diff --git "a/deduped/dedup_0666.jsonl" "b/deduped/dedup_0666.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0666.jsonl"
@@ -0,0 +1,39 @@
+{"text": "Furthermore, hypotension (systolic BP < 80 mm Hg) was present in 44% of children with severe acidosis (base deficit >15). These findings also indicate important baseline differences in two cohorts of children studied. We agree that reconsideration of guidelines for acute fluid management is warranted, particularly when current recommendations await an adequate evidence base. Nevertheless, conflicting opinions on the question of volume status in children with severe malaria can be satisfactorily resolved only through prospective randomized trials that include both fluid resuscitation and control groups. While the design and conduct of such trials will involve considerable challenges, optimal fluid management will never be resolved on the basis of theoretical consideration alone.The study by Planche et al."}
+{"text": "We recently established a human breast cancer cell line, KPL-3C, from a breast cancer patient with humoral hypercalcaemia. This cell line possesses oestrogen receptor (ER) and secretes parathyroid hormone-related protein (PTHrP) into medium. To investigate the effects of oestrogen and antioestrogens on PTHrP secretion, KPL-3C cells were cultured for 48 h in an oestrogen-eliminated medium with 17beta-oestradiol (E2), tamoxifen (TAM) and/or a pure antioestrogen, ICI182,780 (ICI), and PTHrP secretion was measured using an immunoradiometric assay. The effects of these agents on cell cycle progression were also studied using flow cytometry. E2 (1-100 nM) significantly inhibited PTHrP secretion, whereas both TAM (0.1-10 microM) and ICI (1-100 nM) significantly stimulated it. These effects were completely blocked by the simultaneous addition of 1 nM E2 to the medium. At the same time, E2 significantly increased the percentage of cells during the S and G2/M phases, whereas both antioestrogens significantly increased the percentage of cells during the G0/G1 phase. Again, these cytostatic effects were completely reversed by the addition of E2. These findings indicate that antioestrogens inhibit the growth of ER-positive breast cancer cells but may stimulate PTHrP secretion and that these effects may be mediated by ER."}
+{"text": "Escherichia coli allows cells to detect changes in external ligand concentration (e.g. nutrients). The pathway regulates the flagellated rotary motors and hence the cells' swimming behaviour, steering them towards more favourable environments. While the molecular components are well characterised, the motor behaviour measured by tethered cell experiments has been difficult to interpret.The chemotaxis pathway in the bacterium We study the effects of sensing and signalling noise on the motor behaviour. Specifically, we consider fluctuations stemming from ligand concentration, receptor switching between their signalling states, adaptation, modification of proteins by phosphorylation, and motor switching between its two rotational states. We develop a model which includes all signalling steps in the pathway, and discuss a simplified version, which captures the essential features of the full model. We find that the noise characteristics of the motor contain signatures from all these processes, albeit with varying magnitudes.Our analysis allows us to address how cell-to-cell variation affects motor behaviour and the question of optimal pathway design. A similar comprehensive analysis can be applied to other two-component signalling pathways. Biological systems sense stimuli from their environment using cell-surface receptors, and process this information to make reliable decisions, e.g. where to move, or whether to divide or to express new enzymes. Typically, intracellular signalling molecules are activated by modification, e.g. phosphorylation or methylation, and interact in complicated biochemical reaction networks. The biochemical reactions in such networks rely on probabilistic collisions of a limited number of molecules. Hence, the number of signalling molecules fluctuates with time, making signal processing noisy. The abundance of noise sources in a cell is in stark contrast to the remarkable accuracy with which cells are known to respond to minute amounts of chemical concentration, including growing axons and immune cells ,2.E. coli . Typically, any system is subject to various sources of noise, i.e. random fluctuations in the input, as well as from signal processing. This is true in particular for biological systems, which rely on biochemical reactions and conformational changes of signalling molecules, which are intrinsically probabilistic. Here, we use the noise power spectrum to characterise fluctuations. The power spectrum captures the correlations between fluctuations in motor behaviour at different time points . In order to make the analysis easier, we typically consider the Fourier transforms of the dynamical equations of our model. The Fourier transform is an equivalent description of time-dependent data, and represents its decomposition into its frequency components. Using this analysis, there are several fundamental questions we would like to address:To characterise signal propagation along the pathway, we use the so-called linear response function. This function characterises the response to a small time-varying input signal, such as impulse, sinusoidal and step stimuli. However, knowing the linear response function allows the calculation of system response to Firstly, what types of signals are transmitted and what types are attenuated by the pathway? Early work showed that the system responds to the time-derivative of the input signal . A numbeSecondly, how is noise generated, amplified or filtered in the signalling pathway, and how do different sources of noise affect the motor behaviour? The power spectrum of the motor rotation was measured for wild-type cells and mutant cells lacking the chemotaxis signalling pathway . The speFinally, how reliably are concentration input signals transmitted through the pathway in the presence of noise? An important task for the cell is to generate an appropriate motor response to input signals in the presence of fluctuations in the input, as well as due to noise in the biochemical signalling pathway. Furthermore, cell-to-cell variation in protein expression influences signal transmission and noise filtering. Comparing these two aspects of the pathway dynamics, namely chemotactic signal transmission and noise filtering, in close comparison with experimental data along the pathway is a novel perspective in our present study.Methods section. We discuss the average (deterministic) response of the signalling pathway to concentration signals. We analyse the noise sources in the signalling pathway and their effects. Finally, we vary pathway parameters and study how they affect signal and noise transmission. We also discuss briefly how our approach can be applied to other two-component systems and signalling pathways.In the following, we present a mathematical model for the chemotaxis signalling pathway. A simplified pathway is discussed in the text to provide intuitive understanding. However, results are shown for an extended model for the full pathway provided in the Methods). Specifically, the response has been measured at the level of CheY-P using fluorescence resonance energy transfer (FRET) by Shimizu et al. [\u03b1-methyl-DL-aspartate (MeAsp). Using a series of frequencies of the stimulation, the magnitude (modulus) and phase, i.e. the lag between signal and response, of the response was determined. In cell-tether experiments of motor rotation, the response to short impulses of attractants was measured at the level of the motor by Block et al. [The signal propagation in the chemotaxis pathway has been characterised by the response to small concentration signals  and an inactive (off) state. Their activity A is described by the Monod-Wyman-Changeux (MWC) model [c at the receptor complex, as well as the methylation level M of the complex as detailed in Methods.We assume C) model -47. The C Nreceptor complexes in a cell, and assume that each complex signals independently of the others. The total activity c Aof all receptors in a cell is determined by the sum over all signalling complexes j. The dynamics of the total activity isWe consider \u03b7(t) introduced in this section are discussed in Methods.i.e. the dynamics of the complex activity is affected by changes in the receptor complex methylation level (first term), changes in ligand concentration (second term), as well as fluctuations due to the switching of the complex between its states (last term). All noise terms c(t)\u232a, as well as fluctuations due to ligand diffusion. The dynamics of the concentration at the jth receptor complex is given byChanges in the concentration originate from time-varying input signals \u2329where the first term captures average concentration changes (indicated by angular brackets \u2329...\u232a), affecting all receptors, and the second term describes concentration fluctuations at each receptor complex, assumed to be uncorrelated between different receptor complexes.Adaptation is provided by reversible receptor methylation and demethylation, whose dynamics is described by the following equation :j Mof a receptor complex j is changed by methylation of receptors in the inactive state by CheR (first term) and demethylation (second term). This latter rate is assumed to be strongly dependent on the receptor complex activity as only active receptors are demethylated by phosphorylated demethylation enzymes CheB-P. These may act cooperatively, in agreement with time course data of wild-type and a CheB adaptation mutant [The total methylation level n mutant . The lasX is derived from the Master equation of an ensemble of two-state motors, and is given byThe motor is described as a two-state system with CW and CCW rotating states, corresponding to running and tumbling modes, respectively. The dynamics of the motor bias X the fraction of motors in the CW rotational state and applying the single-motor limit. In Eq. 4, the first term represents the switching from CCW to CW with the transition rate k+, the second term represents switching from CW to CCW with transition rate k-, and the third term describes temporal fluctuations in switching rates due to the stochastic nature of motor switching. Note that the Langevin equation for the two-state motor is exact [with is exact , see alscA, whereas in the full pathway model CheY-P modulates motor switching. These rates have been experimentally measured using signalling mutants expressing varying amounts of constitutively active signalling molecule CheY [Methods) to the data, are shown in Figure Here, transition rates are modulated by the receptor signalling activity ule CheY . The swiule CheY  (cf. MetMethods). Briefly, an input signal \u0394c(t) is a concentration change relative to a constant background concentration c0, affecting all receptors equally and representing a \"meaningful\" input to the chemotaxis signalling pathway. Hence, the concentration is given by \u2329c(t)\u232a = c0 + \u0394c(t). Furthermore, cells are assumed to be adapted to the pre-stimulus concentration c0 with the various levels R of the signalling pathway adapted to their steady-state values R*.We consider the response to input concentration signals at various levels in the signalling pathway to study how signals are transmitted to the rotary motor (see Methods). We can analyse the filtering of the signal at each level of the pathway. The Fourier transformed linear response function for the total activity of all receptors in a cell isWe can analytically calculate the Fourier transformed linear response function from the dynamical equations Eq. 1-4 without noise (see \u03c9 below M \u03c9= (\u03b3R + 3\u03b3BA*2)\u2202A/\u2202M, which is the characteristic frequency due to adaptation. For frequencies above M \u03c9the response function is a constant, given by the number of receptor complexes C Nparticipating in the response, and their sensitivity \u2202A/\u2202c to ligand, evaluated at steady-state. The sensitivity is proportional to the receptor complex size N, i.e. it describes the amplification of the response of a single receptor.The receptor activity is a high-pass filter: The magnitude of the response function is small for frequencies Similarly, the Fourier transformed response of the motor is given by\u03c92 describes the sensitivity of motor switching with respect to changes in receptor activity (Methods). At frequencies above X \u03c9the response is reduced. From Eq. 6 it is obvious that receptors and motor are in a cascade: The motor response introduces a new filter proportional to (i \u03c9- i\u03c9)-1 which simply multiplies the response function of the response of the receptor activity. The response functions of the full pathway including the phosphorylation reactions are shown in Additional File The motor is a low-pass filter, i.e. its dynamics introduces a frequency-dependent response, which is constant below the characteristic frequency For further analysis, we can write the Fourier transformed linear response function asR is the phase of the response function, which characterise the amplitude and lag of the response behind the input signal, respectively.where X \u03c9of the motor switching is 2.1/s, consistent with switching rates of about 1 Hz [left). The adaptation rates for room temperature are one order of magnitude smaller. Importantly, fitting to the magnitude of the Fourier transformed response yields a good fit for the phase of the response as well . Fitted parameters are given in the Methods.Figure out 1 Hz . It is nout 1 Hz . Besidesout 1 Hz  used popout 1 Hz  were donout 1 Hz , we adjuout 1 Hz  , including total receptor activity in a cell (cA), phosphorylated kinase CheA, phosphorylated response regulator CheY, and finally the motor (X). In Figure middle we show the corresponding linear response functions.Figure c(t) up to the characteristic frequency M\u03c9, eliminating the response to slowly changing attractant concentrations. The activity of chemoreceptors is the input to further levels in the pathway. The response of CheA-P is fast, and shows no qualitative difference to the response of receptors in the frequency range shown. In contrast, due to the fast but finite rates of phosphorylation and dephosphorylation, preventing the CheY-P concentration to respond to rapidly changing input signals, the response at the level of CheY is reduced at high frequencies. Similarly, the motor introduces another high-frequency filter due to slow switching between its two states. This additional filter can be deduced from Eq. 6, where the motor response function takes the response of chemoreceptors as input, and additionally introduces a characteristic cut-off frequency X \u03c9due to slow motor switching rates. Hence, the chemotaxis pathway acts as a band-pass filter [middle the phase tends towards \u03c0/2, i.e. a quarter period, at low frequencies. This has been analysed only for the receptor complex activity [M \u03c9of adaptation. The phase shift of the receptor activity increases to \u03c0 at high frequencies, indicating that the activity simply follows the output , this property is due to adaptation, which introduces the time-derivative of the signal \u0394s filter , which oactivity . This phntration ). The phon and off states, as well as receptor methylation and demethylation, phosphorylation and dephosphorylation of signalling proteins CheA, CheY and CheB, and switching of the rotary motor between its two states, CW and CCW rotation. To characterise fluctuations of the phosphorylated signalling protein \u03b4R(t) around its mean value \u2329R(t)\u232a, we use the power spectrum RS(\u03c9) and the variance \u2329\u03b4R2\u232a = \u2329R2(t)\u232a - \u2329R(t)\u232a2 (cf. Methods).To understand the noise characteristics of the motor, we consider the noise sources and their transmission in the pathway. Each step in the signalling pathway is essentially probabilistic, hence, noisy: ligand diffusion and binding, receptor switching between its functional Methods). The power spectrum of activity fluctuations is given byConsidering Eq. 1-4 with noise, we can analytically calculate power spectra , cS(\u03c9) and M Qare given by Eq. 30, 34 and 36 in Methods. The frequency dependence of the ligand noise, as well as noise from receptor complex switching, indicates filtering of slowly varying fluctuations with frequencies below the characteristic frequency M \u03c9due to adaptation. In contrast, only high-frequency fluctuations from the receptor methylation dynamics are filtered by the adaptation dynamics. This is due to finite rates of methylation and demethylation fluctuations introducing correlations in the receptor methylation level.In this equation we considered fluctuations from receptor switching (first term in numerator), ligand diffusion (second term), as well as the receptor methylation dynamics (third term) at each of the The power spectrum of fluctuations in the motor bias is obtained asX\u03c9. The noise spectra of the full pathway including the phosphorylation reactions are shown in Additional File The first term represents transmitted noise from receptor complexes, including the noise power spectrum of the receptor activity and the sensitivity right we show the power spectrum of fluctuations at the various levels of the signalling pathway, i.e. total receptor activity, CheA-P, CheY-P and the motor. We also plot the individual contributions from processes generating noise, namely ligand diffusion, receptor switching, methylation and demethylation of receptors, and phosphorylation and dephosphorylation of proteins, as well as motor switching. This allows us to follow how noise is generated and transmitted at the various levels of the pathway. The noise spectrum of the receptor activity has its largest contribution at low frequencies, which originates in the receptor methylation and phosphorylation dynamics. Most of the fluctuations from phosphorylation stem from CheB . At high-frequencies, the activity noise spectrum is at. This is due to ligand and receptor switching noise, which is removed at low frequencies by adaptation, but not at high-frequencies. The general behaviour of the noise spectrum corresponds to the simplified model (cf. Eq. 8).In Figure The noise spectrum of CheA-P has generally the same shape as the activity spectrum with a large low-frequency component, mainly due to receptor methylation and CheB phosphorylation dynamics. This spectrum also has an almost flat high-frequency behaviour in the frequency range shown. Apart from ligand and receptor switching noise, the flat part of the spectrum is largely determined by fluctuations from CheA autophosphorylation, which has roughly the same shape as activity noise at high frequencies because autophosphorylation depends on the receptor activity.The noise spectrum of CheY-P is also largest at low frequencies. However, at high frequencies the spectrum falls off as noise is filtered due to the finite rates of CheY phosphorylation and dephosphorylation, which introduce correlations in the fluctuations.X \u03c9(cf. Eq. 9). Hence, transmitted noise is reduced by two filters in the frequency range shown, namely due to the CheY-P and motor dynamics. However, the main contribution to the spectrum is due to the motor switching itself, which is reduced only by a first-order filter with characteristic frequency X\u03c9.The motor introduces another layer of filtering of transmitted noise with the characteristic motor switching frequency How are the signal response, fluctuations and the signal-to-noise ratio (SNR) affected by changing parameters of the pathway such as size of receptor complexes, protein concentrations and reaction rate constants? In this section, we discuss the effect of cell-to-cell variation on the power spectrum of the motor. In the next section, we discuss the SNR and its contributions, and how they depend on receptor complex size and adaptation rates.right). Specifically, Figure According to our model parameters obtained from fitting the Fourier transformed linear response to data, the main contribution to the power spectrum comes from the steady-state switching of the motor between CCW and CW state. However, cell-to-cell variation in protein content and motor switching rates can lead to modifications of the largely Lorentzian-shaped spectrum. These modifications are caused by the transmitted noise from receptor methylation and phosphorylation dynamics , provided we assume a low CCW to CW switching rate leading to small motor bias (see Methods for the details of parameters). Specifically, the low-frequency component of our spectrum originates from noise in the methylation and phosphorylation dynamics in cells with low motor bias. Furthermore, experiments show that the low-frequency component in the motor power spectrum is reduced by increasing the expression level of CheR [Inset). The low-frequency component due to noise from receptor methylation and demethylation is effectively reduced by increasing the methylation rate constant.An increased low-frequency component has been observed in the motor power spectrum for cells with low motor bias . Both, w of CheR . In FiguTo characterise how signals are transmitted in the presence of noise, we define the SNR at the level of the motor asX2 and \u2329\u03b4X2\u232a defined in Methods. For optimal signalling this ratio should be maximised. For simplicity, we only discuss the receptor activity in the text, while in the figures we additionally show the contribution from phosphorylation processes as transmitted to the motor in the full pathway model.with \u0394N. However, also concentration fluctuations are expected to be amplified. Hence, we hypothesise that the receptor complex size could be optimised to yield a balance of advantageous amplification of signals and detrimental amplification of input noise.Receptor complexes amplify small signals proportionally to their size X2 (see Methods) to a step stimulus for varying background concentration and receptor complex size. We assume that the step stimulus size is a constant fraction of 10 percent of the background concentration. The integrated response has a characteristic variation with background concentration with the maximum in the sensitivity range of Tar receptors (indicated by their dissociation constants). Furthermore, the response increases with receptor complex size N. We calculated the integrated signal response of the receptor activity (see Methods). This quantity scales linearly with receptor complex size, In Figure Methods) of the transmitted noise of the pathway at the level of the motor. Only the contribution to the variance from ligand diffusion depends on the background concentration. Compared to the signal response, the maximum of the variance is shifted to a slightly lower concentration. The contribution to the variance from switching of receptor complexes is relatively small compared to the other contributions and roughly constant with receptor complex size, whereas those from ligand diffusion, receptor methylation and phosphorylation dynamics increase with receptor complex size.In Figure Methods). We find, the contribution to the variance of the receptor activity from receptor switching is indeed constant, independent of N. The contribution from ligand diffusion scales steeply as N2, the difference between ligand noise and ligand signal amplification being due to (i) noise from different complexes is added up incoherently, and (ii) the main contribution to the variance coming from high-frequency ligand noise, which is not filtered by adaptation. The contribution from receptor methylation grows approximately linearly with receptor complex size as a result of the incoherent addition of fluctuations at different receptor complexes and the sensitivity of the receptor complex activity with respect to changes in methylation level increasing proportionally with N. The contribution to the variance from phosphorylation processes grows with receptor complex size similar to the contribution from the methylation dynamics. Overall, the total variance of transmitted noise at the level of the motor has contributions from receptor switching, the dynamics of receptor methylation, and phosphorylation. The latter is approximately constant or grows slower than the amplified signal response, whereas the component from ligand diffusion increases steeper than the signal response with growing receptor complex size.To understand these behaviours of the variance more intuitively, we analysed the receptor activity analytically  and demethylation (B\u03b3). Varying these parameters describes changing the concentrations of receptor modification enzymes CheR and CheB. The integrated signal response is found to be maximal when both rates of methylation and demethylation become small simultaneously. Then, the adapted receptor activity is in the steep region of dose-response curves, and the initial response to attractant is maximal. At the same time adaptation becomes slow and, therefore, the response lasts long. Interestingly, varying the two parameters independently has different effects on the signalling response: the integrated signal response increases for vanishing \u03b3R, whereas it decreases for vanishing \u03b3B. There are two effects that contribute to this behaviour, illustrated in Figure A* = 0 or A* = 1). This effect would tend to quench the response by receptors. Secondly, as the enzyme concentration is reduced, adaptation times increase. Hence, this effect increases the integrated signal response as the time the receptor activity deviates from the adapted state increases. According to calculations shown in Methods for the integrated response of receptors, the first effect dominates in the case of reduced B\u03b3: Due to the strong activity dependence of the demethylation rate, reducing the demethylation rate constant effects the adapted activity of receptors strongly. Hence, receptors are quickly driven into saturation for vanishing B\u03b3. In contrast, in the case of reduced R \u03b3the second effect dominates and the increased adaptation time leads to an increased integrated signal response. At large methylation and demethylation rates, adaptation times are reduced leading to a decreasing integrated signal response.Figure R \u03b3and B \u03b3such that the adapted receptor activity is in the steep region of dose-response curves, the variance of transmitted noise is largest. In contrast, for either vanishing R \u03b3or B \u03b3all contributions decrease, consistent with calculations for the variance of the receptor activity in Methods. In these cases, the adapted receptor activity becomes saturated, hence, quenching fluctuations transmitted by receptors.The variance of fluctuations is shown in Figure R \u03b3and decreases for vanishing B\u03b3. According to Figure R \u03b3and large B\u03b3, corresponding to the parameters of our model.The resulting SNR is shown in Figure Park et al.  presente\u03bcM, i.e. when typically half of CheY is phosphorylated. The exact relationship depends on what parameters varied, exemplified by the different curves in Figure Inset.Using our model, we tested this hypothesis and varied the adaptation rates, as well as the total CheY concentration in a cell, resulting in a shifted adapted CheY-P concentration at steady state. We find that the variance of CheY-P  decreases as the adapted CheY-P value increases except for very small adapted CheY-P concentrations Figure , indicatE. coli chemotaxis signalling pathway, which controls the bacterial swimming behaviour in chemical gradients. Specifically, we considered the dynamics of ligand diffusion, receptor methylation and demethylation, receptor complex switching between on and off, phosphorylation and dephosphorylation of the kinase CheA, and response regulators CheY and CheB, as well as from rotary motor switching between CW and CCW direction. We assume cooperative chemoreceptor signalling complexes, whose activities depend on ligand concentrations and receptor methylation level, described by the MWC model [Biological signalling pathways employ biochemical reaction networks and molecular state transitions to sense and process signals from the environment. Fluctuations inherent in these processes determine the signals which can reliably be transmitted. Here, we studied the signal and noise propagation in the WC model -47.We formulated a model which includes all processes in the signalling pathway. Not included is the dynamics of gene expression and enzyme localisation to the chemoreceptor cluster, which is assumed to be much slower than the dynamics of signalling processes (discussed below). To make results intuitive we also presented a simplified version of the model, which only includes the dynamics of the activity of chemoreceptors, ligand concentration and receptor methylation level, as well as the motor dynamics. To calibrate the model, we first collected experimental data sets for the signalling pathway and rotary motor -28, and Despite the fitting, there is a discrepancy of our response function and the data at large frequencies. Block et al.  and SegaE. coli to tumble and change its swimming direction, and is therefore crucial for its search strategy. However, low-frequency contributions from signalling and adaptation may become more significant for some cells or under certain conditions . Furthermore, the ligand noise may be underestimated in our model since fluctuations of the ligand concentration at individual receptor complexes were treated as uncorrelated. If the fluctuations are treated as strongly correlated , the ligand noise becomes substantially larger as complexes coherently transmit the ligand noise  the VanS (kinase)/VanR (response regulator) system conferring vancomycin resistance in Gram positive bacteria [ii) quorum sensing in Vibrio harveyi, where the three kinases LuxN, LuxQ and CqsS respond to different autoinducers and first phosphorylate the phosphotransferase LuxO , which then phosphorylates the response regulator LuxU [iii) the phosphorelay controlling sporulation in Bacillus subtilis. The relay contains at least four kinases KinA-KinB and the phosphotransferase Spo0F, which phosphorylates the response regulator Spo0A [The nication ,59. In tbacteria , (ii) qutor LuxU , and  between the on and off state isranging from zero to c present at the receptor complex site and the methylation level M of the receptor complex. The methylation level of a complex is the sum of methylation levels of all receptors in a complex. Here, we consider two receptor types, Tar (indicated by index a) with fraction a \u03c5of receptors in the complex, and Tsr (indicated by index s) with fraction s \u03c5of receptors. Receptors are sensitive to attractant MeAsp with dissociation constants on Kand off Kin the on and off state, respectively. We use the following parameters for the MWC model for receptor complexes: which is a function of the concentration son=106mM,47.j in the full pathway model is described byEquations 1-4 represent a simplified model of the chemotaxis pathway to illustrate signalling and noise transmission. In the following, our model used for the full signalling pathway is summarised. Equations 1 and 2 equally apply to the full pathway model. However, instead of Eq. 3, the dynamics of the methylation level of complex pB) molecules cell Vthe cell volume.Here, we explicitly include the number of CheB-P (pA), CheY (pY) and CheB (pB), which are described by the following equations:In addition, we take into account phosphorylation and dephosphorylation of CheA  is the free-energy difference of switching per molecule of CheY-P, and CCW Kand CW Kare the dissociation constants for binding CheY-P in the CCW and CW state, respectively.where k+ and k- have been derived experimentally as a function of the concentration of a signalling mutant CheY**, which is constitutively active [\u03bcM [k+ and k- in our full pathway model (Eq. 17).Motor switching rates y active , as showtive [\u03bcM . We fitttive [\u03bcM  and usedR. The time-dependent response \u0394R(t), i.e. the deviation from the adapted state due to a small input signal \u0394c(t), is linear and determined byThe mean, or deterministic response of a system to an arbitrary, sufficiently small signal is described in terms of a characteristic function of the system, the linear response function \u03c7apparent dissociation constants for the on and off states. These dissociation constants depend on the background concentration as the system adapts to the background concentration c0, resulting in a particular free-energy difference F*. Thus, the concentration change has to be small compared to BTk. In Figure c0 = 0 and the peak concentration of the impulse is 10-3 mM, compared to Hence, the time course of the response is determined by the convolution of the linear response function and the input signal. The linear response function describes the dynamics of the pathway and the convolution with the input signal represents the fact that the current state of the system is determined by the history of the input signal . ImportaThe Fourier transform of Eq. 20 reads more simplyent gain . The modTypically, finite activation rates of the system limit the response to rapidly changing input signals, i.e. high-frequency signals. In this case, the Fourier transformed linear response functions falls off at high-frequencies, and the system is called a low-pass filter. If low-frequency components of the input signal are filtered out rather than high frequencies, the system is called a high-pass filter. The chemotaxis pathway is a band-pass filter , we define \u0394R2 the integral of the response over frequencyTo obtain a succinct measure for the signalling response due to an input concentration change \u0394\u03b4R(t) around the mean value \u2329R(t)\u232a can be characterised by their correlations at different time points. The autocorrelation function K is defined asFluctuations R(t) is stationary, i.e. the mean value \u2329R(t)\u232a and variance \u2329\u03b4R2(t)\u232a do not vary with time t. Averaging over different measurements of R(t) is indicated by angular brackets. Typically, correlations decay with the interval length \u03c4 between time points. Here, we use the power spectrum to characterise fluctuations. According to the Wiener-Kinchin theorem the power spectrum is the Fourier transform of the autocorrelation function [i.e. the average value of the product of fluctuations at two time points. It only depends on the interval between time points if the dynamics of function ,For exponentially decaying correlations as in Figure \u03b4R(t) measured or simulated over a time interval T,The power spectrum can be calculated from the absolute square of the Fourier transform of time series T and the average \u2329\u00b7\u232a is over multiple time series.where the Fourier transform is defined on the finite measurement interval The variance of a stationary process can be calculated as the integral of the power spectrum over frequency,Here, we use the Langevin approximation to describe fluctuations (noise) around average molecule numbers. For instance, consider the following general stochastic differential equation:r1 and r2 typically depend on the concentrations of proteins in the signalling network. The noise term \u03b7(t) is composed of two terms \u03b71(t) and \u03b72(t), which are associated with the rates r1 and r2, respectively. We assume \u03b71 and \u03b72 to be independent, i.e. \u2329\u03b71(t) \u03b72(t')\u232a = 0. In general, this is justified as different reactions are catalysed by different proteins. Using \u2329j\u03b7(t)j\u03b7(t')\u232a = j\u03b4Q(t - t'), the noise intensities can be calculated if we make the assumption that fluctuations are due to so-called birth and death processes, i.e. creation and destruction of the molecules with average rates \u03b7(t) is the sum Q = Q1 + Q2 due to the independence of the two noises. As forward and backward rate are equal at steady state, Q is twice the reaction rate in one direction at steady-state.The rates nd Q2=r2*. The intA\u03b7(t) in Eq. 1 is due to the switching of each receptor complex between on and off states. We assume the switching to be a fast process, which can be described by the following dynamics of the receptor-complex on-bias a:The switching noise a\u03b7(t) is a Gaussian white noise with zero mean and noise intensity a Q= 2k2A*, where we used that the receptor complex activity A = \u2329a\u232a which is equal to the (quasi) steady-state activity of a, and A = A* when adapted. The power spectrum of a due to switching between on and off states isThe noise term k1 + k2 is the characteristic frequency of switching. Hence, the high-frequency component of fluctuations \u03b4a(t) is reduced due to averaging by the finite rates of switching. Hence, the power spectrum of activity fluctuations A\u03b7(t), which are due to fluctuations in the rate of receptor complex switching da/dt, iswhere da/dt yielding a and da/dt differ by a factor \u03c92 as the power spectrum is proportional to the magnitude squared of the Fourier transform according to Eq. 26.This result is due to the Fourier transform of the rate of receptor complex switching c\u03b7(t) in Eq. 2. Consider a volume whose dimensions are given by the diameter of a receptor complex R s= 1 nm is the size of a receptor dimer [L in this volume is determined by the exchange rate D k\u2248 D/(2s2) due to diffusion [The number of ligand molecules in the vicinity of a receptor complex fluctuates due to binding/unbinding, and potential rebinding of previously bound ligand molecules at this complex, as well as diffusion ,68. Hereor dimer . The chaiffusion :DL kis the rate of molecules moving out of the volume by diffusion, and D ktimes the mean concentration c0 in solution serves as a proxy of the rate of ligand molecules moving into the volume. The noise term L\u03b7(t) is assumed to be Gaussian and white, with zero mean and noise intensity L Q= Dsc0.where L and concentration c of molecules at receptor complex j are respectivelyThe power spectra of the number s6 is the squared volume given by the dimension of the receptor complex. The zero-frequency limit of the power spectrum of the ligand concentration cS(0) = c0/(Ds), which corresponds to calculations by Berg and Purcell [where  Purcell  and Bial Purcell  for the c\u03b7(t) in Eq. 2 is related to rate of change of the ligand concentration, similar to the considerations of the switching noise above. Hence, the power spectrum of the ligand fluctuations c\u03b7(t) isThe noise j in Eq. 3 is estimated from the average rates of methylation and demethylation at the adapted state, respectively. The noise M \u03b7(t) is assumed to be Gaussian and white, with zero mean, noise intensity M Q= 2R\u03b3(N - A*) and power spectrumThe size of fluctuations in the rate of methylation of a receptor complex The noise in motor switching rate in Eq. 4 is assumed to be a Gaussian white noise term with zero mean, noise intensity After linearising around the steady state and inserting the Fourier transforms we obtain for the simplified modelwhereX \u03c9= k+* + k-* is a characteristic frequency due to motor switching at steady state. \u0394A is the response of every receptor signalling complex, and \u0394c A= CN\u0394A is the activity response of all receptor complexes in a cell. Solving for with N\u22c5Ar*\u2248N\u22153 the adapTo calculate spectra, we linearise the deterministic parts of Eq. 1-4 similar to the calculation of the response functions, and formally Fourier transform the equations. We obtainWe solve for the Fourier transformed activity fluctuations M \u03c9= \u03c91\u2202A/\u2202M, and we used Eq. 31 and 35. From Eq. 44 we obtain for the Fourier transformed fluctuations in the motor bias which yields the power spectrum in Eq. 8. The parameter and their power spectrum is given by Eq. 9.The integrated response of the receptor activity to a step stimulus isC N= totN/N with tot Nthe total number of receptors in a cell.where we inserted Eq. 5. Hence, the activity response scales as The variance of the receptor activity is given by the integral of the power spectrum of activity fluctuations Eq. 8\u03c4-1 \u2248 0.1 ... 1 Hz. The contribution from receptor switching iswhere we consider the frequency range relevant for motor switching indicated by a Qand inserted Eq. 30 for the power spectrum of receptor switching noise and used that it is almost constant and equal to its zero-frequency value over the integration range. Furthermore, the factor where we used The contribution from ligand diffusion is\u03b4c2\u232a = c0/(Ds\u03c4) is the variance of the ligand concentration measured during the time interval \u03c4. We used Eq. 34 and the same argument as for the switching noise to calculate the integral. Hence, the contribution to the variance from the ligand diffusion grows as A/\u2202c increasing as N2, and the size dependence of receptor complexes s \u221d N1/2.where \u2329The contribution to the variance from receptor methylation isM \u03c9= \u03c91(\u2202A/\u2202M). Hence, where we defined N for small complex sizes, and decreases as N-2 for larger complex sizes, resulting in an optimal medium receptor complex size, in qualitative agreement with Figure The SNR grows linearly with The integrated signal response of the receptor activity Eq. 47h(c) = \u2202F/\u2202c, where the numerator expresses the initial response of receptors of concentration changes and the denominator the filtering by adaptation. The sensitivity \u03b2 = R\u03b3/B\u03b3. Expanding the adapted activity around R \u03b3\u2192 0) yields B \u03b3\u2192 0) yields and is only a function of the ratio R\u03b3. For vanishing B\u03b3, the initial response to concentration changes decreases faster than adaptation speed, hence yielding a vanishing signal response. The overall dependence of the integrated signal response is R \u03b3\u2192 0(B \u03b3\u2192 0). For the contributions to the variance of the receptor activity from receptor switching, ligand diffusion and receptor methylation dynamics we obtain The initial response to concentration changes decreases slower than adaptation times, resulting in an increased signal response for vanishing c0 = 0 and peak concentration 10-3 mM. The integration time step was \u0394t = 10-3, maximum integration time was 100 s. In each integration step, first the receptor complex activity was calculated according to Eq. 11 based on the current ligand concentration and receptor methylation level from the previous iteration. All other variables x were updated in each time step i according to xi+1 = xi + \u0394t \u00b7 rate, where rate is given by the r.h.s. of the differential equations for the respective variable.Only the full pathway model without noise was solved numerically i\u03b7(t')\u232a = i\u03b4Q(t - t') with noise intensities i Qgiven in Table Rate constants and total cell concentrations of proteins for the full pathway model are given in Table DC and RGE conceived and designed the study, performed analytical calculations, analysed the data, and wrote the paper. DC performed computer simulations. All authors read and approved the final manuscript.Supplementary information. Supplementary information in .pdf format, including the extended model for the chemotaxis pathway, additional mathematical derivations and validity checks.Click here for file"}
+{"text": "The mechanism of action of levonorgestrel (LNG) as emergency contraception (EC) remains a subject of debate and its effect on sperm function has been only partially explained. The aim of this study was to assess whether LNG at a similar dose to those found in serum following oral intake for EC could affect spermatozoa when exposed to human fallopian tubes in vitro.Fifteen mini-laparotomies were performed, the side on which ovulation occurred was recorded, and both tubes were removed and perfused with a suspension containing 1 \u00d7 10(6) motile spermatozoa, with or without LNG. Following 4-hour incubation, the tubes were sectioned to separate the isthmus and the ampulla. Each segment was flushed and the material was evaluated to quantify the number of motile sperm, the number of spermatozoa adhering to the oviductal epithelium and the acrosome reaction (AR) rate.The addition of LNG did not significantly alter the number of recovered motile spermatozoa either at the isthmus or at the ampulla, nor did it have any effect on the number of recovered spermatozoa adhered to the human tubal epithelium. Furthermore, LNG did not affect the AR rate. No significant differences were found even when the side on which ovulation occurred was taken into account.In a similar dose to that observed in serum following oral intake for EC, LNG had no effect on the number of motile spermatozoa recovered from the human fallopian tubes in vitro, on their adhesion to the tubal epithelium, distribution or AR rate. The possible effect of LNG as EC on sperm function remains poorly understood. Levonorgestrel (LNG) is a progestin used in emergency contraception (EC). The currently recommended LNG dose consists of two 0.75 mg pills taken 12 h apart or one dose of 1.5 mg up to 72 h after unprotected sexual intercourse ,4.One of the proposed mechanisms of action concerns the effect of LNG on spermatozoa and their functions -8. HowevAfter ejaculation, mammalian spermatozoa are unable to fertilize the oocyte and this capacity is subsequently acquired as a consequence of a series of physiological and functional changes called capacitation. Sperm capacitation occurs during sperm migration within the female genital tract ; howeverThe effect of LNG as EC on sperm function is still poorly understood and to the best of our knowledge, this effect has not been tested at the site of fertilization. Therefore, the objective of this study was to assess whether LNG, at a similar dose to those observed in serum following oral intake for EC, could affect spermatozoa exposed to human fallopian tubes under in vitro conditions.The study was conducted at the Human Reproduction Unit, Department of Obstetrics and Gynecology, School of Medicine, University of Campinas (UNICAMP), Campinas, Brazil. All the women and semen donors gave their written informed consent and the study protocol was approved by the institution's internal review board. Women of 25-41 years of age were invited to participate in the study. The admission criteria consisted of: women who had requested surgical sterilization and for whom the abdominal route of surgery was indicated, with regular menstrual periods , no known tubal diseases, not having used hormonal or intrauterine contraceptives during the cycle of the experiment, not having used any other form of hormone therapy, and not having been breast feeding or pregnant in the 6 months preceding the study.th day of the menstrual cycle by ultrasound with a 5.0 MHz vaginal probe . When the dominant follicle reached a diameter of 14-17 mm, surgical sterilization was scheduled for the following day. All in vitro experiments were performed prior to ovulation to avoid the effect of the P milieu on AR and any possible confounding effect of P on sperm adhesion to the tubal epithelium. To confirm the follicular phase of the menstrual cycle, a blood sample was drawn on the day of surgery and the serum was separated and stored at -20\u00b0C until analysis. Serum P levels < 3 ng/mL were considered as confirmation of the follicular phase of the cycle [Women were instructed to use condoms as their method of contraception from the first day of the cycle until the day of surgery in order to avoid unplanned pregnancy. Follicular development was monitored daily in all participants from the 8he cycle . P levelAll the women were anesthetized and mini-laparotomy was then performed. Both fallopian tubes were removed gently from the proximal portion. The side on which the dominant follicle was present was identified and recorded. The tubes were placed in two separate Petri dishes with HEPES-buffered modified Human Tubal Fluid medium  and transferred immediately to the laboratory. The excess tissue  was removed.2) and 25 nM of LNG (0.1% solution obtained from a stock solution containing 25 \u03bcM of LNG in ethanol) were used in one tube, while the same final concentration of ethanol present in the LNG-treated sample was added to the other tube. After 1 h of incubation, the supernatant with the motile spermatozoa was carefully removed and an aliquot was placed into a Makler counting chamber , warmed to 37\u00b0C and examined under a microscope. After evaluation, each fraction was re-suspended in the same medium to achieve a sperm concentration of 10 \u00d7 106 motile spermatozoa/mL. A sample of each sperm suspension was taken to evaluate the AR as described below.Fifteen semen samples were obtained from healthy donors with normal sperm according to the analysis criteria defined in the World Health Organization manual . Semen w6 motile spermatozoa in the medium described above, including LNG, while in the other tube the LNG in the sperm suspension was substituted for the same concentration of ethanol present in the LNG-treated sample. The fallopian tube corresponding to the ovary with the dominant follicle received the suspension containing LNG, while the other tube received the suspension containing only the vehicle. Therefore, the tube that received LNG (either the right or left tube) varied in the women according to the presence of the dominant follicle in the ipsilateral ovary. Perfusion was carried out very slowly to avoid spilling any of the solution outside the tube. The procedure was performed outside the culture medium, over a glass, under controlled temperature conditions. After perfusion with the sperm suspension, the tubes were incubated separately at 37\u00b0C for 4 h in a Petri dish containing the same medium used in the sperm suspension to allow capacitation to occur.Using a blunt needle, one of the fallopian tubes was perfused from the proximal to the distal portion with 100 \u03bcL of a sperm suspension containing 1 \u00d7 10After incubation, the tubes were sectioned to separate the isthmus and the ampulla, and each segment was flushed twice, first with 5 ml of HTF-HEPES medium and then with an equal volume of phosphate-buffered saline  medium containing 0.5% Triton-X100 , a nonionic surfactant, in order to remove the spermatozoa adhering to the oviductal epithelium ,27. The The samples obtained following flushing with Triton were evaluated in a Neubauer chamber to verify the number of spermatozoa recovered in each segment. The other samples were divided to allow 50 \u03bcL to be used for counting the number of motile spermatozoa in a Makler counting chamber and another 50 \u03bcL to be used for analysis using Hoechst stain. A volume of 50 \u03bcL of 1 \u03bcg/mL Hoechst 33258  was added to the 50 \u03bcL aliquot of the washing medium containing the recovered spermatozoa. The mixture was incubated for 5 min at 37\u00b0C, washed twice with PBS to remove the excess stain and then centrifuged. The pellets were re-suspended in 50 \u03bcL of PBS. Two slides from each washing were prepared and allowed to dry in a dark environment at room temperature.Pisum sativum agglutinin  was used to evaluate AR status. After being left to dry, the slides prepared from the spermatozoa suspension stained with Hoechst were immersed in cool absolute methanol at -20\u00b0C for 30 s. Next, the slides were stained by immersing them in FITC-PSA at a concentration of 40 \u03bcg/mL in PBS for 30 min, protected from light at room temperature. After incubation, the slides were washed in PBS and stored in the dark until analysis of AR and vitality. The slides were evaluated using a fluorescent microscope  equipped with a specific filter for the FITC-PSA method  and with a filter for the Hoechst 33258 stain . Two hundred cells were evaluated in randomly selected fields.The fluorescent probe fluorescein isothiocyanate-labelled The spermatozoa that were considered acrosome-reacted were those with the following patterns: (i) patchy fluorescence in the acrosome region  and (ii) fluorescence of the equatorial band only (acrosome reacted) . The AR The SAS statistical software program, version 9.2, was used to analyze the data. The mean number of recovered spermatozoa and the AR rate with and without LNG were compared using the Mann-Whitney test. The level of significance was established at p < 0.05 and all values are shown as means \u00b1 standard error of the mean (SEM).Fifteen experiments were conducted. However, two women had P levels > 3 ng/mL on the day of the experiment and were excluded from the analysis to avoid the effect of P on the AR. Most of the spermatozoa recovered after the first tubal flushing was motile. The number of motile spermatozoa recovered in the isthmus was similar, irrespective of whether LNG had been added or not. Nevertheless the number of recovered motile spermatozoa was almost 10 times greater at the ampulla than at the isthmus, although there was also no difference with respect to whether LNG had been added to the medium or not. When the number of spermatozoa recovered after flushing with Triton was considered, the addition of LNG was found to have had no effect and the numbers were fairly similar, although the number of spermatozoa recovered from the ampulla was ~ 5 times greater than the number recovered from the isthmus Table .The number of motile spermatozoa recovered was similar both in the tubal isthmus and in the ampulla irrespective of whether LNG had been added or not. There was no difference in the number of motile spermatozoa recovered from the tubes irrespective of whether the tube was from the side with the dominant follicle or from the opposite side. In addition, there were no statistically significant differences in the number of spermatozoa recovered after flushing with Triton. Nevertheless, the number of spermatozoa was greater in the ampulla than in the isthmus on both sides irrespective of whether LNG had been added or not Table .After preparing the slides for evaluation of the AR, some were found to contain numerous epithelial cells and red and white blood cells, making it almost impossible to evaluate the AR rate accurately. For this reason, some of the evaluations were excluded from the analysis Tables  and 4. TThese results show that the addition of LNG did not significantly affect the number of recovered motile spermatozoa either at the isthmus or at the ampulla nor did it affect the number of recovered spermatozoa adhered to the tubal epithelium. With respect to whether the addition of LNG affected the number of recovered motile spermatozoa, the number of spermatozoa adhered to the tubal epithelium or the AR rate in the flushing medium on the side with the dominant ovarian follicle or on the opposite side, no statistically significant differences were found.However, the principal limitation of this study refers to the design and development of the procedures. The experiments were conducted in vitro and, although the spermatozoa were tested in the tubal environment, conditions differed from those encountered in vivo. The doses of LNG used for flushing the tubes are similar to serum levels found after oral intake as EC and possibly higher than those found in oviductal fluid. In fact, as previously reported by our group , the LNGPrevious in vitro experiments have shown that at a dose of 10 ng/mL, LNG was unable to induce AR ,17 and aThe methodology used in this study could not be better. Initially, an attempt was made to recover spermatozoa from tubes obtained at the time of sterilization from women who had had unprotected coitus and received LNG as EC. However, the number of spermatozoa recovered after perfusion of the tubes was extremely low and did not permit any further analysis to be made, a result that had also been reported previously using the same technique . ConsequIt is well known that women are fertile for six days in the menstrual cycle: the five days preceding ovulation and the day of ovulation itself . Recentl2 has been reported to facilitate sperm migration from the uterus to the oviducts and P modulated this effect [2 and P stimulated sperm adhesion to the tubal epithelium. Although no different sperm reservoir has been found in human tubes, a functional reservoir has been described and in vitro, spermatozoa were observed adhered to the epithelium of the isthmus, albeit in an intermittent manner [2 of tubal explants decreased both at the isthmus and at the ampulla when LNG was added. However, in the present study, a different methodology was used in that the tubal segments were incubated for 4 h and flushed with a nonionic surfactant (Triton-X100). In addition, the number of spermatozoa obtained in each segment of the tube was recorded separately. LNG had no effect on the number of adhered spermatozoa recovered or on their distribution along the fallopian tubes.Sperm migration to the oviducts and adhesion to the tubal epithelium, a well-known mechanism of achieving fertilization, are controlled by sex steroids. In rats, Es effect . In addit manner ,33. Ortit manner  observedWhen ovulation is about to take place, spermatozoa undergo capacitation and hyperactivation and are able to progress to the tubal ampulla. In addition, P modulates many aspects of sperm function and mimics the AR-inducing properties of the follicular fluid almost perfectly, while the effects of P on sperm function are mediated by receptors located in the plasma membrane,  defined There are two classes of nongenomic P receptors in the human spermatozoa. One has an elevated affinity (at nanomolar concentrations) and is specific for P, while the other has low affinity (micromolar) and also binds to other hydroxylated P derivatives . When P With respect to the effect of P on the AR process, some studies were carried out to evaluate whether LNG was able to affect sperm function as P does. A direct relationship was found between an increase in the AR rate and higher LNG concentrations, suggesting that at higher LNG concentrations 200-800 ng/mL) the nongenomic P receptors on the surface of spermatozoa are able to recognize the progestogen molecule and exert their effect 00 ng/mL ,17 or inIn conclusion, the hypothesis that LNG, in a similar dose to those found in the serum of women following oral intake for EC, may affect the number of motile spermatozoa, the adhesion of sperm to the tubal epithelium, distribution and the AR of spermatozoa in the fallopian tubes in vitro was not confirmed in the present study. The present findings also failed to show any effect on motile spermatozoa recovered after exposure to the fallopian tubes despite the fact that the doses of LNG used in vitro are probably higher than those reached within the oviduct in vivo.2: Estradiol; FITC-PSA: Fluorescein isothiocyanate-labelled Pisum sativum agglutinin; HTF-HEPES: HEPES-buffered modified human tubal fluid medium; LNG: Levonorgestrel; P: Progesterone; SEM: Standard error of the mean; ZP: Zona pellucidaAR: Acrosome reaction; CV: Coefficient of variation; EC: Emergency contraception; EThe authors declare that they have no competing interests.AH, MEO, HBC and LB participated in the design of the study and in developing the research protocol; AH, MVB, FF, NMM, MHRRG, and LB conducted the study at the outpatient clinic, surgical theatre and at the laboratory. All the authors contributed equally in writing the manuscript and in reviewing and revising it. All authors read and approved the final manuscript."}
+{"text": "Objectives. To highlight the importance of early diagnosis of colloid cyst of the third ventricle and its early management. Clinical Presentation and Intervention. This is a young lady who presented with sudden onset headache. She attended a local clinic and also her area hospital. Her diagnosis was delayed several hours due to a diagnostic dilemma initially. No surgical intervention was tried since the patient developed early signs of brainstem coning by the time she was seen by neurosurgeon. Patient died after few days in spite of intensive ICU measures. Conclusion. Sudden onset headache in young adults should be looked at carefully. Early imaging is mandatory to prevent mortality. Colloid cysts of the third ventricle are benign cysts but sometimes can be life-threatening. Headache is the most common symptom in 75% of patients. Headache can be constant, intermittent, or migrainous in nature . The def22-year-old healthy lady, 5 days prior to her admission, developed global, bitemporal headache that is associated with nausea and vomiting. She was seen in a local clinic and then in her area hospital. She was treated with simple analgesic drugs but the headache did not subside but in fact it was increasing in intensity. Five days, she went to another main area hospital because the headache was intolerable.She was treated with analgesics, antiemetic, and sedative injections. Patient became drowsy but still arousal. An immediate neurological consultation was requested. In the past 5 days, there was no brain imaging requested.At the time she was assessed by a neurologist, she was very drowsy but conscious, moving her limbs, holding her head, and shouting due to pain. Her pupils were 3\u2009mm reacting to light with spontaneous full eye movements. Fundi were normal also. Deep tendon jerks were very brisk all over and she had extensor planters. Patient was admitted and urgent CT brain was requested. The CT brain showed severe obstructive hydrocephalus; see Two hours later, an urgent MRI brain with contrast was arranged. There was a well-defined nonenhanced oval lesion at the foramen of Monro, with high signal intensity at T2 and FLAIR study. The lesion is about 12.2 \u00d7 14.7 \u00d7 12.3\u2009mm in size with obstructive hydrocephalus. The neurosurgeon deferred any surgical intervention since patient's general condition was poor at that time; see Figures On the next day, the patient's GCS was 3/10 and she was unconscious. A follow-up CT brain revealed brain edema with functioning EVD tube. She was started on antiedema measures with dexamethasone, mannitol, hypertonic saline, and hyperventilation. On the third day after admission, without sedation, the patient showed minimal response to pain over the limbs, with pupils 4\u2009mm not reacting to light.A follow-up CT brain showed increasing brain edema. On day 4, the blood pressure of the patient dropped and she was maintained on inotropic support.On day 5, patient developed dilated pupils, 7\u2009mm in size, not reactive to light. A follow-up CT brain showed more brain edema with loss of white and grey mater differentiation; see On day 7, caloric and apnea tests were done after stopping sedation. Pupils were 7\u2009mm not reacting to light with absent vestibuloocular and corneal reflexes. Patient was declared to be brain-dead unfortunately 7 days after her admission.Colloid cyst was first described by Wallman in 1858 and then by Dandy in 1922. They detected these cysts with ventriculography and pneumoventriculography . ColloidColloid cyst is the most common third ventricular mass in adults. Many colloid cysts are asymptomatic and are diagnosed incidentally during routine imaging usually for headache. Headache is the most common symptom, seen in 75% of patients. Headache may be constant, intermittent, or migrainous in nature. The headache is due to transient obstruction secondary to a ball valve mechanism at the foramen of Monro . The mecThe definite cause of this lethal phenomenon is still a matter of debate. Acute blockage of the CSF fluid may cause hydrocephalus, which leads to rostrocaudal herniation of the brainstem causing brain death . Sudden A circadian variation in human CSF production has been demonstrated using MRI phase imaging.A minimum production of volume (21.7\u2009mL/hr) at 18.00\u2009p.m. with a peak production is twice the day production at 02.00\u2009a.m. 42.2\u2009mL/hr) [2.2\u2009mL/hrAlso, cardiac arrest due to hypothalamic stimulation by the colloid cyst may result in death.Sudden increase in the intracranial pressure in the third ventricle may cause neurogenic cardiac stunning secondary to hyperacute and intense neurogenic sympathetic activation . The cysHypothalamic structures, which are involved in nonendocrine and autonomic regulation, play a key role in controlling cardiac function. They are located close to the wall of the third ventricle. This may suggest that reflex cardiac effects due to compression of the hypothalamic cardiovascular regulatory centers by the cyst may explain the sudden death in patients with colloid cysts , 9. It iThis case reminds us about the importance of early brain imaging in children and young adults when they present with headache and vomiting, especially if this is the first presentation and there is no previous history of migraine. If a CT brain was done early in this patient, it may facilitated the diagnosis and hopefully prevent the mortality of this young lady. This patient had typical history of severe headache and vomiting starting in the early morning; the diagnosis was delayed due to late imaging and also delayed referral to neurologist for taking their opinion. Colloid cyst of the third ventricle should be in our differential diagnosis in a patient with acute onset of headache especially when other etiologies have been ruled out. In patients with third ventricle colloid cyst, even if it is asymptomatic or small cyst, surgical removal of the colloid cysts of the third ventricle is mandatory ."}
+{"text": "Bivalves process large volumes of water, leading to their accumulation of bacteria, including potential human pathogens . These bacteria are captured at low efficiencies when freely suspended in the water column, but they also attach to marine aggregates, which are captured with near 100% efficiency. For this reason, and because they are often enriched with heterotrophic bacteria, marine aggregates have been hypothesized to function as important transporters of bacteria into bivalves. The relative contribution of aggregates and unattached bacteria to the accumulation of these cells, however, is unknown. We developed an agent\u2010based model to simulate accumulation of vibrio\u2010type bacteria in oysters. Simulations were conducted over a realistic range of concentrations of bacteria and aggregates and incorporated the dependence of pseudofeces production on particulate matter. The model shows that the contribution of aggregate\u2010attached bacteria depends strongly on the unattached bacteria, which form the colonization pool for aggregates and are directly captured by the simulated oysters. The concentration of aggregates is also important, but its effect depends on the concentration of unattached bacteria. At high bacterial concentrations, aggregates contribute the majority of bacteria in the oysters. At low concentrations of unattached bacteria, aggregates have a neutral or even a slightly negative effect on bacterial accumulation. These results provide the first evidence suggesting that the concentration of aggregates could influence uptake of pathogenic bacteria in bivalves and show that the tendency of a bacterial species to remain attached to aggregates is a key factor for understanding species\u2010specific accumulation. They often dominate bottom communities, forming large clustered populations that are both ecologically and commercially important Dame, . SuspensGeukensia demissa) are able to capture 1\u2010\u03bcm particles with approximately 40% to 50% efficiency  are agglomerations of suspended particulate matter formed by physical, chemical, and biological processes  and spatial  scales  at concentrations between 100 and 105 colony\u2010forming units (CFUs) per ml of aggregates. Their values represent samples from four habitats over the course of 8\u00a0months. The majority of data in this regard, however, are based on laboratory experiments that arguably tend to enrich microorganisms. For example, Froelich, Ayrapetyan, and Oliver  of water per time step (L/min) related to their length as V\u00a0=\u00a00.016\u00a0\u00d7\u00a0length1.46/60, where length is in units of millimeters . Aggregate abundance was 11.3\u00a0\u00d7\u00a0d1.9  from 0.2 to 20\u00a0mm diameter (macroaggregates) and an additional bin for 0.05\u20130.2\u00a0mm diameter (microaggregates). Aggregate size has generally been reported by diameter in field data, but from this point forward, we will use aggregate radius, which is the principal convention in the experimental literature. Both metrics are actually effective measures as aggregates are often not spherical. Microaggregates are large enough to be captured with near 100% efficiency, but too small to be regularly counted and reported in the literature. The proportion of the total area occupied by each size class was then used to randomly draw a collection of 500,000 aggregates in the same proportions to use in the feeding simulation. The simulations examine a range of aggregate abundances from 50 to 500/L that encompasses the commonly observed range of normal variation in coastal systems . This model used a colonization\u2013birth\u2013death process to simulate bacterial colonization, attachment, detachment, and reproduction, as well as predation of bacteria by flagellates and ciliates, on aggregates of different sizes that form in different concentrations of unattached pathogenic bacteria. The model was originally parameterized for the average behavior of the marine bacterial community  was taken to be equivalent to that of the smallest macroaggregate size class. We did not separately simulate these aggregates because the physics and biology observed for macroaggregates and implemented in the bacteria\u2013aggregate model are unstudied at the smaller aggregate scales Ki\u00f8rboe, . The lac2.610.5061/dryad.m56c1). Oysters were treated as fixed grid cells in a 21\u00a0\u00d7\u00a021 grid that initially contained no pathogen cells. The total number of aggregates consumed by all oysters in a time step was determined from the macroaggregate concentration, with microaggregates then added in the proper ratio. Microaggregates were handled in this way so as to report aggregate concentration consistently with the literature, as microaggregates are not counted or reported in most studies. Random variation in number of aggregates consumed and the number of pathogen cells on those aggregates then entered the model in two ways. First, the number of aggregates consumed was chosen from the stochastic collection of aggregates described above, with sizes distributed as estimated from Shanks  A model with \u201caverage\u201d bacteria , rather than chance consumption of individual aggregates.The relationships reported here depend on four assumptions made to increase the realism of the model, but for which direct empirical support is limited. First, the rate of loss of the pathogen from the aggregates was assumed to be much lower than the empirically estimated parameter for the bacterial community as a whole  the size distribution of aggregates, (2) the relationship between aggregate concentration and SPM density, and (3) the effect of aggregate concentration on pseudofeces production, it was necessary to extrapolate at the boundaries of the best available published data. We extrapolated at the upper and lower ends of the aggregate size distribution, and note that this relationship was based on a specific location and year Shanks, . SimilarFinally, we assumed that all pathogens were treated in a similar manner by the feeding organs of the oyster , and had the same likelihood of rejection regardless of whether they were captured unattached or associated with an aggregate. This assumption was based on studies which demonstrate several key points regarding how bivalves feed on aggregated material. First, the ciliary activity on the gills and palps of bivalves can disrupt and separate particle aggregations into smaller particle masses and, perhaps, individual cells Ward, . Second,Vibrio vulnificus are often >1\u00a0\u00d7\u00a0104 cells/g oyster tissue . It is clear that the role of aggregates depends substantially on particular characteristics of the pathogen such as affinity for aggregates, high growth rate on aggregates, or species\u2010specific dynamics in the gut and tissues of the shellfish. In fact, even strain\u2010level differences can be important .None declared.\u00a0Click here for additional data file.\u00a0Click here for additional data file.\u00a0Click here for additional data file.\u00a0Click here for additional data file."}
+{"text": "Neurofibromatosis type I (NF1) is a neurocutaneous disorder that involves autosomal dominant transmission. Skull defects, including sphenoid dysplasia and calvarial defects, are a rare finding in patients with NF1. Spinal meningocele and sphenoid wing dysplasia have been identified in NF1 but the occurrence of meningoceles at the skull base is extremely rare. A rare instance of jugular foramen meningocele being identified in an NF1 patient on imaging is described in this paper. To the best of our knowledge, only two such cases have been reported in the English literature. Neurofibromatosis type I NF1) is a neurocutaneous disorder that involves autosomal dominant transmission. This disease is caused by a mutated NF1 gene on chromosome 17 and is characterized by inactive neurofibromin. The diagnostic criteria for NF1, with emphasis on the involvement of the skin, bones, and nervous system, was formulated at the National Institutes of Health consensus development conference [ is a neu caf\u00e9-au-lait spots and axillary freckles were observed in the anterior and posterior aspect of the body during the physical examination. Focal neurological deficits and cranial nerve palsy were not found. The patient was referred for a computed tomography (CT) scan of the brain . Left jugular foramen enlargement was noticed, featuring a homogeneous, well defined, low-density lesion on CT imaging. The lesion had caused expansion in the adjacent bones   (using a 3.0 Tesla scanner) of the brain to evaluate the lesion. An enlarged left jugular foramen with a pouch was observed, extending from the left cerebellopontine angle cistern . This st caf\u00e9-au-lait spots and axillary freckling, osseous dysplasia, and benign and malignant nervous system tumors, and neurofibromas in particular. Neurofibromas are benign tumors of the peripheral nerve sheath that are typically associated with NF1. Neurofibromas present as focal cutaneous/subcutaneous or nodular/diffuse plexiform lesions [NF1 is an autosomal dominant neurocutaneous disorder (phakomatosis), with an incidence of roughly 1 per 3,000\u20134,000 live births . It is c lesions .Additional congenital malformation and syndromes  are also associated with cephaloceles. Several clinical manifestations, including meningitis caused by CSF rhinorrhea, cranial midline defects , and endocrine abnormalities, can also occur, depending on the size and location of the cephalocele . TherefoCephaloceles are divided into two groups: primary  and secondary. Primary cephaloceles may be occipital, parietal, sincipital, or basal. Sincipital cephaloceles are classified as nasofrontal, nasoethmoidal, nasoorbital, or combined and basal cephaloceles as transethmoidal, sphenoethmoidal, sphenoorbital, sphenomaxillary, and transsphenoidal. Secondary cephaloceles are sometimes caused by trauma or surgery .Encephaloceles occur in approximately 1 in 3,000\u20135,000 live births . Spinal Jugular foramen involvement does not fit into the cephalocele classification. Indeed, only two case reports were identified in the literature at the time that this report was prepared , 8. SiddThis was an uncommon case of the identification of jugular foramen meningocele in a neurofibromatosis type 1 patient. As this pathology is so rare, it may not be recognized during the initial investigation of NF1 patients. Thus, physicians should be aware of this uncommon finding and of the importance of treating and managing such patients accordingly. Imaging findings and MRI in particular are obligatory for head and neck region neurofibromas and central nervous system manifestations in NF1 patients and also during follow-ups."}
+{"text": "The study was designed to evaluate and compare the rest periods of 4 and 6\u00a0weeks for healing of orthodontically induced root resorption craters.U test.The study was conducted with a split-mouth design, with the right and left mandibular first premolars of 14 subjects serving as the two groups of the study. The right premolars constituted group A and the left ones, group B. Intrusive force was applied on these teeth for a period of 6\u00a0weeks, followed by retaining the teeth for 4\u00a0weeks (group A) and 6\u00a0weeks (group B) as rest periods before extraction. The extracted teeth were prepared for histologic examination with haematoxylin and eosin staining and studied under a light microscope. The histological sections were scored based on the level of repair  seen in the deepest craters in the apical third region of the roots. The mean values of the scores in the two groups were compared using Mann-Whitney P\u2009<\u20090.05).All the teeth showed healing in their deepest craters. The teeth in group A showed partial repair more frequently (84.6%), with the remaining (15.4%) showing functional repair. The teeth in group B showed anatomic repair more frequently (60%), with the remaining (40%) showing functional repair. The mean level of repair was higher in group B (2.6\u2009\u00b1\u20090.5) as opposed to that in group A (1.15\u2009\u00b1\u20090.37). The difference between these values was of very high significance (Longer rest period of 6\u00a0weeks showed more advanced healing than a shorter rest period of 4\u00a0weeks. Six weeks of rest period is adequate only for the functional repair of resorption craters. Orthodontic tooth movement is always accompanied by some amount of root resorption , 2. WhenAmount of root resorption has been studied extensively in relation to the magnitude as well as the duration of application of orthodontic forces , 5. The This study was an attempt to evaluate the following: (i) if a period of 6\u00a0weeks is enough for the orthodontically induced resorption craters to heal anatomically, (ii) the progress of repair from 4\u00a0weeks to 6\u00a0weeks after discontinuation of orthodontic forces, and (iii) the difference in the thickness of repair cementum after the two time periods as measured in micrometer.This study was conducted on the right and left mandibular first premolars of 15 subjects who reported for orthodontic treatment and who were indicated for extraction of mandibular first premolars for the same. Subjects were explained the procedure and informed consent was obtained from each participant. The mean age of the selected sample was 15.4\u00a0years\u2009\u00b1\u20092.95\u00a0years (12\u201323\u00a0years). The study was approved by the ethics committee of the university.In order to be included in the study, the subjects had to be without (i) any history of previous orthodontic treatment, (ii) trauma in the orofacial region, and (iii) predisposing systemic diseases. The mandibular first premolars had to be fairly upright as evident visually, free of any periodontal or endodontic pathology, and with completely closed apices and without pre-existing root resorption as seen on the orthopantomogram.The study was a split-mouth study, with the right and left mandibular premolars of the subjects forming the two groups of the study, viz. group A, where the teeth were retained for 4\u00a0weeks post-orthodontic intrusion, and group B, where the teeth were retained for 6\u00a0weeks similarly. The final study design is shown in Fig.\u00a0Mandibular first molars were banded with 0.018\u2033 MBT tubes . Occlusal grinding of the first premolars was done till enough clearance was obtained for bonding the spring on to the tooth. Interproximal clearance was obtained using single-sided abrasive strips to prevent damage to the adjacent tooth.A spring design was chosen which involved a posterior coil and a cantilever arm resting on the occlusal surface of the mandibular first premolar to provide an apical direction of the force. Each spring was prepared using a 0.017\u2033 \u00d7 0.025\u2033 TMA wire  in which a coil with 3-mm internal diameter was incorporated in front of the molar. The spring was activated before bonding to the premolar by opening the coil so that the active arm goes apically. The amount of activation was adjusted to a magnitude of 50\u00a0g of force as seen on a dial gauge. The spring was bonded onto the occlusal surface of the premolar , the teeth were extracted atraumatically with forceps under local anaesthesia. The extracted teeth were immediately washed under running water and placed in formaldehyde solution diluted to a 1:10 ratio with distilled water and stored in this manner for a minimum of 5\u00a0days to allow fixation.The teeth were then prepared for histological sectioning. A stereomicroscope  was used at a magnification of \u00d710 to study these teeth. After careful examination of each surface , the largest surface irregularity in the apical third of each tooth was marked using a toothpick dipped in India ink solution , which could make linear measurements on histological images, was used to compare the depth of the craters from the bottommost point in the crater to the outer root outline imagined as a continuation of the adjoining cementum. The following parameters were studied for each of these craters undergoing repair.The grading system described by Owman-Moll et al.  was usedThe thickness of the repair cementum in these same craters was measured (in \u03bcm) as the perpendicular distance from the deepest point of the crater till the outer surface of the layer Fig.\u00a0. The imaU test. Similarly, mean values and standard deviations for the base readings (first operator) for cementum thickness obtained from both the groups were calculated and compared using Mann-Whitney U test. A \u201cP value\u201d of <0.05 was considered statistically significant for both the comparisons.Statistical tests were performed using R statistical software, v3.2.2. To check the reliability of the system utilized to measure the thickness of the repair cementum, the interoperator reliability for the cementum thickness readings was assessed using Spearman\u2019s rank correlation coefficient for both the groups. Mean values and standard deviations were calculated for the scores of level of repair for both the groups and compared using Mann-Whitney Fifteen subjects originally participated in the study. However, 1 subject dropped out midway before extraction of the mandibular first premolars. The final sample consisted of 14 subjects of which, 4 were males and 10 were females. Another subject could not report for extraction at 4\u00a0weeks after force withdrawal. Subsequently, both mandibular first premolars of this subject were included in group B, the 6\u00a0weeks rest period group. Subsequently, group A included 13 teeth and group B included 15 teeth. The largest craters that were analysed for the study were all found in the apical third of the lingual surfaces of the specimens.Histologically, all the teeth showed healing in their deepest craters. Healing was with either type (cellular/acellular) of cementum, with early repair areas showing the presence of acellular cementum predominantly (8 out of 13 in group A) and later areas showing the presence of cellular cementum more often (13 out of 15 in group B) Fig.\u00a0. The resU test suggests that the difference between the mean values is significant (P\u2009<\u20090.05).All the teeth showed healing in their deepest craters. Thus, none of the teeth in the sample were assigned a score of 0. A majority of the teeth in group A showed partial repair (score 1), with the remaining showing functional repair score 2). A majority of the teeth in group B showed anatomic repair (score 3), with the remaining showing functional repair see Fig.\u00a0. The dis. A majorU test suggests that this difference between the thickness of cementum is significant (P\u2009<\u20090.05).Table\u00a0ots Fig.\u00a0 show theOrthodontically induced inflammatory root resorption is an unavoidable side effect of orthodontic therapy. Minimizing this resorption by taking appropriate steps should be a moral duty for any orthodontist. That intermittent force is biologically less detrimental than continuous force is common knowledge , 2, 4, 5Intrusion is known to be the most harmful type of tooth movement where root resorption is concerned, with intrusive movement causing four times the resorption caused by extrusive movement . AlthougTo standardize the morphology of the resorption craters for comparison in both the groups, the initial force levels, the duration, and the direction of the force were kept the same for both the groups. Following active intrusion, the teeth were retained with a passive spring instead of leaving them unbonded, avoiding resorption during extrusive relapse, as the objective was to study the repair of the craters induced by application of intrusive forces only.There was a significant difference between the mean values for the level of repair in the two groups. Anatomic repair was seen more frequently in group B while partial repair was more frequent in group A. This indicates that healing of craters progresses rapidly with time. Previous studies have shown similar results. Be it tipping forces , or intrWhile a majority of the teeth in group B showed anatomic repair after a rest period of 6\u00a0weeks, there were still six teeth in this group that showed only functional repair. Based on these results, the hypothesis that full anatomic repair occurs with 6\u00a0weeks of force withdrawal was rejected. It can be concluded that 6\u00a0weeks is close to, but not enough for complete repair of orthodontic resorption. Six weeks, however, is enough for the exposed dentin to get fully covered with new cementum. At first glance at the previous studies, it might seem that full repair of orthodontic resorption occurs by 8\u00a0weeks. In the study by Cheng et al.  reportedAnother interesting observation was that initial repair (group A) was predominantly acellular in nature while later repair proceeded with deposition of cellular cementum predominantly (group B). This finding is in agreement with previous studies , 6, 16. For this study, it was hypothesized that with an increase in the time period allotted for the repair, the greater amount of cementum would be deposited within the resorption craters. If this hypothesis was true, then the thickness of repair cementum should have been greater in the teeth in group B as opposed to that in group A. There was a significant amount of difference between the mean values of the repair cementum thickness seen in both the groups, with the mean value clearly being more in group B (127.88\u00a0\u03bcm) as compared to that in group A (44.59\u00a0\u03bcm). This indicates that the amount of cementum deposited is indeed greater at 6\u00a0weeks. However, the standard deviation accompanying these values was very high  with individual values ranging from 11.57 to 77.34\u00a0\u03bcm in group A and 24.46 and 244.34\u00a0\u03bcm in group B.While the high and significant values of Spearman\u2019s rank correlation coefficient in both the groups validate the reliability of the method used to measure the repair cementum thickness in this study, other factors may have played a role in causing this variability including (i) variations in root anatomy and surface morphology which can be seen between contralateral teeth also , 20, leaThere were certain other limitations to this study. A cantilever spring such as the one used in this study would tend to exert extrusive and distal tipping forces on the molars. Future studies using a similar spring design could employ the use of anchorage preservation protocols, like a lingual holding arch for instance, to maximize the intrusion force on the premolars.While 6\u00a0weeks of rest period was not found to be adequate for full repair of the craters, it was surely enough for the exposed dentinal tubules to be fully covered with repair cementum. Repair of root resorption is a spontaneous, time-based phenomenon, with a longer rest period of 6\u00a0weeks showing better healing than a shorter rest period of 4\u00a0weeks. This repair begins at the centre of the resorption crater with deposition of acellular cementum and progresses further with deposition of cellular cementum extending to involve the entire surface of the crater. The thickness of the repair cementum also increases with time but is possibly only limited to the actual depth of the crater."}
+{"text": "This study was aimed to determine whether structured written and verbal education provided to patients by community pharmacists about high blood pressure (BP) and its treatment would be (a) better retained and (b) be associated with improved BP control as compared to patients receiving verbal advice only.The study was designed as a randomised controlled trial and was conducted in the West Midlands, UK, between January 2014 and June 2014. The primary outcome measures were differences in systolic and diastolic BP from baseline and retention of information about high BP assessed with a questionnaire at 2-, 4- and 26-week follow-up points.p\u2009<\u20090.001) and awareness about potential adverse effects of the new BP medicine (p\u2009<\u20090.001). Similarly, there was a greater and more significant reduction in systolic BP in favour of the intervention group 8\u00a0mmHg (95% CI 2.1\u201313.3 p\u2009=\u20090.009) compared to 6\u00a0mmHg (95% CI 0.6\u201311.7 p\u2009=\u20090.02) in the control group at the week 4 follow-up. However, this greater effect of an intervention on BP was not sustained at the 26-week follow-up. For diastolic BP, there was no added effect of the intervention.A total of 64 adults were included in the study. At the week 26 follow-up, compared to participants in the control group, there was a significant improvement in the knowledge of intervention participants about the risks associated with high BP (This randomised controlled trial suggests that although written advice provided by community pharmacists in comparison to verbal advice was more effective in improving knowledge and understanding of patients about hypertension and its treatment, it did not lead to better blood pressure control. It has been reported that behavioural interventions\u2014patient-centred counselling, self-monitoring of blood pressure (BP) and structured training courses\u2014on BP management lead to better BP control in patients with hypertension as compared to patients receiving ordinary care . Pooled In the UK, the New Medicines Service (NMS) allows community pharmacists to explain medicine use to patients with long-term medical conditions such as hypertension. Within this scheme, the advice is structured but verbal, with no specific written information provided on drugs or the disease being treated. There is limited evidence to suggest that provision of written medical advice to patients about a disease and its treatment is better retained by patients than verbal information  and leadClinicalTrials.gov (Identifier NCT01939860). Participants in both groups were required to attend four visits in total over a period of 6\u00a0months .This study was a 6-month multicentre randomised controlled trial (RCT) conducted across four community pharmacies in the West Midlands area of the UK between January 2014 and June 2014. The trial was registered on All participants 18\u00a0years or over, male or female and had been started on a BP medication were eligible for the study. Eligible participants were identified by a member of the pharmacy team. Exclusion criteria included patients under 18\u00a0years and patients not capable of giving written consent.The questionnaire drawn from a 12-item questionnaire developed by the National Institutes of Health  was aimeThree readings of systolic and diastolic BP were recorded for both intervention and control groups participants during all four visits . BP was recorded electronically by trained pharmacy staff using a British Hypertension Society (BHS)-approved Omron BP monitor . As per Participants in both groups were asked to continue to take their prescribed anti-hypertensive medications during the study. In addition to usual care, participants in the intervention group received individually tailored information sheets containing structured advice on BP and their anti-hypertensive medication that was prepared using National Institute for Health and Care Excellence (NICE) guidance CG 127 . These iThe sample size calculation indicated that a sample size of 54 per group completing the study will provide a power of 80% at the 5% level in a two-tailed test to detect a reduction of a size equal to 0.6 standard deviations (SD) in systolic and diastolic BP. The primary outcome of the study was to detect the difference in systolic and diastolic BP from baseline. The secondary outcome was the retention of information about BP assessed with a questionnaire at 2, 4 and 26\u00a0weeks follow-up. ANOVA was used to calculate the mean difference in systolic and diastolic BP (in mmHg). Cross tabulation was used to analyse the responses to hypertension knowledge questions.A total of 64 participants were included in the study  compared to 6\u00a0mmHg (95% CI 0.6\u201311.7 p\u2009=\u20090.02) in the control group. However, this greater effect of intervention on systolic BP was not sustained at the 26-week follow-up with little difference remaining between the groups, 8\u00a0mmHg (95% CI 2.1\u201313.3 p\u2009=\u20090.01) intervention group vs. 7\u00a0mmHg  control group. For diastolic BP, there was no added effect of the intervention and both groups achieved a similar reduction in diastolic BP at the 26-week follow-up, 4.5\u00a0mmHg (95% CI 1.2\u20137.7 p\u2009=\u20090.008) intervention group vs. 5\u00a0mmHg (95% CI 1.3\u20138.8 p\u2009=\u20090.009).At the end of week 4 follow-up, there was a greater reduction in systolic BP in favour of the intervention group 8\u00a0mmHg (95% CI 2.1\u201313.3 p\u2009<\u20090.001), the role of lifestyle measures in reducing high blood pressure (p\u2009<\u20090.01) and awareness about potential adverse effects of the new blood pressure medicine (p\u2009<\u20090.001) (see Table With regard to the assessment of knowledge about BP, there was a significant improvement in the knowledge of intervention participants in comparison to participants in the control group at the 26-week follow-up including knowledge about the risks associated with high blood pressure (The findings of this study suggest that although there was a greater reduction in systolic BP in favour of the intervention group compared to control group at the 4-week follow-up, this greater effect of intervention on BP was not sustained at the 26-week follow-up with both groups achieving similar reduction in BP. These findings suggest that verbal advice provided by pharmacists alone was equally effective as the written advice in supporting a reduction in systolic and diastolic BP of hypertensive patients following the introduction of a new BP-lowering medicine. However, compared to verbal advice only, provision of structured verbal and written education was associated with an improvement sustained over 6\u00a0months in the knowledge of hypertension.There can be many possible reasons for the non-sustainability of greater BP control initially achieved by intervention participants over the long-term follow-up. It is not completely clear if the intervention participants initially responded better to their new BP treatment than the control participants. Another reason for the loss of their greater BP control could be that perhaps they needed frequent reminders about high BP and its treatment. A recent study that included 1300 adults with high BP compared two intervention groups who received education about high BP and its treatment through text message reminders and interactive text messaging to a control group receiving standard care. The study reported that those who had received text messages had a slightly greater reduction in their BP and were more likely to have achieved a controlled BP .This study has several limitations. Although, the study reported a greater initial reduction in systolic BP of intervention participants compared to control group, such initial better blood pressure control could have been explained by the risk of confounding factors including the type and dose of antihypertensives used, and degree of patient compliance with their medication. Such confounders could have been addressed by appropriate matching of controls. In addition, we were not able to recruit the initially planned number of participants, resulting in reduced power for assessment of the outcome measures. This was primarily due to the withdrawal of two participating pharmacies from the study. Finally, owing to the nature of pharmacists\u2019 interventions in this study, participants and the investigators could not be blinded to the study intervention.The initial reduction in BP by pharmacist-led interventions has important implications for primary and secondary prevention of cardiovascular morbidity and mortality. For example, evidence from a meta-analysis reported that even a 2-mmHg reduction in systolic BP could reduce the risk of stroke by 10% in the USA . HoweverThis randomised controlled trial suggests that although written advice provided by community pharmacists in comparison to verbal advice was more effective in improving knowledge and understanding of patients about hypertension and its treatment, it did not lead to better blood pressure control."}
+{"text": "The study identifies the prevalence of violence victimization and the perpetration among youths, and explores the determinants and predictors using a socio-ecological model. The data of 36 variables from a representative sample of 1722 persons, ages 15\u201324 years, from the National Health Survey of Serbia in 2013, were analyzed by a multivariate logistic regression modeling. The study shows that 13.4% of youths experienced multi-victimization, while 10.4% were perpetrators of violence. Up to one-third of the victims were violence perpetrators. A small percentage of victims seek family and community support. Predictors of violence among youths were: male sex, households with fewer members, urban settlements, violence perpetration, self-assessed health as poor, lack of close friends and perception that it was difficult to obtain the assistance needed. Predictors of youth violence highlighted the need to improve health education, social support and community regulations, as well as strengthen the promotion of gender equality and a healthy environment. Violence is among the top five leading causes of death for young people aged 10\u201329 , p. 82).The consequences of violence are various and often long-lasting, such as fear and anxiety, increased risk of psychiatric and behavioral problems, including suicide attempts, harmful use of tobacco, alcohol, and psychoactive substances, unsafe sex, pregnancy in adolescence and sexually transmitted disease, as well as difficulties in education, psychosocial adjustment, employment, relationships, while some victims later become perpetrators of violence ,9,10,11.According to the socio-ecological model ,14, violViolence is unequally widespread and is likely higher in a country going through an economic, social transition, or in a post-conflict situation . In SerbThis is a cross-sectional study of physical and psychological violence among youths in Serbia. It is a secondary analysis of the data from the 2013 National Health Survey of the Republic of Serbia, designed and conducted by the Ministry of Health of the Republic of Serbia and the Institute of Public Health of Serbia . The InsThe study population was persons aged 15 to 24 years who at the time of data collection lived and reside in private households in the territory of the Republic of Serbia. The National Health survey used three instruments: the household characteristics questionnaire, the face-to face interview questionnaire and the self-assessment questionnaire.The following data were taken from the Institute of Public Health of Serbia for the purpose of this research: demographic and socio-economic characteristics of respondents, violence victimization and violence perpetration , also the health characteristics and risk factors of the respondents.In this study, we measured the prevalence of the general violence victimization and perpetration. We analyzed 36 variables, including nine outcome and 27 explanatory variables . Outcomep < 0.05. Multiple logistic regression was used to identify predictors of violence among significant explanatory variables, , except tobacco smoking, alcohol binge drinking, and same-sex intercourse, due to low response rate . To determine the strength of predictors for different types of violence, a 95% confidence interval was calculated by using the odds ratio (OR). All statistical analyses were performed using the SPSS, version 22.0 [The Kolmogorov-Smirnov test examined the normal distribution of data. For continuous variables that follow a normal distribution, the data are presented as the mean and standard deviation (number of household members). For categorical variables, data are displayed as absolute and relative frequencies. Pearson Chi-squared test and one-factor ANOVA were used to test for statistically significant difference at ion 22.0 .In the representative sample of 1722 (100%) young people, 51% were females and 60% were in the age interval of 15\u201319 years . The majp < 0.05) regarding individual characteristics such as sex, violence perpetration, self-assessed health status, binge-drinking and sexual relationship with person of the same sex, close relationship characteristics such as number of members in the household, and number of close friends, community characteristics such as type of residence, and social characteristics such as perceived difficulty in getting necessary assistance (The study showed that 13.4% of young people were victims (mostly in the family and on the street) of combined psychological and physical violence , while 5.3% were victims of psychological and 1.3% of physical violence . Also, 6sistance . The preA greater psychological violence victimization was found among respondents who rated their health as bad/very bad (14.3%), with chronic disease (11.4%), lived in urban settlements (7.8%), with two or less close friends (7.5%), and among those who thought that neighbors had little or no interest in them (7.4%), than among their counterparts . Larger Greater domestic violence victimization was more likely among psychologically and physically violence perpetrators , those who rated their health as bad/very bad (10 times), with chronic disease (three times), and among those with two or less close friends and among those who thought that people had an average, little or no interest in them, than among their counterparts . The higAbout two-fifths of all respondents who were victims of violence asked for help from their relatives or friends, while significantly fewer victims contacted the police or teachers, professors, social workers, health workers or SOS service for that reason .Respondents who assessed their own health as bad/very bad, and physically or psychologically violent perpetrators were more likely to be exposed to combined violence than their counterparts  . Those wRespondents who have assessed their own health as bad/very bad, from urban settlements, and males were more likely to be victims of street violence  . Psycholp < 0.05) in terms of individual characteristics including sex, self-perception of their health status, practicing binge-drinking and same-sex intercourse, and close relationship status such as marital status and number of household members  . Young p members . Combine members .p < 0.05) in terms of individual characteristics including sex, household wealth index, self-perception of their health status, and chronic disease, family status, and close relationship status such as number of household members and marital status  in terms of individual characteristics including sex, psychological violence perpetration, binge-drinking, then, close relationship status such as family status, and social characteristics such as perceptions of difficulties in obtaining the necessary assistance , also those who have assessed their health as average or bad/very bad (2.2 or 5.5 times respectively), than their counterparts . PhysicaIn Serbia, the violence victimization was greater than the prevalence of the violence perpetration (13.4% vs. 10.3%). The prevalence of violence victimization is in the range of median prevalence estimated in some countries  . This prYoung people were exposed to more than one type and place of violence. Researchers have shown that 71% of children aged 2\u201317 years reported at least one victimization, 67% two incidents, 25% three separate incidents of violence, and 22% at least four incidents . As in tIn Serbia, as well as worldwide , similarThe study showed that Socio-ecological model is useful for analyzing youth violence, as it provided evidence that victims also act violently and that equal attention should be paid to the health education of victims as well as perpetrators, in order to end the vicious circle of violence. Socio-cultural theories explain that aggressive behavior is primarily a product of a cultural and social structure in which widespread social inequalities, lack of opportunities for development, including unemployment and delinquency, often present in post-conflict situations and crisis, can contribute to creating a subculture of violence in society ,35. ThisThe strength of the study comes from a representative sample of the young population, a high level of expertise in instrument design, a high response rate, and a comprehensive approach that encompasses 36 variables on the four levels of the Socio-ecological model and outweighs the potential biases often seen in surveys . A crossOverall, the increased prevalence of violence perpetration among young people in Serbia, especially the women victimization, suggests the need to strengthen the efforts for violence reduction in society. Determinants and predictors of psychological and physical violence have highlighted the necessity to improve a range of programs aimed at the eliminating violence, also promoting health education at the individual, relationship, community and social level, as well as developing healthy and violence-free environments. An effective health education network can raise awareness of the importance of empowering young people to solve problems and take control of their behavior, maintain healthy relationships, and become more informed about the work of institutions, programs, procedures and regulations to prevent violence."}
+{"text": "Patterns of homozygosity can be influenced by several factors, such as demography, recombination, and selection. Using the goat SNP50 BeadChip, we genotyped 3171 goats belonging to 117 populations with a worldwide distribution. Our objectives were to characterize the number and length of runs of homozygosity (ROH) and to detect ROH hotspots in order to gain new insights into the consequences of neutral and selection processes on the genome-wide homozygosity patterns of goats.FROH coefficients (<\u20090.10), while ~\u200930 and ~\u200910% of the goat populations show moderate (0.10\u2009<\u2009FROH\u2009<\u20090.20) or high (>\u20090.20) FROH values. For populations from Asia, the average number of ROH is smaller and their coverage is lower in goats from the Near East than in goats from Central Asia, which is consistent with the role of the Fertile Crescent as the primary centre of goat domestication. We also observed that local breeds with small population sizes tend to have a larger fraction of the genome covered by ROH compared to breeds with tens or hundreds of thousands of individuals. Five regions on three goat chromosomes i.e. 11, 12 and 18, contain ROH hotspots that overlap with signatures of selection.The proportion of the goat genome covered by ROH is, in general, less than 15% with an inverse relationship between ROH length and frequency i.e. short ROH (<\u20093\u00a0Mb) are the most frequent ones. Our data also indicate that ~\u200960% of the breeds display low FROH\u2009<\u20090.15) are similar in goats from different geographic areas. The increased homozygosity in local breeds is the consequence of their small population size and geographic isolation as well as of founder effects and recent inbreeding. The existence of three ROH hotspots that co-localize with signatures of selection demonstrates that selection has also played an important role in increasing the homozygosity of specific regions in the goat genome. Finally, most of the goat breeds analysed in this work display low levels of homozygosity, which is favourable for their genetic management and viability.Patterns of homozygosity  contains supplementary material, which is available to authorized users. Runs of homozygosity (ROH) can be defined as genomic regions that display a series of consecutive homozygous genotypes . Their lFST, iHS and hapFLK) has facilitated the identification of several genomic regions under positive selection in goats [The recent availability of a caprine high-throughput genotyping chip  and a rein goats , 15, 17.The AdaptMap dataset was initially composed of samples collected from 4653 goats from 130 breeds and 14 crossbred populations that were genotyped with the Goat SNP50 BeadChip; SNP genomic coordinates were based on the ARS1 reference genome . Animal Highly related individuals (pairwise identity-by-state higher than 0.99) were also removed from the dataset. Moreover, in populations with more than 50 individuals, a random sampling selection procedure implemented in the BITE R package  was usedTo investigate the factors that influence the patterns of homozygosity in the goat genome, we performed comparisons based on (1) population characteristics, (2) geographical origin and (3) sampling locations of transboundary breeds.This comparison was based on three population characteristics: (1) large versus small size populations, where breeds with a small population size include a few hundreds or thousands of individuals and breeds with a large population size have a census of at least 20,000 individuals, although most of them are in the range of hundreds of thousands of individuals or even millions; (2) traditional versus improved breeds: improved breeds are those that have undergone intensive programs of selection for milk i.e. Maltese, Murciana, Toggenburg or Saanen or meat (e.g. Boer); and (3) crossbreds versus purebred breeds, when available in the dataset.Goats were sampled from: (1) America ; (2) Oceania (no subgroups); (3) Asia ; (4) Europe  and (5) Africa .Transboundary breeds collected from multiple locations  were split into subpopulations according to the geographic area where they were sampled .FROH) by considering the total length (2.92\u00a0Gb) of the most recent caprine assembly version ARS1 [nlme package (R software v.2.15.3) by assuming inequality of the variances associated with each one of the two parameters outlined above (ROH number and coverage) and each group:m levels), We used the Zanardi software  for ROH ion ARS1 . For eacnd Bates . For botnd Bates  and multH score). This information was used to detect ROH hotspots across the goat genome by considering regions that contained at least three SNPs above the top 0.998 of the overall SNP distribution. The H score that represents this distribution varied between comparisons. Then, we performed a gene search within the common ROH hotspots by using the most recent available annotated genome version, ARS1 [In Comparison (2), ROH were classified into seven length classes . For each subgroup and length class, ROH were summed and averaged according to the number of animals included in each subgroup. The \u2013save option was used to retain the output derived from the analyses that provided, for each SNP, the percentage of animals that have a ROH in a given position  and sd(HDij) denote the expected value and standard deviation of HD between the ith and jth sub-populations. These analyses were performed by using the R computing environment (https://www.r-project.org/) and implementing the approach suggested by Akey et al. [H scores (SHD\u2009>\u20095) were considered in these analyses.For transboundary breeds that were raised in multiple countries, the summary statistics of the percentage of animals that have a ROH in a given position were calculated for each country and breed and then standardized to compare the locus-specific divergence for each location based on y et al.  and modiy et al. . To provFROH coefficients (<\u20090.10), while ~\u200930 and ~\u200910% of the populations show moderate (0.10\u2009<\u2009FROH\u2009<\u20090.20) or high (>\u20090.20) FROH values. A high variability in the magnitude of FROH coefficients within breeds was also observed in our dataset. It is interesting to note that several of the caprine populations with the highest FROH values are raised on islands and have undergone prolonged geographic isolation , Kamori (KAM), Bari (BRI) and Barbari (BAB) (FROH\u2009=\u20090.20\u20130.25), and Boer (BOE), one of the most improved goat breeds (FROH\u2009=\u20090.21).The average fraction of the genome that contains ROH in each analyzed breed is provided in Additional file ents <\u20090.0, while adj-value\u00a0<\u20090.05), for at least one of the two parameters considered (ROH number and coverage), except for Central_Asia-North_Europe, Central_Europe-North_Africa, Central_Europe-Oceania, Central_Europe-South_Europe, Central_Western_Africa-East_Africa, Near_East-North_Africa, North_Africa-South_Europe, North_Africa-Oceania and Oceania-South_Europe. It is interesting to note that the average ROH number and coverage for goats from Oceania (49 ROH and 182.19\u00a0Mb) were significantly lower  than those for goats from America (136 ROH and 333\u00a0Mb), see Fig.\u00a0adj-value\u2009<\u20090.0001), with 60 ROH and 210.64\u00a0Mb, than from Central Asia (90 ROH and 260.64\u00a0Mb). As shown in Figs.\u00a0Figures\u00a0adj-value\u2009<\u20090.0001) in crossbred populations.To understand the effects of demography, admixture and selection on the patterns of homozygosity, we carried out comparisons based on sets of selected caprine breeds. Results of the comparison between continental breeds that have large population sizes  and local breeds with relatively small population sizes are in Fig.\u00a0Figure\u00a0Capra hircus chromosome (CHI) CHI18, the 1.7-Mb (14.64\u201316.38\u00a0Mb) and 842-kb ROH (26.83\u201327.67\u00a0Mb) were specific to Asian and American breeds, respectively. Moreover, six ROH ranging in size from 107\u00a0kb to 1\u00a0Mb on CHI3 (110.15\u2013111.16\u00a0Mb), CHI5 (95.67\u201396.54\u00a0Mb), CHI7 (59.82\u201359.92\u00a0Mb), CHI8 (43.94\u201344.62\u00a0Mb), CHI11 (94.23\u201394.50\u00a0Mb) and CHI12 (48.30\u201348.44\u00a0Mb) were exclusively detected in goats from Oceania.Analyses across the continental and subcontinental divisions revealed several partial or complete ROH overlaps (top 0.998 regions) across all populations listed in Additional file gap junction protein beta 6 (GJB6), Sin3A associated protein 18 (SAP18), and gap junction protein beta 2 (GJB2).Five regions on three chromosomes, i.e. CHI11, 12 and 18, contained ROH that are present in the highest percentage of animals Fig.\u00a0. A ROH oH scores derived from the locus-specific divergence analyses . As we will explain in the next section, population admixture and crossbreeding both contribute to the disruption of long homozygous stretches and decrease in global autozygosity levels.The patterns of homozygosity in goats from Oceania and America are quite different although these two populations were founded around 200 and 500\u00a0years ago, respectively. According to our data, ROH number and length are much smaller in goats sampled in Oceania than in\u00a0those sampled in America. In principle, a recent founder effect should have resulted in a larger number of ROH, as observed for American goats  but not for Oceanian goats. The most likely explanation for these unexpected results is the extensive crossbreeding of goats from Oceania. For instance, Rangeland goats are composed of a mixture of Angora, Cashmere, Anglo-Nubian, British Alpine, Saanen and Toggenburg breeds , and KikRegarding the transboundary breeds, in general we detected no major differences across subpopulations through locus-specific divergence analyses, which is probably mainly due to the recent worldwide dispersal of these breeds because of the intensification of goat production, artificial insemination and the existence of an efficient transportation network across the globe. Hardiness and robustness of goats also facilitate the shipment of improved breeders to distant countries. However, ROH regions of high divergence were identified in several comparisons. For example, Alpine goats that were sampled from a limited and close geographical area  showed different ROH distributions particularly on CHI3 (91.54\u201392.29\u00a0Mb) and 13 (62.90\u201363.69\u00a0Mb) for the subpopulation sampled in Switzerland, and on CHI11 (94.31\u201395.44\u00a0Mb) for the subpopulation sampled in Italy. Differences in the genome-wide diversity patterns of the Alpine goats sampled in these countries were also observed in the admixture analyses that were carried out by Colli et al.  and coveBos taurus\u2009\u00d7\u2009Bos indicus [The effects of population admixture on homozygosity patterns are illustrated in Fig.\u00a0 indicus . Szpiech indicus  reported indicus , but, inhttp://www.capgenes.com/IMG/pdf_ Pyreneenne_anglais.pdf). With 640 registered individuals, the Valdostana breed is at risk [http://www.mapama.gob.es). Population reduction often involves a global increase in the levels of inbreeding and autozygosity. For instance, Williams et al. [Demography is another important factor that shapes the genomic patterns of homozygosity . Our res at risk , and thes et al.  analyzeds et al. , no decrs et al. .Artificial selection generally results in an increase of the ROH frequency and coverage in the genomes of livestock species (e.g. ). The coOne of the goals of our study was to detect regions of the genome where ROH were more abundant and to investigate if they coincided with the signatures of selection reported by Bertolini et al. . It shouGJB6 and GJB2 [SAP18 [The ROH on CHI11 37\u201338\u00a0Mb) is shared by goats from three continents  and, interestingly, a signature of selection related to milk production has been detected in the same genomic region in caprine populations from America, East Africa and Central Europe \u00a0Mb is sh on CHI12and GJB2 , 40 and 2 [SAP18 .Patterns of homozygosity can be similar in populations from different geographic areas. Moreover, reduced population size, strong founder effects and geographic isolation are associated with increased levels of homozygosity in goats, while population admixture has the opposite effect. The existence of three ROH hotspots that co-localize with signatures of selection demonstrates that selection has also played an important role in increasing the homozygosity of specific regions of the goat genome. Our results will be useful to define future strategies that aim at ensuring the genetic management of goat resources with a broad geographic distribution and a remarkable impact on the economy of developing countries.Additional file 1: Table S1. Animals used for the analyses. Breed symbol, name and number (N). The country in which samples were collected (Country), the continental and subcontinental groups used for the analyses are reported. Table S2. Average fraction of the genome that contains ROH in each one of the breeds under analysis. Breed code (Breed) and average fraction of the genome that contains ROH (FROH). Breeds are reported based on FROH increasing values. Table S3. Summary statistics of number of ROH regions and genome coverage considering the sub-geographical and continental classification. min: minimum number of ROH regions or coverage detected; max: minimum number of ROH regions or coverage detected; mean: average number of ROH regions or coverage detected; sd: standard deviation from the mean value. Table S4. Comparison of pairwise least square means of the sub-geographical comparisons. Comparison: pairwise comparison considered; estimate: estimated difference in LSM; p.value: adjusted Bonferroni P value. Table S5. Summary statistics of number of ROH regions and genome coverage for comparison 1 and pairwise least square means comparison. min: minimum number of ROH regions or coverage detected; max: maximum number of ROH regions or coverage detected; mean: average number of ROH regions or coverage detected; sd: standard deviation from the mean value; estimate: estimated difference in LSM; p.value: adjusted Bonferroni P-value. Table S6. Chromosomal regions with a high level of homozygosity (the top 0.998 percentile of at least three consecutive SNPs) and overlaps  across continents and continental sub-divisions. NP\u2009=\u2009not present; \u201c-\u201c: no overlap detected; for the regions shared by most of the subgroups (All), the symbol of the genes detected within those regions are reported. See the bold number in the \u201coverlap with other continental/sub-continental\u201d column. (1) MIR217; MIR216B; CFAP36; PNPT1; PPP4R3B; EFEMP1. (2) GJB6; SAP18; MRPL57; ATP12A; CENPJ; MPHOSPH8; ZMYM5; GJA3; GJB2; CRYL1; IL17D; EEF1AKMT1; LATS2; SKA3; ZDHHC20; FGF9; RNF17; PSPC1; ZMYM2; IFT88; XPO4; MICU2; PARP4. (3) MAB21L1; DCLK1; NBEA. (4) TPPP3; AGRP; CARMIL2; PARD6A; ENKD1; C18H16orf86; TSNAXIP1; THAP11; NUTF2; EDC4; NRN1L; LCAT; DPEP3; DPEP2; DDX28; SLC7A6OS; LRRC36; ZDHHC1; ATP6V0D1; FAM65A; ACD; GFOD2; CENPT; PSKH1; PSMB10; DUS2; ESRP2; PLA2G15; SLC7A6; SMPD3; HSD11B2; CTCF; RANBP10; NFATC3; PRMT7; SLC12A4.Table S7. Chromosomal regions displaying a high divergence in homozygosity across countries for the same breeds. For each breed-based analysis, chromosome (chr), start and end of the regions with H\u2009\u2265\u20095 are reported.Additional file 2: Figure S1.FROH calculated in the single breeds of the AdaptMap dataset. Legend: ABR\u2009=\u2009Abergelle; ALP\u2009=\u2009Alpen; ANG\u2009=\u2009Angora; ANK\u2009=\u2009Ankara; ARG\u2009=\u2009Argentata; ASP\u2009=\u2009Aspromontana; BAB\u2009=\u2009Barbari; BAW\u2009=\u2009Balaka-Ulongwe; BEY\u2009=\u2009Bermeya; BIO\u2009=\u2009Bionda_dell\u2019Adamello; BLB\u2009=\u2009Bilberry; BOE\u2009=\u2009Boer; BR I\u2009=\u2009Bari; BRK\u2009=\u2009Barki; BUR\u2009=\u2009Burundi_goat; BUT\u2009=\u2009Bugituri; CAM\u2009=\u2009Cameroon_goat; CAN\u2009=\u2009Caninde\u2019; CAS\u2009=\u2009Cashmere; CCG\u2009=\u2009Ciociara_Grigia; CRE\u2009=\u2009Creole; CRP\u2009=\u2009Carpatian; CRS\u2009=\u2009Corse; DDP\u2009=\u2009Dera Din Panah; DIA\u2009=\u2009Diana; DIT\u2009=\u2009Di_Teramo; DJA\u2009=\u2009Djallonke; DZD\u2009=\u2009Dedza; FSS\u2009=\u2009Fosses; GAL\u2009=\u2009Galla; GAR\u2009=\u2009Garganica; GGT\u2009=\u2009Girgentana; GOG\u2009=\u2009Gogo; GUE\u2009=\u2009Guera; GUM\u2009=\u2009Gumez; ICL\u2009=\u2009Icelandic; JAT\u2009=\u2009Jattan; JON\u2009=\u2009Jonica; KAC\u2009=\u2009Kachan; KAM\u2009=\u2009Kamori; KAR\u2009=\u2009Karamonja; KEF\u2009=\u2009Keffa; KES\u2009=\u2009Koh-e-sulmani; KIK\u2009=\u2009Kiko; KIL\u2009=\u2009Kil; KLS\u2009=\u2009Kilis; LND\u2009=\u2009Landin; LNR\u2009=\u2009Landrace_goat; LOH\u2009=\u2009Lohri; LOP\u2009=\u2009Local_Pothohari; MAA\u2009=\u2009Maasai; MAL\u2009=\u2009Mallorquina; MAU\u2009=\u2009Maure; MEN\u2009=\u2009Menabe; MLG\u2009=\u2009Malaguena; MLS\u2009=\u2009Maltese_Sarda; MLT\u2009=\u2009Maltese; MLY\u2009=\u2009Malya; MOR\u2009=\u2009Moroccan_goat; MOX\u2009=\u2009Moxoto\u2019; MSH\u2009=\u2009Mashona; MTB\u2009=\u2009Matebele; MUB\u2009=\u2009Mubende; MUG\u2009=\u2009Murciano-Granadina; NAI\u2009=\u2009Naine; NBN\u2009=\u2009Nubian; NGD\u2009=\u2009Nganda; NIC\u2009=\u2009Nicastrese; NRW\u2009=\u2009Norwegian; OIG\u2009=\u2009Old_Irish_goat; ORO\u2009=\u2009Orobica; OSS\u2009=\u2009Oasis; PAH\u2009=\u2009Pahari; PAL\u2009=\u2009Palmera; PAT\u2009=\u2009Pateri; PEU\u2009=\u2009Peulh; PRW\u2009=\u2009Pare_White; PTV\u2009=\u2009Poitevine; PVC\u2009=\u2009Provencale; PYR\u2009=\u2009Pyrenean; RAN\u2009=\u2009Rangeland; RAS\u2009=\u2009Blanca_de_Rasquera; RME\u2009=\u2009Rossa_Mediterranea; RSK\u2009=\u2009Red_Sokoto; SAA\u2009=\u2009Saanen; SAH\u2009=\u2009Sahel; SAR\u2009=\u2009Sarda; SDN\u2009=\u2009Soudanaise; SEA\u2009=\u2009Small_East_Africa; SEB\u2009=\u2009Sebei; SHL\u2009=\u2009Sahel; SID\u2009=\u2009Saidi; SNJ\u2009=\u2009Sonjo; SOF\u2009=\u2009Sofia; SPA\u2009=\u2009Spanish; TAP\u2009=\u2009Tapri; TAR\u2009=\u2009Targui; TED\u2009=\u2009Teddi; THA\u2009=\u2009Thari; TOG\u2009=\u2009Toggenburg; TUN\u2009=\u2009Tunisian; VAL\u2009=\u2009Valdostana; VSS\u2009=\u2009Valpassiria; WAD\u2009=\u2009West_African_goat; WYG\u2009=\u2009Woyito_Guji.Additional file 3. Comparison of ROH across the breeds raised in different countries. The higher the value on the y axis, the bigger is the difference. The threshold of H\u2009=\u20095 is indicated with a red line."}
+{"text": "Positions of leaves along a stem usually adhere to a genetically determined, species-specific pattern known as a leaf phyllotaxis. We investigated whether the arrangement of lateral secondary veins along primary midveins adhered to a species-specific pattern that resembled an alternate or opposite phyllotaxis. We analyzed the venation of temperate dicotyledonous species from different taxonomic groups and chose 18 woody and 12 herbaceous species that have reticulated leaf venation. The arrangement of the lateral veins was neither alternate nor opposite for any of the species. Lateral vein arrangements were instead mixtures of symmetric and asymmetric patterns. Our results show that lateral vein arrangements are related neither to stem-level leaf phyllotaxis  nor to life form (woody vs. herbaceous). Our results are therefore generally consistent with the canalization hypothesis that the locations of lateral veins are not completely specified genetically prior to leaf formation. In plant scaling theories, modeling plant vascular networks is a fundamental method to scale from plant organs to an individual, because the physiology of vascular networks is linked to all levels of plant physiology, from leaves to trunks14. Many plant scaling models are based on the simplified assumption of self-similarity of vascular networks14. Self-similarity means that branching patterns are similar at multiple scales. It has been suggested that scaling models of stem venation networks can be extended to venation networks in leaves12, though deviations from such simple models have been reported12. To extend current plant scaling models to leaf vascular networks, it is necessary to quantify the similarity and dissimilarity between two different scales, stem vascular networks and leaf venation networks12.Scaling from an organ to whole-organism function has been one of the main goals of biology21 as well as with the mechanical stability23 of leaves. Interspecific variations of vein length per unit lamina area , which is one of the determinants of leaf hydraulic conductance26 and maximum leaf photosynthetic rate24, underpin the leaf economics spectrum29. The architecture of reticulated  venation is analogous to stem-branching architecture30. Because the arrangement of lateral organs (leaves and branches) along the stem is one of the determinants of species-specific branching patterns, it usually follows a species-specific pattern, known as a phyllotaxis, and has also been a subject of studies concerning light interception33, though several studies have suggested that phyllotaxis per se does not always significantly affect light interception efficiency33. If leaf venation patterns are species-specific in a way similar to stem-level patterns, modeling approaches that scale functions from veins to trunks could be unified.Leaf venation patterns have important physiological implications, because venation patterns are linked with water-, carbohydrate-, and nutrient-transport strategies12 have revealed a discrepancy between simple self-similar models and venation networks. This discrepancy may be explained by the results of recent developmental studies35 that have identified a likely difference in the mechanisms that underlie the generation of branching nodes of stems and veins. Developmental studies38 have shown that phyllotaxis or the regular arrangement of leaves  along a stem is a consequence of self-organized spacing between auxin concentration peaks, each of which generates a single leaf primordium at the apex. The results of those studies have shown that during the generation of phyllotaxis, each lateral organ becomes spontaneously separated from nearby lateral organs around the growing apical meristem. Canalization models of venation networks45 have suggested that gullies or canals are analogous to veins, which are polarized by auxin flow . Recently, canalization models of venation have been further unified with phyllotaxis models of auxin flow. In those unified models , the spacing of leaves and formation of midveins occur concurrently46. It is, however, still unclear whether lateral venation patterns exhibit consistent morphologies that correspond to phyllotaxis.However, in contrast to such naive expectations, recent attempts to quantify venation networks45. Those studies have therefore indicated that the branching points on the midvein, from which lateral veins bifurcate, may not be controlled by the same spacing mechanism responsible for phyllotaxis. Indeed, it has long been recognized that unlike phyllotaxis, which is a genetically determined species-specific trait, the arrangement of lateral veins may not be strictly determined genetically35 but instead is subject to unpredictable noise during development40. Despite the fact that both phyllotaxis and venation appear to be controlled by auxin flows46, the mechanisms responsible for branching of the main axis may therefore differ.Based on our review of previous studies, we suggest that there is an inherent difference between the mechanisms that generate branching points on the main axes of stems and midveins. In the case of stem branching or generation of phyllotaxis, the branching nodes are generated in the region near the growing apexes, as described above. In contrast to stem branching, in vein formation, the generation of branching nodes along the midvein, to which lateral secondary veins are connected, is not confined to the growing apex or the edge of a leaf. Instead, branching nodes on the midvein are formed by the coalescence of flows from the two opposite sides of a leaf lamina into the midveinIn this study, to quantify the similarity or dissimilarity between stem-level phyllotaxis and leaf-level venation patterns, we investigated the arrangement of lateral veins along the midvein. Specifically, we asked the following questions: (1) does the arrangement of secondary veins reflect a species-specific, genetically determined pattern that is analogous to either an alternate or opposite phyllotaxis? (2) Is the venation pattern consistent with stem-level leaf phyllotaxis?Fraxinus and Ligustrum) that both belonged to the family Oleaceae. Among the woody species, three  were evergreens, and the rest were deciduous species.In 2017 and in 2018, we investigated 18 woody and 12 herbaceous species that had clearly visible reticulate venation: 18 had an alternate and 12 had an opposite phyllotaxis (Table\u00a0The plants were sampled from seven locations in Japan: (1) the Forest of Obihiro (Obihironomori), a plantation forest that included a mixture of planted and regenerated trees. The sampling locations included the roadsides inside and around the forest; (2) the campus of the Obihiro University of Agriculture and Veterinary Medicine, including an experimental garden at the Field Center of Animal Science and Agriculture; (3) a roadside near the Obihiro station; (4) the riparian zone of the Urikari River; (5) Tokachi Ecology Park, which is located in the riparian zone of the Tokachi River; (6) the riparian zone of the Kikankono River; and (7) a roadside near the Taguri River.The sites (1)\u2013(6) were located in Obihiro City or in Otofuke Town in Hokkaido in a cool-temperate region in Japan. These six sites were within 10\u2009km from the Japan Meteorological Agency Obihiro Weather Station . The mean annual temperature and precipitation at the weather station during 1998\u20132017 were 7.2\u2009\u00b0C and 937\u2009mm, respectively. The site (7) was located in Sakura City in Chiba prefecture in a warm-temperate region in Japan. This site was ca. 4\u2009km from the Japan Meteorological Agency AMeDAS Sakura Observatory . The mean annual temperature and precipitation at the observatory during 1999\u20132017 were 14.9\u2009\u00b0C and 1469\u2009mm, respectively. The weather data were taken from the Japan Meteorological Agency homepage, viewed 2 March 2018.Amphicarpaea, Chenopodium, Justicia, Lonicera, Paederia, Scutellaria, and Solanum) that had relatively few lateral veins on each lamina. For each of those seven species, 50 or 60 leaves  were measured to ensure that sufficient numbers of lateral veins were measured  were measured, except for seven species  at a resolution of 400 dpi. The scanning was usually conducted on the same day as the sampling. Because of time constraints, in some cases samples in closed plastic bags were stored in a refrigerator, and the leaves were scanned within two days of the sampling day.30, which is an updated version of the standard definition by Hickey47, but with a few modifications. (1) For each leaf, the midvein at the center of each lamina was recognized as a primary vein. (2) For leaves or leaflets that had actinodromous venation , for which more than one primary vein originated at the base of the leaf lamina, other basal  veins were also recognized as primaries. Similarly, for Cynanchum, thick basal lateral veins were not recognized as lateral veins. (3) Tertiary veins were defined as the widest veins that filled the field of the leaf lamina, and secondary veins were defined as veins that were at intermediate positions between the primary and tertiary veins. In this study, we defined \u201clateral veins\u201d as secondary veins that originated from the midvein and ran toward the leaf margin. For leaves that had more than one primary vein, only the midveins were measured. Intersecondary veins30 that were considerably thinner than other lateral veins and did not reach the leaf margin were not considered to be lateral veins in the present analysis. If a single lateral vein bifurcated into two or more lateral veins on the way toward the leaf margin, it was still considered as a single lateral vein, and the point from which that lateral vein originated from the midvein  was measured.For simple leaves, we followed the definition of primary and secondary veins articulated by the Leaf Architecture Working Groupet al.48, we regarded each leaflet as equivalent to a single leaf for the purposes of this study. Nonetheless, because a lateral vein of a leaflet may not be equivalent to the lateral vein of a simple leaf, we performed the following preliminary analysis to determine whether we could regard a leaflet as equivalent to a leaf, at least for purposes of this study. We used leaflets of Amphicarpaea (hog-peanut), which had ternate leaves, and we separately analyzed the terminal leaflets and compared them to the leaflets from all positions . We considered the lateral veins of a terminal leaflet to be equivalent to those of a simple leaf. As shown in the Results section, we obtained similar results when we analyzed only the terminal leaflets and when we analyzed leaflets from all positions. The same procedure described above was therefore performed to determine the midvein and the lateral veins for each leaflet. For a compound leaf, we therefore defined the \u201cmidvein\u201d to be the vein at the center of each leaflet.For compound leaves, following the model by Runions 50, and statistical analyses were performed with R ver 3.5.151 For each leaf, the image of either the adaxial or abaxial surface was measured, depending on the distinguishability of the lateral veins. We manually determined the coordinates of all the points at which lateral veins bifurcated from the midvein by using the \u201cpoint tool\u201d of ImageJ. For each of those points, two sets of distances (dopposite and dsame) were calculated from the coordinates. For each vein, the ratio (r) between those two distances was calculated as follows:The digital images were analyzed by using ImageJ ver 1.51nr should be unimodal, with a single mode at an r of 0.5 , which is useful for visualizing a difference between unimodal and bimodal distributions53, combined with a bee swarm plot54 (by using the R package \u2018beeswarm\u201954), which is useful for visualizing an entire dataset without any information loss. The analysis was carried out with Hartigan\u2019s dip test of unimodality55 (by using the R package \u2018diptest\u201956). We followed the argument by Freeman and Dale57 that the p-value of the dip test can be used as a measure of departure from unimodality; a small p-value indicates a deviation from a unimodal distribution, and in the present context, was considered to indicate a departure from an alternate-like vein arrangement. We therefore tested whether the p-values differed between species with different stem-level phyllotaxes  or between woody and herbaceous species with a two-sided nonparametric Brunner\u2013Munzel test58 by using the R package \u2018lawstat\u201959.If the lateral veins were arranged in the same way as the alternate phyllotaxis, the distribution of 0.5 Fig.\u00a0. In contd 1 Fig.\u00a0. As showr\u2009>\u20091. We hypothesized that if those irregular cases were generated by a systematic rule, they should appear at approximately the same positions on each pair of left- and right-positioned leaflets of ternately compound leaves of Amphicarpaea . We therefore compared the relative positions  at which this r\u2009>\u20091 pattern appeared for each case to determine whether the r\u2009>\u20091 cases appeared as mirror images on the compound leaves.We occasionally observed cases in which two successive lateral veins were on the same side of a leaf lamina Fig.\u00a0. This irr) varied continuously from zero to more than 1 , Bpt (Betula), Cay (Cayratia), and Eua (Euonymus)) showed distinct deviation from unimodality  with peaks at r\u2009=\u20090\u20130.2 and at r\u2009=\u20090.8\u20131.0 . In contrast, other species (Bid (Bidens), Lgo (Ligustrum), and Mkb (Magnolia)) showed little departure from unimodality  and had an r distribution with a single mode at an r of \u22480.5 . The remainder of the species had r distributions that were intermediate patterns between those two extreme cases. Lateral vein arrangements were related neither to stem-level leaf phyllotaxis   Fig.\u00a0 nor to lte) Fig.\u00a0. For Ampike Fig.\u00a0, oppositike Fig.\u00a0, and irrike Fig.\u00a0 patternsike Fig.\u00a0. The indr\u2009>\u20091), in which two or more successive lateral veins ran into the same side of the leaf lamina  or opposite phyllotaxis , but those patterns did not always correspond with the stem-level phyllotaxis. Patterns corresponding to r\u2009>\u20091  had been generated by a systematic rule, they should have appeared as mirror images on each pair of left- and right-positioned leaflets. Nonetheless, we found that the irregular cases usually appeared on only one leaflet of each pair . Actual venation patterns may be a consequence of both pre-determined spacing of midveins associated with asymmetry in auxin concentrations and post-determined spacing of auxin canals within each leaf lamina. Further studies are needed to clarify the extent to which auxin flow within a single leaf is determined prior to leaf development.In the canalization models63 and is consistent with canalization models48. Those models have revealed that the locations of major veins are determined partially by the locations of lobes, the centers of which often become major veins. Those major veins follow a canal of auxin flow from the tip of the lobe toward the base of a leaf. The termination of some of the lateral veins of Acer, which has lobed leaves, at the lobe apexes is consistent with this scenario. When leaf laminae were symmetric, the symmetrically arranged lobes in some cases corresponded to symmetrically arranged lateral veins (Fig.\u00a0Betula (Fig.\u00a0Correlated growth between lobes and major veins has long been recognized by developmental studiesins Fig.\u00a0, though ins Fig.\u00a0. Similarula Fig.\u00a0. Therefoper se may not significantly affect water or nutrient transport within leaf laminae as long as vein density is maintained. Despite the fact that both stem-level branching morphology and venation are constrained by optimization of resource transport14 and mechanical stability64, stem-level branching architecture is also constrained by three-dimensional light-capturing strategies65 and a balance between vertical and horizontal growth during competition with neighboring plants66. Inherent differences in functions may therefore partially explain the observed difference between venation and phyllotaxy. Nonetheless, because the present analysis was based on a limited dataset, further study is needed to confirm our conclusions.The observed plasticity in the arrangement of lateral veins suggests that the arrangement of secondary veins"}
+{"text": "The recent claim of structural differences between alanine enantiomers in the solid state is critically discussed. IUCrJ, 5, 6\u201312] reports observations that may lead one to think of very strong and visible consequences of the parity-violation energy difference between enantiomers of a molecule, namely alanine. If proved, this claim would have an enormous impact for research in structural chemistry. However, alternative, more realistic, explanations of their experiments have not been ruled out by the authors. Moreover, the theoretical calculations carried out to support the hypothesis are unable to differentiate between enantiomers . Therefore, the conclusions drawn by Belo et al. (2018The recent paper by Belo, Pereira, Freire, Argyriou, Eckert & Bordallo [2018, IUCrJ,  al. 2018 are deem In the abstract of the paper, the authors conclude that their \u2018results reveal d-alanine compared with l-alaninedissimilarities in the structural properties of \u2019 (our emphasis). These are very strong statements. In their generality, they are no less than a refutation of the empirically and theoretically founded principle that enantiomeric molecules have the same energies and the same chemical properties; optical activity and circular dichroism are the same in absolute value but have opposite sign.In a recent paper, entitled \u2018Hydrogen bonds in crystalline  al. 2018 report pi.e. its mathematical structure requires that the energies of enantiomers be identical; their equilibrium structures and their potential energy surfaces must be exact mirror images of each other and their vibrational spectra identical . The effects of such a dependence on the properties reported by Belo et al.  calculations of inelastic neutron scattering (INS) spectra for  al. 2018 are said al. 2018 used mod al. 2018 is sugge3.3.1.et al. , mainly with the intention of finding experimental confirmation of the effects of PV. While Wang et al. , which shows the B bands, these signals are seen at all temperatures between 21 and 290\u2005K. The one at 170\u2005cm\u22121 shifts to lower frequency at the higher temperatures, reduces its maximal intensity and becomes broader. The behaviour of this band in the A spectrum is not incompatible with its behaviour in the B spectrum. Since the experimental part says nothing about the accuracy of the crystal orientation relative to the probing laser beam, it cannot be excluded that the B bands in the A spectrum are due to slight misorientation of the crystal. Such an explanation would make the postulated phase transition unnecessary, but is not considered.The Raman studies concentrate on \u2018anomalies in the lattice modes of hydrogenated b) and 2(c) . It is quite obvious that there are significant differences in the vibrational amplitudes (i.e. peak intensities) of the low-frequency modes below 350\u2005cm\u22121\u2019. As mentioned in Sections 1et al. cannot account for PV since they do not contain the corresponding operator. In the context of differences between enantiomers this evidence is meaningless.Belo  al. 2018, p. 10 sd- and l-ala, Belo et al. \u2013(c)], and tests to confirm or exclude them :In the list below, we suggest some alternative explanations for the reported differences between a) Incongruent crystallization processes for the enantiomeric substances, possibly leading to differences in sample characteristics, specifically the degree of deuteration or the density of crystal defects. Differences in sample treatment have been shown to explain differences observed in scanning temperature experiments  Anharmonicity and isotope effects.(c) Inconsistent structural optimization by the PV-free quantum chemical DFT method used.(d) Comparison of Raman data for d- and l-ala.(e) Tests for multiple structural minima during the refinement of NPD data.(et al. (2018We do not deny that the differences observed by Belo  al. 2018 are realNote added in proof: After submission of this work we became aware of similar work on l-nucleic acids [\u2018First look at RNA in l-configuration\u2019 (Vallazza et al., 2004d- over the non-natural l-configuration in nucleic acids\u2019 (Bolik et al., 2007a fortiori to this work. Enantiomeric biomolecules such as duplex RNA octamers are even more difficult to characterize and compare than the relatively simple ala crystals."}
+{"text": "The aim was\u00a0to assess the cognitive dysfunction and physical disability after autologous hematopoietic stem cell transplantation (AHSCT), to explore the potential factors influencing disability regression after AHSCT and to estimate the safety of low-dose immunosuppressive therapy in highly active Multiple Sclerosis (MS) patients. In single-center prospective study patients who failed to conventional therapies for highly active relapsing MS underwent the AHSCT. The disability was followed up with Expanded Disability Status Scale and cognition with Brief International Cognitive Assessment for Multiple Sclerosis. Twenty four patients [18 (72.0%) female] underwent AHSCT. Two patients of 13 had one relapse during the first year and three patients\u2014during the second year after AHSCT. Disability regression was found in 84.6% of patients. The scores of information processing speed and verbal learning were significantly higher at month 12 after AHSCT. The clinical variable that explained the disability regression at months 6 and 12 after AHSCT was the disability progression over 6\u00a0months before AHSCT. No transplant related-deaths were observed. Selective cognitive improvement was found after AHSCT in MS patients. The disability may be temporarily reversible after AHSCT in a significant proportion of highly active RMS patients if AHSCT is well-timed performed. Currently there are many disease-modifying treatments (DMT) for MS, and all of them are focused on the active inflammation control2. The evidence shows that the most effective disease-modifying therapy can help to prevent the relapses and to delay long-term disability progression in MS3. Despite advances in the current treatment of MS, some patients do not respond to available drugs and require other therapeutic strategies to control the disease activity and to prevent the progression of disability4.Multiple Sclerosis (MS) is the most prevalent chronic autoimmune disease of the central nervous system (CNS) and is presumed to be the immune-mediated disease caused by autoreactive T cells6. It enables to remove disease-causing immune cells and to reset the immune system2. Since 1995 more than 1000 patients with MS have undergone this treatment. Most of these patients were recognized as having highly active MS after failure of all available MS treatments8. Consensus recommendations on AHSCT as a second line therapeutic option for severe MS were published in 2012 and revised recently in 20199. The recommendations recognized severe deteriorating MS patients despite standard therapy\u00a0as the best candidates for AHSCT10. AHSCT ensures higher rates of disease activity (NEDA) than those achieved with any other DMT. AHSCT is also associated with greater short-term risks witch have limited its use in whom the disease can be controlled with DMT11.During the last 25\u00a0years, severe autoimmune diseases including MS have been treated with immunosuppression and autologous hematopoietic stem cell transplantation (AHSCT)16. Thereafter, it was shown that intermediate intensity, non-myeloablative regimen using cyclophosphamide with Anti-Thymocyte Globulin (ATG) is associated with similar efficacy but less toxicity. Less-intensive conditioning regimen with AHSCT is supported by some evidence that AHSCT is not only immunosuppressive therapy but also have an immunomodulatory component19.The first clinical trials have addressed the issues of safety and efficacy of AHSCT with high-dose and intermediate-intensity [BEAM ] conditioning regimen in MS resulting in clinical benefit22. The benefit in progressive forms of the disease is more limited, however, patients with higher degrees of disability, or occasionally progressive disease course, can be considered if there is clear evidence of significant clinical and MRI disease activity23.The first AHSCTs were performed in patients with advanced progressive disease. Currently AHSCT is performed in patients with highly active disease course without adequate response to second line treatment, shorter disease duration and less disability24. However, treatment-related mortality, which was initially high (3.6%), has decreased to 0.3% in studies post-2005. The reduction in treatment mortality appeared due to the greater experience, improvements in transplant techniques and optimization of patient selection24. The most common side effects of AHSCT are secondary to the immunosuppression and are tending to appear during the first 6\u00a0months after AHSCT. The most common complications include infections, febrile neutropenia, sepsis and viral reactivations. Late adverse events have also been described, including secondary autoimmune conditions, malignancies and infertility26.The main concern limiting the use of AHSCT in MS patients is the mortality risk28. Recently the first randomized clinical trial has shown the higher efficacy of AHSCT versus DMT in relapsing\u2013remitting MS. In this study AHSCT compared with DMT resulted in prolonged time to disease progression27. However, further research is needed to replicate these findings27 and to assess long-term outcomes and safety of AHSCT. Experience from single centers and long-term follow-up of MS patients remain important in providing valuable information about the efficacy and safety of AHSCT. In this single-center prospective observational cohort study we describe disease characteristics and outcomes of the Lithuanian population treated with AHSCT, between 2014 and 2019\u00a0years.For a long time, there was a lack of randomized clinical trials comparing AHSCT with DMT in MS patientsThe main objective of our study was to assess the cognitive dysfunction and physical disability after AHSCT, to explore the potential factors influencing disability regression after AHSCT and to estimate the safety of low-dose immunosuppressive therapy (LDIT) in highly active MS patients.Twenty-four patients were selected and underwent AHSCT procedure. All patients had relapsing\u2013remitting MS. The mean follow-up was 22.3\u2009\u00b1\u200916.5\u00a0months (range 5\u201377). Demographic and clinical characteristics of the patients are provided in Table Patient pretransplant disease characteristics and outcomes after AHSCT are shown in Fig.\u00a026, the safety issues were analysed in all 24 patients who completed 6\u00a0month follow-up.13 patients (54.2%) of 24 patients who underwent AHSCT completed the 24\u00a0month follow-up and were included in the efficacy analysis. As potential side effects can occur during the 6\u00a0months after AHSCTTwo patients (15.4%) of 13 had one relapse during the first year after AHSCT and three patients 23.1%) had one relapse during the second year after AHSCT. The annualized relapse rate (ARR) dropped to 0.2 in the first year and to 0.3 in the second year. A reduction of 89% was found when comparing the ARR 2\u00a0years after AHSCT (0.5) with ARR 2\u00a0years before AHSCT (4.6)  after AHSCT: in six patients (46.2%) the EDSS score improved by 0.5 (EDSS score in these patients was\u2009>\u20095.5), in two patients (15.4%)\u2014by 1.5, in two patients (15.4%)\u2014by 2.0 and in 1 patient (7.8%)\u2014by 2.5 points. Sustained disability improvement was found in 10 (76.9%) of 13 patients at month 12 after AHSCT. In 10 patients (76.9%) of 13 EDSS score remained stable at month 24 after AHSCT, in one patient (7.7%) improved by 0.5 and in two patients (15.4%) by 1.0 point  that assesses information processing speed was slightly lower at month 3 than before AHSCT, however, the difference was not significant. The score of SDMT was significantly higher at month 12 than before AHSCT and at month 3. And the score of SDMT was significantly lower at month 24 than at month 12. The score of Brief Visuospatial Memory Test Revised (BVMT-R) that assesses visuospatial memory was slightly lower at month 3 than before AHSCT, however, the difference was not significant. The scores of BVMT-R didn\u2019t differ between pretransplant, month 12, and month 24 after AHSCT assessments. The score of California Verbal Learning Test Second Edition (CVLT-II) that assesses verbal learning was significantly higher at month 12 than before AHSCT, while the scores of CVLT-II didn\u2019t differ between pretransplant assessment and month 3, also between month 12 and 24 after AHSCT (Table Eight patients (61.5%) of 13 had new or enlarged T2 lesions and eight patients (61.5%) had active lesions on the brain MRI before AHSCT. No new or active lesions were found on the spinal MRI before AHSCT. There were no new or enlarged T2 lesions, no gadolinium-enhanced lesions on the brain and spinal MRI in 13 patients that have completed 24\u00a0month follow-up at month 3, 12, 24 after AHSCT.B-6) or EDSS change from baseline assessment before AHSCT to 12\u00a0months after AHSCT (\u2206EDSSB-12). Independent variables (regressors) in the models were\u2014age, gender, disease duration, change in EDSS score from 6th month before transplant to baseline assessment (\u2206EDSS6-B) or change in EDSS score from 12th month before transplant to baseline assessment (\u2206EDSS12-B) (one of them per model), relapse number per 6\u00a0months before transplant (RN6) or relapse number per 12\u00a0months before transplant (RN12), either relapse number per 24\u00a0months before transplant (RN24) (one of them per model), the score of one of the Brief International Cognitive Assessment for Multiple Sclerosis (BICAMS) tests , the number of new and active lesions on brain MRI.General Linear Model (GLM) was used to assess the impact of demographic characteristics and disease characteristics on the disability change after AHSCT per 6\u00a0months and 12\u00a0months. Dependent variables in the models were\u2014EDSS change from baseline assessment before AHSCT to 6\u00a0months after AHSCT (\u2206EDSSB-6\u2009=\u2009\u22121.5\u2009+\u20090.79x (\u2206EDSS6-B); R2\u2009=\u20090.55; p\u2009<\u20090.05.\u2206EDSSB-12\u2009=\u2009\u22121.2\u2009+\u20090.54x (\u2206EDSS6-B); R2\u2009=\u20090.48; p\u2009<\u20090.05.\u2206EDSSRegression models that had explained the disability improvement after AHSCT:p\u2009<\u20090.05).The model was considered successful if both the model itself and all the independent variables left in the model by the backward removal procedure were significant  was diagnosed in 19 patients (79%) and was most common adverse event after AHSCT. 10 FN episodes developed within 48\u00a0h of stem cell reinfusion and were probably a reaction to circulating ATG. Blood culture was positive only in one FN episode. One patient developed Acute respiratory distress syndrome (ARDS) with respiratory failure during conditioning. ARDS resolved after treatment with glucocorticoids. During the follow-up period one patient developed idiopathic thrombocytopenic purpura (ITP), not responsive to glucocorticoids and normal human immunoglobulin therapy. The previous DMT in this patient was fingolimod. Third line therapy with eltrombopag in this patient resulted in prompt response. Eltrombopag was discontinued after 3\u00a0months, platelet count remained within normal range. One patient developed hemorrhagic cystitis of viral etiology [significant Adenovirus (ADV) and John Cunningham virus (JCV) viruria detected]. Cystitis resolved after infusion of normal human immunoglobulin. Epstein\u2013Barr virus (EBV) reactivation was detected in 18 (75%) patients during follow-up period. Median number of EBV copies/ml was 1145, range 32\u2013223,000. 5 patients were considered at risk of postransplant lymphoproliferative disorder (PTLD) and received preemptive treatment with rituximab. EBV reactivation resolved in all patients. There were no PTLD cases in our cohort. All adverse events associated with AHSCT procedure resolved. All patients are alive.16. Among the patients involved in the earlier studies, the patients with relapsing\u2013remitting forms of MS demonstrated more favourable results than those with progressive MS forms (both primary progressive and secondary progressive) without activity12. The significant difference is possibly due to the predominant neuroinflammatory process in relapsing forms of MS4. On the basis of the previous studies we included only the highly active relapsing MS patients with clinical evidence of disease activity without the response to currently available MS therapy. Most patients (91.7%) failed on the second line MS therapy, therefore the study represented highly active RMS patients.The previous studies have shown that patient selection is important in determining outcomes of AHSCT for MS patients and highly active relapsing MS is the target population for recent investigations10. Intermediate intensity, non-myeloablative conditioning regimen at our center was selected over high intensity regimens due to superior safety and comparable efficacy16. The main reason for using intermediate intensity regimen instead of high intensity regimen was to avoid transplant related mortality.Since the first transplantations in MS were performed and the data published, several protocols for mobilization and conditioning have been used10. The main result in the terms of efficacy in our study was the dramatic reduction in the relapses and annualized relapse rate in the 2\u00a0years after AHSCT and the reduction of disability progression, with 84.6% of patients improving their disability score after AHSCT at month 6 and 76.9%\u2014at month 12. Since most patients who progressed before AHSCT subsequently improved in EDSS disability at month 6 and 12, the current definitions of disability progression for relapsing\u2013remitting MS may not accurately estimate irreversible disease progression for all patients29. No new or active lesions were found on MRI after AHSCT, this meant that all patients remained without radiological disease activity. These outcomes are highly promising, as compared to conventional MS treatment outcomes4, and consistent with other investigations of AHSCT for similar MS population22.The primary goal of AHSCT is to suppress the active disease and to prevent further disability progression4. Few studies have published the data concerning the ability of MS therapies to help to reduce the disability at least temporarily32, however, there is a need for suitable analytical methods to assess this novel outcome. So far there is a lack of randomized clinical trials comparing the efficacy of AHSCT with DMT in MS patients28. Recently the first randomized clinical trial have demonstrated the higher efficacy of AHSCT versus DMT in relapsing\u2013remitting MS27. However, further research is needed to replicate these findings and to assess long-term outcomes and safety of AHSCT27. Mainly the evidence of effectiveness from the large registry studies indicates that AHSCT is of the highest effectiveness in highly active RMS22. The current analysis shows that in patients with RMS with inadequate response to prior DMT, AHSCT provides not only a dramatic reduction in relapse rate, but also temporary disability regression. The findings of EDSS improvement in almost 85% of the patients suggest that disability may be often at least temporarily reversible in patients with highly active RMS if they receive suitable and well-timed treatment irrespective of the severity of baseline deficit. On the other hand, the effect of the AHSCT on the disability regression after transplantation can be explained by the severity of disability progression before the transplantation and well-timed transplantation can be effective in highly active MS patients to the extent that it causes disability regression.Current available MS treatment may delay or prevent further increase in disability33. The BICAMS that reliably assesses three cognitive domains40 was selected to provide more elaborate cognitive evaluation. Non-significant decline in information processing speed and visuospatial memory was found at month 3 after AHSCT and significant improvement of information processing speed at month 12 after AHSCT. The results at month 3 were not significant, however, slight decline in information processing speed and visuospatial memory can suggest that AHSCT using intermediate intensity lymphoablative conditioning regimen may negatively impact the cognitive function most likely information processing speed and visuospatial memory in the early phase after the AHSCT procedure. Our results supports the previously published data35 that AHSCT procedure have the temporal negative impact on the cognition, however, despite it\u2019s aggressive nature do not have lasting deleterious effect on it. The improvement in information processing speed and verbal learning at month 12 in our study confirms that selective cognitive improvement can occur after AHSCT in MS patients.The EDSS is most commonly used and recognized neurological disability assessment tool in the clinical trials, however, it doesn\u2019t adequately reflect cognition12. There were no transplant-related deaths. Our study data add to the already considerable body of evidence supporting the usefulness of AHSCT and its favorable benefit-to-risk profile in the treatment of highly active RMS when all available DMTs have failed.The incidence and severity of adverse events after AHSCT were in the expected range and similar to the data reported in the literature27 in which comparative group is used to assess the results of AHSCT22. The absence of comparative group remains the main limitation in most AHSCT studies in MS. Therefore, the experiences from single centers and sustained long-term follow-up of MS patients remain important in providing valuable information about the efficacy and safety of AHSCT.The main limitation of the study was the relatively low sample size, therefore, the results of the study cannot be generalized and further research is needed to replicate these findings. On the other hand, the patient\u2019s assessment and follow-ups were provided at the same-center without comparative group. However, we did not identify any controlled study, with the exception of one small randomized controlled trialThe Lithuanian Bioethics Committee approved the study in 2011 (2011-01-27 No.: L-12-01/2), the permission to continue the study was granted by the Lithuanian Bioethics Committee in 2018 (2018-02-22 No.: 6B-18-41). All methods were performed in accordance with the relevant guidelines and regulations. The open-label prospective single-center observational cohort study was conducted in Vilnius University Hospital Santaros Klinikos, Lithuania. The patients were enrolled in the study between 2013 and 2019. All participants signed the Informed Consent Form. The AHSCT procedure is performed at our hospital as routine clinical practice for highly active relapsing MS patients who do not respond to second line therapy. Highly active MS patients in the case of AHSCT were defined the patients who experienced at least two relapses and had disability progression of at least 2.0 points according EDSS in the last year. Fingolimod, cladribine, natalizumab, ocrelizumab and alemtuzumab are the second line therapy for MS in Lithuania based on the regulations of the Ministry of Health. Exclusion criteria were primary or secondary progressive MS; neurological disorders, other than MS; active infections; pregnancy; pulmonary, cardiac, renal, or liver dysfunction; abnormal blood cell counts. The AHSCT procedure was carried out in Hematology, Oncology and Transfusion Medicine Center of Vilnius University Hospital Santaros Klinikos, Vilnius, Lithuania.2 single dose with intravenous mesna prophylaxis) was administered, subcutaneous filgrastim 10\u00a0\u00b5g/kg was started on day +7 and peripheral blood stem cell (PBSC) apheresis procedure were targeted on day +12 after cyclophosphamide. Collected cells were cryopreserved using dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. The target yield of cryopreserved CD34+ cells was\u2009>\u20092.5\u2009\u00d7\u2009106 CD34+/kg. The conditioning regimen was intravenous cyclophosphamide, 50\u00a0mg/kg per day on days \u2212\u20095 to day \u2212\u20092  and rabbit antithymocyte globulin 0.5\u00a0mg/kg on day \u2212\u20095, 1.5\u00a0mg/kg on day\u2009\u2212\u20094, and 1.5\u00a0mg/kg on days \u2212\u20094, \u2212\u20093, \u2212\u20092, and \u2212\u20091 . Methylprednisolone (1000\u00a0mg) was infused 30\u00a0min prior to rabbit antithymocyte globulin infusion. Hydration , diuretics, and intravenous mesna were continued until 24\u00a0h after the last dose of cyclophosphamide. Filgrastim (5\u201310\u00a0\u00b5g/kg per day) was started on day +5 and continued until engraftment. Cytomegalovirus (CMV) and Epstein\u2013Barr virus (EBV) was monitored by PCR for at least 90\u00a0days after AHSCT.Participants underwent peripheral blood stem cells mobilization: cyclophosphamide  with Gadolinium were performed before AHSCT, at 3\u00a0month and every year after AHSCT. MRI in all patients was performed using a 3.0\u00a0T scanner Philips ACHIEVA 3TX. MRI assessment included the following sequences: T1 , T2  and fluid-attenuated inversion recovery (FLAIR) T2 . MRI was assessed by one and the same radiologist.42. All subjects were assessed by the same person, in the same assessment room and in the same BICAMS test sequence: the Symbol Digit Modalities Test (SDMT), the Brief Visuospatial Memory Test Revised (BVMT-R), the California Verbal Learning Test, second edition. Parallel versions of SDMT, BVMT-R and CVLT-II were used in each evaluation session42. The cognitive assessment was done before AHSCT, at 3\u00a0month and every year after AHSCT.Cognition was assessed with Brief International Cognitive Assessment for Multiple Sclerosis (BICAMS)Patients were followed by the transplant physician for at least 6\u00a0months after AHSCT. CMV and EBV PCR tests were performed routinely for at least 6\u00a0months after AHSCT. We collected information about all nonhematological adverse events grade\u2009\u2265\u2009II\u00b0 from the start of mobilization to 6\u00a0months after AHSCT.p\u2009<\u20090.05 was accepted.Data were analyzed using statistical software package SPSS (version 20.0 for Windows). Continuous variables were reported as medians and ranges or means and standard deviations, while categorical variables were reported as absolute numbers and percent of total patients. GLM Repeated Measures were used when measuring the data of cognitive scores at different time points . General linear regression was used to assess the impact of various demographic, clinical factors on the disability change after AHSCT per 6\u00a0months and 12\u00a0months. A significance level"}
+{"text": "Anemia and changes in platelets (PLT) are common in inflammatory bowel disease (IBD). In our study, we aimed to verify whether PLT count can independently reflect the severity of IBD.In our hospital, 137 Crohn\u2019s Disease (CD), 69 Ulcerative colitis (UC) patients, and 412 healthy controls were included to compare the differences in PLT count. In addition, the effect of anemia, C-reactive protein (CRP), age, CD activity index (CDAI) or Mayo on PLTs was also analyzed. If PLTs independently affected CD or UC, we used the receiver operating characteristic (ROC) curve to verify the diagnostic value and obtain the cut-off value of PLT.p<0.001, p<0.001; respectively). In CD patients, the results showed that patients with anemia (P<0.01), Iron Deficiency Anemia (IDA) (p<0.001), CRP\u22658 mg/L (p=0.046), and CDAI\u2265150 (p<0.001) had higher PLT, while in UC patients, those with anemia (p=0.018), CRP\u22658 mg/L (p=0.045), and Mayo\u22653 (p=0.029) had higher PLT. Univariate analysis showed that CDAI was positively correlated with PLT count (p<0.001), while hemoglobin (p=0.001) and age (p<0.001) were negatively correlated with PLT in CD. In UC patients, Mayo (p=0.001) and CRP (p<0.001) were positively correlated with PLT, while hemoglobin (p=0.002) was negatively correlated. Finally, by linear stepwise multivariate analysis, we clarified the positive relationship between PLT and CD (p<0.001) by eliminating the interference of hemoglobin, and determined the cut-off value of PLT as 298\u00d7109/L. For UC, we did not obtain similar results.CD and UC patients had higher PLT than controls (PLT can be an indicator of disease severity in CD, while there is a lack of evidence regarding this finding in UC. Inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), refers to a group of chronic gastrointestinal disorders characterized by dysregulated intestinal inflammation . The immThe primary role of PLT is hemostasis, including surveying the endothelial barrier consistency and interfering when vessel integrity is threatened . MoreoveWe know that patients with IBD usually have gastrointestinal symptoms, such as diarrhea, abdominal pain, weight loss, or gastrointestinal bleeding. Remarkably, approximately one-third of IBD patients present at least one extra-intestinal feature . Anemia,In IBD, anemia and PLT count changes were observed. However, no study has been conducted to determine whether there is a close relationship between anemia and PLT in IBD. Whether PLT count change is affected by secondary bone marrow metabolic disorder or anemia is yet to be determined. In our study, we aimed to determine the relationship between the three factors of IBD, PLT, and anemia by analyzing clinical data. In addition, we aimed to verify whether PLT can be an independent indicator of IBD severity.Medical records of patients undergoing evaluation and treatment for UC and CD in our hospital between January 1, 2012, and May 1, 2016, were reviewed. This study was approved by our Institutional Review Board. Informed consent was obtained from the participants and their privacy was respected. The experimental protocol was approved by the Ethics Committee of the First Affiliated Hospital, College of Medicine, Zhejiang University. In addition, all procedures were performed in accordance with the relevant guidelines and regulations.In total, 137 CD patients and 69 UC patients were included. The diagnosis of UC and CD were made based on a combined assessment of abdominal imaging, endoscopy, symptomatology, and histology. The pattern and distribution of UC and CD were obtained from endoscopic, radiological, and histological findings . All theThe inclusion criteria were as follows: 1) age>18 years old; 2) no history of tuberculosis, cirrhosis, cancer, cardiovascular and cerebrovascular diseases, or other chronic diseases; 3) no history of thrombus or drugs that can influence PLT quantity and activity; 4) no other acute infectious diseases.We extracted data, including age, gender, general condition, hemoglobin (HB), PLT, C-reactive protein (CRP), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Moreover, anemia was defined as HB<120 g/L in males or <110 g/L in females. Microcytic hypochromic anemia was defined as MCV<80 fl, MCH<26 pg, and MCHC<310 g/L. CRP was chosen to reflect the disease activity and 8 mg/L was the cut-off level between remission and IBD activity . In addip\u22640.05. We used SPSS 21.0  to perform the statistical analysis. Other associated data were calculated and plotted using GraphPad Prism 5 .Continuous variables were expressed as mean\u00b1standard deviation. The variables were tested by SPSS and were found to be normally distributed. Student's t-test was used to compare the difference in PLT between the different subgroups. Univariate analysis of linear regression was performed to compare PLT count with age, anemia, IDA, CRP, CDAI, and Mayo. If a significant difference was found on univariate analysis, it was included into the stepwise multivariate analysis using logistic or linear regression. In addition, Pearson\u2019s correlation coefficient was conducted to correlate PLT and CDAI or Mayo score. Furthermore, coefficients of variables for the multivariate model were estimated. If PLT was related to the severity of CD or UC, we also conducted an ROC curve to verify the diagnostic value of PLT and to obtain the PLT cut-off value. The PLT cut-off value was defined by Youden's index. The statistical significance was defined as vs. 208.97\u00b150.39, p<0.001; 267.29\u00b1109.34 vs. 209.68\u00b159.2, p<0.001; respectively) .The basic characteristics of the patients, including age, gender, PLT, CRP, hemoglobin, CDAI or Mayo are described in ctively)  A and B.vs. 240.3\u00b185.68, p=0.018; vs. 240.17\u00b196.31, p=0.045; vs. 192.33\u00b1104.01, p=0.029; p=0.241, p=0.071) were not statistical significance.Similarly, UC patients with anemia , while hemoglobin . Age had no statistical correlation with PLT  by eliminating the interference of hemoglobin (P=0.006). In contrast, age was negatively correlated with PLTs . These results showed that PLT can be used to evaluate the severity of CD. In UC patients, Mayo  and CRP  were still positively correlated with PLT. Moreover, hemoglobin  was negatively correlated with PLT. For these results, we could not clarify whether PLT change in UC was affected by hemoglobin.Finally, we performed a linear stepwise multivariate analysis on PLT with age, hemoglobin, CRP, CDAI or Mayo. Firstly, through the analysis of the collinearity of the variables, we found that there was no severe collinearity among the respective variables (VIF<10). For CD patients, we clarified the positive relationship between PLT and CDAI (p<0.001) and the PLT cut-off value was 298\u00d7109/L.Through the ROC curve, we aimed to determine whether PLTs had a diagnostic value for CD. CD patients were divided into remission and activity by CDAI. The results of the ROC curve showed that PLT had a diagnostic significance for CD (Area=0.695, In our study, we found that PLT count was positively correlated with the CDAI while it was negatively correlated with age. In addition, we identified the diagnostic value of PLT for CD using the ROC curve and defined the PLT cut-off value for CD as 298*10E9/L. In UC patients, we found that Mayo and CRP were positively correlated with PLT, while hemoglobin was negatively correlated with PLT. However, we could not conclude as to whether PLT can reflect the severity of UC because the influence of hemoglobin on PLT could not be ignored.In CD patients, PLT was negatively correlated with age. As individuals age, the number and function of hematopoietic stem cells may decrease and PLT consumption due to vascular endothelial injury may induce a decrease in PLT. Cowman et al. reported that aging resulted in a significant reduction of the PLT function in the Dynamic Platelet Function Assay . DestrucMurawska et al. found that anemia coexists with IBD  and our in vivo 11-dehydro-thromboxane-dependent PLT activation and lipid peroxidation in IBD patients while demonstrating that anti-TNF-\u03b1 therapy with infliximab down-regulates isoprostane generation and TX biosynthesis in vivo in responder IBD patients (Staphylococcus aureus or HIV virus, promoting further PLT activation changes (In IBD patients, in addition to anemia, elevated PLT levels could also be found. In our study, after excluding the effect of anemia on PLT, we found that PLT were directly associated with CD disease activity. Di Sabatino et al. found evidence for enhanced patients . Except  changes . In addi changes . Heits e changes ,29. SincCollins et al. demonstrated that PLT circulate at a highly activated state in IBD and activation possibly occurs in the mesenteric microcirculation ,31. DuriOur study demonstrated the significance of PLT as an important indicator of inflammation in CD; however, some limitations still exist. Firstly, the main limitation of the study was related to the lack of endoscopic examination. The absence of endoscopic examination data led to the inability to understand the severity and healing of the colonic mucosa, thereby making it impossible to combine PLT, disease activity score, and endoscopic examination for disease assessment. This factor also made our results less reliable. Secondly, the PLT cut-off value for CD was 298*10E9/L in our study, which is almost the normal upper limit of PLT. We require more cases to improve the cut-off value. In addition, we need more data of moderate and severe CD patients to improve the PLT evaluation system. Second, although PLT cannot independently reflect the severity of UC, more data is needed to support our result. In the case of excluding anemia in UC patients, PLT can still be used as a reference index to reflect the disease activity to some extent.In conclusion, PLT can reflect the disease severity of CD, while there is a lack of evidence regarding this finding in UC. The higher the PLT count, the more serious the CD. Furthermore, we need more multi-center research and data to support our results because it is possible that PLT can reflect the severity of UC independently.Lu C designed the study. Xu P, Zhang Z and Zhou X collected the data. Chen C performed the statistical analysis. Xu P wrote the manuscript. Lu C and Li L revised the manuscript."}
+{"text": "As a result of the coronavirus disease pandemic, commercial hand hygiene products have become scarce and World Health Organization (WHO) alcohol-based hand rub formulations containing ethanol or isopropanol are being produced for hospitals worldwide. Neither WHO formulation meets European Norm 12791, the basis for approval as a surgical hand preparation, nor satisfies European Norm 1500, the basis for approval as a hygienic hand rub. We evaluated the efficacy of modified formulations with alcohol concentrations in mass instead of volume percentage and glycerol concentrations of 0.5% instead of 1.45%. Both modified formulations met standard requirements for a 3-minute surgical hand preparation, the usual duration of surgical hand treatment in most hospitals in Europe. Contrary to the originally proposed WHO hand rub formulations, both modified formulations are appropriate for surgical hand preparation after 3 minutes when alcohol concentrations of 80% wt/wt ethanol or 75% wt/wt isopropanol along with reduced glycerol concentration (0.5%) are used. Because commercial products are hardly or no longer available due to the coronavirus disease (COVID-19) pandemic, alcohol-based hand rub formulations for hygienic and surgical hand treatment published by the World Health Organization (WHO) in 2009   80% wt/wt, hydrogen peroxide  0.125% vol/vol, and glycerol  0.5% vol/vol. WHO II modified comprised isopropanol  75% wt/wt, hydrogen peroxide 0.125% vol/vol, and glycerol 0.5% vol/vol. For the reference alcohol of EN 12791, we used N-propanol  60% (vol/vol) without additions , to participate in the study. Exclusion criteria were age <18 years and skin breaks on hands . Nails were short and clean and volunteers agreed to not use any antibacterial soap or other antibacterial substance during the trial, starting from 1 week before testing. Volunteers were also asked to not use any hand rub or hand cream on trial days. All volunteers provided written informed consent. The study protocol was approved by the institutional ethics committee of the Medical University of Vienna .Culture media were as described in EN 12791 . The other hand was gloved and sampled 3 hours later to assess the 3-hour effect. We performed quantitative surface cultures from all sampling fluids and dilutions on tryptic soy agar, incubated counting plates for a total of 48 hours at 36\u00b0C \u00b1 1\u00b0, and counted colony-forming units. . From the intra-individual differences between log10 pretreatment minus log10 posttreatment values, we calculated individual log10 reduction factors separately for immediate and 3-hour effects. We tested pretreatment values of study formulations and the reference formulation for significant differences by means of the Friedman analysis of variance with an agreed significance level of p = 0.05. Subsequently, we tested the differences between the log10 reduction factors from each study formulation and the appropriate values of the reference for significance by a nonparametric noninferiority test according to Hodges-Lehmann. We rejected inferiority of a study formulation and assumed noninferiority if the Hodges-Lehmann upper 97.5% confidence limits for the differences in log10 bacterial reductions between study formulations and reference treatment were smaller than the agreed inferiority margin of 0.75 log10 (immediate effect) or 0.85 log10 (3-hour effect). We set the level of significance at p = 0.025 (1-sided). Furthermore, we used the Wilcoxon matched-pairs, signed-ranks test to test for a suspected sustained effect at p = 0.01 (1-sided) if\u2014as concluded from a higher mean log10 reduction\u2014a study formulation was suspected to be more efficacious than the reference antisepsis procedure 3 hours after antisepsis.For statistical analyses, we expressed all colony counts per mL of sampling fluid as decadic logarithms10 pretreatment bacterial counts for the immediate and 3-hour efficacy tests. Hence, the baseline for each study formulation can be considered equivalent.We observed no significant differences between the means of the log10 reductions of >2.00 , so sustained efficacy cannot be confirmed.Overall, immediate effects were comparable to that of the reference alcohol of EN 12791; typical magnitude was mean logof >2.00 . Each mohttps://www.biorxiv.org/content/10.1101/2020.03.10.986711v1) showed that severe acute respiratory coronavirus 2 can be inactivated within 30 seconds by both WHO-recommended formulations but also by modifications as proposed by us in 2013 (The COVID-19 pandemic has led to scarcity of commercial hand antisepsis agents, and healthcare institutions worldwide are seeking alternatives. Since the end of February 2020, pharmacies in Europe have been producing the WHO-recommended formulations either for sale or as donations for personal use by the general population or use in healthcare settings. Use of hygienic hand preparations made with the original WHO-recommended formulations might be justifiable to prevent infection or transmission of pathogens outside patient care. However, to be approved in Europe, preparations for hygienic hand antisepsis used in healthcare facilities must meet the bactericidal efficacy requirements of EN 1500 (The use of WHO-recommended formulations in hospitals, including for surgical hand preparation, is paramount despite the lack of commercial agents. In Europe, before a product is allowed to be used for surgical hand preparation, its efficacy must be evaluated in the laboratory on the hands of volunteers according to EN 12791 (Frequent use of alcohol-based hand rubs can cause skin dryness unless emollients or humectants such as glycerol are added to the formulation. A recent study (10 step higher than those achieved with the original WHO-recommended formulations when applied for 3 minutes for both immediate and 3-hour effects (In this study, we were able to show, once again, that the effect on the resident skin flora of the original WHO formulations can be improved if the concentration of the alcohols is increased by using weight instead of volume percentage. In addition, by further reducing the glycerol content from 1.45% to 0.725% or to 0.50%, the 3-hour effects of each formulation can be improved to such an extent that the requirement of the European test standard is already ensured after 3 minutes of application. Although the criteria for use as a product regulated by the US Food and Drug Administration differ from the EN requirements, these results could also be of interest to US healthcare providers. Reductions achieved with the modified formulations were >1 log effects .On the basis of these results and considering the current situation, we believe that the original WHO formulations should be urgently reconsidered. We therefore recommend a modification of the WHO I formulation with 80% wt/wt ethanol, 0.125% vol/vol hydrogen peroxide, and 0.50% vol/vol glycerol and a modification of the WHO II formulation with 75% wt/wt isopropanol, 0.125% vol/vol hydrogen peroxide, and 0.50% vol/vol glycerol."}
+{"text": "Salmo salar) as a model to study the molecular responses at the nasal olfactory mucosa of a teleost fish when challenged with oxidants. Microarray analysis was employed to unravel the transcriptional changes at the nasal olfactory mucosa following two types of in vivo exposure to peracetic acid (PAA), a highly potent oxidative agent commonly used in aquaculture: Trial 1: periodic and low dose  to simulate a routine disinfection; and Trial 2: less frequent and high dose  to mimic a bath treatment. Furthermore, leukocytes from the olfactory organ were isolated and exposed to PAA, as well as to hydrogen peroxide (H2O2) and acetic acid (AA)\u2014the two other components of PAA trade products\u2014to perform targeted cellular and molecular response profiling. In the first trial, microarrays identified 32 differentially expressed genes (DEG) after a 45-day oxidant exposure. Erythrocyte-specific genes were overly represented and substantially upregulated following exogenous oxidant exposure. In Trial 2, in which a higher dose was administered, 62 DEGs were identified, over 80% of which were significantly upregulated after exposure. Genes involved in immune response, redox balance and stress, maintenance of cellular integrity and extracellular matrix were markedly affected by the oxidant. All chemical stimuli  significantly affected the proliferation of nasal leukocytes, with indications of recovery observed in PAA- and H2O2-exposed cells. The migration of nasal leukocytes was promoted by H2O2, but not much by PAA and AA. The three chemical oxidative stressors triggered oxidative stress in nasal leukocytes as indicated by an increase in the intracellular reactive oxygen species level. This resulted in the mobilisation of antioxidant defences in the nasal leukocytes as shown by the upregulation of crucial genes for this response network. Though qPCR revealed changes in the expression of selected cytokines and heat shock protein genes following in vitro challenge, the responses were stochastic. The results from the study advance our understanding of the role that the nasal olfactory mucosa plays in host defence, particularly towards oxidative chemical stressors.The olfactory organs of fish have vital functions for chemosensory and defence. Though there have been some ground-breaking discoveries of their involvement in immunity against pathogens in recent years, little is known about how they respond to non-infectious agents, such as exogenous oxidants, which fish encounter regularly. To this end, we employed Atlantic salmon ( Oxidative stress is a physiological state in an organism in which the redox balance is altered, as characterised by an increase in the levels of reactive oxygen species (ROS) but normal or low amounts of antioxidants, which may be due to compromised neutralisation property and/or scavenging potential ,2. Fish,Oxidants can be endogenously produced or derived from external sources. Endogenous ROS are produced from molecular oxygen as a result of normal cellular metabolism , and ROSMucosal organs of fish are multifunctional; besides their role in defence, they carry a multitude of other physiological functions ,14. TheyThe nasal olfactory system plays a role not only in chemoreception but also in immune defence, as it is considered an ancient component of the mucosal immune system of vertebrates . It is aSalmo salar). We employed both in vivo and in vitro strategies to unravel the molecular changes in the nasal olfactory mucosa when challenged with exogenous oxidants relevant in fish farming. In this study, we employed peracetic acid (PAA) as the main oxidant, as it is currently being developed as a chemotherapeutant  and disinfectant in recirculating aquaculture systems for salmon [2O2) and acetic acid (AA). These two compounds are present in equilibrium with PAA in its trade product.This study explored the impacts of oxidative chemical stressors on the nasal olfactory mucosa of Atlantic salmon  and the in vivo exposure trials received approvals from the Norwegian Food Safety Authority . All key personnel have a FELASA  C certificate to conduct experimentation on live animals. Two independent in vivo trials  were per3 octagonal tanks in a recirculation system was stocked with 735 smolts with an average weight of around 90 g. After four weeks of acclimatisation, the oxidant in the form of a peracetic acid-based disinfectant  was directly applied to each tank at a nominal concentration of 1 ppm every 3 days for 45 days, making a total of 15 applications in the duration of the trial. This mode of application was patterned on a previous PAA experiment conducted in rainbow trout, a closely related species of salmon [\u22121, salinity at 11.6 \u00b1 0.5 \u2030, temperature at 12.8 \u00b1 0.6 \u00b0C, pH at 7.5, dissolved oxygen > 90% saturation, photoperiod at 24 L: 0 D, and a continuous feeding regime .Trial 1 was conducted at Nofima Centre for Recirculation in Aquaculture  and was aimed at evaluating the impacts of periodic low-dose oxidant exposure on the transcriptome of the nasal olfactory mucosa. This experiment was designed to mimic the use of the oxidant as a routine water disinfectant in a recirculating aquaculture system . Brieflyf salmon . Moreovef salmon . It was \u22121, salinity at 35\u2030, temperature at 12.0 \u00b1 1 \u00b0C, dissolved oxygen > 90% saturation, photoperiod at 24 L: 0 D, and a continuous feeding regime .Trial 2 was performed at Havbruksstasjonen i Troms\u00f8  and was designed to unravel the changes in the nasal transcriptome after repeated but less frequent exposure to higher doses of oxidant. PAA is currently being explored as a potential treatment for amoebic gill disease (AGD), a gill health issue affecting mostly seawater-adapted salmon ,7. The t\u00ae, ACD Pharmaceuticals AS, Oslo, Norway). Percussive stunning was avoided because it triggered the influx of blood to the head, including the olfactory epithelium. Olfactory organ was collected by opening the nostrils to expose the outermost section of the nasal mucosa. The rosette from the left side was then dissected out, immediately suspended in RNAlater\u2122 , kept at room temperature overnight for penetration, and then stored at \u221270 \u00b0C until RNA isolation. In Trial 1, olfactory rosettes (n = 8 per time-point) were collected before and 45 days  after the start of periodic oxidant exposure. In Trial 2, the tissue samples  were collected 24 h after the 3rd exposure.All fish for sampling were humanely euthanised with an overdose of either Tricaine methanesulfonate  or Benzocaine  gradient. The tubes were then centrifuged for 30 min at 400\u00d7 g at 4 \u00b0C. The cell layer between the gradients was carefully transferred to a tube with modified L-15 medium, centrifuged for 10 min at 400\u00d7 g at 4 \u00b0C, and suspended in new modified L-15 medium. Cell viability and number were determined by CellCountess\u2122 II . The cells were seeded out onto a 12-well plate  at a density of 2 \u00d7 105 cells per well and incubated at 13 \u00b0C.Leukocytes from olfactory organ were isolated from 15 freshwater-adapted salmon (ca. 80\u201390 g) with similar genetic background, following a previously published method , with sl2O2, and 100 \u00b5M AA\u2014for 30 min. The concentrations were based on several preliminary in vitro trials and the concentrations were selected because they were able to trigger significant increase in intracellular ROS, thereby providing an indication that the internal redox balance had been altered by the tested oxidants. Each treatment group had four independent wells. Untreated cells served as controls and were handled similarly to the treatment groups, though no chemical stressor was added. After 30 min, the media were removed, cells were washed gently with modified L-15, and 300 \u00b5L of the same media was added to each well. After 24 h, the media were removed. The cells were suspended in lysis buffer  and scraped, and the cell suspension was stored at 70 \u00b0C until RNA isolation.The cells were allowed to adhere for 48 h before the exposure was performed. The leukocytes were exposed to three chemical stressors at physiological concentrations\u2014100 \u00b5M PAA, 100 \u00b5M H\u00ae, CellBIND\u00ae Surface, Sigma-Aldrich, Oslo, Norway) at a density of 105 cells per well. After the cells were allowed to settle and adhere for 24 h, they were exposed to PAA, H2O2, and AA at a physiological concentration of 100 \u00b5M for 30 min and washed. New media were added and the exposed cells were allowed to recover in the incubator. Unexposed cells, serving as controls, were likewise washed, and new media were added. Cell proliferation (proxy for cytotoxicity) was measured using the CyQUANT Direct Proliferation Assay  24 and 48 h after the challenge. Each treatment group, including the unexposed control group, had six replicate wells. Rate of proliferation was expressed relative to the control group of that time-point.Nasal leukocytes were isolated from 12 freshwater-adapted salmon (ca. 80\u201390 g) following the method described in 2O2, or AA in a final concentration of 100 \u00b5M. Wells with L-15 medium containing 10% FBS served as the positive control for chemotaxis while L-15 medium alone was designated as a negative control. Each treatment, including the controls, had been assigned three wells. Thereafter, the cells were added to the upper receptacle of the migration chamber at a density of 2 \u00d7 105 cells. The migration chamber was incubated for 24 h at 13 \u00b0C before the migratory cells were dislodged from the membrane, lysed and labelled with CyQuant\u00ae GR dye solution , and fluorescence was read at 480 nm/520 nm.The effects of the chemical stressors on cellular migration were determined by the CytoSelect\u2122 Cell Migration Assay kit . Freshly isolated nasal leukocytes were suspended in modified L-15 medium without serum. The lower receptacle of the migration chamber was added with L-15 media containing either PAA, HNasal leukocytes were isolated, cultured, and treated with the chemical stressors as described in detail in \u00ae 2100 Bioanalyzer\u2122 RNA 6000 Nano kit . All samples had an RNA Integrity Value higher than 8.8.The RNA from both olfactory tissues and nasal leukocytes were isolated using Quick-RNA\u2122 Microprep kit . RNA concentration was measured in a NanoDrop 1000 Spectrophotometer , and the quality of the samples for microarray was further assessed using an Agilentelongation factor 1a (eef1a), acidic ribosomal protein (arp), and \u03b2-actin (actb) [A High Capacity RNA-to-cDNA Reverse Transcription kit  was used to prepare the complementary DNA from the nasal leukocyte samples using 300 ng RNA input following a synthesis protocol of 25 \u00b0C for 10 min, followed by 37 \u00b0C for 120 min and then 5 min at 85 \u00b0C. The expression of selected antioxidant defence, cytokines, and heat shock protein genes  was quann (actb) .Olfactory rosettes from Trials 1 and 2 were subjected to microarray analysis using Nofima\u2019s Atlantic salmon DNA oligonucleotide microarray SIQ-6 , which contains 15\u2009K probes for protein-coding genes involved in immunity, tissue structure, integrity and functions, cell communication and junctions, and extracellular matrix, amongst many others . Agilentp < 0.05).The significant difference in the transcript level of the target marker genes between before and after periodic oxidant exposure in Trial 1 and between the unexposed-control and oxidant-exposed groups in Trial 2 was determined by Student\u2019s t-test for independent samples; the threshold of differential expression in microarray analyses was 1.75-fold. The level of significance was set at 5% , with a level of significance set at c-c motif chemokine 28, interleukin 13 receptor alpha-2, defensin beta 4, ig heavy chain, and mannose-specific lectin-like, were all downregulated after 45 days of oxidant exposure. Two genes encoding cytokeratins were downregulated. Three out of four genes with metabolic functions were likewise downregulated.After 45 days of periodic low-dose oxidant exposure, microarray analysis identified 32 differentially regulated genes (DEG) in the nasal olfactory rosette . The numkeratin and plekstrin were likewise upregulated. A similar effect was observed on genes encoding extracellular proteins . Several genes involved in various metabolic pathways were represented in the DEGs panel, such as those involved in amine, amino acid, calcium, and xenobiotic metabolism. A total of 3/4 DEGs of lipid metabolism were downregulated following oxidant exposure. Exogenous oxidant exposure upregulated the expression of genes with function in cellular processes such as DNA replication, signalling, and protein folding/modification including the heat shock proteins. Oxidant-induced changes in cellular redox balance were likewise manifested with two DEGs.Sixty-two DEGs were identified in the olfactory rosettes from fish exposed to an oxidant on three occasions, 56 of which, accounting for 82% of the DEGs, were upregulated . From th2O2 and AA  is a predominant component in erythrocytes responsible for oxygen transport to the different tissues in vertebrates . The Hb e stress ,33. Expoe stress . The upre stress ,35. Suche stress . This pae stress ,37.ornithine decarboxylase, a gene coding for an enzyme responsible for catalysing the conversion of ornithine to putrescine, the first and rate-limiting step in the synthesis of putrescine and the polyamines spermidine and spermine [spermidine/spermine N1-acetyltransferase 1, a key molecule in amine metabolism, and with a counteractive function against oxidative stress, was significantly upregulated too. Increased expression of ornithine decarboxylase had been demonstrated in human hepatoma HUH7 cells subjected to chemically induced oxidative stress [hsps in the nasal mucosa following oxidant exposure suggests intervention in oxidative stress-triggered changes by correction of conformation or selecting and directing aberrant proteins to the proteasome or lysosomes for degradation, in which these molecules are known to be key regulators. Besides the activation of several effector molecules that provide an interconnected response to oxidant-triggered oxidative stress, it is compelling to observe that several genes for molecules for cytostructural and extracellular matrix were represented in the list of upregulated genes. Previous studies using this oxidant found histostructural changes, though minimal, in the gill and skin mucosa [GMP giant mucus protein and mucin 5b, implies that mucus physiology is affected by the oxidant and that the changes in these two genes underline their function in providing a layer of protective defence at the mucosa. Two related genes have been shown to participate in modulating the mucus layer of the olfactory epithelium in mammalian models [Trial 2 provided a relatively clearer picture of how an oxidant administered at a higher dose, but less frequently, altered the nasal transcriptome as shown with a higher number of DEGs and a prominent regulatory profile. It was evident that oxidant treatment resulted in dysregulation of nasal redox balance, and hence triggered mucosal oxidative stress. In earlier publications, we have demonstrated that antioxidant defences in mucosal tissues  were remarkably altered by a similar oxidant though delivered at a much lower concentration ,7. The mspermine . It is ie stress . The upre stress . There ae stress ,7,27,28.n mucosa ,27,42. Wn models ,44, and n models ,46. The 2O2-exposed cells. This indicates that the effects on cellular proliferation following PAA and H2O2 stimulation could be transitory, and the cells were able to recover quickly. AA was more potent in inhibiting cellular proliferation, as the effects persisted until 48 h. Nasal olfactory leukocytes exhibited migratory potential, as all factors resulted in migration of the cells, though at varying levels. Cell migration plays an important role in many normal biological and pathophysiological processes, and oxidants can either promote or inhibit migration [2O2 administered individually and not in mixture with PAA and AA modulated the migration of the nasal olfactory leukocytes, suggesting its potent chemoattractant function, as demonstrated by earlier studies in other animal models [We then focused on one specific cell type at the nasal mucosa to investigate how the cells respond to the oxidant, as well as to the two other constituents of PAA trade products. The proliferation of nasal olfactory leukocytes was affected by the three chemical stressors 24 h after exposure at an almost similar rate. However, such an influence was no longer observable 48 h after exposure in PAA- and Higration . H2O2 adl models ,48. The If the oxidants triggered changes in the cellular phenotypic response , can they also induce oxidative stress? The oxidant used had been shown to prompt oxidative stress at the systemic [2O2 and AA have long been identified as inducers of oxidative stress [2O2 were far more potent inducers of intracellular ROS production than AA in nasal leukocytes. Interestingly, for both PAA and AA, induction of intracellular level was transient because, after an elevated level 24 h after exposure, the concentration returned to the normal/control level. This was not observed in H2O2-exposed cells; their intracellular ROS was still at an elevated level 48 h after exposure, though the level was slightly lower compared to that at 24 h. This indicates that cells exposed to PAA and AA have a faster capability to abate an increased intracellular ROS level than H2O2-exposed cells, which further suggests that H2O2 has a higher and more persisting impact as an oxidative stressor on the nasal leukocytes. Different oxidants could trigger different mechanisms of oxidative stress induction [We further asked: systemic  and tisssystemic ,7 levelse stress ,48,49. Hnduction ,50, and 2O2 were more potent triggers than AA, which, to some extent, is in agreement with the results in terms of how the oxidative stressors affected the intracellular ROS level. Antioxidant markers gpx, gr, gsta, and cat were perhaps the key response molecules, as their expression was significantly elevated in at least one time-point in PAA- and H2O2-exposed cells. The response profile can be divided into two arbitrary groups based on their elevated temporal expression \u2013 early  and late  oxidant responders. Glutathione peroxidase metabolises H2O2 to H2O, and the reduced glutathione provides an antioxidant function by resetting the redox status in tissues [Gpx has been implicated in the responses of fish to environmental toxicants that can trigger oxidative stress [gpx expression in the gills and skin of salmon; hence, the results provide further evidence that it is a vital molecule for the mucosal antioxidant system in this fish species [glutathione reductase gr was upregulated both in the cells and as one of the DEGs identified in Trial 2. Gr, as an antioxidant, is responsible for the regeneration of reduced glutathione during detoxification of peroxides and free radicals formed in mitochondria, thus maintaining the redox potential of the cell [gr in both instances, as well as in previous oxidant studies in salmon [gpx and cu/zn sod were responsive.The increased intracellular ROS incited by the three chemical stressors initiated a response from the antioxidant system of the nasal olfactory leukocytes. The expression of enzymatic antioxidants was predominantly upregulated, indicating their key role towards the threats of the oxidative stressors. The overall expression profile of these antioxidant genes shows that PAA and H tissues . Gpx hase stress , and thi species . It is ithe cell . The uprn salmon ,10, provil1b expression was modulated by PAA and H2O2 24 h after exposure. An earlier publication reported that increased IL-1\u03b2 stimulated glutathione production, thereby protecting neurons from oxidative damage [il1b and the two genes of glutathione metabolism offer a potential link. In Trial 2, we have identified several cytokines genes that were upregulated following the oxidant challenge. It is possible that this increase in expression facilitated the migration of inflammatory cells to the epithelial surface where the oxidant was in close contact. One of the areas that must be explored in the future is the early phase of the inflammatory response, which was not captured by the current data. Both hsp70 and hsp90 were significantly upregulated in the olfactory rosette in Trial 2, but a similar change in the cell experiment could not be observed. The mode of oxidant application may play in part in this apparent difference.The overall profile in the expression of cytokine markers and heat shock protein genes could not be conclusively established, though the stochastic changes provide insights into how oxidative stressors may likely influence these molecules. The relationship between oxidants and inflammatory response is well-established in mammalian systems , though e damage . The preFish encounter environmental oxidants during production, as several husbandry practices rely on the use of oxidative chemical compounds, such as during water disinfection  or disea"}
+{"text": "P <\u2009.05). In ENKTL patients, levels of PD\u2010L1 mRNA and soluble PD\u2010L1 were related to disease stage, level of lactate dehydrogenase, lymphocyte count, and copies of Epstein\u2010Barr genome in blood. Levels of PD\u2010L1 mRNA and soluble PD\u2010L1 were similar between healthy volunteers and ENKTL patients who showed complete remission after treatment, and uni\u2010 and multivariate analyses identified soluble PD\u2010L1 as a predictor of treatment response in ENKTL patients. Our results suggest that the levels of PD\u2010L1 mRNA in PBMCs and soluble PD\u2010L1 in plasma are useful for ENKTL staging and prediction of treatment response.Appropriate biomarkers may help predict patient response to treatment for extranodal natural killer/T\u2010cell lymphoma (ENKTL), a subtype of non\u2010Hodgkin's lymphoma in China. Programmed cell death receptor 1 (PD\u20101) and its ligand (PD\u2010L1) have been investigated in various tumors. However, few studies have addressed expression of PD\u20101/PD\u2010L1 in peripheral blood of ENKTL patients. To identify novel peripheral blood biomarkers for diagnosis and treatment of ENKTL, we retrospectively examined 89 healthy volunteers, 49 patients with ENKTL and 74 patients with diffuse large B\u2010cell lymphoma treated at West China Hospital from September 2017 to September 2018. Both patient groups showed significantly higher expression of PD\u20101 and PD\u2010L1 on CD4+ T cells, higher levels of PD\u2010L1 mRNA in peripheral blood mononuclear cells (PBMCs) and higher levels of soluble PD\u2010L1 in plasma than healthy volunteers ( Two studies have reported that elevated levels of soluble PD\u2010L1 (sPD\u2010L1) in serum correlate with poor prognosis in ENKTL.Therefore, we examined the expression of PD\u20101/PD\u2010L1 on circulating lymphocytes as well as levels of PD\u2010L1 mRNA in peripheral blood mononuclear cells (PBMCs) and sPD\u2010L1 in plasma in ENKTL patients. Our results show that the levels of PD\u2010L1 mRNA in PBMCs and sPD\u2010L1 in plasma are useful for ENKTL staging and prediction of treatment response. The same results were not obtained for patients with another type of lymphoma, diffuse large B\u2010cell lymphoma (DLBCL), suggesting that the two biomarkers may show some specificity for ENKTL.22.1This retrospective study involved 49 patients with ENKTL and 74 with DLBCL who were initially treated at West China Hospital from September 2017 to September 2018. Diagnosis was made according to the 2008 WHO Classification of Hematopoietic and Lymphoid Tissue Tumors.All 49 ENKTL patients received chemotherapy, 26 of whom were administered at West China Hospital. From these 26 patients we again sampled peripheral blood after two courses of chemotherapy. Treatment response was categorized as complete remission (CR), partial remission (PR), stable disease (SD), or disease progression (PD).2.2erythrocyte lysis solution, washed twice with phosphate\u2010buffered saline (PBS), and incubated in the dark at 4\u00b0C for 15\u2009minutes with antibodies  against CD4 (conjugated to the fluorophore APC), CD8 (PE\u2010Cy7), PD\u20101 (FITC), or PD\u2010L1 (PE). The samples were washed twice with PBS, resuspended in 300\u2009\u03bcL PBS, and examined by flow cytometry . Data were analyzed using FlowJo X 10 software (Beckman Coulter).Blood aliquots (500\u2009\u03bcL) were transferred to a 1.5\u2010ml Eppendorf tube, treated with ACK 2.3Blood aliquots (500\u2009\u03bcL) were centrifuged at 3000\u2009rpm to separate plasma from cellular components (lower layer). The upper plasma layer was transferred to a fresh tube and frozen at \u221280\u00b0C for subsequent sPD\u2010L1 assay (see below). PBMCs were separated from the lower cellular components by Ficoll density gradient centrifugation, mixed with 1 mL of Trizol reagent  and stored at \u221280\u00b0C until assay. RNA was extracted from thawed samples using a Nanodrop spectrophotometer  and 1 \u03bcg of total RNA was reverse\u2010transcribed into cDNA in a 20\u2009\u03bcL reaction using of a reverse transcription kit .2.4\u2212\u2206\u2206Ct method and normalized to levels of \u03b2\u2010actin mRNA. Each test was performed in triplicate.Levels of mRNA encoding PD\u20101 or PD\u2010L1 were measured by quantitative RT\u2010PCR using quantitative PCR kits . The following primers were designed to target the PD\u20101 or PD\u2010L1 transcript (NCBI Sequence Database). PD\u2010L1 forward, 5\u2032\u2010CTATGGTGGTGCCGACTACA\u20103\u2032, PD\u2010L1 reverse, 5\u2032\u2010TGCTTGTCCAGATGACTTCG\u20103\u2032, and PD\u20101 forward, 5\u2032\u2010GCGTGACTTCCACATGAGC\u20103\u2032, and PD\u20101 reverse, 5\u2032\u2010GCAGGCTCTCTTTGATCTGC\u20103\u2032. Reactions were cycled 39 times on a CFX Manager Detector  with pre\u2010denaturation at 95\u00b0C for 15\u2009minutes, denaturation at 94\u00b0C for 15\u2009seconds, annealing at 55\u00b0C for 30\u2009seconds, and extension at 70\u00b0C for 30\u2009seconds. Relative levels of PD\u20101 or PD\u2010L1 mRNA were calculated by the 22.5Plasma fractions obtained as described above were thawed and assayed for sPD\u2010L1 using the Human PD\u2010L1 ELISA kits , which has a manufacturer\u2010specified minimal detectable concentration of 2.91\u2009pg/mL. First, samples were added to microplates pre\u2010coated with anti\u2010PD\u2010L1 monoclonal antibodies. After washing out the reagent and unbound antibody, TMB substrate was added to the wells, which were incubated for 10 minutes. Then stop solution was mixed to prevent blue color development, and the color changed to yellow. Absorbance at 450\u2009nm was measured immediately using a microplate reader . Each test was performed in duplicate.2.6U test. Levels of PD\u20101 and PD\u2010L1 on CD4+ or CD8+T cells, as well as levels of PD\u2010L1 mRNA and sPD\u2010L1 were expressed as median and interquartile range (IQR). Differences between groups were assessed for significance using the Kruskal\u2010Wallis test. For the subset of patients sampled at diagnosis and after two treatment courses, we assessed differences in levels of PD\u2010L1 mRNA or sPD\u2010L1 using the Wilcoxon matched\u2010pairs signed rank test. Univariate analysis to identify predictors of treatment response was performed using the Mann\u2010Whitney U test for continuous variables or chi\u2010squared test for categorical variables. Variables that were significant in univariate analyses were entered into a binary logistic regression multivariate model. Correlations between variables were analyzed using Spearman rank correlation. Differences associated with a two\u2010sided P\u2009<\u2009.05 were considered significant.Data were analyzed using SPSS 24.0  and GraphPad Prism 6.0 software . Differences between groups in baseline clinical characteristics were assessed for significance using the Mann\u2010Whitney 33.1Baseline clinical characteristics of patients with ENKTL or DLBCL are summarized in Table 3.2r = 0.3466, P = .0147, Figure P =\u2009.0208, Figure P =\u2009.0161, Figure r = 0.3207, P = .0247, Figure r = 0.3055, P = .0328, Figure r = \u22120.3958, P = .0049, Figure Flow cytometry Figure  showed t3.3P\u2009<\u2009.001] and DLBCL patients  than in healthy controls [0.77 (0.56\u20100.96)] , ] Figure . Levels 3.4P\u2009<\u2009.0001] or DLBCL  than in healthy controls . The post\u2010treatment levels of both biomarkers were similar to those in healthy controls.Of the 26 ENKTL patients for whom we had blood samples after two courses of treatment, 16 showed CR; 5, PR; 3, SD; and 2, PD. In the CR subgroup, levels of PD\u2010L1 mRNA in PBMCs were significantly higher before treatment than after  or sPD\u2010L1 in plasma . The post\u2010treatment levels of both biomarkers were significantly higher than in healthy controls  vs 1.27(0.81\u20102.74), s Figure .P = .0085, Table P = .0168) and Ki\u201067 index (P = .0027). In multivariate analysis, however, only Ki\u201067 index varied significantly with treatment response (P = .013).Univariate analysis showed that ENKTL patients with high sPD\u2010L1 levels at diagnosis were more likely to achieve CR . Participants provided written consent for their anonymized clinical data to be used and published for research purposes.The authors declare no conflicts of interest."}
+{"text": "All the patients have already been delivered 10000 shockwaves of total seven treatment points twice a week for 4 weeks. Simultaneously, questionnaires of International Index of Erectile Function-Erectile Function (IIEF-EF), Erectile Hard Score (EHS) and Minimal Clinical Important Differences (MCID) were evaluated for the efficiency and safety at 8th and 16th weeks.The changes in the IIEF-EF score by MCID suggested that Li-ESWT treatment was effective in 22 PDE5i nonresponders patients (58%) at 8th week. Then at 16th week the number of patients who were effectively treated increased to 27 (71%). Among PDE5i responders, 5 patients (71%) were effective base on MCID at 16th week. Among PDE5i nonresponders 22 patients (58%) achieved erection hard enough for vaginal penetration and increased to 27 (71%) patients at 16th week (EHS \u22653). Moreover, even 3 patients achieved EHS 4 in PDE5i nonresponders at 16th week. Among PDE5i responders, 4 of 7 patients reached EHS of 4 from EHS 3 at 16th week. Apart from this, Li-ESWT treatment was also effective in 9 patients (24%) in PDE5i nonresponders without follow-up PDE5i.Energy flux density (EFD) of 0.05 of Li-ESWT could improve the erectile function of ED patients with PDE5i response. In addition, EFD of 0.05 of Li-ESWT treatment could turn PDE5i nonresponders to responders.To evaluate the efficiency of an energy density of 0.05mj/mm Erectile dysfunction (ED) is a male sexual dysfunction defined as a consistent or recurrent inability to attain or maintain an erection sufficient for sexual intercourse   . The cuA novel method to prevent the deterioration of erectile function due to these pathophysiologic processes is desperately needed. Animal studies have demonstrated neoangiogenesis in myocardial tissue and skin flaps, which invites the hypothesis that erectile dysfunction of vascular origin could be treated by Li-ESWT   - 8 . Pr2 of shockwaves after Vardi et al.  of 0.09mj/mm et al.    first ral.  impaired erectile function, enhancing penile angiogenesis and regain of blood circulation in PVNI rat model. EFD of 0.05mj/mm2 of Li-ESWT could activate local penile progenitor cells of rats and contribute to the beneficial effects of shockwave treatment for erectile dysfunction, which represents a non-invasive alternative to exogenous stem cell therapy  of Li-ESWT for ED. To our knowledge this is the first clinical study that evaluated efficacy and safety after an energy density of 0.05mj/mm2 of Li-ESWT in men with ED.Thus, we investigated and monitored the treatment of different EFD . The study is listed in Chinese Clinical Trial Registry (ChiCTR-IIR-17011554). An independent clinical research unit monitored the research process.Patients complaining of ED during a consultation at our outpatient clinic for other indications also were offered participation in the trial. Inclusion criteria included: 1) Accord with ED; 2) Stable heterosexual relationships at least 3 months before treatment. Exclusion criteria were: 1) Patients who had radical prostatectomy or pelvic surgery before; 2) Any condition that may not be compatible with the completion of treatment, as judged by a doctor, such as an unstable mental condition that is not controlled by drugs, spinal cord injury, penile anatomical abnormality, excessive obesity; 3) Patients with penile prosthesis; 4) Patients who have recovered from cancer in the past year or who have serious illnesses of vital organs; 5) Serious hematomas; 6) Venous leakage, diagnosed by cavernosography; 7) Anti-androgen, oral or injected androgen; 8) After pelvic radiotherapy; 9) Coagulation dysfunction or the use of anticoagulants (such as coumarin); 10) Participated in any other medical device or drug clinical investigator in the past three months; 11) Other patients who were considered not suitable in this trial.th week. Finally only the questionnaires  were assessed at 16th week. PDE5i nonresponders received 25mg of sildenafil after Li-ESWT treatment and before assessment at 8th week and 16th week. Details are listed in When subjects met the inclusion criteria and returned a signed consent form, they could enter the trial. All subjects consented not to use additional erectile dysfunction treatment outside this study protocol during the treatment. They who previously have used PDE5i should underwent a 4-week washout period before the Li-ESWT treatment. Each study patient had abnormal 2-night Nocturnal Penile Tumescence (NPT) parameters at screening. Serum glucose, lipid profile, and total testosterone level as well as several validated sexual function questionnaires including International Index of Erectile Function-Erectile Function (IIEF-EF), Sexual Encounter Profile (SEP), Erection Hardness Score (EHS), were assessed at baseline. These indexes except NPT and the questionnaire Global Assessment Questions (GAQ) were performed again at 82 . We applied a standard commercial gel normally used for sonography without any local anesthetic effect on the penis and perineum, and the penis was stretched manually. All patients were treated twice a week and the treatment course was 4 weeks, comprising of 10.000 shockwaves delivered to seven treatment points at two sides of the distal and proximal penile shaft (1600 shockwaves to each position), and corporal bodies on the perineum (1200 shockwaves to each crura and in between). The 10.000 shocks for 7 foci at an energy density of 0.05mJ/mm2 and a frequency of 200/min were delivered according to the manufacturer\u2019s guidelines. Each treatment session lasted 50 min. The shockwave generator implemented in our study has been used in the treatment of tenosynovitis and tendonitis. During the treatment period, patients were required to maintain their normal sexual habits if they could. PDE5i nonresponders who were prescribed sildenafil were observed after treatment of 4 weeks of as-needed, flexible-dose treatment with sildenafil citrate at the recommended initial dose of 25mg.Shockwaves were applied to the corporal cavernosa using a focused shockwave source with lower energy density of 0.05mj/mmth and 16thweeks, which represented 4 and 12 weeks after completion of treatment, change from baseline for IIEF-EF score. Secondary outcome measures included the interval change of EHS, SEP and GAQ, as well as adverse events from Li-ESWT therapy. Treatment success was defined as EHS 3 or greater, which indicated that the erectile function was hard enough for vaginal penetration. Furthermore, we evaluated an improvement on IIEF-EF according to Minimal Clinical Important Differences (MCID) criteria, at least 4 points improvement for ED patients  was used to analyze the data. The results were expressed as median (interquartile range IQR). The values of the study variables were compared using the Student t-test or Wilcoxon signed-rank test, as appropriate. A Fisher\u2019s exact test was applied to measure the levels of EHS or the questionnaires GAQ and SEP. The level of significance for all analyses was p <0.05.th week follow-up examination the median IIEF-EF score increased from 10 (IQR 8-11) at baseline to 15 (IQR 12-16) in PDE5i nonresponders group and from 16 (IQR 16-18) to 21 (IQR 20-22) in PDE5i responders. Moreover, at 16th week, the score increased to 16 (IQR 14-17) in PDE5i responders and still 21 (IQR 20-23) in PDE5i nonresponders.45 patients were recruited into this trial, including 7 PDE5i responders and 38 nonresponders patients. th week, and 16thweek, respectively ( thweek and increased to 27 patients (71%) at 16th week. In PDE5i responders, 5 patients (71%) were effective based on MCID at 16thweek ( The median change after treatment in IIEF-EF score in the PDE5i responders and nonresponders were 5 (IQR 4-6), 6 (IQR 4-7)  and 5 (IQR 1-6), 6 (IQR 1-6)  at 8ctively   . Accord6thweek   .thweek  PDE5i nonresponders marked \u201cYes\u201d in both GAQ 1 & 2 and 25 patients (66%) marked \u201cYes\u201d in both SEP 2 & 3 vs. 4 or 5 of 7 patients in PDE5i responders in GAQ & SEP, respectively ( In PDE5i nonresponders 22 patients (58%) achieved erection hard enough for vaginal penetration and increased to 27 (71%) patients at 16th week   . 9 patith week   . At 16tctively   . No adv2 of Li-ESWT treatment for ED patients who do not respond to PDE5i is largely unsuccessfully  with or without PDE5i. In PDE5i responders, though the sample size is small, 70% of them were able to have intercourse without medication after Li-ESWT treatment. The improvement of erectile function was found in from 82 of Li-ESWT; we use lower EFD of shockwave but more treated points and more number of shocks. The feasibility and safety have been reported in relevant animal trials. Li et al.  positive nerve fibers coinciding with recruitment of endogenous progenitor cells. In a porcine model of skin burn, Goertz et al. ( 2 of Li-ESWT has a better capacity in angiogenesis and blood flow than other intensity of EFDs. In other similar studies, Lin G and his colleagues investigated the effects of 0.057mj/mm2 of EFD and less of it of Li-ESWT in Sprague-Dawley rats. The above scientific research led to the assumption that Li-ESWT also might be beneficial in activating penile progenitor cells in the corpora cavernosa of vasculogenic ED patients ( 2 of Li-ESWT on ED, though the level of EFD has the pathological potential to improve erectile function.This is the first application of EFD of 0.05mj/mm et al.    reporte et al.    demonstatients   , 19 . I2 and a frequency of 120/min. It showed that Li-ESWT had a positive short-term clinical physiological effect on erectile function and about 50% of patients got spontaneous erection sufficient for sexual penetration. In our present study, we prefer to 1200 or 1600 shocks were delivered to per treatment point at an energy density of 0.05mj/mm2 and a frequency of 200/min, and each session included 10000 shocks and twice a week for 4 week. Our study used shockwave generated electromagnetically and the machine was manufactured in China. The present study and the studies by Vardi are not completely comparable owing to differences in the number of patients, treatment sites, total number of treatments (the Vardi group used This study is in contrast to trial first reported by Vardi et al.   . In theThe mechanism of action that leads to improvement in IIEF-EF scores in men treated with Li-ESWT has not been elucidated completely. The basis for its use is the notion that it could regenerate microvasculature and improving penile hemodynamics. It could induce the release of endothelial or neuronal NOS, vascular endothelial growth factor and proliferating cell nuclear antigen. Studies on the effect of Li-ESWT on penile tissue in rats have shown improvement in erectile function and regeneration of endothelium, smooth muscle, and nerves expressing neuronal nitric oxide synthase   , 21 . S2 level of EFD of Li-ESWT for ED patients. The effective rate is about 70%, higher than other EFD of Li-ESWT. As expected and akin to published data, 0.05mj/mm2 of Li-ESWT appears to be safe and effective in our present study. All of present patients in this study completed the treatment course with no discontinuations and no patient reported penile pain, bruise or others during subsequent follow-up visits.To our knowledge, this is the first application of 0.05mj/mm2 of Li-ESWT on ED patients, the number of patients is relatively small. Also the number of patients enrolled in this study was too small to have multivariate analysis. This study did not cover comparisons between different energy densities, such as 0.09mj/mm and 0.05mj/mm. Therefore, the effects of two energy density shock wave treatments cannot be directly compared. Also this is not a controlled study. Further studies with a longer follow-up and a large sample are required to generate a more suitable protocol and optimal level of EFD of Li-ESWT.One limitation of this study is the lack of penile haemodynamic or other objective measurements. We have tested NPT prior to treatment but lack of comparison of change before and after intervention. However, Vardi et al. concluded that NPT is not suitable to be used as an investigative tool due to difficulties in interpreting the results in terms of meaningful parameter changes and changes in penile hemodynamics   . Anothe2of Li-ESWT for ED patients is effective, even part of patients could achieve full erection of EHS of 4. The PDE5i nonresponders became drug-sensitive after EFD of 0.05mj/mm2 of Li-ESWT treatment, which meant that after Li-ESWT they were able to achieved a good erection using PDE5i. In PDE5i responders, they were able to have intercourse without medication. Although these are preliminary results, it is expected to be an alternative option for PDE5i nonresponse ED patients for physicians. Additional studies with large sample sizes, longer term studies are required to establish the clinical impact of Li-ESWT.EFD of 0.05mj/mm"}
+{"text": "To explore how pictorial information on subclinical atherosclerosis affects GPs\u2019 perception of patient cardiovascular disease (CVD) risk, their communication with patients, and GPs\u2019 attitude to the treatment of CVD risk factors.Fifteen individual interviews were conducted between March 2014 and December 2016, with GPs who had received pictorial information regarding their patients\u2019 subclinical atherosclerosis. The pictorial information was also received by the patients together with written information regarding atherosclerosis and CVD risk prior to the appointment with their GP. The interviews were recorded, transcribed and analyzed using qualitative content analysis.Increased knowledge makes a difference: When patients had more in-depth knowledge regarding atherosclerosis, the consultation became more patient-centered and moved towards shared decision making. This is real, not just a number: GPs described their risk assessment and the patient\u2019s risk perception as more accurate with pictorial information about subclinical atherosclerosis. How to deal with the result \u2013 A passive to active approach: Some GPs acted promptly on the pictorial information while others took no action.Three categories were identified in the analysis. Pictorial information regarding patients\u2019 subclinical atherosclerosis affected GPs\u2019 assessment of CVD risk. The communication shifted towards shared decision-making although the GPs\u2019 attitude to the result and treatment of CVD risk factors varied. Informing patients about examination results, both in writing and pictures, prior to a consultation can facilitate shared decision making and enhance preventive measures.https://clinicaltrials.gov/ct2/show/NCT01849575.Providing pictorial information about carotid ultrasound results and information regarding atherosclerosis to GPs and patients affects primary prevention:\u2022Informing patients about examination results prior to a consultation can be useful in clinical practice to enhance preventive measures\u2022GPs experienced that increased patient knowledge resulted in a more patient-centered consultation and improved shared decision-making\u2022GPs described their risk assessment and patients\u2019 risk perception as more accurate with pictorial information about subclinical atherosclerosis Cardiovascular disease (CVD) is the leading cause of death worldwide . CVD is In GP consultations, graphical presentation of data could facilitate and save time in communicating risk . PhysiciAn additional strategy to conventional risk factor-based assessment would be to assess and communicate CVD risk in pictorial form based on the prevalence and extent of the patients\u2019 subclinical atherosclerosis. Subclinical atherosclerosis can be detected by ultrasound of the carotid arteries. New automated ultrasound systems have been developed, making ultrasound examinations with high reproducibility feasible and cost-effective within community medicine .VIsualiZation of asymptomatic Atherosclerotic disease for optimum cardiovascular prevention \u2013 a randomized controlled trial nested in the V\u00e4sterbotten Intervention Program). Recently published 1-year follow-up data provides evidence of the contributory role of pictorial presentation of subclinical atherosclerosis to reduce CVD risk [This study is part of the VIPVIZA trial  . Both prIn VIP, all V\u00e4sterbotten residents are invited to their local primary care center during the year in which they turn 40, 50 or 60\u2009years, in order to undergo CVD risk factor screening, together with individual counseling and a health promotion discussion with trained nurses. On thisn\u2009=\u200922, as compared to included n\u2009=\u20093532). In the case of technical problems, difficulties in evaluating the images or confirming suspected carotid stenosis, the patient may also undergo an extended ultrasound examination; this was required for only a minority of patients. All ultrasound examinations followed a strict protocol with automated IMT measurements at predefined angles. The presence of plaque was defined at the occasion of examination [All participants underwent a carotid ultrasound examination with portable ultrasound equipment to detect plaques and measure cIMT. The method has previously been described in detail . Particimination . All parIn the intervention group, participants and their GP were informed of the extent and severity of the participants\u2019 atherosclerosis in pictorial form according to the VIPVIZA protocol . No infoThe information provided to the intervention group and their GPs included a stylized picture of the individual\u2019s carotid arteries. For each side, the presence of plaque was presented as a red circle, while a green circle indicated that plaque was not observed. A gauge presented the CIMT compared to a reference population, running from green  to red   Figure . In addiMoreover, GPs received a leaflet with a brief description of the VIPVIZA study and instructions to interpret plaques as \u2018very high risk\u2019 according to the SCORE system, the European Society of Cardiology (ESC) Systematic Coronary Risk Evaluation assessment model. The web address to the ESC guidelines for primary prevention of CVD ,14 was aA letter asking GPs to participate in this study was sent to health centers. Further recruitment was conducted via phone calls to GPs, consulting nurses or health care center superiors. To be included, the GP needed to have received ultrasound results for at least three different patients. The characteristics of participating GPs are shown in The first author (AB) conducted all interviews. AB had no relationship to any of the GPs. She introduced herself as a PhD student and GP in advance of the interview. Before the interviews began, the GPs were informed about their right to withdraw from the study at any time. This information was followed by general questions to ascertain the number of years practicing as a GP, whether the practice was urban or rural and the number of VIPVIZA results received. The GPs received no financial compensation for participation.https://clinicaltrials.gov/ct2/show/NCT01849575, literature review of the field and the author\u2019s clinical experience being a GP. The first question asked in all interviews was \u2018What is your experience of the VIPVIZA trial?\u2019 After the first three interviews, the guide was revised based on the initial analysis with one questions added (\u2018What do you remember from the VIPVIZA result?\u2019) and one question removed . The interviews were recorded and transcribed verbatim and analyzed using qualitative content analysis [The interviews lasted 25\u201345\u2009min and were conducted at a location selected by the GP. A semi-structured interview guide  was deveanalysis .The authors represented a multidisciplinary research team from the fields of general practice, public health and nutrition with 2\u201335\u2009years of experience in clinical work from different regions in Sweden. The first author (AB) is a PhD-student, KL PhD, MN associate professor and EF PhD. When the interviews were completed, each author read the text of the first four interviews and identified \u2018units of meaning\u2019 which were then condensed. The process of analysis included both na\u00efve reading of the transcribed interviews to obtain a sense of the whole and interpretation of the latent content of the interviews. An illustration of the analytical process is given in In the analysis of the interviews with GPs, three categories were identified; \u2018Increased knowledge makes a difference\u2019, \u2018This is real, not just a number\u2019 and \u2018How to deal with the result \u2013 From passive to active approach\u2019.Each category is described next.The patients received information and results from VIPVIZA before seeing their GPs. This was in general perceived as an advantage as the discussion was described as more profound since the patient had a more advanced knowledge regarding their CVD risk and atherosclerosis in general. With increased patient knowledge, the GPs found their role more consultative than instructive. The encounter became an issue of confirming and giving feedback, collaboration rather than just the GPs informing the patient of what to do.I ask, what information have you got from the study? Then I do not have to fantasize what to say, I get exact information from the patient. Then I give feedback to the patient. It is easier to give feedback than starting from scratch. It is something different compared to when beginning with patients that you have to motivate to change (GP5)They are more interested in knowing, many patients are up-to-date and are well-informed, they know what it is all about. They are positive in their attitude towards treatment, obviously, because they realize they are at risk (GP9)Some GPs emphasized that the patient should participate in their treatment and shared decision-making was mentioned as preferable. When the patient participated in VIPVIZA, GPs found that the attention was transferred from the doctor to the patient.So the consultation becomes reasoning between me and the patient: this is the information we have, these are the recommendations I give you on the basis of that information (GP2)When the patient had more knowledge, less time was spent on motivation. The GPs described most VIPVIZA patients as motivated to undertake preventive measures, although there were patients who did not make changes. This situation was familiar to the GPs and could sometimes cause frustration.Well it differs how they accept the result, some just put their head in the sand while others act by making changes (GP5)It is not up to me if they want to continue to live GP 9 continues I give them the tools, medications, information and so on. But for some, it goes in in one ear and out through the other. They don\u2019t care and those are the most difficult ones (GP 9)The GPs\u2019 perception of the patients\u2019 CVD risk was altered by the pictorial representation of the patients\u2019 results, which was considered valid and the consequences of refraining from preventive actions were clear.It is black and white, it is not just a high value (GP1)CVD prevention was considered important but difficult. GPs using the VIPVIZA result when communicating risk found it useful when they tried to reach out to and motivate their patients. The patients understood normal atherosclerotic disease progression and their own personal CVD risk more accurately than with normal care.Many patients accept this information in a way that makes you feel that you have reached them, they understand what it is all about (GP9)The GPs advocated lifestyle changes and pharmaceutical treatment of hypercholesterolemia and hypertension to prevent CVD. However, explaining the association between risk factors and atherosclerosis to patients was considered difficult. Some GPs considered the carotid artery images helpful when explaining the association between risk factors and atherosclerotic disease.I believe they think it is only high blood pressure and high cholesterol, that this does not mean much (GP1)I have more facts regarding their health, and if there is something atypical then I have this as support. I find it useful (GP9)In general, GPs regarded results showing the presence of plaque or a red indicator for CIMT to be more serious than their patients considered them. The GPs\u2019 explanation for this was that doctors were more likely to understand the clinical implications. The results were sometimes a surprise to the GPs and led to questions about why some individuals had more atherosclerosis than expected based on risk factors. The GPs\u2019 perception of the patient\u2019s risk often changed based on the result.Often it comes as a surprise to them and to me but I don\u2019t think they understand and interpret it the same way\u2026. They don\u2019t see it as seriously as I might do (GP9)Some GPs found that the straightforward information could cause stress and anxiety to patients. However, some degree of stress or anxiety was not necessarily considered to be a bad thing by the doctors, as the patients\u2019 motivation to behavioral change increased when the severity of atherosclerosis became clear.I experience an increased awareness regarding their treatment but there is also a small amount of patient anxiety, for better or worse. Increased anxiety can be good because you get more motivated to carry out your treatment (GP5)Some doctors met no reactions from patients while others encountered powerful reactions with fear and anxiety. After explaining the results and emphasizing that atherosclerosis is a modifiable process, the patient was empowered to make changes.One woman said, \u2013 My life is destroyed, I have found out that I am 10\u2009years older than I thought I was. It was a shock to her\u2026 but then the GP continued Well, at the end the patient still thought it was necessary. Painful but necessary (GP3)Some GPs were more prone to treat their patients pharmacologically when there were signs of atherosclerosis, particularly presence of plaques. Others hesitated, concerned that treating the patient would cause over-prescription.When I do traditional risk evaluation then I only have the patients\u2019 profile and values, I am more used to that. Now I am in a gray-zone, when you have more information than before and wants to act on it. But then you don\u2019t know if you do the correct thing or am I over-prescribing? (GP 6)The information made some GPs more proactive and was sometimes used as an instrument to motivate the patient to make lifestyle changes and to evaluate the need for medication.I have a more solid base on which to tell them and motivate them that their blood pressure needs to be regulated, therefore you need more medication. Physical activity and lipids are also important (GP5)When the patient\u2019s results were entirely green (i.e. low risk for CVD), then on-going preventive medication, if any, was not discontinued. The GPs argued that if the reason for treatment was once present and if there had been no side effects, a green result was considered to be, at least in part, the fruits of successful medication.You don\u2019t know if they are green because of successful treatment. If the patient feels good under treatment one should only say, or think, that this looks great (GP5)In general, the workload was heavy and a few GPs described being too short of time to look into the VIPVIZA results and act on them. Some healthcare centers had developed their own guidelines on how to deal with the VIPVIZA results, with nurses handling low/normal risk results, while high-risk results were handled by physicians. Others had made a collegiate decision not to change the pharmacological treatment based on the VIPVIZA result, arguing that VIPVIZA is research and results on hard endpoints were still not available. In general, GPs interviewed in the first year of VIPVIZA seemed to be more hesitant about the results and their role compared to the GPs interviewed during the third year.The main findings from this study were that a difference was made when both patients and GPs received a pictorial representation of the patient\u2019s subclinical atherosclerosis together with written information about the atherosclerotic process. When patients received the ultrasound result before the consultation, the consultation moved towards patient-centeredness and shared decision-making. The pictorial information about subclinical atherosclerosis had an impact on how GPs interpreted the CVD risk. GPs described their risk assessment, as well as patients\u2019 risk perception, as more accurate with pictorial information; the information was concrete, not just a number. Nevertheless, the GPs had different attitudes towards the treatment of risk factors based on the VIPVIZA results, from a passive to active approach.Our results suggest that receiving a result based on actual atherosclerosis as a complement to conventional risk factor assessment and information could be more informative and can enhance CVD preventive actions. This finding is in line with another study using coronary calcium scoring to demonstrate subclinical atherosclerosis . When paIt was in general considered positive that GPs and patients both received the pictorial information prior to the consultation. To receive a result based on actual atherosclerosis as a complement to conventional risk factor assessment and information could be more informative and can enhance CVD preventive actions. A Cochrane review regarding decision aids for people facing health treatment or screening decisions, found in four out of five studies that participants discussed the choice with the physician to a greater extent when exposed to the decision aid prior to the consultation . This suSeveral GPs stated that shared information had a beneficial impact on the communication and led to a more shared decision-making process. The information exchange became a two-way process , insteadThe pictorial result was in general considered clear and reliable. The graphic information regarding plaque and the color gauge relating CIMT to vascular age was recalled by most GPs as being of substantial benefit, \u2018not just a number\u2019. Other studies support the use of graphs and visual aids as a complement to numerical and verbal communication of risk  to optimMany GPs changed their practice in relation to the VIPVIZA report, while others were less pro-active. This is in line with the theoretical framework \u2018Diffusion of Innovations\u2019, which comprises those referred to as innovators, early adopters, late adopters and laggards. This theory concerns the conditions and processes by which people in a social system adopt an innovation . In geneIn conclusion, pictorial information regarding patients\u2019 subclinical atherosclerosis affected GPs\u2019 assessments of CVD risk. The communication shifted towards shared decision-making, although the GPs\u2019 attitudes to the result and treatment of CVD risk factors varied. We found that informing patients about examination results, both in writing and pictures, prior to a consultation can facilitate shared decision making and enhance preventive measures.GPs participating in this study were heterogeneous in terms of work experience, gender, practice location  and timing of the interview during the period of entry into the trial, which strengthened the credibility of the study . HoweverSaturation was determined by an abductive process where data collection and analysis were conducted alternately . The metTo provide pictorial information of subclinical atherosclerosis to patients and their GPs has the potential to improve the primary prevention of CVD and enhanced shared decision-making. The concept of sending test results and information regarding their condition to patients prior to the consultation is a new approach, to our knowledge rarely studied before. This approach could be applicable in several different clinical situations, for example, diabetes."}
+{"text": "Diabetic peripheral neuropathy (DPN) is the presence of symptoms and/or signs of peripheral nerve dysfunction in people with diabetes after the exclusion of other causes. It is associated with pain, paresthesia, sensory loss, muscle atrophy with fat infiltration, and muscular dysfunction typically starting distally in the feet and progressing proximally. Muscle deterioration within the leg and foot can lead to muscle dysfunction, reduced mobility, and increases the risk of disability, ulceration, and amputation. Exercise training is an established method for increasing the different components of physical fitness, including enhancing body composition and improving neuromuscular strength. A number of experimental studies have utilized exercise training to treat various impairments associated with DPN, such as nerve conduction velocity, pain tolerance, and balance. However, the broad spectrum of exercise training modalities implemented and differences in target outcome measurements have made it difficult to understand the efficacy of exercise training interventions or provide appropriate exercise prescription recommendations. Therefore, the aims of this review were to (1) briefly describe the pathophysiology of DPN and (2) discuss the effects of exercise training interventions on sensorimotor, metabolic, and physical functions in people with DPN. Diabetes mellitus remains one of the largest metabolic diseases in the world, having high prevalence in both developed and developing countries. As of 2019, approximately 463 million adults between the ages of 20\u201379 were living with diabetes across the globe while 4.2 million deaths had occurred as a result of diabetes. Moreover, an estimated 1 in 5 adults with diabetes are over the age of 65 ,9,10.A muscle\u2019s ability to respond to an exercise stimulus is likely related to the distal to proximal progression of vascular and nervous system disease associated with DPN. The vascular and nervous system mediators of neuropathic muscle adaptation that may be critical are muscle specific microvascular perfusion, glucose uptake, and neural drive. However, the current standard measures of these mediators are not precise or muscle specific. For example, (1) microvascular dysfunction from type 2 diabetes-associated peripheral neuropathy is not detected with common macrovascular assessments ; (2) muscle specific metabolic function is not adequately measured with whole body indices (homeostatic model assessment of insulin resistance score); and (3) muscle strength, a measure of motor neuropathy, is unable to decouple neural transmission from a muscle\u2019s intrinsic contractility. Different forms of exercise training, including traditional and circuit-based resistance training, have been shown to increase the aforementioned mediators in older adults with and without diabetes, but research done specifically on DPN patients is lacking ,15,16,17Diabetic peripheral neuropathy results from various biochemical perturbations and is categorized by widespread damage to the peripheral nerve fibers, which can lead to pain, foot ulcers, diminished mobility, impaired quality of life, and significant morbidity. The exact mechanisms behind the pathogenesis of DPN are still unknown due to the multifactorial nature of the disease; however, chronic hyperglycemia with a significant drop in insulin sensitivity seems to be at the forefront of DPN causes . Muscle A review by Schreiber et al.  describeAs hyperglycemia persists and further damage accumulates, dysfunction of the microvasculature  becomes a greater concern. The downregulation of glucose transport induces microvascular endothelial dysfunction, resulting in decreased nitric oxide availability, increased permeability, reactive oxygen species, and leukocyte adhesion . As micrFor this article, \u201cexercise\u201d will be defined as \u201cphysical activity that is planned, structured, repetitive, and purposive in the sense that improvement or maintenance of one or more components of physical fitness is an objective\u201d ,29. MoreThe authors searched four databases, CINAHL Plus, Google Scholar, PubMed, and Science Direct, for relevant literature, with the last search taking place on 21 June 2021. Additional articles were extracted from the references of the resulting studies. Search terms included \u201cdiabetic peripheral neuropathy\u201d  and \u201cexercise\u201d . Inclusion criteria for the review included full-text articles in English, experimental clinical trials with quantitative analysis, and interventions must be \u22654 weeks. Studies were excluded if they did not include patients with DPN, were observational in nature, or exercise (or exercise-based training or therapy) was not the primary experimental intervention modality with at least one group of subjects with DPN participating in the intervention. Of the 264 initially searched articles, a final total of 41 studies were included in the current review and can be seen in For many years, the idea of prescribing weight-bearing exercise was not generally accepted, with practitioners believing it to be unsafe for individuals with DPN. Mueller et al.  had 29 DNot all studies initiating these types of interventions produce the desired results. Sartor et al.  had 26 i1c, fasting blood glucose, low-density lipoproteins, triglycerides, systolic and diastolic blood pressure, and body fat percentage [Aerobic exercise is one of the most studied exercise modalities. It recruits large muscle groups to perform dynamic, rhythmic movements done over a prolonged period of time . Engagement in regular aerobic exercise sessions is typically done to improve endurance; however, it produces a wide range of additional health benefits. Increases in cardiorespiratory fitness is largely associated with a reduction in all-cause mortality, specifically from cardiovascular disease, and those with high levels of cardiorespiratory fitness have a greater level of habitual physical activity ,70,71,72rcentage . Though When designing an aerobic exercise training program, one major component is determining the exercise intensity; this becomes even more complex with working with people with DPN. Individuals with diabetes are at greater risk for having a heart attack or stroke due to increases in blood pressure and cholesterol levels ,77. In cResearch has supported that moderate to vigorous aerobic exercise prescription using heart rate (HR) metrics, such as percentages of maximum HR (MHR) or HR reserve (HRR), may be an effective method for improving the signs and symptoms of DPN in patients with T2D ,43,44,79Hyperglycemia can propagate superoxide production, which can lead to endothelial dysfunction and vascular distensibility . Previou2+ channels, thereby delaying the onset of tactile hypersensitivity of the neurons [Neuropathic pain coupled with decreased sensorimotor function may cause individuals with DPN to be physically inactive and therefore an important target for aerobic training interventions. A 16-week supervised aerobic exercise program resulted in a significant reduction in perceived pain (average of 7 pain interference items) during various daily activities (4.29 \u00b1 2.70 to 2.36 \u00b1 2.22) . It was  neurons .2peak) (16.88 \u00b1 1.11 to 17.41 \u00b1 1.42 mL/kg/min); however, significant improvements were seen in fasting blood glucose levels (7.6 \u00b1 0.9 to 7.5 \u00b1 1.1 mmol/l), glycated hemoglobin (Hba1c) (7.3 \u00b1 0.3 to 7.2 \u00b1 0.5%), and insulin (15.9 \u00b1 3.3 to 14.5 \u00b1 3.2 \u00b5U/mL) concentrations. Additionally, participants demonstrated reductions in body fat (38.9 \u00b1 1.6 to 37.3 \u00b1 1.8%), increased gait velocity (108.91 \u00b1 1.73 to 116.42 \u00b1 2.15 cm/s), stride length (59.24 \u00b1 0.65 to 62.73 \u00b1 0.81 cm), step length (122.81 \u00b1 1.28 to 125.80 \u00b1 1.59 cm), and a decrease in time spent in stance (63.6 \u00b1 0.9 to 61.8 \u00b1 1.0%) [2reserve) three times per week. The resulting data displayed a significant increase in 2peak (16.2 \u00b1 3.6 to 17.3 \u00b1 4.0 mL/kg/min) and a decrease in total body fat (44.79 \u00b1 6.62 to 43.79 \u00b1 6.64%). Additionally, improvements were found in general (15.7 \u00b1 2.3 to 12.2) and physical (15.5 \u00b1 2.4 to 12.4 \u00b1 3.7) fatigue scores, both collected using the Multidimensional Fatigue Inventory questionnaire [2reserve) for durations of \u22658 weeks can result in favorable improvements in cardiorespiratory fitness and metabolic function, which may prompt greater participation in subsequent daily physical activity and enhance glycemic control.Sedentary behavior has been a longstanding global pandemic and is recognized as one of the top five leading contributors to premature mortality ,89. More \u00b1 1.0%) . Kluding \u00b1 1.0%)  prescribionnaire . Individionnaire ,94,95. Iionnaire  observedionnaire ,97. BaseResistance exercise training is an established method for increasing muscular endurance, size, strength, and power ,99,100. Growing evidence demonstrates the efficacy of resistance exercise to promote overall metabolic health in individuals with T2D through improvements in glycosylated hemoglobin (HbA1c) and insulin sensitivity, particularly in the early stages of T2D among those with a lower body mass index ,102,103.d = \u22121.20 to \u22121.49) decreases in arterial stiffness measures in healthy individuals. Maeda et al. [\u22121) and oxidative stress  in African American men. Though the discussed data was not collected in patients with DPN, it does suggest that RT may be effective in stimulating favorable vascular changes and improving endothelial function in this population. Though the aforementioned results were observed in a healthy population, it gives insight into the potential effects possible from chronic RT. Future research should attempt to replicate or build on the current studies, limiting enrollment to those with DPN in order to investigate whether similar or even greater improvements in circulation and perfusion can be attained.Impaired function of the peripheral vasculature is a common issue that emerges in patients with diabetes, and the development of DPN only further exacerbates the decrease in circulation and perfusion . In a rea et al.  observeda et al.  demonstra et al.  demonstrIndividuals with DPN are at an increased risk of falling relative to age-matched controls, with 60% of fall-related deaths occurring during descent down stairs ,115,116.As previously mentioned, aerobic exercise is the most commonly employed training intervention in the scientific literature investigating exercise effects on people with DPN. Conversely, research looking into the efficacy of resistance exercise training is lacking. However, a concurrent aerobic and resistance exercise training approach has been studied in people with DPN.Kluding et al.  had 17 iIt has been speculated that the length of the intervention and the degree of damage sustained by the peripheral nerve fibers play a major role, with shorter interventions  affecting less extensively damaged fibers while longer interventions are necessary when damage is more severe . One expDamage to the sensory and motor nerves can severely impair myofiber innervation and perfusion, causing muscle atrophy and balance impairments, which is of even greater concern for older adults already at an elevated risk of developing sarcopenia and falling ,9,10. FoSong et al.  had 19 i2; 58.31%), ankle sway  and hip joint sway  during the balance test with open eyes. Only the ankle sway was significantly reduced in the experimental group  during measurements while the eyes were closed. Additionally, the number of steps walked showed a substantial but non-significant increase  in the experimental group following training [The postural instability observed in individuals with DPN seems to be a result of inaccurate proprioceptive feedback from the lower extremities. Decreases in proprioception results in the loss of the ability to adequately coordinate essential reflexes and joint movements, in addition to complex balance and postural control ,130. Gretraining . Finallytraining  had 24 itraining , suggestYoga-based interventions have been suggested as an alternative to traditional balance and flexibility exercise therapy. Boslego et al.  found thAnother modality of exercise training practitioners have investigated is the use of tai chi, or tai chi chuan. Tai chi is a Chinese-based martial arts dating back more than 3000 years. In the modern day, tai chi is utilized as a form of exercise characterized by self-paced, well-controlled physical movements synced with focused breathing, stretching, and relaxation techniques . In addiA primary characteristic of DPN is chronic pain caused by accumulated damage to the afferent nociceptors from the chronic hyperglycemia . This da2) and eyes closed  sway velocity testing. One leg stance time significantly increased for eyes open (6.41 \u00b1 4.59 s) and closed (2.09 \u00b1 1.30 s). Lee et al. [Kessler and Hong  found the et al.  also obse et al. ,154,155.Upon reviewing the literature, there is support that exercise-based interventions \u22654 weeks are beneficial for patients with DPN. This conclusion falls in line with other recently conducted literature reviews investigating the effects of exercise on enhancing gait function , decreas2reserve) has shown the ability to improve sensorimotor function, cardiorespiratory endurance, reduce fatigue, and promote increased physical activity. Mechanisms for the observed improvements following aerobic exercise interventions may be tied to enhanced glycemic control and endothelial function. Furthermore, three studies demonstrated improvements in electrophysiological examinations, specifically in greater nerve conduction velocity within the sensory nerves [As previously stated, aerobic exercise is one of the most commonly utilized training modalities in both healthy and special populations. Aerobic exercise training at moderate intensities  and determine a priority list in order to decide the most appropriate modality to choose. Future studies should look to perform more multi-group studies comparing various exercise training modalities against one another and combined. Furthermore, comprehensive outcome assessments need to be implemented to specify which type of training demonstrated the largest effects for a particular test. Based on the findings of the current review, the authors recommend that outcome assessments include NCS, neuropathic signs/symptoms assessments, performance tests to evaluate physical function as it relates to lower-body strength, gait, balance, and posture control, and analyses of metabolic biomarkers specifically related to glycemic control."}
+{"text": "Early life experiences can influence later life outcomes such as physical, mental, and cognitive health. Previous research investigated the effect of childhood socioeconomic status in relation to mid-to-later life cognition ; however, the effects of childhood emotional adversity on cognition have not been examined. Controlling for age, education, sex, and race, the current study investigated the influence of childhood emotional adversity and later life friend solidarity on change in later life episodic memory, executive functioning, and subjective memory . Utilizing the Midlife in the United States (MIDUS) database, we studied 2,752 participants  with completed measures on MIDUS 1 retrospective childhood adversity, MIDUS 2 friend solidarity, and MIDUS 2/3 cognition. Multilevel modeling (Mplus) was used. Higher friend solidarity was associated with higher executive functioning  and higher subjective memory , suggesting the positive impact of supportive friendships. Higher childhood emotional adversity was associated with lower perceived subjective memory . There was no significant friend solidarity by emotional adversity interaction. Together, these findings suggest that later life friend solidarity may be important for objective and subjective cognition; whereas, childhood emotional adversity may play a role in subjective cognition. Given the associations in prior research between lower perceptions of memory and lower mental well-being and quality of daily life, experiencing childhood emotional adversity may increase risk of lower perceptions of well-being, including cognitive functioning."}
+{"text": "In this review, we attempt to connect past research studies to new findings with animal models of cellular and neurotransmitter mediators of stress buffering to extreme fear generalization onto testable research and clinical concepts. Drawing on the greater impact of inescapability over unpredictability in animal models, we propose a mechanism by which ELA aggravates an exhaustive cycle of amygdala expansion and subsequent toxic-metabolic damage. We connect this neurobiological sequela to psychosocial mal/adaptation after ELA, bridging to behavioral studies of attachment, emotion processing, and social functioning. Lastly, we conclude this review by proposing a multitude of future directions in preclinical work and studies of humans that suffered ELA.Early life adversity (ELA), such as child maltreatment or child poverty, engenders problems with emotional and behavioral regulation. In the quest to understand the neurobiological sequelae and mechanisms of risk, the amygdala has been of major focus. While the basic functions of this region make it a strong candidate for understanding the multiple mental health issues common after ELA, extant literature is marked by profound inconsistencies, with reports of larger, smaller, and no differences in regional volumes of this area. We believe integrative models of stress neurodevelopment, grounded in \u201c The amygdala has been the focus of a great deal of attention in research aimed at understanding the effects of Early Life Adversity (ELA). The fact that this evolutionarily ancient brain structure is of interest is perhaps not surprising given this region's essential role in socioemotional functioning , extreme household dysfunction , and poverty . These and related negative experiences have been referred to using different umbrella terms, such as \u201cearly life stress,\u201d \u201cchild trauma,\u201d \u201ctoxic stress,\u201d \u201cearly adversity,\u201d and \u201cAdverse Childhood Experiences (ACEs).\u201d An important starting question is whether to lump adversities together, think about specific experiences , or examine potential shared dimensions of ELAs. Initial research took a purely cumulative exposure approach, summing up the total number of adversities suffered, or looking at child trauma externalizing psychopathology\u201d). For example, greater disruptive behavior and conduct problems have been found in victims of child sexual abuse  being associated with child maltreatment , collectively the amygdala calculates the intensity of response to positive and negative emotional stimuli ; post-traumatic stress disorder (PTSD)] and some samples with autism have shown greater amygdala relative to brain volume continue to increase through adolescence, reaching maximum volumes in the late teens or early twenties. The exact age of these peaks is, however, dependent on the sex and pubertal dynamics of an individual  that found participants who reported two or more early-life events had significantly smaller amygdalae with increasing age  with these patterns should likely be greeted with skepticism. Moving away from hand-tracing, there are now many commonly available automated methods for amygdala volumetric quantification  often yield unsatisfactory results with high-variability and low-validity . When these investigators examined the full cohort, there were no significant effects detected. But, looking at age X ELA interactions, these investigators found that lower family income was significantly associated with smaller amygdala volumes in adolescence (13\u201321 years old). However, this relation was not seen for younger age children (3\u201312 years), suggesting important neurodevelopmental associations may only be revealed when considering ELA and developmental stage(s).Turning to issues with study designs, many investigations in humans have had a large age range of participants ; this is particularly important to note given amygdala developmental trajectories reviewed earlier. For example, LoPilato et al.  examinedU allostatic growth trajectory. High levels of stress initially increase amygdala volume, but the most extreme (or chronic) levels of adversity may result in smaller volumes. Support for this idea comes from multiple avenues. First, cross-sectional studies suggest complex associations between amygdala structure, the intensity of ELA, and developmental consequences of stress. For example, Mehta et al.  the amygdala is not a unitary brain area, but rather heterogenous subnuclei with unique functions and developmental trajectories , there is interruption of the normal excitation-inhibition balance in the amygdala. This may occur through multiple pathways and may explain a portion of the heterogeneity of structural results seen previously. First, stress may cause higher excitability in the basolateral amygdala, due to: increases in the number of spontaneously firing neurons , suggesting a common amygdala response in disorders of sustained distress  demonstrate atrophy. We believe research in rodents and non-human primates suggest a testable model about the factors driving this enlargement. As McEwen detailed in multiple reports about allostatic load, the body increases certain functions to meet the demands of the stress, but long-term adaptation is costlier than true homeostasis. Connected to this, Ghosh and Chattarji  examinedr et al.  demonstrIt is as yet unclear if there is an equivalent fear generalization in primates proportional to the intensity of an aversive stimulus, but this is likely the mechanism by which individuals suffering ELA proportionally over-activate their amygdalae. We predict that this metabolically costly effort to map the environmental space surrounding an intense aversive event represents a key function of the basolateral amygdala as defining the boundaries of danger cues so that safety can be achieved. This is in line with imaging findings and neural network modeling that suggest greatest recruitment in situations of uncertain danger  are related to either withdrawal from or overt aggression toward peers. While many may consider these divergent phenotypes, both may be appropriate (and learned) responses to environmental entrapment and an inability to map safety signals. Youth either fight, attempting to escape perceived entrapment; or eventually surrender under the belief that breaking free is not possible. Furthermore, ELA-exposed youth often make errors in encoding social cues, exhibit biases toward attributing hostile intent, generate more aggressive responses, and positively evaluate aggression as an appropriate response  can paradoxically produce an We can take this model one step further and consider how social buffering could lower the excitation:inhibition ratio of the amygdala so as not to rush experience-dependent plasticity during development. Zhang et al.  mapped rFeedforward safety signals likely reduce the average excitation:inhibition ratio of the amygdala, permitting a slower maturation throughout adolescence and possibly more DARPP-32 cells that could activate positive affects in safe contexts. If an environment offers few to no safety signals, this maturation is accelerated according to the allostatic load model, progressing more rapidly to dendritic outgrowth, higher excitation:inhibition and an early allostatic peak that likely compresses stress buffering periods. It is unknown, however if the lack of any parental safety signals during this critical period, most exemplified by institutional neglect, leads to amygdala shrinkage in the absence of additional adversity. This is particularly challenging given the high incidence of further adversity in foster care and may be better studied in children with diffuse attachment disorder. We speculate that the lack of safety learning during critical periods leads to limited psychological and emotion regulation resources, represented by the safety learning possibilities wired through the DARPP-32+ cells, to overcome challenges. Lack of social safety learning likely leads to inability to detect and avoid dangerous environments and individuals, ultimately leading to similar outcomes.Fortunately, future treatments may be able to mimic the temporal dynamics of dopamine signaling and repair or renew DARPP-32 cells in the basolateral complex, re-opening a window of plasticity for social safety learning. Consistent with this model, a single dose of the dopamine precursor L-DOPA/carbidopa facilitates fear extinction in rodents and humans through enhanced negative connectivity between ventromedial prefrontal regions and amygdala  when they are in these settings, and the global neglect they are experiencing may impinge upon attachment processes  experiences may not rise to the level of a \u201cformal ELA.\u201d For example, there is a litany of research on \u201cexpressed emotion\u201d and risk for poor mental health  may be compensatory efforts to map environmental features to detect safety in the context of these stressors; however, with high-levels of psychosocial burden and/or limited social support (limited formation of DARPP-32+ escape solutions), no safety can be achieved so the amygdala churns away, reaching a terminal toxic-metabolic shrinkage. These psychosocial perceptions and neurobiological changes may indeed explain many \u201cDeaths of Despair\u201d in populations exposed to ELA  to probe markers of amygdala neurobiology, including cell density, membrane phosphocholines, second messenger turnover, and other critical molecular markers. The second author and his colleagues at University of Wisconsin-Madison . The seminal studies by Vyas et al. motivated a host of human studies on ELA; however, this work was completed in young adult rodents. Additional work that is often less highlighted, by Rosenkranz et al. completed similar stress manipulations and found many critical differences  in animals exposed to stress as juveniles vs. in adulthood. Little work, in our opinion, goes far enough to truly understand the true developmental impact of ELA. In line with recommendations from Callaghan et al. , it is aIn particular, we believe it will be important to consider the interaction of ELAs with stressors during childhood and also later in life. ELA may affect how individuals respond to subsequent life stressors and heighten risk for poor mental health  multiple, different stages of development. In addition, there may be psychosocial consequences of ELA that may increase the likelihood of volumetric shrinkage in exposed individuals. Such a developmental incorporation may have important insights for the prediction, prevention, and treatment of negative outcomes related to ELA. ELA may cause psychosocial  alterations at one time point, but individuals who have suffered these adversities keep engaging in, as well as creating, different experiences. Outcomes at later time points may be related to this initial adaptation, but also could be due to the interaction of early changes and current situational experiences. Clinically, those working with adversity-exposed populations often know that previous (negative) adaptations in their clients may create later residue that individuals who have suffered bring to the different situations that subsequently greet them. Connected to the ideas we advance above, future work will need to consider not just age and duration of a stressor, but also the \u201cescapability\u201d or proportion of contexts affected . Thoughtful execution of these multiple ideas, across preclinical and human studies, could significantly advance our understanding of the neurobiological sequelae of ELA, the mediating connections between ELA and psychopathology, and more basic science questions such as nature vs. nurture.Here, we put forward an integrated model of amygdala neurodevelopment to think about inconsistencies in research on ELA, as well as the behavioral consequences of adversity. We must all continue to dissect heterogeneity, think about theoretical integrations of stress neurobiology and developmental psychology, and clarify complex relationships between ELA and related long-term mental health challenges. We are excited to pursue many of the future directions we proposed here and would be excited about improvements in preclinical and human studies focused on early stress exposure. Continued progress in these spaces, potentially guided by the theoretical model laid out here could be particularly important for predicting, preventing, and treating the consequences of ELA.https://github.com/jlhanson5/Hanson_Nacewicz_Frontiers_Amygdala_Review_Data.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found at: The authors owe a great debt to the late Dr. Bruce McEwen, whose careful measurement of the effects of sustained stress and theoretical extrapolation far beyond the timescale of typical research studies led to the model of Allostasis. His bridge from basic science studies of rodent neurons and synapses to human neuroimaging and behavior inspired us as neuroscientists. As this model has developed, it has become a fantastic tool for patient education in psychiatric practice (of BN) as a tangible mechanism by which fears expand or improve with treatment.Both authors contributed equally to the outlining, drafting, and writing of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Oral health is crucial to the experience of well-being, and symptoms from the mouth are common at the end of life. Palliative care aims to identify and treat symptoms early to avoid unnecessary suffering and is thus an important part of nursing in home healthcare. The aim of this study was to illustrate the professional reflections of registered nurses about oral health amongst patients in palliative care, who are being cared for in a home healthcare setting.Oral health is easily overlooked in palliative care, Oral health is everybody\u2019s but in reality nobody\u2019s responsibility, Patient integrity can be an obstacle for oral health, and Focus on oral health is urgently needed. The mouth is often not included as part of the daily basic care routine, by the registered nurses and the home healthcare staff, until the patient is near end of life. Moreover, neither does the patient tell about symptoms from the mouth. The interpreted whole indicates that the registered nurses had a bad conscience about not doing what they are actually responsible for and ought to do.The results showed oral health in end-of-life care, to be an area marked by responsibility and ethical considerations. This was seen in all four partly overlapping themes that emerged through the analysis: The oral health of patients at the end of life risks being forgotten or falling between the cracks, due to the nurses\u2019 scattered tasks and unclear delimitations between their, and other professionals\u2019 responsibilities. The responsibilities of registered nurses are also ethically demanding, since their intent to respect the patient\u2019s integrity could mean that in some cases the patients does not allow them to help with oral health. To reduce the risk that oral health is overlooked, clearer demarcation and guidelines on the division of responsibilities are required. Routines that clearly implement early and recurring oral health assessments in home healthcare as well as continuing education updates on oral health and oral care are also needed.The online version contains supplementary material available at 10.1186/s12904-021-00859-3. This emphasizes the importance of the mouth and of oral health in patients\u2019 well-being in general, and particularly at the end of life. According to the definition by the FDI World Dental Federation, oral health is \u201cmulti-faceted and includes the ability to speak, smile, smell, taste, touch, chew, swallow and convey a range of emotions through facial expressions with confidence and without pain, discomfort and disease of the craniofacial complex\u201d [Oral health, an important component of general health, is crucial to our well-being whether healthy or ill. The mouth as a symbol has been described as \u201cistence\u201d . This emcomplex\u201d .that improves the quality of life of patients (adults and children) and their families who are facing problems associated with life-threatening illness\u201d. Palliative care is part of the third UN sustainable development goal and needs to be improved not least at the primary care level in order to decrease avoidable suffering [Palliative care is an area of increasingly global concern as a result of, among other things, an ageing population, and an increase in the incidence of chronic diseases . More thuffering . Palliatuffering . Oral heuffering , 7 in evuffering  and it iProblems with the oral cavity that can arise at the end of life, in addition to dry mouth, include pain, changes in taste and changes in the mucosal membranes , 9. As mDespite the importance of oral health-related problems at the end of life, patients report that their problems are not always taken seriously by healthcare staff . PatientRevised Oral Assessment Guide (ROAG) and the Oral Health Assessment Tool (OHAT) were recommended as the best choice for assessment of the oral health of older people by non-dental professionals [Difficulties in providing adequate oral care faced by healthcare staff, related to patient\u2019s unwillingness to cooperate, exists in both hospitals and institutional facilities , 17. Heassionals .Being functionally dependent and thus needing assistance with oral care increases the risk of having poorer oral health . UntreatIn Sweden, 36% of the population over 80\u2009years receive home care in a community setting . It has The aim of this study was to illustrate the professional reflections of RNs about oral health amongst patients in palliative care who are being cared for in a home healthcare setting.This qualitative study had a descriptive design , and useThe interviews were conducted with RNs, with or without specialisation, who were working in home healthcare in a community setting in two municipalities in western Sweden. The RNs were working in ordinary housing, nursing homes or housing with special services for people with functional disabilities, hereafter referred to as \u201chome healthcare\u201d. The RNs were responsible for the care given to the patients, and led one or more groups of staff consisting of both enrolled nurses and untrained staff who were responsible for a certain area or nursing home. The expression \u201chealthcare staff\u201d will hereafter be used for the staff led by the RNs, regardless of their education. The RNs did not always take an active part in daily patient care and often acted as consultants when the healthcare staff needed advice about the care.In order to answer the research question purposive sampling was used . Head maThe interviews were conducted by\u00a0AG or JS. All interviews but one were carried out at the participants\u2019 workplaces during working hours. The other interview was carried out in a secluded public meeting place during non-working hours. A semi-structured interview guide was used in order to gain a deeper understanding of the participants\u2019 thoughts on oral health. The interview guide was constructed based on the literature, expert opinion and the authors\u2019 clinical experiences . The opeThe data was analysed using qualitative content analysis based on the description by Graneheim and Lundman , since tThis study adhered to the guidelines for empirical studies in Sweden. Ethical permission was given by the managers of each of the two municipalities that participated. No formal approval from the Regional Ethics Review Board was required for this kind of non-interventional study involving healthcare professionals which does not involve risks or the processing of sensitive personal data  and hencOral health is easily overlooked in palliative care, Oral health is everybody\u2019s but in reality nobody\u2019s responsibility, Patient integrity can be an obstacle for oral health, and Focus on oral health is urgently needed. The interpreted whole indicates that the RNs had a bad conscience about not doing what they are actually responsible for and should do.Oral health at the end of life, from an RN\u2019s perspective, was shown to be an area marked by responsibility and ethical considerations. This was seen in all four partly overlapping themes: The RNs described oral health in palliative care within home healthcare as a natural and important part of care to be performed regularly and frequently, but also as something that easily was forgotten. Structured oral health assessments and oral care might seem trivial, but the RNs considered they were more difficult to carry out than, for example, pain assessment. They were in agreement that oral health has a great impact on the patient\u2019s overall health. Oral health was seen as an important part of holistic care, since it is always present and has a great impact on the patient\u2019s well-being. The RNs also stated that impaired oral health affected the patients\u2019 overall health and could spread like ripples, contributing to severe consequences in several other areas.\u201d (IP7).\u201cShe is so very clear-headed, so one thinks \u2018why don\u2019t you ask for help with it\u2019 Despite the holistic view of their patients described by the RNs, it also emerged that the mouth was sometimes overlooked as a part of the body. The reasons for the patient\u2019s symptoms were first sought outside the mouth. The patient\u2019s oral health was also neglected because the subject was not always brought up in or included as a component of care. The oral health status were not always immediately apparent to an outside observer and could be ignored by patients, relatives and staff, leading to under-treatment of problems. The patients might also be unaware that ease of oral problems could be at hand and consequently did not ask for help.\u201cIt is actually easiest when the patient is in the final stage because then you have the opportunity. You are naturally there all the time, moisturizing, fixing, anointing and making sure the mouth is not dry\u201d (IP3).The RNs said that some nursing colleagues as well as other healthcare staff were not completely comfortable performing oral health assessments, but thought that this became easier and more natural when the patient was in the final stage of life. The mouth was then less likely to be forgotten.The RNs also described how patients who were asked about their oral health reacted to the fact that they had not been asked earlier. When the patient\u2019s health deteriorated and they became bedridden, stopped eating and drinking and breathed through their open mouth, the mouth became more visible and was thus more naturally seen as a part of the holistic care.\u201cIt is not the responsibility of dental care practitioners, nor of the enrolled nurses, so it is probably our responsibility.\u201d (IP2)Oral care was not seen as an entirely natural part of the RN\u2019s responsibility and was thus easily down-prioritized as a result of the many areas of responsibility that were considered important.Although the RNs considered oral health at the end of life, including practical oral care and documentation of systematic oral assessments, to be their responsibility, it was evident that they sometimes used the exclusion method to come to this conclusion.\"We have a doctor, but she is not very familiar with \u201cthe mouth\u201d  (IP5)\".The RNs described their profession in the home healthcare setting as \u201ca wandering profession\u201d and stated that they were dependent on other healthcare staff informing them about changes in the oral status or deterioration of the patient. It was thought that the healthcare staff, although considered skilled and experienced, not always performed structured oral assessments. The RNs led the working group and distributed the responsibilities for practical care to be performed while supporting, tutoring and acknowledging the healthcare staff but wished for more time designated to that. The RNs considered it their responsibility to convey confidence, and to encourage the healthcare staff to realise the importance of oral health and oral assessments and that the mouth is an important part of the body and should be an integrated part of the daily basic care routine.\u201cIt's great to see, now that the youngsters have been working here for a few months, that (now when) they come to me when someone is not feeling well or has not eaten, they have checked! (the mouth) in the way I showed them\" (IP1)The RNs saw the relatives as part of the team around the patient and thought oral care could be used as a way to encourage the relatives to approach the severely ill person, especially if they were finding this difficult.\"Relatives may feel that they can\u2019t help the loved one with anything, but ... if you give them small tasks  it seems to become very positive.\u201d (IP5)The RNs perceived that relatives often found it comforting to be able to help but that they could also experience it as difficult and that the RNs needed to instruct and support them. It was thus very important to emphasize that the RNs still had the final responsibility for the patients\u2019 oral health. If the relatives did not carry out any oral care, the patient would still get help with this from the healthcare staff and the RNs.The patient\u2019s oral health was described as a team effort, shared by several professions, and continuity and collaboration were considered important factors for success. The RNs stated that contact with other care providers was usually undertaken by them, and it was also they who, after assessment, initiated any eventual treatment. Dental care practitioners, hospital dental care practitioners and the palliative care team were seen as resources, while other inpatient care facilities and primary care physicians were considered to have insufficient or only generalized knowledge about oral health. Moreover, there were occasionally disagreements about treatment strategies between RNs and physicians since the RNs sometimes considered themselves as having more expertise within oral health and its treatments.\u201cYou believe you do something good when you let someone be, but that is not always the case (IP4)\u201d.The RNs also sometimes experienced internal ethical conflict when attending to a patient\u2019s oral health in situations where the patient and the RN had no previous relationship and the patient could not give consent to the care as a result of unconsciousness or cognitive impairment.\"She was unconscious and could not say yes or no to it  so I felt that when you get into the mouth and check with the lamp and your fingers and so on, it felt a little uncomfortable\" (IP6).Emotional perceptions around the mouth were twofold; some RNs reported experiencing the mouth as a private and sensitive zone while others did not look upon the mouth as different from the rest of the body. It was thought that the healthcare staff could have the same dual perceptions about the mouth.\"Some home healthcare staff consider the mouth so intimate, they have no problem wiping someone's behind but have a very hard time looking into someone\u2019s mouth\" (IP7).The RNs said that also patients might feel that the mouth is an intimate area and related to integrity, leading to an unwillingness to open their mouth. Patients\u2019 feelings of fear and panic or of experiencing oral care as uncomfortable and difficult to endure were also mentioned. It was considered to be of the utmost importance that patients did not experience oral care as abusive. The RNs described situations where patients experienced it as painful and time-consuming to have their oral health assessed and any complaints remedied. They put this in relation to the risk of ill health if the problems were not detected and relieved.Respect for the patient\u2019s integrity could, according to the RNs, be an obstacle to oral health. In order not to violate the patient\u2019s integrity, the work with oral health needs to be individualized. The individual adaptation of care, using a person-centred approach, was described as having to consider differences between individuals, for example age differences, differences in individual views on what is private, and differences in personality such as the loner. Sometimes patients did not want to receive assistance with oral care or assessment of oral health, despite the RNs\u2019 consideration that this risked causing oral health problems. A delicate ethical balance was described between respecting the patient\u2019s unwillingness to accept assistance with their oral health and the RN\u2019s wish to do good for the patient.\u201cThen we must realise that we cannot succeed every time with this group of patients. But you may succeed five times out of ten, which is much better than nothing\u201d (IP1).The RNs also described other ethically demanding situations where, for example, relatives could not understand why the staff did not force the patient to succumb to oral care, as may have occurred earlier when the relatives were helping the patient. The RNs described that part of their role was to explain the situation to the patient and relatives, and also to the healthcare staff.The RNs said that they and the healthcare staff helped to find strategies for preserving the integrity of patients who did not want to open their mouths. The strategies, such as reasoning with the patient about being allowed to carry out oral care or trying to look into the mouth from a distance, differed according to whether or not the patient was competent to make decisions. Not being allowed to help with the patient\u2019s oral health problems was described as frustrating and the RNs had to accept that they could only do what was possible.\u201cThe palliative care register accounts for certain things. You want to reach up to set goals ... now the focus is on oral health assessments and so it also becomes more important to make the assessments and to document them\u201d (IP2).However, it was emphasized that quality registers were of little use if oral care was not carried out as decided for each patient.The RNs described a great need to focus on oral health in order to uphold the quality of the offered care. Oral health was perceived as being easily forgotten if it was not constantly paid attention to. The RNs stated that, by increasing the focus on oral health, they had become better at paying attention to it in their duties, but thought that there was still room for further improvement. Data from quality registers could contribute to increased attention paid to oral health, could highlight areas for improvement, and could allow for results to be followed over time.\u201cWe have guidelines for everything else but I have never seen any memo or anything concerning oral health\u201d (IP7).Knowledge of the individual patient\u2019s oral health was stated as a key aspect of the work to prevent oral health problems but since the level of knowledge about oral health among the healthcare staff was considered to have decreased in recent years it could be difficult to get this information. Training in oral care and having access to the appropriate equipment could help to encourage oral care and make it more visible. The current undergraduate education of RNs was generally described as providing only limited, and mostly practical, knowledge of oral health.\u201cI have to think \u2026 Did we learn about the mouth (during nursing education)? \u2026 We \u2018passed by the mouth\u2019, I can say. But\u2026 the mouth itself \u2013 no\u201d (IP6).Some higher education institutions were stated to currently include oral health in the education programmes for nursing students, as seen in the approach of newly graduated RNs to the mouth as part of the patients\u2019 daily bodily care. It was stated that integration of oral care into education would raise both awareness of oral care and the status of performing it. Continuing education was given in the workplace but the RNs wished for it to be more extensive than currently offered.\"Before my education (as a registered nurse), I thought someone else could do it , it was not a prioritized task for me\u201d (IP8).The RNs stated that when systematic assessments were performed (e.g. with ROAG), this led to both a focus on oral health and to uniform assessment of all parts of the mouth. This in turn made it easier to detect oral health problems while also providing suggestions for further actions. Difficulties implementing ROAG in the home healthcare group compared with implementing assessment instruments regarding, for example those used for nutrition and pressure ulcers, were described by the RNs. However, if an instrument was used regularly, it was considered that the staff would feel more confident in using it and thus benefit even more from its utilization.The RNs emphasised the importance of commitment from the management and of communication between the RNs and the management. The management could accordingly both support and hinder focus on oral health. It was also thought that colleagues in coordinating key positions, such as palliative coordinators, could provide support and contribute to increased focus on oral health, while the lack of uniform routines and guidelines was mentioned as obstacles.\u201cOral health is easily overlooked in palliative care\u201d revealed that the perceived importance is not always visible through the RNs\u2019 caring acts. The RNs\u2019 reflections showed that oral health is easily forgotten, missed or lost among their scattered assignments, in line with previous research showing negligence with respect to oral health [This study reports reflections of RNs on the oral health of patients at the end of life receiving home healthcare within the community setting, where responsibility and ethical considerations characterize the results. Despite the RNs united view that oral health is an important part of the patient\u2019s overall health near the end of life, the theme l health , 38. Thel health \u201339. Coulpalliative care is the active holistic care of individuals across all ages with serious health-related suffering\u201d [\u201cit cannot be relieved without medical intervention and when it compromises physical, social, spiritual, and/or emotional functioning\u201d [A revised definition of palliative care has been proposed  to replaffering\u201d . Since htioning\u201d , it becoOral health is easily overlooked in palliative care\u201d shows the importance of focusing on oral health early, preferably as part of the enrolment routine when initiating home healthcare, in order not to lose track of this important issue. It was also apparent that some patients might be unaware that oral health problems can be eased and therefore don\u2019t ask for help. Previous palliative care research has found that patients might relate to the mouth differently from the way they relate to the remainder of the body; they will often only talk about symptoms from the mouth as an aside (\u201cby the way...\u201d) instead of reporting them specifically [The theme \u201cifically . Awarene\u201cOral health is everybody\u2019s but in reality nobody\u2019s responsibility\u201d. At the same time, they stated that the responsibility was not solely theirs and that the borders between and demarcation of their responsibilities were considered unclear. The responsibility of RNs for daily basic bodily care of patients is shared with healthcare staff such as enrolled nurses and care assistants, while the medical responsibility is shared with the physicians. The responsibility is also shared with dental health professionals, primarily responsible for the teeth but also partly responsible for the health of the rest of the oral cavity. According to the findings, oral health is everybody\u2019s responsibility and the whole team\u2019s effort is therefore crucial. Similar findings have previously been reported from within specialised palliative care, where the only professionals seen to fully acknowledge responsibility for oral care were the hospital dentists [The RNs acknowledged the patient\u2019s oral health as their responsibility, seen in the theme dentists . HoweverOral health is easily overlooked in palliative care\u201d, it might not be until the patient is bedridden, or even unconscious, with their mouth wide open, that the RNs\u2019 expectation that the patient is fully responsible for their own oral health seems to cease. This is the moment when their full responsibility seems to dawn on the RNs, leading to actions being taken. Although this has been confirmed by others [As long as a person is healthy, the mouth is generally considered their own responsibility and the person takes care of their oral care themselves, including keeping contact with dental care providers. Even Swedish laws concerning health separate the mouth from the rest of the body by providing separate laws for the two areas: the Health and Medical Services Act  and the y others , researcy others .Patient integrity can be an obstacle for oral health\u201d, suggests that a patient\u2019s unwillingness or inability to cooperate might be an obstacle to the RNs carrying out oral care and thus impeding the upholding of oral health, is in line with previous findings [The theme \u201cfindings . Failurefindings . One of findings . To notiFocus on oral health is urgently needed\u201d. One issue was that oral health has not been seen as a main question by either caregivers or educational institutions (basic and higher education). This is despite both national organisations, such as the National Board of Health and Welfare, and international organisations, such as the Worldwide Hospice and Palliative Care Alliance, highlighting this as an area of importance and considering it a priority. The RNs also raised that it is important to have proper knowledge concerning oral health for the subject to be addressed. The lack of both awareness of, and education about, oral health within palliative care has previously been targeted in research [The results emphasise that \u201cresearch , 38, 44,research . In an iFor oral care in palliative settings and end-of-life care to take place and attract more attention, it seems reasonable to suggest an increased focus on oral health within healthcare education curricula, at both basic and higher levels, and on a continuing basis in the work place, in line with previous suggestions . The RNsThis study addresses professional reflections on oral health, an area commonly causing unwanted symptoms in patients\u2019 end of life, from RNs working in community home healthcare. The interview data were of good depth and provided a wide variety of descriptions of oral health at the end of life. The open interview format gave the RNs the possibility of developing their thoughts about oral health, thus contributing to the strength of the study. They willingly shared their thoughts and were open with their own faults and failings indicating a permissive climate during the interviews.The diversity among the participating RNs is a strength of the study. Both men and women were represented, and there were different ethnicities and varied length of professional experience. The impact of experience and working time on the nurses\u2019 views on and expertise within oral health is unclear. Longer experience of work as an RN will most likely give opportunities to encounter patients with oral health problems. The combined experience in healthcare for the group was well over 200\u2009years (211\u2009years), and almost half (99\u2009years) of this was in the context of home healthcare, which can be considered a strength. However, personal interest in the field might also be important for developed reflections and expertise. While the sex distribution was uneven, it accurately reflects the actual gender distribution among professionals in healthcare. However, only RNs from a defined and similar socioeconomic area in Sweden participated, which is a limitation.Methodological trustworthiness was achieved by carefully following the steps for content analysis as described in the methods section . The firOral health risk being overlooked or falling between the cracks. Despite oral health affecting the patient\u2019s physical, social and emotional functioning yet the involved seem to overlook it and the problems associated with it. The wide variety of tasks assigned to RNs and the lack of a clear demarcation between the responsibilities of RNs and other professionals in this area are some of the factors that contributes to the overlooking of oral health. Other influencing factors are situations when patients no longer can carry out their own self-care, resulting in ambiguity regarding exactly when responsibility passes to other actors around the patient. We also show that ethical aspects influence the work with oral health. Respect for the patient\u2019s integrity might lead to decisions that are in opposition to the ambition of the healthcare staff to do good, meaning that they feel they are not allowed to help the patients. This can result in a bad conscience and ethical stress for both RNs and healthcare staff.It is important that oral health is attended to in order to fulfill the goal of palliative care: to relieve suffering and thereby improve or maintain quality of life in patients and their families who are facing problems associated with life-threatening illness. If oral health problems are overlooked, we lose the opportunity to relieve the suffering oral health problems might result in. To reduce this risk, clearer demarcation and guidelines on the division of responsibilities are required, as well as clear routines that implement early and recurring oral health assessments in home healthcare. With this increased focus on oral health, continuing education is also required in order for oral health not to be overlooked in home healthcare at the end of life. Further research on the views of the patients themselves on oral health at the end of life would be welcome.Additional file 1."}
+{"text": "The aim of this study was to present a concise summary of the oral health policies and oral healthcare schemes for older adult populations in a number of selected countries around the world. In this paper, the current and planned national/regional oral health policies and oral healthcare schemes of nine countries  are reported. Barriers and challenges in oral health promotion in terms of devising oral health policies, implementing oral health schemes, and educating the future dental workforce are discussed. In response to the aging of population, individual countries have initiated or reformed their healthcare systems and developed innovative approaches to deliver oral health services for older adults. There is a global shortage of dentists trained in geriatric dentistry. In many countries, geriatric dentistry is not formally recognized as a specialty. Education and training in geriatric dentistry is needed to produce responsive and competent dental professionals to serve the increasing number of older adults. It is expected that oral health policies and oral healthcare services will be changing and reforming in the coming decades to tackle the enduring oral health challenges of aging societies worldwide. The number and percentage of older adults in most countries around the world are rapidly increasing. The United Nations estimates that there were 703 million older adults (aged 65 years or above) globally in 2019 and this number will double to 1.5 billion by 2050 [via their pathological processes and/or indirectly via disease-related behavioral changes, while oral diseases such as periodontitis are associated with systemic diseases such as endocarditis [Oral health, as an essential component of health, is a fundamental human right. It contributes to physical, mental, and social well-being of a person and has a significant impact on the quality of life . Multifacarditis  and diabcarditis . PreventThe burden of oral diseases is substantial globally . Dental Notwithstanding regional differences, most countries are moving forward to achieve a healthy aging society at their own pace by adopting tailor-made strategies. There has been constant improvement in the performance of healthcare systems globally over the last three decades, but important inequalities persist and the gap between high- and low-income countries has not been reduced . In thisAuthors from nine selected countries  were invited to report on the oral health policies and oral healthcare schemes for older adults in their corresponding country/region. The authors followed an agreed outline to present the situation of their own country/region. Firstly, the most recent available key epidemiological information regarding the oral health conditions  of the older adults was summarized. Secondly, the current national/regional oral health policies and oral healthcare schemes/services for older adults, if present, were described. In addition, local situations regarding dental professionals specialized in geriatric dentistry and advanced training in geriatric dentistry were reviewed. Lastly, obstacles and barriers for developing appropriate dental care services for the older adults in the country/region, as well as possible future plans, were briefly discussed.Australia, like many nations, has an aging population and groups of older adults that are highly disadvantaged in terms of oral health and access to dental care . The AusAustralian policies regarding oral health of older adults have increasingly focused on this intersectoral, interdisciplinary issue with greater input from areas such as public health and primary health care. In Australia, dental care is not generally included in the universal healthcare system Medicare . AustralThere have been limited large-scale programs addressing the oral health of older Australians, both in the community and in residential care, apart from subsidized public dental care. One review noted most workforce models for dental care in aged care have some benefits in terms of dental outcomes . One appThe oral health of older adults in Brazil has been characterized by a high prevalence of edentulism. According to the 2010 Brazilian Oral Health Survey, the latest available survey from a nationally representative sample, 53.7% of the adults aged 65\u201374 years were edentulous . The preBrazil reformed its healthcare system in 1988, transitioning to universal health care with the development of the Sistema \u00danico de Sa\u00fade . Under this system, Brazilians are entitled to free health care at government funded facilities. Incentives for the implementation of oral health teams within primary care started in 2000 and a national oral health policy was implemented in 2004. Older adults are prioritized as a group, with preferential access to oral health care. Primary health care is the main source of oral health care for the older adult population, and services include oral health promotion and prevention, dental clinical care, and oral rehabilitation with partial and complete dentures provided by oral health teams. The oral health network also comprises specialized dental care centers, and older adults are referred, if needed, by the oral health teams to receive specialized care in endodontics, periodontics, oral surgery, and oral medicine . GeriatrThe Brazilian oral health policy expanded access to oral health care for older adults, with more than 27,000 oral health teams in primary care and more than 1,000 specialized dental care centers providing oral health care free of charge . In addiIn mainland China, there were 264 million older adults aged 60 and above in 2020, which accounted for 18.7% of the total population . The fouDental health care in China is predominantly provided by hospital-based public health services at the provincial, county and rural area level . The majRecently, geriatric dentistry has drawn attention as a new subject. Some dental schools started a new curriculum including geriatric dentistry. For example, students in the Peking University School of Stomatology are required to participate in community projects every year as part of their dental public health curriculum. They are trained to conduct oral examinations for older adults and to understand older adults' oral health beliefs, knowledge, and behaviors through focus group discussions. The students are also required to design oral health pamphlets and to deliver oral health educational talks to older adults.Despite the large treatment needs, utilization of dental services is very limited among older adults in China. The main reasons for dental neglect include lack of oral health knowledge, economic problems, perceived lower priority for oral healthcare by individuals and limited dental care resources , 49. To The oral health status of older adults in Hong Kong is far from satisfactory. Dental caries, periodontal diseases and tooth loss are prevalent among the older adults  Table 1Table 1. The above two oral care service programs aim to provide primary prevention , secondary prevention , and tertiary prevention  of oral diseases for selected older adults in Hong Kong. The shared funding, administration and provision mode of dental care services for the older adults makes good use of public funds and the private dental care delivery system in Hong Kong. With continued improvements in the scope of treatment, expansion of the eligible population and increases in subsidies for these programs, the number of older adults benefiting from this shared mode of dental service provision has been increasing over the years . HoweverIndia is the world's second most populous country comprising 17% of the total world population. Of its 1.36 billion people, 116 million (9%) are above the age of 60 years, and this age group will likely increase to over 324 million by 2050 [Under the National Health Mission, the National Oral Health Programme (NOHP) was launched in 2013. The nodal agency is the National Oral Health Cell at the Ministry of Health and Family Welfare. The state and district level oral health cell receives funding to set up one dental clinic with the required manpower, equipment, and consumables, in addition to the existing dental care facilities at the district level or below. The National Oral Health Cell at the central level is responsible for planning, monitoring, and implementing the NOHP. It helps to produce the Information, Education and Communication (IEC) materials and the Behavior Change Communication (BCC) materials for wider dissemination to states. Its mandate is also to train oral and general health care workers and teachers in imparting oral health in various promotional activities.n = 315), which is one of the highest in the world, producing ~25,000 graduates and 5,000 postgraduates in a year [India has a large number of dental schools  of the Japanese population has been the highest in the world. It took only 24 years from the aging rate of 7% (aging society) in 1970 to become 14% (aged society), and this was much faster than in Germany (40 years) and in the United States (72 years). Only 13 years after that, Japan's aging rate reached over 21% (super-aged society). Therefore, Japan experienced an extremely rapid population aging in 40 years, which no other country had ever experienced. In 2020, Japan's older adult population was estimated to be over 36 million, an aging rate of 28.7%. Additionally, it is predicted that the so-called baby boomer generation born after World War II (1947\u201349) will reach the age of 75 by 2025, which means that a quarter of the Japanese population will be over 75 years old. Among the various social problems that accompany aging , the most serious ones are medical care, long-term care, and welfare.As a result of these social problems, various efforts have been made in dentistry over the last 10 years with the collaboration of the Japanese government, the Japan Dental Association and academic societies in the field of dentistry. In Japan, most of the medical care and long-term care services are covered by public health insurance systems . While iMost of the dental treatment in Japan has been provided in dental offices, but the system has been re-designed to increase the opportunities to accommodate older adults living at home or in long-term care facilities, and older patients in hospital. Examples of improving access include the addition of fees for home-visits in medical insurance, the inclusion of fee for oral care and oral functional rehabilitation, as well as reimbursement for the cost of oral care for maintaining oral function in long-term care insurance. Maintaining the oral function of older adults is important not only for maintaining quality of life and reducing the burden of long-term care, but also for preventing aspiration pneumonia and reducing the burden of medical care. The cost of maintaining oral function has been part of the long-term care insurance since 2008, and dentists and dental hygienists have worked in collaboration with physicians and long-term care professionals since 2012. However, in reality, this system is used by only a few long-term care facilities . One of On the other hand, in the medical insurance system, the cost of new tests for oral function such as masticatory ability, occlusal force and tongue pressure have been set in 2018, and the additional cost is allowed when controlling oral hypofunction  for oldeIn Japan, reforms and continuous reviews of the medical insurance system and the long-term care insurance system are being carried out, and efforts are being made by academic societies and educational institutions to train dental care workers who can be more active in the super aged society. The Japanese Society of Gerodontology (JSG) announced the \u201cDental Innovation Roadmap to 2040\u201d in 2018, in which the three pillars that support a healthy and long-lived society are oral health management, dentistry in the comprehensive community care system and dental service in terminal care . In ordeThere is no Swiss-wide systematic evaluation of oral health, but there have been data from regular Swiss health surveys since 1992. The latest data related to oral health stem from the 2012 survey . AccordiThe dental care of the Swiss population is based on self-responsibility of the patient and on the knowledge that tooth loss is mostly avoidable. With few exceptions , dental care is excluded from the basic health insurance. The list of exceptions is definitive and does not comprise age-related diseases like dementia or hyposalivation. Healthcare is largely organized by Switzerland's individual communes and there are Chief Dental Officers in most of the 26 cantons. This exceptional organization for a relatively small country is the result of historic developments that date several 100 years back. Currently, there are ~4,800 dentists in Switzerland and 85\u201390% of dental care is paid out-of-pocket; Majority (73%) of the population sees a dentist at least once a year, predominantly for regular check-ups .As there is no country-wide responsibility for oral health care by the Swiss government, the Swiss Dental Association (SSO) and the Swiss Society for Gerodontology and Special Care Dentistry (SSGS) are the main driving forces to advise on oral care for the older adults. Furthermore, there are several non-connected initiatives within the 26 cantons that often aim to implement the recommendations of the SSO and SSGS . These rThere are non-binding recommendations for older adults who are dependent on care, but the effectiveness of these measures has not been evaluated so far. The main obstacle for implementing a universal health care program for senior citizens in Switzerland is the exceptional and independent organization between the cantons and that oral care is excluded from the basic health care insurance. There are current and past political initiatives to include oral care in the health care system for persons who are dependent on care, as they cannot be made responsible for their own oral hygiene. Furthermore, a nation-wide systematic assessment of the oral health status is needed to better understand the specific requirements of the older Swiss population in regard to oral care.The population of older adults (aged 60 or older) in Thailand was about 20% of the total population in 2020 and the number is projected to grow rapidly . Most ofWith supportive policies for public health infrastructure such as the National Health Development Strategic Plan for the Elderly (2013\u20132023), the Universal Health Coverage (UHC), and the Primary Care Act (2019), the National Oral Health Plan for the Elders 2016\u20132022 (NOHPE) has become Thailand's main driver for a wide range of programs and activities regarding oral health care for the older adult populations . The NOHThe main national policies and implementation include an integration of oral health services with the non-communicable disease (NCD) clinics in community hospitals as well as having a public health dentist and a dental nurse working as part of a sub-district level primary care team nationwide. The services include clinical examination as well as oral cancer screening at least once a year; consultation and referral system for comprehensive dental treatments including a home visit service; training and networking of village health volunteers and members of the community-based senior clubs for daily oral care of both independent and dependent older adults. Most of the essential oral health care procedures are covered under the UHC, especially preventive care as well as basic curative care, including acrylic dentures , 65.As for the educational strategies of the NOHPE , most deIn summary, public health infrastructure in Thailand has facilitated the development of oral health care programs for older adults. Nonetheless, securing tax-based budget for the initiatives and sustaining the UHC system is challenging. The recent Primary Care Act and its movement has been promoted as a solution for a resilient and sustainable system . TherefoEpidemiological data on the oral health status of older adults in the United Kingdom (UK) is collected by the Adult Dental Health Survey (ADHS) . The firOral healthcare services for older adults in the UK is provided through the publicly funded National Health Service (NHS) with the vast majority of care offered through independent general dental practices within primary care. The majority of older patients pay a proportion of treatment charges but some are exempted based on financial income levels. A broad range of specified dental treatments are offered, including direct and indirect restorations, and prosthodontic and periodontal care although there is limited access to dental implant treatment. Although the organization of dental services varies throughout the constituent parts of the UK, all systems reward dentists based on levels of operative clinical activity with less emphasis placed on prevention. Currently in the UK, geriatric dentistry is not recognized as a clinical specialty and there are currently no formal taught postgraduate courses offered in this area . Since 2Older dependent adults within residential care are worth particular consideration when discussing issues around oral health provision within the UK. Strategies for this population are to prevent oral diseases and to reduce pain and co-morbidity as summarized in a recent National Institute for Health and Care Excellence (NICE) guideline which aims to maintain and improve the oral health of care home residents . UnfortuThe current population of the United States (US) is ~332 million persons, of which 52.4 million are aged 65 and older and make up 15.8% of the entire US population . The agiIn the US, dental health is not considered to be a right but rather a privilege, and is a reflection of its culture, which emphasizes independence and individualism. Although there is a federally supported National Institute of Dental and Craniofacial Research and there are federally qualified health centers with dental services, each state is responsible for its oral healthcare policies. The majority of states have a dental director. Funding for dental care is primarily out-of-pocket, as only 29.2% of older adults have dental health insurance and this percentage declines with age .In 1965, there was a major change in social legislation, which included Medicare and Medicaid. Medicare was a federally funded medical health insurance for older adults. However, this program did not include dental care, except certain oral surgery procedures and non-dental oral soft tissue lesions . MedicaiIn 2010, the Affordable Care Act (ACA) was passed by Congress and provided a number of rights and protections to make healthcare more accessible and affordable. Ten categories of service were required under ACA, such as doctors' services, inpatient and outpatient hospital care, prescription drug coverage, pregnancy and childbirth, and mental health services. However, the ACA does not require insurance plans to include dental care. In fact, if dental insurance is purchased as a stand-alone policy, it will not receive federal subsidy tax credits under the law. ACA also allowed states to expand their Medicaid programs to cover more people with low incomes, and these programs could include reimbursement for dental care .Many US older adults are at risk for poor oral health, which can have a negative impact on their systemic and mental health . Older aWith the accelerating global aging, we will confront enduring oral health challenges as well as opportunities over the next decades. Countries are adapting to the aging transformation of the society at their own pace. The delivery systems of oral healthcare services vary among different countries and regions, where tailor-made strategies and policies are adopted or reformed to assist achieving better oral health. In some countries, although no specific oral health policies and oral healthcare program/schemes are currently available for the older adult population, these countries are considering developing policy initiatives, long-term plans and innovative approaches on oral healthcare for the aging populations in the near future.The FDI World Dental Federation, in its report \u201cVision 2030\u2014Delivering Optimal Oral health for All,\u201d calls for actions to attain empowering, evidence-based, integrated, and comprehensive oral healthcare by 2030 . This foUHC, aiming to reduce inequities regarding access to healthcare, has been adopted, reshaped or initiated in a number of countries. At present, oral healthcare is not included or is limited in the UHC in many countries. Even when incorporated into UHC, oral healthcare is not a prominent part of the program, since not all necessary oral health services are covered. For instance, the expenditure for prosthodontic treatment is not fully covered by the UHC in China. Subsidized oral healthcare services for older adults vary from country to country depending on the oral health situations of the people and the level of economic development of the country.Oral health is an essential part of overall health, and oral diseases commonly share risk factors with NCDs. Integration of oral healthcare into general healthcare can lead to more effective prevention and management of oral diseases, resulting in improved overall health and well-being . This stDifferent workforce models have been employed in different places where oral health providers at various levels, such as dental therapists, hygienists, and even trained nursing care providers, can help to improve older adults' access to oral health services. Currently, many countries still rely on a dentist-centered mode to provide oral health services. The primary oral healthcare and prevention services are usually inadequate to cope with the huge need for oral healthcare among the large number of older adults. The shift to evidence-based people-centered healthcare mode rather than traditional chief-complaint-based management mode led by dentists is happening in several countries around the world.Dental education is the foundation for establishment of a proper oral healthcare workforce. Considering the global aging trend, reform of the current dental education curricula is needed to produce responsive and competent dental professionals to serve the growing number of older adults. Although geriatric dentistry has been incorporated into dental education curricula and recognized as a clinical specialty in some countries, having formal postgraduate course/programs or training in geriatric dentistry is uncommon around the world. The number of specialists in geriatric dentistry is grossly insufficient to meet the growing demands of the aging society. Besides, there is shortage of educators and mentors in geriatric dentistry to teach and train the future dental workforce to care for older adults. It should be pointed out that graduation from dental school is never the end of learning and training, since the study period in dental schools is quite limited and technical innovations continue to develop. Life-long learning and continuing education programs are important for dental professionals, which empower them to adapt to the transformation of the aging society and to provide optimal oral health services for the aging population.As a preliminary exploratory study, there are a number of limitations in the present study. Rather than conducting a review covering a full scale of the world's situations, we purposely selected nine representative countries from various continents to present a picture of the current status. We may not be able to generate a comprehensive analysis report, but we tried to present a general overview of the global situation. These selected countries include the most populous ones  that make up more than half of the world population, and the largest economic entities . We covered countries in various continents, including Asia , Australia, Europe , North America (US), and South America (Brazil). The only geographical region (continent) that was not covered in this project is Africa, which has the least aging population. In this descriptive study, we did not attempt to conduct policy analysis nor to compare oral health policies and schemes in different countries regarding financing and reimbursement, thereby future studies are needed.Individual countries are adopting tailor-made strategies to deliver oral health services for the increasing number of older adults in the aging society. Expansion of dental education and incorporation of clinical training in geriatric dentistry are needed to produce responsive and competent dental professionals to meet the demands of aging societies around the world.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Spontaneous common bile duct (CBD) perforation is an extremely rare disease in adults. We report an adult case of CBD perforation due to choledocolithiasis accompanied with pancreaticobiliary maljunction, which is, to our knowledge, the first such case report based on a search using PubMed.A 71-year-old woman with consciousness disorder was transported to the emergency department of another hospital. She was diagnosed as having severe peritonitis with septic shock and transferred to our hospital for emergency surgery. Enhanced computed tomography (CT) revealed supraduodenal CBD dilation similar to a diverticulum and a defect of bile duct wall continuity. Furthermore, CT showed a long common channel of the pancreaticobiliary duct, so she was diagnosed as having spontaneous CBD perforation with pancreaticobiliary maljunction. Emergency surgery was performed that revealed a necrotic diverticulum-like change on the supraduodenal part, and a 2.5\u2009\u00d7\u20091\u00a0cm perforation was found on the anterolateral wall of the CBD. Peritoneal lavage was performed, and CBD perforation was resolved with a T-tube. The patient suffered refractory intra-abdominal and retroperitoneal abscess formation and bleeding from the abdominal wall, which required a long period of postoperative management. The T-tube was removed on day 136, and the patient was transferred on day 153.The cause of CBD perforation is commonly considered to be increased intraductal pressure or weakness of the bile duct wall. In this case, pancreaticobiliary maljunction may have significantly influenced onset and the postoperative course. This case suggests that early surgical intervention and appropriate drainage are important to ensure survival. Spontaneous common bile duct (CBD) perforation has been described as a perforation of the CBD without traumatic or iatrogenic injury . It is rA 71-year-old woman was transported to the emergency department of another hospital because of consciousness disorder. Enhanced computed tomography (CT) showed an amount of free fluid in the peritoneal cavity mainly around the right upper abdomen without free air. Ultrasonography identified cholecystolithiasis. Paracentesis revealed intra-abdominal bilious fluid with high levels of total bilirubin (21.6\u00a0mg/dL) and amylase (8697\u00a0U/L) on biochemical examination. She was diagnosed as having severe peritonitis with septic shock and was transferred to our hospital for emergency surgery and intensive care management.She had no history of past abdominal operations, and other past medical history included choledocholithiasis and pancreatitis. Hematological investigations on admission revealed coagulopathy, renal dysfunction, and circulatory insufficiency Table , which iIntraoperative findings revealed a large amount of bilious ascites along with edematous omentum. No perforation was apparent either in the gallbladder or the gastrointestinal tract. A necrotic diverticulum-like change with bile leakage was present on the supraduodenal part of the CBD. After the necrotic lesion was removed, a 2.5\u2009\u00d7\u20091\u00a0cm perforation was found on the anterolateral wall of the CBD, below the junction of the common hepatic duct and cystic duct Fig.\u00a0a, b. IntThe patient remained unstable and required inotropic agents, artificial respirator support and continuous hemodiafiltration in the intensive care unit until postoperative day 10. Furthermore, multiple additional drainage, and administration of antibacterial and antifungal agents were required for the refractory intra-abdominal and retroperitoneal abscesses. On day 16, active bleeding was observed at the abdominal wall around the T-tube, and hemostasis was achieved by transcatheter arterial embolization. On day 55, T-tube cholangiography revealed that the impacting CBD stone had disappeared naturally and, thus, the long common channel of the pancreaticobiliary duct and the diagnosed pancreaticobiliary maljunction could be observed  in this review could be diagnosed preoperatively. In these cases, the authors reported that the loss of bile duct wall continuity on CT and high bilirubin levels in ascites were important diagnostic factors % in this, 23, 24.Surgical intervention is an effective treatment for CBD perforation as shown in our case. It is important to drain the abdominal contamination caused by the infected bilious peritoneal fluid. In most cases, T-tube drainage was followed by elective treatment for the causative diseases, such as endoscopic lithotomy for choledocholithiasis, resection of an extrahepatic bile duct, and hepaticojejunostomy for congenital biliary dilation. In cases diagnosed as idiopathic after detailed evaluation, the T-tube was removed without additional treatment. As a result of this review, we recommend prompt and appropriate peritoneal and biliary drainage in the unstable phase with peritonitis, followed by accurate assessment of the necessity of additional treatment for the background disease in the stable phase.Postoperatively, our patient suffered from refractory intra-abdominal and retroperitoneal abscesses and the hemorrhagic shock due to the rupture of an aneurysm formed along the T-tube fistula. Our review indicated that postoperative complications such as bile leakage or intraabdominal abscess were reported in 30.4% of the cases. Compared to the patients in the literature review, our patient required more time for treatment of postoperative complications, and we considered that one of the reasons was due to the mechanism of pancreaticobiliary maljunction. Pancreaticobiliary maljunction is generally accepted as a congenital condition in which the pancreatic and bile ducts join anatomically outside the duodenal wall. Because the action of the sphincter of Oddi does not affect the pancreaticobiliary junction, pancreaticobiliary reflux occurs. As a result, various pathologic conditions, such as obstruction of bile and pancreatic outflow, carcinoma, or inflammation, can occur . In the One of the clinical questions in the presented case is whether the diverticulum-like imaging finding of CBD was due to the coexistence of congenital biliary dilation, type II by Todani\u2019s classification, or secondary changes associated with perforation. Glenn et al. suggested that congenital biliary dilatation that forms a diverticulum may be due to hypoplasia of the bile duct wall muscularis . PreviouThis is the first case report of spontaneous CBD perforation accompanied with pancreaticobiliary maljunction. Early surgical treatment and appropriate perioperative management prevented mortality in our patient. Spontaneous CBD perforation should be considered in the differential diagnosis if the perforation cannot be identified during exploratory laparotomy."}
+{"text": "Diet recommendations changed in 41 of 63 (65%) enrolled patients (p < 0.001). Conclusion: Instrumental diagnostic by FEES during the early convalescence period of stroke patients leads to clinically relevant changes to diet restrictions and lower rates of pneumonia. Our findings underline the need for regular and qualitative dysphagia diagnostics in stroke patients participating in neurological rehabilitation.Background: Dysphagia assessment in postacute stroke patients can decrease the incidence of complications like malnutrition, dehydration, and aspiration pneumonia. It also helps to avoid unnecessary diet restrictions. The aim of this study is to verify if regular reassessment of dysphagia would change the diet management of postacute stroke patients in rehabilitation settings. Methods: This single-center retrospective study included 63 patients referred to an inpatient neurological rehabilitation center between 2018\u20132019. A standardized clinical swallowing evaluation and Fiberoptic Endoscopic Evaluation of Swallowing (FEES) were performed. Diet level according to Functional Oral Intake Scale (FOIS) was evaluated. As the primary endpoint, the FOIS values based on diagnostic procedures were assessed at hospital discharge, rehabilitation admission, and after FEES. Results: 19 women (30%) and 44 men (70%), with a mean age of 75 y (SD \u00b1 10.08), were enrolled. The intergroup ANOVA revealed significant differences ( The total number of prevalent strokes, deaths, and disability-adjusted life years due to stroke has increased steadily worldwide from 1990, reaching 101 million prevalent stroke survivors, 6.55 million deaths from stroke, and 143 million disability-adjusted life years due to stroke in 2019 . Dysphagia can be assessed using various methods, including bedside swallowing tests or a formal instrumental assessment. Up to now, no gold standard dysphagia assessment protocol has been defined and implemented . There iVideofluoroscopic swallowing study (VFSS) and fiberoptic endoscopic evaluation of swallowing (FEES) are complimentary modalities. According to international organizations nowadays, both methods should, ideally, be available . Recent The aim of this study is to verify if the reassessment of dysphagia and, in particular, FEES would change the diet management of poststroke patients and lead to clinically relevant changes in diet restrictions in the rehabilitation setting.We hypothesize that the reassessment of dysphagia during the early convalescence period of stroke patients may lead to significant changes in diet restrictions.TM, CompuGroup Medical AG, 3007 Bern, Switzerland). We used RehaTISTM  to record and manage the individual rehabilitation process of each participant, including all therapies and procedures. All patients gave written informed general consent at admission. The local ethics committee approved the study protocol .The patient data and results of the assessments were sourced for analysis from our clinic information system (Phoenix(1)the first diagnosis of stroke and(2)stable medical condition.We retrospectively analyzed the records of 620 patients with an ICD-10-CM Code: I60\u2013I69 diagnosis (cerebrovascular diseases) who had been referred for neurological inpatient rehabilitation to Z\u00fcrcher RehaZentren, Klinik Wald, Switzerland from stroke units and acute wards of various regional hospitals between January 2018 and December 2019. Sixty-three patients met the study inclusion criteria and were enrolled. The mean period from stroke onset to presentation in our rehabilitation facility was 2.5 weeks (SD \u00b1 7 days). The inclusion criteria were as follows:We excluded patients with(1)n = 69),known history of swallowing difficulties due to previous strokes ((2)n = 19),presence of neurological conditions other than stroke, which could lead to dysphagia ((3)n = 220),no referral for SLP intervention ((4)n = 168),referral for SLP intervention for reasons other than dysphagia ((5)n = 28)patients who required a change in oral diet due to reasons other than dysphagia  ((6)n = 21),data missing in the medical records\u2019 prior dysphagia assessments ((7)n = 32).transferred back to a hospital before completed diagnostics , occurrence of pneumonia, and length of rehabilitation stay.The chart review process is depicted in On the day of admission, the dietary levels assigned in the acute care institution (T1) were translated to Functional Oral Intake Scale (FOIS)  values. Within the first 6 h, patients admitted to the rehabilitation facility underwent specific screening procedures by nurses, physicians, physiotherapists, and occupational therapists. On that basis and the results of the clinical diagnosis, the so-called \u201cadmission coordination report\u201d is issued. It defines the goal of treatment to be attained, the limitations of the patients, the results of swallow screening by nurses, and the need for other types of therapy . Dysphagia was considered present when (1)listed as a medical diagnosis,(2)confirmed by previous diagnostic procedures documented in the patient\u2019s records,(3)diet status prescribed in acute care,(4)stated by staff in the admission-coordination-report.After referral to SLT, the risk of dysphagia was reassessed with the Standardized Swallowing Assessment (SSA) using a binary present/absent scoring . This meIn the next step, the Clinical Swallowing Evaluation (CSE) was performed according to the in-house protocol based on the screening protocol for neurogenic dysphagia ,18. This\u00ae, Rehder & Partner Company, Methfesselstra\u00dfe 74, 20,257 Hamburg, Germany). Due to institutional protocol, the neurologist supervised the analysis and authorized the final FEES report.FEES was performed as a standard diagnostic procedure for all patients suspected of dysphagia. An experienced neurologist and one or two certified SLPs carried out the FEES protocol. The examination was recorded and subjected to a video analysis , with the highest PAS score of all tested consistencies recorded. The results were recorded and then classified as follows: (1) PAS I\u2013II: normal\u2013mild  (2) PAS III\u2013V: moderate (penetrations), (3) PAS VI\u2013VIII: severe (aspirations), and (4) PAS VIII: silent aspiration .The type of diet was determined for each patient after the clinical and instrumental swallowing examination. The dietary levels (including the dietary levels assigned by the acute care institution) were translated into Functional Oral Intake Scale (FOIS) values. FOIS was used to assess the oral intake of the patients classified by an ordinal rating scale, including seven tries. Levels 1\u20133 describe tube dependency, where Level 1 describes patients with no oral intake, and Levels 2\u20133 describe tube-dependent patients. Levels 4\u20137 describe full oralization, where Levels 4\u20136 are for patients who have not yet reached oral diet expansion, and Level 7 is for patients who have fully reached diet expansion . To measure the change in functional limitations of patients during rehabilitation, the Functional Independence Measurement (FIM) is performed on admission and before discharge. FIM is an 18-item measurement tool that explores the severity of an individual\u2019s physical and psychological disability, especially in rehabilitation patients .t-test was used to determine differences in baseline characteristics between the groups of patients with and without diet changes. All variables were expressed as mean \u00b1 standard deviation (SD). Before using a parametric test, the assumption of normality was verified using the Kolmogorov\u2013Smirnov test. The distributions of all variables were normal or close to normal. The numbers of quality data for analyzing groups were obtained using an analysis of the contingency table. Student p < 0.05, to determine intergroup statistically significant differences between PAS scores for FOIS variables prior to rehabilitation, at admission, and after instrumental diagnostic. When appropriate, a Tukey post hoc test was used to compare selected data, and the effect of each test was calculated to determine the significance of the results. The effect size (\u03b72) was classified according to Hopkins as 0.01\u2014small, 0.06\u2014medium, and 0.14\u2014large. Values of p < 0.05 were considered significant. The remaining analyses were performed using STATISTICA  version 12).One-way ANOVA was used, with significance set at The study group consisted of 63 persons, including 19 women and 44 men, with a mean age of 75 (SD \u00b1 10.08) years. The baseline characteristics and differences in patients with and without a change in diet type are summarized in At the time of transfer (T1), 34 patients were fully tube-dependent (FOIS 1). Seven were tube-dependent with some oral intake (FOIS 2\u20133). Seventeen patients were not tube-dependent but restricted in their oral diet (FOIS 4\u20136); five patients had no restrictions in oral intake. The mean FOIS value at T1 was 2.59 (SD \u00b1 2.08).The initial dysphagia screening (T2) was positive in 58 of 63 patients. In 57 patients, two or more predictors of aspiration were recorded. Only 6 patients presented with one or no clinical indicator but were referred for further diagnostic workup due to clinical suspicion of dysphagia. Based on these results, we changed the diet recommendations in 27 patients, with lower dietary restrictions in 19 patients and increased restrictions in 8 patients. In 36 patients, we did not make any diet modifications; 27 patients were still tube-dependent. The mean FOIS value at T2 was 2.79 (SD \u00b1 1.81). On average, all 63 patients underwent FEES examination (T3) five days following the first dietary prescription. FEES identified 21 patients with penetration episodes (PAS III\u2013V). Aspiration (PAS VI\u2013VIII) was found in 38 patients, including 24 patients with silent aspiration (PAS VIII). Due to the FEES results, a diet modification was required in 41 patients, with a lowering of restrictions in 38 cases. In three patients, we increased restrictions, and one patient additionally received a nasogastric tube to protect him from aspiration. In 12 cases, no oral intake was recommended. The mean FOIS value at T3 was 3.67 (SD \u00b1 1.92). p = 0.001). The contingency tables analysis revealed 25 individuals with PAS I\u2013V and 38 with PAS VI\u2013VIII, including 24 individuals only with PAS VIII. Posthoc tests revealed statistically significant differences between aspiration (PAS VI\u2013VIII and VIII) vs. normal (PAS I\u2013II) and penetration values (PAS III\u2013V) for FOIS at T1, T2, and T3. A statistically significant increase was observed for FOIS at T3 in reference to FOIS at T1 and T2 in all aspects of PAS I\u2013II, III\u2013V, VI\u2013VIII, and VIII groups . We also noted significantly higher general FIM scores at discharge in those patients (mean 74.5 (SD \u00b117.4) vs. 68.5 (SD \u00b113.15); p = 0.031). Furthermore, we found differences in baseline characteristics in patients with adjustment of diet. In this group, rates of pneumonia were significantly lower than in patients without diet change . However, patients with restrictive adjustment of diet had a longer rehabilitation stay of 42.5 days (SD \u00b1 22.5) vs. 39 days (SD \u00b1 18) (p = 0.337).The length of stay was only minimally shorter in the patient group with diet change than in patients without diet adjustment (38 days (SD \u00b1 19.5) vs. 39 days (SD \u00b1 20.5), The aim of this study is to verify if the reassessment of dysphagia and, in particular, FEES would change the diet management of poststroke patients and lead to clinically relevant changes in diet restrictions in the rehabilitation setting.The results of the study illustrate that a comprehensive reassessment of poststroke dysphagia in the rehabilitation setting contributed significantly to clinically relevant changes in the diet restrictions of 65% of our cohort. The necessity for dysphagia reassessment as a routine has not yet been established, although national and international guidelines recommend an assessment of dysphagia in stroke survivors in acute care ,9. Our sOnly in a minority of the patients\u2019 transfer records (40%), documentation of the initial dysphagia assessment of the acute care facility was included. In the majority (60%), the dysphagia assessment in acute care was not mentioned. Heckert et al. reported comparable rates in 2009. In their study population, the diagnosis of dysphagia was mentioned in only 36% of transfer records .In this study, all patients with suspected dysphagia were assessed using clinical and instrumental diagnostics. The results showed that a standardized swallowing assessment was positive for the presence of dysphagia in 92% of cases, which is comparable to previously published data . HoweverAccording to Warnecke et al. , the accBased on the FEES results, a significant change in diet occurred in 65% of the patient cohort in this study, with diet restrictions being decreased in 60% and increased in 5% of patients. These results are supported by a recent German hospital study by Braun et al. . In 72% Our study shows comparable results. We observed a statistically significant increase in FOIS values after the FEES examination (T3) compared to the FOIS values on discharge (T1) and after the clinical swallowing examination (T2) in all aspects of penetration and aspiration episodes. The present study also shows significantly lower rates of pneumonia, a significantly better general FIM score on discharge, and a shorter length of stay in patients with dietary changes.According to Cohen et al., pneumonia prevention does not only include the early detection of swallowing disorders . Both thAt the time of transfer from the hospital, 54% of our patients were tube-dependent. The study by Teuschl et al. showed similar results, where 60% of cases of pneumonia were recorded in patients without oral intake .Brogan et al. argued that there is a relationship between pneumonia and long waiting times for clinical swallowing tests in patients, as these waiting times have been synonymous with oral abstinence . A similIn our cohort, the time span between admission and introduction of instrumental diagnostics was 5 days (mean). In patients with an adjustment of diet, we also observed significantly lower rates of pneumonia compared to patients without diet change. That assumes that the implementation of the diagnostic approach might have prevented the occurrence of pneumonia.Some limitations exist in our study. It is a retrospective cohort study performed at a single center, with unavoidable biases and limitations. Moreover, the sample size was small, and we lacked a validated tool for the screening of dysphagia. To validate and expand our findings, future prospective research in this field is needed.Instrumental diagnostics by FEES during the early convalescence period of stroke patients lead to clinically relevant changes to the diet and lower rates of pneumonia. Our findings underline the need for regular and qualitative dysphagia diagnostics during stroke rehabilitation."}
+{"text": "Changes in the expression of IL-1\u03b2, TNF-\u03b1, and BDNF in NG2 cells were detected after the addition of 5-HT receptor specific blockers and phospholipase C (PLC) specific activators and inhibitors. The results confirmed that the NG2 protein and 5-HT co-localized in the prefrontal cortex. 5-HT treatment of NG2 cells significantly reduced the expression of IL-1\u03b2 and BDNF mRNA and increased the expression of TNF-\u03b1. The 5-HT receptor specific inhibitors alverine citrate, ketanserin, ondansetron and SB-399885 blocked the regulatory effects of 5-HT on NG2 cells. The PLC signal was linked to the secretion of IL-1\u03b2, TNF-\u03b1 and BDNF in NG2 cells. These results indicated that 5-HT affected IL-1\u03b2, TNF-\u03b1, and BDNF secretion from NG2 cells via the 5-HT1A, 5-HT2A, 5-HT3, 5-HT6 receptors and the PLC signaling pathway.The present study was clarified the relationship between NG2 glial cells and 5-hydroxytryptamine (5-HT) to further revealed a role in the regulation of cortical excitability. The co-localization of NG2 cells and 5-HT in rat prefrontal cortex was determined using immunofluorescence. Different concentrations of 5-HT were applied to cultured NG2 cells. Real-time PCR measured the expression of interleukin-1 These\u03b1) \u20136. They \u03b1) , 8. The  the CNS  .Moreoveal cells , 11. Recunctions . BDNF waunctions .\u03b24 subtype is uniquely localized in the geniculate nucleus of the thalamus, which is postulated to have a key role in the transition and maintenance of sleep stages. PLC-\u03b24\u2212/\u2212 mice exhibited increased REM sleep and unusual wake-to-REM sleep transitions at night [5-HT is an important monoamine neurotransmitter in the CNS, and it is synthesized primarily in the raphe nuclei . This neat night . The actat night . Our pre\u03b2, TNF-\u03b1 and BDNF was associated with 5-HT. The results showed that the effects of 5-HT on NG2 cell secretion was related to 5-HT1A, 5-HT2A, 5-HT3 and 5-HT6 receptors and the PLC signaling pathway.The present study examined whether NG2 cell secretion of IL-1Adult male Sprague-Dawley (SD) rats (Tianqin Biotechnology Co. Ltd. China) were used for immunofluorescence study. All relevant experiments were performed in accordance with the protocol of the National Institutes of Health and institutional guidelines for the humane care of animals. All efforts were made to reduce the number of animals used and minimize any pain and discomfort.2 humidified atmosphere.NG2 cells, namely rat oligodendrocyte precursor cells (ROPCs), were provided by Qingqi  Biotechnology Development Co, Ltd. Cells were routinely cultivated in dulbecco's modified eagle medium (DMEM) with high glucose  supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml) and streptomycin (100\u2009\u00b5g/ml) at 37\u00b0C in a 5% CO\u03bcM) for 24 hours. NG2 cells were treated with various receptor (5-HT) inhibitors and specific activators/inhibitors of intracellular signals, such as 5-H1A, 5-HT2A, 5-HT3 and 5-HT6 receptors, including the 5-HT1AR, 5-HT2AR and 5-HT6R nonspecific antagonist asenapine maleate , the 5-HT1A specific receptor inhibitor alverine citrate (1.25\u2009\u03bcM), the 5-HT2A specific receptor inhibitor ketanserin (37.5\u2009\u03bcM), the 5-HT3 specific receptor inhibitor ondansetron (5\u2009\u03bcM), the 5-HT6 specific receptor inhibitor SB-399885 (1\u2009\u03bcM), the PLC specific activator m-3M3FBS (3\u2009\u03bcM) and the specific inhibitor U-73122 (2.5\u2009\u03bcM). These reagents were applied with 5-HT (100\u2009\u03bcM) for 24\u2009hours.For 5-HT-induced NG2 cell secretion assays, according to the results of the pre-experiment, the cells were treated with 5-HT  and anti-TPH . Subsequently, sections were incubated with secondary antibodies, including ALexa Fluor 488  and ALexa Fluor 594 , for 1 hour at 37\u00b0C protected from light. These were followed by counterstained with a DAPI Mix . Finally, sections were observed under a fluorescence inverted microscope . Fluorescence was detected using excitation wavelengths of 488 nm (green), 649 nm (red) and 358 nm (blue) , respectively. NG2 cells (red fluorescence) and 5-HT neuronal markers (green fluorescence) were observed. When two immunofluorescence images overlapped in yellow (red\u2009+\u2009green\u2009=\u2009yellow), the two markers exhibited co-expression [The brain was removed after perfusion and the prefrontal cortex was cut into 30-5 cells/well) were seeded in 6-well plates and treated with each group for 24 hours. The protein levels of TNF-\u03b1, IL-1\u03b2 and BDNF in the cell supernatants were detected using ELISA kits, according to the manufacturer's instructions. ELISA kits for rat IL-1\u03b2 , TNF-\u03b1  and BDNF  [NG2 cells in the exponential growth phase  .5 cells/well) were seeded in 6-well plates and treated with each group for 24 \u2009hours. Intracellular total RNA was extracted using a kit . cDNA was reverse transcribed with a kit , and 2\u2009\u00d7 SYBR Green qPCR Mix  was used for real-time PCR. Real-time PCR . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference gene. The amplified products were resolved by 1.5% agarose gel electrophoresis and visualized using ethidium bromide staining and a UV light source. Each experiment was repeated three times with three replicate wells, and the results were analyzed using the 2\u2212\u0394\u0394Ct method to determine the relative expression. All primers and the related sequences used in the experiments are shown in NG2 cells in the exponential growth phase (2\u2009\u00d7\u2009105 cells/well) were seeded in 6-well plates, and all the experimental groups were incubated for 24\u2009 hours. The protein expression of PLC , IL-1\u03b2 , TNF-\u03b1  and BDNF  was determined using Western blot (WB) analysis. Protein extracts were separated using 5% gum concentrate and 12% separating adhesive and transferred to PVDF membranes. The membranes were blocked with TBST buffer and kept at room temperature for 2\u2009hours on a shaker. The corresponding primary antibody was diluted in the blocking solution and the PVDF membranes were immersed in the primary antibody incubation solution overnight at 4\u00b0C. The membranes were rinsed three times with TBST buffer and incubated with a secondary Ab for 2 hours at room temperature. After four rinses with TBST buffer, the PVDF membranes were scanned and imaged.NG2 cells in the exponential growth phase . Outcomes are presented as the means\u2009\u00b1\u2009SD from at least three separate experiments. Distinctions between groups were analyzed using one-way analysis of variance (one-way ANOVA) followed by post hoc tests using LSD or Dunnett's test. Statistical differences at To determine whether NG2 cells co-localized with 5-HT neuronal markers (TPHs) in the prefrontal cortex, double immunofluorescence staining was performed using NG2 and TPH antibodies. As shown in To further investigate the functional relationship between NG2 cells and 5-HT, real-time PCR was used to detect 5-HT receptors expressed on NG2 cells. The expression of the 5-HT1A, 5-HT2A, 5-HT3, 5-HT5, 5-HT6 and 5-HT7 receptors was detected on NG2 cells .\u03b2, TNF-\u03b1 and BDNF in NG2 cells was associated with 5-HT, we used different concentrations of 5-HT  to stimulate NG2 cells. \u03b2 and BDNF and significantly increased TNF-\u03b1 secretion. These results showed that 5-HT induced the secretion of IL-1\u03b2, TNF-\u03b1 and BDNF in NG2 cells.To investigate whether the secretion of IL-1\u03b2, TNF-\u03b1 and BDNF secretion. We used the nonspecific antagonist asenapine maleate (Ase) to block 5-HT1AR, 5-HT2AR and 5-HT6R and found elevated secretion of IL-1\u03b2, TNF-\u03b1 and BDNF in NG2 cells  or adenosine receptor 2A (A2AR) on different neuronal membranes [With the widest distribution and the largest number of neural cells in the central nervous system, glial cells fulfil various physiological functions, including the orchestration of synaptic activity, maintenance of ion homeostasis, ensuring the integrity of the blood\u2013brain barrier, and participating in neurotransmitter uptake , 23. Preembranes \u201327. The embranes .The prolembranes , 30. Actembranes , 32. Abl\u03b2, TNF-\u03b1 and BDNF are associated with cortical excitability and sleep-wake. Increased expression of IL-1\u03b2 and TNF-\u03b1 in the brain was detected in rats completely deprived of sleep for 24 hours [\u03b2 and TNF-\u03b1 expression induce slow-wave sleep [\u03b2, TNF-\u03b1 and BDNF in sleep regulation are related to the degree of insomnia and the concentration and duration of IL-1\u03b2, TNF-\u03b1 and BDNF effects. This study found that different concentrations of 5-HT  stimulated NG2 cells to secrete IL-1\u03b2, TNF-\u03b1 and BDNF. 5-HT  significantly inhibited the secretion of IL-1\u03b2 and BDNF, while 5-HT  significantly increased the secretion of TNF-\u03b1. The results showed that 5-HT could significantly increase the secretion of TNF-\u03b1. NG2 cells were induced to secrete IL-1\u03b2, TNF-\u03b1 and BDNF.In summary, NG2 cells may be related to central nervous system excitability and sleep-wake regulation. Notably, IL-124 hours . High leve sleep . Increasve sleep . These s\u03b2, TNF-\u03b1 and BDNF. 5-HT may regulate the release of IL-1\u03b2, TNF-\u03b1, BDNF and other sleep regulation-related active substances by affecting the glial system, which regulates the neuronal and glial cell activity involved in the regulation of cortical excitability. Their specific roles and mechanisms are discussed further below.Our study revealed that 5-HT acted on NG2 cells to regulate the secretory levels of IL-1The raphe nucleus group, located in the reticular structure of the brainstem, contains the cell bodies of 5-HT neurons , 36. Des\u03b1q, G\u03b1i/o and G\u03b112/13 proteins in vitro and in vivo. Stimulation of the G\u03b1q pathway activates PLC, generates inositol-1,4,5-triphosphate (IP3) and diacylglycerol (DAG), and releases calcium from intracellular stores to induce specific biological effects. The present study used 5-HT2AR receptor inhibitors and PLC signaling pathway inhibitors and showed consistent trends in the secretory levels of IL-1\u03b2, TNF-\u03b1 and BDNF from NG2 cells. Our results suggest that 5-HT regulates the secretion of IL-1\u03b2, TNF-\u03b1 and BDNF by affecting the 5-HT2AR-coupled PLC signaling pathway in NG2 cells. In summary, 5-HT may regulate cytokine activity via interaction with NG2 cells, which affects cortical excitability.5-HT acts via 5-HT receptors. The 5-HTRs in mammals are organized into seven families (5-HT1-7R), and more than 16 subtypes have been described. 5-HT1AR and 5-HT1BR activation may hyperpolarize the cell membrane by inhibiting adenylate cyclase. 5-HT2AR and 5-HT2BR regulation by PLC leads to cell membrane depolarization. 5-HT3R activation depolarizes acetylcholine and amino acidergic neurons, and 5-HT6R and 5-HT7R receptor activation leads to depolarization of neurons that participate in the regulation of cortical excitability . 5-HT fu\u03b2, TNF-\u03b1, and BDNF via 5-HT1A, 5-HT2A, 5-HT3, and 5-HT6 receptors, through PLC signaling pathway.NG2 positive cells and 5-HT neuronal marker TPH were co-localized in the prefrontal cortex. 5-HT1A, 5-HT2A, 5-HT3, 5-HT6, and 5-HT7 receptors can be expressed on NG2 cells. 5-HT affected NG2 cells secretion of IL-1"}
+{"text": "Pelargonium \u00d7 hortorum cultivars and Pelargonium sidoides root extract. It revealed the presence of catechin and gallic acid in high concentrations and the absence of umckalin in P. \u00d7 hortorum root extracts. The antibacterial activity of these extracts was screened against 19 Pseudomonas aeruginosa clinical isolates. P. \u00d7 hortorum root extracts showed the lowest MIC values (512\u20131024 \u00b5g/mL). This activity was concluded to be attributable to the high concentrations of catechin and gallic acid. The anti-biofilm activity of catechin, gallic acid, and their combination was examined by a crystal violet assay. The combination reduced the percentage of strong and moderate biofilm-forming isolates from 52.63% to 5.26%. The impact on lasI and lasR genes expression using qRT-PCR and simultaneous docking against LasR protein was explored. The combination downregulated lasI and lasR gene expression in eight and six P. aeruginosa isolates, respectively, and showed the greatest docking score. Additionally, the in vivo protection capability of this combination in infected mice showed enhancement in the survival rate. Our study revealed the potential biofilm and quorum-sensing-inhibitory activity of the catechin and gallic acid combination as a novel alternative to inhibit bacterial pathogenicity.HPLC-UV was used to compare the major constituents of two  Pelargonium \u00d7 hortorum, commonly known as zonal or garden geranium, is one of the most popular ornamental crops that is believed to be originated by cross hybridization between several wild species of genus Pelargonium section Ciconium [Ciconium ,2. It isPelargonium sidoides  is a medicinal plant belonging to the genus Pelargonium. It is used traditionally for the treatment of many disorders, including upper respiratory tract infections, such as bronchitis, common cold, and sinusitis [P. sidoides showed antibacterial and antiviral activities against several respiratory pathogens [Pelargonium \u00d7 hortorum plants, and the medicinal importance of other species belonging to the same genus, the research studies investigating their phytochemical composition and medicinal uses are limited. Previous phytochemical research indicated that the therapeutic effect of P. sidoides is partly attributed to catechin, gallic acid, and highly oxygenated coumarins, including scopoletin, and umckalin [Pelargonium \u00d7 hortorum cultivars grown in Saudi Arabia as ornamental flowering plants and comparing the obtained results to that of the root extract of the medicinal plant, P. sidoides, using the HPLC-UV technique.inusitis . The maiathogens ,5,6. Desumckalin ,8. TherePseudomonas aeruginosa is a ubiquitous opportunistic Gram-negative pathogenic bacterium. It is one of the major causes of hospital-acquired infections [Disseminating antibiotic resistance among the pathogenic bacterial isolates is regarded as a major public health concern owing to the high number of patients suffering from untreatable serious infections . Pseudomfections ,11. It cfections . Bacterifections . In addifections ,15. Virufections . This apfections . LasI/LasR is a major pathway used by P. aeruginosa for the regulation of quorum sensing using autoinducers such as acyl-homoserine lactones which activate the transcriptional regulators in the bacterial cells and induce gene transcription. Therefore, the inhibition of quorum sensing (QS) by targeting LasI and LasR enzymes could help in decreasing the antibiotic resistance and pathogenicity of P. aeruginosa [ruginosa ,18. Pelargonium \u00d7 hortorum cultivars and their major biological markers against P. aeruginosa clinical isolates was investigated. We also elucidated the anti-biofilm and anti-quorum-sensing potential of the tested biological markers. Moreover, their mechanism of action was investigated using qRT-PCR and in silico docking studies against the main targets involved in the coordination of QS in P. aeruginosa.In this study, the antibacterial activity of the methanolic extracts of different parts of Pelargonium \u00d7 hortorum and P. sidoides are important plants belonging to the same genus in the family Geraniaceae. However, there is no established analytical method that could compare the phytochemical profile of both plants. In this study, two P. \u00d7 hortorum cultivars, with pink flowers (PPH), P. sidoides root extract was obtained from the commercial kalobin\u00ae solution. The method used for the comparative study is based on the presence of four reported biomarkers, including catechin, gallic acid, scopoletin, and umckalin , a flow rate of 1 mL/min, an injection volume of 20 \u00b5L, a run time of 25 min, on a Waters XBridge\u00ae C18 column  employed at 30 \u00b0C and a wavelength of 210 nm. This analytical method is fully validated in accordance with the guidelines of the International Council for Harmonization (ICH) to show that it is linear, accurate, precise, and fast. The conditions of the simultaneous chromatographic separation were optimized by changing one parameter while maintaining other parameters constant at a time. These parameters included the mobile phase, stationary phase, wavelength, and samples preparation method. Several trials were performed with separate values of acetonitrile-water ratio and pH. The most appropriate chromatographic settings for the current study were using the acetonitrile-water ratio, 20:80 The four investigated biomolecules were simultaneously eluted yielding symmetrical peaks within 25 min as a minimum time of analysis, P. sidoides showed the presence of detectable peaks corresponding to the investigated biomolecules with concentrations of 22, 10.96, 0, and 3.09 \u03bcg/mL for gallic acid, catechin, scopoletin, and umckalin, respectively (The HPLC-UV chromatogram of ectively b. f 0.11) on silica gel GF254, using the solvent system; CHCl3-CH3OH, 90:10 v/v . Moreover, none of the investigated P. \u00d7 hortorum extracts showed the presence of peaks corresponding to the coumarin biomarker, umckalin; The root extracts of PPH and WPH showed the presence of appreciable amounts of gallic acid  and catechin  with observable higher concentrations in PPH as displayed in 0:10 v/v . SimilarP. \u00d7 hortorum cultivars can be distinguished from that of the medicinally used P. sidoides species by the absence of the prominent characteristic peak for umckalin. This result is in full agreement with the conclusion drawn by Harborne and Williams [P. sidoides from garden geraniums. We can also conclude the presence of catechin and gallic acid combination in higher concentrations in P. \u00d7 hortorum root extracts in comparison to P. sidoides root extract. The root extract of Pelargonium \u00d7 hortorum, especially the cultivar with the pink flowers (PPH), can be considered as a rich source for catechin and gallic acid phytochemical combination.Therefore, by comparing the chromatograms  and the Williams  which inP. \u00d7 hortorum plants are cultivated varieties \u201ccultivars\u201d that refer to man-made variations within the plant species to obtain desirable characteristics. Creating new cultivars with superior traits is crucial, especially in the field of growing medicinal plants [Phenolic compounds, such as flavonoids, anthocyanins, coumarins, and hydroxycinnamic acids, are biosynthesized in plants via the shikimate pathway ,21. Phenl plants . In thisP. aeruginosa can cause severe life-threatening infections, particularly in patients who are suffering from a weak immune system such as AIDS and cancer patients. Unfortunately, many isolates of P. aeruginosa can form biofilm which enables them to be much more resistant to the available antibiotics [Pelargonium \u00d7 hortorum cultivars and P. sidoides root extract against P. aeruginosa isolates using the agar well diffusion method. Interestingly, all of the tested plant extracts exhibited antibacterial activity as they resulted in the appearance of inhibition zones around the wells. Thus, their MIC values were detected using the broth dilution method. Among the tested extracts, the root extracts of PPH and WPH showed the most promising antibacterial activity against the tested P. aeruginosa isolates. Noticeably, the root extract of PPH showed better results than that of WPH. The PPH root extract exhibited minimum inhibitory concentration (MIC) values ranging from 512 to 1024 \u00b5g/mL against 18 isolates, while WPH root extract exhibited MIC values within the same range against only 14 isolates, P. sidoides root extract exhibited higher MIC values of \u22652048 \u00b5g/mL against most of the tested isolates.ibiotics . ConsequCatechin and gallic acid are polyphenolic compounds that are widely distributed in numerous foods and plants and they are renowned for their various biological activities ,27. BothThe biological activity of the herbal plant extracts is usually attributed to the presence of combination of multiple compounds . Hence, Biofilm represents an attractive target for the anti-virulence compounds because biofilm eradication can produce a negative impact on the progression of infections . Hence, LasI/LasR is a major pathway used by P. aeruginosa for the regulation of quorum sensing using autoinducers such as acyl-homoserine lactones which activate the transcriptional regulators in the bacterial cells and induce gene transcription. As the combination of catechin and gallic acid revealed the best anti-biofilm activity, we tested its impact on the gene expression of the QS genes (lasI and lasR) in ten P. aeruginosa isolates which had a strong and moderate biofilm formation ability before treatment using qRT-PCR. Remarkably, the combinatorial treatment revealed a significant downregulation in lasI and lasR gene expression in eight and six P. aeruginosa isolates, respectively, as revealed in During the biofilm formation, bacterial cells communicate with each other via the QS system which induces biofilm formation, regulates the metabolic activity of the planktonic cells, and increases their virulence. in vivo antibacterial activity. The survival curve of the experimental groups was constructed as revealed in P. aeruginosa, four mice died after two days, four mice died after four days, and the rest died after one week. Interestingly, one mouse only died after eight days in group III representing the mice infected with P. aeruginosa treated with gallic acid and catechin combination and the remaining mice remained alive till the end of the experiment. The combination revealed a significant (p < 0.05) decline in the killing capability of the treated isolates when compared to the non-treated ones.Moreover, the protective effect of catechin and gallic acid combination was investigated in a mice model to evaluate its LasR) that is essential for QS in P. aeruginosa to investigate the mechanism of action of gallic acid, catechin, and their combination. Simultaneous docking is a new function that has been implemented into the new version of AutoDock Vina 1.2.0 which enables the docking of multiple ligands to the same target simultaneously [LasR simultaneously. Interestingly, the docked combination showed the highest docking score , P. sidoides.Two 3OH (3 \u00d7 100 mL). The CH3OH extracts were combined and concentrated using a rotary evaporator at 45 \u00b0C then allowed to dry at room temperature. The dried total CH3OH extracts of WPH yielded leaf extract , flower extract , root extract , and stem extract . While the dried total CH3OH extracts of PPH yielded leaf extract , flower , root extract , and stem extract . The obtained dry extracts were kept in closed containers in a refrigerator to be used in HPLC analyses.The different dried powdered parts of WPH, including 15 g of leaves, 1.9 g of flowers, 3.5 g of stems, and 3.5 g of roots, in addition to 12 g of leaves, 3 g of flowers, 6 g of roots, and 9.5 g of stems of PPH were extracted separately by rinsing with CH3CN , methanol, CH3OH , orthophosphoric acid, H3PO4  were used in the preparation of the mobile phase. Nylon membrane filters of 0.45 \u03bcm pore size were used in solvent filtration . Ultra-pure (HPLC grade) water was obtained using a Milli-Q water purification system.Acetonitrile, CH18 column, 200 mm L. \u00d7 4.6 mm W., and 5 \u00b5m particle size . The system was supplied with an HPLC photodiode-array detector (SPD-20 A) set at a wavelength of 210 nm. The HPLC instrument was interfaced with a computer installed with LabSolutions software on a Microsoft Windows 7.0 operating system.HPLC chromatographic investigation was achieved utilizing a UFLC-SHIMADZU 1200 series UFLC system  provided with a binary pump, an autosampler, and an online degasser. Separation was achieved on a C3CN-H2O  with an adjusted pH at 3.0 by adding drops of 10% H3PO4. The mobile phase was then filtered by a 0.45 \u00b5m membrane filter and degassed by a sonicator for 15 min. The column was set at 30 \u00b0C as the operating temperature. An injection volume of 20 \u00b5L, a flow rate of 1 mL/min, and a total run time of 25 min were maintained during investigations.Isocratic elution was applied using a mobile phase composed of CHFour standards were used in this study, including umckalin , scopoletin , (+)-catechin , and gallic acid , 3OH to obtain 1 mg/mL solution. Then, each solution was further diluted with CH3OH to obtain a 100 \u00b5g/mL final concentration. To prepare a serial dilution, the obtained stock solution, in each case, was further diluted with CH3OH to obtain different concentrations ranging from 0.1 to 1 \u00b5g/mL.The standard stock solutions of catechin, gallic acid, scopoletin, and umckalin were prepared by dissolving 10 mg of each reference standard in 10 mL of CH3OH to obtain 200 \u00b5g/mL concentration, followed by transferring 8.75 mL of the last solution to a 25 mL volumetric flask and adjusting the volume with  to obtain 70 \u00b5g/mL concentration. Aliquots of 20 \u00b5L of this working solution were injected, the chromatograms were recorded, and the responses of the peak areas were calculated. Percentages of catechin, gallic acid, scopoletin, and umckalin in different parts of the investigated plants were recorded; then, means of the % content were calculated.The working standard solution was obtained by mixing 5 mL of each standard stock solution in a 25 mL volumetric flask, adjusting the volume with CHPelargonium \u00d7 hortorum cultivars (100 mg) were dissolved in CH3OH in a 10 mL volumetric flask, sonicated, filtered through a 0.45 \u00b5m membrane filter, and the first few mL of the filtrate was discarded to afford a 10 mg/mL solution. Aliquots of 20 \u00b5L of sample solutions were injected in triplicate and the peak areas were measured.Different extracts of \u00ae solution, which approximately contains 100 mg of P. sidoides dry root extract, were diluted with methanol in a 10 mL volumetric flask, sonicated, and filtered through a 0.45 \u00b5m membrane filter to prepare a 10 mg/mL solution. Aliquots of 20 \u00b5L of sample solution were injected in triplicate and the peak areas were measured.For HPLC analysis, 1.1 mL of KalobinP. aeruginosa clinical isolates were acquired from the culture collection of the Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Tanta University, Egypt. Pseudomonas aeruginosa ATCC 27853 was the reference isolate.Nineteen P. aeruginosa isolates to the tested agents [The agar well diffusion method was utilized for testing the susceptibility of d agents . The plad agents . In orded agents . We calcThe FICI of catechin and gallic acid in the combination was calculated according to the following formula:The two compounds were considered to have a synergetic interaction in the combination if the FICI was equal to or less than 0.5.P. aeruginosa isolates were screened for their ability to form biofilm by a crystal violet assay as previously described [escribed ,43 via dlasI and lasR) [oprL gene as a housekeeping gene [P. aeruginosa (1.0 McFarland) were added to fresh 5 mL Luria\u2013Bertani (LB) broth containing the tested compounds and grown at 37 \u00b0C for eight hours with shaking. Then, total RNA was extracted by GeneJET RNA kit  and it was converted to cDNA by the cDNA synthesis kit  according to the instructions of the manufacturer. The cDNA was amplified using SYBR\u00ae Green master mix . The primer sequences are listed in \u2212\u0394\u0394Ct method [The impact of the sub-inhibitory concentration of gallic acid and catechin combination on the QS genes (nd lasR)  was inveing gene . Overnigt method  was follWe obtained thirty male albino mice from the animal house of Cairo University, Egypt. They weighed 22 g to 27 g, and they were allowed to access freely both filtered water and a standard pellet meal. Additionally, they were retained in room temperature and a 12 h light/dark cycle . They weP. aeruginosa [P. aeruginosa were prepared (1 \u00d7 108 CFU/mL) with and without treatment with sub-inhibitory concentrations of the combination. They were intraperitoneally injected into the animals. Then, mice were randomly grouped into three groups (n = 10 mice): group I non-infected normal group, group II infected with untreated P. aeruginosa, and group III infected with treated P. aeruginosa. Survival of the mice was monitored for two weeks.The survival rate was determined in the different experimental groups to evaluate the ability of the combination to protect the mice against the infection caused by ruginosa . In briep < 0.05. A Kaplan\u2013Meier survival curve was established for assessing the survival rate of the animals. We used Graph Pad Prism software for the statistical analysis .Experiments were conducted in triplicate and the results are presented as mean \u00b1 standard deviation (SD). Two-way ANOVA was utilized for evaluating the statistical significance at The molecular docking study was executed using the new version of Autodock vina 1.2.3 ,47 as dePelargonium \u00d7 hortorum cultivars with the medicinally used P. sidoides root extract. Umckalin was found to be characteristic for P. sidoides root extract and absent in all other tested extracts. P. \u00d7 hortorum root extracts can be considered as a rich source for catechin and gallic acid combination and showed the best antibacterial activity against the tested P. aeruginosa isolates. Our study revealed that the combination between catechin and gallic acid could be a future medical approach for the treatment of the infections caused by P. aeruginosa due to its anti-biofilm and quorum-quenching activities. It was demonstrated that these activities could be attributed to the downregulation of LasR and LasI genes that are essential for quorum sensing in P. aeruginosa, in addition to inhibiting the LasR protein as predicted by the simultaneous docking study. More research studies are recommended for confirming the predicted interactions of catechin and gallic acid and the effect of their binding on the activity of LasR protein and to illuminate the anti-biofilm potential of this combination against other bacterial species.In this article, an HPLC-UV study has been developed for comparing the main phytochemical constituents of the different plant parts of two"}
+{"text": "Our non-tube no fasting  fast-track surgery (FTS) was safe and effective to combine with neoadjuvant chemotherapy for McKeown minimally invasive esophagectomy. In addition, the two groups were similar in terms of the recovery time, hospital discharge day, and early resumption of oral feeding.To evaluate the safety of early oral feeding (EOF) combined with neoadjuvant chemotherapy (NAC) of esophagectomy.Our non-tube no fasting  fast-track surgery (FTS) was safe and effective for primary surgery esophageal cancer patients.We retrospectively evaluated consecutive patients who underwent non-tube no fasting and McKeown minimally invasive (MIE). They were divided into two groups: one received NAC, and the other received primary surgery. Complications after the operation, postoperative CRG complications, operative time, operative bleeding, and length of stay were evaluated.Between 01/2014 and 12/2017, there hundred and eighty two consecutive patients underwent MIE with total two-field lymphadenectomy under the non-tube no fasting fast-track surgery program. A total of 137 patients received NAC, and 245 accepted primary surgery. Propensity score matching was used to compare NAC patients with 62 matched patients from each group. The NAC group had a similar number of total complications as the primary surgery group  and had the same median postoperative hospitalization duration .After McKeown MIE, the patients receiving NAC combined with \u201cnon-tube no fasting\u201d FTS had a similar incidence of postoperative complications outcomes as those without NAC. In addition, the two groups were similar in terms of the recovery time, hospital discharge day, and early resumption of oral feeding. Esophageal cancer has a high incidence rate in China. Surgical treatment is the primary method to cure local advanced resectable esophageal cancer. However, it presents high morbidity and mortality, even in high-volume centers. The National Oesophago-Gastric Cancer Audit reported a morbidity rate of 3.2% and mortality rate of 29.7% for esophagectomy . If the To reduce the morbidity, mortality and hospitalization duration of these patients, the concept of fast-track protocols after surgery was initially introduced by Kehlet in 1997 . It was More than ten years have passed since the first attempt of \u201cnon-tube no fasting\u201d FTS after esophagectomy. We also wanted to confirm its safety and feasibility in combination with NAC for MIE. The short term outcomes of neoadjuvant chemotherapy (NAC) and primary surgery were compared for EC patients with \u201cnon-tube no fasting\u201d FTS.The study was approved by the Ethics Review Committee of the Affiliated Cancer Hospital of ZhengZhou University/Henan Cancer Hospital (number 2016ct081).In this study, the inclusion criteria were as followed: 1.consecutive patients ESCC patient who underwent surgery between 3 January 2014 and 29 December 2017. 2. with R0 resected ESCC. 3.Surgery was performed in the strict one of the thoracic surgery department of Henan Cancer Hospital. Exclusion criteria: 1.Patients who remained in the intensive care unit (ICU) for more than 1 day. 2.Patients with bilateral recurrent laryngeal nerve (RLN) injury. Preoperative tests included enhanced abdominal and cervical color ultrasound, thoracic and upper abdominal computed tomography (CT) scanning, endoscopic ultrasound (EUS), pathological examination, emission computed tomography (ECT) and other routine examinations.All patients underwent MIE surgical approaches, as previously described , 8. BrieDuring the first 2 years, the patients visited our patient department or were followed up by phone every 3 months. From the third year to the fifth year, follow-up occurred every six months, and from the sixth year, follow-up occurred annually. Follow-up examinations included chest CT scans and abdominal and cervical ultrasound. Other examinations were performed based on the patient\u2019s symptoms. The date from surgery to the first date of neoadjuvant treatment was defined as overall survival (OS). May 3, 2020, was the last follow-up date. Not all the patients did their follow up in out patient department. Some of the patients were follow-up by research nurse of our department by phone and all of them were follow-up by LinkDoc company for our hospital.The Mann\u2013Whitney U test and the chi-square test were adopted to compare the clinicopathological qualitative variables between the two groups. Student\u2019s t test was used for quantitative data, and Fisher\u2019s exact test was used for categorical variables. IBM SPSS statistics version 23  was employed for statistical analysis. A p value/0.05 was considered statistically significant. To reduce the bias between the two groups, propensity score (PS)-matched analysis was adopted. The matched variables included age, sex, BMI, clinical TNM stage, history of disease, surgical time, bleeding volume during surgery, and performance status score.On the morning of the first day after the operation, the patient was allowed to sip liquid. If the patients had no symptoms of nausea, vomiting or aspiration. Then the patients could start to consume food at will after fifty chews for every bite of food before swallowing . This waThe basic nutrition for EOF patients was parenteral nutrition, including glucose, amino acids and fat emulsion, which offered 1000 to 1500, 800 to 1000, and 500 to 800 kilocalories  on POD1, POD2, and POD3, respectively. Oral feeding was started on POD1. The Harris-Benedict formula was used to calculate the required caloric intake of each patient by dieticians. Nutrition education was provided by dieticians. The nurse would emphasize the need for strict aspiration precautions. On POD1, more liquid diet was encouraged, such as porridge, milk, and juice. Semiliquid foods and soft solid foods were provided from POD2, such as cakes, boiled eggs, rice, steamed bread and noodles. The fifty chews per bite of food method was required to ensure patients chewed the food completely and that it had been transformed into a semiliquid state. Normally, parenteral nutrition is removed on POD4 or POD5.via a nasoenteral feeding tube from POD 1. Parenteral nutrition was also adopted. Normally, the nasogastric and nasoenteral feeding tube was removed on POD 7, and the patients resumed oral feeding under the guidance of dieticians.In the traditional group, nasogastric and nasoenteral feeding tubes were used. The patients received nutrition From 01/2014 to 12/2017, a total of 382 consecutive patients met the inclusion criteria; 137 patients received NAC, and 245 underwent primary surgery. Beginning in 2014, an increasing number of patients received NAC and underwent \u201cnon-tube no fasting\u201d FTS Figure\u00a01The intraoperative and postoperative outcomes and total complication rates are shown in The primary surgery and NAC groups showed no significant differences in terms of CRG complications and other complications Table\u00a03.It is challenging to adapt esophagectomy to FTS. The most controversial part of FTS for EC is the resumption of early oral feeding in cases of anastomosis leakage and aspiration pneumonia . Ten yeaIn the present study, we attempt to summarize and demonstrate the safety of NAC in combination with \u201cnon-tube no fasting\u201d fast-track surgery. Our study showed that the combination of NAC with \u201cno tube no fasting\u201d fast-track surgery after McKeown MIE did not increase the incidence of anastomotic leakage (the difference rate was -1.61% (95% CI -5.3% to 8.59%)) or pneumonia (the difference rate was 1.61% (95% CI -9.79% to 13.07%)). The results of this study were consistent with the results of our previous study, although only 31.1% (87/280) of the patients received NAC.The other aspect was the efficacy of the NAC and \u201cnon-tube no fasting\u201d FTS combination. A short postoperative hospital stay is one of the most important recovery outcomes and the most desirable outcome of FTS. In the current study, the NAC combined with FTS group had the same median discharge day as the FTS group . The length of stay was also consistent with other esophageal FTS studies . In our Regarding other data, the NAC combined group had a significantly longer surgical time . Although 22.5 min is insignificant in our daily clinical practice, it indicates that NAC may prolong the surgical time. This result was different from the findings reported in our previous study . HoweverIn the present study, we demonstrated that NAC combined with \u201cnon-tube no fasting\u201d FTS was equal to \u201cnon-tube no fasting\u201d FTS in terms of the incidence of pulmonary complications, and the rates of postoperative complications, unscheduled readmission, hospital mortality and 90-day mortality were not affected. Taken together, our results showed that the NAC combined with \u201cnon-tube no fasting\u201d FTS is safe and does not affect the hospital discharge day, as indicated by our previous RCT with little NAC data.As a single-center retrospective study, our study could not avoid natural biases. Moreover, in the current study, although PSM was adopted, some differences may have led to selection bias; for example, patients with a better performance status were more likely to receive preoperative treatment. Second, this study was performed in the highest-incidence EC area worldwide in a high-volume cancer hospital in Henan Province. A total of 997 esophagectomy procedures were performed for esophageal cancer during 2015 in our department, so the learning curve and surgical experience may be quite different from those of a low-volume center in a low-incidence area. Further exploration is needed to determine whether this approach is truly suitable for centers with limited experience. Third, this study used MIE hand-sewn cervical anastomosis. We did not know if the mechanical anastomosis also work? Fourth, similar to Japan, we were more likely to adopt NAC rather than NACR, so the number of NACRs was too limited to draw any conclusions. Finally, the total number of patients was limited. Therefore, we excluded NACR patients. This topic still needs to be addressed in the future.dingjing201305@163.com.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. Requests to access these datasets should be directed to Jing Ding, The studies involving human participants were reviewed and approved by Ethics Review Committee of the Affiliated Cancer Hospital of ZhengZhou University/Henan Cancer Hospital (number 2016ct081). The patients/participants provided their written informed consent to participate in this study.YZ and WX designed the study. YL, XL, HS, ZW and YZ performed the surgical treatment and fast track surgery. WH and SL analysed the data, and YZ and WH wrote the manuscript. All authors contributed to the article and approved the submitted version.This work was supported by National Natural Science Foundation of China, NSFC (grant numbers 82002521); Natural Science Foundation of Henan Province (grant numbers 202300410389), China; Henan Anti-Cancer Association Youth Talent Project , China; Wu Jieping Medical Foundation (CN) (grant numbers 320.6750.2020-15-1), China; Henan Province health science and technology innovation outstanding young talents training project (YXKC2021029), China; Henan Province Medical Science and Technology Key Projects Co-constructed by the Ministry of health (SBGJ202102059), China.We acknowledged Yanan Qi, a statistician, to help us for the statistics. Department of Statistics, LinkDoc Technology Co., Ltd., Beijing, China.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Platelet detection and counting play a greatly significant role in medical field, especially in routine blood tests which can be used to judge blood status and diagnose related diseases. Therefore, platelet detection is valuable for diagnosing related blood diseases such as liver-related diseases. Blood analyzers and visual microscope counting were widely used for platelet detection, but the experimental procedure took nearly 20 minutes and can only be performed by a professional doctor. In recent years, technological breakthroughs in artificial intelligence have made it possible to detect red blood cells through deep learning methods. However, due to the inaccessibility of platelet datasets and the small size of platelets, deep learning-based platelet detection studies are almost nonexistent. In this paper, we carried out experiments for platelet detection based on commonly used object detection models, such as Single Shot Multibox Detector (SSD), RetinaNet, Faster_rcnn, and You Only Look Once_v3 (YOLO_v3). Compared with the other three models, YOLO_v3 can detect platelets more effectively. And we proposed three ideas for improvement based on YOLO_v3. Our study demonstrated that YOLO_v3 can be adopted for platelet detection accurately and in real time. We also implemented YOLO_v3 with multiscale fusion, YOLO_v3 with anchor box clustering, and YOLO_v3 with match parameter on our self-created dataset and, respectively, achieved 1.8% higher average precision (AP), 2.38% higher AP, and 2.05% higher AP than YOLO_v3. The comprehensive experiments revealed that YOLO_v3 with the improved ideas performs better in platelet detection than YOLO_v3. Routine blood examination   , RetinaNTo realize the platelet detection timely, the methods based on deep learning were applied to the detection task. In this section, we introduce our approach to implementing platelet detection, namely, the YOLO_v3 network which used the Darknet_53 as the feature extraction network. Then, we show the relative improvements based on YOLO_v3.YOLO_v3 is a single-stage CNN model for end-to-end detection. It consists of the backbone network Darknet_53 (except for the full connection layer) and a scale fusion network. The entire model structure is shown in In the figure above, \u201cCBL\u201d consists of three network layers: conv2d, Batch Normalization, and Leaky Relu. \u201cResX\u201d denotes X residual blocks, and a residual block contains two convolution blocks and an \u201cadd\u201d layer. Darknet_53 is mainly stacked with 5 subsample convolutions and residual blocks. The convolution layer subsamples images by varying the stride of the convolutional kernel to obtain feature maps with different sizes. The structure uses five residual blocks to complete the identity mapping and avoid gradient extinction as much as possible.The \u201cNeck\u201d network is used for multiscale feature fusion  and outpThe \u201cHead\u201d architecture's output contains the class probability, the confidence\u00ef\u00bc\u0152and the boundary box coordinates.The shallow feature layer  of the nFor small-sized targets, the shallow features extracted by the network contain some of its details. However, as the number of layers deepens and the receptive field increases, the geometric details in the extracted features may disappear completely.So we added a shallow feature layer 104 \u00d7 104 for the \u201cHead\u201d input in YOLO_v3 adopted the k-means clustering mechanism to obtain anchors with the purpose of multiscale learning. The anchors are several boxes of different sizes obtained by statistics or clustering from the real boxes in the training set. After observation, it is found that the anchors generated by YOLO_v3 are closely connected with the data sets, and the size of the gap between platelets in this paper and the original data set (VOC2007) is too large. This paper improves it to produce anchor boxes of size , , , , , , , , and  by k-means clustering method.In the experiments, there will be certain problems in the use of matching parameters between the real frame and the predicted frame, that is, if the two targets do not overlap, it will be 0, and the distance between the two targets will not be reflected at this time. In the case of the nonoverlapping target, if IOU was used as a matching parameter, the gradient would be 0 and cannot be optimized. IOU is defined in the following formula:C and the ground truth G. area(C) refers to the area of the prior box C, and area(G) refers to the area of the real box G. When the prior box is completely close to the real box, the value of IOU between the two boxes is 1.IOU refers to the overlap ratio between the prior box b represents the predicted frame, bgt represents the real frame, area(b) represents the area of the predicted frame area, area(bgt) represents the area of the real frame area, \u03c12 represents the center distance between the predicted frame and the real frame, c represents the diagonal distance of the smallest area that can include the predicted box and the ground-truth box, \u03b1 is a parameter used for balance, and \u03bd is a parameter used to measure the consistency of the aspect ratio.Therefore, CIOU + IOU will be used as the matching parameter of the model, instead of the original matching parameter. CIOU + IOU means that the two values are added. Then, even though the real frame and the predicted frame do not overlap, the matching parameter still can measure how much the two boxes overlap. It is because that the CIOU takes into account the position information of the two boxes, such as the distance of central points of two boxes and the diagonal length of the smallest enclosing box covering two boxes. CIOU is shown in the following formula:As platelet dataset is hard to get online, we exploited a homemade platelet dataset to carry out experiments to evaluate the proposed method.Given the color of background proximity of platelets when whole blood cells are not processed, it is difficult to distinguish. Therefore, we colored the blood cells.We identified the platelets under the microscope by observing the internal staining of the platelets when dynamically adjusting the focal length. Then, we used LabelImg to draw a rectangular box to surround the corresponding platelets to the most accurate degree; then, we can obtain the location information and category information of platelets for each picture. The total number of the dataset was 412; then, 296 were for training and 33 for validation\u00ef\u00bc\u0152and 83 for testing.The image collection system in platelets was composed of two parts of hardware and software shown as . The harThe center of The experiments for detecting platelet were carried out in a supervised learning manner; hence, the labeling information of the platelets was required. The labeling information was composed of the platelet boundary location information and the platelet category information and was obtained by utilizing labeling. The format of the final generated Extensible Markup Language file is the same as that of PASCAL VOC. The image annotation process is shown in The left side of The experimental platform for the paper is equipped as follows:Based on the above configuration, we implemented a total of five experiments employing Faster_rcnn, SDD, RetinaNet, YOLO_v3, and the proposed improved YOLO_v3 for the assessment of the performance of the platelet detection. The number of iterations of the proposed improved YOLO_v3 was set to 100. The learning rate (LR) was set to 0.001 when we first train the model and then was set to 0.0001 after 50 iterations. The LR was not fixed and adjusted at every iteration with the multiplication factor of 0.92. And the batch size was set to 4. The IOU threshold was set to 0.45 and the confidence threshold to 0.25 for obtaining a precise detection result.F1, and AP (average precision). And these metrics are obtained based on the confusion matrix in To quantitatively evaluate and compare five deep neural networks for detecting platelet, we utilized a variety of standard metrics frequently used to evaluate these methods including recall, precision, TP is true positive and indicates the number of positive samples classified as positive samples; FP is false positive and represents the number of negative samples that are misclassified as positive samples. FN is false negative and indicates the number of positive samples that are misclassified as negative samples. TN is true negative and indicates the number of negative samples that are classified as negative samples.Precision is defined as follows:Recall is defined as follows:F1 score can comprehensively evaluate the performance presented by the two indicators of precision and recall. When we create classifiers, we always make a compromise between recall and precision, and it is difficult to compare models with high recall and low precision compared to models with high precision but low recall. F1 score is a metric we can use to compare two models. F1 is defined as follows:The M is the number of all targets predicted by the network, P(k) refers to the corresponding precision value when the model predicts k objects, and \u0394r(k) represents the difference between the recall rates when the model predicts k \u2212 1 to k object value.AP (average precision) is the precision across all elements of objects as defined in the following formula:To ensure the fairness of experiments, the experiments were implemented under the same hardware environment and test images.In order to well understand the effectiveness of YOLO_v3 used to detect platelet, we carried out experiments to compare the results of four methods. The experimental effects of different methods for platelet detection are shown in To be specific, the average precision (AP) values, F1, precision, and recall of the four network models are shown in The above methods include single-stage target detection methods and a multistage target detection method (Faster_rcnn). As can be seen from The SSD network does not have a multiscale fusion module, and the features used in the prediction are separate deep features or shallow features. Therefore, it is not conducive to the detection of a small target platelet. Faster_rcnn was inferior to YOLO_v3 in platelet detection because the detection principle of Faster_rcnn requires candidate region screening, which can well separate the target from the background, while platelet is a small target, and there are not enough pixel features used for its learning. In addition, the pixel value of the platelet in the stained picture is close to the background, which makes Faster_rcnn unable to give full play to its advantages. RetinaNet detected platelet poorly because there are only three feature layers used to predict the platelet, and the shallow feature information contained is insufficient. YOLO_v4 and YOLO_v4-tiny can hardly learn the platelet's features because their improvements compared to YOLO_v3 are not suitable for platelet detection. The YOLO_v3 model has a multilayer feature map output for predicting platelet, and it also uses a multiscale fusion method, so that it can contain both shallow and deep feature information for the model to detect platelet.We carried out parametric experiments, and the experimental results are shown in P, precision) graph under the recall rate . It can be seen from the graph that precision and recall are a pair of contradictory values. Thus, there is no possibility that both are ideal.To validate the practicality of improved_YOLO_v3 for detecting platelet, ablation experiments were implemented and experiment results are shown in First of all, we studied the impact of multiscale fusion on our model. To avoid ambiguity, we treated the header as the first row in the table. The second row in We also analysed the effect of anchor box clustering on our proposed method. The fourth row in We conducted experiments to discuss the contribution of the match parameter to the proposed method. The relative results are shown in the last three rows of Thus, YOLO_v3 with anchor box clustering and match parameter is our final chosen model. In this paper, we realized the platelet detection task on the whole via the YOLO_v3 network used a small number of platelet images that are manually annotated. Our comparative experiments show that YOLO_v3 can achieve better detection results that close to clinical requirements. And we proposed three ideas to enhance the detection performance. The experimental results demonstrated that each improvement idea improves the detection effect compared with YOLO_v3. Among them, simultaneous changes in match parameter and anchor box clustering can obtain the best AP (87.3%) in platelet detection and the AP lifts by 3.11%. Moreover, we achieved real-time platelet detection at the same time and can significantly lighten the load of doctors. Comprehensive experiments on our self-created platelet dataset indicated the validity and superiority of our method."}
+{"text": "Background and objectiveEndocrine-disrupting chemicals (EDCs) are natural or synthetic molecules that can alter and affect the operations of the hormonal system of an organism. These compounds include plastic consumer products and food containers such as phytoestrogen, which is also naturally present in food. EDCs can be found in the cord blood and maternal blood of pregnant women, as well as colostrum. Hence, they may affect not only the mother but also the offspring. In this study, we aimed to\u00a0evaluate the awareness among females of reproductive age regarding the nature, source, as well as physiological and psychological burden associated with sex hormones disruptors.MethodsA descriptive cross-sectional study was conducted among females between the age of 15-45 years in the Al-Jouf region, Saudi Arabia. A self-administrated questionnaire was used as the data collection tool; it consisted of multiple-choice questions to obtain information on the awareness among the females. In this study, females were classified into those with good knowledge and those with poor knowledge based on their level of knowledge by using a scoring system with a total score of 12. IBM SPSS Statistics version 24  was used to analyze the collected data.ResultsThe study included 491 females; 6.6% of them had been using soya-containing products for a long time, and 32.5% reported using\u00a0oatmeal for a long time. The majority (86.2%) did not use any other hormonal therapy. There were significant differences in the knowledge\u00a0about sex hormone disruptors among the participants, and women with poorer knowledge about sex hormone disruptors were significantly less likely to report the\u00a0long-time usage of soya-containing food\u00a0when compared to women with greater knowledge . The results showed that women with poorer knowledge were also significantly less likely to report the usage of hormonal therapies when compared to women with greater knowledge , indicating that the usage of these chemicals is higher in women with greater knowledge although they are aware of their effects.ConclusionThe study showed that females had good knowledge about the nature and usage of EDCs but poor knowledge about their impact. The knowledge of females was associated with their behavior regarding the usage of such products. Endocrine-disrupting chemicals (EDCs) are defined as chemical substances that can mimic or interfere with the normal functions of the endocrine system and hormone biosynthesis, resulting in a deviation of normal hormonal control in the normal cells. These deviations are linked with developmental and reproductive health problems, especially in females. These chemical disruptors are found in food, cosmetics, and many other daily products . SeveralStudy design, setting, and sampling methodThis was a descriptive cross-sectional study conducted among women of reproductive age in the Al-Jouf region, Saudi Arabia. A pre-validated form was circulated online through social media; the sampling method used was convenience sampling.Sample sizeThe population of the Al-Jouf region is 531,952 according to the General Authority for Statistics (GAStat) . We targTool for data collectionSelf-administered questionnaires consisting of multiple-choice questions were used. The questionnaire was designed to obtain information about\u00a0the usage as well as the awareness regarding endocrine disruptors, such as the long-time consumption of soya-containing foods (six months and above). In addition, we obtained data on variables such as sociodemographic status including age, educational status, weight, place of residence, and income. Also, we obtained data on other variables regarding the reproductive status such as menarche, duration of the menstrual cycle, and its regularity. We classified the participants into two categories based on a scoring system with a total score of 12: a score of 0-6 indicated poor knowledge while that of 7-12 showed good knowledge.\u00a0The questionnaire has been\u00a0partly adapted from the study by\u00a0Anjum et al. about knowledge and attitude toward xenoestrogens\u00a0[Inclusion and exclusion criteriaThe inclusion criteria were as follows: females of reproductive age (15-45 years) residing in the Al-Jouf region. The exclusion criteria were as follows: incomplete forms and non-Arabic speakers.Ethical consideration\u00a0The study was conducted after obtaining the approval of the Ethics Review Committee (LCBE)\u00a0of Al-Jouf University . No identifying data were included in the questionnaire.Statistical analysis\u00a0The\u00a0data were analyzed\u00a0by\u00a0using IBM SPSS Statistics version 24 . Descriptive statistics and a comparison of the variables were carried out.A total of\u00a0491 participants were involved in this study. All of them were asked about certain products that can lead to hormonal disruption. Our findings showed that the percentage of participants who were using soya-containing products for a long period was 6.6%. Among the total participants, 32.5%\u00a0used oatmeal and 33.6% were using contraceptive pills. The proportion of participants who were unsure if they used soya-containing products was 21.8%  ; it also showed that women with poorer knowledge were significantly less likely to report the usage of hormonal therapies when compared to women with greater knowledge (p<0.001). These findings indicate that better knowledge regarding the nature of hormonal disruptors is not associated with a decrease in the usage of soya-containing products despite the fact that the participants are aware of the\u00a0nature of these products.\u00a0The study also observed no significant relationship between knowledge about\u00a0sex hormone disruptors and various parameters such as age, place of residence, and social and educational status. A statement provided in the knowledge assessment  reported regular menstruation duration. More than one-half reported 13-15 years as the age of menarche. This information indicated that most females had normal menstruation and reached puberty at the normal age range. This reflects no problems and no disruption of sex hormones among those females. A previous study conducted on females in Pakistan showed that the large majority of females had regular periods, even those of older age. Also, the age of menarche for 43.93% of respondents was 13-14 years. Additionally, the large majority denied using hormonal replacement therapy (89.5%)\u00a0[0.7% repoPhytoestrogens are secondary plant metabolites that are metabolized to chemicals with weak estrogen activity. They may interact with estrogen receptors and result in effects similar to those of EDCs. Phytoestrogens can be classified into different families, including isoflavones. Soybeans are the most common source of isoflavones in food\u00a0.In this study, the utilization of different products that can affect and disrupt sex hormones was investigated. A small proportion of females reported that they used soya-containing products for a long time, but more than one-half denied using other products such as lavender and jasmine oils, and soya seeds\u00a0or their derivatives. Almost one-third of females reported using oatmeal. Additionally, more than half denied using contraceptive pills, whereas only 33.6% reported using these pills; this relates to those women\u00a0who find the pills a more appropriate contraception method. However,\u00a0the reason for using contraceptive pills was not investigated. We found some significant statistical differences in the knowledge and the usage of soya-containing foods and hormonal therapy. The findings indicate that a good knowledge regarding the nature of these products was not associated with a decrease in their intake.\u00a0On the other hand, on assessing the knowledge of females regarding the impact of EDC, there was\u00a0a significantly large number of females with poor knowledge regarding the environmental factors that can affect their menstruation duration and intensity. Also, there was a significant correlation between the poor knowledge of females and their level of agreement with the fact that environmental factors may affect fertility.Other studies on this subject investigated different aspects compared to what we focused on; however, we still found it worthwhile to compare the final findings of such studies with ours. One study revealed that the awareness regarding xenoestrogens among females in Pakistan was insufficient. However, that study investigated the administration of different products and foods\u00a0.\u00a0A\u00a0crossIn a study from Malaysia conducted on 15 university students regarding the use of Plastic-Type Food Contact Materials (PTFCMs), it was found that the majority of students 84%) had a low level of knowledge regarding EDCs. It should be noted that the study focused on the use of PTFCMs such as canned food and bottled mineral water\u00a0[4% had a In a qualitative study conducted to assess public awareness, it was reported that public awareness regarding EDCs, their sources, and associated health effects was low. This was\u00a0attributed to the lack of attention EDCs get from the mainstream media, the lack of awareness programs in schools, and the lack of information from health\u00a0professionals . AnotherIn a study conducted in France, 15\u00a0girls were selected and interviewed along with their parents, and asked about exposure to xenoestrogen products; of them, nine girls reported being exposed to such products. Further investigations\u00a0revealed an increased level of estrogenic bioactivity in their serum, suggesting that it can be related to their exposure to estrogen disruptors. This study measured the serum levels of plasma estradiol, follicle-stimulating hormone, and luteinizing hormone . The incAn Italian study\u00a0in 2012 that involved 17 females with early pubertal signs of synthetic estrogen \u00a0found that six out of the\u00a0total 17 participants had elevated\u00a0levels of this product without it having any significant effect on their early puberty. However, the study concerned herbicides as an\u00a0environmental factor linked to elevated levels of estrogen\u00a0.Our study has a few limitations, primarily its relatively small sample size and the fact that the study was conducted in a small geographical area; hence it is difficult to generalize our results to other areas or populations. Also, in our descriptive study, we did not account for potential confounders, which could impact the interpretation of the findings.Females in our study had good knowledge about the nature and usage of EDCs but poor knowledge regarding their impact. The knowledge of females was associated with their behavior regarding the use of such products. Also, their knowledge affected their perceptions regarding the impact of environmental factors on menstruation and fertility."}
+{"text": "Harnessing immune effector cells to benefit cancer patients is becoming more and more prevalent in recent years. However, the increasing number of different therapeutic approaches, such as chimeric antigen receptors and armored chimeric antigen receptors, requires constant adjustments of the transgene expression levels. We have previously demonstrated it is possible to achieve spatial and temporal control of transgene expression as well as tailoring the inducing agents using the Chimeric Antigen Receptor Tumor Induced Vector (CARTIV) platform. Here we describe the next level of customization in our promoter platform. We have tested the functionality of three different minimal promoters, representing three different promoters\u2019 strengths, leading to varying levels of CAR expression and primary T cell function. This strategy shows yet another level of CARTIV gene regulation that can be easily integrated into existing CAR T systems. Cancer cells originate from one\u2019s own cells, hence the major difficulty in targeting them and not healthy tissue. In recent years there has been an ongoing hunt for new treatments that exclusively target cancerous cells. Immunotherapy\u2019s main goal is to artificially navigate the immune system into attacking tumor cells precisely and specifically. One of the techniques in practice today involves chimeric antigen receptor T-Cells (CAR-T cells) . Known aMany studies have shown innovative strategies to increase efficacy on one hand or reduce toxicity on the other. One of the methods to reduce toxicity is by the introduction of a suicide gene into the T cell. Here, an inducible caspase 9 (icas9) is introduced to the cells and is dimerized by the drug AP1903, thus forcing the cells to perform apoptosis ,11. AnotIn order to increase treatment efficacy and to optimize CAR T cells treatment, there are several proposed modifications. These modifications, coined \u201carmored cars\u201d, use cytokines or ligands such as interleukin 12 (IL12) or 4-1BBL, inducible or constitutive, in order to try and increase persistence or cytotoxicity ,17. HereAs we have shown, the CARTIV method is capable of restricting the transgene expression to the TME . Our CARHere we describe a way to adjust the promoter\u2019s level of expression while maintaining its response to TME signals. Using different minimal promoters of varying transcription strength, we demonstrate the practical ability to adjust a given CARTIV promoter. We describe a series of synthetic CARTIV promoters having the same TME-responsive portion conjugated with different minimal core promoters, including the miniTK , miniCMVA eukaryotic inducible synthetic promoter may consist of two main components, the promoter response elements (PREs), and the minimal promoter. The minimal promoter, or core promoter, is commonly a short sequence that allows the formation of a transcription initiation complex right at the transcription start site. We had previously developed CARTIV promoters ,15 focusWe cloned either YB_TATA, miniTK, or miniCMV right after the G1K0.6H1 part of our recently published CARTIV ,15, gett+), gated of transduced cells and normalized to the total Zs+ population. Second, the geometric mean of the RFP670 fluorescent signal (MFI) of the Zs+ fraction.In order to functionally test the promoters, we transduced HEK293T cells, which are responsive to hypoxia , and to +) cells, ranging from 87.39% to 97.5% RFP670+ cells for the miniTK and 98.64% to 98.95% RFP670+ cells for the miniCMV  were RFP670 positive  cells were also very different across the different minimal promoters. The background expression levels were low for the miniTK (1.36% \u00b1 0.17% Myc+), while a substantial expression was recorded for the miniCMV (21.22% \u00b1 3.21% Myc+). As expected, the miniCMV had the highest maximal response (92.45% \u00b1 1.57% Myc+), followed by the miniTK (74.89% \u00b1 2.86% Myc+)  C. Both tordingly . However of 3.56 C. Taken + cells, all three promoters had a stimuli dependent response with varying levels of maximal and background expression. The miniCMV had high background expression levels (79.6%RFP670+) and a high maximum response (95.04%RFP670+). The YB_TATA had the lowest background level (6.38%RFP670+) and lowest maximum response (24.03%RFP670+). The miniTK background levels were in between those of the miniCMV and YB_TATA (26.09%RFP670+), as well as the maximum response (75.17%RFP670+)  . Taken tTo test for possible benefits in employing different promoters, we proceeded to testing the membrane CAR expression and CAR mediated T cell function. TNF\u03b1 stimulation had a week effect on CAR expression, while a substantial increase in expression was recorded following hypoxia and a synergistic response following the double stimulation for the miniTK . The min+ cells from the ZsGreen+ population . Cell activation was measured using a CD107a degranulation assay. The percentage of degranulating cells was calculated as the fraction of CD107apulation . Betweenpulation B.The YB_TATA had no detectable degranulation in the ERBB2 coated well for stimulation conditions, probably due to lack of membranal CAR expression. For the miniTK there was no increase in degranulation levels following IFN\u03b3, TNF\u03b1 or the combination of the two. Only after adding the hypoxic conditions was an increase in degranulation recorded C. DespitIn this study we compared three minimal promoters using the CARTIV platform to characterize an optimal minimal promoter for inducible CAR expression. Given the importance of CAR density on the effector cell membrane , the abi\u00ae [The minimal promoters used in this study were all previously reported ,20,21. B\u00ae . Moreove\u00ae . ConsideOur results suggest that the CARTIV promoter response element remains functional when coupled with all three minimal promoters. Pronounced RFP670 reporter expression was observed with the minimal CMV having the highest background of the three and the YB_TATA having very low background, only slightly higher than background levels. Normalization of each mini-promoter reveals that, despite overall highest expression levels by miniCMV, it is the miniTK that gains the best relative-induction and synergism. We must stress that gaining various patterns bring new options, and this may prove useful. Having substantial background levels may favor basal-levels of receptor signaling, supporting cellular viability and proliferation . In othePrimary human T cells are currently the main type of immune effectors for clinical utilization ,42. InteTaken together, our data present the robust modular ability to change synthetic promoters. The option that response to TME can be separately designed and tuned, while the very short mini-promoter at the transcriptional start site can be easily flipped. Gaining the adequate level of expression of CAR, or other effector immune effector genes, will provide for better engineering of CAR-T and other immune cells to treat various types of tumors in more patients.The G1K06H1 Promoter response element was synthesized upstream to a mini TK minimal promoter as described elsewhere . The minHEK293T were grown in DMEM  containing 10% serum, pen-strep, HEPES, L-glutamine, non-essential amino acids and sodium pyruvate .Human primary T cells were extracted, cultured and infected as described extensively elsewhere . Briefly\u00ae transfection reagent  according to the manufacturer\u2019s recommendations. Media was added for the following two days and on the third day LV containing media was collected and 0.45 \u00b5 filtered and stored in \u221280 \u00b0C or concentrated by ultracentrifugation for 90 min at 17,000 RPM 4 \u00b0C. LV pellets were suspended in DMEM 10% FBS, aliquoted and stored in \u221280 \u00b0C.LVs were produced in HEK293T cells cultured in DMEM 10% FBS . Cells were grown to 90% confluence in 10 cm plates and were transfected with 10 \u00b5g of pHAGE2 vector and 3 \u00b5g of the packaging plasmids tat, rev, hgpm2 and vsvg in a mass 1:1:1:2 ratio. The transfection was performed using jetprime2 0.3% O2 and 94.7% N2 at 20 L/minute for three to five min was applied to the chamber. The chamber was sealed and placed at 37 \u00b0C for 16\u201320 h.For hypoxic condition simulation, a hypoxic chamber was used. The experiment plate was placed in the chamber and the chamber was sealed. A gas mixture containing 5% CO5 per well in a 96 well Flat bottom plate; human primary T cells at 2 \u00d7 105 in a 96 well U-shape plate. Cytokines IFN\u03b3 and TNF\u03b1 added to final concentrations of 500 U/mL. Hypoxia was induced for the last 16\u201320 h of the experiment. Cells were harvested, washed once in PBS 2% FCS, suspended with DAPI 1 \u00b5g/mL and FACS measured using a Beckman Coulter\u00ae Cytoflex\u2122 flow cytometer. Data were analyzed using Kaluza\u2122 or cytexpert\u2122 software. The normalized reporter expression was calculated by: HEK293T cells plated at 1 \u00d7 10\u00ae Cytoflex\u2122 flow cytometer.Cells harboring the promoters were induced as described above and harvested. Cells were washed once in PBS containing 2% FBS and stained using anti Myc tag antibody (Millipore) and incubated on ice for 1 h. Cells were washed once and stained using a secondary anti mouse APC (Jackson) and incubated on ice for 30 min. Cells were washed twice and suspended with DAPI 1 \u00b5g/mL and FACS were measured using a Beckman Coulter4 on 1 \u00b5g/mL ERBB2 (R&D) coated 96U plates together with anti-human CD107a APC  and incubated for 4 h in a tissue culture incubator. After 4 h, cells were washed once and stained using anti human CD107a APC  for 30 min on ice. Degranulation was assessed by FACS as above.Primary human T cells were plated at 5 \u00d7 10t-test was performed where applicable.A paired one tailed"}
+{"text": "For liposomal encapsulation thin-film hydration and DRV methods were applied, and different lipid compositions were tested for optimized protein loading. RLX2 and O-RLX2 were quantified by HPLC. The capability of the peptides/conjugate to stimulate transfected cells to produce cyclic adenosine monophosphate (cAMP) was used as a measure of their biological activity. The stability and bioactivity of free and liposomal RLX2 types were monitored for a 30 d period, in buffer (in some cases) and bovine serum (80%) at 37 \u00b0C. The results showed that liposome encapsulation substantially increased the RLX2 integrity in buffer; PEGylated liposomes demonstrated a higher protection. Liposome encapsulation also increased the stability of RLX2 and O-RLX2 in serum. Considering the peptide\u2019s biological activity, cAMP production of RLX2 was higher than that of the oxidized form and the P-RLX2 conjugate , while liposome encapsulation resulted in a slight decrease of bioactivity initially, but prolonged the peptide bioactivity during incubation in serum. It was concluded that liposome encapsulation of RLX2 and synthetic modification to P-RLX2 can both prolong RLX2 peptide in vitro stability; however, the applied chemical conjugation results in a significant loss of bioactivity (cAMP production), whereas the effect of liposome entrapment on RLX2 activity was significantly lower.Relaxin (RLX) is a protein that is structurally similar to insulin and has interesting biological activities. As with all proteins, preservation of RLX\u2019s structural integrity/biological functionality is problematic. Herein, we investigated two methods for increasing the duration of relaxin-2\u2019s (RLX2) biological activity: synthesis of a palmitoyl RLX2 conjugate (P-RLX2) with the use of a Palmitoyl- Relaxin 2 (RLX2) is a two-chain peptide hormone that has a similar structure to insulin. It is one of the peptides of the so called \u201cinsulin-relaxin peptide family\u201d that includes insulin, insulin-like growth factors, relaxins , and relaxin/insulin-like factors 3, 4, 5, and 6)  (PEG), and Phosphatidyl-glycerine (PG) were purchased from Lipoid, Germany. Cholesterol (Chol) was purchased from Sigma-Aldrich . Human Relaxin 2 (RLX2) and Oxidized Human Relaxin 2 (O-RLX2), as well as N-Palmitoyl-l-glutamic acid \u03b1-tert-butyl ester \u03b3-succinimidyl ester -OtBu), were kindly supplied by CBL . Agar was from Sigma-Aldrich . All solvents used were of analytical or HPLC grade and purchased from Merck . All other materials, such as the salts used for buffer preparation, reagents for lipid concentration determination, etc., were of analytical grade and were purchased from Sigma Aldrich .Egg phosphatidylocholine (PC), 1,2-Distearoyl-\u00ae 100 RP-18 (5 \u03bcm) LiChroCART\u00ae 250-4. Mobile phase: THF/H2O; Gradient: 20% THF to 100% THF in 30 min (Conditions A); 50% THF to 100% THF in 30 min (Conditions B); Flow rate: 1 mL/min; Detection at 280 nm. ESI-MS spectra were recorded on a Waters Micromass ZQ 4000 mass detector (positive mode), controlled by MassLynx 4.1 software, by direct infusion, using a syringe pump at a flow rate of 5 \u03bcL/min. Cone voltage was set at 30 V and scan time at 1 s, with the interscan delay at 0.1 s.HPLC analysis was performed on a Shimadzu LC-2010 liquid chromatography system  using a LiChrospherl-Glu(OSu)-OtBu  dissolved in DMSO or Dioxane (2 mL) was added dropwise at 4\u20135 \u00b0C while vigorously stirring, within 2 h, and the reaction mixture was further stirred for 12 h at 20 \u00b0C. Next, the reaction mixture was dialyzed over distilled water (3 times) and then lyophilized to afford a white powder that was further purified by semi-preparative HPLC. The collected fractions of P-RLX2 were combined and finally lyophilized to afford P-RLX2 as a white solid (yield 30\u201335% relative to RLX2). Purity: > 98% . ESI-MS [M+3H] calcd.: 2128.38; found: 2129.46; [M+4H] calcd.: 1596.54; found: 1597.26; [M+5H] calcd.: 1277.43; found: 1278.05; [M+6H] calcd.: 1064.69; found: 1065.28.RLX2  was dissolved in buffer phosphate PB at pH 7.40 (2 mL). To the resulting solution, Palmitoyl-The lipid membrane compositions used for all the liposome formulations prepared were (i) PC/Chol (2:1 mole/mole), (ii) PC/PG/Chol (8:2:5 mole/mole/mole), and (iii) PC/PG/Chol/PEG (8:2:5:1.3 mole/mole/mole/mole). Details about liposome preparation using the two different methods applied are mentioned below.v/v) mixture. The mixture was then placed in a round-bottom flask and connected to a rotor evaporator  under vacuum, until complete evaporation of the organic solvents and the formation of a thin lipidic film on the sides of the flask. The film was hydrated with 1 mL of PBS at 40 \u00b0C and vortexed until complete removal of the lipids from the sides of the flask, for multilamellar vesicle (MLV) formation.The thin film hydration method was used for P-RLX2 liposome preparation, as previously described in detail . In briev/v) mixture and stored at \u221220 \u00b0C. For each liposome preparation, the appropriate amounts of each solution (depending on the lipid composition required), for a final lipid concentration of 20 mg/mL, were placed in a 100-mL round-bottomed flask. Organic solvents were evaporated by the connection of the flask to a rotary evaporator, until a thin film was formed. For complete removal of organic solvents, the film was flashed-dried with nitrogen for 2\u20133 min. The lipid film was hydrated with 1 mL of diluted PBS buffer (10% v/v) pH 7.40, heated at 40 \u00b0C. The resulting dispersions consisting of MLVs were subsequently converted into SUVs by probe sonication with a tapered micro-tip . In all cases, the initially turbid liposomal suspension was well clarified after sonication for 5\u201315 min. Following sonication, the liposome suspensions (SUV) were left to stand for at least 1 h at 40 \u00b0C, in order to anneal any structural defects. Any Ti-fragment and/lipid aggregate contaminants were removed from SUV suspensions by centrifugation at 15,000\u00d7 g for 20 min. Then, 1 mL of the SUV suspension was mixed with 1 mL of a 0.5 mg/mL RLX2 or O-RLX2 solution (in distilled H2O), and the mixture was freeze-dried. With controlled rehydration of the dried materials, as described previously [For dehydration\u2013rehydration vesicle (DRV) preparation, empty small unilamellar vesicles (SUV) were initially prepared as described in detail before, from empty MLV liposomes ,23,24. Feviously ,23, multSize reductions of liposomes (both MLVs and DRVs) were carried out by sequential extrusion of the liposomal dispersions at least ten times, through polycarbonate filters with a pore diameter 0.4 \u00b5m, followed by a second extrusion cycle through membranes with a 0.1 \u00b5m pore diameter, fitted in a syringe-type extruder . Extrusion was used as a size-reduction method, since sonication was avoided, in order to prevent disruption of the DRV liposomes and leakage of the encapsulated drug and/or destruction of the encapsulated protein. After size reduction, all liposomes were purified from non-entrapped (or incorporated) peptides by size exclusion chromatography on a Sepharose CL-4B column (1 \u00d7 40 cm), eluted with PBS, pH 7.40.v/v and the mixture was incubated at 40 \u00b0C for 2 h. After post-pegylation, liposomes were purified from non-incorporated PEG, by size exclusion chromatography, as described above.For preparation of PEGylated liposomes, a post-pegylation technique  was usedLiposomes were characterized for peptide encapsulation efficiency (%), calculated according to Equation (1):rt assay , a color\u00ae 5 \u00b5m C18 (2) 100 \u00c5, LC Column (250 \u00d7 4.6 mm) was used; the mobile phase was a mixture of acidified water (0.1% v/v trifluoroacetic acid) and acetonitrile at 63:37 v/v. The column was eluted at a flow rate of 1 mL/min at 25 \u00b0C, and RLX2 or O-RLX2 was eluted at 5.2 min and 5.4 min, respectively. The sample injection volume was 100 \u00b5L. A calibration curve in the range of 2.5\u201330 \u00b5g/mL was constructed by preparation of standard solutions of RLX2 or O-RLX2 in the presence of 1 mg/mL lipid (lipid composition PC/Chol or PC/PG/Chol) in media with a similar composition to the samples. Liposomes were analyzed after being lysed in isopropanol, for efficient protein extraction, as previously reported [RLX2 and O-RLX2 concentration in liposomes was quantified by gradient high-performance liquid chromatography (HPLC) using a Shimadzu 20A5 Gradient HPLC system coupled to a SPD-20A Prominence UV/VIS detector operating at 220 nm. A Lunareported ,28. One Due to the low absorptivity of the conjugate P-RLX2, its concentration in the liposomes could not be measured by the HPLC method , and its complete incorporation in the liposomes was verified by HPLC studies carried out in the combined liposome and free molecule fractions collected, following size exclusion chromatography on a Sepharose CL-4B column (1 \u00d7 40 cm), eluted with PBS, pH 7.40.The particle size distribution (mean hydrodynamic diameter and polydispersity index) of RLX2, O-RLX2, and P-RLX2 loaded liposomes dispersed at 0.4 mg/mL lipid, in phosphate-buffered saline (10 mM) with pH 7.40, was measured by dynamic light scattering (DLS)  at 25 \u00b0C and a 173\u00b0 angle . Each sav/v) was used as media). Samples were placed separately in hermetically sealed screw-tubes (to avoid evaporation) and then in an orbital incubator  set at 50 rpm and 37 \u00b0C, for a period of up to 30 d. At specific time intervals, samples were analyzed by HPLC, for quantification of intact RLX2 or O-RLX2, with the method mentioned above, in the case of samples in PBS. For quantification of free or liposomal peptides in the presence of 80% FBS, serum proteins precipitation was accomplished by mixing one volume of sample (100 \u03bcL) with three volumes (300 \u03bcL) of acidified isopropanol (with 0.1% TFA), followed by vortex agitation and centrifugation at 15000 rpm for 15 min. Next, the supernatant was transferred to a new eppendorf tube and 400 \u03bcL of HEPES (pH 5.0) were added, followed by vigorous vortex for 1 min, in order to retrieve the peptide. Finally, the samples were analyzed by HPLC, based on a calibration curve constructed at the exact same conditions as the samples to be analyzed.To ensure peptide stability during incubation in media containing, or not containing, serum proteins, solutions of RLX2 peptides, as well as liposomal dispersions with lipid membrane compositions of PC/PG/Chol (8:2:5 mol/mol/mol) and PC/PG/Chol/PEG (8:2:5:1.3 mol/mol/mol/mol), were incubated at a final peptide concentration of 35 \u00b1 8.1 \u03bcg/mL (when PBS was used as media), and 58 \u00b1 5.0 \u03bcg/mL . Experiments were carried out in triplicate, and the results are expressed as the mean value \u00b1 standard deviation.2. A total of 6 \u00d7 105 cells were seeded in 6-well plates and allowed to attach overnight. The following day, cells were transected with RXFP1  with Xfect transfection reagent . After 48 h, RXFP1-HEK293 cells with transient expression were prepared for stimulation assay, with various receptor agonists. In more detail, cells were washed twice with Hanks\u2019 balanced salt solution and were incubated in Hanks\u2019 balanced salt solution in the presence of 0.1 mM 3-isobutyl-1-methylxanthine  for 10 min. Cells were then stimulated for 30 min with vehicle or RLX2 peptide types at concentrations between 0.1\u2013100 nM, media were aspirated, and 200 \u03bcL of HCL 0.1 M was added into each well, to extract cAMP. After 10 min, the extracts were collected and centrifuged at 600 g for 5 min and subsequently samples were used for Cyclic adenosine monophosphate (cAMP) assay [Human HEK-293 embryonic kidney cells (HEK)  were provided by Prof. G.T. Stathopoulos . Cells were grown in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 10% fetal bovine serum , 100 IU penicillin/mL, and 100 \u03bcg streptomycin/mL , and incubated at 37 \u00b0C and 5% COThe biological activity of RLX2 peptides was measured by their ability to stimulate cAMP production in RXFP1-HEK293 cells [v/v) at 37 \u00b0C, for 30 d. At specific time points , 250 \u03bcL of each sample was added to 750 \u03bcL of culture medium (4\u00d7 dilution), in order to realize a peptide concentration of 100 nM for all tested samples. HEK-293 cells were transfected and stimulated with each compound, and the cAMP concentration was measured, following the procedures described above. Experiments were carried out in triplicate, and the results are expressed as mean value \u00b1 standard deviation.For these experiments, RLX2 peptides (400 nM) in the form of solutions (free) or liposomes  were incubated in FBS -OtBu) at the a-amino group of the N-terminal amino acid of the \u0392-chain of RLX2, avoiding acylation at the \u03b5-amino group of Lys9,17 of the A chain and the \u03b5-amino group of Lys9 of the B chain. In addition, the use of pGlu at the N-terminal of the A-chain of RLX2  at pH 7.40. Thus, the reaction was performed in PB 7.40 or a mixture of PB 7.40 and DMSO (or Dioxane), by dropwise addition of up to a four molar excess of Palmitoyl-l-Glu(OSu)-OtBu to an aqueous solution of RLX2. The reaction progress was monitored by HPLC analysis. With this method, P-RLX2 was formed in a percentage of about 35\u201350% relative to RLX2, depending on the exact reaction conditions. Adding higher than a four molar excess of Palmitoyl-l-Glu(OSu)-OtBu repeatedly resulted in the formation of high amounts of bis-palmitate products , as determined by a ESI-MS analysis of the corresponding eluted HPLC peaks. In l-Glu(OSu)-OtBu resulted to the formation of P-RLX2, with only small amounts (and in some cases with no) of bis-palmitated RLX2. Then, the reaction mixture was subjected to dialysis over distilled water, and finally lyophilized and purified by semi-preparative HPLC, to afford, after lyophilization, P-RLX2 of > 98% purity. The overall yield, relative to RLX2, was about 30\u201335%. A representative analytical HPLC of the final obtained pure P-RLX2 conjugate that was used in the current studies is presented in In order to achieve selective lipidation at the The properties of the liposomal formulations of RLX2 are reported in It can be observed that the encapsulation of RLX2 in liposomes is markedly increased (from 4% to 22%), when the negatively charged lipid (PG) is added in the liposome membrane, due to the opposite charge attraction between the peptide  and the liposome membrane .When PEG is added in the liposome membrane the EE of RLX2 drops to a very low value . The fact that the zeta potential of the vesicles decreased when PEG was added proves that the coating of the liposome surface with PEG chains was achieved . NeverthFor this reason, as mentioned in the Methods section , in ordeIn Concerning the encapsulation efficiency, O-RLX2 was observed to obtain a similar encapsulation in liposomes to that of RLX2, implying that using the oxidized form of the peptide does not affect its encapsulation in liposomes (at least under the conditions applied herein). On the other hand, as a lipid conjugate, the Palm-L-Glu-OtBu conjugate of RLX2 (P-RLX2) is totally incorporated in the liposome lipid membrane ) using the thin film hydration method.In In any case, regardless of the media in which the peptides were placed, encapsulation of RLX2 peptide into PEG liposomes resulted in a profound increase of its stability .25 B-chain), conferred a decrease of the peptide stability. Nevertheless, encapsulation in liposomes (PEGylated or not) provides prolonged stabilization of the oxidized form of RLX2; indeed, although after 10 d of incubation, all the free O-RLX2 peptide was degraded, liposomal encapsulation preserved more than 40% of the O-RLX2 peptide with the same incubation time period  ,30,31. PThe bioactivity of the three peptide types in solution was studied initially, in order to understand if the bioactivity was also influenced by the applied chemical modifications, as demonstrated by the O-RLX2 stability study , compareAnother important question is whether liposome encapsulation could also preserve the bioactivity of the peptides, as demonstrated for their stability . In Figup < 0.0001) preservation of the bioactivity of O-RLX2 peptide, as also observed for RLX2 -OtBu) as the fatty acid modifier, after identifying an efficient synthetic pathway and the appropriate conditions that conferred a high production yield of the monopalmitate RLX2 peptide conjugate, in the final stage of its synthesis. This peptide modifier is known to delay peptide absorption and extend the half-life of Liraglutide, while renal clearance is also reduced, due to the shielding effect of the fatty acid moiety [Liposome encapsulation and fatty acid conjugation were investigated as methods to retain the stability and prolong the biological activity of RLX2 peptides. To the best of our knowledge this is the first report that has compared the effect of chemical modification and liposome encapsulation of any peptide on the peptide activity. A palmitoyl conjugate of RLX2 peptide (P-RLX2) was synthesized, using d moiety .RLX2 peptide encapsulating nanosized liposomes were additionally formulated (with mean diameters between 114 nm\u2013160 nm) for all the peptide types, by appropriate methods that confer a high encapsulation. In more detail, the DRV method ,23, a miFor the reduction of the size of both types of peptide-loaded liposomes, DRVs and MLVs, extrusion was applied, since it was previously reported that extrusion resulted in a much higher retention of heparin in nanosized DRV liposomes compared to sonication . We antiIt is well known that PEGylated liposomes have a higher integrity compared to non-PEGylated ones  ,30,31, aThe results of the peptide stability studies indicated that both peptide types, RLX2  and O-RLThe current results about the liposomal forms of RLX2 peptide types cannot be compared with others, since the liposomal encapsulation of RLX2 had not been previously studied as a method to prolong this peptide\u2019s activity; the beneficial effect of a special type of targeted RLX2 liposomes has been reported ; howeverOn the other hand, several chemical modifications were previously reported for RLX2. Dicarba RLX2 analogues were found to retain their activity but lose their stability in serum , while ol-Glu-OtBu modifier at the a-amino group of the N-terminal amino acid of the \u0392-chain, had a similar effect on the bioactivity of the peptide as that caused by oxidation , it was highly preserved. Indeed, after 30 d incubation in FBS at 37 \u00b0C, the bioactivity of the conjugate was much higher  compared to the preservation of the bioactivity of the liposomal form of RLX2 peptide . However, due to the higher initial bioactivity of liposomal RLX2, its bioactivity was practically the same as that of P-RLX2 at the 30 d time point. Nevertheless, liposomal RLX2 demonstrated a much higher bioactivity at all other time points evaluated; therefore, according to the current results, entrapment of RLX2 peptide in PEGylated liposomes was the most successful method, among those evaluated herein, for attaining a high and prolonged biological activity of RLX2. Another very interesting finding from the current study is that the stability study resulted for for the free and liposomal forms of RLX2 and O-RLX2 peptides are in good agreement with the results of the bioactivity preservation studies, indicating that such studies may provide good predictions for the preservation of their biological activity.N-terminal amino acid of the \u0392-chain of RLX2, resulted in a significant loss of its biological activity, although the remaining activity was highly preserved for up to 30 d, under the conditions applied in the current study.The current study proved that encapsulation of RLX2 in PEGylated liposomes could be used as a method to preserve its biological activity. The synthesis of a Palm-L-Glu-OtBu conjugate of RLX2, where this peptide modifier was linked at the a-amino group of the"}
+{"text": "Codonopsis pilosula straw (CPS) and the optimal fermentation parameters for mixed fungal fermentation. Single-factor tests were used to study the effects of the fungal ratio (Trichoderma reesei: Coprinus comatus), fungal inoculum, corn flour content, and fermentation time on the degradation rate of cellulose and lignin. Based on the results of this experiment, the optimal fermentation factors were identified, and the effects of various factors and their interactions on the degradation rates of cellulose and lignin were further evaluated using the response surface method. The quadratic polynomial mathematical model of degradation rates of the cellulose and lignin in CPS by mixed fungus fermentation was established using Design Expert software v8.0.6. Under the optimal parameters for fungal fermentation of CPS straw , the CDR and LDR reached 13.65% and 10.73%, respectively. Collectively, the mixed fungal fermentation of CPS resulted in decreased lignin and cellulose content, better retention of nutrients, and enhanced fermentation quality. The results of this study indicate that fermentation using Trichoderma reesei and Coprinus comatus is a productive method for straw degradation, providing a theoretical basis for the development of CPS as feed.The objective of this study was to investigate the cellulose degradation rate (CDR) and lignin degradation rate (LDR) of  Codonopsis pilosula having a large pharmacological value, the CPS industry is focused on planting, large-scale cultivation, and product development, and does not divert resources to research or the utilization of the large amount of straw resources generated during the production process. Many straw resources are discarded as waste or burned on site, which is both harmful and wasteful, so effective uses for straw resources are needed.Lignocellulose is the richest renewable and low-cost biomass energy in the world. Around 10 billion tons of lignocellulose is produced annually, about 70% of which is crop straw because of its high yield and considerable resource potential . DespiteCodonopsis pilosula is a Chinese herbal medicine that is cultivated worldwide, particularly in China, Japan, and Korea  reached 91.74%, including 17 different amino acids and nitrogen-free extracts (31.63%), which made it a valuable and feasible ruminant feed resource  the optimal CPS fermentation conditions could be identified using response surface methodology (RSM), providing guidance for preparing high-quality CPS-fermented feed.The objective of the present study was to determine if CPS was able to be developed as feed. This study tested the following hypotheses: (i) the lignocellulose in CPS could be degraded by Trichoderma reesei (strain CGMCC 3.5218) and Coprinus comatus (strain CC900) used in this study were purchased from the China General Microbiological Culture Collection Center  and the Tianda Institute of Edible Fungi , respectively. Before beginning the experiment, two strains of fungi were resuscitated according to the protocols of our research team. Two fungi were maintained on potato dextrose agar plates containing (g/L): potato 200, dextrose 20, and agar 15, and the pH value was not adjusted. The fungi were grown in a 28 \u00b0C constant temperature incubator for roughly a week until mycelia colonized and completely covered the agar plates. Finally, the fungi were stored at 4 \u00b0C and subcultured every 3 months.The CPS was collected at the ripening stage  from Dingxi City, Gansu Province . The collected CPS was then chopped into approximate lengths of 2\u20133 cm and then crushed into granules with an average particle size of 0.2 cm using a pulverizer  to facilitate subsequent fermentation. These granules were stored in sealed plastic bags in the laboratory and kept in a cool, dry room to avoid deterioration and rotting. The chemical compositions of CPS are presented in pastorianus. The medium was composed of 200 g/L potatoes, 20 g/L glucose, 2 g/L anhydrous ammonium sulfate, 1 g/L peptone, 1 g/L anhydrous potassium dihydrogen phosphate, and 1 g/L anhydrous magnesium sulfate, which was cultured for 2 d to Trichoderma reesei and 5 d to Coprinus comatus in a rotary shaker (150 rpm) at 28 \u00b0C. To guarantee that the spore concentration was constant in this investigation (1 \u00d7 107 cells/mL), the hemocytometer plate was used to count the spore concentrations of the two strains after culture .Trichodemma reesei: Coprinus comatus), mixed fungal inoculum, corn flour content, and fermentation time as single factors, the effects on the degradation rate of lignin and cellulose in the CPS were investigated, with three replicates in each group.Using fungus ratio , corn flour content was 10% (weight basis), and fermentation time was 10 d.Group 1: Testing for best fungal ratio: the fungal liquid was inoculated with Group 2: Testing for best fungal inoculum: mixed fungal inoculums of 5%, 10%, 15%, and 20% (water content basis) were added to the substrate, using the optimal fungal ratio determined from Group 1 and same proportions and fermentation time as Group 1.Group 3: Testing for optimal nutrient additive amount: 5%, 10%, 15%, and 20% (weight basis) of corn flour was added into the substrate, using the optimal fungal ratio determined in Group 1, the optimal fungal inoculum determined from Group 2, and a 10-day fermentation time.Group 4: Testing for optimal fermentation time: Using the optimal fungal ratio, fungal inoculum, and nutrient additive amounts determined in Groups 1-3, the fermentation was carried out on the substrate for 5 d, 10 d, 15 d, and 20 d.Trichoderma reesei and Coprinus comatus mixed fermentation to break down lignocelluloses . An experimental response surface analysis was conducted with three levels of each factor. A mathematical model was established between the degradation rate of lignin and cellulose and the various factors tested and these calculations were used to determine the optimal conditions for using lluloses .Characterization scanning electron microscope (SEM) imaging was carried out using a Gemini 500 SEM. The chemical phase analysis was carried out using a PANalytical X-ray diffractometer (XRD), which was equipped with CuK\u03b1 radiation (\u03bb = 0.15406 nm). Fourier-transformed infrared (FTIR) spectra were obtained from an FTIR spectrometer .Each sample\u2019s neutral detergent fiber (NDF), acid detergent fiber (ADF), and lignin were measured after the single-factor test. Dry matter (DM), crude protein (CP), ether extract (EE), ash, NDF, ADF, lignin, and volatile fatty acids were evaluated in the samples before and after response surface methodology optimization. After drying the samples to a constant weight at 65 \u00b0C, the DM content of the samples was calculated. CP content was calculated by multiplying nitrogen content by 6.25. The diethyl ether extract was determined using the Soxhlet method . After tP < 0.05.Experimental data, including the chemical compositions of CPS after different treatments, were expressed as means and analyzed by IBM\u2019s Statistical Product and Service Solutions software (SPSS 21.0). ANOVA was conducted to evaluate differences, followed by a Duncan\u2019s multiple range test. Differences were considered statistically significant at Trichoderma reesei gradually decreased and Coprinus comatus gradually increased (Trichoderma reesei: Coprinus comatus), the CDR and LDR reached 12.3% and 5.67%, respectively, with an initial transient increase followed by a slight decrease in degradation rate, verifying that Coprinus comatus is important to lignin decomposition (Trichoderma reesei was not included in the substrate (0:10 ratio), the CDR decreased.As the proportion of ncreased , celluloposition . When TrThe degradation rates of cellulose and lignin increased as the inoculum size increased . The peaP < 0.05). Batch fermentation was conducted to save costs, and the optimal addition of corn flour was set to 10%.At a corn flour concentration of 10%, the cellulose and lignin content was the lowest, and peak CDR (13.30%) and LDR (10.47%) were observed  and 3B. Trichoderma reesei and Coprinus comatus primarily grew hyphae in the first 5 d, but the CDR and LDR increased significantly over time. The degradation rates of cellulose and lignin decreased after 10 d of fermentation, and after 15 d, the CDR and LDR were 13.61% and 9.33%, respectively , and C and AD had significant effects on the CDR (P < 0.05), indicating that these were solid , which indicates that these were important factors in the solid-state fermentation process. The missing items were not significant, indicating that there were no abnormal points in the test data and that the model was appropriate , while the lack-of-fit test was not significant (P = 0.8196), indicating that the regression equation had a good fitting degree. The regression equation\u2019s coefficient of determination (R2) was 0.93, indicating that this model can explain 93% of the variation in CDR, suggesting that it is a good fit for actual data , and the lack-of-fit test was not significant (P = 0.2428), which indicates that the regression equation had a good fitting degree. The R2 of the regression equation was 0.93, indicating that 93% of the variation in CDR could be explained by this model and that the model is a good fit for actual data  spectrometer , indicating that lignin was degraded to a certain extent. The peak of 1,201\u20131,357 cm\u22121 (C-O stretching vibration in lignin) represents the byproducts of lignin decomposition, such as phenol, ether, alcohol, and ester. The increase in the intensity of these peaks indicates an increase in these byproducts. After pretreatment, the peak at 1,022 cm\u22121  or polysaccharide) was enhanced, showing that cellulose is degraded into sugars. The 3,300\u201335,00 cm\u22121 wide absorption band corresponds to carbohydrates . The decrease of the peak here indicates that the stretching vibration of the hydroxyl group was strengthened. This may be because the ether bond broke, making the molecular structure looser, exposing the internal hydroxyl group, and increasing the hydroxyl group of lignin. This shows that the lignin undergoes a demethylation reaction, which can reduce the steric hindrance inside the lignin and improve its reaction activity. These results show that the chemical structure of the cellulose and lignin of the Codonopsis pilosula straw were destroyed by the introduced strains, effectively degrading the cellulose and lignin.To further investigate the influence of trometer . Figure Codonopsis pilosula straw samples were examined through a scanning electron microscope (SEM) and are presented in Trichoderma reesei and drumstick fungi for fermentation, the straw surface showed corrosion and tearing, with the straw surface becoming loose, with exposed cellulose and lignin, and broken and rough fiber bundles. Lignocellulose-degrading enzymes secreted by Trichoderma reesei and Coprinus comatus during the growth process led to some degradation in Codonopsis pilosula straw. With the shedding of the primary cell wall, more inferior walls are exposed, which is conducive to the in-depth role of enzyme molecules.The morphological structures of both raw and fermented Codonopsis pilosula is a traditional medicine that has been used worldwide for many decades (Codonopsis pilosula straw (CPS) has been largely understudied and is often burnt as waste. Few studies have examined the use of CPS as crop straw feed. It has been established that straw is primarily made up of cellulose, hemicellulose, and lignin. Biodelignification can be done using microbes, as these microorganisms produce enzymes to attack, and degrade polymers in lignocellulosic substrates. Many microorganisms in nature can degrade lignin, including fungi and bacteria. This study used the microbial fermentation method to ferment and degrade the lignocellulose of CPS, specifically using the fungal microorganisms Trichoderma reesei and Coprinus comatus. Genetically-engineered Trichoderma reesei is one of the most promising fungi for cellulase production, with an estimated 60 to 100 g of extracellular protein per liter of cultured Trichoderma reesei  and laccase (Coprinus comatus) were used to degrade CPS, and the degradation effect of CPS was evaluated through various fermentation conditions. The results showed that these strains had a degradation effect on CPS lignocellulose.Using a comprehensive analysis of SEM, XRD, and FTIR, the degradation degree of lignocellulose by drilling . Bacteridrilling . Zhang eCoprinus comatus led to increased lignin degradation and a synergistic degradation of cellulose. This finding explains the increase in the cellulose breakdown rate when the fungal ratio increased and the concentration of Trichoderma reesei decreased. When the inoculum was too large, the microorganisms grew too quickly; the insufficiently dissolved oxygen in the fermentation system reduced microorganism activity and enzyme production rate. In contrast, when the inoculum was too small, microorganism growth and the enzyme production rate were slow. Carbon and nitrogen supplies are reportedly significant factors for microbial lignin degradation and enzyme production and modifying the culture conditions can greatly increase the production of lignin-degrading enzymes (The growth of microorganisms is influenced by several factors, including: moisture, inoculum amount, nitrogen source, carbon source, nutrient requirements, and fermentation time. Other studies have assessed the effects of pH, carbohydrates, and nitrogen source ratios in the straw fermentation process and found that adding a suitable amount of carbs and nitrogen sources during the process can significantly improve the feed fermentation quality . This st enzymes . Differe enzymes .Bacillus amyloliquefaciens increases CP content in rape straw (Trichoderma reesei and Coprinus comatus were added to CPS at a 4:6 ratio, leading to different degrees of cellulose and lignin degradation the straw. More lignin was destroyed by more Coprinus comatus, explaining the increase in cellulose breakdown when the relative concentration of Trichoderma reesei declined. It is widely acknowledged that Trichoderma reesei and Coprinus comatus can synthesize laccase, manganese peroxidase, lignin peroxidase, and cellulase to degrade cellulose and lignin as quickly as possible in the solid-state fermentation process with the right inoculation dosage. However, if the inoculum is too high, the nutrients in the solid-state fermentation medium are consumed too quickly, affecting the growth of the fungal strain later in the fermentation process. At the same time, the metabolites produced increase in a short time, reducing the synthesis rate of various decomposing enzymes. The benefit of mixed fungal fermentation is that different strains exhibit different enzyme-producing properties and complement one another, resulting in the rapid breakdown of lignocelluloses in straw (Trichoderma reesei and Coprinus comatus were used to ferment CPS in this experiment, and the impact on cellulose degradation was the most significant after a fermentation time of 15 days. As the fermentation time increased, the remaining nutrients in the solid fermentation medium gradually decreased, the growth and metabolism of the strains slowed, and the secretion of related enzymes used for degradation decreased, resulting in a gradual decrease in the rate of cellulose and lignin degradation.A symbiosis of microorganisms can increase the palatability and digestibility of straw for livestock and poultry, reducing feed rate, costs, and environmental pollution. Research shows that fermentation with lactic acid bacteria, yeast, and pe straw . In thisin straw . Laccasein straw . TrichodTrichodemma reesei and Coprinus comatus for lignin degradation in CPS were obtained. The fungal combination fermentation could significantly increase cellulose, hemicellulose, and lignin degradation rates for converting CPS to more edible feedstuffs.The optimal fermentation conditions of 10.7717/peerj.15757/supp-1Supplemental Information 1Click here for additional data file.10.7717/peerj.15757/supp-2Supplemental Information 2Click here for additional data file.10.7717/peerj.15757/supp-3Supplemental Information 3Click here for additional data file.10.7717/peerj.15757/supp-4Supplemental Information 4Click here for additional data file.10.7717/peerj.15757/supp-5Supplemental Information 5Click here for additional data file.10.7717/peerj.15757/supp-6Supplemental Information 6Click here for additional data file.10.7717/peerj.15757/supp-7Supplemental Information 7Click here for additional data file.10.7717/peerj.15757/supp-8Supplemental Information 8Click here for additional data file.10.7717/peerj.15757/supp-9Supplemental Information 9Click here for additional data file.10.7717/peerj.15757/supp-10Supplemental Information 10Click here for additional data file.10.7717/peerj.15757/supp-11Supplemental Information 11Click here for additional data file.10.7717/peerj.15757/supp-12Supplemental Information 12Click here for additional data file.10.7717/peerj.15757/supp-13Supplemental Information 13Click here for additional data file.10.7717/peerj.15757/supp-14Supplemental Information 14Click here for additional data file.10.7717/peerj.15757/supp-15Supplemental Information 15Click here for additional data file.10.7717/peerj.15757/supp-16Supplemental Information 16Click here for additional data file.10.7717/peerj.15757/supp-17Supplemental Information 17Click here for additional data file.10.7717/peerj.15757/supp-18Supplemental Information 18Click here for additional data file."}
+{"text": "Despite a consensus that followers and leaders are interdependent, the focus of nursing education, practice, and research has been leader centred. This has spawned calls in the nursing literature for increased scholarship on followership in nursing.To develop a grounded theory of followership in nursing.This study addressed the question - how do registered nurses understand followership? 11 registered nurses participated in online interviews that were later transcribed and analyzed following Charmaz's approach to Constructivist Grounded Theory.The core category of trusting informal and formal leaders was co-constructed from the data. A conceptual model, titled Followership as Trust in Acute Care Nursing Teams, illustrates that the nurses\u2019 decision to trust (and subsequently to engage in following) hinges on sharing the load ; demonstrating knowledge ; and connecting through communication . When participants fully trust formal and informal leaders, they engage in following as proactive members of the team, provide solutions to problems, and take initiative. Conversely, when they are less trusting of informal and formal leaders, they are less willing to follow.This study underscores the importance of trust between followers and leaders for effective team function and safe patient care. More research on the follower-leader dynamic in nursing is needed to inform education, policy, and practice so that every nurse possesses the knowledge and skill to be both a follower and a leader. Teamwork is an essential aspect of nursing that affects patient care and quality outcomes . Teams cIn their 2018 study, Kaiser and Westers noted that members of high functioning teams clearly understand their roles and responsibilities, work respectfully with each other, and do not rely as heavily on a leader for specific purpose-related instruction. This suggests that high functioning teams involve effective followership and while the leadership role has been extensively researched in nursing, there is a dearth of research about followership in nursing. Despite this gap, there is a recognition that followership is an important topic for the profession and discipline of nursing. For example, The idea that followership is integral to teamwork was further advanced in an editorial by Another supporter of followership education in nursing, Every nurse has been in a follower role at some point in time; however, the focus of nursing research, education, and practice has been primarily on leadership, despite calls for increased attention to and scholarship on followership in nursing. For these reasons, the focus of this study is understanding nurses\u2019 perceptions of followership.The purpose of this study is to develop a theory of followership in nursing using constructivist grounded theory . The objThe constructivist model of followership described by The setting for this study was a tertiary care hospital in Western Canada. Participants were recruited from the hospital's four acute care units - two medical and two surgical units. Individuals were eligible to participate if they were registered with the College and Association of Registered Nurses of Alberta (CARNA), were employed as staff nurses in one of the target hospital's four designated units and provided informed consent. RNs employed in a supervisory position at the time of the interviews were excluded from participating.Purposive sampling was initially used to recruit nine participants who agreed to reflect on the topic of followership and participate in a conversational interview . In CGT,Ethics approval was obtained from the University of Saskatchewan Research Services and Ethics Office, the University of Alberta Health Research Ethics Board , and Northwestern Polytechnic  Research Ethics Board. Operational approval was obtained from the target hospital.Participants provided informed written consent, which was affirmed verbally immediately prior to the start of the interview. Anonymity was not possible with interviews; however, to ensure confidentiality participants were assigned a numerical identifier and all identifying information was removed from the interview transcripts. Interview audio tapes, interview transcripts, memos, and signed consent forms, are stored in a locked cabinet in the first author's private office and all electronic data is being stored on a password protected computer and on a secure server .Initial email contact was made with the managers and clinical educators on the target units to explain the purpose of the study and request permission to recruit RNs. Once permission was received, recruitment posters and a participant information letter were placed in each unit's staff room inviting potential participants to contact the first author and to attend an online information session. Two such presentations were offered on different dates and times. In addition, a link to a video explaining the study was included on the poster for individuals who were unable to attend an online information session. Online rather than in-person information sessions were used for recruitment due to COVID-19 physical distancing requirements.Digitally recorded, individual interviews were completed by the first author between August and October 2021 using a semi-structured interview guide. This short timeline for data collection was influenced by the pandemic and constraints on participants\u2019 time. The interviews were conducted via telephone and lasted between 20 and 40\u2005min each. Interviews were scheduled at a time selected by the participant and began with introductions, a review of the purpose of the study, an invitation to ask outstanding questions, and confirmation of the participant's consent. All participants had the opportunity to debrief following the interview.Second interviews with the first two participants were completed before the remaining nine participants were interviewed. The information gleaned from these second interviews facilitated the creation of additional questions related to the concept of being open to followership and helped to strengthen theoretical sensitivity. Consistent with the practice of theoretical sampling, three participants took part in another interview to confirm whether they agreed with the findings of the study. The study's rigor was strengthened when these three participants endorsed the core category and agreed that the analysis resonated with their perceptions of followership.Data collection and analysis proceeded concurrently to enable researchers to remain close to the participants\u2019 understanding of their experiences and reflects on how followership was constructed and enacted . In keepEleven RNs participated in the study. All identified as female, their ages ranged from 20 to 49 years, and were employed in a casual, part-time, or full-time position. Participants included a newly graduated RN with two months of experience, four RNs with more than 15 years of nursing experience, and six others with between two and 14 years of experience. Ten participants were baccalaureate prepared and one had a master's degree in nursing. One participant acknowledged having worked in a manager position in the past. This wide range in ages and nursing experience provided multiple views of followership, which were influenced by participants\u2019 formal education, personal beliefs, behaviours, expectations of other team members, and the organizational context. In this study, participant's understanding of followership is constructed by the team dynamic they work in and their understanding of the relationship between followers and leaders. Team members are considered the leader and the followers. A formal leader refers to someone officially appointed to a leadership role and an informal leader is a member of the team, a follower, who provides leadership within the team.The four focused codes, sharing the load, demonstrating knowledge, connecting through communication, and willingness to engage, became the categories. Finally, the core category, trusting informal and formal leaders, was developed to illustrate the relationship among and between the categories created during focused coding and became the theoretical code .The conceptual model, titled Followership as Trust in Acute Care Nursing Teams, is illustrated in Several focused codes merged to support the creation of the category sharing the load and the subcategories understanding one's role, accepting one's role, and working together. Sharing the load was defined as being part of the team, agreeing on a shared goal, and implementing a shared plan. Within the team, everyone was expected to share the load \u2013 to work together to care for the team's patients. Participants in this study worked together in teams which creates the context for, and guides, their understanding of followership.I feel it's important that every team member does have their own specific role. So that tasks do get completed in a timely manner\u2026I feel like a follower should also understand their role prior to getting into it. They understand that they are under the umbrella of somebody else. So, somebody that has a little more experience and knowledge and that they are adjustable to\u2026whatever that unit requires from them (P6).Although ten of the eleven participants had never heard the term followership prior to participating in the study, all intuitively understood that it was integral to effective team function and involves a leader and the people who get the work done - the followers. Despite not having previous experience with or a language related to followership, participants were able to articulate their understanding of followership, and how they enacted the role. As well, there was overlap and consistency in participants\u2019 perspectives.\u2026I feel like all nurses, [of all levels of] experience need to really understand that everyone was in that same boat \u2026 We were all followers whether we recognized it, or we didn\u2019t\u2026I feel like every level of nursing needs to recognize that it's okay to be in that position, to be a follower (P6).Participants noted that a large part of sharing the load was dependent on followers accepting what needed to be done, accepting they were not in the leader role, and accepting and following the directions that were given to complete the task.When team members do not work well together, they risk not feeling part of the team and miss a sense of accomplishment: \u201cbeing a part of that team, and you\u2019re helping\u2026feeling helpful\u2026feeling accomplished\u2026being part of that group dynamic\u2026it definitely makes you feel good\u2026I think working together too helps us be cohesive together\u2026make good choices for our patients\u2026\u201d (P3). A team functioned best when every member did their part to work together: \u201c\u2026everyone works together because it's multiple members of the team to one patient\u2026it's truly based on\u2026how well your team is functioning\u2026\u201d (P10). Team members who worked together demonstrated followership, understanding and accepting their roles to complete the goal set by the team.\u2026if they give answers that they can\u2019t back up with policy or medical knowledge then sometimes I\u2019m not quite as willing to follow what they say\u201d (P4). Three sub-categories having experience, modelling, and mentoring contributed to the creation of the demonstrating knowledge category.Participants described demonstrating knowledge as having knowledge and being able to support that knowing with evidence, policies, or procedures. Participants also noted that demonstrating knowledge was informed by experience, was backed up by evidence, was current, and changed as new evidence was available. Having team members who demonstrated specialized knowledge was integral to safely and effectively completing tasks and working together. Participants also acknowledged that they were reluctant to follow those team members who did not use evidence to guide their practice: \u201c\u2026she's been here the longest, she has the most experience in this department and so\u2026she's taken on that role\u2026no one's ever said to her\u2026you\u2019re the charge nurse or you\u2019re the clinical coordinator\u2026and she definitely doesn\u2019t hold that title formally\u2026\u201d (P2) and \u201c\u2026they\u2019re usually more experienced so that I go with them, they\u2019re kind of guiding how my practice is\u201d (P11). Having experience was a definite asset when demonstrating knowledge, with the caveat that the experience be backed up with evidence, policies, or procedures.Having experience was deemed more important than having credentials; it reflected years of practice on the unit and a familiarity with unit and hospital procedures. As these participants explained, they looked to team members who had more experience for guidance: \u201cDemonstrating knowledge was exhibited through role modelling, an informal relationship whereby one nurse admired another and emulated their behaviour. This modelling was an important process and guided novice followers in their development as nurses. Participants highlighted the importance of a team member's behaviour: \u201c\u2026they\u2026lead by example\u2026they help out too. And those things\u2026make me want to follow their\u2026example and their lead\u201d (P4). Conversely, participants were not as likely to follow a team member whose behaviours were incompatible with or diverged from team expectations. Having experience and modelling were interwoven and integral to demonstrating knowledge.Participants emphasized the importance of new nurses finding someone to formally mentor them. Demonstrating knowledge in a formal mentorship role was a process that participants understood as important and was a role that a nurse grows into: \u201c\u2026when you\u2019re a follower\u2026you\u2026take those pieces\u2026like what you like about someone that you\u2019re following\u2026and be a mentor yourself\u2026and say, oh I like this piece, I like that piece\u2026maybe I can\u2026implement some of those things\u201d (P3). Finding a mentor was encouraged by participants, especially for new nurses learning to follow: \u201c\u2026find a mentor or a leader or a teacher\u2026then you emulate their practice\u201d (P10). Mentoring facilitated demonstrating knowledge by passing along information, practice, and skills and should be enacted at all levels of a nurse's career, either as mentee or mentor.Communication was fundamental to followership and was essential to the cohesiveness of the team, increased quality of care, and job satisfaction. Communication was articulated by participants as an exchange of ideas and knowledge in a respectful manner that involved listening to others and understanding what was being communicated. Two sub-categories knowing the goal and communicating clearly supported the category connecting through communication. The team could not complete the task and meet expectations if they did not connect via communication: \u201c\u2026because you don\u2019t want to\u2026assume anything that you\u2019re gonna be doing because that other person might be doing it. And in a\u2026life-threatening situation, any time that you can save is vital to that person's life\u201d (P9). A lack of communication within the team led participants to feel unwilling to follow and decreased the efficacy of the team: \u201cI will never follow someone who is more like a dictator\u201d (P10).The nurses in this study believed that followers on nursing teams must endorse the common goal of providing the highest quality of care. An important function of the team lead was to ensure that team goals were clearly communicated: \u201cwell it's [the responsibility of the leader] to make sure that everyone is aware of what that goal is and that everyone is\u2026working\u2026towards that goal in the most effective way\u2026so it's really to\u2026focus the group\u2026to what the end goal is going to be\u201d (P2). To follow effectively, the team must understand the goal. Connecting through communication strengthened group cohesion and when the goal was not clear, the team had difficulty working together: \u201cI struggle [to follow] leaders [team members] who just give direction\u2026because maybe they\u2019re given direction at a higher level without questioning the background\u201d (P7) and \u201c\u2026I feel like\u2026if I wasn\u2019t given a\u2026clear\u2026instruction\u2026I will never follow\u201d (P9).Communicating clearly was articulated by participants as essential for effective following, understanding one's role, and working together: \u201c\u2026really good communication with those around\u2026.and knowing what your role is in the group dynamics so that\u2026your role is done properly\u201d (P11). Having clear directions was an indispensable element of follower-leader communication and effective following. Communicating reiterated the shared goal and strengthened connections between team members. This was especially true when the rationale for the goal or the direction was also clear: \u201c\u2026explaining why [a] change [is necessary] or why we\u2019re being asked to do the specific task is, I think, critical\u2026and basically that there's some benefit to the change, either to the practice or to patient care that we\u2019re providing\u201d (P7). When participants understood their role, they were better prepared and able to follow and function to their fullest capacity on the team.The core category, trusting informal and formal leaders, was developed from constant comparison of initial and focused codes. The four categories sharing the load, demonstrating knowledge, connecting through communication, and willingness to engage emerged as an integral and continuous process in the construction of a preliminary understanding of followership in nursing. Participants noted that their decision to follow was based on their positive assessment of team members including informal and formal leaders\u2019 understanding of the role, their use of evidence-based knowledge, and that informal and formal leaders communicated clearly which facilitated willingness to engage. RNs\u2019 willingness to follow team members including an informal and formal leader was based on trust, which was developed over time and became the thread that connected the categories.\u2026your fellow followers are kind of like the make it or break it thing that makes it easier to follow\u2026the leader\u2026is a big factor in what it's like to follow someone but also your fellow followers\u2026are a big factor too\u2026it's easier to\u2026work towards that goal if your fellow followers are\u2026of the same like mind, work the same\u2026take care of each other, that kind of stuff. Because, working on the floor\u2026it's your team of your people who make it or break it for you\u2026whether you\u2019re in a leadership role or not, the people who are around you, you know that\u2026it's going to be a good shift or not a good shift\u2026you know if you can handle whatever comes through the door if your fellow co-workers\u2026are a good team.Trust was necessary to effective team function and was reciprocated between and among followers, and leaders. Participant 2 summarized the importance of trust in nursing teams:Sharing the load was essential among followers and for each team member to work to their highest potential. In the absence of sharing of the load, participants were less motivated to engage in following. Participants were more apt to follow a leader who demonstrated knowledge and could support that knowledge with evidence. Connecting through communication was integral to the willingness to engage especially regarding making sure team members had the knowledge they needed to complete the task and meet the goals of the team.I like to approach work with a really positive and optimistic mindset, and I understand that change is difficult and with COVID\u2026there has been a lot of change and some staff members are really\u2026not opposing the change, but just have a negative mindset about the change. And I think that can be really deterring to both followership and teamwork\u2026because that can\u2026lead to\u2026you\u2019re just not miserable, but\u2026you just don\u2019t approach work with the same passion that you should\u2026which deters the teamwork\u2026then you\u2019re not likely to follow the mission set out by the leader (P1).Willingness was described as feeling ready or inclined to engage in following activities: \u201cIf I\u2019m following others and they\u2019re confident and honest and transparent and trustworthy and just generally a nice person, I want to follow them more\u201d (P8).Also, participants commented that they were less willing to engage in followership if they did not feel respected within the team or the organization. The willingness to follow arose from the need to work together as a team and was maintained by continuing involvement in the processes of learning, being open, and participating.I guess when I think of the\u2026example, like something within the organization that made it easier for myself and every other nurse to follow as far as\u2026practicing and learning and feeling okay\u2026was that there was adequate time provided, adequate pay provided to do the preparation work\u2026so that if you learned one way versus another you\u2026could access the different learning styles. (P8)Participants noted that learning was about being willing to change and be open to new experiences and was integral to followership: \u201cI hope they would be open to new learning and\u2026like to learn from the person that they\u2019re following\u2026I would hope that they wouldn\u2019t be\u2026closed off or opinionated\u201d (P5). Learning takes time and when support was provided by leaders and the organization , participants were more willing to take the time to attend courses.Lifelong learning was essential to positive patient care outcomes and directly affects nursing teams\u2019 primary goal. Taking part in learning events enabled RNs to function at their highest potential and in turn increased following.\u2026initially for me\u2026it was a negative feeling because I wasn\u2019t used to it. However, after the end, when I started debriefing with\u2026my instructor and my preceptor, I realized that it was a really positive experience, a setting aside my beliefs to provide\u2026the holistic sense of care that [was] required for my patient and being able to\u2026step up outside of my shoes into their shoes made me\u2026feel\u2026I don\u2019t know\u2026like it was rewarding\u2026to be able to do that. (P1)Participants did not consider being open to new ideas or practices as being an empty vessel, but rather as being open to new experiences and the potential to improve. When asked to describe how they felt about setting aside their beliefs to consider a new idea or a proposed change, Participant 1 explained that their feelings changed from negative to positive:Followers affect their team members\u2019 attitudes toward openness. As one participant commented, \u201cbeing openminded and receptive to what's being asked and ideally trying to motivate others to align with what's being asked\u201d (P7). Being open to caring for others in a manner that supports their needs, being open to learning in new situations and contexts, and being open to listening to a new idea increased their willingness to follow and their team cohesion.I feel like what I\u2019ve seen sometimes in practice is\u2026co-workers that may\u2026team up together to think that we don\u2019t like this change, we don\u2019t want it to succeed. We\u2019re doing\u2026everything we can to\u2026shine negative light on it, or to not help others\u2026follow\u2026by kind of nit picking or\u2026just not doing what's meant to be done, what was asked of them and kind of going against the leader. (P8)Participating was an action which was demonstrated by helping, observing, following directions, and working together; it relied on synergy, cohesion, and teamwork. \u201cI see the followers as\u2026the people carrying out the actions, the doers\u201d (P8). \u201cThey are the ones who work to achieve the leader's vision or goal\u201d (P1). A willingness to engage was integral to following directions, however when participants did not like a change or were not supportive of the leader or team members they were not motivated to participate.Participating worked hand in hand with being open and learning and was inherent to a willingness to engage.The concept of followership first appeared in the nursing literature in the middle of the last century. In the intervening years, the topic resurfaced periodically in editorials, opinion pieces, and three research studies whose authors endorsed its importance in nursing practice and decried the lack of scholarship regarding followership in the nursing context . FindingLike followership, the concept of trust in nursing is not new . ParticiAlthough most participants were unfamiliar with the concept of followership before the interview, they intuitively seemed to understand what In their study of followership, Research on followership in nursing has the potential to advance follower's and leader's understanding and performance of their roles . The limThe findings from this study are potentially of interest to nurse educators as they update their curricula. Undergraduate nursing education has focused almost exclusively on leadership, with some content directed to the topic of followership, despite followership and leadership being interdependent and essential to teamwork. Nurses are followers and leaders throughout their careers and preparing them to function effectively in both roles ultimately affects patient care. Integrating the concept of followership would provide nursing students with a language and the foundational knowledge needed as they embark on their careers. A practice recommendation would be that education sessions for practicing nurses include the topic of followership especially in relationship to leadership and interprofessional collaborative practice. Nurses participate in following and leading roles throughout their careers and a fulsome understanding of followership in nursing through academic institutions and workplace education benefits nurses, organizations, and healthcare systems .Limitations of this study include: (1) participants\u2019 lack of familiarity with the concept of followership, which may have affected their ability to reflect upon and describe their understanding of the topic; (2) data collection occurred at a single acute care site; (3) the ongoing effects of the COVID pandemic and related stressors on RNs\u2019 understanding and experience of followership; and (4) the lack of diversity in participants\u2019 sex and gender.This study highlights the need for a holistic understanding of followership in nursing and its contribution to the leader-follower dynamic. Followers and leaders are interdependent, their relationship is synergistic, they are not mutually exclusive, and both roles are equally important. In the current study, the findings highlight the need for more research on followership in nursing and its relationship to trust, teamwork, and organizational culture. The role of followers must be acknowledged as legitimate and as essential to the follower/leader dyad. Without followers, teams, patient care units, and healthcare organization cannot function to their fullest capacity. Education on followership in nursing, that begins in nursing programs and is encouraged post-licensure, is needed to support effective followership for all nurses."}
+{"text": "To explore the molecular mechanisms underlying aggressive progression of papillary thyroid microcarcinoma and identify potential biomarkers.Samples were collected and sequenced using tandem mass tag-labeled liquid chromatography\u2013tandem mass spectrometry. Differentially expressed proteins (DEPs) were identified and further analyzed using Mfuzz and protein\u2013protein interaction analysis (PPI). Parallel reaction monitoring (PRM) and immunohistochemistry (IHC) were performed to validate the DEPs.Five thousand, two hundred and three DEPs were identified and quantified from the tumor/normal comparison group or the N1/N0 comparison group. Mfuzz analysis showed that clusters of DEPs were enriched according to progressive status, followed by normal tissue, tumors without lymphatic metastases, and tumors with lymphatic metastases. Analysis of PPI revealed that DEPs interacted with and were enriched in the following metabolic pathways: apoptosis, tricarboxylic acid cycle, PI3K-Akt pathway, cholesterol metabolism, pyruvate metabolism, and thyroid hormone synthesis. In addition, 18 of the 20 target proteins were successfully validated with PRM and IHC in another 20 paired validation samples. Based on machine learning, the five proteins that showed the best performance in discriminating between tumor and normal nodules were PDLIM4, ANXA1, PKM, NPC2, and LMNA. FN1 performed well in discriminating between patients with lymph node metastases (N1) and N0 with an AUC of 0.690. Finally, five validated DEPs showed a potential prognostic role after examining The Cancer Genome Atlas database: FN1, IDH2, VDAC1, FABP4, and TG. Accordingly, a nomogram was constructed whose concordance index was 0.685 .PDLIM4, ANXA1, PKM, NPC2, LMNA, and FN1 are potential diagnostic biomarkers. The five-protein nomogram could be a prognostic biomarker.The online version contains supplementary material available at 10.1007/s40618-022-01960-x. Papillary thyroid carcinoma (PTC) is the most common pathologic form of thyroid cancer and its incidence has increased worldwide over the past 50 years , 2. AlthWith the rapid development of high-throughput proteomic techniques, proteomics has become an important strategy for determining tumor biological mechanisms and exploring potential cancer biomarkers . In contAll specimens were obtained from the Department of Thyroid Surgery, China-Japan Union Hospital, Jilin College. Patients with PTMC who had undergone surgery and had a pathological diagnosis were included in the study. Both tumor samples and adjacent normal samples were collected 30\u00a0min after surgery, immediately transferred to sterilized vials, frozen in liquid nitrogen, and stored at \u2013\u00a080\u00a0\u2103.The study was conducted in accordance with the Declaration of Helsinki (revised 2013) and approved by the China-Japan Union Hospital Institutional Review Board (No. 20220804014). Informed consent was obtained from all the patients.Tandem mass labeling (TMT) was performed for mass spectroscopy (MS) using three consecutive TMT-10-plex  isobaric labeling kits according to the manufacturer\u2019s protocol. For digestion, the protein solution was reduced with 5\u00a0mM dithiothreitol for 30\u00a0min at 56\u00a0\u00b0C and alkylated with 11\u00a0mM iodoacetamide for 15\u00a0min at room temperature in the dark. The protein sample was diluted to a urea concentration of less than 2\u00a0M by adding 100\u00a0mM triethylammonium bicarbonate. Finally, trypsin was added at a ratio of 1:50 trypsin to protein mass for the first overnight digest and at a ratio of 1:100 trypsin to protein mass for a second 4\u00a0h digest.For data acquisition, tryptic peptides were dissolved in 0.1% formic acid (solvent A) and loaded directly onto a home-built analytical reversed-phase column. The gradient included an increase from 6 to 23% solvent B (0.1% formic acid in 98% acetonitrile) over 26\u00a0min, 23\u201335% over 8\u00a0min, and an increase to 80% over 3\u00a0min to then remain at 80% for the final 3\u00a0min, all at a constant flow rate of 400 nL/min on a EASY-nLC 1000 UPLC system . The resulting liquid chromatography\u2013tandem mass spectrometry data (LC\u2013MS/MS) were processed using the MaxQuant search engine (v.1.5.2.8). Tandem mass spectra were aligned with the human Swiss-Prot database, which was concatenated with a reverse Decoy database. Trypsin/P was indicated as a cleavage enzyme, with up to four missing cleavages. The mass tolerance for precursor ions was set at 20\u00a0ppm for the first search and 5\u00a0ppm for the main search, and the mass tolerance for fragment ions was set at 0.02\u00a0Da. Carbamidomethyl on Cys was reported as a fixed modification, and 18 modifications and oxidation on Met were reported as variable modifications. The false discovery rate was set at\u2009<\u20091%, and the minimum score for modified peptides was set at\u2009>\u200940.P value of\u2009<\u20090.05 were used for c-means clustering with the R package Mfuzz to characterize dynamic changes in expression patterns. Fuzzy c-means clustering is a soft clustering method that uses the Mfuzz algorithm with two key parameters. The algorithm iteratively assigns the profile to the cluster with the shortest Euclidean distance while minimizing an arbitrary objective function.Fragments per kilobase of transcripts per million mapped reads (FPKM) from DEPs identified by the likelihood ratio test with an adjusted P\u2009<\u20090.05) and blue represents nonsignificant enrichment. The size of the circle represents the fold enrichment.The Kyoto Encyclopedia of Genes and Genomes (KEGG) database was used for protein pathway annotation. First, the KEGG online service tool KEGG Automatic Annotation Server was used to annotate the description of the KEGG database for proteins. The annotation results were mapped to the KEGG pathway database using the KEGG online service tool KEGG mapper. The circles in the figure show the enrichment of differentially expressed proteins. Red represents highly significant enrichment of differentially expressed proteins  protein network, and the differential protein interaction relationship was extracted using a confidence value\u2009>\u20090.4.PRM verification included protein extraction, trypsin digestion, LC\u2013MS/MS analysis, and data processing using the Skyline (v.3.6) software. A validation set of 20 pairs of specimens was detected using PRM.The target proteins in the two comparison groups were sorted by their characteristics and then selected and applied to the receiver operating characteristics (ROC) analysis. In general, the closer the ROC curve is to the upper left corner, the better the predictive ability of the model. An intuitive indicator is the area under the ROC curve, namely the AUC (area under the curve), where the AUC value ranges from 0.5 to 1, with 0.5 denoting a poor classifier and 1 denoting an excellent classifier. SIMCA (version 14.0) software was used for partial least squares discrimination analysis (PLS-DA). The protein of predictive variable importance in projection larger than 1 (VIP pred\u2009>\u20091) was considered to be meaningful for sample discrimination. Further leave-one-out (LOO) cross-validation was applied to select candidate biomarkers. The samples were trained and evaluated in a leave-one-out manner using scikit-learn python package. Logistic regression was chosen as the classifier with {\\rm solver\u2009=\u2009'liblinear\u2019} and {\\rm class weight\u2009=\u2009'balanced\u2019}.https://portal.gdc.cancer.gov/repository). The dataset includes 510 PTC tissue samples and 58 adjacent normal tissue samples. Cox regression and the Kaplan\u2013Meier method were applied to analyze the association between target proteins, clinicopathologic features, and prognosis. The RMS package  was used to generate the nomogram. The calibration curves were evaluated graphically by mapping the probabilities predicted by the nomogram to the observed occurrences. A concordance index (C-index) was used to determine the discriminant ability of the nomogram.The mRNA sequencing (RNA-Seq) data and corresponding clinical information of 507 patients with PTC were downloaded from The Cancer Genome Atlas (TCGA) database , and the other was the discrepancy between the N1 group and the N0 group (N1/N0 comparison group).In this study, a total of 5203 proteins were identified and quantified with a fold change threshold of\u2009>\u20091.30 or\u2009<\u20090.67. In the tumor/normal group, 487 proteins were upregulated and 486 proteins were significantly downregulated compared with the normal tissues. Similarly, more than 200 proteins were upregulated and downregulated in the N0 tumor/N0 normal group and the N1 tumor/N1 normal group, respectively. However, contrary to our expectations, only 20 DEPs were observed in the N1 tumor/N0 tumor group, and 53 DEPs were detected in the standardized N1 tumor vs normal/N0 tumor vs normal group  using Mfuzz analysis. As shown in Fig.\u00a0To investigate the specific functions of DEPs, KEGG pathway analysis was performed. As shown by the circle map in Fig.\u00a0To validate the targeted proteins, 20 paired samples were collected from PTMC and further analyzed with PRM. The basic clinical information of the patients is shown in\u00a0suppletment Table 1. Similarly to the original PTMC sequencing, half of the patients had lymph node metastases (N1 stage) in the validation, but only two out of ten were in the progressive stage (N1b stage). Indeed, the heat map of PRM showed an obvious trend and pattern that changed according to the progression normal-tumor-metastasis Fig.\u00a0A. The deFurthermore, using machine learning strategies based on the PRM results, we evaluated the predictive power of the validated proteins Fig.\u00a0. In distTo investigate their prognostic value in thyroid cancer, we further evaluated 18 validated proteins from the TCGA database. Interestingly, five proteins showed a potential prognostic role: FN1, IDH2, VDAC1, FABP4, and TG Fig.\u00a0. First, In this study, we first established the proteomic profile of PTMC, validated several target proteins using PRM and IHC analyzes, identified potential diagnostic markers using machine learning, and constructed a nomogram of five proteins to predict prognosis.Proteomics has been used for more than 20\u00a0years. Early research was based on simple Western blot technology, and later mass spectrometry was used to identify proteins . HoweverBased on machine learning, PDLIM4, ANXA1, PKM, NPC2 and LMNA are potential diagnostic biomarkers. FN1 showed good results in distinguishing patients with lymph node metastases (N1) from N0. FN1 is a fibroadenoma protein involved in cell adhesion and migration. This may affect wound healing and the host immune system . Since iTg) is a macromolecular glycoprotein secreted by thyroid follicular epithelial cells, most of which are synthesized by thyroid cells and released into the residual cavity of thyroid follicles [Finally, using the TCGA database, we constructed a nomogram based on the prognosis-related validated DEPs, which showed good performance. In a previous study using the nomogram, clinicians were able to create a risk stratification system to better assess patients who would benefit from surgery for prostate cancer. In addition, nomograms are more quantitative and intuitive, making them more convenient for clinicians . It has ollicles , 45. It In conclusion, this study identified potential molecular mechanisms underlying the progression of PTMC. Machine learning suggested potential diagnostic biomarkers for PDLIM4, ANXA1, PKM, NPC2, LMNA, and FN1. Finally, the five-protein nomogram may be a prognostic biomarker in the future. However, the predictive ability and biological function need to be further verified by experiments with larger sample size and clinical trials. We hope that our study will provide a theoretical basis for clinical development and progress in the diagnosis and evaluation of PTMC.Supplementary file1 (PDF 85 KB)Below is the link to the electronic supplementary material."}
+{"text": "R)-sulfoxide with high optical purity (80% ee) and the same stereopreference was maintained in the oxidation of some other sulfides. Changes in the substituent on the sulfur atom affected the selectivity of the enzyme and the best results were obtained with phenyl methoxymethyl sulfide, which gave the corresponding sulfoxide in 92% ee as exclusive product. The over-oxidation of sulfides to sulfones was instead detected in all the other cases and preferential oxidation of the (S)-enantiomer of the sulfoxide intermediate was observed, albeit with low selectivity. Carrying out the oxidation of thioanisole up to the 29% formation of sulfone led to enhancement of the sulfoxide optical purity (89% ee). The activity in sulfoxidation reactions, in addition to that reported in the epoxidation of different substrates, makes this plant peroxygenase a promising and useful tool in organic synthesis.Biocatalyzed oxidations are an important target in sustainable synthesis since chemical oxidations often require harsh conditions and metal-based catalysts. A raw peroxygenase-containing enzymatic preparation from oat flour was tested as a biocatalyst for the enantioselective oxidation of sulfides to sulfoxides and the variations of some reaction parameters were evaluated. Under optimal conditions, thioanisole was fully converted into the corresponding ( Chiral sulfoxides are an important class of organosulfur compounds with relevant applications as intermediates in asymmetric synthesis as well as in medicinal chemistry. Since the early 1980\u2032s, they have become very popular as chiral auxiliaries  due to tEnantiomerically pure sulfoxides have been used in asymmetric synthesis  as effecS)-enantiomer esomeprazole  and 19.4 min [(S)-1a]; 17.2 min [(R)-2a] and 19.0 min [(S)-2a]; 21.7 min [(R)-3a] and 25.9 min [(S)-3a]; 18.1 min [(R)-4a] and 19.7 min [(S)-4a]; 22.6 min [(R)-5a] and 25.3 min [(S)-5a].HPLC analyses were carried out on a Dionex instrument  equipped with an Ultimate 3000 high-pressure binary pump, an ASI-100 autosampler, a TCC-100 thermostated column compartment and a UVD-100 multiple wavelength detector set at 220, 230, 240 and 260 nm. Chromeleon software (version 6.7) was used for instrument control, data acquisition, and data handling. Chiral HPLC was performed on a Phenomenex  Lux 5 \u03bcm Cellulose-1 (250 \u00d7 4.6 mm) column eluting with ry phase ,58: tR 11  in the solvent of choice (5 mL) the lyophilized enzymatic preparation (100 mg) was added and the resulting mixture was vigorously stirred at 25 \u00b0C (or other set temperature). The oxidant TBHP  was added in three portions over 1 h and the reaction course was monitored by chiral HPLC. At suitable times, aliquots (0.3 mL) of the reaction mixtures were withdrawn and extracted with diethyl ether (0.6 mL). The organic phase was separated, dried over anhydrous Na2SO4 and diluted with mobile phase before HPLC injection. To a suspension of 1\u20135 (0.18 mmol) in phosphate buffer pH 7.5/acetone 8:2 v/v mixture (5 mL), TBHP  was added in three portions over 1 h and the reaction course was monitored by chiral HPLC, as described above. To a suspension of lyophilized enzymatic preparation (100 mg) and sulfides v/v 50 mM phosphate buffer pH 7.5:acetone mixture (30 mL) and 1  was added. To the suspension, vigorously stirred at 25 \u00b0C, TBHP was added in three aliquots over 2 h  and the reaction progress was monitored by chiral HPLC. After 3 h the reaction mixture was extracted with 95:5 v/v EtOAc/MeOH (3 \u00d7 20 mL) centrifuging at 4000 RPM for 10 min to better separate the organic phase. The organic layers were pooled, dried over anhydrous Na2SO4 and taken to dryness to give pure (R)-1a as clear oil  in 80% ee; 1H- and 13C-NMR spectra were found in agreement with the literature data D25 = +109 , lit. [\u03b1]D25 = +114  for (R)-1a with 97% ee D25 = +195.3 , lit. [\u03b1]D25 = +191.4  for (S)-3a 86% ee [1H- and 13C-NMR spectra were found in agreement with the literature data [The lyophilized enzymatic preparation (600 mg) was suspended in a 50 mM phosphate buffer at pH 7.5 (30 mL) and sulfide a 86% ee . 1H- andure data .w/w H2O2 solution . The reaction progress was monitored spectrophotometrically by the increase in absorption at \u03bb 470 nm for the product tetraguaiacol (\u03b5 = 26.6 mM\u22121 cm\u22121) over 3 min. Pure horseradish peroxidase was used as positive control. Lyophilized enzymatic preparation (50 mg) was suspended in a 50 mM phosphate buffer pH 7.5 (2.5 mL) in a cuvette and a 96 mM water solution of guaiacol  was added. The volume was adjusted to 3 mL with 50 mM phosphate buffer pH 7.5 and the reaction was started by the addition of 3% g for 10 min. The obtained pellet was discarded and the retained supernatant was further centrifuged at 100,000\u00d7 g for 45 min by an ultracentrifuge. After decanting the supernatant, the microsome pellet was washed by resuspension in 50 mM phosphate buffer pH 7.5 and recentrifugation as above. The final pellet was suspendend in 50 mM phosphate buffer pH 7.5 (5 mL) and sulfide 1  was added. The reaction was started by adding TBHP  at 25 \u00b0C under magnetic stirring and monitored by HPLC. After 1 h, a 33% conversion of 1 was measured and (R)-2 was formed in 76% ee. In a parallel reaction by using the whole lyophilized enzymatic preparation in the same reaction conditions, sulfide 1 was fully converted in 30 min and (R)-2 in 75% ee was obtained.The lyophilized enzymatic preparation (100 mg) was suspended in a 50 mM phosphate buffer pH 7.5 (10 mL), stirred for 10 min at 25 \u00b0C and centrifuged at 10,000\u00d7 A raw peroxygenase-containing preparation was used as a biocatalyst in the asymmetric oxidation of sulfides to optically active sulfoxides and high reaction rate, coupled with selectivity ranging from moderate to excellent, was observed for five different substrates. The formation of sulfones as over-oxidation products was also detected in the biocatalyzed reaction and investigated in detail.Oat peroxygenase tolerated different reaction conditions without significant changes in its activity, confirming to be a robust enzyme also suitable for reactions in preparative scale for its low cost and easy availability. The activity in sulfoxidation reactions described here, in addition to that reported in the epoxidation of different substrates, makes this plant peroxygenase a promising and useful tool in organic synthesis."}
+{"text": "The landscape of ophthalmology is undergoing significant transformations, driven by technological advancements and innovations in materials science. One of the advancements in this evolution is the application of nanoporous materials, endowed with unique physicochemical properties ideal for a variety of ophthalmological applications. Characterized by their high surface area, tunable porosity, and functional versatility, these materials have the potential to improve drug delivery systems and ocular devices. This review, anchored by a comprehensive literature focusing on studies published within the last five years, examines the applications of nanoporous materials in ocular drug delivery systems (DDS), contact lenses, and intraocular lenses. By consolidating the most current research, this review aims to serve as a resource for clinicians, researchers, and material scientists engaged in the rapidly evolving field of ophthalmology. The landscape of ophthalmic care has experienced transformative changes over the past few decades, notably due to technological advancements and innovative materials science. Among the burgeoning frontiers in this interdisciplinary field is the application of nanoporous materials, characterized by their unique physicochemical properties and potential for sophisticated functionality .To present an up-to-date overview of this dynamic field, we conducted a comprehensive literature review, explicitly focusing on studies published within the last five years. This review aims to explore the myriad applications of nanoporous materials in ophthalmology, particularly in drug delivery systems (DDS), contact lenses, and intraocular lenses.Nanoporous materials are distinguished by their high surface area, tunable porosity, and capacity for functional modifications, which make them apt for potentially enhancing the bioavailability and controlled release of therapeutic agents ,3. FurthThe ensuing sections of this review are structured as follows: By consolidating the most current research and identifying future research trajectories, this review aims to serve as a resource for clinicians, researchers, and material scientists actively engaged in the evolving field of ophthalmology. The synthesis of past, present, and future perspectives on the application of nanoporous materials in ophthalmology offers a roadmap to navigate challenges and harness the potential of these materials in ocular therapeutics.Over the last few decades, research centered around nanomaterials has undergone significant evolution, transitioning from nanomaterial discovery to synthesis and application. The unique properties of these materials, such as their tunable size, versatility, and shape, continue to capture the attention of the scientific community, inspiring further research focused on developing approaches for studying and tuning these structures, particularly in the field of drug delivery ,8.Nanoporous materials are a type of nanoscopic material that consist of a well-organized arrangement of nanoscopic pores with diameters of 100 nm or less . Unlike Some nanoporous materials offer several advantages for addressing current challenges in ophthalmology since their structure can be personalized and controlled for effective drug release . They seNanoporous materials have many unique physiochemical and biological characteristics that make them ideal drug carriers in the delicate ocular environment. First, they are non-toxic and biodegradable and will undergo either enzymatic or non-enzymatic degradation in the body, producing a harmless, biocompartible by-product . This prControlled drug delivery systems (DDS) for diseases have been studied across specialties in recent years to overcome the challenges and barriers of traditional drug administrations . While cTopical, systemic, and intravitreal deliveries are most often employed to reach the posterior eye segment. Among these, topical applications, which may include solutions, suspensions, ointments, gels, or emulsions, are the simplest yet least efficient, achieving only around 5% penetration to internal eye structures . These oThe tear film, consisting of lipid, aqueous, and mucin layers, represents the first obstacle in topical drug delivery . LacrimaNearly 95% of a topically applied drug is eliminated via the nasolacrimal drainage system, comprising the lacrimal sac, canaliculi, and nasolacrimal ducts. This not only reduces ocular availability but also contributes to unwanted systemic absorption . VariousThe cornea\u2019s multi-layered structure  acts as both a mechanical and chemical barrier  Figure . Its semAlthough intravitreal administration offers a more direct route to the retina and vitreous, larger and positively charged molecules may find it difficult to cross the retinal pigment epithelium (RPE) barrier .Drug clearance from the aqueous humor occurs via two primary pathways: aqueous turnover through the chamber angle and Schlemm\u2019s canal, and venous outflow from the anterior uvea . While tBoth the blood-aqueous barrier (BAB) and the blood-retinal barrier (BRB) serve as major roadblocks for drug delivery to the anterior and posterior segment of the eye . The BABBioavailability remains a significant hurdle in delivering medications to the different segments of the eye via systemic, local or topical routes . SystemiIn summary, the anatomical constraints within the ocular environment necessitate meticulous design and consideration in ophthalmic drug delivery systems. Understanding these barriers is crucial for optimizing bioavailability and therapeutic efficacy. While the current drug delivery methods have their own set of advantages and limitations, the need for a more effective and patient-compliant approach remains an additional critical focus in ophthalmic drug delivery research.Much attention in the past has been centered around nanoparticle synthesis and design. While still limited, in recent years, researchers have centered their studies around the applications of nanoporous materials as DDS for the treatment of various ocular diseases, such as glaucoma, cataracts, or dry eye ,35,36. CHydrogels consist of three-dimension networks of polymer chains that can absorb a large amount of water, at least 10% of their total weight or volume, while maintaining their structural integrity . Their fMesoporous silica and nanoporous silica are inorganic nanoporous materials, synthesized from sodium silicates or silica tetraethyl orthosilicate with a surfactant micelle . They haR) and hydrophilic L-Arginine (Lo) to the eye as a potential treatment for glaucoma. They loaded JR and Lo into the internal cavity and mesoporous shell and found that the synthesized silica showed high stability and biocompatibility during degradation. After testing the HOS\u2019s ability to deliver NO donors (JR/LO) to the target tissue on a Cav1 knockout (KO) mice, which was observed to have higher intraocular pressure (IOP) compared to a Cav1 mice, they found that the HOS showed greater tissue permeability and was able to directly transport the drug to the tissue of interest. Additionally, Fan and collaborators investigated the long-term side effects of HOS-based NO nanotherapeutics as current sustained NO donor treatments tend to release NO in excess, which can lead to cell damage. After treating the Cav1 KO mice with the HOS-JRLO, every 48 h, they found that across 10 days, the IOP still decreased, showing that the HOS was able to release the NO in a sustained and stable fashion, thus preventing tissue damage, while still decreasing IOP [In light of these developments, recent studies have investigated innovative drug delivery systems such as hollow mesoporous organosilica (HOS) nanocapsules for co-delivering NO donor drugs to the eye as potential glaucoma treatments. Glaucoma is a complex, multifactorial ocular disease often characterized by the progressive degeneration of the optic nerve. Although various risk factors have been implicated, intraocular pressure (IOP) remains the most important modifiable risk factor. Traditional medical and surgical interventions predominantly focus on lowering IOP to halt or slow the disease\u2019s progression. As our understanding of glaucoma deepens, emerging research is exploring the role of physiological mediators like nitric oxide (NO) in disease management. NO is not only involved in reducing IOP but may also have a role in improving the perfusion of the optic nerve head, offering a multi-faceted approach to treatment. Latanoprostene bunod 0.024%, for instance, is a therapeutic agent that has demonstrated promise in clinical trials in this regard . In one sing IOP . They foIn another study, Sun et al. 2019)  looked a9  lookedIn another study, Pavia et al. (2021)  also looLastly, Wu et al. (2020)  were theNanoporous polymers are different types of polymers, such as nylon, polyethylene, and polyester, that consist of a framework of pores with sizes below 200 nm . They taIn one study, He et al. (2021)  developeNanoporous nanofibers are materials with a nanoscale structure and porous architecture. They are produced through electrospinning, a process where a polymer solution is exposed to an electric field, which causes the fibers to stretch and form their unique fibrous structure . The porWhile research using nanoporous nanofibers as DDS is still very new and limited, in one recent study, Rohde et al. (2022)  investigIn another study, Li et al. (2023)  designedWhile nanoporous nanofibers find many of the same applications as other porous structures due to their unique porous structure, such as filtration, catalysis, sensors, energy storage, etc., they also have the additional advantageous properties of nanofibers, such as flexibility and a lightweight build, which make their use in ocular DDS very effective .Advancements in nanotechnology within the past decades have made great strides in improving treatments for ocular diseases, from improving drug bioavailability to decreasing eye irritation and improving ocular biocompatibility ,67,68,69Although still in its infancy, the research for the use of nanoporous materials in intraocular lenses (IOL) shows significant promise for applications such as drug depots, biomarker sensors, lens structure enhancement, and the prevention of posterior capsular opacification (PCO).Liang et al. have made structural improvements to an accommodating IOL by adding a porous support ring made of PDMS (polydimethylsiloxane) between the front and back support meniscus. This modification improves lens stability as less central liquid polymer is needed. Given that PDMS is a common IOL material, toxicity is not a concern; however, the clinical use for this novel design has not yet been established as optical quality testing has not been conducted . Nanoporosity can play a role in the detection of disease biomarkers in the aqueous humor (AQ). A multifunctional nanoporous (NP) IOL composed of a PEGDAAm (diacrylamide-group-modified poly(ethylene glycol)) hydrogel was developed by Shin et al. with a mechanism to detect MMP-9 . The IOL was embedded within an MMP-9 activatable fluorogenic sensor. Fluorescence detected after intraocular injection of MMP-9 demonstrated the efficacy of this novel technology. Visual field distortion could potentially be a limiting factor for clinical use as the effects of the fluorescence on optical quality were not measured . Kim et Please refer to The self-administration of eye drops poses a challenge for patients, including the need for frequent administration, significant medication loss through spillage and leakage, and systemic absorption through the nasolacrimal duct. Hand-eye discoordination poses issues as well. The lack of medication adherence is linked with poor ocular health outcomes .A mechanism for controlled and non-invasive drug release to the eye can help improve ocular health outcomes. Implantable ocular drug depot devices delivered through intravitreal injection currently exist on the market ; howeverPlease refer to Although limited, a couple recent studies have centered around NP IOL development techniques. Both need further testing to determine optical quality, drug capacity, and drug release kinetics. Kraj\u0148\u00e1k et al. developed an efficient mechanism to build NP IOLs in a pHEMA (poly(2-hydroxyethyl methacrylate)) hydrogel using a replica mold. The nanopores, coined \u201cnanopillars\u201d, are adjustable in number, shape, and arrangement, potentially allowing for a drug storage depot adjustable based on ocular drug needs. Given that pHEMA has a long history of use in ophthalmic applications, toxicity is not expected, and the study\u2019s preliminary in vitro cytotoxicity testing with fibroblasts corroborates this . The chaGiven biocompatibility is an important consideration when developing ocular devices, the need for additional safety and efficacy testing in animal and human models for these novel IOLs remains. As porous ocular implants allow for easier bacterial adhesion , future Eye drops have poor ocular penetration and high systemic absorption, while hand-eye discoordination can make administration difficult. Improved drug delivery systems into the eye can improve therapeutic outcomes through better adherence. Like NP IOLs, NP contact lenses (CL) can address some of the challenges faced with topical ocular drug administration. CL-mediated drug delivery allows longer drug residence time on the cornea, improving penetration through ocular barriers while reducing the likelihood of leakage out of the eye through lacrimal fluid secretion and nasolacrimal drainage. Bimatoprost  and lataNP contact lenses offer a less invasive and more practical option for drug delivery compared to NP IOLs. A 2-HEMA (2-hydroxylethylmethacrylate) CL with cyclosporine A (CsA) embedded NP silica may reduce the irritation commonly experienced with CsA eye drops. This CL developed by Choi et al. shows CsA elution reaches the cornea and conjunctiva. For dry eye disease, this is not a significant finding given the drug does not need to pass through the corneal barrier for therapeutic effect. Sustained release of CsA only lasts 2 days, a disadvantage of this design . An NP, 2 g\u22121) and high pore volume (1.41 cm3 g\u22121), which allowed for a substantial loading capacity for and release of the glaucoma drugs, TMS and BTS. After measuring the drug release behavior of the DCLs in greater detail, they found that the LPMSN-laden DCLs released the TMS and BTS at slower rates in comparison to the standard CLs, which allowed for longer drug release time (up to multiple days) and greater ocular availability. It would be important in future research to build upon this study and look at specific lenses that could be worn for multiple days at a time that would allow for this sustained drug release since this was beyond the scope of the study. Further analyses revealed that the LPMSN-laden DCLs exhibited good biocompatibility and non-toxicology, thus supporting their potential use in clinical applications. In a recent study, Lai et al. (2023)  investigIn another recent study, Lai et al. (2023)  created Please refer to Oh et al. developed a reliable manufacturing approach for a HEMA (2-hydroxyethyl methacrylate) and MAA (methacrylic acid) porous contact lens using various blowout agents . FurtherNanoporosity can provide additional structural and functional benefits to CLs. Song, Ben-Shlomo, and Que developed a tri-functional PDMS (polydimethylsiloxane) based CL enveloped with a porous anodic aluminum oxide (AAO) thin film. This CL can measure IOP through optical signal shift. As intraocular pressure changes, corneal and contact lens curvature shifts, and this change can be measured and translated to an IOP measurement. The function holds no clinical significance as It must be performed ex vivo. The CL nanopores can also function as drug depots, providing stable drug release with 90% of the depot capacity released after 30 days. Lastly, this CL can detect biomarkers. The binding of a target biomarker to an antibody embedded in the CL can be detected through the change in an optical reflection signal before and after binding .Please refer to The field of nanoporous contact lenses is still underdeveloped and questions about pharmacokinetics, cost, and manufacturing remain unanswered. Furthermore, the use of multiple topical medications is common in some ocular diseases, yet the evaluation of some multi-drug depots has not been conducted. Additional research is needed to better understand the future clinical role of NP CLs.As the field of ophthalmology continues to evolve, the integration of nanoporous materials stands as a testament to the transformative power of interdisciplinary research. These materials, distinguished by their high surface area, tunable porosity, and functional adaptability, have opened new horizons in the treatment and management of ocular diseases. Their applications span from innovative drug delivery systems to the enhancement of intraocular and contact lenses, offering the potential for more effective therapies and improved patient experiences.By consolidating the most recent advances and outlining potential future directions, this review has aimed to provide a comprehensive and current understanding of the role of nanoporous materials in ophthalmology. It serves as a resource and guidepost for clinicians, researchers, and material scientists who are shaping the future of this dynamic and impactful field. The potential of nanoporous materials underscores the need for interdisciplinary collaboration between scientists and clinicians. With a focus on enhancing therapeutic modalities, the ultimate goal is the betterment of patient vision and overall quality of life."
\ No newline at end of file