSR measured by the corporate social contribution rate. In model 1, the independent variable HA_hqhr is a dummy variable that equals 1 if the ultimate controller of a firm is overseas Chinese, and 0 otherwise. In model 2, the independent variable HA_qx is also a dummy variable that equals 1 if the registration site of the firm controlled by an overseas Chinese  is in an expatriate hometown, and 0 otherwise. Controls is a vector of control variables defined in 1 is significantly positive, that is, HA of the firms' ultimate controllers is significantly positively correlated with the level of CSR.where the dependent variable (HA_hqhr) and the other based on the location of the company's registration (HA_qx). Next, we implemented heterogeneity tests for the characteristics of the ultimate controller  and regional characteristics . In addition, to test the robustness of the results, we re-tested models 1 and 2 by replacing key variables and excluding the effect of the economic crisis. Finally, to exclude possible endogeneity issues, we used instrumental variables for endogeneity testing through 2SLS regressions.To sum up, CSR_rate ranges from 0.0177 to 0.3880, and the mean of CSR_rate is 0.1209. In all firm year samples, 10.55% of the ultimate controller are overseas Chinese and 5.71% of the firms held by overseas Chinese are registered in expatriate hometowns. In terms of the control variables, the average firm size (Size) is 21.7081, financial leverage (Leverage) is 39.03%, and ROA (Roa) is 4.09%. Additionally, the mean of the ratio of operating revenue growth (Growth) is 24.53%. Moreover, the mean of operating cash flows (Cash) is 4.04%. Furthermore, the average listing year (Firmage) is 7.4535 years. In addition, the average firm performance (Roe) is 6.10%. Then, for the management shareholding (Manho), the average is 19.47%. Moreover, the mean of the size of the board of supervisors (Mtnum) is 3.2717. In addition, there are 81.07% of the companies whose ultimate controller is the chairman or general manager (Ucpd). Furthermore, there are 54.60% of the companies where the control right and ownership of the ultimate controller are separated (Wedge). For ultimate controller's characteristics, it is shown that 95.23% of ultimate controllers are male (Ucsgender), and the average age of ultimate controllers is 52.84 years old (Ucsage). In addition, the average education of ultimate controllers is undergraduate (Ucsedu). For regional characteristics, the average GDP per capita level by province is 64664.6875RMB. In addition, the average number of award-winning religious places in the province is 10.4442, and the average of number of chambers of commerce in the province is 41.8470.CSR_rate) and the ultimate controller's characteristics between firms with and without overseas Chinese ultimate controller (HA_hqhr), and between firms located or not located in expatriate hometown (HA_qx). The results show that the average CSR level of the firms with overseas Chinese ultimate controller is 0.1317, while firms with no overseas Chinese ultimate controller is 0.1230, which exists a statistically significant difference (0.87 percentage points) at the 1% level. Moreover, for the firms with overseas Chinese ultimate controller, the average CSR level of the firms registered in famous overseas Chinese hometown is 0.1354, whereas firms registered in other places is 0.1232; the difference (1.22 percentage points) is statistically significant at a 1% level.CSR_rate and the independent variable HA_hqhr, and only controls the variables of firm-level characteristics and the year and industry dummies. It is observed that HA_hqhr has a positive correlation with CSR_rate with an estimated coefficient of 0.0066 and is significant at a 1% significance level. Then, we gradually added the characteristics of the ultimate controller and region. In detail, after adding the ultimate controller characteristic variables in column 2, HA_hqhr and CSR_rate are positively correlated with an estimated coefficient of 0.0068 and are significant at the 1% level of significance. Finally, after we added all control variables in column 3, the estimate coefficient of HA_hqhr has a positive estimate of 0.0062 with a t-statistics of 3.46 and the relationship is significant at the 1% level of significance. The above tests all control year and industry dummy variables. Therefore, the baseline results support H1, that is, HA of the ultimate controller promotes CSR.We first examined whether the firm's ultimate controller is an overseas Chinese affecting CSR. Size and CSR_rate has a negative estimate of \u22120.0062 and is significant in 1% level significance in column 3 of Leverage is 0.0462, which is significantly positive at the 1% level of significance in column 3. In addition, Cash, Roa, Mtnum, and Wedge have a significant positive relationship with CSR_rate, respectively. Moreover, Firmage and Roe have a significant negative relationship with CSR_rate. For the variables of ultimate controller trait, Ucsgender, Ucsage, and Ucsedu are significantly correlated with CSR_rate. For regional characteristic variables, GDP is positively correlated with CSR_rate, whereas Religion is negatively correlated with CSR_rate. Overall, H1 is supported, that is, the HA of the ultimate controller has a positive impact on CSR.For control variables, the estimate coefficient of HA_qx has a positive estimate of 0.0106 with a t-statistic of 4.30. Then, in column 2 of HA_qx was positively correlated with CSR_rate with an estimated coefficient of 0.0110, which was significant at 1% significance level. Moreover, in column 3 of HA_qx is positively correlated with CSR_rate with an estimated coefficient of 0.0108, remaining statistically significant at 1% significance level. Therefore, the results are robust.Next, we examined whether the registration site of the firm with an overseas Chinese ultimate controller in an expatriate hometown influences CSR. Size, Firmage, and Roe are negatively correlated with CSR_rate at a 1% significance level in column 3 of Cash, Leverage, and Roa are positively correlated with CSR_rate at a 1% significance level in column 3, which is in line with Cheung  as a benchmark  and a low marketization group (Market_low). We performed cross-sectional tests for model 1 and model 2, and HA_hqhr and CSR_rate. For the high marketization group in column 1, HA_hqhr is positively correlated with CSR_rate with an estimated coefficient of 0.0041, remaining statistically significant at the 10% significance level. Moreover, for the low marketization group in column 2, HA_hqhr is positively correlated with CSR_rate with an estimated coefficient of 0.0066, remaining statistically significant at the 5% significance level. Comparing columns 1 and 2, the coefficients of the Market_low group are 0.0025 higher than those of the Market_high group.Using the latest NERI index released by the National Economic Research Institute Reform Foundation (degree of marketization)  as the benchmark and divide the trust level of the cities where the sample firms are registered into a higher trust level (Trust_high) and a lower trust level (Trust_low) according to the median. We conducted cross-sectional tests for model 1 and model 2, and HA_hqhr and CSR_rate. For the high social trust group in column 1, HA_hqhr is positively correlated with CSR_rate with an estimated coefficient of 0.0065, remaining statistically significant at the 1% significance level. In addition, for the low social trust group in column 2, the estimated coefficient of HA_hqhr is 0.0038 but is statistically insignificant.We used the China Commercial Credit Environment Index (CEI index) . Since 2014, China has set up national-level overseas Chinese industrial zones and entrepreneurial clusters \u2013 QiaoMengYuan (QMY), i.e., Overseas Chinese Dream Zone \u2013 to attract overseas Chinese businessmen and talents to invest and start businesses. As of 2019, China has established seventeen QMYs across the country. The areas where the QMYs have been established have attracted more overseas businessmen to gather. Areas, where locals and overseas Chinese firms have enhanced ties, are more likely to be close to the traditional diaspora atmosphere. Thus, we used HA_qmy as a proxy for the independent variable HA_qx. We defined HA_qmy as a dummy variable that equals 1 if the firm's place of incorporation is in the province where QMY is located and 0 otherwise. HA_qmy is 0.0131 and is significantly positive at the 1% level of significance. Therefore, our results remain robust.We re-measured the independent variable HA . The other is a dummy variable that equals 1 if Christian and Roman Catholic missionaries opened Western-style colleges (Westcollege) in a region of China as of the 1820s and 0 otherwise.Although we have controlled for the effects of economic and different cultural factors, there may still be omitted variables. Following Ang et al. , we usedThe above two instrumental variables are theoretically exogenous and relevant. First, from the exogeneity perspective, these two variables can meet the exogeneity requirement better because their data sources are old and not directly related to contemporary CSR behaviors. Second, in terms of relevance, Zhuang  has founTradingport and Westcollge are significantly positive at the 1% significance level. The results indicate that the ultimate controller of the local firm is more likely to be an overseas Chinese if the province where the firm is located has a higher number of open ports of commerce and operates a Western-style university, and the result is consistent with our expectations. Column 2 presents the results of the second-stage regression, where the estimated coefficient of the independent variable HA_hqhr is significantly positive at the 1% significance level, consistent with the results of the baseline regression.Next, we statistically validated the exogeneity and correlation of the instrumental variable to address the endogeneity of the ultimate controller's HA and CSR. Tradingport and Westcollge satisfy the requirement of correlation. The p-value of the Hansen J statistic is 0.4070, which indicates that the null hypothesis of \u201call instrumental variables are exogenous\u201d cannot be rejected, i.e., the instrumental variables Tradingport and Westcollge satisfy the requirement of exogeneity. In addition, the regression results also reported the endogeneity test of the independent variable HA_hqhr with a p-value of 0.0132, indicating that the null hypothesis of \u201cthe independent variable is exogenous\u201d can be rejected and that the HA variable has some endogeneity problems, so it is necessary to use the instrumental variables method to solve the endogeneity problem. In conclusion, after controlling for the endogeneity problem caused by omitted variables using the instrumental variables method, our results are still robust.Finally, in the instrumental variable test, we found that the Kleibergen-Paap rk Wald F-statistic is greater than the 10% threshold of the corresponding Stock-Yogo weak instrumental variable test, which indicates that the null hypothesis of \u201cthe existence of weak instrumental variables\u201d can be significantly rejected, i.e., the instrumental variables With the above analysis, we summarized the results of our hypotheses tests in To explore the effect of HA of the firm's ultimate controller on CSR, this study combines identity theory, attachment theory, and upper echelons theory to empirically examine the relationship between the HA of the ultimate controller of firms with overseas migration experience and CSR using a sample of Chinese non-financial private-listed firms from 2003 to 2019.The results show that H1 and H2 are supported. The HA of the ultimate controller has a positive impact on CSR in Chinese-listed private firms. This result is consistent with the results of Ren et al. , who stuThe results support H3a\u2013H3c. Female ultimate controllers positively moderate the relationship between HA and CSR in Chinese-listed private firms. Our findings are consistent with Boulouta  who founThe results support H4. Among Chinese-listed private firms, the extent of marketization negatively moderates the relationship between the HA of the ultimate controller and CSR. Our results show that the HA of the ultimate controller has less impact on CSR in regions with a higher degree of marketization. Thus, as the degree of marketization increases, firms' decisions become more rational and may be less influenced by traditional culture.The results support H5. Social trust positively moderates the relationship between ultimate controllers' HA and CSR in Chinese-listed private firms. Our results show that HA of ultimate controllers has a stronger incentive effect on CSR in regions with high levels of social trust. Notably, social trust is an important condition for economic activities, and our study adds to evidence of the impact of social trust on non-economic activities of firms, i.e., CSR.We empirically tested the relationship between the HA of the firm's ultimate controller and CSR using a sample of Chinese non-financial private listed firms from 2003 to 2019. We proxied the HA of the ultimate controller by the Chinese diaspora identity of the ultimate controller, and the results showed that HA helps to improve the level of CSR. Moreover, the level of CSR is higher when the ultimate controller is an overseas immigrant and the company is registered in the expatriate hometown. Furthermore, we examined the moderating effect of the characteristics of the ultimate controller on HA and CSR. Our results found that among listed private firms, female ultimate controller and ultimate controller age positively moderate the relationship between HA and CSR, while ultimate controller education level negatively moderates the relationship. In addition, we examined the moderating effect of the external environment on the relationship between HA and CSR. The results show that the level of social trust in the place of incorporation of listed companies positively moderates the relationship between HA and CSR, while the degree of marketization in the place of incorporation of listed companies negatively moderates the relationship. Finally, our results still hold after the endogeneity test and robustness test.This paper has the following three implications for existing theory and management practice. First, we have enriched the research on the motivation of CSR. Although there has been much literature examining the economic motivations of CSR, there are still fewer studies that explore CSR motivations from a psychological perspective. For example, Ren et al.  exploredSecond, we have enriched the research related to attachment psychology and identity theory. Existing studies have mainly explored the well-being experiences or pro-social behaviors resulting from place attachment , Natural Science Foundation of Guangdong Province, China (2021A1515011536), and Fundamental Research Funds for the Central Universities (19JNKY08).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Due to requests for the items, instructions, and scoring information used in this study, the authors have now provided this material as Table 1. Item 1, in English, stated \u201cBefore age 11, I had a bedtime routine .\u201d The correct statement is \u201cBefore age 12, I had a bedtime routine .\u201d Item 1, in Spanish, stated \u201cAntes de los 11 a\u00f1os, ten\u00eda una rutina antes de acostarme a dormir .\u201d The correct statement is \u201cAntes de los 12 a\u00f1os, ten\u00eda una rutina antes de acostarme a dormir .\u201d Item 3, in Spanish, stated \u201cUno de mis padres podr\u00eda pasar en un instante de la calma al estr\u00e9s y los nervios.\u201d The correct statement is \u201cUno de mis padres podr\u00eda pasar en un instante de la calma a la furia.\u201d Item 4, in Spanish, stated \u201cMis padres ten\u00edan una relaci\u00f3n estable.\u201d The correct statement is \u201cMis padres ten\u00edan una relaci\u00f3n estable entre ellos.\u201d The corrected In the published article, there were also errors in The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Case Report. A 27-year-old female with a 2-year history of lupus and a 1-week history of paroxysmal atrial fibrillation presented with three days of bilateral focal neurological deficits in the arms and legs. She was found to have ischemic cardiac and neurologic manifestations during her hospital stay.  Systemic lupus erythematous (SLE) is an autoimmune condition which can cause complex, multiorgan dysfunction. This autoimmune disease is caused by the production of antinuclear antibodies which allows this disease to target virtually any organ in the human body. When a patient experiences an unpredictable worsening of disease activity, it is generally considered a lupus flare. Organ dysfunction due to a lupus flare tends to manifest as separate events in the literature and rarely do we witness multiple compounding organ failures during a lupus flare. If we do witness organ dysfunction and failure, rarely do we see cardiac and cerebral involvement. Typically, patients take immunosuppressants for a long term to avoid the patient's disease process from worsening and to provide prophylaxis from a flare to occur. Despite the availability in preventive strategies, some patients will have increased disease activity multiple times throughout their lifetime and will need increases in their medication doses or changes to their regimen. Some flares can be managed in the clinic, but more severe ones may be life-threatening that they require intravenous medications and hospitalization to achieve remission. In the following case, we see a patient with a past medical history of SLE on multiple immunosuppressants who arrived at the hospital with acute, bilateral weakness of the upper and lower extremities. It was later determined via various imaging and laboratory testing that she was having an SLE flare that was directly causing myocarditis which progressed to global ischemia of the brain via myocardial hypoperfusion. She experienced substantial recovery from her flare with treatment with high-dose, intravenous corticosteroids.  Our patient presented with reversible focal neurological deficits, elevated high-sensitive troponin levels, and high lupus serum antibodies who showed significant improvement after the introduction of high-dose steroids. This case recommends keeping a large differential and to not discount patients' past comorbidities for causing atypical symptomatology. Systemic lupus erythematous is a connective tissue disorder which can affect any organ with varying severity. Sometimes known as \u201cthe great imitator,\u201d SLE manifests in a myriad of ways, having the potential to cause deadly neurological and cardiovascular complications \u20134. AccorCardiac manifestations are seen in 50% of patients with SLE over a lifetime. The most common manifestation is pericarditis, which is seen in about 25% of those with SLE over a lifetime. A lesser common one, myocarditis, is seen in as low as 9% of those with SLE and cardiac problems , 9. SimuOur aim in this report is to describe the atypical presentation of neurological and cardiac dysfunction in a patient with active SLE, as well as mentioned how this case differs from those seen in the literature so far. We also highlight some of the available instruments for measuring SLE activity.We herein present a case report of a patient with a 2-year history of SLE and a 1-week history of paroxysmal atrial fibrillation who demonstrates new focal neurological deficits bilaterally and myocarditis.A 27-year-old female with a 2-year history of lupus and a 1-week history of paroxysmal atrial fibrillation presented with three days of bilateral focal neurological deficits in the arms and legs. She denies any history of thrombosis in the past. Her home medications included mycophenolate 250\u2009mg twice daily, hydroxychloroquine 200\u2009mg twice daily, metoprolol 50\u2009mg twice daily, and apixaban 5\u2009mg twice daily. Upon presentation, she was hemodynamically stable and afebrile. Using the medical research council scale for muscle strength (MRC) on her physical exam, she had 1/5 strength in her right upper and lower extremities and 2/5 strength in her left upper and lower extremities. Upon further examination, her cranial nerves II through XII were intact and light touch was intact in the upper and lower extremities. Speech was normal, and she was alert orientated to herself, location, and time. Her weakness of the right upper and lower extremity was profound and affected her abductors, flexors, extensors, and those that provide internal and external rotation. As for her left upper extremity, her weakness was in the same nature but at a lesser degree. The high-sensitive troponin level was 2781\u2009ng/ml, and the ECG showed normal sinus rhythm with nonspecific ST wave abnormalities stable from previous ECG. The patient was started on clopidogrel 75\u2009mg and atorvastatin 40\u2009mg daily and continued apixaban and metoprolol. A computed tomography angiography (CTA) of the brain showed hypoattenuation in the left frontal convexity. A magnetic resonance imaging (MRI) brain with contrast was notable for acute ischemic changes in the watershed area among the anterior, middle, and posterior cerebral arteries . CTA of S\u2009<\u20090.2\u2009U, Jo 1 Ab IgG S\u2009<\u20090.2\u2009U, C3 was 110.30, and C4 was 26.80 compared to 82.70 and 19.90, respectively, two months earlier. The patients' complement levels were taken after the start of her intensive immunosuppression therapy and thus could cause her results to be falsely normal. DS-DNA Ab was above upper limit of test, >1000, without a previous value for comparison. Patients' lupus anticoagulant was unremarkable. Cardiolipin antibody IgA\u2009<\u200910 APL , cardiolipin antibody IgG was 13 GPL , and cardiolipin antibody IgM was 12 MPL . Protein electrophoresis showed a normal electrophoretic pattern. The patient was continued on mycophenolate with a new regimen of 500\u2009mg BID, hydroxychloroquine 200 mg BID and prednisone 60\u2009mg QD for two weeks followed by a steroid taper of 40\u2009mg for two weeks followed by 20\u2009mg for two weeks and remain on 10\u2009mg daily until her follow-up visit with her rheumatologist.Rheumatology was consulted, and they stated that the overall clinical picture could be a lupus flare. Rheumatology recommended 1.0\u2009g solumedrol for three days followed by prednisone 60\u2009mg daily as well as a lupus flare work-up. ANA was positive. Sjogren's antibody, DNA DS antibody, and atypical p-ANCA antibody were elevated. SS-A was 3.7\u2009U , SS-B\u2009<\u20090.2, Sm Ab IgG\u2009<\u20090.2\u2009U, RNP Ab IgG\u2009<\u20090.2\u2009U, Scl 70 Ab IgG After reconvening with neurology, they stated that a cause of the stroke-like symptoms was neuropsychiatric systemic lupus erythematosus (NPSLE), a diagnosis of exclusion. After discussion with cardiology and rheumatology, it was thought that the patient's elevated high-sensitive troponin levels were SLE-induced too, most likely being a presentation of lupus myocarditis. The patient showed significant improvement in her signs and symptoms after the steroids were introduced. The strength in both her legs and left arm was 4/5 and then right arm was 3/5.3. CSF pleocytosis can be indicative of neuroinflammation from systemic lupus erythematous or also from blood contamination during the procedure. When pleocytosis is reactive, it usually presents with an increase in mononuclear cells. With this information, it is possible that the elevation in the presented patient's monocytes arose from the central nervous system involvement of her disease. We attributed her neurological symptoms to NPSLE after correlating her symptoms with her elevation in anti-dsDNA antibody levels and CSF findings, as well as by observing her response to steroids [In this case report, we describe a patient who presented with focal neurologic deficits and myocarditis who demonstrated improvement with the 1.0\u2009g solumedrol for three days. This diagnosis was difficult as her symptoms mimicked a primary cerebrovascular event. We expanded our differentials and considered a rheumatological cause after ruling out a primary cardiac and neurological cause. An increase in the serum titer of anti-dsDNA antibodies and a fall in complement levels such as C3 and C4 are helpful in determining the presence of active lupus . Ribosomsteroids .In the literature, there are a limited number of reported reversible focal neurological deficits caused by SLE. The pathogenesis of cases of reversible neurological deficits reported have been due to lesions associated with isolated seizures, reversible posterior leukoencephalopathy syndrome (RPLS) which has usually been associated with comorbidities driven by SLE such as hypertension or seizures, cerebral edema secondary to a focal infarct, lesions of acute myelopathy, or thrombotic thrombocytopenic purpura (TTP) . This paThe diagnosis of myocarditis is based on clinical suspicion rather than definitive diagnostic tests, especially in those patients with subclinical heart symptoms. We presumed the diagnosis of myocarditis from her elevated high-sensitive troponins, positive serum labs indicative of a lupus flare, and episode of atrial fibrillation which all showed improvement with the initiation of the 1.0\u2009g of solumedrol. This was also a difficult diagnosis to make, as this patient did not present with the classic signs of chest pain, cardiogenic shock, or shortness of breath usually seen in myocarditis. Based on this and the neurological work-up, the pathogenesis of her NPSLE was made clearer in which the cerebral hypoperfusion was from myocarditis. The pathogenesis of reversible neurological deficits is not outlined in the AACR definition of NPSLE, which highlights the unmet need for an expansion of this definition, especially given the several cases that have occurred and have been reported in the literature so far , 8, 13.Certain disease-measuring instruments such as the Physician Global Assessment (PGA) and the SELENA-SLEDAI are widely used for measuring changes in lupus activity in clinical research, and regular use of these tools in routine clinical care is advocated for in the literature , 15. UnfThe patient showed significant improvement on her second day of steroids and continued to improve the following week. Physical therapy was a significant component to her progression to baseline in addition to the steroids. She was scheduled to go to an acute rehabilitation center to regain her strength and was to follow up with her outpatient rheumatologist for long-term management of SLE.Systemic lupus erythematous presents in a variety of ways, from subclinical to overtly detrimental. Our patient presented with reversible focal neurological deficits, elevated high-sensitive troponin levels, and high lupus serum antibodies who showed significant improvement after the introduction of high-dose steroids. This case highlights the importance of considering active lupus as a differential diagnosis for atypical presentations of cardiac and neurological involvement. Reversible focal neurological deficits are a distinct entity from CVD and demyelinating diseases but still fit the criteria for NPSLE. This case also highlights the availability of instruments such as the PGA and SELENA-SLEDAI to help assess worsening lupus activity. As cardiac and neurological manifestations are contributors of overall lupus morbidity and mortality, recognizing atypical manifestations and understanding the available tools are vital in routine patient care."}
+{"text": "Human adenovirus type 7 (HAdv-7) infection is the main cause of upper respiratory tract infection, bronchitis and pneumonia in children. At present, there are no anti- adenovirus drugs or preventive vaccines in the market. Therefore, it is necessary to develop a safe and effective anti-adenovirus type 7 vaccine.in vitro. We then measured the levels of neutralizing antibodies and T cell activation in vivo.In this study, In this study, we used the baculovirus-insect cell expression system to design a recombinant subunit vaccine expressing adenovirus type 7 hexon protein (rBV-hexon) to induce high-level humoral and cellular immune responses. To evaluate the effectiveness of the vaccine, we first detected the expression of molecular markers on the surface of antigen presenting cells and the secretion of proinflammatory cytokines The results showed that the rBV-hexon recombinant subunit vaccine could promote DC maturation and improve its antigen uptake capability, including the TLR4/NF-\u03baB pathway which upregulated the expression of MHCI, CD80, CD86 and cytokines. The vaccine also triggered a strong neutralizing antibody and cellular immune response, and activated T lymphocytes.Therefore, the recombinant subunit vaccine rBV-hexon promoted promotes humoral and cellular immune responses, thereby has the potential to become a vaccine against HAdv-7. In children, it is highly infectious and infection with HAdv often leads to diseases such as acute respiratory disease (ARD), which includes upper respiratory tract infection, bronchitis and pneumonia . In immuAdenoviruses are divided into seven subgroups: A, B, C, D, E, F and G. The most common types associated with respiratory infection are types 3, 7, 14 and 21 (subgroup B), types 1, 2 and 5 (subgroup C) and type 4 (subgroup E) . Among tThe administration of vaccines is an effective way to prevent infections. At present, there are no adenovirus vaccines available for public use, and only vaccines targeting HAdV types 4 and 7 have been developed for the US military . TherefoCompared with traditional inactivated vaccine and attenuated vaccine, genetically engineered subunit vaccine has higher antigen content and purity, and has many advantages such as strong specificity, non-infectivity, low cost, less restrictions, etc., and is the best choice for the research and development of vaccines for severe infectious diseases . At presIn this study, we selected the strategy of baculovirus vector expressing adenovirus type 7 hexon protein to construct the recombinant Baculovirus hexon (rBV-hexon) subunit vaccine. The vaccine construct can stably express the hexamer protein, which can not only promote DC maturation, but also effectively stimulate humoral and cellular immune responses, and does not lead to any dire effects in the vaccinated mice. This study provides an experimental basis for the future development of a safe and efficient recombinant subunit vaccine for human adenovirus type 7.22.1Human adenovirus type 7 was isolated and preserved in our laboratory. Female BALB/c mice aged 5 weeks old were purchased from the Experimental Animal Center of the Chinese Academy of Agricultural Sciences. The Institutional Animal Care and Use Committee (IACUC) of the Changchun University of Chinese Medicine approved the animal experimental protocols .2.2hAd-7 hexon sequence was obtained from the Human adenovirus 7 strain BJ/CHN/2018 (GenBank: MH355567.1). The hexon gene was inserted into pFastBac HT A vector to obtain pFastBac-hexon recombinant plasmid. The recombinant plasmid was transformed into competent cells of DH10Bac\u2122, coated on a blue-and-white spot screening plate containing tetracycline (10 mg/L), kanamycin sulfate (50 mg/L), gentamicin (7 mg/L) and IPTG/X-gal, and inverted at 37\u00b0C for 48 hours. White colonies were selected and added to SOC culture medium, and the recombinant baculocytes were extracted after shaking culture at 37\u00b0C for 3 hours. Then, 4 \u03bcg of recombinant baculovirus was mixed with 8 \u03bcL of Cellfectin II Reagent transfection reagent, and then added to 1.5 \u00d7 106 viable Sf9 cells (Insect cell line)/ml. After standing at 27\u00b0C, the cell state was observed every day. When 60% of the cells showed CPE, the supernatant was collected as the first generation recombinant baculovirus, which was used to infect SF9 cells and spread to the third generation, and the recombinant baculovirus (rBV) containing the hAd-7 hexon gene was obtained. To produce the recombinant subunit vaccine, 2.5 \u00d7 106 viable Sf9 cells (Insect cell line)/ml were infected with rBV at an MOI of 5 and incubated at 27\u00b0C for 72 hours. The expressed protein was purified by sucrose gradient ultracentrifugation and analyzed by western blot.The 2.36 cells per well. After 24h, 1 \u03bcg LPS (1\u03bcg/ml) and 10 \u03bcg rBV-hexon (5\u03bcg/ml) were added and the cells were further incubated for 48 hours. The DCs cells were then harvested and stained with FITC dextran (1mg/ml) at 37 \u00b0C and 4 \u00b0C for 2h respectively. Flow cytometry was used to analyze the difference in the mean fluorescence intensity (MFI). In the DC maturation experiment, supernatants obtained from the culture of antigen treated DCs were collected and used to detect the presence of IL-6 , IL-12p70 , TNF\u03b1  and IFN-\u03b3  according to the instructions of the ELISA kit.The mouse primary bone marrow cells were isolated according to the methods described in a previous study , and the2.4After euthanasia, the spleen was taken out under sterile conditions and smashed with a 70\u03bcm cell strainer to prepare a single-cell suspension. The spleen lymphocytes were extracted with Mouse Spleen Lymphocyte Separation Kit , and the red blood cells contained in the splenic lymphocytes were removed with Red Blood Cell Lysis Buffer .2.56 cells) and spleen lymphocytes (2 \u00d7 106 cells) were incubated with APC-CD11c , PE-CD80 , PE-CD86 , PE-CD40 , FITC-I-A/I-E , PE-CD3 , PerCP-CD4 , and FITC-CD8  antibodies and the proportion of positive cells was analyzed by flow cytometry.DC (2 \u00d7 102.66 cells) were pretreated with 100 nM TAK-242  or 20 mM PDTC  for 2 hours, and then incubated with 10 \u03bcg rBV-hexon for 48 hours at 37 \u00b0C. Cell surface markers were detected by flow cytometry and cytokines were detected by the ELISA kit.DCs  and immunized with the rBV protein at 0 and 21 days. Blood was collected weekly to detect the level of specific antibody and neutralizing antibody levels were detected according to the methods in previous study . The micescribed .6 cells) were stained with anti-CD3, CD4, and CD8, and then detected by flow cytometry. The cChanges in CD3+CD4+ and CD3+CD8+ counts in each group of mice were determined. The cCells were then stained with anti-IL-4 and IFN-\u03b3 and flow cytometry was used to detect changes in CD3+CD4+/IL-4/IFN-\u03b3 and CD3+CD8+/IL-4/IFN-\u03b3 in each group of mice.Extracted The extracted mouse spleen lymphocytes cells  score was established : (a) wei2.9The histopathological scores of each tissue were as follows: extremely mild or no - 0 point, mild - 1 point, moderate - 2 points and severe - 3 points Table 1.2.10P < 0.05 is considered statistically significant. *P < 0.05, **P < 0.01, ***P < 0.001.All data are presented as the mean \u00b1 SD. We used GraphPadPrism 6.0 to perform statistical analysis or analysis of variance (ANOVA) of unpaired double-tailed Student\u2019s test. 33.1Using the insect expression system, we constructed a recombinant baculovirus rBV expressing adenovirus type 7 hexon protein (3.2P <0.001), which was similar to that in the LPS group (\u25b3MFI=6340.29)  had the highest antigen uptake, while DCs cells in the rBV-hexon-treated group had significantly reduced antigen uptake (\u25b3MFI=9139.25)  treatment, while only MHC II and CD86 positive cells were significantly decreased after TAK242 (TLR4 inhibitor) treatment (via the TLR4/NF-\u03baB pathway.Studies have shown that the LPS receptor (TLR4) can recognize viral glycoprotein , and tha3.4P <0.05) than that in those of the control group and the adjuvant group. From the second week onwards, the effect of the high dose vaccine group was superior to that of the low dose vaccine group, and the adjuvant (Al(OH)3) was able to improve the specific antibody levels induced by the vaccine (Weekly tail vein blood collection and testing for specific antibodies towards adenovirus type 7 were performed over the mice immunization period (3.5P<0.01), but there was no significant difference between the adjuvant and control groups (P>0.05)  than that of the control group  of the Changchun University of Chinese Medicine.Conceived and designed the experiments: YQL, JH, JF and YZ. Performed the experiments: YRL, XY, RZ, ZX, SL, YL, GS and CG. Analyzed the data: RZ, JF and JH. Contributed reagents/materials/analysis tools: YZ, RZ, ZX, SL, YL, GS and CG. Wrote the paper: YRL, XY and YQL. All authors contributed to the article and approved the submitted version."}
+{"text": "Human infants cannot report their experiences, limiting what we can learn about their bodily awareness. However, visual cortical responses to the body, linked to visual awareness and selective attention in adults, can be easily measured in infants and provide a promising marker of bodily awareness in early life. We presented 4- and 8-month-old infants with a flickering (7.5\u00a0Hz) video of a hand being stroked and recorded steady-state visual evoked potentials (SSVEPs). In half of the trials, the infants also received tactile stroking synchronously with visual stroking. The 8-month-old, but not the 4-month-old infants, showed a significant enhancement of SSVEP responses when they received tactile stimulation concurrent with the visually observed stroking. Follow-up experiments showed that this enhancement did not occur when the visual hand was presented in an incompatible posture with the infant\u2019s own body or when the visual stimulus was a body-irrelevant video. Our findings provide a novel insight into the development of bodily self-awareness in the first year of life. Studies in recent years have revealed that several brain areas and networks are specialised to respond to bodily multisensory information and encode bodily self-awareness . However, little is known so far about the development of the neural basis of body representations and bodily awareness in early human development . In this study, we attempt to establish a neural marker of bodily awareness that can be used to trace the developmental origins of the sense of body ownership and self-awareness in preverbal human infants. Building on research showing that tactile stimulation of the hand promotes visual awareness of one\u2019s body in adults9, we investigated putative measures to track the development of bodily awareness in the first year by comparing tactile modulations of steady-state visual evoked potentials (SSVEPs) in 4- and 8-month-old infants.As an adult, perceiving one\u2019s own body is essential for skilled interactions with the external world and plays a fundamental role in the sense of self . Certainly, the multisensory basis of bodily perception is absent in such somatotopic markers. Studies in adults have demonstrated that perception of one\u2019s body is highly dependent on integrating bodily information across multiple senses .Researchers interested in the development of body representations in the human brain have recently explored the origins of somatotopy in cortical responses to tactile stimuli16). It is now generally established that even with only a few months (or even days) of postnatal experience, human infants are sensitive to the spatiotemporal congruency between cues about the body coming from different senses, specifically between proprioception and vision21, and between touch and vision/audition27. Additionally, these types of multisensory links are not limited to one\u2019s own body but can extend to another\u2019s body. For example, at 4\u00a0months of age, the somatosensory cortex can be activated by seeing other people being touched28.Several behavioural studies have probed the postnatal development of the multisensory links involved in body representations  when congruent tactile stimulation was also presented. However, rather than examining visual sensitivity through a verbally reported task, we investigated whether tactile stimulation would modulate the amplitude of SSVEPs in response to the visual presentation of a hand. SSVEPs are a neural correlate of visual awareness in adults39, and have been successfully applied in infants39 and even in newborns40. We conducted three experiments in which the visual displays of the body varied in the degree to which they were perceptually compatible with the infant\u2019s own body across multiple senses.In the present study, we investigated the tactile modulation of visual cortical responses to bodily stimuli in a cross-sectional comparison of 4- and 8-month-old infants. The design we used was similar to Van der Hoort et al.9, we proposed that a stronger SSVEP response in the tactile-visual condition than in the baseline condition would indicate tactile facilitation of awareness of visual bodily stimuli. To test whether this SSVEP enhancement is driven by a multisensory body representation that underpins the perception or by merely detecting the tactile-visual contingency of the stimuli, we conducted two further experiments in which we presented a body-irrelevant visual stimulus (Experiment 2) or an inverted visual hand (Experiment 3).In Experiment 1, infants watched a video of a hand stroked with a metal tube flashing at 7.5\u00a0Hz to elicit 7.5\u00a0Hz SSVEPs to be measured over the visual cortex. While observing the video, the infants either received a concurrent stroke on their hands  or did not (the baseline condition). Because synchronous tactile-visual stimulation increases visual awareness of the artificial hand in adults41. However, several studies doubt that human infants are bestowed with a fully-fledged sense of their own bodies before postnatal experience43. For example, it has been shown that the referral of tactile stimuli on the hand to coordinates in an external visual space emerges between 4 and 6\u00a0months43. Additionally, the use of body representations in the service of purposeful actions also undergoes significant spatial tuning, which continues well into late infancy44. Therefore, we considered two alternative hypotheses about the visual modulation by tactile information. The first hypothesis would suggest the modulation would be seen throughout the first year of life, while the second one indicates this would undergo development between 4 and 8\u00a0months of age.Recent studies show that newborns can detect aspects of multisensory congruence that specify their own bodyWe presented groups of 4, and 8-month-old infants with a video of a hand stroked with a metal tube Fig.\u00a0A flashin46. Ten additional infants were excluded due to fussiness (nine infants) or EEG recording trouble (one infant). All infants were recruited locally, full-term at birth, and healthy at the time of the experiment. The experiment was conducted in accordance with the ethical principles for conducting research with children. This experiment was carried out in the UK, and ethical approval was obtained from the Ethics Committee of the Department of Psychology Goldsmiths, University of London. Written informed consent was obtained from the parents of the participants.Fourteen 4-month-old infants  and fourteen 8-month-old infants participated in this experiment . We did not perform a power calculation during design because no previous studies were available to estimate the effect size of an enhanced SSVEP response. Therefore, we determined our sample size after previous SSVEP studies with infant participants8, brushes41, mechanical taps11, median nerve stimulation47, and nociceptive touch48. Here, we selected a stimulus that could provide spatiotemporally discriminative cues in both tactile and visual sensory modalities . We recorded a video in which a toddler\u2019s left hand was stroked with an aluminium tube. The hand was presented on the screen in an upright and dorsal-facing orientation  was used to present visual stimuli. The infant\u2019s looking behaviour was monitored by a hidden infrared camera set below the display. A dynamic cartoon was shown in the centre of the monitor before each trial to attract the infant\u2019s attention. A second experimenter outside the room observed the infant\u2019s behaviour via a video monitor and controlled the timing of the stimulus presentation after confirming that the infant was looking at the cartoon. The tactical-visual and baseline conditions were randomly presented. The duration of each trial was fixed at 4\u00a0s. During the inter-trial intervals, looming images of animals were presented to attract the infant\u2019s attention. Continuous EEG was recorded throughout. Data collection continued as long as the infants remained settled and were attentive to the visual stimulus.The electrical activity of the brain was continuously recorded using a Hydrocel Geodesic Sensor Net, consisting of 128 silver\u2013silver chloride electrodes evenly distributed throughout the scalp. The electrical potential was amplified by Net Amps 300 , digitised at a 500\u00a0Hz sampling rate, and stored on a computer disk for offline analysis.46.A technical colleague who did not know the identity of the stimulus coded the looking behavior of each infant and removed the epochs in which the infant did not fixate the visual stimulus on the monitor for 3.5\u00a0s continuously in a single test. This criterion ensured that the EEG signals used for further analysis were recorded when the infants actively observed the visual stimulus. Infants were only included in the further analysis if they completed five or more trials for each condition, a similar criterion used in previous infant SSVEP studies50.The EEG signals were preprocessed using the EEGLAB toolbox in Matlab R2018a . A 1\u2013100\u00a0Hz bandpass filter (basic linear finite impulse response filter) was applied to remove slow drifts and high-frequency noise in the EEG signals. The EEG signals were then re-referenced to an average reference and segmented into epochs that lasted from 0 to 4\u00a0s following the onset of the visual stimulus. Epochs containing large artefacts  were discarded. The segmented data were then averaged in the time domain, separately for each condition and each infant. A discrete Fourier transformation analysis was performed for the averaged data on the electrodes in an EEG frequency domain at a frequency resolution of 0.25\u00a0Hz (=\u20091/4\u00a0s). Signal-to-noise ratios (SNRs) were computed for noise variations across the EEG spectrum. SNRs in the 4\u00a0s epochs were calculated as the 7.5\u00a0Hz signal amplitude ratio and the average of the amplitudes in 8 surrounding frequency bins. The surrounding frequency bins were separated by units according to frequency resolution (0.25\u00a0Hz) and comprised windows of\u2009\u00b1\u20091\u00a0Hz around the following points: 6.5\u00a0Hz, 6.75\u00a0Hz, 7\u00a0Hz, 7.25\u00a0Hz, 7.75\u00a0Hz, 8\u00a0Hz, 8.25\u00a0Hz, and 8.5\u00a0Hz)\u03c72 (1)\u2009=\u20090.000, p\u2009=\u20090.995, n.s.; baseline condition, \u03c72 (1)\u2009=\u20090.000, p\u2009=\u20091.000, n.s.).For each condition, we had between 5 and 16 valid trials for analysis . The average numbers of trials excluded because the infants looked away from the visual stimulus in the tactile-visual condition were 10.5 (4-month-old infants) and 9.6 (8-month-old infants). For baseline trials, an average of 11.4 (4-month-old infants) and 9.4 (4-month-old infants) trials were excluded for the same reason. There was no significant difference in the number of valid trials contributed in the two conditions between age groups \u2009=\u20097.027, p\u2009=\u20090.000, d\u2009=\u20091.878; baseline, t(13)\u2009=\u20095.074, p\u2009=\u20090.000, d\u2009=\u20091.356, and for 8-month-old infants: tactile-visual, t(13)\u2009=\u20098.930, p\u2009=\u20090.000, d\u2009=\u20092.387; baseline, t(13)\u2009=\u20098.363, p\u2009=\u20090.000, d\u2009=\u20092.235; a Bonferroni corrected significance level of 0.0125 was used) \u2009=\u20095.223, p\u2009=\u20090.031, \u03b7p2\u2009=\u20090.167), but no significant main effect of condition or age group \u2009=\u20093.331, p\u2009=\u20090.079, \u03b7p2\u2009=\u20090.114; Age group, F\u2009=\u20090.042, p\u2009=\u20090.840, \u03b7p2\u2009=\u20090.002). To scrutinize the interaction effect, separate one-way ANOVAs examined the effect of the condition for each age group. For 8-month-old infants, the mean SNR obtained in the tactile-visual condition  was significantly higher \u2009=\u200915.46, p\u2009=\u20090.001, \u03b7p2\u2009=\u20090.543) than that in the baseline condition  \u2009=\u20090.073, p\u2009=\u20090.791, \u03b7p2\u2009=\u20090.006). We also report Bayes Factor (BF) in order to help evaluate the null hypothesis. A BF exceeding 3 signifies substantial evidence favouring the alternative hypothesis (H1) over the null (H0), often analogous to p\u2009<\u20090.05. A BF of 1/3 or less indicates substantial evidence for H0 over H1, while a BF ranging between 3 and 1/3 suggests the data is inconclusive for distinguishing either hypothesis. Following the execution of a Bayesian paired T-test, our findings provide moderate evidence supporting the absence of SSVEP enhancement in 4-month-old infants (BF\u2009=\u20090.279). Conversely, among 8-month-old infants, strong evidence endorses the presence of SSVEP enhancement (BF\u2009=\u200924.7).The final stage of our analysis was to examine the effect of the experimental manipulation on the SSVEP response. SNRs were analysed using a 2\u2009\u00d7\u20092 mixed analysis of variance (ANOVA) with condition  and age group (4-month-olds vs. 8-month-olds) as factors. This analysis revealed a significant interaction between the factors, condition x age group . Four additional infants were excluded from the sample due to fussiness (three infants) and difficulty recording EEG (one infant). All infants were recruited from the UK and were full-term at birth and healthy at the time of the experiment. Ethical approval was obtained from the Ethics Committee of the Department of Psychology at Goldsmiths University of London. In addition, written informed consent was obtained from the parents of the participants.2. The video had an identical visual angle to that used in Exp. 1 and flickered at the same frequency, i.e., 7.5\u00a0Hz. In the tactile-visual condition, the infants watched the video accompanied by a tactile stimulation identical to that in Exp. 1. In contrast, no tactile stimulation was presented in the baseline condition.The visual stimulus was a body-irrelevant video in which a doll danced on a ball. The average luminance per frame of the video was quantified as 64.0\u00a0cd/mThis experiment was carried out in the same laboratory as in Experiment 1. EEG recording and analyses were the same as described in Experiment 1.\u03c72 (1)\u2009=\u20090.000, p\u2009=\u20091.000, ns). The average number of trials excluded because infants looked away from the visual stimulus was 7.3 in the tactile-visual condition and 7.0 in the baseline condition. Consistent with Experiment 1, strong SSVEP responses were observed over the medial occipital cortex, as shown in the SNR topography \u2009=\u20096.784, p\u2009=\u20090.000, d\u2009=\u20091.958; baseline, t(11)\u2009=\u20099.989, p\u2009=\u20090.000, d\u2009=\u20092.884, a Bonferroni corrected significance level of 0.0125 was used) \u2009=\u20090.117, p\u2009=\u20090.739, \u03b7p2\u2009=\u20090.010). Additionally, a BF of 0.302 from the Bayesian paired T-test provided support the null hypothesis (H0). Consequently, the mean SNR of the tactile-visual condition, M\u2009=\u20094.957, SD\u2009=\u20092.020, did not differ statistically from that of the baseline condition, M\u2009=\u20094.775, SD\u2009=\u20091.309 , compared to Experiment 1 (38.5\u00a0cd/m2). Given that the visual stimuli were modulated in a pattern of onset/offset, the magnitude of SSVEP response primarily depends on the luminance change between the onset/offset alternation. Consequently, we refrained inferential statistical comparisons of the SSVEP responses in Experiment 1 and 2 within an omnibus analysis.It is noteworthy that the SSVEP response in the baseline condition in Experiment 2 (4.775) was larger than that in Experiment 1 (3.953). This increase in response can be attributed to the higher luminance of the visual stimuli in Experiment 2 , and sensitivity to crossmodal visual-tactile congruency in both infants and adults54. Therefore, we predicted that if the tactile enhancement of visual processing observed in 8-month-olds in Experiment 1 was driven by a multisensory representation of their own body , we would see a weaker or absent influence of tactile stimulation on infant SSVEPs.In this experiment, we further probed the extent to which the tactile enhancement of visual processing observed in 8-month-olds in Experiment 1 was specific to the visual processing of their own bodies. The design of Experiment 3 was identical to Experiment 1, except the visual stimulus of the hand was inverted, which means that its visually presented posture was incompatible with the posture of the infant observer\u2019s own body. Such manipulations are known to undermine a sense of body ownership in adults . Four additional infants were excluded from the sample due to fussiness (three infants) and poor EEG signals (one infant). All infants were full-term at birth and healthy at the time of the experiment. This experiment was carried out in Japan, and ethical approval was obtained from the Ethics Committee of Chuo University.Visual and tactile stimuli were identical to those used in Exp. 1, except that the video stimuli were inverted so that the hand was presented with a finger pointing downward in a posture incompatible with the posture of the infant\u2019s own body.A 32-inch LCD display  was used to present visual stimuli. The sizes of the visual stimuli were rescaled so that these subtended a visual angle with the visual stimuli in Experiments 1 and 2. We used different Hydrocel geodesic sensor nets to record the EEG signals. These nets were newer than those used in Experiments 1 and 2. Otherwise, the procedures were the same as those used in Experiments 1 and 2. As before, the tactile-visual and the baseline conditions were presented randomly. The EEG recording and analyses were the same as described in Experiment 1 and 2.\u03c72 (1)\u2009=\u20090.004, p\u2009=\u20090. 951, ns). The average number of trials excluded because infants looked away from the visual stimulus was 10.8 in the tactile-visual condition and 10.3 in the baseline condition. Consistent with Experiments 1 and 2, strong SSVEP responses were observed from the SNR topography in the medial occipital cortex \u2009=\u20097.831, p\u2009=\u20090.000, d\u2009=\u20092.093; baseline, t(13)\u2009=\u20099.065, p\u2009=\u20090.000, d\u2009=\u20092.423, a Bonferroni corrected significance level of 0.0125 was used) \u2009=\u20097.212, p\u2009=\u20090.012, \u03b7p2\u2009=\u20090.217) and a significant main effect of the experiment \u2009=\u200917.96, p\u2009=\u20090.000, \u03b7p2\u2009=\u20090.409), but without a main effect of condition \u2009=\u20090.221, p\u2009=\u20090.642, \u03b7p2\u2009=\u20090.008). These results indicated that visual manipulations could modulate the tactile enhancement of SSVEPs in two different experiments. A further one-way repeated-measure ANOVA with the condition was applied to examine the tactile enhancement of SSVEPs in Experiment 3. This showed that the effect of the condition was not significant \u2009=\u20091.462, p\u2009=\u20090.248, \u03b7p2\u2009=\u20090.101), and indeed any trend in this effect was in the direction of greater SNR in the baseline condition, M\u2009=\u20098.672, SD\u2009=\u20093.167, than in the tactilevisual condition, M\u2009=\u20097.856, SD\u2009=\u20093.276  and was presented in a posture that was spatially compatible with their own body (Experiment 3). Together, these findings demonstrate that tactile-visual crossmodal interactions in the brain become tuned to certain featural and spatial visual cues concerning the infant\u2019s own body between 4 and 8\u00a0months of age. Additionally, we believe that this is the first demonstration of crossmodal influences of somatosensory input on visual processing in human infants.9. Such effects have been taken to indicate that spatiotemporally congruent tactile-visual cues of the kind presented here to promote a sense of ownership and visual awareness of the body in adults. However, human infants cannot report their visual awareness. Here we suggest that the tactile enhancements of SSVEPs, as presented here, provide an intuitive and reasonable alternative measure of visual bodily awareness in infants, which can be added to the growing battery of neural measures of perceptual consciousness in infancy56. In fact, the SSVEP response to visual stimuli is correlated with visual awareness in adults39, and could be enhanced by the visuomotor contingency57. We also raise the possibility that the enhancement of SSVEPs could be used as a marker of the sense of limb ownership in infants because visual awareness of the body is correlated with the sense of body ownership in adults9. In contrast to 8-month-olds, 4-month-olds in Experiment 1 showed no tactile enhancement of their SSVEPs, leading to the conclusion that the multisensory visual-tactile interactions involved in bodily awareness undergo development throughout the first year of life. Our results undermine the notion that infants are born with fully functional bodily awareness58, i.e., the notion that the human newborns can be aware of their own body.Enhancements in the visual processing of bodily information by tactile input have been observed in adults, but measured through an increased report of visual images of the hand during continuous flash suppression presentations24 reported hemodynamic responses close to the temporal-parietal junction (TPJ) and the superior temporal sulcus (STS) that were sensitive to visual-tactile and visual-proprioceptive multisensory congruency; of note, hemodynamic responses were modulated by the degree of synchrony between the infant\u2019s own bodily movements\u00a0or\u00a0tactile experiences and a video feed of their movements viewed on a screen. In a further study with 4-month-old infants, Rigato et al.28 reported a modulation of somatosensory evoked potentials according to whether they observed simultaneously the touch, another person\u2019s hand being touched (or the surface next to the hand being touched).In contrast to our findings, two studies have demonstrated neural sensitivity to visual-somatosensory information in early infancy. In a study with 5-month-old infants, Filippetti et al.28 concerning young infants\u2019 sensitivity to vicariously observed tactile stimulation on another person\u2019s limb is precisely based on the lack of compatibility between the limb of the infant participant and the limb on which they observed the tactile event. As such, although these studies demonstrate infant sensitivity to visual-tactile and visual-proprioceptive congruency in the first 4 to 5\u00a0months of age, the conclusions that can be drawn about the presence of representations or self-awareness in these age groups are more limited.Crucially, neither of these aforementioned studies included a manipulation of the spatial compatibility of the visually observed bodily stimulation with the infant\u2019s own body. Indeed, the argument of Rigato et al.28) may arise earlier than their awareness of their own body59.In contrast to the studies just discussed, in our Experiment 1, we saw no evidence that our SSVEP putative marker of visual awareness of the body was modulated by tactile stimulation in our younger sample of infants. This was only seen in the 8-month-old infants\u2019 SSVEP responses when the infants were viewing visual stimuli, which showed the degree of featural and spatial compatibility with the infant\u2019s own body. Therefore, these results suggest the emergence of bodily self-awareness throughout the first postnatal year of life. Further research is required to examine the effects of the specificity of physiological and behavioural measures of self-awareness to multisensory cues specifying the infant\u2019s own body to gain a full picture of the emergence of bodily self-awareness in early life. An intriguing possibility is that infants\u2019 sensitivity to perceptual information about sensory events on other people\u2019s bodies  compared to asynchronous stroking. Importantly, this effect was not observed when the visual face was inverted, suggesting that attention to visual-tactile congruency was specific to body-specific processing. This effect is comparable to the differential modulation of SSVEPs by tactile stimulation developing between 4 and 8\u00a0months in the data reported in Experiments 1 and 3. The crucial difference is that Filippetti\u2019s study involves visual-tactile processing on the face, whereas current studies examine this in relation to the hand. Given that the face is such an important focus of perceptual processing in early postnatal life (e.g.60), one potential explanation for the discrepancy in these findings is that bodily tactile-visual processing and awareness may emerge according to different developmental timetables for different parts of the body, with visual-tactile processing of the face forming a primitive and early developing basis for bodily awareness, and awareness spreading to the peripheral limbs as infants gain more competence at controlling these through the first postnatal year. This account would be consistent with an increasing number of studies demonstrating that the development of multisensory limb representation depends on postnatal experience . For example, several studies now show that the influence of external spatial coordinates on the localisation of tactile stimuli in the hands and feet develops gradually throughout the first year of life63, and depends on visual experience66.An important behavioural study in this field has demonstrated an index of visual-tactile perception in newborns modulated by the specificity of visual information concerning the body. Filippetti et al.16). We propose that multisensory integrative mechanisms that construct a body representation, rather than tactile stimulation itself, modulate the activity observed in the visual cortex. This view is in line with evidence from human adults showing that activations in the visual cortex, including the primary visual cortex67 and the extrastriate body area (EBA)70, are upregulated by tactile stimulation during a form of rubber hand illusion. In these studies, feedback signals from the intraparietal sulcus and the premotor cortex, which are known to be involved in the sense of body ownership71, are integrated with a body representation that improves the processing of visual stimulation through a top-down modulation that can play a role in improving visual awareness of the stimulation. This proposal is also compatible with the findings that interregional functional connectivities in the brain develop dramatically after six months of age, while intraregional functional connectivities emerge at birth72. Furthermore, recent studies have shown that feedback processing in the visual system develops after 7\u00a0months of age74. Therefore, it is possible that the\u00a04-month-old infants in Experiment 1 did not show any enhancement in SSVEPs due to a lack of feedback from higher-level cortices to the visual cortex, which developed between 4 and 8\u00a0months of age.How does tactile-visual stimulation promote visual processing of the hand in 8-month-old infants? Evidence from recent developmental studies has revealed that multisensory experiences obtained from their own bodies facilitate the development of body representations in infants  in which we seek to identify measures which can comprise a network of measurable phenomena which can lead to more firm conclusions about the origins of awareness of the bodily self in infancy. We have identified SSVEP responses that are measurable in infants as a proxy for visual awareness33. Based on this hypothesis, we have examined whether dimensions of bodily stimulation  known to be predictive of body ownership and visual self-awareness in adults9 would also influence the strength of SSVEPs in infants. Given the modulations of SSVEPs between age groups and experiments related to these bodily dimensions, we conclude here that tactile-visual crossmodal interactions in the brain tuned to sensory information specifying the infants\u2019 own bodies develop between 4 and 8\u00a0months of age. Importantly, there are further questions that can be asked about the specificity of tactile enhancement of SSVEPs in human infants . However, the manipulations undertaken in our report go beyond previous studies of the neural basis of early body representations (e.g.28), in that they show that the tactile-visual interactions observed are specific to an upright visual orientation of the hand which through its postural compatibility with the infant\u2019s own body preferentially specifies the infant\u2019s own body.It is important to carefully qualify the extent to which the data presented here demonstrate clear evidence of the development of bodily self-awareness. In the absence of direct measures of conscious awareness in human infants , our approach in this study adopts a natural kinds framework (see, e.g.In summary, our findings indicate that multisensory tactile-visual interactions in SSVEPs tuned to sensory information specifying an infant\u2019s own body develop between 4 and 8\u00a0months of age. We propose that tactile enhancement of SSVEPs specific to the infant\u2019s own hand in a posturally-compatible upright visual presentation represents a plausible marker of emerging awareness of the bodily self in early life, which can contribute to the growing literature on the origins of conscious awareness in preverbal postnatal development and independently provide a promising avenue for investigating the specificity of early body representations in human infancy."
\ No newline at end of file