diff --git "a/deduped/dedup_0880.jsonl" "b/deduped/dedup_0880.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0880.jsonl"
@@ -0,0 +1,51 @@
+{"text": "Listeria monocytogenes propulsion that explicitly simulates a large number of monomer-scale biochemical and mechanical interactions. The literature on actin networks and L. monocytogenes motility provides the foundation for a realistic mathematical/computer simulation, because most of the key rate constants governing actin network dynamics have been measured. We use a cluster of 80 Linux processors and our own suite of simulation and analysis software to characterize salient features of bacterial motion. Our \u201cin silico reconstitution\u201d produces qualitatively realistic bacterial motion with regard to speed and persistence of motion and actin tail morphology. The model also produces smaller scale emergent behavior; we demonstrate how the observed nano-saltatory motion of L. monocytogenes, in which runs punctuate pauses, can emerge from a cooperative binding and breaking of attachments between actin filaments and the bacterium. We describe our modeling methodology in detail, as it is likely to be useful for understanding any subcellular system in which the dynamics of many simple interactions lead to complex emergent behavior, e.g., lamellipodia and filopodia extension, cellular organization, and cytokinesis.To understand how the actin-polymerization-mediated movements in cells emerge from myriad individual protein\u2013protein interactions, we developed a computational model of  A detailed computer simulation explicitly simulates monomer- scale biochemical and mechanical interactions to characterize bacterial motion These interactions can be both biochemical, as in the activation of one protein by another, and mechanical, as in the application of force between bodies. Even when each individual interaction is simple and understood in detail, neither intuition nor qualitative description can forecast the emergent behavior of the whole system. We describe a methodology to characterize such emergent behavior using a detailed computer simulation of both biochemical kinetics and mechanical dynamics. In this paper, we apply the technique to the motility of the bacteria Listeria monocytogenes, a well-studied system in which actin network growth produces a force that moves the bacterium inside of cells. We discuss the model design, compare behaviors of the computational and biological systems, use the model to explain observed features of the bacterial motion, and identify observable experimental correlates of our hypotheses through which our interpretations may be confirmed or rejected.Cellular processes generally involve interactions among 10L. monocytogenes is a pathogenic rod-shaped bacterium that invades cells, reproduces, and spreads to neighboring cells, never exposing itself to the extracellular environment, thus avoiding a humoral immune response  affect this larger scale behavior. The exploration of putative mechanisms is also straightforward, as it is easy to add, remove, or modify each individual interaction.With our approach, we formalize experimentally based models of specific protein\u2013protein interactions and biochemical kinetics in a direct and flexible way, but there are drawbacks. The theoretical approaches used to analyze the Brownian ratchet model and its refinements , 2003 faThe biochemical and mechanical interactions near the bacterial surface are stochastic processes involving hundreds of filaments. We model dynamic processes on a per filament basis, rather than through bulk network properties and average filament growth. The growth of any particular filament depends upon that filament's precise location, orientation, and biochemical state, all of which change through time. There is no better way to simulate such a system than with a model that tracks each of these variables for each individual filament. In the future, this type of detail will be essential to capture (and thus explain) many observed biological phenomena.L. monocytogenes motility display repeated runs and pauses that closely resemble the actual nanoscale measurements of bacterial motion  exert equal and opposite forces that hold those objects together; these links break under sufficient strain. Forces of random orientation act on every explicit player to simulate Brownian motion . This system never approaches an equilibrium; Brownian motion and biochemical events ceaselessly create collisions and perturb protein\u2013protein links. Thus, we must compute new forces, exchanged between new neighbors, in each time-step. At the heart of this simulation is the dendritic nucleation model of actin dynamics . AsynchrL. monocytogenes associating with their actin tails; to match the biological reality, we need to modify our simulation of Brownian motion, since we cannot yet use much smaller time-steps. We compensate for this technical problem by carrying out simulations both for the two extreme cases  and for an intermediate degree of Brownian motion. Advances in computer processing speeds will, most likely, make such attenuation unnecessary in the near future. We will henceforth use the term \u201cBrownian simulation force\u201d to refer to the forces and torques that we apply to the bacterium to simulate its Brownian motion.The simulation time-step has a subtle effect on the simulation of Brownian motion for constrained objects . Applying the same forces and torques that are appropriate for free objects exaggerates the simulated Brownian motion of constrained objects since the motion restriction that results from those constraints can only be resolved over several time-steps, and those time-steps are large relative to the intrinsic time-scale of the constraints. Experimental measurements  show verD = 0.6 \u03bcM) does not sufficiently characterize that interaction since the interaction rates may be limited by the flux of Arp2/3 or G-actin onto the surface. We have calculated the flux of Arp2/3 and G-actin onto the bacterium's surface to determine the expected equilibrium number of ActA\u2013Arp2/3 and ActA\u2013actin complexes there, as explained in For our model, we use typical physiological concentrations for each of the proteins involved; these are listed in The ActA protein is distributed asymmetrically on the bacterial surface, with more ActA near the rearward tail-forming end. The unipolar shape of our distribution is based on measurements of the fluorescence signal from RFP-labeled ActA along the bacterial length for newly divided bacteria . New filaments are produced by two pathways. By activating Arp2/3, ActA is thought to catalyze the creation of new actin filaments and side-branches. We simulate the co-binding of ActA, Arp2/3, and an existing actin filament, allowing binding in any order. This complex leads to a new side-branch on the existing filament. Binding of ActA to the actin filament can occur only at specific ATP or ADP-Pi actin sites and is binding site limited, meaning that each bound ActA occludes a linear region of five monomers on the filament from further binding. Creation of a new filament de novo in our model involves the co-binding by ActA of G-actin and Arp2/3, in any order .In conjunction with other proteins , ActA may also regulate actin dynamics in other important ways . In thisL. monocytogenes. Average speeds of motion varied from ten to hundreds of nanometers per second, as do real observed bacterial speeds in different experiments (40 nm/s in purified proteins in www.celldynamics.org). The gross behavior of our simulated bacterium is life-like; model bacteria move in a qualitatively similar way to wild-type L. monocytogenes motility is multiphasic; motion of the bacterium that appears smooth on the micrometer length-scale actually consists of pauses that last many milliseconds, discrete nanometer-scale steps, as well as uninterrupted runs. No current model of this bacterial motility has fully explained these discrete steps, though numerical simulations with the tethered ratchet :A particularly large Brownian simulation force  in the forward path direction causes an unusually rapid but small forward displacement of the bacterium (region A).The steady-state rate of filament link turnover increases slightly as highly strained links break and are replaced by an ensemble of new links that all form nearly simultaneously in an unstrained state, thus creating a larger than steady-state population of coordinately unstrained links.A particularly large Brownian simulation force, or correlated sequence of forces, opposite to the path direction forces the bacterium backward against the population of linked barbed end actin filaments; filament collision force increases, filament link force falls, and actin polymerization near the surface decreases. A pause ensues.During the pause new filaments form and existing but distant barbed ends \u201ccatch up\u201d with the bacterium, thus increasing the filament collision force forward which the links restrain. The pause terminates when a particularly large Brownian simulation force  in the forward path direction is sufficient to break a few of the strain-synchronized filament links. As these links break, the force stretching each remaining link increases, setting in motion an avalanche of cooperative link breakage and initiating a run.We are justified in interpreting these correlations of Brownian simulation forces as causal because those forces are generated in our simulations so as to be random in direction and magnitude (representing a Gaussian distribution). Nothing in our model can cause such Brownian simulation force \u201caccidents.\u201d Their correlation with pause initiation or termination must therefore be causal.Absent Brownian simulation forces on the bacterium, the system response throughout the course of a pause is very different. In this case, a pause occurs only when a population of synchronized filament links is able to balance the filament collision forces, which on average increase only slightly during a pause, until a cascade of breaking links allows the bacterium to run again. Judging from the shape of the step-size histograms in The small amplitude of experimentally measured fluctuations of bacteria in vivo  suggest L. monocytogenes motility is mediated by actin-mediated forces. Building a simulation from basic, well-understood structures and interactions, we have reconstituted bacterial motility in silico. Appropriate speeds and persistence of motion emerge, reproducing experimentally observed values. Additionally, our simulation yields as an emergent behavior the nanometer-scale saltatory motion reported by experimentalists. We can analyze details of the simulated bacterial trajectories to investigate characteristics of this saltation: what is the mechanism behind the stepping, and is there a favored step-size?We have used our model to ask how Our computational experiments lead us to conclude that the tethered-ratchet model is an inherent \u201cpauser\u201d with several important attributes. First, there is no characteristic step-size or pause length; shorter steps and pauses are more frequent than longer ones. Second, the intensity of Brownian agitation of the bacterium influences average pause duration and frequency, but this agitation is not necessary for persistent saltatory motion. Third, pauses start when a population of filament links happen to form nearly simultaneously with low strain to balance filament collision forces. Pauses end when those links catastrophically break.To produce nanometer-scale pauses and runs, no special function need be attributed to the bacterial bound ActA protein, beyond an elastic linkage to actin filaments and some mechanism that prevents barbed end filament capping. Specifically, the ActA protein does not need a motor-protein-like stepping ability, nor need it act as a clamped-filament elongation motor . Given tThe speed of motion during a run is variable, but it is mostly confined to a narrow range of speeds that depends on the parameter set see C. PausesLastly, we have explored the variation of key biochemical events and mechanical interactions during a typical nanometer-scale saltation, looking at both individual pause events and averages of many such events, in an effort to uncover the causal factors. We conclude that the tethered-Brownian ratchet model is an inherent pauser; forward motion is temporarily halted whenever a population of synchronously strained filament links balances filament collision forces. Different mechanisms cause pause initiation/termination with and without simulated Brownian motion of the bacterium. With simulated Brownian motion of the bacterium, we find that pauses events are largely driven by coordinated Brownian simulation forces: a series of forces in the forward direction helps establish a set of coordinately-strained links, forces in the backward direction can help maintain a pause, and lastly forces in the forward direction help break links to terminate a pause. Without simulated Brownian motion of the bacterium, we find that a coordinately strained set of filament links balances the filament collision forces and that a pause will ensue until those links break en masse. Formation of such a set of filament links is an accidental, but frequent, occurrence, explaining the shape of the step-size and pause duration histograms see .That we find no characteristic step-size in our simulated nanoscale stepping constrasts with experimental results . RestricL. monocytogenes motility described here represents a new tool that should be useful for understanding many complex subcellular systems. The construction of this computational model requires experimental measurements of the biological details in L. monocytogenes propulsion and actin dynamics in general. Only in the last several years have crucial biological details come to light, e.g., the role of Arp2/3 in filament branching, or the binding sites and functionality of the ActA protein. Additionally, the implementation of the model in silico requires significant computational power, now affordable in the form of clusters of \u201coff-the-shelf\u201d machines . Powerful object-oriented languages are also recently mature (we use Java\u2122), making it possible to write computer code to implement such models. We believe that the confluence of detailed biological information and computational power/software heralds a new approach for understanding subcellular systems in which many thousands of simple biochemical and mechanical interactions lead to complex emergent behavior.The computational analysis of The biological systems in which this approach will be useful are, by definition, rich in detail. This complexity favors collaborations between modelers and the experimentalists who discover and quantify the molecular details without which this study would be specious. Creating a simulation environment that makes intuitive sense to experimentalists, i.e., one in which there is clear correspondence between biological entities and their modeled counterparts, greatly facilitates communication between modelers and biologists, and it ensures appropriate refinement of the model as new biological facts are uncovered.There are many future refinements and research directions for this model. We can incorporate a more sophisticated representation of the actin hydrolysis cycle  and inclA large set of differential equations determine how our state variables change with time. We solve these equations numerically, but not in a standard way because discontinuities in time occur frequently as objects collide suddenly and as objects suddenly spring into existence or disappear (due to new filament nucleation and depolymerization). To solve these thousands of differential equations, we divide time into discrete steps  balancing the necessities of capturing the system dynamics and accomplishing the simulation in reasonable human time . At the beginning of each time-step, the biochemical events and forces experienced during the last time-step will have changed the state of the system. New collisions and link forces may have arisen, as well as new objects. Existing links may break if they experience excessive strain for several consecutive time-steps. Each explicit player thus experiences a net force vector; in the next step, we move each explicit player in this vector direction so as to reduce or eliminate the strain energy associated with its collisions and links. To accomplish this practically, we calculate the forces required to resolve each individual collision (or strained linkage) in a single time-step. Each individual computer run simulates bacterial motion for a period of up to many minutes. We run hundreds of such simulations and then statistically analyze the ensemble of runs. Fitting straight line segments to each trajectory and filtering those segments by slope (speed of motion) reveals that each simulated bacterial trajectory is composed of a sequence of pauses (of varying duration) separated by near-constant speed runs between pause locations. After we identify all the pauses, we measure the distances between adjacent pauses; these are the putative step-sizes. Histograms of pause duration and step-size, distilled from multiple simulations, then allow comparison with experimental observations and reveal whether there exists a preferred step-size or pause duration. We average many thousands of pause events into portraits characterizing system behavior preceding, during, and following the typical pause. To do this, we align pauses, time and space shifting short sections of the path projected trajectories that span a single pause event so as to superimpose their starting or stopping points . These pAny trend remaining after the averaging of many thousands of events will reveal significant system behavior near the alignment point. Any individual event, however, might not exhibit all the trends revealed in such an average, so that the interpretation of these average profiles should be tempered accordingly.Not all of the capabilities of our model have been enabled in the simulations contributing to this study. Our calculations show that the local depletion of the implicit players, due to their incorporation into a larger assembly, is not significant for the concentrations, rate constants, and geometries of this system (data not shown). Thus, we do not simulate the diffusion of any of the implicit players (proteins), but rather assume that each exists at a constant concentration see . With thIn addition, F-actin interacts with cellular components in vivo that are not explicitly represented in either the dendritic nucleation model or our simulations . Some of these interactions have the effect of locking down actin tail in cellular space. We approximate their effect with a time- and actin length-dependent application of adhesions that eventually fix F-actin and the actin tail in our simulation space.Dataset S1(29 KB DOC).Click here for additional data file.Dataset S2(52 KB DOC).Click here for additional data file.Video S1A close-up look at the interaction of a single polymerizing filament with the bacterium. This filament has an artificially durable link with an ActA protein on the bacterium's surface; these links are typically very transient. The tip-clearance (drawn with a cyan line), the polymerization probability, the capping probability, and the Arp2/3 binding probability (set to zero for this demonstration) are reported at each simulation time-step.(1 MB MOV).Click here for additional data file.Video S2L. monocytogenes motility. Microscale hops, as opposed to the nanoscale steps we investigate in this paper, are apparent at this scale view. The bacterium induces an actin tail of variable density and demonstrates persistent motion.An animation rendered from the output of one simulation of (9.8 MB MOV).Click here for additional data file."}
+{"text": "A comprehensive understanding of the cytoskeleton can only be achieved by the combination of biochemical, cellular, and whole organism studies As a student I always marvelled at the sight of single cells in culture moving over artificial surfaces and exhibiting membrane ruffles and protrusions. However, while I found cultured cells fascinating I always wondered how cells are able to move and regulate their shape in the context of a whole organism where so many space constraints exist and where all cellular processes have to be tightly regulated. Some answers to my questions began to emerge in a paper written by Drosophila, which offers virtually unlimited possibilities as a model system for the genetic and molecular analysis of biological processes.The cytoskeleton is a meshwork of protein polymers extending throughout the cytoplasm. It not only provides structural support for the cell but also plays a central role in a range of dynamic processes from signalling to endocytosis and intracellular trafficking. A particularly clear example of this is the use of actin cytoskeleton as a \u201cwool\u201d for knitting multiple dynamic structures such as lamellae, filopodia, and stress fibres. These structures determine cell shape and also produce the driving force accompanying many types of cellular movements including muscle contraction and cell division. We know many details about some of the proteins that modulate the dynamics of actin in these structures. However, most of them have been found biochemically and their function has been elucidated primarily using in vitro and cell culture assays of actin assembly. What about these proteins in the context of a developing organism? How do cells generate a spatially and temporally ordered network of actin filaments represented at the tissue level? To answer these questions, we need to move to experimentally accessible multicellular organisms, such as Drosophila oogenesis. These cells have a simple polarised arrangement of actin filaments, which provides a useful system to study the spatial organisation of the actin cytoskeleton.Drosophila homologue of adenylyl cyclase-associated proteins), Enabled (Ena) and Abelson (Abl). These proteins had been well characterized in cell culture and in vitro studies, but little was known about their function in a developing organism. Clones of cells lacking CAP (Taking advantage of the ability to generate clones of cells lacking specific proteins, the authors identified new functional roles for actin regulators such as CAP (a king CAP , a proteIn contrast to the spatially restricted functions of CAP, Ena, and Abl, profilin and cofilin were shown to regulate actin filament formation throughout the cell cortex, a more global function that matches the results obtained in cell culture experiments. In summary, this study showed how proteins can organise actin in space and began to highlight some of the differences and similarities between cells in culture and in vivo. The functions revealed in the follicular epithelium were consistent with the roles previously shown in mammalian systems, but the experiments on intact tissue began to reveal a spatial and temporal functional dimension that could not have been observed in cell culture.These experiments could be expanded to large-scale screens , but thiDrosophila to screen a number of genes involved in signalling and cytoskeletal dynamics. They targeted 994 genes, of which 160 produced phenotypes in the experiment. The range of phenotypes varied from specific defects in the actin and tubulin cytoskeleton to others affecting cell cycle progression, cytokinesis, and cell shape. They also showed that only about 40% of the genes had similar loss-of-function phenotypes in both cell lines. This alone indicates an important limitation of many tissue culture experiments, since the same protein can have different effects depending on the cell type. Another valuable element of this work is that clustering of genes with similar phenotypes leads to the identification of pathways and networks of genes that are involved in cytoskeletal function.Drosophila cell line, studied the effects of proteins involved in the formation of lamellae. The authors looked at the effects of loss of function in 90 genes known to be involved in actin dynamics and the formation and activity of the lamella. As well as confirming the function of many proteins already known to play a role in this process, this analysis allowed them to find interactions between genes and to build genetic pathways.Drosophila embryos, as an example of how signalling pathways coordinate and regulate the activity of the cytoskeleton in the generation of shape and morphogenetic movements (Together these two studies reveal that RNAi screens in tissue culture can be a powerful tool for finding new functions of known and uncharacterized genes, and new relationships between genes. However, this is only the beginning, and the genes identified in this manner will have to be tested in vivo, in systems like that of Baum and Perrimon, where specific functions can be assessed in time and space within the confines of real organisms. The focus must be to understand how all these molecular events and regulation cascades operate in individual cells to contribute to the generation of changes in a whole individual. Increasingly, the attention of developmental biologists is being drawn from genes and their products towards cells . The futovements ."}
+{"text": "Each of the cells in our body is a complex machine. Within each cell, thousands of proteins and other molecules interact to produce the highly organized cellular events that are needed for life. However, there is no cellular line manager telling the individual proteins where to go and what to do. It's rather like an ant colony. No one tells the individual ants how to build a nest. They just do it. Similarly, no one tells the individual actin molecules, for example, to get together and polymerize to form the cytoskeleton that is essential for cell movement and other cellular processes. It just happens.Ant colonies and actin polymerization are both examples of emergent behavior. Broadly defined, emergent behavior is when a collection of individuals interact without central control to produce results that are not explicitly programmed. Scientists are only just beginning to understand how complex behaviors of this type can emerge from a myriad of individual interactions, many of which are well-defined experimentally.Listeria monocytogenes\u2014in their study of the complexities of cellular actin polymerization. This rod-shaped microbe, which lurks in well-ripened brie and other unpasteurized cheeses, can cause the sometimes fatal disease listeriosis, particularly in young babies or people with weakened immune systems.Jonathan Alberts and Garrett Odell have turned to an unlikely ally\u2014the bacterium Listeria microbes in food reach a person's gut, they penetrate the cells lining the gut, reproduce, and then spread from cell to cell without ever exposing themselves to the extracellular environment. In this way, they avoid the host's immune system. One particular protein produced by Listeria is central to this sneaky intracellular lifestyle: ActA. Expression of ActA allows the microbes to hijack the machinery in the host cell that controls the growth of actin networks. Some of the cellular actin, instead of forming the cytoskeleton of the cell, polymerizes around the bacterium, forming a dense \u201ccomet tail\u201d of actin that generates a force to move the bacterium around the cell and push it into neighboring cells. This clandestine use of our cellular machinery for actin polymerization is far simpler to understand than the elaborate use our cells normally make of it, so the study of Listeria propulsion provides a scientific stepping-stone to understanding the involvement of the actin cytoskeleton in normal cell movements.When Listeria cells do not move smoothly. Instead, the microbes move jerkily, with runs interspersed with pauses. The simulation faithfully reproduces this type of movement and offers a mechanistic explanation for it.Alberts and Odell have used established data on the biochemical and mechanical details of actin polymerization and the physiological concentrations of the proteins involved in the process to build a computer simulation of how an actin network assembles around a moving, rod-shaped bacterium. Their \u201cin silico\u201d reconstitution, which considers the behavior of individual actin filaments and requires a cluster of 80 computer processors to be run for several days at a time, produces realistic bacterial motion in terms of speed and persistence, and models the actin tail shape. The model also reproduces smaller scale emergent behavior. Real The approach described by Alberts and Odell can now be used to investigate many other, more complex cell mechanics problems, such as how the cellular movements involved in cell division are achieved. With the availability of detailed biological information and powerful computers, we may at last start to solve the mystery of how interactions among maybe 100,000 gene products can produce the organized cellular processes that cell biologists have been watching under the microscope for years."}
+{"text": "The capacity for self-generated movement is a defining characteristic of animal life. With the molecular components of cellular locomotion conserved in organisms from protozoa to vertebrates, directed cell motility appears to be an ancient cell process, likely dating back a billion years. Most directed motion relies on the assembly, or polymerization, of actin proteins into filaments. Actin is one of the most abundant proteins in cells; about half of the cellular concentration of actin is bound together in filaments at any given time while the other half floats freely as \u201cmonomers\u201d in the cytoplasm. The erection and demolition of actin filaments directs the cell motility that lays down the remarkable million miles of nerve cells that form the nervous system and drives a variety of fundamental biological processes, from effective immune response to embryonic development. Mutations in proteins that regulate actin assembly can lead to the abnormal cell migration associated with metastatic cancer. The actin cytoskeleton also provides the structural support for animal cells that the cell wall provides for plants.The molecular mechanisms underlying actin assembly and cell motility remained obscure until 1994, when Thomas Pollard and his colleagues discovered the protein complex that initiates actin polymerization. Called actin-related protein 2/3 (Arp2/3) complex, this molecular machine consists of seven subunits, including the two actin-related proteins. Free actin monomers are primed for rapid polymerization, but polymerization must be initiated by the Arp2/3 complex in a process referred to as nucleation. To nucleate a new filament, the Arp2/3 complex must be activated, a job accomplished by a family of proteins called WASP . WASP proteins bind to both the Arp2/3 complex and an actin monomer. The Arp2/3 complex also binds two molecules of adenosine triphosphate (ATP) on the Arp2 and Arp3 subunits. ATP releases energy in a process called hydrolysis, which drives most energy-dependent processes, from actin polymerization to muscle contraction. The precise mechanisms governing Arp2/3 activation and nucleation are not known. Now Mark Dayel and Dyche Mullins show where hydrolysis occurs during this crucial first step in polymerization and use this finding to investigate the mechanisms that drive nucleation.In previous experiments, Dayel and Mullins found that Arp2/3 appears to require hydrolysable ATP to effect nucleation. To determine when and if ATP hydrolysis occurs on the Arp2/3 complex, Dayel and Mullins developed a technique that allowed them to analyze the Arp2 and Arp3 subunits separately. Dayel and Mullins discovered that hydrolysis occurs only on the Arp2 subunit of the complex and that it happens during the step when WASP initiates the nucleation of a new filament. The researchers then used ATP hydrolysis on Arp2 to dissect the mechanism by which WASP activates the Arp2/3 complex and develop a model of nucleation.  They find that WASP proteins activate the Arp2/3 complex by coordinating its interaction with an actin monomer\u2014the first monomer of the new filament.By developing a novel technique to monitor activation of the Arp2/3 complex, the authors contribute a new tool for further investigations of this central part of the cellular motility machinery. And by showing how Arp2/3 is activated, they offer important insights into the workings of a multiprotein cellular machine and the mechanisms that cells enlist to control their shape and motility\u2014which could suggest potential drug targets to inhibit the abnormal cell movement characteristic of cancer and other diseases."}
+{"text": "The Wiskott-Aldrich Syndrome protein (WASP) is an adaptor protein that is essential for podosome formation in hematopoietic cells  Cell migration requires the rearrangement of adhesions and cytoskeleton in response to extracellular stimuli to form a leading edge that allows directed locomotion. In most cell types, migration-related adhesive structures are composed of integrin heterodimers and intracellular associated proteins clustered in plaques termed focal complexes and their more mature variant, focal adhesions WASP is an essential component of podosomes, where it activates the Arp2/3 complex inducing actin polymerization \u2212/\u2212 DCs by confocal microscopy. As expected, podosomes were grouped in clusters in wild-type DCs  after the expression of eGFP-WASP (Surprisingly, the recovery of WASP levels in WIPructures A. In add \u2212/\u2212 DCs C. This cGFP-WASP B, bottomGFP-WASP D. These \u2212/\u2212 DCs, which express normal levels of WIP, also lack podosomes and assemble large focal contacts and disorganized actin clumps instead Our data show that WIP by itself is not sufficient to promote podosome assembly because WASPIn summary, we have shown that in DCs WIP is essential for podosome formation and cell polarity by preventing the extensive degradation of WASP by calpain and by facilitating the recruitment of WASP to discrete foci to form the core of podosomes. The tight coupling between WASP and WIP is therefore a key contributor to normal podosome dynamics and likely of major importance to the cell trafficking behavior of DCs"}
+{"text": "The capacity for directed motion arises from core cellular processes shared by organisms from protozoa to primates, indicating an ancient origin over a billion years ago. Amoeba foraging for food, pathogenic microbes invading host tissue, host immune cells ingesting those pathogens\u2014all depend on the same core motility components. Actin, the most abundant protein in eukaryotic cells (cells with nuclei), lies at the heart of the motility machinery. Individual actin proteins assemble into polymers and organize into long filaments that form intricate networks under the direction of a seven-subunit protein complex called the actin-related protein (Arp) 2/3 complex. As actin polymerization occurs, newly formed daughter filaments grow out at an angle from mother filaments, much like branches sprout from a tree trunk. The place where daughter filaments bud from a mother filament (branching nucleation) is called the branch junction.Branch formation requires Arp2/3 activation, which occurs when the Arp2/3 complex binds to nucleation promoting factors , molecules of adenosine triphosphate (ATP)\u2014a molecule that fuels most energy-requiring processes\u2014and already-existing mother filaments. The details of branch junction formation have remained obscure, though nucleation models have proposed that Arp2 and Arp3 assemble around the mother filament and form a template for actin subunits to nucleate from. While the atomic structure of the inactive Arp2/3 complex (previously determined) shows that the two actin-related proteins resemble actin enough to form a template for nucleation, the spatial relationship between the proteins in the inactive complex does not match that in actin filaments.Current models postulate that Arp2/3 complex activation triggers a change in spatial relationship so that Arp2 and Arp3 resemble actin monomers in a filament; but without evidence on the structure of the Arp2/3 subunits at the branch junctions, these models have to assume that this is how nucleation occurs. In a new study, Coumaran Egile et al. combine electron microscopy, genetic labeling, and computational analysis to resolve the structure of the Arp2/3 complex at the branch junction to a resolution of one nanometer (that's one billionth of a meter), and demonstrate that the Arp2/3 template assumption is correct.To study the mechanics of branched actin nucleation by the Arp2/3 complex, Egile et al. assembled actin branches in test tubes and observed the action at the molecular level. To do this, the researchers tagged the different Arp2/3 subunits with labels that can be detected with electron microscopy, allowing them to determine the location of the proteins. Using this approach, they introduced different nucleation promotion factors\u2014WASp proteins as well as cortactin (an Arp2/3 activator that is found near the inner cell membrane)\u2014and compared the resulting branch junction formations. Only cortactin was found at the branch junction, supporting the model that WASp activators transiently bind, activate, and release Arp2/3 after branch formation. Cortactin, on the other hand, may stay behind to help stabilize the interaction between Arp2/3 and the mother filament. After genetically engineering yeast to express fluorescently labeled versions of the different subunits, Egile et al. observed the complexes' nucleation activities and located their position in the branch junction. The likely orientation of the subunits at the branch junction was determined with computational modeling. Given the position of the subunits and the number of possible combinations at this site, the authors used the crystal structure of the inactive Arp2/3 complex to map all the possible orientations. Only one cluster of orientations satisfied the constraints: Arp2 and Arp3, associated with the fast-growing end in an actin filament, facing away from the mother filament and toward the daughter filament.Though Arp2 and Arp3 orientations would have to change upon activation to support daughter filament growth, the authors argue that the change would not disrupt the overall architecture of the complex. Rotating the subunits to reflect their activated conformations places Arp3 next to the mother filament and Arp2 farthest away. In this orientation, the longest axis of the complex aligns perpendicular to the mother filament , an arrangement that could provide stability at the branch junction, by taking advantage of protein interactions on either side of the mother filament.\u2014Liza GrossAltogether, these results provide conclusive evidence for the starting assumption of a nucleation model in which Arp2 and Arp3 form a template at the branch junction that triggers daughter filament growth. And with the help of the subunit map presented here, researchers can further dissect the molecular mechanisms of actin branch nucleation and elucidate the dynamics of cellular motion."}
+{"text": "In line with our mechanistical studies and the colocalization of Abp1, N-WASP and Arp2/3 at sites of actin polymerization in neurons, we reveal an essential role of Abp1 and its cooperativity with Cdc42 in N-WASP-induced rearrangements of the neuronal cytoskeleton. We furthermore show that introduction of N-WASP mutants lacking the ability to bind Abp1 or Cdc42, Arp2/3 complex inhibition, Abp1 knock down, N-WASP knock down and Arp3 knock down, all cause identical neuromorphological phenotypes. Our data thus strongly suggest that these proteins and their complex formation are important for cytoskeletal processes underlying neuronal network formation.Polymerization and organization of actin filaments into complex superstructures is indispensable for structure and function of neuronal networks. We here report that knock down of the F-actin-binding protein Abp1, which is important for endocytosis and synaptic organization, results in changes in axon development virtually identical to Arp2/3 complex inhibition, i.e., a selective increase of axon length. Our in vitro and in vivo experiments demonstrate that Abp1 interacts directly with N-WASP, an activator of the Arp2/3 complex,  The organization and dynamics of the cortical actin cytoskeleton play important roles in cell migration, establishment and changes of cell morphology and adhesion but also in cellular uptake processes, such as phagocytosis, macropinocytosis and receptor-mediated endocytosis The importance of actin filament polymerization and dynamics in neuronal cells has been primarily investigated during neuronal development. The formation and migration of growth cones and neurites but also the establishment of neuronal polarity critically relies on actin dynamics A powerful nucleator of actin filaments is the actin-related protein 2 and 3 (Arp2/3) complex. Purified Arp2/3 complex alone poorly nucleates actin filaments and thus requires nucleation-promoting factors for efficient activity Our previous studies suggested a role for the mammalian F-actin-binding protein 1  in Arp2/3 complex-mediated actin dynamics. Abp1 does not associate with relatively static actin structures but strongly accumulates at the dynamic leading edge of moving and spreading cells where it colocalizes extensively with the Arp2/3 complex. The occurrence of Abp1 at sites of high actin dynamics is dependent on de novo actin polymerization and controlled by different signaling cascades, such as activation of Rho-type GTPases. In vitro-reconstitution assays with actin and recombinant Abp1 had, however, not revealed any direct effects on actin dynamics The mammalian cytoskeletal component Abp1 directly associates with F-actin The striking similarity of the effects of Abp1 knock down and Arp2/3 complex inhibition on neuronal morphology strongly suggested that Abp1 functions are tightly connected to Arp2/3 complex functions. We therefore tested whether Abp1 is capable to promote actin polymerization by incubating beads coated with recombinant proteins with rat brain extracts supplemented with an energy regenerating mix and fluorescently labeled G-actin. The assay was set up using the extended C-terminal part of N-WASP (N-WASP PWA), which interacts with and stimulates the Arp2/3 complex, as positive control. Glutathione S-transferase (GST)-N-WASP PWA led to fluorescent halos on the beads corresponding to newly polymerized actin , while GSince full-length Abp1 contains two N-terminal F-actin binding domains Supporting a role for Abp1 in Arp2/3 complex-mediated control of neuronal morphology, colocalization studies show a high degree of overlap for the immunoreactivities of Arp3 with that of Abp1 in hippocampal neuronal cultures at different stages of development. Both proteins accumulate at sites enriched for polymerized F-actin . In younIn mature neurons (21 d.i.v.), Abp1 showed a spatially well-defined staining at sites within the periphery of the neuronal network , mammalian Abp1 does not exhibit any motif typical for direct Arp2/3 complex binding and activation . ConsistIn order to unravel the molecular mechanism underlying the observed effects of Abp1 knock down on axon development, we therefore tested the hypothesis of an indirect association with the Arp2/3 complex and of a potential activity modulation of the Arp2/3 complex by an Abp1 interaction with an Arp2/3 complex activator. Immunocytochemical analyses revealed that Abp1 does not only colocalize with the Arp2/3 complex but also with its catalytic activator N-WASP at growth cones from young neurons  and at sAdditional experiments with different parts and mutants of Abp1 revealed that in line with the in vitro reconstitution data of actin polymerization  the Abp1In blot overlay analyses, the GST-Abp1 SH3 domain but not GST alone specifically interacted with purified Flag-tagged N-WASP . This deSince N-WASP is a multi-domain protein , it was To determine whether endogenous Abp1 and N-WASP associate in vivo, we carried out immunoprecipitations. Anti-Abp1 antibodies effectively precipitated Abp1 from rat brain extracts . ImmunobTo confirm the immunoprecipitation data and to firmly exclude that our detection of Abp1/N-WASP complexes represents a post-homogenization artifact, we reconstituted and visualized the Abp1/N-WASP interaction in intact cells by making use of a mitochondrial recruitment system This in vivo reconstitution of Abp1/N-WASP interactions at cellular membranes was based on a classical PXXP-motif interaction of the Abp1 SH3 domain with N-WASP because no recruitment of the corresponding P422L and G425R SH3 domain mutant to mitochondria enriched for N-WASP  was obseAbp1 knock down displayed a phenotype identical to Arp2/3 complex inhibition  and the Comparable to material purified from insect cells We next addressed whether the Abp1 SH3 domain would be able to release the N-WASP autoinhibition. The SH3 domain of Abp1 indeed accelerated Arp2/3 complex-induced actin polymerization in a dose-dependent manner when added in nanomolar concentrations to a reaction mixture containing N-WASP, Arp2/3 complex and actin . This acComparable to an SH3 domain-containing actin nucleation mixture lacking N-WASP , also fuTaken together our reconstitution experiments with purified components provide clear evidence for the involvement of Abp1 in the regulation of actin dynamics by stimulating the N-WASP/Arp2/3 complex-mediated actin polymerization reaction and indicate that Abp1 is an activator of N-WASP.Cdc42 (gi|61889112) in its GTP form associates with the GTPase-binding domain (GBD) of N-WASP and thereby activates N-WASP While in vitro reconstitutions are state-of-the-art for studying the molecular mechanisms of Arp2/3 complex-mediated actin polymerization, we wanted to take our analyses beyond in vitro studies. We thus next designed an experimental system allowing us to address the in vivo relevance of the observed activation of N-WASP-triggered actin polymerization by Abp1 and to also study the Cdc42 cooperation in vivo. We therefore reconstituted these processes at membrane surfaces in living cells that are normally F-actin-free, the outer membranes of mitochondria. Applying a mitochondrial targeting system we observed that targeting of Mito-GFP-N-WASP  but not The Abp1 C-terminus, which has been proven to be necessary and sufficient for stimulating N-WASP-triggered Arp2/3 complex-dependent actin polymerization in vitro , is effiSubsequently, we applied the system to also unravel the contribution of Cdc42 in N-WASP activation in vivo. Quantification studies revealed that coexpression of dominant-negative Cdc42 N17 significantly reduced (p<0.05) the number of transfected cells exhibiting some F-actin on Mito-GFP-N-WASP-positive mitochondria (58\u00b17%) . AdditioThe results from the in vitro actin polymerization assays suggested that the SH3 domain of Abp1 activates N-WASP-mediated actin polymerization in concert with Cdc42. If this is of in vivo relevance as well, then increasing N-WASP activation by the Abp1 SH3 domain should at least partially overcome the dominant-negative effect of Cdc42 N17. Indeed, qualitative  and quanThe enrichment of Abp1, N-WASP and the Arp2/3 complex in actin-rich growth cones of young hippocampal neurons  promptedPrimary hippocampal neurons were transiently transfected with GFP  and GFP-A potential critical role of Abp1 in N-WASP-mediated control of neuronal morphology was then addressed by RNAi. Cotransfection of neurons with N-WASP and an Abp1 RNAi vector clearly suppressed the effects of N-WASP overexpression . The numWe observed strong deficites in axon development when we reduced the availability of the Arp2/3 complex or Abp1  and reveThe integrity of the actin cytoskeleton and its ability to reorganize rapidly in response to external stimuli and internal cues is indispensable for changes in cell shape and motility but also for a variety of intracellular functions. These features of the actin cytoskeleton are regulated by a diverse array of actin-binding proteins, which are thereby modulators of cellular dynamics and key components of signaling processes. We here report that the mammalian F-actin-binding protein Abp1 plays an indispensable role in Arp2/3 complex-mediated actin polymerization controlled by the Arp2/3 complex activator N-WASP. We demonstrate that Abp1 directly interacts with N-WASP and that Abp1/N-WASP complexes exist both in brain extracts and in intact cells. Our reconstitutions of actin polymerization with purified components in vitro clearly demonstrate that Abp1 stimulates Arp2/3 complex-mediated actin filament assembly via activation of the catalytic activator N-WASP.S. cerevisiae, Abp1p, has been demonstrated to interface directly with the Arp2/3 complex S. cerevisiae, demonstrated that these proteins compete with each other for Arp2/3 complex binding and that Abp1p presence drastically reduced Las17p/Arp2/3 complex-mediated actin polymerization. In yeast, Abp1p was thus rather considered as an inhibitor of Arp2/3 complex-mediated actin polymerization than as an activator because Las17p-mediated actin nucleation seems to be more powerful than Abp1-mediated actin nucleation The moderately related counterpart of Abp1 in Strikingly, the degree of cooperative action between Cdc42 and proteins reported to associate with the PRD of N-WASP shows major differences in in vitro reconstitutions. Whereas Grb2 (gi|2498425) has been reported to act synergistically with Cdc42 in relieving the autoinhibited conformation of N-WASP and thereby in enhancing N-WASP-mediated actin polymerization Our examinations of Abp1 functions clearly demonstrate that Abp1 can activate N-WASP and cooperates with Cdc42 not only in vitro but also in vivo. The data from the in vivo reconstitutions of N-WASP/Arp2/3 complex-mediated actin polymerization at intracellular membranes are hereby very well in line with the finding that, in neurons, the N-WASP-induced increases of neurites and of neuritic branch points were very effectively suppressed by both Abp1 RNAi and dominant-negative Cdc42 and is thus dependent on both Abp1 and Cdc42. The fact that Abp1 RNAi alone had no effect on dendritogenesis is important to note because this demonstrates that specifically the effects of the excess of Abp1/N-WASP complexes are blocked by reducing Abp1 and excludes that putative indirect effects, which are unrelated to N-WASP, account for the suppression of the N-WASP overexpression phenotype.A special feature of Abp1 as N-WASP activator is that in addition to its N-WASP interacting domain it has two N-terminal F-actin binding modules. Abp1/N-WASP/Arp2/3 complexes can thus associate with F-actin via both the side binding activity of the Arp2/3 complex The colocalization of Abp1, N-WASP and Arp2/3 complex in growth cones we observed suggested that all three components mediate actin dynamics in neurite outgrowth and differentiation. The identical phenotypes of Abp1 and Arp3 knock down as well as Arp2/3 complex inhibition on axon outgrowth strongly support this view. The finding that suppression of Abp1 and Arp2/3 complex-mediated actin nucleation promotes axon outgrowth hereby seems somewhat counter-intuitive considering the well-established role of the Arp2/3 complex in actin nucleation and its pivotal role in creating the branched actin structures extending lamellipodia during cell migration Two conclusions can be drawn from these findings, first, at least in neurons, there must be considerable functional redundancy of the Arp2/3 complex with other, not yet identified actin nucleators that help to ensure that neurites are formed, elongated and branched properly to give rise to polarized cells that can form functional neuronal networks. It will be of extreme importance to identify these factors, as their discovery and characterization will lead to a deeper understanding in neuronal morphology control and in mechanisms of actin nucleation in general. Second, in axonal growth cones, Arp2/3 complex functions seem to interfere to some extend with the mere extension of the growth cone. The work of Strasser et al. Importantly, our data do not only show that Abp1 and the Arp2/3 complex function in the same cellular process but that also the molecular link between Abp1 and Arp2/3 that we discovered, N-WASP, does so. Expressing either an N-WASP mutant that is able to interact with Cdc42 but lacks the Abp1-binding PRD or expressing an N-WASP mutant that can undergo Abp1 binding but lacks the Cdc42 binding N-terminal part also caused phenotypes similar to that of Arp2/3 complex inhibition, Arp3 RNAi or Abp1 RNAi. The same is true for reducing the availability of N-WASP as a whole by RNAi. Together, these data strongly suggest that Abp1, N-WASP and the Arp2/3 complex work together in one complex, as demonstrated by our biochemical analyses, and that Abp1 is a crucial component in N-WASP/Arp2/3 complex-mediated cytoskeletal functions.Our N-WASP RNAi data are well in line with results very recently reported by Kakimoto et al. In addition to control of neuronal morphology, N-WASP-mediated Arp2/3 complex-dependent actin polymerization controlled by Abp1 might play a role during endocytic vesicle formation, a process supported by transient, local actin nucleation In mature neurons, a functional crosstalk between the cytoskeletal and membrane trafficking machineries might be of particular importance in nerve terminals to ensure the high speed, efficiency and accuracy of vesicle formation and recycling \u2013 important for both synaptic transmission and plasticity TTCCGGAAAAG; mutations underlined) were introduced by PCR into the Abp1 cDNA site targeted by RNAi sequence #1. The PCR product was then cloned into pCMV-Tag2 and verified by DNA sequencing.The expression and purification of the Abp1 GST fusion proteins used in this study were described previously Mammalian expression constructs encoding GFP-N-WASP and GFP-N-WASP \u0394PRD as well as HA-tagged N-WASP were described in CAGCGGGAAGGTGATGTACTTGATATCCGGTACATCACCTTCCCGCTGTTTTTTA-3 and 5-AGCTTAAAAAACAGCGGGAAGGTGATGTACCGGATATCAAGTACATCACCTTCCCGCTGG-3, Abp1 RNAi sequence #2: 5-GATCCGGTGATGTACGCCTTCTGCTTGATATCCGGCAGAAGGCGTACATCACCTTTTTTA-3 and 5-AGCTTAAAAAAGGTGATGTACGCCTTCTGCCGGATATCAAGCAGAAGGCGTACATCACCG-3. Residues mutated for generation of an RNAi-resistant Abp1 are underlined (in RNA sequence #1). A non-silencing RNAi control was generated with the following oligos: GATCCAATTCTCCGAACGTGTCACGTTTGATATCCGACGTGACACGTTCGGAGAATTTTTTTTA-3 and 5- AGCTTAAAAAAAATTCTCCGAACGTGTCACGTCGGATATCAAACGTGACACGTTCGGAGAATTG -3. RNAi tools against N-WASP and the Arp2/3 complex component Arp3 were generated by annealing and subcloning oligonucleotides corresponding to the siRNAs established by To generate RNAi constructs directed against rat Abp1 the following oligonucleotides were annealed and subcloned into pRNAT H1.1-GFP (GenScript), Abp1 RNAi sequence #1: 5-GATCCFor the actin polymerization assays, GST-fusion proteins of N-WASP WA and N-WASP PWA were expressed and purified according to methods described previously 2) of COS-7 cells were transiently transfected according to the DEAE-Dextran procedure  and butyrated 24 h after transfection, as described 2, 150 mM NaCl, 1% Triton X-100, pH 7.5) supplemented with an EDTA-free protease inhibitor cocktail (Roche) and spun for 20 min at 14,000 g. The supernatant was incubated overnight with anti-Flag antibodies covalently attached to protein G sepharose (see below). After several washes with TBS  Flag-N-WASP was eluted by incubation with 1.5 ml of TBS containing 100 \u00b5g/ml Flag-peptide (Sigma) for 12 h and dialyzed against PBS.For expression and purification of Flag-tagged N-WASP, 16 bottles  the resin was incubated for 0.5 h with 0.4 ml of 10 mM N-(3-dimethylaminopropyl)-N\u2032-ethylcarbodiimide hydrochloride (Sigma) in HEPES buffer. Beads were washed twice with HEPES buffer and once with lyses buffer prior to incubation with cell extracts. All steps of the lysis and purification procedure were carried out at 4\u00b0C.For antibody coating, 300 \u00b5l of protein G sepharose 4 Fast Flow (Amersham Biosciences) were incubated with 1 ml of 0.24 mg/ml anti-Flag antibodies in PBS containing 5% BSA for 5 h. After several washes with HEPES buffer  antibodies, and rabbit anti-GST antibodies were described previously Monoclonal anti-MAP2, anti-actin and anti-Flag (M2) antibodies were from Sigma, monoclonal anti-GFP (B34) and anti-myc (9E10) antibodies were from Babco. Rabbit anti-profilin antibodies were from Cytoskeleton. Rabbit anti-myc (A-14) antibodies were from Santa Cruz Biotechnology, Inc., rabbit anti-GFP antibodies were from Abcam.Secondary antibodies used in this study included Alexa Fluor\u00ae 350, 488 and 568 goat anti-mouse, Alexa Fluor\u00ae 350, 568 and 647 goat anti-rabbit, and Alexa Fluor\u00ae 647 goat anti-guinea pig antibodies from Molecular Probes; goat anti-guinea pig FITC antibodies from ICN Biomedicals; and goat anti-rabbit Cy5 and donkey anti-mouse Cy5 antibodies from Dianova.Peroxidase-conjugated donkey anti-rabbit and goat anti-mouse antibodies were from Jackson ImmunoResearch Laboratories and peroxidase-conjugated rabbit anti-guinea pig antibodies were from DakoCytomation.Blot overlay experiments were performed according to g. 20 \u00b5l of the high speed supernatant was supplemented 1\u223610 with 150 mM creatine phosphate, 20 mM ATP and 20 mM MgCl2. Additionally, 2.5 \u00b5l of 10 \u00b5M Alexa Fluor\u00ae 568 G-actin (Molecular Probes) in 50% glycerol were added. The polymerization reaction was initiated by adding coated beads. Samples were incubated on ice for 5 min and analyzed by fluorescence microscopy.The actin polymerization bead assay was essentially designed according to 2, 0.1 mM EDTA, 1 mM DTT) and were preincubated for 5 min at RT. The reaction was initiated by adding 5.5 \u00b5l of a mixture of 40 \u00b5M unlabeled G-actin, 4 \u00b5M pyrene-labeled G-actin and 4 mM ATP (pH 7.0). The change in fluorescence was measured at 407 nm in a fluorescence spectrometer . Cdc42 (Cytoskeleton) was preincubated with 20 mM EDTA and 40 \u00b5M GTP\u03b3S for 15 min at 30\u00b0C. The reaction was stopped by adding 20 mM MgCl2.The pyrene-actin polymerization assay was designed according to Immunoprecipitations were performed with affinity-purified rabbit anti-Abp1 antibodies or unrelated rabbit IgG (Santa Cruz) from rat brain extracts (1 mg each) in the presence of 100 mM NaCl as described HEK293 and COS-7 cells were maintained and transfected as described For mitochondrial staining, cells were incubated with MitoTracker\u00ae Red CMXRos or Deep Red 633 (Molecular Probes) as described Images were recorded digitally using a Zeiss Axioplan 2 microscope or a Zeiss Axio-Imager.D1 both equipped with a CCD camera 2.1.1 from Diagnostic Instruments and processed in MetaVue or Spot Software and Adobe Photoshop.To assess the effect of the reconstitution of N-WASP/Abp1 complexes at mitochondrial membranes, all transfected cells on several coverslips were identified by GFP fluorescence or by immunolabeling and scored for phalloidin staining on the mitochondria. The presence of F-actin on mitochondria was only analyzed in cells with Mito-GFP-N-WASP correctly targeted to mitochondria and, if contransfected with Flag-Abp1 flex/SH3, with Flag-Abp1 flex/SH3 corecruited. About 180\u2013500 cells were scored for each group. Results from at least 3 independent experiments were averaged and subjected to statistical significance calculations using the two-tailed Student test.Morphometric measurements of transiently transfected hippocampal neurons were performed with the aid of the NIH Image Software (ImageJ). Each experiment was repeated at least three times with independent neuronal preparations. Neurons were identified by anti-MAP2 staining and sampled randomly for morphometric analyses. The number of neurites protruding from the cell body and the number of neuritic branching points from 29\u201346 neurons for each condition were counted and measured at day 6 in culture. Axon and dendrite lengths as well as neurite numbers were determined in 46\u201367 neurons each (at day 3 in culture). Axons of immature neurons were defined as longest neurite at that time. Statistical analysis was performed using the two-tailed Student test.Figure S1RNAi-based reduction of Abp1 expression levels. (A\u2013D) Primary hippocampal neurons were transfected at day 5 in culture with a vector encoding for GFP and small interfering RNAs complementary to the Abp1 message under two different promotors. Neuronal cells were identified by anti-MAP2 immunostaining (C). Neurons transfected with pRNAT-driven Abp1 RNAi sequence #1 are marked by GFP expression  and showed a significant reduction in the anti-Abp1 immunoreactivity (B). Labelling of images reflects the color of the fluorescence signal in the merged image . (E) Quantitative analysis of the anti-Abp1 immunoreactivity of 50 neurons transfected with pRNAT-driven Abp1 RNAi construct (marked by GFP coexpresion) demonstrates that both Abp1 RNAi sequences tested result in an almost 60% reduction of the anti-Abp1 immuno-fluorescence intensity when compared to the pRNAT control. Data are represented as mean\u00b1SEM. Bar\u200a=\u200a20 \u00b5m.(5.27 MB TIF)Click here for additional data file.Figure S2Reconstitution of Abp1/N-WASP complexes at intracellular membranes. N-WASP and Abp1 SH3 domain fusion proteins encompassing a mitochondrial targeting sequence are recruited efficiently to mitochondrial membranes. COS-7 cells were transfected with Mito-GFP-Abp1 SH3 domain (B) and with Mito-GFP-N-WASP (E), respectively. Both Mito-GFP-Abp1 SH3 domain (B) and Mito-GFP-N-WASP (E) were targeted successfully to mitochondria, which were stained with MitoTracker\u00ae . Labelling of images reflects the color of the fluorescence signal in the merged images . Inserts represent higher magnifications of the boxed areas. Mito-GFP-N-WASP (H) is able to corecruit myc-tagged Abp1 full-length (G) in vivo, as evident by the obtained colocalization on mitochondria (I). Bars (A\u2013F)\u200a=\u200a15 \u00b5m; bars (G\u2013I)\u200a=\u200a10 \u00b5m.(5.24 MB TIF)Click here for additional data file.Figure S3Characterization of immunoisolated Flag-N-WASP by immunoblotting. Flag-tagged N-WASP immunoisolated from COS-7 cells was analyzed further by immunoblotting with different antibodies. Anti-Flag and anti-N-WASP incubations show that the material is intact and of correct size  obtained with anti-N-WASP antibodies). Further analyses demonstrated that the immunoisolation protocol employed is suitable to yield N-WASP material free of direct N-WASP binding partners, such as actin, the Arp2/3 complex component Arp3, profilin (gi|6755040) and Abp1. 50 \u00b5g RBC was loaded as positive control for each antibody.(6.39 MB TIF)Click here for additional data file.Figure S4Mito-N-WASP-induced actin polymerization on mitochondrial membranes is mediated by the Arp2/3 complex-interacting C-terminal WA domain COS-7 cells transfected with mitochondrially targeted full-length N-WASP (A) or N-WASP WA (D) showed presence of F-actin polymerized specifically at places of N-WASP targeting, as seen in the Alexa Fluor\u00ae 568 phalloidin staining . Labelling of images reflects the color of the fluorescence signal in the merged images . (G) Schematic representation of the parts of the N-WASP protein that trigger Arp2/3 complex mediated actin polymerization at mitochondrial membranes. Bars\u200a=\u200a10 \u00b5m.(4.32 MB TIF)Click here for additional data file."}
+{"text": "Wiskott Aldrich Syndrome protein (WASP) has a unique regulatory role in sealing ring formation and bone resorption in osteoclasts. Here, using the TAT-transduction method, we show the possible role of WASP domain(s) in sealing ring formation and bone resorption. Transduction of TAT-fused full-length WASP peptide induced Arp2/3 complex formation, F-actin content, sealing ring formation and bone resorption. Transduction of WASP peptides containing basic, verpolin-central, pTyr294, and proline-rich regions inhibited the processes listed above at various levels. The ability to resorb bone by WASP peptides containing basic, verpolin-central, and proline-rich regions was reduced and the resorbed area matched the size of the sealing ring. However, osteoclasts transduced with WASP peptide containing pTyr294aa demonstrated the following: a) a considerable decrease in the interaction and phosphorylation of c-Src with endogenous WASP; b) total loss of sealing ring-like structures; c) formation of actin-rich patches at the peripheral edge that contains filopodia-like projections; d) reduced capacity for bone resorption in vitro. These findings suggest that modulation of phosphorylation state of pTyr294aa assists in integrating multiple signaling molecule and pathways that partake in the assembly of sealing ring. Osteoclasts are highly motile multinucleated giant cells actively involved in bone resorption. Osteoclast function depends on dynamic regulation of the actin cytoskeleton to accomplish its ordered cycles of movement and attachment during bone resorption -6. OsteoStructural dynamics of actin cytoskeleton are dependent on the function of actin-binding proteins, which comprise many proteins with distinct properties, such as severing, capping, cross-linking, and nucleation. We have previously shown that gelsolin, an actin capping/severing protein, plays a key role in podosome assembly/disassembly and osteoclast migration. Gelsolin deficient (Gsn-/-) osteoclasts failed to display distinct podosomes. Mechanisms of cell attachment substituting for podosomes were expressed in Gsn-/osteoclasts. However, these adhesion structures failed to support osteoclast motility .Although Gsn-/- osteoclasts failed to exhibit distinct podosome structures, they contained the sealing ring. The presence of WASP in the sealing ring of Gsn-/- osteoclasts suggests the likelihood of the role of WASP in the bone resorption of osteoclasts . TherefoWASP stimulates actin filament nucleation by Arp2/3 complex . WASP coWASP was shown to be imperative in the assembly of sealing ring in osteoclasts. WASP integrates signals from Rho, Cdc42, and kinase(s) to bind to the Arp2/3 complex and WASP-Arp2/3 mediated actin polymerization . This seStructure-function analysis of WASP facilitated defining the role of distinct domains in actin polymerization ,15,21,22Antibodies to WASP, HA, Arp2, c-Src and c-Src pTyr418 were purchased from Santa Cruz Biotechnology, Inc. . Rhodamine phalloidin was bought from Sigma-Aldrich chemicals . Ni-NTA sepharose beads were purchased from Pharmacia chemicals. Acrylamide-bisacrylamide solution and protein estimation reagent were obtained from Bio-Rad.C57/BL6 mice were used for in vitro osteoclast generation. Bone marrow cells isolated from five mice were cultured into 100 mm dishes with 20 ml \u03b1-MEM medium, supplemented with 10% fetal bovine serum (\u03b1-10). After culturing for 24 h, non-adhered cells were layered on histopaque-1077 (Sigma) and processed as described previously [Full length (FL):5'catgccatgggcatgagtgggggcccaatgggaggaag3' and 5'acatgcatgcac ttatcagtcatcccattcatcatcttcatc3'; Basic region (BR):5'catgccatgggcgctgataagaaacg ctcag3' and 5'acatgcatgcactt aatcagctttgctgatcttc3'; GBD and Pro Rich domain (GP):5' catgccatgggctcagggaaga agaagatcag3' and 5'acatgcatgcacttaattcccggagctgggcggcggtg3'; pTyr294 containing fragment (pTyr):5'catgccat gggcggctgggatccccagaatg3' and 5'acatgcatgcacttactcttggc gcctcatctcctg 3'; Proline Rich domain (PRO); 5'catgccatgggccaggagatgaggcgccaagag3' and 5'acatgcatgcacttacactggagtaggagggagcgggggag3'; Verpolin, central domain (VC):5'catgccatgggc ctggcccctggtgggggtc3' and 5'acatgcatgca cttactccccttcgtcggaggagtg3'; Verpolin-like, central, and acidic domain (VCA):5'catgccatgggcgtgcctgccgggggcctg3' and 5'acatgcatgcacttatcagtcatcccattc atcatcttcatc3'. The PCR product was digested with Nco I and Sph I restriction enzymes and inserted into the HA-TAT fusion vector, which was cut with the same restriction enzymes. The sequences of all the clones were confirmed for reading frame by DNA sequencing.Bacterial expression constructs coding various HIV-TAT fusion peptides of WASP were generated by PCR method. cDNA from mouse osteoclast and full length WASP in pGEX-2T were used as PCR templates. WASP constructs were generated from mouse cDNA library by using the following primers: Escherichia coli  was used to transform HA-TAT vector containing the above-mentioned WASP constructs. Protein was purified using Ni-NTA column as described previously . PurifieFollowing transduction with various proteins, osteoclasts were washed three times with cold PBS and lysed in RIPA buffer  and centrifuged at 15,000 rpm for 15 min at 4\u00b0C. Protein contents were measured using the Bio-Rad protein assay reagent. Equal amounts of lysate proteins were used for immunoprecipitation with antibody to WASP or HA. Immunoprecipitation and immunoblotting were performed as described previously .5 cells) were seeded on dentine slices and cultured for 36\u201348 h. Prior to staining; osteoclasts were washed three times with PBS containing 5 mM EGTA (PBS/EGTA). Osteoclasts were fixed with 3% paraformaldehyde in PBS/EGTA for 20 min. Subsequently, cells were permeablized with 0.1% Triton \u00d7-100 in PBS/EGTA for 5 min. Osteoclasts were incubated with rhodamine phalloidin  for 30 min. at 37\u00b0C or overnight at 4\u00b0C as described earlier [Osteoclast precursors 1005 cells On day four, osteoclasts were transduced with 100 nM TAT-fused WASP peptides and incubated for 36\u201348 h. After transduction, osteoclasts were rinsed three times. Subsequently, cells were fixed, permeablized, and incubated with rhodamine phalloidin 1:200) as described earlier 0 as desc,27.4 cells). After 2 h of adherence, \u03b1-MEM medium containing 10% FBS and RANK-L was added. The same medium was replaced with the respective TAT-fused WASP proteins after 24 h. After 48 h, cells were scraped from dentine, and the slices were washed twice with water. Dentine slices were stained with acid hematoxylin (Sigma) and washed with water to remove excess stain. Pits were scanned under confocal microscopy. Images were stored in TIF image format and processed by the Adobe Photoshop software program .Osteoclasts transduced with the indicated TAT-WASP proteins were added to 48-well-containing dentine slices  of three or more experiments done at different times normalized to intra-experimental control values. Asterisks were used to graphically indicate the statistical significance. A value of p < 0.05 was considered significant. For statistical comparisons, analysis of variance (ANOVA) was used with the Bonferroni corrections .GTPase binding and proline rich-domain  and human simian virus thymidine kinase protein  are shown. The purified TAT-fused WASP peptide containing phospho-tyrosine 294 aa , proline-rich sequences  VCA , basic , and VC  domains are shown in a 15% SDS-PAGE. HSV-TK and vector  proteins were used as controls for transduction experiments. Phosphotyrosine 294 aa (pTyr294aa) in mouse WASP (includes the first methionine aa) corresponds to pTyr 291 in human WASP. There are six proline-rich clusters in the TAT-fused WASP-Pro construct (307\u2013428aa). The number given below within the parentheses indicates the proline-rich aa sequences in each cluster: 311\u2013318 (8), 350\u2013355(6), 358\u2013361 (4), 366\u2013372 (7), 379\u2013385 (7), and 390\u2013403 (14).A schematic diagram of WASP constructs cloned into HA-TAT expression vector is shown in Fig. Based on the dose-dependent uptake experiment (data not shown), a concentration of 100 nM TAT-fused WASP protein was decided for transduction experiments given below. The uptake of TAT-fused WASP proteins were determined by immunoblotting with an antibody to HA  and various WASP peptides Fig.  and 5B. The reduced interaction of c-Src with endogenous WASP Figure ; lane 2 Inhibition of Src interaction with endogenous WASP in cells transduced with pTyr294 fragment suggests that this peptide may have the ability to block this interaction through competitive inhibition of the phosphorylation of endogenous WASP. Subsequently we addressed the question whether the transduced WASP fragment containing pTyr294 is phosphorylated in vivo Fig. . LysatesWe then addressed the question whether increasing the intracellular levels of WASP peptides would reduce sealing ring formation Fig.  and bone2) generated in vitro by osteoclasts is shown in Fig. 2): FL-WASP > PBS = HA-TAT>BR>VC>Pro>GP > pTyr294aa.We subsequently determined the bone resorption activity of osteoclasts treated with PBS Fig.  or transWASP regulates sealing ring formation through regulatory mechanisms mediated by Rho family GTPases (Rho and Cdc42), c-Src kinase, and a phosphatase PTP-PEST . WASP nuOur data show that the inhibitory effect with the TAT-fused WASP peptide was observed in the following order: pTyr294 = GP domain>Pro>BR = VC = VCA. The inhibitory effect of TAT-fused peptides containing BR Fig.  and 7D, The consequence of transduction of pro-rich WASP peptide was apparent in the abnormality of sealing ring structures Fig. , and 6E'Next, the questions are, How does phosphorylation of WASP influence WASP mediated events? How does the WASP peptide containing pTyr294aa block the osteoclast function? It has been suggested that phosphorylation of human WASP at Y291 can effect two important aspects. First, the WASP, which is phosphorylated on pTyr291, has higher basal activity. Second, it could enable protein-protein interactions by SH2-SH3 binding and respond to new signal through complex interaction of signaling proteins . We havePhosphorylation of N-WASP on Tyr256 corresponds to the Tyr291 in WASP. Phosphorylation of N-WASP and its consequent localization in the cytoplasm increased the ability of N-WASP to stimulate cell migration . FAK sliHowever, in the present study, we could show that phosphorylation of pTyr294aa is essentially responsible for WASP-mediated effects in osteoclasts. This is consistent with the observation that WASP phosphorylation is critical for T cell activation. Over expression of pTyr mutant (Y291F) or inhibition of Src family kinases affects T-cell activation or neurite outgrowth, respectively ,35. WASPThe process of sealing ring formation requires phosphorylation events arbitrated by tyrosine kinases ,36,37. FHowever, it will be of interest to further elucidate how phosphorylation of pTyr294aa modulates WASP function in osteoclasts. The focus of future studies would be on the mechanisms by which WASP-peptide containing pTyr294 regulates the activity of WASP in sealing ring formation. Once the mechanisms are understood, therapeutic measures can be developed with this pTyr294aa containing peptide to reduce bone resorption during osteoporosis caused by estrogen deficiency or cancer metastasis in general.Based on our observations, we suggest that modulation of phosphorylation state of pTyr294aa in WASP or binding of SH3 containing signaling proteins with the proline-rich region of WASP may assist in integrating multiple signaling pathways that partake in the assembly of sealing ring and bone resorption. These biologically active permeable WASP peptides containing pro-rich region and pTyr294aa function as inhibitors of sealing ring formation and bone resorption activity of osteoclasts. Thus, these studies suggest that WASP and WASP-based signaling complex of the osteoclast sealing ring is an attractive target for pharmacologic regulation of bone resorption.Wiskott-Aldrich Syndrome protein; HA, hemagglutinin; TAT, transactivator peptide with transforming properties; RANKL, receptor activator of nuclear factor-kappa B ligand; mCSF-1, macrophage colony stimulating factor; HSV-TK, herpes simplex virus-thymidine kinase; PTP-PEST, protein tyrosine phosphatase-proline-glutamic acid, serine, threonine amino acid sequences; VCA, verpolin, cofilin, acidic domain; aa-amino acid; GP, GTPase binding (G) and proline-rich (P) domain; F-actin, filamentous actin; FL, full length; Arp2/3; actin-related proteins 2 and 3; NI, non-immune serumWASP, The author(s) declare that they have no competing interests.TM participated in the design of the study as well as carried out the biochemical and cell biological studies. VS cloned and purified pTyr291 and pro-rich WASP domains. MAC conceived of the study, participated in its design, and drafted the manuscript. All authors read and approved the final version of the manuscript."}
+{"text": "Escherichia coli (EHEC) generate F-actin\u2013rich adhesion pedestals by delivering effector proteins into mammalian cells. These effectors include the translocated receptor Tir, along with EspFU, a protein that associates indirectly with Tir and contains multiple peptide repeats that stimulate actin polymerization. In vitro, the EspFU repeat region is capable of binding and activating recombinant derivatives of N-WASP, a host actin nucleation-promoting factor. In spite of the identification of these important bacterial and host factors, the underlying mechanisms of how EHEC so potently exploits the native actin assembly machinery have not been clearly defined. Here we show that Tir and EspFU are sufficient for actin pedestal formation in cultured cells. Experimental clustering of Tir-EspFU fusion proteins indicates that the central role of the cytoplasmic portion of Tir is to promote clustering of the repeat region of EspFU. Whereas clustering of a single EspFU repeat is sufficient to bind N-WASP and generate pedestals on cultured cells, multi-repeat EspFU derivatives promote actin assembly more efficiently. Moreover, the EspFU repeats activate a protein complex containing N-WASP and the actin-binding protein WIP in a synergistic fashion in vitro, further suggesting that the repeats cooperate to stimulate actin polymerization in vivo. One explanation for repeat synergy is that simultaneous engagement of multiple N-WASP molecules can enhance its ability to interact with the actin nucleating Arp2/3 complex. These findings define the minimal set of bacterial effectors required for pedestal formation and the elements within those effectors that contribute to actin assembly via N-WASP-Arp2/3\u2013mediated signaling pathways.Enterohemorrhagic  Escherichia coli (EHEC) O157:H7 is a food-borne pathogen that causes diarrhea and life-threatening systemic illnesses. EHEC colonizes the intestine by adhering tightly to host cells and injecting bacterial molecules that trigger the formation of a \u201cpedestal\u201d below bound bacteria. These pedestals are generated by reorganizing the actin cytoskeleton into densely packed filaments beneath the plasma membrane. Pedestal formation is therefore not only important for EHEC disease, it provides a means to study how mammalian cells control their shape. We show here that two EHEC proteins, Tir and EspFU, are sufficient to trigger pedestal formation. Tir localizes to the mammalian plasma membrane, and its central function is to promote clustering of EspFU. EspFU contains multiple repeat sequences that stimulate actin polymerization by binding N-WASP, a host protein that initiates actin assembly. Although a single repeat of EspFU can generate pedestals, multi-repeat variants promote actin assembly cooperatively. One explanation for this synergy is that tandem repeats can potently trigger the formation of a complex of mammalian proteins that modulate the actin cytoskeleton. These findings define the minimal set of EHEC effectors required for pedestal formation and the elements within those effectors that confer their ability to alter cell shape.Enterohemorrhagic  Escherichia coli (EHEC) O157:H7 colonize the intestinal tract of cattle and other reservoir hosts without inducing disease, but cause severe diarrheal illness in humans that ingest contaminated materials attaching and effacing (AE) family of pathogens. These bacteria, which include enteropathogenic E. coli (EPEC) and Citrobacter rodentium, attach tightly to the intestinal epithelium, efface microvilli, and generate filamentous (F-)actin pedestals beneath sites of adherence. The formation of AE lesions is critical for pathogenesis, because mutations that abolish their biogenesis severely impair colonization Enterohemorrhagic locus of enterocyte effacement (LEE), which also contains several of the substrates for injection translocated intimin receptor (Tir), which is essential for AE lesion formation. Tir is delivered into the host cell, where it localizes to the plasma membrane in a hairpin conformation that includes a central extracellular region that binds to intimin, a LEE-encoded adhesin. Intimin-Tir interaction promotes intimate attachment to the host cell, and also results in clustering of the N- and C-terminal cytoplasmic domains of Tir During infection, EHEC expresses a type III secretion system capable of translocating more than 30 effector proteins from the bacterium into the mammalian cell verprolin-connector-acidic (VCA) segment to activate the Arp2/3 complex, a major actin nucleator in cells WASP-interacting protein), bind to its N-terminal WH1 domain and influence its activation The Tir molecules from EHEC and EPEC both trigger actin assembly pathways that involve N-WASP, an actin nucleation-promoting factor EPEC pedestal formation involves activation of N-WASP by signaling initiated from the C-terminal cytoplasmic domain of its Tir protein, which is phosphorylated by host tyrosine kinases U , localizes beneath bound bacteria after delivery into host cells, co-precipitates with Tir, and promotes phosphotyrosine- and Nck-independent actin assembly U recruitment and efficient pedestal formation U have not been detected, additional factors are assumed to mediate their association.In contrast to EPEC, EHEC requires a second effector to trigger pedestal formation. This protein, EspFU contains an N-terminal secretion signal followed by a C-terminus consisting of multiple nearly-identical 47-residue proline-rich peptide repeats U derivatives containing these repeats bind to a segment of N-WASP encompassing the GBD U N-terminus and as few as two repeats were shown to be capable of stimulating actin assembly using purified N-WASP and Arp2/3 in vitro and also could promote some degree of pedestal formation during infection of cultured cells, whereas derivatives containing only a single repeat did not EspFU are central to actin assembly, the Tir C-terminus is critical for recruitment of EspFU and other putative factors that may contribute to actin nucleation, and multiple proline-rich repeats of EspFU are required for maximal signaling. However, important questions remain unanswered. For example, the potential roles for EHEC effectors other than Tir and EspFU during actin assembly have not been defined, nor have the precise roles of the Tir C-terminus and/or the putative factors that mediate Tir-EspFU interactions. In addition, whereas EspFU can bind and activate purified recombinant N-WASP derivatives in vitro, it is unknown how accurately these assays might reflect N-WASP-stimulating activities in the context of the complex intracellular milieu, where other N-WASP binding partners like WIP likely modulate its autoinhibited state.These observations provide a framework for understanding the mechanisms by which EHEC triggers actin pedestal formation: Tir and EspFU are sufficient to trigger pedestal formation in the absence of any other EHEC factors. By analyzing EspFU derivatives for the ability to bind native and recombinant N-WASP and stimulate N-WASP/WIP-mediated actin assembly in vitro and pedestal formation in cells, we arrive at a model in which the critical function of Tir is to promote clustering of the C-terminal repeats of EspFU. These repeats, in turn, activate N-WASP synergistically and lead to the formation of an Arp2/3-containing multi-protein complex that promotes robust actin polymerization.In the current study, we show that Tir and EspFU and EspF, are known to directly activate N-WASP U, have been shown to be crucial for EHEC pedestal formation in genetic deletion studies. Moreover, KC12, an EPEC strain in which EPEC tir has been replaced by EHEC tir, is defective at actin pedestal formation, whereas expression of EspFU by KC12 allows pedestal formation at high efficiency in manner indistinguishable from that of EHEC U are the only effectors essential for EHEC-mediated actin pedestal formation. To definitively test whether EspFU is the only effector in addition to Tir that is required for actin pedestal assembly, mammalian cells were transfected with plasmids encoding derivatives of EHEC Tir and EspFU in the absence of all other bacterial factors. Tir was N-terminally tagged with an HA epitope, and its first transmembrane domain replaced with the transmembrane segment of the Newcastle Disease Virus HN surface protein to promote efficient plasma membrane localization U was fused to GFP at its N-terminus and a 5myc tag at its C-terminus to allow detection by fluorescence microscopy and immunoblotting, respectively  or its C-terminal repeats (EspFU-R1-6)  . To clus intimin , and binU, only those cells exhibiting GFP fluorescence were examined. Adherent bacteria were identified by DAPI-staining and F-actin was visualized using fluorescent phalloidin. Bacteria that bound to cells co-expressing Tir and full-length EspFU were associated with robust localized actin assembly, indicating that clustering of Tir in the presence of EspFU is sufficient to trigger pedestal formation . This discrepancy in actin assembly cannot be attributed to differences in protein levels, because immunoblotting revealed that GFP-EspFU-R1 was well expressed in mammalian cells (data not shown).We next sought to further investigate the activity of EspFt region . MoreoveE. coli effectors that might compete with Tir or EspFU for host target proteins, we also utilized the co-transfection approach described in U fusions carrying different numbers of repeats were expressed in mammalian cells and clustered by treating cells with intimin-expressing bacteria. When Tir was co-expressed with EspFU constructs harboring multiple repeats, intensely staining F-actin pedestals were formed in high numbers . These results indicate that although EspFU derivatives containing a single repeat can function for pedestal formation after clustering of full-length Tir in mammalian cells, the presence of 2\u20136 repeats is required for robust actin assembly.To independently assess pedestal formation in the absence of other  numbers . On cellU repeats, we next examined whether the efficiency of pedestal formation correlates with the ability of the different EspFU truncations to interact with N-WASP. To characterize the interaction between N-WASP and derivatives of EspFU harboring different numbers of repeats in a complex environment reflective of the mammalian cytosol, we generated protein extracts from pig brains, which are rich in actin cytoskeleton-associated factors, including N-WASP, WIP, and the Arp2/3 complex (data not shown). We also purified recombinant N-terminally His10- and C-terminally 5myc-tagged EspFU derivatives consisting of 1 to 6 repeats, or as a negative control, an N-terminal fragment of EspFU , and then collected using cobalt-chelated magnetic particles. Immunoblotting revealed that N-WASP interacted efficiently with EspFU derivatives containing 6 or 4 repeats . Interestingly, increasing the concentration of EspFU truncations had little effect on the quantity of N-WASP pulled-down by those proteins. Thus, although one repeat is capable of binding N-WASP in brain extracts, stepwise increases in binding are associated with the presence of additional EspFU repeats within the same molecule, with an apparent plateau at 4\u20136 repeats.Since it is possible that saturating beads with a single EspF repeats . SlightlU derivatives containing the N-terminal secretion domain and two or more repeats have been shown to stimulate N-WASP-Arp2/3\u2013mediated actin assembly using purified proteins in vitro, while a truncation containing a single repeat barely triggered assembly U to promote actin polymerization, but in the presence of native components, we examined the ability of recombinant EspFU variants to stimulate actin polymerization in brain extract. Purified EspFU derivatives were added to extract supplemented with pyrene-labeled actin, and polymerization kinetics were measured fluorometrically U-R1-6 accelerated actin assembly in extract, while EspFU-N did not . Collectively, these data indicate that the presence of multiple repeats within the same polypeptide is important for triggering actin polymerization in an extract system designed to mimic a complex native environment.To characterize the relationship between the number of EspF present . In cont extract . ConsistU can trigger Arp2/3-mediated actin assembly in the presence of an N-WASP/WIP complex. We purified a recombinant complex containing N-WASP and WIP at 1\u22361 stoichiometry and also contained a trace amount of insect cell actin , while the single repeat constructs EspFU-R1 and EspFU-R6 were even less active . Even when present at very high concentrations (>500 nM), the EspFU derivatives harboring 1\u20132 repeats could not accelerate polymerization to rates comparable to those elicited by 35 nM EspFU-R1-6 (data not shown). Thus, in the presence of purified N-WASP/WIP and Arp2/3, the number of EspFU repeats positively correlates with the rate of actin assembly.We next examined the abilities of the EspFonstruct . These eU derivatives on the basis of repeat numbers, we normalized protein concentrations to the quantity of repeat units within each polypeptide. For example, 4.17 nM of the 6-repeat construct was considered equivalent to 8.33 nM of a 3-repeat truncation and 25 nM of a single repeat. Scaling of the data in this manner revealed that EspFU derivatives containing greater numbers of repeats within the same protein had substantially higher activity than smaller constructs  were generated with N- and C-terminal repeat boundaries based on recent structural studies that defined the GBD-binding sequences of EspFUU constructs was determined using isothermal titration calorimetry and yielded predicted differences in stoichiometry  but similar dissociation constants   . Thus, vU repeats instead might promote binding of the Arp2/3 complex. N-WASPC, a C-terminal fragment of N-WASP that contains the GBD, PRD, and VCA domain, is a fragment previously shown to function in pedestal formation U derivatives differing in repeat number also differed in their ability to form a complex containing N-WASPC and Arp2/3, EspFU variants containing 1 or 2 repeats, fluorescently labeled at their N-termini with AlexaFluor647, were incubated with equivalent molar concentrations of N-WASPC in the absence or presence of the Arp2/3 complex. The relative size of EspFU-containing complexes, detected by absorbance at 650 nM, was then determined by gel filtration chromatography. The single EspFU repeat bound N-WASP at essentially stoichiometric levels when mixed in equimolar (2 \u00b5M) quantities, as determined by an increase in the apparent size  of EspFU , the two proteins bound one another at essentially stoichiometric levels (C and the two repeat derivative resulted in the formation of an Arp2/3-containing complex (U repeats to assemble N-WASP dimers (or by implication higher order multimers) may facilitate binding of the Arp2/3 complex, providing a likely source of inter-repeat cooperativity.When 1 \u00b5M N-WASPU for the formation of an Arp2/3-containing complex described above involved the addition of only EspFU, N-WASPC, and Arp2/3, N-WASP-associated proteins such as WIP should not be required for cooperativity between the EspFU repeats in actin assembly. Furthermore, domains of WASP (or N-WASP) other than the GBD (which binds EspFU) and VCA (which binds Arp2/3) should also be dispensable. We therefore tested whether the EspFU repeats were capable of synergistically activating a minimized  is required for recruitment of EspFU and actin pedestal formation U has not been detected, suggesting that they interact indirectly. The delineation of Tir and EspFU as the only bacterial effectors required for pedestal formation indicates that the putative adaptor that mediates this interaction is of host origin. Efficient association of EspFU with the putative adaptor linking it to Tir may require multiple EspFU repeats, because when Tir and EspFU were expressed separately rather than as a single fusion protein, at least two repeats were required for robust EspFU function. Consistent with these results, a translocated 2-repeat EspFU derivative, but not a 1-repeat derivative, localized to sites of bacterial attachment Within the Tir C-terminal domain, a tripeptide sequence  more frequently than a single repeat U derivatives promote more efficient actin assembly in vitro than a single-repeat derivative U-induced actin polymerization in brain extracts, and found that in this complex environment, the number of repeats correlated both with the ability of EspFU derivatives to interact with native N-WASP and to stimulate actin assembly. Single-repeat constructs did not accelerate polymerization in these assays, possibly due to competition with endogenous N-WASP activators or the presence of inhibitory factors in the extract.In addition to promoting more efficient recruitment to Tir, the presence of multiple repeat units in EspFU constructs are capable of potently activating Arp2/3-mediated actin assembly in the presence of a recombinant N-WASP/WIP complex, and as predicted based upon N-WASP pulldown assays and measurements of actin polymerization in extracts, EspFU derivatives containing greater numbers of repeats stimulate actin assembly more rapidly. Interestingly, when we normalized the EspFU derivatives to the concentration of repeats and quantitated actin assembly rates, we found that increasing the number of repeats within individual proteins does not simply result in additive increases in actin polymerization. Instead, the presence of multiple repeats in the same derivative enhances N-WASP/WIP-mediated actin assembly synergistically.Under physiological conditions, N-WASP is stably associated with WIP, a protein that binds to its N-terminal WH1 domain and influences its activation U-N-WASP binding. Indeed, an earlier study reported that the dissociation constants (Kd) for the EspFU-N-WASP interaction varied depending on the numbers of repeats  U and N-WASP. Similarly, the more efficient pulldown of N-WASP by multi-repeat EspFU derivatives in brain extracts that we observed could be influenced by other endogenous factors. Although a previous study found that 2 repeats is the minimal N-WASP-binding module within EspFU in gel overlay assays U derivatives to the WASP GBD were all similar to one another , and within an order of magnitude of that measured for the N-WASP GBD . Similarly, analysis of a diverse collection of UespF-containing E. coli strains showed that all EspFU proteins contain at least 2 repeats U derivatives containing 1 versus 2 repeats to enter into a complex with recombinant N-WASP and Arp2/3 complex. As predicted from the affinities of EspFU fragments for the GBD, the single and two repeat derivatives bound to N-WASP indistinguishably. However, the 2-repeat protein formed a complex with both N-WASP and Arp2/3 with much greater efficiency. These experiments suggest that N-WASP multimers assembled by tandem EspFU repeats may have higher affinity for Arp2/3 complex. As predicted from such a model, the inter-repeat cooperativity was revealed during in vitro actin assembly assays using a WASP derivative containing only the EspFU-binding GBD and the Arp2/3-binding VCA domain. Further study will be required to illuminate the molecular basis of this enhanced interaction.An alternative explanation for inter-repeat cooperativity during actin polymerization is that an EspFU is likely an important feature of other Arp2/3-mediated processes that are triggered by microbial pathogens. Pedestal formation by EPEC, which occurs in an EspFU-independent manner, requires clustering of Tir, a step that may mimic multivalent binding. The critical EPEC Tir phosphopeptide has no activity when added in soluble form in standard pyrene actin assays , but potently stimulates actin assembly when clustered on a bead U but not involved in pedestal formation Shigella IcsA (VirG) protein uses repetitive sequences to bind N-WASP and promote actin-based intracellular motility U promotes actin assembly is likely to provide insight into related phenomena central to multiple pathogenic processes.Interestingly, the multivalency that is clearly a critical property of EspFdam mutant used in this study was derived from TUV93-0, a Shiga toxin-deficient version of the prototype O157:H7 strain EDL933 tir-cesT-eae operon replaced with the corresponding EHEC operon, has also been described E. coli (MC1061) expressing EHEC intimin was also described elsewhere UespF derivatives were generated by PCR from EDL933 genomic DNA and cloned into the EcoRI and BamHI sites of pGAD424 UespF fragments were subcloned into the KpnI and BamHI sites of pKC425 UespF derivatives were subcloned into the NdeI and XbaI sites of the vector pET16b (Novagen) to create fusions between an N-terminal His10-tag and C-terminal 5myc tag. Some EspFU constructs contained only an N-terminal His-tag , 80-384 (R1-6), 80-275 (R1-4), 80-228 (R1-3), 80-181 (R1-2), 80-134 (R1), 229-384 (R4-6), 276-384 (R5-6), 323-384 (R6), 80-314 (R\u20321-5), 221-314 (R\u20324-5), and 268-314 (R\u20325). For dominant negative transfections, rat N-WASP derivatives were generated by PCR with an N-terminal Flag-tag using domain boundaries described previously C (residues 193-501) and WASP GBD-VCA (residues 230\u2013310 and 420\u2013502 with a GGSGGS linker) constructs are described elsewhere E. coli strains were grown in LB media at 37\u00b0C. Prior to infections, EHEC was cultured in DMEM+100 mM HEPES pH 7.4 in 5% CO2 to enhance type III secretion. HeLa, Cos7, and murine fibroblast-like cells (FLCs) 2.The EHEC  His-tag  [41]. FoE. coli expressing intimin S. aureus Pansorbin particles  All transfections were performed as described previously U were refractory to pedestal formation and were not included in these analyses. All scalebars are 1 \u00b5m in length.Infected cells were fixed in 2.5% paraformaldehyde for 35 minutes and permeabilized with 0.1% Triton-X-100 in PBS as described previously U variants consisting of different combinations of the 6 repeats were fused to the Gal4 transcriptional activation domain, whereas the N-WASP GBD was fused to the LexA DNA-binding domain. Pairwise combinations of these fusion proteins were tested for interactions by measuring activation of a lacZ reporter, as described U-myc derivatives by incubating them with 75 \u00b5g/ml of each recombinant fragment for 1 h. After removal of unbound EspFU, beads were incubated with brain extract for 1 h in 50 mM NaPO4 pH 7.4, 150 mM NaCl, and 0.015% Triton X-100. Bound proteins were eluted by boiling in SDS-PAGE sample buffer. For other pulldown assays ), prior to mixing with SDS-PAGE sample buffer. Protein samples were boiled for 10 minutes, centrifuged, and analyzed by 10% SDS-PAGE prior to staining with Coomassie blue or transferring to nitrocellulose membranes and staining with Ponceau S. Membranes were blocked in PBS+5% milk (PBSM) before probing with N-WASP or GFP antibodies, as described previously To prepare mammalian cell lysates, transfected cells were collected in PBS+2 mM EDTA and lysed in 50 mM Tris-HCl, pH 7.6, 50 mM NaCl, 1% Triton X-100, 1 mM NaU-myc fusion proteins were expressed in E. coli BL21-Rosetta (Novagen) at 37\u00b0C in the presence of 0.1 mM IPTG for 3 h. Bacteria were lysed in 10 mM Tris pH 7.4, 150 mM NaCl, and protease inhibitor cocktail (Roche) using a cell disruptor . EspFU was purified first using His-tag affinity for Ni-NTA-agarose beads (Qiagen) and eluted in lysis buffer containing 400 mM imidazole. To remove EspFU degradation products, an anion exchange purification step, facilitated by the negatively charged 5myc-tag, was performed. EspFU was bound to a HiTrap Q column  and eluted in 10 mM Tris pH 9.5 containing 1 M NaCl. Other EspFU constructs .His-EspF2, 0.1 mM EDTA, 1 mM DTT, protease inhibitor cocktail), prior to homogenization using a Waring blender . After clarification , extracts were filtered through cheesecloth and further clarified  prior to storage (\u221280\u00b0C). Extract to be subfractionated (60 ml) was dialysed against 2\u00d75 L 20 mM Tris-Cl pH8, 2 mM MgCl2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM ATP, 2.5% glycerol at 4\u00b0C, prior to loading onto tandem HiTrap Heparin columns (2\u00d75 ml), pre-equilibrated with dialysis buffer. Bound proteins were eluted using a 0\u20130.5 M KCl gradient in dialysis buffer (2 ml/min) and 20 3 ml fractions collected. Fractions 11\u201317 contained both Arp2/3 complex and N-WASP upon immunoblotting, and were combined, dialysed (as above), concentrated 5-fold (Centricon), and stored at \u221280\u00b0C.Brains obtained from freshly slaughtered pigs  were cleaned, sectioned, and resuspended in extraction buffer . A recombinant N-WASP/WIP complex was purified by Nickel affinity chromatography followed by gel filtration chromatography to separate the complex from N-WASP or WIP alone. To maintain an autoinhibited N-WASP/WIP complex, freeze-thaw cycles and prolonged periods of storage on ice were kept to a minimum. Recombinant human Arp2/3 complex and native bovine Arp2/3 complex were purified as described previously Assays utilizing brain extract contained samples supplemented with 2.5 \u00b5M skeletal muscle actin (10% pyrene-labeled), and polymerization was measured as described previously 2, 1 mM EGTA, and 10 mM imidazole pH 7.0) plus 5 mM \u03b2-mercaptoethanol. Prior to gel filtration analyses, the N-termini of EspFU fragments R\u20325 and R\u20324-5 were fluorescently labeled by dialysis against 100 mM sodium bicarbonate pH 8.3 and treatment with a five-fold molar excess of AlexaFluor647-carboxylic acid, succinimidyl ester (Invitrogen) at 4\u00b0C for 16 hours. Extra dye was removed by desalting chromatography and subsequent dialysis. Conjugation was confirmed by mass spectrometry. Labeling efficiency was estimated as >97% by the ratio of absorbance at 280 and 650 nm. Interactions between Arp2/3 complex and N-WASPC in complex with EspFU were examined using a Superdex 200 10/300 GL column  equilibrated in KMEI plus 1 mM dithiothreitol buffer.Isothermal titration calorimetry was performed as described elsewhere"}
+{"text": "Background and Objectives. Extended spectrum \u03b2-lactamase (ESBL) production is increasing all over the world, and organisms other than E. coli and K. pneumoniae are acquiring this character. ESBL production is detectable by automation, E-test, double disk diffusion (DDD), and PCR. This study aimed to determine the prevalence of ESBL production among clinical isolates of gram-negative rods, and to evaluate the effectiveness of augmentation of clavunate with Cefotaxime, Ceftazoxime, Aztreonam, Ceftriaxone, and Cefpodoxime in detecting ESBL production. Methods. 472 clinical gram-negative isolates identified by standard methods were tested for ESBL-production by (DDD) method using six cephalosporins and amoxicillin-clavulinate discs. Results. 108/472 (22.9%) of the isolates were ESBL producers, and were prevalent in tertiary care hospitals. 88.2% of E. cloacae, 71.4% of K. pneumoniae, 28.6% of K. oxytoca, 12.5% of C. freundii, 11.1% of A. calcoacceticus, and 10.8% of E. coli were ESBL producers. The DDD test demonstrated some variations in the efficacy of the different cephalosporins in detecting all the ESBL producers. The inclusion of ceftizoxime discs increased the efficacy of the test. It is concluded that ESBL-producing bacteria were prevalent among our hospitalized patients, and involved genera other than Klebsiella and Escherichia, and the inclusion of ceftizoxime increased the efficacy of ESBL detection by the DDD test. The vaseumoniae . These erapenems . In inteal AmpC) , or the al AmpC) .Klebsiella spp. and Escherichia coli, but have been also reported in other genera world wide, such as Citrobacter, Enterobacter, Morganella, Proteus, Providencia, Salmonella, Serrati, and Pseudomonas [Among Enterobacteriacae, ESBLs have been found mainly in udomonas \u20139. Infections caused by ESBL-producing bacteria often involve immune-compromised patients, making it difficult to eradicate these organisms in high-risk wards, such as intensive care unites , 11.\u03b2-lactams, using double-disk diffusion method, or E-test [Klebsiella spp, and E.coli, but not established for the other Enterobacteriaceae [Microbiology laboratories play an important role in detecting and promptly reporting the isolation of ESBL-positive bacteria, especially AmpC beta-lactamases-producing ones that complicate therapy and limit treatment options . Drug sur E-test . The experiaceae .\u03b2-Lactamase enzymes may contribute to defining the degree of the problem in a specific geographical area, and establishing a proper treatment protocol.When detecting ESBL-positive strains, microbiology laboratories should provide the clinician with reliable therapeutic options for successfully treating infected patients, since ESBL-distribution has been shown to differ among countries , 6, 16. Before the emergence and increased spread of ESBL-producing gram-negative bacteria, most infections could be reliably treated with second- and third-generation cephalosporins. However, ESBL-producing organisms are spreading world wide, resulting in the failure of empiric therapy dependent on second- and third-generation cephalosporins which complicate infections in immune-compromised patients, neonates, the elderly, debilitated patients, nosocomial infections, and outbreaks occurring in hospital setting \u201322. The aim of this study was to assess the prevalence of ESBL-producing gram-negative organisms among different bacterial genera and species isolated from clinical cases from three major hospitals in northern Jordan, and to assess the effectiveness of clavulanate and six cephalosporins in detecting ESBL production.Escherichia, Klebsiella, Proteus, Citrobacter, Enterobacter, Serratia, Pseudomonas, Acinetobacter, Alkaligenes, and Stenotrophemonas were included in the study. These bacteria were isolated from various clinical specimens such as blood culture, urine, CSF, sputum, wound, pus, ear swabs, eye swabs, peritoneal fluid, and other miscellaneous sources. These isolates were recovered from the specimens by being cultured on the specific media, under the optimal conditions, and were identified to genus and species using standard methods  [A number of 472 gram-negative bacterial isolates recovered from 463 patients were included in this study. These isolates were isolated from clinical specimens at the microbiology laboratories in three hospitals in northern Jordan during ten-month period (January\u2013October 2004). These hospitals were King Abdullah University Teaching Hospital (KAUTH) , Princess Basma Teaching Hospital (PBTH) , and Princess Rahmeh Teaching Hospital (PRTH) . Gram-negative bacteria belonging to the genera hnology) \u201325. Multhnology) .Test organisms from stock culture were activated by inoculation in to Mueller Hinton broth  and incubated at 37\u00b0C for 24 hours. The concentration of the bacterial suspension was adjusted to be equivalent to 0.5 McFarland standards. The test organism was seeded on the surface of freshly prepared Mueller Hinton agar , in three directions using a sterile Dacron swab, according to the recommendations of Kirby-Bauer Disk Diffusion method , and NCC ESBL-producing isolates were detected using the Double Disk Diffusion method (Double Disk Approximation Test) . Six antPlates were incubated aerobically at 37\u00b0C for 18\u201324 hours, and the diameter of the inhibition zone (if any) around the antimicrobial disks was measured in mm using a ruler. Any augmentation (increase in diameter of inhibition zone) between the central Amoxicillin-Clavulanic acid disk and any of the six antibiotic disks showing resistance or intermediate susceptibility was recorded, and the organism was thus considered as an ESBL producer.Urine was the major source of the bacterial isolates collected, comprising 262/472 (56%) of the total isolates, blood culture 79/472 (16.7%), swabs from various sites 80/472 (16.9%), CSF 16/472 (3.3%), sputum 8/472 (1.6%), and the other miscellaneous sources 44/472 (5.5%) .Escherichia coli was the most common species isolated from these specimens, comprising 195/472 (41.4%). This organism was the major isolate recovered from urine samples, representing 171/195 (87.7%) of the total E. coli isolates from the three teaching hospitals  of the total isolates, of which Klebsiella pneumonia represented 84/472 (17.8%) of the total isolates. However, 48/84 (57%) of the Klebsiella pneumoniae isolates were recovered from blood culture, 21/84 (25%) from urine, and the remaining 15/84 (18%) from sputum and the other miscellaneous sources. Similarly, Klebsiella oxytoca comprised 28/472 (5.9%) of the total isolates, of which 19/28 (67.9%) were isolated from urine, and the remaining 9/28 (32.1%) were detected at low frequency from the specimens (Genus pecimens .Pseudomonas aeruginosa represented 64/472 (13.5%) of the total isolates, where 24/64 (37.5%) of these pseudomonas aeruginosa were isolated from swabs of various sources, 12/64 (18.8%) from Cerebrospinal fluid (CSF), 10/64 (15.6%) from urine, and the remaining 18/64 (28.1%) were from the other miscellaneous sources  of the bacterial isolates, where 16/23 (69.5%) of them were isolated from urine samples, 7/23 (30.4%) from swabs of various sources and other miscellaneous specimens (pecimens .Enterobacter was common among the gram-negative isolates constituting 32/472 (7.8%) of the isolates. Enterobacter cloacae was the major species isolated constituting 11/17 (64.7%) of the Enterobacter recovered from blood cultures, 5/17 (29.7%) from urine cultures, and 1/17 (5.9%) from sputum samples. The other 14 Enterobacter spp were isolated from swabs of various sources and urine  constituted 18/472 (3.8%) most of which were recovered from blood culture, sputum, and miscellaneous sources. Other gram-negative bacterial species, including Citrobacter frundii, Serratia marcescens, Alkaligenes xylosoxidans, and Stenotrophomonas maltophilia, collectively represented 12/472 (2.5%), most of which were isolated from urine samples  were ESBL producers. However, within Klebsiella oxytoca isolates, only 8 out of 28 isolates were ESBL-producers, representing only 28.5%. On the other hand, ESBL production in E. coli was found in 21/195 isolates representing only 10.8%  were ESBL producers, and all of them were recovered from blood culture and urine culture from KAUTH during Enterobacter cloacae outbreak (Out of the 17 outbreak . Citrobacter frundii was found only in one isolate out of the 8 isolates (12.5%) recovered from KAUTH. Similarly, only one Acinetobacter calcoaceticus out of the nine isolates was ESBL producer. None of the other Acinetobacter spp. isolated produced ESBL  and Ceftizoxime (ZOX) disks were used. Both of these antibiotics were successful in identifying 20/21 (95.2%) of the ESBL producers. Augmentation with Aztreonam (ATM) detected 18/21 (85.7%) ESBL-producing E. coli, Ceftazidime (CAZ) 15/21 (71.4%), Ceftriaxone (CRO) 11/21 (52.4%), and Cefpodoxime (CPD) 4/21 (19%)  disk and the surrounding cephalosporin's ones. The 21 ESBL-producing 21 (19%) .Enterobacter cloacae, which were collected during an out break in KAUTH, had little variation in the antibiogram of the isolates suggesting a common source. Disks used in the detection of ESBL were closely successful in detecting ESBL production, where ATM was capable of detecting all of the 15 ESBL producing isolates, followed by CTX and CRO which detected 14/15 (93.3%) of them. Both CAZ and ZOX detected only 13/15 (86.7%), while CPD detected only 12/15 (80%) of the ESBL-producing Enterobacter cloacae  of the ESBL-producing isolates, CTX 49/60 (81.7%), ATM 43/60 (71.7%), CAZ 30/60 (60%), CRO 26/60 (43.3%), and CPD 15/60 (16.7%), respectively,  of the ESBL producers, ATM 6/8 (75%), CTX 4/8 (50%), CAZ 3/8 (37.5%), and CRO 2/8 (25%), respectively,  are enzymes capable of hydrolyzing oxyimino-cephalosporins, such as Cefotaxime (CTX), Ceftriaxone, Ceftazidime (CAZ), and monobactams ), thereby causing resistance to these drugs. The enzymes are detected most commonly in Klebsiella pneumoniae and Escherichia coli but have been noted in other members of the family Enterobacteriaceae as well [Enterobacteriaceae and other gram-negative bacteria, and single strain of K. pneumoniae or E. coli may harbor different variants of ESBL genes such as SHV with CTX-M type, AmpC or metalo-\u03b2-lactamases together, that may complicate therapy [Extended-spectrum  as well . The maj therapy . In our study, urine was the source of 262/472 (56%) of the isolates, indicating that UTI is a common illness in our community. Blood culture  was the second major source of isolates thus indicating the relatively high frequency of gram-negative bacteria involved in bacteremias or septicemias in hospitalized patients. The rest of the isolates collected in our study were from ear swabs, swabs from miscellaneous sources, CSF, and sputum.E. coli and 84 were K. pneumoniae. Both E. coli and K. pneumoniae are involved world wide in ESBL production, however, as major isolates from our hospitals, they can give us a good picture about ESBL production in our community.Out of the 472 isolates recovered in this study, 195 isolates were Pseudomonas aeruginosa (64/472), Klebsiella oxytoca (28/472), Proteus mirabilis (23/472), Enterobacter cloacae (17/472), and Pseudomonas Spp (16/472) were recovered in moderate number, whereas the remaining isolates were scarce. Although the moderate number of these isolates is high enough to allow a calculation of the percentage of ESBL production, this percentage may not actually reflect the true nature of ESBL production in the isolate nation wide, and may only indicate the presence of an endemic bacteria in a specific hospital or a specific ward. This is certainly true\u2014if not at least\u2014for the 17 isolates of Enterobacter cloacae which were all collected from King Abdullah University Teaching Hospital during an outbreak. Other clinically important isolates that include Klebsiella pneumoniae isolates. This percentage is considered to be very high compared to prevalence of ESBL production world wide among this species when compared with the 20% prevalence of the Italian study [K. pneumoniae isolates recovered from the ICU of Jordan University Hospital to be ESBL producers [Klebsiella pneumoniae isolates recovered from Princess Basma Teaching Hospital were ESBL producer, which may be attributed to the low number of isolates recovered, the nature of the hospital type, and the patients being served. On the contrary, Isolates from Princess Rahma Teaching Hospital and King Abdullah University Teaching Hospital showed ESBL production in 35/39 (89.7%) and 25/32 (78.1%), respectively. The abnormally high percentage of ESBL production in these two hospitals may indicate the presence of a previously undetected source of a nosocomial infection, the nature of patients being served as both hospitals are serving debilitated patients, and as referral hospitals for malignancy and chronic diseases. Such findings impose the need for applying specific infection control measures to eliminate this organism.In regard to ESBL production, one of the most alarming findings of this study is the ESBL production in 60/84 (72.4%) of the an study , and 39.an study , 11.3% ian study , and 13.an study . Howeverroducers . On the Enterobacter cloacae, which was found in 15/17 collected isolates, thus constituting 88.2%. As indicated before, this high percentage disagrees with prevalence of ESBL production in this species which was 2.9% in the Italian study [Enterobacter cloacae isolates were recovered from King Abdullah University Teaching Hospital during a period of outbreak, as supported by their semi-identical antibiogram profiles and DDD test results.One of the highest ESBL producers by percentage was found to be an study , 6% in tan study , and 12.Escherichia coli isolates, ESBL production was found in 21 out of a total of 195 isolates recovered (10.8%). This percentage agrees with the Chinese study, which demonstrated ESBL production in 11.4% of their Escherichia coli isolates [E. coli isolates were from King Abdullah University Teaching Hospital, whereas those from PBTH and PRTH did not exceed 6%.In isolates , the Sauisolates , and theisolates , but higisolates , and lowKlebsiella oxytoca isolates, ESBL production was found in 8/28 (28.5%) of the isolates recovered. This percentage  is considered to be high when compared to those for Klebsiella oxytoca worldwide, where the Italian study reported 15% prevalence [Citrobacter frundii, Acinetobacter calcoaceticus, Enterobacter hormaechei, and Stenotrophemonas maltophilia isolates from the tertiary care hospital KAUTH, which may reflect the expansion of the genes coding for ESBLs production to other bacterial genera. Although their prevalence in our samples is not high, however, these organisms are becoming a threat to ICU patients and becoming involved in nosocomial infections as reported in Taiwanese, Bulgarian, and Korean hospitals [In evalence . It is aospitals , 11. The NCCLS (CLSI)  recommenEscherichia coli, both CTX and ZOX detected 20/21 (95%) of the ESBL-producing isolates, whereas ATM detected only 85.7% of the isolates. However, CAZ, CRO, CPD were not efficient in detecting ESBL-producing E. coli. Similarly, ZOX, CTX, and ATM were efficient in detecting 95%, 81.7%, 71.7% ESBL-producing Klebsiella pneumonia, respectively. The other antibiotics could detect few ESBL-producing K. pneumoniae. In Klebsiella oxytoca, ZOX showed excellent performance by detecting 7/8 (87.5) of the ESBL-producing isolates. ATM detected 75% of the isolates, while the other antibiotics detected only 50% or less of the ESBL-production in the isolates.In Enterobacter cloacae, CTX and CRO performed excellently by detecting 14/15 (93.3%) of the ESBL producing isolates, whereas CAZ and ZOX detected 13/15 (86.7%) of the ESBL producers, while CPD detected only 12/15 (80%) of them. In E. coli, K. pneumoniae, K. oxytoca, Enterobacter cloacae, especially from samples collected from patients in secondary and tertiary care hospitals. The inclusion of ceftizoxime (ZOX) to the ESBL-detection panel will increase the efficacy of the DDD test in detecting ESBL producers.In conclusion, ESBL-producing gram negative bacteria constituted 22.9% (108/472) of all recovered isolates, and were prevalent among"}
+{"text": "Klebsiella pneumoniae, are few in Saudi Arabia. Therefore, we determined the prevalence of ESBL in K pneumoniae from Riyadh and characterized the predominant \u03b2-lactamase gene in these isolates.Reports on extended-spectrum \u03b2-lactamases (ESBL) production by Enterobacteriaceae, and especially in K pneumoniae samples were isolated from two hospitals in Riyadh during 2007 and screened for production of ESBL using ESBL-E-strips and combined disk methods. PCR assay was used to detect blaTEM, blaSHV, and blaCTX-M genes.A total of 400 K pneumoniae isolates. ESBL-producing K pneumoniae were PCR positive for SHV, TEM and CTX-M \u03b2-lactamase genes with prevalences 97.3%, 84.1% and 34.1%, respectively. Within the CTX-M family, two groups of enzymes, CTX-M-1 and CTX-M-9-like genes were found with prevalences of 60% and 40%, respectively.Phenotypic characterization identified a high ESBL rate of 55% of K pneumoniae clinical isolates in hospitals in Riyadh. This study demonstrates the worldwide spread of blaCTX-M genes. This first report of the presence of the blaCTX-M gene in clincial isolates in Saudi Arabia is evidence of the continuing worldwide spread of this gene.This study confirms the high rate of ESBL in  Escherichia coli and Klebsiella pneumoniae have spread rapidly worldwide and pose a serious threat in healthcare-associated infections.http://www.lahey.org/studies). A typical characteristic of ESBLs is their ability to hydrolyze oxyimino-cephalosporins and aztreonam while being inhibited by \u03b2-lactamase inhibitors.2ozaenae in 1983.5http://www.lahey.org/studies) categorized in five different groups called CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25.7Extended-spectrum \u03b2-lactamase (ESBL)-producing K pneumoniaeK pneumoniae and the molecular characterization of ESBLs in K pneumoniae isolates from Riyadh.In Saudi Arabia, few studies have been undertaken to determine the prevalence of ESBL-producing K pneumoniae non-duplicate isolates were collected from hospitalized patients at two different hospitals in Riyadh, Saudi Arabia, during 2007. Susceptibility testing was performed by the disc diffusion method according to Clinical and Laboratory Standards Institute recommendations.Escherichia coli ATCC 25922, was used in the sensitivity test and in the MIC determination. Phenotypic detection of ESBL was carried out by two different methods: 1) the combined disc method using discs containing cefotaxime and ceftazidime with and without clavulanate  with the ESBL phenotype defined as an increase of \u22655 mm in the zone around the disc containing clavulanate compared to the zone of corresponding discs without clavulanate; and 2) using the E-test ESBL-strip  with a ceftazidime gradient at one end and a ceftazidime plus clavulanic acid gradient at the other end. These strips were applied according to the procedure described by the manufacturer. ESBL was detected if the ratio of the MIC of ceftazidime to the MIC of ceftazidime plus clavulanic acid was \u22658. PCR methods were used to detect blaTEM, blaSHV, and blaCTX-M using the primers and methods previously described.916Four hundred K pneumoniae are listed in ESBL phenotype was detected in 220 (55%) of 400 isolates. The antibiotic resistance rate and MIC distribution of ESBL-producing blaCTX-M-1 -like genes and 30 (40%) of 75 CTX-M-producers harbor blaCTX-M-9 -like genes.The PCR assays revealed that the prevalence of SHV, TEM and CTX-M genes was 97.3% (n=214/220), 84.1% (n=185/220), and 34.1% (n=75/220), respectively, in ESBL-producing isolates. Further PCR experiments to characterize CTX-M groups indicated that 45 (60%) of 75 CTX-M-producing isolates carry K pneumoniae is the most frequent ESBL-producing species worldwide. Production of ESBLs was detected in 220 (55%) of 400 clinical isolates of K pneumoniae isolated from hospital-acquired infections in Riyadh. There was no difference between the combined disk method and the E-test strip method in the phenotypic detection of ESBL for K pneumoniae isolates from Riyadh. Reports on ESBL production by Enterobacteriaceae, and especially in K pneumoniae, are few in Saudi Arabia. The overall prevalence of ESBL producers was found to vary greatly in different geographical areas and in different institutes in Saudi Arabia. In our study, the rate of ESBLs-producing isolates collected from two hospitals in Riyadh was relatively high (55%) and was similar to other rates reported from previous studies in Riyadh.K pneumoniae were detected in Abha and Al-Khobar .13Escherichia coli and 785 K pneumoniae isolates from 31 centers in 10 European countries found that the prevalence of ESBL in these organisms ranged from as low as 1.5% in Germany to as high as 39% to 47% in Russia, Poland, and Turkey.E coli, K pneumoniae and K oxytoca were 79.0%, 69.4% and 100%, respectively. ESBL-positive E coli rates were also relatively high in China (55.0%) and Thailand (50.8%) and Australia with higher rates of 20% to 50% in other parts of the continent.326K pneumoniae was very high (70%).K pneumoniae were identified as having the ESBL phenotype in Kuwait.K pneumoniae was found to harbor the ESBL phenotype.K pneumoniae isolates express ESBL phenotypes and this prevalence is alarming.31K pneumoniae isolates studied was alarmingly high to most antibiotics tested including gentamicin, amikacin, cefepime, and trimethoprim/sulfamethoxazole. Imipenem and cefoxitin followed by ciprofloxacin were the antibiotics most active against ESBL-producers. K pneumoniae isolates harboring ESBLs are significantly more often resistant to flouroquinolones.34K pneumoniae were resistant to ciprofloxacin. In Iran, resistance to ciprofloxacin was found among 32% of the ESBL-producing K pneumoniae strains.36Resistance to \u03b2-lactams, especially third-generation cephalosporins and non-\u03b2-lactams, among clinical isolates of gram-negative bacteria is increasing worldwide.32ISEcp1), which enhances the mobilization of the CTX-M gene, was detected in 60% of CTX-M-producing Klebsiella (study under preparation), while the prevalence of ISEcp1 was relatively low (10%) in isolates included in the present study (Data not included). However, 32 (74%) of the 43 ESBL-producing isolates from Kuwait carried blaCTX-M.blaSHV and blaTEM among ESBL-producing K pneumoniae was 69.6% and 32.1%, respectively.blaCTX-M-1 -like genes (60%) was higher than blaCTX-M-9 -like genes (40%) in CTX-producing K pneumoniae in the present study. In Arab countries, the first description of CTX-M-15 was in Egypt and then in the United Arab Emirates and in Kuwait.937937TEM- and SHV-ESBL are derived from parental TEM-1 and SHV-1 by point mutations. TEM-1 and SHV-1 are non-ESBL; however CTX-M enzymes are not derived from non ESBL and consequently all CTX-M enzymes are ESBL. In the present study, the dominant \u03b2-lactamase was SHV with a prevalence of 97.3% followed by TEM and CTX-M with prevalences of 84.1%, and 34.1%, respectively. In the present study the prevalence of CTX-M enzymes was 34%, but the prevalence of CTX-M enzymes in a study under preparation was 85%. This may be because the present study was done on the isolates were collected during 2007 while in the other study the isolates collected during 2008. In addition to an insertion sequence  of ESBL-producing isolates with elevated MIC for both cefotaxime and ceftazidime (\u2265256 mg/L). The presence of SHV \u03b2-lactamase alone suggests that these SHV genes are responsible for resistance to extended-spectrum cephalosporins in 6.8% of ESBL-producing K pneumoniae isolates. However, the blaSHV gene was found to be associated with the blaTEM gene in 56.8% (n=125/220) with three different patterns of resistance. Seventy-five of 125 (44%) isolates showed a higher MIC for both (\u2265256 mg/L), while 35 (20%) of 125 isolates exhibited an increase in MIC with cefotaxime and a decrease in MIC with ceftazidime, and 15 of 125 (7.2%) isolates exhibited a decrease in MIC with cefotaxime and an increase in MIC with ceftazidime. From this result either SHV or TEM or both are the ESBLs in 125 of 220 isolates producing ESBL. On the other hand, SHV \u03b2-lactamase was present with the CTX-M enzyme in 9.1% (n=20/220) of ESBL-producers. However, the SHV \u03b2-lactamase gene was present with both TEM and CTX-M in 25% (55/220). Thirty-five isolates belonged to the CTX-M-1 group with a higher MIC for cefotaxime and ceftazidime, while 20 isolates belonged to the CTX-M-9 group with a decrease in MIC with cefotaxime and an increase in MIC with ceftazidime.The K pneumoniae was relatively high (34.1%). In India, higher percentages (72%) of ESBL-producers harbor blaCTX-M genes.blaCTX-M genes in Saudi Arabia.CTX-M enzymes (CTX-M-1 like genes) were co-present with TEM in 5 isolates (2.27%) with an increase in MICs with cefotaxime and ceftazidime (\u2265256 mg/L). However, the CTX-M family of ESBLs has been increasingly detected worldwide.K pneumoniae in Riyadh, Saudi Arabia, and further demonstrates the worldwide spread of genes coding for CTX-M enzymes in clinical isolates. Most ESBL producers were resistant to oxyimino-cephalosporins and other non-\u03b2-lactam agents at high levels.In conclusion, this study confirms a high rate of ESBLs in"}
+{"text": "Although female sex workers (FSWs) report high levels of condom use with commercial sex clients, particularly after targeted HIV preventive interventions have been implemented, condom use is often low with non-commercial partners. There is limited understanding regarding the factors that influence condom use with FSWs\u2019 non-commercial partners, and of how programs can be designed to increase condom use with these partners. The main objectives of this study were therefore to describe FSWs\u2019 self-reported non-commercial partners, along with interpersonal factors characterizing their non-commercial partnerships, and to examine the factors associated with consistent condom use (CCU) within non-commercial partnerships.This study used data collected from cross-sectional questionnaires administered to 988 FSWs in four districts in Karnataka state in 2006-07. We used bivariate and multivariable logistic regression analysis to examine the relationship between CCU  with non-commercial partners of FSWs  and interpersonal factors describing these partnerships, as well as social and environmental factors. Weighting and survey methods were used to account for the cluster sampling design.Overall, 511 (51.8%) FSWs reported having a husband or cohabiting partner and 247 (23.7%) reported having a non-paying partner. CCU with these partners was low (22.6% and 40.3% respectively). In multivariable analysis, the odds of CCU with FSWs\u2019 husband or cohabiting partner were 1.8-fold higher for FSWs whose partner knew she was a sex worker  and almost 6-fold higher if the FSW was unmarried .This study revealed important patterns and interpersonal determinants of condom use within non-commercial partnerships of FSWs. Integrated structural and community-driven HIV/STI prevention programs that focus on gender and reduce sex work stigma should be investigated to increase condom use in non-commercial partnerships. Information about the non-commercial partners of female sex workers (FSWs) in the context of HIV and other sexually transmitted infection (STI) epidemiology is limited. Of particular interest in HIV/STI prevention and care programming is the observation that, although condom use within the commercial sex partnerships of FSWs is frequently reported to be high, condom use is much lower within non-commercial partnerships -5. HIV pUnderstanding condom use in non-commercial partnerships is complex. The sex partners of FSWs are usually categorized as commercial/paying versus non-commercial/non-paying. Non-commercial partners can include husbands, boyfriends or lovers, as well \u201cmen who have free sex\u201d  . FSWs haAvahan India AIDS Initiative [Previous research among FSWs in our study setting of southern India has found that exposure to a large-scale HIV preventive intervention (the itiative ), while itiative . The maiDuring 2006-07, in-depth cross-sectional quantitative interviews  were conducted with 988 FSWs in four districts  in Karnataka state, southern India. A probability sampling method was employed, using time-location cluster sampling with normalized weights calculated to account for the complex sampling design. Sampling methods were similar to those reported by Ramesh et al  for otheafflili\u00e9 universitaire de Qu\u00e9bec, Qu\u00e9bec, Canada and the University of Manitoba, Winnipeg, Canada. The surveys were administered through face-to-face interviews and were conducted anonymously, with no names or personal identifiers recorded. A detailed and standardized consent process was implemented for each respondent. The surveys and their protocols were approved by the Government of India\u2019s Health Ministry Screening Committee, the respective Canadian university ethics boards and St John\u2019s Medical College, Bangalore.The SBS was implemented by the CHARME-India project in collaboration with the Institute of Population Health and Clinical Research, St John\u2019s Medical College, Bangalore, the Centre hospitalier CCU with each type of partner was derived from the survey question: \u201cHow often is a condom used when you have sex with <this partner>?\u201d Women were considered to use condoms consistently with each partner, if they answered \u2018always\u2019 compared to inconsistently, which was defined as \u2018never\u2019, \u2018sometimes\u2019 or \u2018frequently\u2019.a priori a set of interpersonal factors in the survey specific to each partner that may influence CCU with non-commercial partners [ever stays or lives with the partner ; if the partner provides the respondent with economic support; if the respondent provides the partner with economic support; if the respondent is normally under the influence of alcohol during sex with the partner; and if the partner is normally under the influence of alcohol during sex with the respondent.Based on previous literature we defined partners ,23. CommDevadasi tradition, a form of temple-based sex work whereby women are dedicated through marriage to gods or goddesses [For each model of CCU, we also examined the impact of social and environmental factors related to the respondent. Social factors included age, marital status , age2 tests were used to assess associations between social and environmental factors, and whether or not FSWs had each type of non-commercial partner, as well as associations between interpersonal, social and environmental factors and CCU. Multivariable logistic regression models were developed with CCU as the outcome, for each of the two types of partners. Inclusion into multivariable models for all potential covariates were based on significance at the P<0.10-level from bivariate analysis. Sampling weights were utilized in multiple regression models to account for the complex sampling design, using survey methods. Multicollinearity in multivariable models was assessed using the variance inflation factor (VIF) and tolerance statistics, corrected for the survey methods employed [P-values reported are two-sided.Statistical analysis was conducted using Stata Version 10.1 . Continuemployed . AdjusteOf the total sample of 988 FSWs, 208, 198, 369 and 213 women were recruited in Belgaum, Bellary, Bangalore and Mysore, respectively. The median age was 30 years (interquartile range: 25-35 years) and the median duration of sex work was 5 years (interquartile range: 2-10 years). Of the whole sample, 90.9% of women reported using some form of contraception for family planning . Overall, 511/985 (51.8%) FSWs reported having a husband or cohabiting partner (with three non-response) and 247/987  reported having a non-paying partner. Of these samples, 506 FSWs had valid responses to condom use with the husband or cohabiting partner and 101 (22.6%) reported CCU with their partner; 247 FSWs had valid responses to condom use with the most recent non-paying partner and 92 (40.3%) reported CCU with their partner. Figure Additional file Table FSWs reported that almost half of their husbands or cohabiting partners 41.1%) had sex partnerships with other women, while this was the case for the majority of their most recent non-paying partners (70.2%)  with non-commercial partners was low and FSWs reported lower CCU with their husband or cohabiting partner than with their non-paying partner. Both FSWs and their non-commercial partners were found to be substantially connected to other types of partners through other sex partnerships. FSWs reported that a considerable proportion of these male partners had other sex partners. These partners included wives, FSWs or other types of female partners \u2013 both within and outside their local geographic settings . These results highlight the vulnerability of FSWs to both acquisition and transmission of HIV/STIs within complex sexual networks, as well as the integral role of FSWs\u2019 non-commercial partners as bridge populations who may facilitate the transmission of HIV to female partners outside the context of sex work.The longevity of the sexual partnerships with FSWs\u2019 non-paying partner appears to be particularly important in determining CCU, with a longer relationship duration being associated with lower CCU. A more nuanced understanding of what the duration of the relationship represents  and how these can be addressed in HIV/STI prevention programming is needed. Although FSWs in southern India are highly economically vulnerable with few comparably well-paying employment prospects , factorsWhile exposure to interventions has been found to be positively associated with increased condom use by FSWs with their clients, including in our setting ,12,34-37Interventions designed for clients of FSWs as well as FSWs have been observed to contribute to declines in STI prevalence and increases in condom use ,48. HoweIn our study, CCU was almost two-fold higher with FSWs\u2019 husband or cohabiting partner when this partner knew the FSW was in sex work. Condom use could be higher in these relationships because of an increased awareness of the risks incurred by these women by the male partner. This could also be due to greater exposure and involvement in HIV/STI programming designed for FSWs, or increased access by HIV/STI programs to male partners. Sex work occupational stigma, which influences women to hide their sex work status from their partners and families, has increasingly been postulated as a major barrier to health access for FSWs ,55. ThesSentinel surveillance and observational studies suggest that HIV and STIs have decreased among FSWs in Karnataka state since Avahan was introduced ,56, and There are several limitations to this study. The study is based in four districts in Karnataka state, southern India, and may not be generalizable to other regions in India. It is based on self-reported data from cross-sectional surveys, and self-reported data may be subject to social desirability bias . HoweverThe results from this study have revealed important patterns and interpersonal determinants of condom use within non-commercial partnerships of women in sex work. Integrated structural and community-driven sexual and reproductive health and HIV/STI prevention programs that include a focus on gender and reduce social stigma surrounding sex work are needed in settings with high HIV prevalence among FSWs and their non-commercial partners.The authors declare that they have no competing interests.KND contributed to the conceptual design of the study, conducted the study and the analysis and drafted the manuscript; JB and KS participated in the conceptual design of the study and coordination, made substantial contributions in the interpretation of data; PB, SM, SYS, MCB, CL and MA made substantial contributions in the interpretation of data and critically revised the manuscript for important intellectual content; BMR, KG, SR, RW made substantial contributions to the acquisition and management of the data. All authors read and approved the final manuscript.Sample characteristics of social and environmental factors: Sample characteristics according to the type of non-commercial partner of female sex workers (FSWs) in four districts in Karnataka state, including FSWs\u2019 husband or main cohabiting partner or their most recent non-paying partner (who is neither a husband nor the main cohabiting partner).Click here for file"}
+{"text": "Heterosexual contact is the most common mode of transmission of sexually transmitted infections (STIs) including Human Immunodeficiency Virus (HIV) in Nepal and it is largely linked to sex work. We assessed the non-use of condoms in sex work with intimate sex partners by female sex workers (FSWs) and the associated self-efficacy to inform the planning of STI/HIV prevention programmes in the general population.This paper is based on a qualitative study of Female Sex Workers (FSWs) in Nepal. In-depth interviews and extended field observation were conducted with 15 FSWs in order to explore issues of safe sex and risk management in relation to their work place, health and individual behaviours.The main risk factor identified for the non-use of condoms with intimate partners and regular clients was low self efficacy. Non-use of condoms with husband and boyfriends placed them at risk of STIs including HIV. In addition to intimidation and violence from the police, clients and intimate partners, clients' resistance and lack of negotiation capacity were identified as barriers in using condoms by the FSWs.This study sheds light on the live and work of FSWs in Nepal. This information is relevant for both the Government of Nepal and Non Governmental Organisations (NGO) to help improve the position of FSWs in the community, their general well-being and to reduce their risks at work. Sex work is characterised by high rates of commercial sex partner exchange, low rates of consistent condom use  with regNepal is one of the least developed country, many people live in poverty and the country experiences considerable seasonal labour migration  mainly tMoreover, the conditions in which FSWs operate need to be seen in the light of the inferior position of women in Nepalese society . Not onlNepal generally has a low HIV prevalence of less than one percent, but it is considerably higher in FSWs, whose prevalence rate is 4% nationally . In and The higher client-FSW ratio (20:1) in Nepal, compared to the South Asian average (7.5:1) indicates higher risks of STIs and HIV transmission among the FSWs including the general population . The sitIn Nepal, one study concluded that clients did not want to wear condoms for fear of losing sexual pleasure and embarrassment over buying condoms . FSW areThis paper presents individual, structural and cultural factors facilitating and creating barriers in using condoms among FSWs in the Kathmandu Valley.Our qualitative study focused on FSWs aged 15 to 45 who have been involved in the commercial sex trade for at least six months prior to the research. FSWs constitute a hard-to- reach population ,23. We cth interview [An interview schedule was prepared outlining some topics to be discussed and some probing questions. This was first developed in English and translated into Nepali. Interview topics included knowledge and use of condoms, sexual activities and protective behaviour, potential partners, sexual harassment, characteristic of paying clients and non-paying partners, and high-risk sexual behaviour. The interviews were tape recorded with written consent. Three participants refused to participate as information about them had been exposed by the media in the past. Theoretical saturation was reached after 15 interviews and no new additional information, appeared after the 13nterview . Intervinterview . ConductThe first author conducted the in-depth interviews, with the help from two trained researchers, at convenient locations and at dates and times of the interviewee's choice, usually in a public area due to fear of disclosure of their occupation. The in-depth interviews completed by the first author lasted between two to five hours and several visits were made prior to the interview to build up rapport with the interviewee.Ethical approval was given by the Nepal Health Research Council (NHRC). Participants' full verbal and written informed consent was obtained; using consent forms written in Nepali and using simple terminology. Those respondents who requested additional information were referred to the nearest health institutions. Confidentiality of information was maintained by removing personal identifiers, names of hotels and massage centres where FSWs operate. The interviews were analysed manually through reading and re-reading of the transcripts and manual thematic analysis by two of the authors.Of the 15 FSWs interviewed six were married and living with their husbands, five were married but separated, three were unmarried, and one was a widow. Of those who were married, their marriages were well established (15 to 17 years). The majority were Janajati (ethnic minority group), two were Dalits (disadvantaged low castes), two were Brahman/Chhetri (privileged castes), and one was a Newar (privileged ethnic group). Their ages ranged from 19 to 42 years, with most (80%) being between 22 and 30 years old. In order to keep the identity of the FSWs confidential, each was assigned identification (ID). The interviewees' characteristics are listed in Table All FSWs knew about condoms. They also claimed that they knew how to use condoms during sexual intercourse which meant a high self-efficacy (SE) with FSWs in this matter. Two peer educators and the owner of a massage centre were involved in educating other FSWs on how to use condoms. It was notable that almost all FSWs reported they had not used condoms. Eleven out of 15 said they did not use condoms with their most recent client because of the client's refusal. Four out of 15 self reported that they had used condoms in their last sexual encounter, but when they were probed further, they revealed that they actually had not used condoms with their last client. The reasons for non use of condoms were reported as clients refused in low SE.Almost all FSWs spoke of client refusing to use condoms for reasons of reduced pleasure, or that they knew each other well and had an established relationship. In fact, FSWs used condoms only if their clients demanded that they use them, the clients generally did not demand that condoms to be used. In cases of client refusal, FSWs did not disagree or try to force clients because they feared that they would lose the client if they disagreed to have sex. The following quote is typical in that it highlights the client's payment for pleasure and the FSW's in ability to refuse on the grounds of unsafe sex:'I asked him (client) to use a condom. He replied that he did not like them and wanted more pleasure while having sex. He further added that he had come to relax as he had paid the restaurant owner already, I could not deny him sex anyway' Another FSW stated clearly that condom use depended on the client's attitude, for example:'I ask every client to use a condom. If he accepts I use the condom. If he does not, I cannot force him. Condom use really depends on the client' Two FSWs felt that they were more educated and fashionable than other FSWs, and had clients who were of higher status: therefore their exposure to STIs and HIV was reduced.'I use condoms with foreigners as they demand them. But with other high profile Nepali men, I do not use them' Consistent condom use was claimed by just one FSW with a higher education and better employment in a dance restaurant:'I am an attractive lady. I have passed my school leaving certificate (Grade 10). I work in a dance restaurant and I know many good looking and high class men. I charge more than Rs.2000 per client. I use condoms every time. If a client refuses to use a condom, I get another client' Almost all FSWs reported that they never asked their boyfriends and husband to use condoms except for family planning purpose. They do not use condoms consistently with their regular sex partners, or the husband, Nepali FSWs expressed their powerlessness to force their husband to use condoms against their will. Even a FSW who was (a) a peer educator; (b) and living with an HIV positive husband did not use condoms with either clients or her husband.She said that she knew the risk but could not stop people having sex without condoms.'I know the danger of having sex without condoms, my husband is HIV positive, and how can I say this to other clients? How can I stop my husband having sex without a condom? I am helpless' We asked FSWs who decided whether or not to use a condom in their last sexual encounter. Of the 15 FSWs interviewed, 6 FSWs reported that it was decided by them, 3 by the client, and the remainder by both of them. One FSW interviewee noted that she never use condom and neither she nor her clients felt the need to use a condom.One of FSW also expressed a similar experience:'I spent last night with a client in a restaurant. I asked him to use a condom while having sex. He used one the first time but refused afterwards saying he had paid a huge amount for all night sex. He assured me he did not have HIV and was tested regularly' Most FSWs said that it was the clients who decided irrespective of suggesting use a condom by the clients during their last sex. One FSW who had a sex with foreigners reported that her clients offered condoms while having sex with her.She added thus:'My client (foreigner) wanted to use condom. Foreigners mostly ask to use condoms' One FSW, who had obtained School Leaving Certificate (SLC) education, reported that she and her clients had jointly decided to use condoms. One younger and relatively educated FSW said confidently that she proposes her clients to use condom.She stated in this way:'I always ask them (clients) to use condom, He did not refuse it' One FSW whose husband was HIV positive never used condoms with her clients. She expressed her frustration towards life as a reason for not using condoms as follows:'My husband has been tested HIV positive. I can't say tell him to use a condom. I have checked for HIV but I am not positive yet. As anyone has to die one day......no one is immortal. So I don't press clients to use condom' Powerlessness and poverty were frequently reported as the reasons behind the non-use of condoms by the FSWs. One FSW expressed her faithfulness of clients and her powerlessness in the following way:'Most of the clients say 'I love you, why do you not love me...? It is so difficult to ignore them. We are here for making money. After all, the clients pay us for sex, not to argue with us for using condoms. We have no other options...' One of the FSW described client's love and stated the following quote:'He did not use condom last time because he did not like it. I reminded him but he said to me,' if we have a virus in us we will die together, why do you worry?'Another FSW explained the risks she had to take in the light of the commercial relationship between the pimps and the clients.'The clients told me that he has no HIV. As he had paid for sex and I am also paid by my owner to provide services to the clients. I got this place here, after searching for a long time. If I lose this job I can't survive, and my family has to suffer' Another FSW expressed her low power to negotiation for condoms use:'I have no power to force him (clients) to use condoms because I am here for this job. I have to keep my customers happy at all the time. We have to accept their demands; otherwise we need to leave our job' Another FSW expressed the reason for not using condom with helpful clients:'I have a few regular clients who I have an attachment for. They love me and come to me with me they don't want sex using condoms. I never press them as I am a widow. They have helped me in many ways and in raising my kids. So I cannot insist them using a condom' Different from others, a 30 year old literate FSW confidently said:'I use condoms with all my clients to protect me from STIs and HIV. One day when I asked a client to use a condom he refused at first. I denied having sex with him. Finally, he agreed to use condom. From then, I knew that if we become strong and can resist the clients, it is certain that they must agree' The FSWs who we interviewed did not use condoms for various reasons: Clients' refusal due to their perception that a condom reduces pleasure during sex, some FSWs offering sex without a condom, FSW's misconception that well off and healthy clients and familiar men or boyfriends do not harbour STI and HIV were reported as the reasons for not using condoms.'They are big people, wealthy, have good education and good looking. They are superior to us. Some are our boyfriends and come to us regularly. For them we do not ask to use a condom. They also do not ask for us' However, a FSW reported that most of the time clients make the decisions not to using a condom. One FSW stated her views in this way:'If we force them to use condom, they might refuse and turn to other FSWs who agree to sex without a condom. It will affect our job and earning. So it is up to them to decide whether or not to use condom' One FSW expressed her feeling in this way:'He (client) did not like to use a condom. He flatly said ''I come here for entertainment'' If I do not get satisfaction, why should I come here and spend money? 'One or two FSWs initially claimed they used condoms every time. But later on they revealed that they really did not use a condom while they had sex with business men (rich people), artists, educated, apparently smart and healthy looking clients. They reported that they recognised the clients based on their personality, behaviours and the amount they pay. An FSW who had regular clients for a longer period was not using condoms at all. She expressed her view as follows:'I do not use condom with him (client) because he comes to me regularly. He is quite educated. He told me that he really loves me and wants to be fully relaxed with me. He pays me well' Of the 15 FSWs interviewed, three were single, five were living with boyfriends, and seven were living with husband. Almost all cohabitating FSWs reported that asking their regular partners to use condoms was culturally inappropriate and viewed as a denial to have sex.They reported that they never asked their regular partners to use condoms except for family planning purposes. They had too low SE to force these non-paying partners to use condoms against their will. One FSW, who is a peer educator and living with an HIV-positive husband, reported that she did not use condoms with her clients, or with her husband, she said that she knew the risk but could not do anything to enforce condom use from following statement:'I know the danger of having sex without condoms. My husband is a HIV-positive... How can a wife ask her husband to use a condom? It is better to die than resist a husband... And how can I tell this (his HIV status) to my clients? I am helpless... As everyone has to die one day, and no one is immortal, I do not press my clients to use condoms' Another FSW expressed her difficulties as:'If I tell my husband to use a condom he will not trust me, and he might leave me in trouble. I want to tell him (my husband) to use a condom but I cannot do this in our culture. We do not use condoms between husband and wife except for family planning purposes. If I ask he will guess my naughty work and leave me in chaos' One FSW reported her fear of violence:'My husband is unemployed. He drinks a lot and often beats me up. He acts violently if I ask him to use condoms. I do not want to make it worse' Another FSW stated her believe following way:'My boyfriend never uses a condom with me and I also accept this because in a true relationship there is no need to wear condoms. We tested our blood together last time. Both of us are HIV-negative. Except for family planning, it is not considered good to use condoms with a husband or close partner' Most of the FSWs claimed or perceived a threat that they could be arrested by the police and kept in jail if their identity as sex workers was discovered. A few FSWs reported that due to police raids for condoms , they no longer carry condoms with them. Most FSWs, when asked if they were carrying condoms on their possession, said no because they feared that the police would search their bags and find them. A typical answer to the question; \"Do you keep condoms with you?\" was:'No I don't.....if the police checks my bags searching for a bomb during war, it is sure he will take me to jail. For them both bomb and condoms are similar, both are illegal' Even peer-educators, who have identity cards that should protect them from police harassment, are still harassed for example:'The police took me into custody for a couple of months after they found condoms with me. They beat me up with a stick. I had many bruises on my body. At one point I lost my capacity to stand. They also stole all my money from my purse' One of FSW went on to complain that it was not only the police that harassed them, but also the Maoist rebels:'Nowadays some males who claim to be Maoist have also started torturing us. One of my friends was caught by them, beaten up in a public park ... She was made to undress there. As a result of this torture, she became critically ill. We FSWs are supporting her treatment now' FSWs were relaxed and tended not to use condoms with apparently healthy, young, educated and wealthier clients. They rarely used condoms in personal sexual relationships with non-paying partners and perceived that foreigners could be safe to have unprotected sex. This, too, confirms UNAID's findings . Almost Only three out of 15 FSWs in the in-depth interviews had carried condoms with them. This finding was confirmed during observation in cabin restaurants and massage centres. Despite claims by establishment owners, it was also confirmed through observation of the cabin and massage centres by the researcher. There were no condoms at these places as claimed by the owners.et al. found that 80% of Cambodian FSWs used condoms consistently [FSW's use of condom was rooted in their concern for ensuring financial gain and earning their livelihoods. Sex workers strove to mitigate disruption and harassment by police, and to maintain their emotional and physical well-being. Attitudes to sexual health risks were shaped by these driving motivations, and thus can only be understood when seen through sex workers own world view. Within this, behaviours that are \"risky\" from a sexual health perspective such as accepting all clients, including those who refuse to wear condoms. Past studies in other countries show varying rates of condom use during a paid sexual transaction. For example, Wong istently , when clistently ,35.The perceived risk of HIV was found to be an important trigger among FSWs negotiating condom use with clients. Women were aware that proper condom use was an effective preventive measure for HIV . UnfortuAdditionally, lack of autonomy in a society that values decisions of men over the rights or well-being of women was an influencing factor. Confounding factors are the high mobility of FSWs, leading to increased health risks and difficulty conducting follow-ups, as well as the illegal status of sex work ,42.Finally, this qualitative study among the FSWs in Kathmandu Valley, Nepal found a clear hierarchy of concerns within the community. Sex workers took pride in their ability to contribute to daily hand to mouth concerns and their families' incomes and viewed their role as earners as of foremost importance. This finding is supported by a study carried out in Vietnamese sex workers in Cambodia and Indonesia ,44. ThreThe findings presented in this paper are based on self-reporting by the FSWs from within the Kathmandu Valley. As sex work is illegal in Nepal, FSWs may have provided some inaccurate or incomplete information because there were difficulties in identifying a sampling frame of FSWs and secure venues where interviews could be conducted due to the fear of media exposure and previous episodes of confidentiality violation. FSWs are also highly mobile due to the fear of police and other armed personnel.This study considers that sex workers were highly vulnerable due to low Self-Efficacy (SE) for their health compromising behaviours, anxiety, fear of life threatened disease like HIV, poor physical, mental and social health, lower levels of education and livelihood problems. Poverty, gender inequality, lack of empowerment ,46 and l(SACTS): STI/AIDS Counselling and Training Service is a non-profit non-governmental organisation; (FSWs): Female sex workers, (FHI): Family Health International; (NCASC): National Centre for AIDS and STD Control; (STI): sexually transmitted infections, (SLC): School Leaving Certificate, (SE): Self-efficacy.The authors declare that they have no competing interests.LG participated in the design, carried out the whole study, interviewed the participant, prepared the dataset, analysed and prepared all the results and drafted the manuscript. WCSS redrafted the manuscript and contributed to design of the analysis. ERvT supervised the data analysis, design of the study and redrafted the manuscript and made important final modifications. RD organised to the interviews in confidential local setting and redrafted the manuscript. NPL facilitated interviews, organising a data set, and helped to redraft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6874/11/42/prepub"}
+{"text": "Although reported condom use between female sex workers and their clients is high in Ethiopia, condom use with regular, non-paying partners remains low, posing a substantial risk of HIV infection to sex workers, their partners and the general population. Previous studies have identified the synergistic effects of substance abuse, violence and HIV risk, but few have examined these inter-relationships among female sex workers and their regular, non-paying partners. This study explored the associations between work-related violence, alcohol abuse and inconsistent condom use among establishment-based female sex workers and their regular, non-paying partners in Adama City, Ethiopia.A cross-sectional survey was conducted with 350 establishment-based female sex workers, aged 15\u201335, at 63 bars, hotels and nightclubs. Multivariate logistic regression analysis was conducted to test the association between work-related violence and condom use with regular, non-paying partners, controlling for age, overall income, education and sex workers\u2019 total number of sexual partners in the past week. Alcohol abuse was explored as an effect modifier.Respondents reported a high prevalence of work-related violence (59%) and alcohol abuse (51%). Work-related violence was statistically significantly associated with unprotected sex with regular, non-paying partners among those who abused alcohol  and among those who did not . Alcohol abuse was not associated with inconsistent condom use within these partnerships, though it may strengthen the effect of work-related violence on unprotected sex.Findings suggest violence against establishment-based female sex workers is associated with HIV risk within regular, non-paying partnerships. Qualitative work is needed to better understand the links between a violent work environment and condom use with regular, non-paying partners and how interventions can be implemented in this context to prevent violence against sex workers and reduce HIV transmission. The syndemic of substance abuse, violence and AIDS, initially conceptualized by Singer, has beePrevious studies in the U.S. and China have identified associations between FSWs\u2019 drug and alcohol abuse and experiences of physical and sexual violence perpetrated by both clients and regular, non-paying partners,4. FSWs The associations between FSWs\u2019 experiences of violence and exposure to HIV risk within their client and regular, non-paying partnerships are well-documented. Studies have shown that FSWs who have ever been sexually or physically abused are more likely to report sexually transmitted infections (STIs) and inconsistent condom use with clients,15. All There is a paucity of data on the links between violence and HIV risk within regular, non-paying partnerships in the developing world. One recent study in southern India examining the link between physical and/or sexual violence and inconsistent condom use found no association in non-paying partnerships, while observing a positive relationship in regular and occasional client partnerships. A studyOther literature suggests the importance of lifetime gender-based violence  among FSWs in relation to STIs and inconsistent condom use with clients and other partners, suggestHeavy alcohol consumption among FSWs has been documented globally. AlcoholIn addition to the effects on FSWs\u2019 general mental and physical health, alcohol abuse has the potential to increase HIV risk in an already vulnerable population. Though FSWs operate in highly diverse environments, the association between alcohol use and increased odds of inconsistent condom use and STIs has been found in studies among FSWs in many developing countries,27,31-33Along the transport corridors of Ethiopia, the prevalence of HIV among women in the general population is 8.6%; among FSWs, it is 25.3%. FSWs\u2019 rUnprotected sex with regular, non-paying partners may put both FSWs and their partners at higher risk of HIV infection. For example, research in Benin found that regular, non-paying partners of FSWs had particularly large numbers of partners, concurrent partnerships with other FSWs, low rates of condom use, and higher HIV prevalence as compared to the new and regular clients of sex workers. StudiesWhile there is an increasing understanding of the synergistic effects of substance abuse, violence and HIV, little research has examined these associations as they relate to FSWs\u2019 condom use with regular, non-paying partners, and to date, no such studies have been conducted in Ethiopia. Intimate partner violence is common in Ethiopia, with women\u2019s reported lifetime prevalence ranging from 51-78%. QualitaData collection was conducted by Miz-Hasab Research Center (MHRC), a licensed private research center based in Addis Ababa, Ethiopia\u2019s capital. Data were collected between December 2009 and February 2010 using a structured survey questionnaire. FSWs were surveyed in Adama City, selected for its high prevalence of sex work, due to the city\u2019s placement as a stop-over for truckers and businessmen traveling between the Port of Djibouti and Addis Ababa.The survey was conducted with 350 FSWs in 63 establishments, including nightclubs, bars and hotels. Though sex work is illegal in Ethiopia, FSWs were typically employed by owners of licensed establishments as waitresses to increase drink sales and room rentals. Establishment owners charged clients for rooms, and FSWs generally paid money to establishment owners for time spent away from the venue with a client, or for breaking establishment rules.A list of the total number of each establishment type was developed by the MHRC from a list of licensed establishments obtained from Health Communication Partnership and Elilta, two organizations that implement HIV prevention interventions with FSWs in Ethiopia. The list included establishments where at least five FSWs worked. Proportions of each establishment type were calculated from the total list of establishments, which were used to determine the proportion of the total sample of FSWs to select from each establishment type. The sample of establishments was randomly selected, and included approximately half of the establishments of each type. FSWs were selected from establishments using a convenience sample. Unlicensed venues were not included because FSWs generally did not drink at these establishments, where the ability to serve alcohol was limited. Often, only one to two FSWs were employed at these venues, and they were typically new to sex work and reluctant to participate in the study. Additionally, licensed venues where fewer than five FSWs operated were excluded.Surveys took an average of 70 minutes, and were generally conducted in bedrooms or other private areas at participants\u2019 work places after obtaining oral consent. Survey questions assessed FSWs\u2019 demographic and socioeconomic characteristics, experience as a sex worker, relationships with establishment owners, patterns of alcohol use, sexual behavior, and condom use with various partner types. Six data collectors and two supervisors were selected from the MHRC staff, all of whom were trained for the study and had substantial previous experience in survey research.Ethical approval for the study was obtained from the Oromiya Health Bureau in Adama City. All participants provided informed consent.Respondents were asked, \u201cHow often do you use condoms with regular, non-paying sex partners?\u201d This was measured using a four-point Likert scale . A binary variable was created whereby sometimes, often or never were considered inconsistent condom use. No time period was specified.Respondents were asked, \u201cIn relation to your work, have you ever experience physical violence?\u201d (yes/no). The same question was asked regarding physical danger, emotional abuse, threats and forced sex. Respondents were not asked to identify perpetrator types. A binary variable for work-related violence was developed and defined as a positive response to at least one of these five questions.cut down on drinking, annoyance by critics, guilt about drinking, and eye-opening morning drinking). Two or more yes responses indicated alcohol abuse, as this cut-off has been shown to provide the best combination of specificity and sensitivity[Alcohol abuse was measured using the four-item CAGE assessment , overall monthly income in Ethiopian Birr , educational attainment , total number of sexual partners of any type in the past week (dichotomized at the median into 0\u20132 and 3+), sex work establishment type  and sex work duration . Categories for age, income and sex work duration were created based on their distributions, using approximately the 25th and 75th percentiles as cut-offs to create three groups for each variable. Although previous studies have controlled for marital status and sex work as participants\u2019 main occupation, we did Statistical analysis was conducted using STATA version 12 software. Of the 350 respondents, 39 were excluded from the analysis because of missing data on the following variables: CAGE (32 missing observations), number of partners (4 missing observations), and the outcome of inconsistent condom use (3 missing observations). Bivariate analysis was used to assess the prevalence of alcohol abuse and work-related violence by demographic, socioeconomic and interpersonal characteristics. To determine if work-related violence mediated the effect of alcohol abuse on inconsistent condom use with regular, non-paying partners, simple logistic regressions were used first to test associations between alcohol abuse and work-related violence, alcohol abuse and inconsistent condom use, and work-related violence and inconsistent condom use. The relationship between alcohol abuse and inconsistent condom use with regular non-paying partners was not significant, so mediation analysis was not continued.Multivariate logistic regression models were developed to test the association between work-related violence and inconsistent condom use with regular, non-paying partners among FSWs who did and did not abuse alcohol. Stratification was used to examine alcohol abuse as a moderator of the effect of work-related violence on inconsistent condom use. In addition, an interaction term was added to the unstratified model to test the interaction between alcohol abuse and violence, but did not produce a significant regression coefficient. However, the study may not have been adequately powered to detect an interaction, as this was done as an adhoc analysis.Age, income, education and total number of partners of any type in the past week were selected a priori as important confounders based on previous studies of condom use among FSWs. Multi-collinearity was assessed using odds ratios of 2.5 as a cut-off, which indicated no collinearity among the variables of interest. The Akaike information criterion (AIC) was used to compare nested models. The first included work-related violence as the only independent variable; demographic and socio-economic variables  were added to the second; number of partners to the third; sex work duration to the fourth; and establishment type to the fifth. The Hosmer Lemeshow test was used to measure model fit . Duration of sex work and establishment type were excluded from the final models because the variables were insignificant in bivariate and multivariate regressions and decreased model fit based on the AIC and Hosmer Lemeshow tests. Odds ratios and 95% confidence intervals were obtained for each variable.Demographic, socioeconomic and interpersonal characteristics of the sample are displayed in Table\u00a0Fifty-one percent reported alcohol abuse based on the CAGE assessment. When asked where they usually drank alcohol, nearly all (96%) reported primarily drinking in the workplace. Respondents primarily drank with new clients (49%) and regular clients (45%); just 2% reported primarily drinking with a boyfriend.Any experience of violence in relation to one\u2019s work was reported by 59% of respondents .Thirty-eight percent of respondents reported inconsistent condom use with regular, non-paying partners, while only 0.3% reported inconsistent condom use with regular clients and 1% with non-regular clients. Table\u00a0Results from multivariate logistic regression analyses, stratified by alcohol abuse, are displayed in Table\u00a0We examined the effects of alcohol abuse and violence on FSWs\u2019 unprotected sex with regular, non-paying partners, relationships which may present a high risk of HIV transmission yet which have not yet been examined in the Ethiopian context. In our survey, 38% of FSWs reported inconsistent condom use with regular, non-paying partners. The majority (59%) reported experiencing work-related violence, and 51% reported alcohol abuse. Findings indicated that inconsistent condom use with regular, non-paying partners is associated with experiences of work-related violence and higher income. No significant relationship was found between alcohol abuse and inconsistent condom use within these partnerships. Data suggested that alcohol abuse among FSWs in Adama City is highly contextualized, and drinking occurs almost exclusively with clients and in work settings, so may not have a substantial effect on sexual behavior within regular, non-paying partnerships.Our findings suggest there may be a relationship between experiencing violence at work and being victimized by regular, non-paying partners. In studies of FSWs in New York, South Africa, and China, participants reported high rates of violence perpetrated by both clients and regular, non-paying partners-5, and iHowever, it is unclear why work-related violence did not interfere with condom use in new or regular client partnerships, which was reported to be consistent by over 99% of respondents. This could indicate that condom use with new and regular clients was over-reported, or that client violence shaped behavior less than violence by regular, non-paying partners. This result is consistent with previous research in China which found that violence perpetrated by regular, non-paying partners was associated with inconsistent condom use with partners of that type, but abuse by clients was not related to condom use with clients. STI hisAlthough this study distinguished between clients and regular, non-paying partners, FSWs may not perceive a clear distinction. Previous research in Madagascar found that some FSWs described sexual relationships that transitioned more fluidly across categories, with client relationships evolving into regular, non-paying partnerships and back. In KenyWe identified a significant relationship between inconsistent condom use with regular, non-paying partners and higher income. Evidence suggests FSWs may receive more money from regular, \u201cnon-paying\u201d partners than clients, and that they may be willing to sacrifice condom use to ensure the stability of this income,41. In aIt is quite possible that FSWs who participated in our study were receiving significant monetary support from their regular, non-paying partners, which may explain the association between higher income and inconsistent condom use with these partners. It should also be noted that types of income were not distinguished in the analysis, and some income may have been generated from jobs outside of sex work. We do not expect that other types of income would have confounded results, as only 7% reported working in any job outside of sex work, and 98% reported that sex work was their main occupation.Fifty-one percent of respondents reported alcohol abuse, measured by two or more positive responses to the CAGE assessment. Alem et al. used theFindings from the current study did not indicate a significant association between alcohol abuse and inconsistent condom use with regular, non-paying partners, and suggested alcohol abuse occurs primarily with clients in a work setting. Though alcohol abuse did appear to strengthen the effect of work-related violence on inconsistent condom use, interaction was not significant. Based on our findings, it appears that violence has a greater influence than alcohol abuse on unprotected sex with regular, non-paying partners among establishment-based FSWs in Adama City. However, the high rate of reported alcohol abuse in our sample has important health implications which should be addressed.Though not investigated in our analysis, other research has found that feelings of trust and intimacy, the desire to separate one\u2019s work from private relationships, and the perception that familiar partners are lower risk, also play a large role in FSWs\u2019 inconsistent condom use with regular, non-paying partners,39,52,53The major limitation to this study was its cross-sectional design, which did not allow causal inferences to be made regarding experiences of violence and sexual risk behavior. Additionally, the measures used were limited in several ways. Measures of work-related violence did not specify who perpetrators were and whether they included regular, non-paying partners, which would clarify the relationship between work-related violence and inconsistent condom use with these partners. Violence, condom use and alcohol abuse variables lacked time frames.Additionally, the CAGE assessment for alcohol abuse was developed for use in the U.S. and may not necessarily be a valid measure in this geographic region or population. Even within the U.S., limitations to its validity have been identified in specific populations. Though Experiences of violence are common among establishment-based FSWs in Adama City. While the impact violence has on women\u2019s immediate physical and emotional health is clear, this study suggests these experiences are associated with increased HIV risk within FSWs\u2019 regular, non-paying partnerships as well, and structural interventions to prevent violence are needed. Recommendations for HIV prevention interventions for sex workers in low- and middle-income countries released by the World Health Organization (WHO) in 2012 suggest The nature of FSWs\u2019 regular, non-paying partnerships in this context, and how such partnerships intersect with FSWs\u2019 experiences of violence and associated HIV risk should be further explored. Research may seek to further characterize regular, non-paying partnerships in this setting, such as typical numbers of regular, non-paying partners; varying partner types within this category; relationship durations; whether partnerships arose from client or supervisor relationships; and patterns of violence and socio-economic exchange within these partnerships. Additional information about these characteristics of relationships could improve understanding of associations with inconsistent condom use.Developing standardized measures for violence in various FSW populations, which would account for diverse types of violence and perpetrators, would be useful to ensure consistent interpretation by respondents, allow for comparison across studies and support a deeper understanding of the relationship between violence and inconsistent condom use among FSWs across partner types.Establishment-based FSWs in Adama City, Ethiopia experience high rates of violence and alcohol abuse. Cross-sectional analysis showed that work-related violence and higher income were associated with inconsistent condom use with regular, non-paying partners. Alcohol abuse was not associated with condom use within these partnerships, though it may strengthen the effect of violence on unprotected sex. Sex establishment working environments have been shown to affect the risk of HIV and violence experienced by FSWs in many settings. However, structural interventions to reduce violence against FSWs for HIV prevention have been rare, despite the high prevalence of violence in this population. FindingThe authors declare that they have no competing interests.AK, HMB, and EKK, designed the study. AK and HMB trained data collectors and AK managed data collection. AM conducted the statistical analysis and drafted the manuscript. CEK and DK provided input into data analysis and overall project management. All authors reviewed, edited and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/13/771/prepub"}
+{"text": "Avahan Initiative, a large-scale HIV preventive intervention targeted to high-risk populations including female sex workers (FSWs), was initiated in 2003 in six high-prevalence states in India, including Karnataka. This study assessed if intervention exposure was associated with condom use with FSWs\u2019 sexual partners, including a dose-response relationship.The Data were from a cross-sectional study (2006-07) of 775 FSWs in three districts in Karnataka. Survey methods accounted for the complex cluster sampling design. Bivariate and multivariable logistic regression was used to separately model the relationships between each of five intervention exposure variables and five outcomes for consistent condom use  with different sex partners, including with: all clients; occasional clients; most recent repeat client; most recent non-paying partner; and the husband or cohabiting partner. Linear tests for trends were conducted for three continuous intervention exposure variables.P=0.001; P=0.006) and numbers of condom demonstrations witnessed ; a dose-response relationship was also observed between condom use with all clients and number of times contacted by staff (P=0.047). Intervention exposure was not associated with higher odds of CCU with the most recent repeat client, most recent non-paying partner or with the husband or cohabiting partner.FSWs reported highest CCU with all clients (81.7%); CCU was lowest with FSWs\u2019 husband or cohabiting partner (9.6%). In multivariable analysis, the odds of CCU with all clients and with occasional clients were 6.3-fold  and 2.3-fold [95% CIs: 1.4-4.1] higher among FSWs contacted by intervention staff and 4.9-fold [95% CIs: 2.6-9.3] and 2.3-fold [95% CIs: 1.3-4.1] higher among those who ever observed a condom demonstration by staff, respectively, compared to those who had not. A significant dose-response relationship existed between each of these CCU outcomes and increased duration since first contacted by staff (Study findings suggest that exposure to a large-scale HIV intervention for FSWs was associated with increased CCU with commercial clients. Moreover, there were dose-response relationships between CCU with clients and increased duration since first contacted by staff, times contacted by staff and number of condom demonstrations. Additional program effort is required to increase condom use with non-commercial partners. Sex work-related harms are linked inextricably to the social, economic, policy, and physical environments of sex workers. Individual behaviour (high- or low-risk) both shapes and is shaped by individual and environmental factors ,2. ThereAnother large-scale intervention designed to reduce HIV infection rates among groups with high HIV risk  and groups that bridge high- and low-risk groups (clients of FSWs) is Avahan, the India AIDS Initiative ,13, whicAs part of this comprehensive evaluation framework, the objective of the current analysis was to determine if the Avahan AIDS Initiative had an impact on condom use amongst FSWs in urban areas of three districts in Karnataka State, India. HIV prevalence among FSWs was 12.7% in Bangalore district, 15.7% in Bellary and 33.9% in Belgaum in the mid-2000s . SpecifiDuring 2006-07, in-depth face-to-face interviews  were conducted with 775 FSWs in three districts in Karnataka state, located in southern India. A probability sampling method was employed, using time-location cluster sampling with normalized weights calculated to account for the complex sampling design. Sampling methods were similar to those reported by Ramesh et al  for otheaffili\u00e9 universitaire de Qu\u00e9bec (CHA), Qu\u00e9bec, Canada, and the University of Manitoba, Winnipeg, Canada. The surveys were administered face-to-face by trained interviewers in the local language (Kannada) and were conducted anonymously, with no names or personal identifiers recorded. Ethics approval was attained from the CHA and the University of Manitoba as well as St. John\u2019s Medical College.The surveys were implemented by the CHARME-India project in collaboration with the Institute of Population Health and Clinical Research (IPHCR), St John\u2019s Medical College, and the Karnataka Health Promotion Trust (KHPT), Bangalore, India, the Centre hospitalier The first outcome, CCU with all clients  during all instances of sexual intercourse in the most recent day worked was derived by dividing the reported number of instances of sexual intercourse in which condoms were used by the reported total number of instances of sexual intercourse in the most recent day worked. This was used to create a dichotomized variable of 100% versus <100% of instances of sexual intercourse in which condoms were used. The remaining four outcomes described CCU with FSWs\u2019 different sexual partners, including: commercial sex clients ; and non-commercial partners ). These outcomes were derived from survey items about general condom frequency with each type of partner (e.g. \u201cHow often do you use condoms with <this partner>?\u201d). Condom use was considered to be CCU with their partners, if they answered \u2018always\u2019, as opposed to \u2018often\u2019, \u2018sometimes\u2019 or \u2018never\u2019.We examined five variables measuring exposure to the intervention, including: if FSWs had been contacted by intervention staff; if FSWs had been given condoms by intervention staff; the duration of time since contacted by intervention staff (years), which was specific to each district and limited to the total number of years women could have been exposed to the intervention (the year/month of the start of the intervention subtracted from the year/month of the survey \u2013 1.5-2.5 years); the number of times in the past month FSWs had been contacted by intervention staff; and the number of condom demonstrations by intervention staff that FSWs had seen in the past month.Devadasi tradition, a form of temple-based sex work whereby women are dedicated through marriage to gods or goddesses) [dabha [road-side lodge-type establishment]; brothel); and public-places-based .For each model, we adjusted for social and environmental factors that may influence condom use. Social factors included age, marital status  -26, age a priori . Each single intervention variable was forced into the five different multivariable models to examine the independent relationship between intervention exposure and CCU. Two intervention exposure variables were dichotomous , while three were originally continuous . The continuous variables were categorized prior to analysis. To examine a dose-response relationship, a linear test for trends across categories for each of the three continuous intervention exposure variables and each CCU outcome was conducted. The median of each category was taken, and the exposure variable was treated as a continuous variable. Odds ratios (ORs) and adjusted odds ratios (AORs) and their 95% confidence interval [95% CIs] were reported for logistic regression and P-values were reported for the tests for trends. All P-values reported are two-sided.Statistical analysis was conducted using survey methods in SAS Version 9.1 , taking Devadasi and 56 (5.9%) were other women who were never married  of FSWs reported CCU with all clients in the most recent day worked, 530 (69.5%) women reported CCU with current occasional clients and 269 (57.5%) women reported CCU with their most recent repeat client. CCU with all clients was higher among FSWs who had ever been contacted by intervention staff compared to those who had not (84.6% versus 65.6%), as was CCU with occasional clients (71.9% versus 53.5%) Figure . The samCCU with all clients in the most recent day worked, with occasional clients and with the most recent repeat client, increased overall as the duration of time since first contact by intervention staff increased, but only steadily increased with increased duration for CCU with occasional clients Figure . CCU witIn bivariate analysis, all five intervention variables were significantly associated (on a P<0.10 significance level) with CCU with all clients in the most recent day worked and CCU with occasional clients Table , after aP=0.001, P=0.006 respectively). For both of these outcomes, significant tests for trends also indicated a dose-response relationship between CCU with all clients in the most recent day worked and CCU with occasional clients and increased numbers of condom demonstrations witnessed (P=0.004 and P=0.026 respectively). Finally, a dose-response relationship was also observed between CCU with all clients and number of times contacted by staff (P=0.047).In bivariate analysis testing for trends, CCU with all clients in the most recent day worked was significantly associated with an increased duration since first contacted by intervention staff, the number of times contacted by intervention staff, and the number of condom demonstrations seen by staff in the last month. CCU with occasional clients was significantly associated with an increased duration since first being contacted by intervention staff, and the number of condom demonstrations seen by staff in the last month. In multivariable analysis, significant tests for trends indicated a dose-response relationship between CCU with all clients in the most recent day worked and CCU with occasional clients, and increased duration since first being contacted by staff  and 354 had a husband or cohabiting partner. Overall, 68 31.1%) and 40 (9.6%) reported CCU with their most recent non-paying partner and their husband or cohabiting partner respectively . In multivariable analysis, after adjusting for social and environmental factors, none of the intervention exposure variables were significantly associated with CCU with their non-paying partner or husband or cohabiting partner Table . In bivaThe results from our analysis suggest that exposure to a large-scale HIV prevention initiative in Karnataka, India, was associated with higher reported consistent condom use (CCU) among women engaged in sex work with their commercial sex clients. After adjusting for social and environmental factors, a strong independent association was observed between CCU with all clients in the most recent day worked and CCU with occasional clients, and five measures of intervention exposure. Moreover, a significant dose-response relationship was observed between these two outcomes and increased duration since first contacted by intervention staff, as well as number of condom demonstrations seen by staff in the last month. There was also a significant dose-response relationship observed between CCU with all clients and the number of times contacted by staff in the past month. In multivariable analysis, intervention exposure was not significantly associated with increased CCU with FSWs\u2019 most recent repeat commercial client, their most recent non-paying partner or their husband or cohabiting partner.The association between increased intervention exposure and increased CCU with all clients likely reflects higher condom use with occasional clients, which constitute the majority of commercial clients in Karnataka. On a micro-level, condom use with occasional clients likely improved due to regular contact between FSWs and peer outreach workers , who were responsible for providing condoms to FSWs, giving demonstrations of correct condom use and facilitating conversations about risk and vulnerability . Of noteResults from this study are supported by other studies showing similar results. These include observational studies suggesting that condom use as reported by clients  and FSWsWhile a higher probability of CCU with all clients in the most recent day worked and occasional clients was observed for FSWs with increased exposure to the intervention, the same patterns were not observed among FSWs for CCU with their most recent repeat client, non-paying partner and their husband or cohabiting partner. Moreover, CCU with FSWs\u2019 husband or cohabiting partner decreased significantly with increasing numbers of condom demonstrations seen by intervention staff in the previous month, when testing for trends. It is not clear why this was observed, but of note, CCU with FSWs\u2019 husband or cohabiting partner was very low and the absolute proportions did not vary substantially according to the number of condom demonstrations seen (10.1% to 13.8%). The reasons for low condom use within non-commercial and regular commercial sexual partnerships of FSWs are complex. These may include power disparities that favour the male partner ,38,39, iThere are several limitations to this study. This study is based on self-reported data from cross-sectional surveys collected in three districts and is not experimental in design. This study was based on data collected only from FSWs and should be considered alongside studies that show consistent results in other populations , using other data sources to assess exposure to the intervention, and in similar settings. The condom use outcomes used in this study did not specify a timeframe. However, the questions were intended to capture recent  or current average behaviour. We relied on self-reported answers to questions that may be perceived as sensitive (e.g. consistency of condom use), and the questions are therefore susceptible to social desirability bias . This mato FSWs [The impact of increases in condom use among FSWs and their clients on the HIV epidemic in southern India should continue to be assessed. Large-scale HIV prevention programs targeted at groups with high HIV risk could in theory also have an indirect impact on HIV prevalence within general populations ; howeverto FSWs .and the patterns of sexual structure vary geographically , we would expect to observe different intervention effects across the three districts in Karnataka. CCU with non-paying partners was also much lower in Bangalore (12.8%) compared to the other two districts (45.7% and 41.6% respectively), indicating that the importance of these partnerships in this district may be more pronounced, and should be considered in this district more than others when planning interventions. Exploring the relative role of different patterns of FSW-client sexual structure and variation in the numbers of different types of partners on HIV transmission in Karnataka, India, using simulation studies, would be useful to further improve the impact of the intervention [If the intervention\u2019s influence on condom use varies by type of commercial sex client  rvention ,24,49-51In summary, study findings suggest that the exposure to a large-scale HIV preventive intervention among FSWs was associated with increased condom use with occasional clients, with a dose-response relationship, but that it did not seem to influence condom use with repeat clients, non-paying partners and with the husband or cohabiting partner. Future research should be directed toward understanding why condom use remains relatively low with non-commercial partners and new strategies should be investigated and developed specifically to increase condom use by these partners.The authors declare that they have no competing interests.KND contributed to the conceptual design of the study, conducted the study and the analysis and drafted the manuscript; MCB, CML, PV, MP and MA participated in the conceptual design of the study and coordination, made substantial contributions in the interpretation of data; JS, MWT, SM and JB made substantial contributions in the interpretation of data and critically revised the manuscript for important intellectual content; BMR, KG, SR, RW made substantial contributions to the acquisition and management of the data. All authors read and approved the final manuscript."}
+{"text": "Dicer gene, located in the 3\u2032 untranslated region (3\u2032 UTR) that is important for mRNA transcript stability. We investigated whether rs3742330 is associated with the survival in 163 TCL patients. Significant association between Dicer rs3742330 and TCL survival were found. Patients carrying the GG genotype (n\u200a=\u200a12) had a significantly increased overall survival (OS) compared with those carrying the GA and AA genotypes . Moreover, the significant association was maintained for patients with mature T type . In multivariate Cox-regression analysis, rs3742330 proved to be an independent predictor for OS, together with the commonly used International Prognostic Index (IPI) and BAFF rs9514828, another SNP we have previously reported to be associated with TCL survival, with hazard ratios (HRs) for patient death rate of 8.956  for the GA genotype and 10.145  for the AA genotype. Furthermore, we observed cumulative effects of Dicer rs3742330 and BAFF rs9514828 on TCL survival. Compared with patients carrying zero unfavorable genotype, those carrying one and two unfavorable genotypes had an increased risk of death with a HR of 7.104  and 14.932 , respectively, with a significant dose-response trend (ptrend \u200a=\u200a0.004). In conclusion, Dicer rs3742330 is associated with TCL survival, suggesting that genetic variation might play a role in predicting prognosis of TCL patients.Dicer, an endonuclease in RNase III family, is essential for the RNA interference (RNAi) pathway. Aberrant expression of Dicer has been shown in various cancers including some subtypes of T cell lymphoma (TCL), which influences patient prognosis. A single-nucleotide polymorphism (SNP) rs3742330A>G has been identified in the  BAFF, encoding a tumor necrosis factor (TNF) superfamily ligand, predict overall survival (OS) in patients with TCL T-cell lymphomas (TCL) comprise a heterogeneous group of lymphoid T-cell malignancies, which have great differences in clinical, histological and biological characteristics. The incidence of this disease shows obvious geographic variation. In North American and Europe, TCL represents only about 5\u201310% of all lymphomas. However, in Asia, 15\u201325% of lymphomas are TCL and NK-cell lymphomas Dicer gene. The SNP is located in the 3\u2032 untranslated region (3\u2032 UTR) of Dicer and the region is important for mRNA transcript stability Dicer, an endonuclease in the RNase III family that specially cleaves double-stranded RNAs, is essential for the RNA interference pathway to produce microRNA (miRNA) and small interfering RNA (siRNA) that represses gene expression Dicer gene SNP rs3742330 may play a role in prognosis of TCL. Therefore, we performed the association analysis between the Dicer rs3742330 genotypes and the survival among patients with TCL. Meanwhile, taking account of the effect of the BAFF rs9514828 genotypes We hypothesize that the Between January 1992 and October 2009, 163 patients were recruited at Southwest Hospital, the 3rd Military Medical University in Chongqing. The last date of follow-up was 17th March 2012. The endpoint of this study was OS, which was calculated from the date of TCL diagnosis to the date of death or last follow-up. All patients were diagnosed with histologically confirmed TCL and they were all genetically unrelated ethnic Han Chinese. The 163 cases of TCL were composed of 43 peripheral T-cell lymphoma not otherwise specified (PTCL-NOS) cases, 40 NK/T cell lymphoma (NKTCL) cases, 30 anaplastic large-cell lymphoma (ALCL) cases, 29 T-lymphoblastic lymphoma/leukemia (T-ALL/LBL) cases, 10 angioimmunoblastic T-cell lymphoma (AITL) cases, 4 subcutaneous panniculitis-like T-cell lymphoma (SCPTCL) cases, 3 mycosis fungoides (MF) cases, 2 enteropathy-type intestinal T-cell lymphoma (EITTL) cases and 2 Lenert's lymphoma cases. The majority of the patients were treated with CHOP -based regimen as the first-line chemotherapy. The staging of the tumor was assessed according to the Ann Arbor system Genomic DNA was extracted from peripheral blood with the RelaxGene Blood DNA System according to the manufacturer's protocol  and stored at \u221280\u00b0C until used.Dicer rs3742330 and BAFF rs9514828 genotypes were determined by polymerase chain reaction (PCR)-based restriction fragment length polymorphism method. The primers used to amplify the DNA fragment for rs3742330 were 5\u2032-GCTTCAATCTTGTGTAAAGGGATTCG-3\u2032 (forward) and 5\u2032- GCACTGCAGAGGATCACTGGAA-3\u2032 (reverse), and the primers used for rs9514828 were 5\u2032-CAGAGTTCTGAGGCTTTAAGTCCGC-3\u2032 (forward) and 5\u2032-GGCACAGTCAACATGGGAGTTG-3\u2032 (reverse). The PCR products were digested with restriction enzyme TaqI and BstUI  respectively. The digested products were separated by 3% agarose gel electrophoresis and genotypes were determined by using a gel imaging system. Genotyping of each sample was performed by two different persons, and the results were 99.6% concordant.Dicer genotypes was tested for Hardy-Weinberg equilibrium. Patient characteristics were compared between the three Dicer rs3742330 genotype groups using the \u03c72 test for dichotomous data and the Kruskal-Wallis test for continuous data. Kaplan-Meier curves and the log-rank test were used to evaluate the association of Dicer rs3742330 and BAFF rs9514828 genotypes with OS. Stepwise multivariate Cox-regression model was applied to analyze the independent effects of gender, subtype, IPI, BAFF rs9514828 and Dicer rs3742330 genotypes on OS. Hazard ratios (HRs) and their 95% confidence intervals (CIs) on the risk of death were calculated from the Cox-regression model including all the above factors for multivariate analysis or the indicated factor for univariate analysis. Three different genetic model, including dominant model , recessive model , and additive model (p for trend) were tested and the one that yielded the smallest p value was ultimately applied to analyze data. Stratified analysis by TCL subtype (precursor T type versus mature T type) was performed to investigate the association of Dicer rs3742330 genotypes with OS in the subsets of TCL subtypes.All statistical analyses were performed using SPSS for Windows version 20 . The distribution of Dicer rs3742330 and BAFF rs9514828 genotypes on TCL survival were assessed by counting the numbers of unfavorable genotypes in each subject. We categorized each subject into low-, medium-, and high-risk groups. Using the low-risk group as the reference group, HRs and their 95% CIs for the medium-risk and high-risk groups were calculated using stepwise multivariable Cox-regression model adjusted for gender, subtype and IPI. We performed survival tree analyses with recursive partitioning to explore the potential high-order gene-gene interactions and to identify subgroups of patients at higher risk of death using the STREE program  The cumulative effects of Dicer rs3742330 genotype are described in The basic clinical characteristics in all patients and by Dicer rs3742330 genotype distribution is displayed in Dicer rs3742330 genotype with OS in these TCL patients using Kaplan-Meier curves. When the three GG, GA, and AA genotypes were regarded separately in Kaplan-Meier curve, no significant differences in OS were found .By the time of final analysis on 17th March 2012, 71 (43.6%) of the 163 patients had died of TCL. We explored the association of Dicer rs3742330 genotypes with OS in the subsets of TCL subtypes, we performed stratified analyses based on TCL subtypes (precursor T type versus mature T type). The association remained significant in 134 patients with mature T type  increased risk of death, whereas the high-risk group with two unfavorable genotypes was at a 14.932-fold  increased risk , 48 months for terminal node 2 , and 96 months for terminal node 3   of death compared with the GG genotype, with approximately 9 times increased risk  of death in patients with the GA genotype. Identification of this significant prognostic factor may be of great value in predicting individual patient having poorer outcomes once the diagnosis is made. In addition, we found no association between rs3742330 genotypes and clinical characteristics of patients at first diagnosis, including gender, age, subtype, LDH level, ECOG PS, stage, number of extranodal involvement site and IPI. This may be one reason why genotypes of the SNP remained an independent prognostic factor for OS both in univariate and multivariate Cox-regression analysis.TCL are uncommon malignancies Growing evidence indicated that miRNAs play an important role in the genesis and progression of human cancers. A global alteration of miRNAs expression profiling has been shown in various human cancers Dicer is essential for the production of mature miRNAs through cleaving the double-strand miRNAs precursor (pre-miRNAs) Dicer gene is unclear. The SNP rs3742330 which is the object of our study has been identified in Dicer gene. The SNP is located in the 3\u2032UTR, a region that is important for Dicer mRNA stability. It has been identified as the target site of two miRNAs that are has-miR-3622a-5p Aberrant miRNAs expression, observed in various cancers, may be partially secondary to abnormal Dicer expression BAFFDicer rs3742330 remained an independent prognostic variable in multivariate Cox-regression analysis after adjusting for factors including rs9514828 in BAFF. Furthermore, we assessed the cumulative effects of the two SNPs on TCL survival by counting the number of unfavorable genotypes. We observed a trend toward an increased risk of death with an increasing number of unfavorable genotypes. Moreover, we performed survival tree analyses to explore the interaction effects of the two SNPs on death risk. We found a high-order interaction between the two SNPs and identified subgroups of patients with different survival outcome based on SNP genotype combinations. These results suggest that the clinical development of TCL may be a polygenic process and that prediction model that considers multiple factors may obtain higher predictive power.BAFF, also known as B cell activating factor, is a key cytokine involved in the activation and survival of B and T cells Dicer SNP rs3742330 is associated with the survival of TCL patients, suggesting this genetic variation may play a role in the prognosis of TCL patients. Nevertheless, it must be emphasized that because of a limited number and a mixed collection of various subtypes of TCL, the results in our study clearly warrant further investigations. In addition, the underlying mechanisms by which rs3742330 affects prognosis are still unclear and needs further study.In summary, we demonstrated that the Figure S1The genomic region containing rs3742330 and its neighboring features. S1A: Target miRNA regulatory sites. S1B: Transcription factor binding sites. S1C: DNA methylation sites. S1D: Histone modification sites.(TIF)Click here for additional data file.Figure S2Overall survival according to Dicer rs3742330 genotypes. AA, wild-type; GA, heterozygous variant; GG, homozygous variant.(TIF)Click here for additional data file."}
+{"text": "CP001 is four traditional herbal medicine mixtures with anti-inflammatory properties. In this study, we investigated the effect of oral administration of CP001 ethanol extract on the 2,4-dinitrochlorobenzene- (DNCB-) induced AD mouse models. For that purpose, we observed the effects of oral administration of CP001 on skin inflammatory cell infiltration, skin mast cells, production of serum IgE, and expression of Th2 cytokine mRNA in the AD skin lesions of DNCB treated BALB/c mice. Histological analyses demonstrated that CP001 decreased dermis and epidermis thickening as well as dermal infiltration induced by inflammatory cells. In addition, CP001 decreased mast cell infiltration in count as well as dermal infiltration induced by inflammatory cells. In the skin lesions, mRNA expression of interleukin- (IL-) 4 and IL-13 was inhibited by CP001. CP001 also reduced the production of IgE level in mouse plasma. In addition, we investigated the effect of CP001 on the inflammatory allergic reaction using human mast cells (HMC-1). In HMC-1, cytokine production and mRNA levels of IL-4, IL-13, IL-6, and IL-8 were suppressed by CP001. Taken together, our results showed that oral administration of CP001 exerts beneficial effects in AD symptoms, suggesting that CP001 might be a useful candidate for the treatment of AD. Atopic dermatitis (AD) is a most common chronic inflammatory skin disease, affecting about 10 million people in the world, leading to a significant reduction in quality of life, and its incidence is continuously increasing in westernized countries . The pat\u03b5R [Mast cells are tissue-based inflammatory cells of bone marrow origin, which respond to signals of innate and adaptive immunity. They play a major role in immediate hypersensitivity reaction and are activated through the high-affinity IgE receptor, Fc\u03b5R . In addi\u03b5R . Mast ce\u03b5R .Proinflammatory cytokines that are released by activated mast cells, including IL-6 and IL-8, play an important role in allergic inflammation ; IL-6 me Houttuynia cordata Thunb, Rehmannia glutinosa Libosch, bark of Betula platyphylla var. japonica, and Rubus coreanus Miq. Houttuynia cordata Thunb has long been used in traditional oriental medicine for the treatment of inflammatory diseases. Also, several studies demonstrated that Houttuynia cordata Thunb has been associated with a broad range of pharmacological activities, including anti-inflammatory [ Rehmannia glutinosa Libosch has traditionally been used as an ingredient herb in East Asian medicine for the effects of hemostasis, activation of blood circulation, and improvement of kidney function [ Rehmannia glutinosa Libosch has antiallergic effects [ Betula platyphylla var. japonica is known to have antioxidant, anti-inflammatory, and anticancer effects [ Rubus coreanus Miq. is a type of red raspberry that grows wild in Korea, Japan, and China. The fruit, known as \u201cBokbunja\u201d in Korean, has been used in traditional oriental medicine for reducing the risk of diseases such as asthma and allergy. It is also known that Rubus coreanus Miq. has anti-inflammatory and antioxidative activities [CP001 is a mixture of four oriental herbal medicines composed ofammatory , and antammatory . Rehmannfunction . Several effects  and anti effects \u201317. Betu effects  and inhi effects , 20. Rubtivities \u201323. ThesTherefore, in this study, we investigated whether 30% ethanol extract of CP001 oral administration has anti-inflammatory activity in 2,4-dinitrochlorobenzene- (DNCB-) induced AD mice model. In addition, we also investigated whether 30% ethanol extract of CP001 has antiallergic effect inhibiting cytokine production in human mast cells, HMC-1. Houttuynia cordata Thunb, Rehmannia glutinosa Libosch, bark of Betula platyphylla var. japonica, and Rubus coreanus Miq. The powder from the extract was dissolved in distilled water for in vivo and in vitro experiments.CP001 was prepared by Hanpoong Pharmaceutical  following good manufacturing practices (GMP) procedure. CP001 is 30% ethanol extracted brown-colored powder, and it is composed ofSix-week-old male BALB/c mice were purchased from Orient . The mice were randomized into 6 groups ), each comprising five mice. All mice were kept under pathogen-free environment and allowed free access to the diet and water. All procedures performed on the mice were approved by the animal care center of Kyung-Hee University -2012-004).\u03bcL of a 1% DNCB using 1 \u00d7 1\u2009cm patches after shaving. Two weeks after sensitization, the back skin was challenged with 200\u2009\u03bcL of a 0.2% DNCB solution twice per week. This procedure was repeated for 2 weeks and CP001 was orally administrated together. At the end of the experiment, mice were sacrificed by CO2 inhalation, and samples were collected.Induction of AD-like skin lesions procedure is described in \u03bcm were cut and stained with hematoxylin and eosin (H & E) for inflammatory cells or with toluidine blue for mast cells counts and examined under light microscopy (Olympus). Mast cells were counted in 10 parts of high-power fields (HPF) at 400x magnification.A portion of the skin biopsies were fixed in 4% paraformaldehyde (PFA) and embedded in Tissue-Tek optical cutting temperature (O.C.T.) compound  on dry ice. Skin sections of 20\u20092SO4 solution was added to stop the reaction. Optical densities were measured at 450\u2009nm on an automated ELISA reader . IL-6 and IL-8 levels were measured in HMC-1 supernatant by sandwich ELISA using BD Pharmingen human ELISA set. The sandwich ELISA procedures were performed by following the same protocols described above.After final CP001 administration, whole blood samples were collected by cardiac puncture for measurement of blood IgE level. The blood was placed in Vacutainer tubes containing EDTA  and blood plasma was isolated. Total IgE levels in plasma were determined by sandwich ELISA using the BD PharMingen mouse IgE ELISA set. Briefly, plates were coated with capture antibody in ELISA coating buffer (Sigma-Aldrich) and incubated overnight at 4\u00b0C. Plates were washed with PBS-Tween 20 (0.05%) and subsequently blocked (10% FBS in PBS) for 1\u2009h at 20\u00b0C. Serial dilutions of standard antigen or sample in dilution buffer (10% FBS in PBS) were added to the plates and plates were incubated for 2\u2009h at 20\u00b0C. After washing, biotin-conjugated anti-mouse IgE and SAv-HRP (streptavidin-horseradish peroxidase conjugate) were added to the plates and plates were incubated for 1\u2009h at 20\u00b0C. Finally, tetramethylbenzidine (TMB) substrate solution was added to the plates and after 15\u2009min incubation in the dark, a 2\u2009N HMice skin was immediately frozen in liquid nitrogen and kept at \u221270\u00b0C until use. For real-time PCR assay, mice skin was homogenized with Ultra-Turrax T10  and RNA extraction was performed using TRIzol . RNA content was measured using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.). 1\u2009g of total cellular RNA from each sample was reverse transcribed using cDNA synthesis kit . Quantitative PCR was performed using SYBR green iMaster and a LightCycler 480 .\u03bcg of total cellular RNA from each sample was reverse transcribed using cDNA synthesis kit . PCR was conducted out in a 20\u2009\u03bcL reaction mixture consisting of DNA template, 10 pM of each gene-specific primer, 10x Taq buffer, 2.5\u2009mM dNTP mixture, and 1 unit of Taq DNA polymerase . PCR was performed using the specific primer and primer sequences for human IL-6, IL-8, and GAPDH are shown in Cells were harvested by centrifugation and the pellet was washed with ice-cold PBS. RNA was isolated from the pellet using easy-blue RNA extraction kit  according to the manufacturer's instructions. Isolated RNA content was measured using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.). 2\u2009\u03bcm membrane filter. A 10\u2009\u03bcL aliquot of the sample solution was injected into a HPLC system . The sample was analyzed on a Capcell Pak UG120 C18 analytical column .Ellagic acid, quercitrin hydrate, and catalpol were purchased from Sigma Chemicals . Purity of standard compounds was guaranteed to be higher than 95% by HPLC. HPLC grade acetonitrile, methanol, and formic acid were purchased from J. T. Baker . Catalpol, ellagic acid, and quercitrin were chosen as Marker compounds to standardize the extract sample. CP001 was dissolved in distilled water at a concentration of 100\u2009mg/mL and the solution was filtered through a 0.45\u2009 t-test. P value < 0.05 was considered statistically significant.Statistical analyses presented as the mean \u00b1 standard error of the mean (SEM) and were analyzed for statistical significance using the unpaired Student'sTo determine whether CP001 decreases infiltration of inflammatory cells into AD-like skin lesions, we performed H & E staining on the skin after oral administration of CP001. We observed infiltration of inflammatory cells into the epidermis and dermis in DNCB group, whereas CP001 decreased such infiltration of inflammatory cells into the skin . MoreoveThe Th2 type cytokines are important in an acute phase of AD whereas mixed Th2/Th1 type inflammation is characteristic to a chronic phase of AD. To determine whether CP001 decreases Th2 type cytokines expression, we performed real-time PCR to measure IL-4 and IL-13 levels. We found that oral administration of CP001 decreased IL-4 mRNA expression in AD-like skin lesions . We alsoHyperproduction of IgE is a major characteristic of AD and patients with AD often exhibit elevated levels of total and allergen specific IgE antibodies (Abs) in their serum. To further test whether suppression of the progression of AD-like skin lesions by CP001 is associated with serum IgE levels, we performed total IgE ELISA assay. We found that total IgE levels were dramatically elevated in DNCB-treated group compared with normal group. However, increased serum IgE levels induced by DNCB were significantly decreased by CP001 treatment .Next, we investigated whether CP001 affects production of IL-6 and IL-8 in HMC-1. For that purpose, mast cells were pretreated with various concentrations of CP001 for 1\u2009h and then treated with PMA and A23187 for 24\u2009h. The levels of IL-6 and IL-8 in culture supernatants were measured by ELISA assay. We found that IL-6 secretion induced by PMA and A23187 was significantly suppressed by CP001 Figures . We alsoCP001 administration decreased IL-4 and IL-13 mRNA expression in AD-like skin lesions . TherefoTo further evaluate the effective compounds of CP001 extract, HPLC analysis was employed. In order to analyze catalpol, the mobile phase consisted of water (W) and methanol (M) and the flow rate was 1\u2009mL/min. The gradient elution program was used as follows. The initial composition of the mobile phase was 97\u2009:\u20093 (W\u2009:\u2009M), which was linearly changed to 95\u2009:\u20095 (W\u2009:\u2009M) over 1\u2009min and changed to 91\u2009:\u20099 (W\u2009:\u2009M) for 9\u2009min. At 11\u2009min, the composition of mobile phase returned to the initial condition, which was maintained for 9\u2009min for column reequilibration. Chromatograms were acquired at 210\u2009nm by UV detection . For ellAD is a chronic inflammatory disease, which is accompanied by erythema, edema, and scaling in AD skin lesions . RecentlGenerally, steroid therapy is used for AD treatment, but it cannot be administrated over the long term because of the many side effects. Therefore, we find a new drug, which is effective in the treatment of AD without any side effects. Recently, we reported that topical application of KM110329 (CP001 modified drug) reduced ovalbumin- and DNCB-induced atopic dermatitis . TherefoMast cells degranulation can be regulated by the recruitment, trafficking, and function of inflammatory response. For example, IL-4 and IL-13 induce cell adhesion molecules on endothelium which can be recruitment of leukocytes \u201329. AlsoIgE is mediator of mast cell activation and we observed that CP001 oral administration reduced elevated blood IgE levels induced by repeated DNCB sensitization.CP001 also suppressed IL-6 secretion and elevated IL-6 and IL-8 mRNA expression induced by PMA and A23187 in HMC-1. It seems that the reduction of infiltration of mast cells is related to decrease of degranulation of mast cells and maturation of eosinophils suppressing the release of various inflammatory cytokines.Our present study clearly demonstrates that CP001 suppresses the progression of AD induced by DNBC. In addition, inflammatory related cytokine production and mRNA levels of IL-4, IL-13, IL-6, and IL-8 were suppressed by CP001. This suggests that CP001 might be a useful candidate for the treatment of AD."}
+{"text": "Although a substantial proportion of individuals with schizophrenia fail to respond to first-line dopaminergic blocking medications and are Treatment Resistant (TR), identifying these subjects prospectively remains challenging. Though clinically defined only after multiple treatment trials, TR is suspected to reflect a stable neurobiological phenomenon that can be identified even at the first episode of schizophrenia (FES). Establishing clear expectations for symptom improvement following antipsychotic initiation would facilitate development of objective thresholds for determining lack of efficacy. The Treatment Response and Resistance in Psychosis  working group has recently published consensus guidelines which define lack of response as a <20% improvement in psychotic symptoms. However, given that most patients with FES respond robustly to antipsychotics , FES specific criteria for prospective identification of TR are warranted. We examined two symptom improvement thresholds across positive and negative symptom domains at 6 months in FES to investigate poor response (PR) as a proxy measure of early TR. We then examined the baseline/early clinical features that best prospectively predicted PR+ status. Given the estimated prevalence of TR is approximately 33%, we hypothesized that a comparable number  of individuals with FES would meet PR criteria using less a 50% response threshold, rather than a more stringent 20% threshold for determining symptomatic response. Furthermore, we hypothesized that very early lack of response would be associated with PR at 6 months.Data from a longitudinal naturalistic cohort study of patients treated at the Prevention and Early Intervention Program for Psychosis (PEPP) in London, Ontario, Canada collected between 2002 and 2007 were used for this analysis. Only individuals meeting criteria for a primary psychotic disorder that were medication compliant were included. Positive and negative symptoms of psychosis were assessed using the SAPS  and SANS  at baseline, and at months 1, 2, 3, and 6. Treatment was administered in a naturalistic setting and followed clinical guidelines for the treatment of FES.Applying a 20% and 50% symptom improvement threshold for defining PR resulted in 2.2% and 14% rates for positive symptom PR, 33% and 60.9% rates of negative symptom PR, and 12% and 37.0% rates of total symptom PR at 6 months. Logistic regression analyses demonstrated that poor premorbid functioning, having a longer duration of untreated illness, and limited overall treatment response at months one and two were significantly associated with being PR+  at 6 months.This is the first study to our knowledge to investigate the symptom response thresholds suggested by TRIPP in FES. Our results suggest that including negative symptoms  is necessary to identify the expected proportion of TR subjects prospectively in a FES sample. We propose that failing to achieve at least a 50% improvement in total symptoms, or at least 20% change in negative symptom severity by 6 months may be an early clinical indicator of eventual TR. On an optimistic note, we speculate that it may be possible to determine clozapine-eligibility as early as 6 months by using this approach. However, further studies are warranted to investigate the utility of this symptom threshold criteria in larger samples of patients with FES."}
+{"text": "In the phase 3 METEOR trial (NCT01865747), cabozantinib significantly improved progression-free survival, overall survival, and objective response rate compared with everolimus in patients with advanced renal cell carcinoma (RCC) after prior antiangiogenic therapy. A statistically significant improvement in overall survival was observed at a second interim analysis with 320 recorded deaths.658 patients with advanced RCC who had received at least one prior VEGFR tyrosine kinase inhibitor were randomised 1:1 to cabozantinib (60\u2009mg daily) or everolimus (10\u2009mg daily). Survival follow-up continued to reach the 408 deaths that were pre-specified for the final analysis.P\u2009=\u20090.0002). Safety profiles of cabozantinib and everolimus were consistent with those reported previously.With 430 deaths (198 for cabozantinib and 232 for everolimus), median overall survival was 21.4 months with cabozantinib and 17.1 months with everolimus (HR 0.70, 95% CI 0.58\u20130.85; Cabozantinib significantly improved overall survival compared with everolimus in previously treated patients with advanced RCC with consistent results after long-term follow-up. Differences in overall survival were statistically significant with a median of 21.4 months with cabozantinib versus 16.5 months with everolimus . Subgroup analyses of overall survival were consistent with results for the overall population. We report results for overall survival and updated safety after follow-up was continued to reach the number of deaths pre-specified for the final analysis.Cabozantinib is an oral inhibitor of tyrosine kinases including MET, vascular endothelial growth factor (VEGF) receptors, and AXL.3 Eligible patients were 18 years of age or older with advanced or metastatic clear-cell RCC and measurable disease per Response Evaluation Criteria in Solid Tumors (RECIST version 1.1).4 Patients must have received at least one prior VEGFR tyrosine kinase inhibitor (TKI) and must have progressed within 6 months of their most recent VEGFR TKI and within 6 months of randomisation. A Karnofsky performance status of at least 70 was required.METEOR is a randomised, open-label, phase 3 trial with patients enrolled at 173 centres in 26 countries.Patients were randomised 1:1 to cabozantinib (60\u2009mg once daily) or everolimus (10\u2009mg once daily). Randomisation was stratified by Memorial Sloan Kettering Cancer Center (MSKCC) risk group and number of prior VEGFR TKIs (1 versus 2 or more). Dose reduction levels to manage adverse events were 40 and 20\u2009mg for cabozantinib and 5 and 2.5\u2009mg for everolimus. To maximise the ability to evaluate the effect of study treatment on overall survival, treatment crossover was not allowed in the study. The study was conducted according to the Good Clinical Practice guidelines and the Declaration of Helsinki. The protocol was approved by the institutional review board or ethics committee at each centre, and written informed consent was obtained for all patients.3 After determination of the primary endpoint, tumour scans were no longer centrally collected nor analysed in aggregate. Safety, including adverse events, was evaluated every 2 weeks for the first 8 weeks and every 4 weeks thereafter until treatment discontinuation. Adverse events were graded according to Common Terminology Criteria for Adverse Events version 4.0. Patients were followed for overall survival every 8 weeks. Information on subsequent anticancer therapy was also collected.The primary endpoint of progression-free survival and secondary endpoints of overall survival and objective response rate and safety have been reported previously.P\u2009=\u20090.0003; critical P-value\u2009\u2264\u20090.0163).3 Follow-up was continued to reach the 408 deaths pre-specified for the final analysis to collect long-term survival data.Overall survival was analysed in all 658 randomised patients. For overall survival, 408 deaths were required to detect a HR of 0.75  with a hypothesised improvement in median survival from 15 months to 20 months and one planned interim analysis to be conducted at the time of the primary endpoint analysis of progression-free survival. The first planned interim analysis did not meet the criteria for significance defined by the Lan-DeMets O\u2019Brien-Fleming alpha spending function. However, the criteria for significance for rejection of the null hypothesis was met at a second interim analysis conducted with a prospectively defined cutoff date of 13 December 2015 and a minimum follow-up of 13 months  with a median age of 62 years. Forty-six percent of patients were in the favourable risk category, 42% in the intermediate risk category, and 13% in the poor risk category as defined by MSKCC prognostic criteria for RCC.A total of 658 patients were randomised from August 2013 to November 2014 (330 to cabozantinib and 328 to everolimus). Baseline characteristics were balanced between treatment arms.P\u2009=\u20090.0002)  of patients in the cabozantinib group and 2.4% (8/328) of patients in the everolimus group remained on study treatment. The minimum follow-up was 22 months, median follow-up was 28 months , and 430 deaths were recorded (198 for cabozantinib and 232 for everolimus). Analysis of overall survival showed a significant improvement for cabozantinib compared with everolimus: median overall survival was 21.4 months with cabozantinib and 17.1 months with everolimus  for cabozantinib-treated patients versus 4.4 months  for everolimus-treated patients. Dose reductions due to adverse events were implemented in 64% of cabozantinib-treated patients and 25% of everolimus-treated patients. The median average daily dose was 42.8\u2009mg for cabozantinib and 9.1\u2009mg for everolimus. Discontinuation due to adverse events occurred for 43 (13%) cabozantinib-treated patients and 35 (11%) everolimus-treated patients.All patients in the cabozantinib group and all but one patient in the everolimus group experienced an adverse event of any grade irrespective of causality; grade 3 or 4 adverse events were experienced by 71% of cabozantinib-treated patients and 61% of everolimus-treated patients  compared with 21.4 months with cabozantinib and 16.5 months with everolimus (HR 0.66) at the earlier analysis.5 In the nivolumab study, long-term survival data at 3 years showed a HR of 0.74 (95.45% CI 0.63\u20130.88).6The PD-1 checkpoint inhibitor nivolumab has also shown a benefit in overall survival in a similar patient population when compared with everolimus.5 was similar in both treatment groups.A possible limitation of analysing survival outcomes with longer follow-up is that increased use of subsequent systemic therapy may confound the results. The percent of patients who received subsequent systemic therapy was similar in the two treatment groups; however, the type of subsequent therapy received differed. Patients in the cabozantinib group more frequently received subsequent everolimus, while patients in the everolimus group more frequently received subsequent therapy with VEGFR TKIs. Importantly, subsequent therapy with the PD-1 checkpoint inhibitor nivolumab, which has demonstrated prolongation of overall survival in this patient population,2 with similar reported incidences of adverse events, dose reductions, and discontinuations due to adverse events. The similar results reflect both the reduced number of patients on study treatment and continued tolerability for those remaining on treatment.The safety profiles of cabozantinib and everolimus were consistent with those reported previously,Cabozantinib significantly improved overall survival compared with everolimus in previously treated patients with advanced RCC with a consistent benefit after long-term follow-up."}
+{"text": "Protein synthesis underpins much of cell growth and, consequently, cell multiplication. Understanding how proliferating cells commit and progress into the cell cycle requires knowing not only which proteins need to be synthesized, but also what determines their rate of synthesis during cell division. Experiments with proliferating populations of microbial strains, animal or plant cell lines, have rigorous expectations. Under the same culture conditions, cells ought to have the same properties and composition in every single experiment. The basic \u201cmetrics\u201d of proliferating cells remain constant, even after many rounds of cell division 11144567Saccharomyces cerevisiae, the protein content ranges from 35% to 44% of all macromolecules, depending on culture conditions 1011Proteins are often the most abundant macromolecules in proliferating cells. For example, in steady-state cultures of the budding yeast S. cerevisiae. The discussion centers on un-perturbed, continuously dividing cells, and the impact of genetic, nutritional or chemical perturbations.In the following sections, we discuss the interplay of protein synthesis and cell division. Examples of translational control in embryonic and meiotic cell divisions have been covered comprehensively elsewhere 14In animal cells, protein synthesis is much lower in mitosis than in other cell cycle phases 16171520212221229242527213233An exponential mode of protein synthesis and growth is consistent with the existence of active mechanisms that sense some growth metric, perhaps somehow related to protein synthesis 6456729363845The rate of synthesis of any given protein depends on not only the concentration but also the translational efficiency of its mRNA. Discrepancies between the two parameters underpin translational control. It is often stated that control of translation in eukaryotic cells is exercised mainly at the initiation step, when ribosomes are recruited to mRNA 404041cell division cycle (cdc) genetic screens yielded mutants carrying temperature-sensitive, hypomorphic alleles of translation initiation factors, which did not display a random arrest at their non-permissive temperature. Instead, cells carrying cdc33 (encoding mRNA cap binding protein and translation initiation factor eIF4E 45cdc63 (encoding the b subunit of translation initiation factor eIF3 47354649mes1) mutant also arrests in the G1 phase of the cell cycle 7TetO promoter alleles for essential genes et al. showed that inhibiting expression of eIF2a, eIF4A, eIF2b, eIF3i, or eIF1 resulted in G1 arrest in yeast  pathway. How the TOR pathway activates initiation of translation and overall protein synthesis has been reviewed elsewhere 53555340404153CLN3 mRNA with that of UBI4, which is efficiently translated when TOR function is low CLN3 did not arrest in G1 when TOR function was inhibited by rapamycin CLN3 enabled G1 arrested cdc33 cells, in which the activity of the eIF4E is impaired (see Table 1), to initiate cell division CLN3 mRNA in cytoplasmic foci, may inhibit translation of CLN3CLN3 mRNA 8CLN3 allowed cells growing in poor medium, with glycerol as the source for carbon, to accelerate completion of START CLN3CLN3 was up-regulated 655861624363CLN3 is a translational target, there is no evidence yet that it is targeted in a periodic manner in the cell cycle, in G1 or any other cell cycle phase.The above examples suggest that translation initiation goes hand-in-hand with G1 progression and initiation of cell division. By and large, however, they do not answer how this is brought about. What are the relevant proteins important for G1 transit, whose synthesis is sensitive to limitations in translation initiation, and how do these proteins impinge on the machinery of cell division? In the case of the G1 cyclin Cln3p was mentioned above, Hall and colleagues replaced the long 5\u2019-UTR of the yeast CLN3 transcription oscillates early in the cell cycle 67CLN3. The data from Thorburn et al.et al.71CLN3 mRNA cannot possibly be the only physiological target of translational control for cell cycle progression. Cells lacking Cln3p are viable 65It has been reported that Kip1 in human cells, whose translation appears to be periodic in the cell cycle, decreasing at the G1/S transition 73747576Kip1 is complex, involving both cap-dependent and independent mechanisms 75Kip1 synthesis decreases at the G1/S transition, this case of translational control cannot account for the postulated activating role of protein synthesis in triggering cell division. Other reported translational targets include the G1 cyclin D1 in mammals 7879In other systems, the best example of a translational target important for initiation of mitotic cell division is the cyclin-dependent kinase inhibitor p27After the initiation step, the rate of translation depends on the concentration and activity of translating ribosomes that elongate the nascent polypeptides. If elongation of protein synthesis is inhibited, then what are the consequences on cell cycle progression? This question was first tackled pharmacologically, monitoring cell cycle progression in the presence of varying doses of cycloheximide 3585873535859090Ribosomes are the complex macromolecular machines that catalyze protein synthesis. Hence, changing the concentration of functional ribosomes in the cell is expected to change the overall rates of protein synthesis.Bacterial cells grown under conditions that favor fast growth and proliferation  have more ribosomes than those propagated in \"poor\" media In budding yeast, although protein synthesis rates decrease with decreasing growth rates, there is no proportional decrease in the number of ribosomes per cell 96 sfp1\u0394 cells 7189sfp1\u0394 cells and the smaller overall size of ribosomal protein mutants led Tyers and colleagues to propose that ribosome biogenesis inhibits START in wild type cells 66104109promotes initiation of cell division in budding yeast.In cycling, unperturbed yeast cells, synthesis of ribosomal components is not cell cycle dependent 102210271INITIATE TO START? above), there are no systematic surveys of mRNAs that are translated differentially in the cell cycle in ribosomal protein mutants.Even when there is a G1 delay due to loss of a ribosomal protein, G1 variables such as birth and critical size of cells lacking individual ribosomal proteins are not uniform, differing qualitatively and quantitatively 104109104112113114For the ribosome to elongate at its maximal rate, all its substrates must be present at saturating concentrations. This includes the aminoacyl-tRNAs and the various elongation factors Translation elongation rates may be affected by several parameters 42119121122123124125The examples outlined above illustrate how alterations in the supply and demand for each tRNA could impact translation rates. The pertinent question for this review, however, is whether such mechanisms could lead to translational control during the cell cycle. Remarkably, a recent study proposed exactly that kind of regulation, based on codon usage Implicit in the discussion of all the examples mentioned above is the notion that cell growth and protein synthesis drive cell cycle progression, not the other way around. This is generally the case, established in classic and particularly lucid experiments by Hartwell and colleagues 45134The role of protein synthesis and translational control has a long history in the cell cycle field. The pioneering experiments of decades ago were incisive, but also largely descriptive. Since then, progress has been incremental and focused on a limited number of putative mRNA translational targets. Identifying all the mRNAs that are under periodic translational control in cycling cells is an obvious and necessary goal. Given the transformative methodologies now available and the current pace of progress, it is only a matter of time before we know how protein synthesis drives cell cycle progression."}
+{"text": "Postural instability in Parkinson\u2019s disease (PD) is characterized by impaired postural responses to transient perturbations, increased postural sway in stance and difficulty transitioning between tasks. In addition, some studies suggest that loss of dopamine in the basal ganglia due to PD results in difficulty in using proprioceptive information for motor control. Here, we quantify the ability of subjects with PD and age-matched control subjects to use and re-weight sensory information for postural control during steady-state conditions of continuous rotations of the stance surface or visual surround. We measure the postural sway of subjects in response to a pseudorandom, surface-tilt stimulus with eyes closed, and in response to a pseudorandom, visual-tilt stimulus. We use a feedback control model of the postural control system to interpret our results, focusing on sensory weighting as a function of stimulus amplitude. We find that subjects with PD can re-weight their dependence upon sensory information in response to changes in surface- or visual-stimulus amplitude. Specifically, subjects with PD behaved like age-matched control subjects by decreasing proprioceptive contribution to stance control with increasing surface-tilt amplitude and decreasing visual contribution with increasing visual-tilt amplitude. However, subjects with PD do not decrease their reliance on proprioception as much as age-matched controls for small increases in surface-stimulus amplitudes. Levodopa medication did not affect sensory re-weighting behaviors for postural control. The impairment in PD subject\u2019s ability to respond differently to small changes in surface rotation amplitudes is consistent with an increased threshold for perceiving proprioceptive signals, which may result from decreased signal-to-noise in the dopaminergic pathways associated with sensory processing and/or sensory integration. Evidence suggests that the basal ganglia are involved in processing and integrating sensory information  approved the protocol for this experiment, and all subjects gave informed consent prior to participating. Eight subjects with PD  and eight healthy, age-matched controls  were recruited from the Balance Disorders Laboratory database and the Parkinson\u2019s Center of Oregon Clinic at OHSU.Subjects with PD were selected based on the following inclusion criteria: (1) a diagnosis of idiopathic PD; (2) levodopa responsive, as demonstrated by a lower score on the Unified PD Rating Scale (UPDRS) motor examination when on anti-Parkinsonian medication compared to off medication; and (3) the ability to stand unsupported for 5 min both on and off medication. Subjects with PD were excluded if they had other neurological, sensory, or muscular disorders .p = 0.79), height (p = 0.96), or weight (p = 0.71). Additional selection criteria for control subjects were: (1) no known neurological, sensory, or muscular problems; and (2) the ability to stand unsupported for 5 min. Off), except Subject 1, either had a Hoehn and Yahr score of three or greater or showed impaired balance control in response to a backwards pull on the shoulders [part of the postural instability and gait (PIGD) sub-score of the UPDRS].Control subjects were selected so that no significant differences existed between subjects with PD and controls in age  that were part of a previously published study Peterka, .We used a custom-built, balance-testing device for the experiments Peterka, . The devEach experiment consisted of six blocks of trials: (1) a calibration trial, (2) surface-stimulus trials, (3) a sway-referenced trial, (4) visual-stimulus trials, (5) a quiet-stance trial, and (6) surface-stimulus trials (repeat). Control subjects performed the experiment once, and subjects with PD performed the experiment twice: once on and once off medication. For off-medication testing, subjects were tested at least 12 h after their last dose of anti-Parkinsonian medication. Five subjects  were tested off medication the first day and on medication the second day. Two subjects were tested on medication the first day and off medication the second day (PD4 and PD6). One subject (PD5) was tested off and then on medication on the same day.During all testing, except during calibration, subjects wore headphones and listened to an audio book to minimize conscious control of their posture. To prevent injury in the event of losing balance, subjects wore a harness attached to the ceiling of the room, and a researcher spotted them at all times. Subjects rested between trials to minimize fatigue. If a subject fell on a trial, the trial was repeated. If the second attempt also resulted in a fall, a third trial was attempted. All subjects successfully completed all trial types in three attempts, except for the sway-referenced trial. If a subject did not successfully complete a full sway-referenced trial within three attempts, we proceeded to the next block of trials.The calibration trial (block 1) defined the relationship between the displacement of the sway rods and the displacement of a subject\u2019s CoM Peterka, . During The purpose of the surface-stimulus trials (blocks 2 and 6) was to determine the dynamic characteristics of responses to surface perturbations and to identify how subjects alter their use of proprioceptive orientation cues as a function of stimulus amplitude.Each surface-stimulus trial was performed with eyes closed. Following 10 s of standing on a stationary surface, the surface rotated according to a stimulus derived from a pseudorandom ternary sequence , subjects performed three surface-stimulus trials with peak-to-peak amplitudes of 2\u00b0, 1\u00b0, and 4\u00b0 for the first, second, and third trials, respectively. Subjects rested between trials to prevent fatigue. The surface-stimulus trials of block 6 were a repetition of the surface-stimulus trials of block 2, to determine any learning effect on the subject\u2019s ability to maintain balance.The purpose of the visual-stimulus trials (block 4) was to determine the dynamic characteristics of responses to visual perturbations and to identify how subjects alter their use of visual cues for spatial orientation as a function of stimulus amplitude.On each visual-stimulus trial, subjects stood with eyes opened on a stationary support surface looking forward into the visual surround, but not staring at a single point in the pattern. After 10 s, the visual surround rotated according to a PRTS stimulus while the support surface remained stationary. Each trial consisted of four sequential cycles of the PRTS, with each cycle lasting 60.5 s. Subjects performed three visual-stimulus trials with peak-to-peak amplitudes of 2\u00b0, 1\u00b0, and 4\u00b0 on the first, second, and third trials, respectively. The subjects rested between trials to prevent fatigue.A lower bandwidth PRTS was used for the visual stimulus trials than the surface-stimulus trials, because the motor controlling the visual surround had a lower bandwidth than the motor controlling the support surface. Therefore, the PRTS for the visual-stimulus trials contained lower frequencies than the PRTS for the surface-stimulus trials. Consequently, the length of a single cycle of the PRTS was longer for the visual-stimulus trials (60.5 s) than the surface-stimulus trials (43.72 s).The purpose of the quiet-standing trial (block 5) was to quantify the magnitude of the subject\u2019s unperturbed body sway. For the quiet-standing trial, the subject stood upright with eyes closed on the stationary support surface for 120 s.The sway-referenced trial (block 3) determined whether subjects could change their reliance on sensory information to maintain their balance when vision was absent and relevant proprioceptive cues were suddenly eliminated. In this trial, subjects were required to rely on vestibular information to maintain balance. During the sway-referenced trial, the subjects stood upright on a stationary support surface with their eyes closed. After 60 s, the angular displacement of the lower body, measured using the hip sway rod, was used to control the angular position of the support surface for 60 s; the surface rotated in direct proportion to the subject\u2019s lower body angle with a proportionality constant of 1 . For subsequent trials, the calculated A1, A2, and OFF coefficients from each subject were used in the linear model, described above, to calculate the CoM displacement from the sway rod measured displacements. A recent publication provides a detailed explanation of this method and includes a Matlab program for the calibration analysis  for: (1) the CoM displacement for surface- and visual-stimulus trials; (2) the PRTS stimulus displacement for the surface- and visual-stimulus trials; (3) the CoM displacement for successful sway-referenced trials; and (4) the CoP displacement for quiet-standing trials. The signals were zero-meaned prior to calculating their RMS values.For surface- and visual-stimulus trials, CoM sway data for each subject were first averaged across all available cycles and then an RMS value of the average waveform was calculated. A comparison of the RMS of CoM sway between blocks 2 and 6 indicated that there was no significant learning between blocks in response to surface-stimuli. Therefore, all six cycles from these two blocks were averaged before calculating the RMS, which increased the signal-to-noise ratio of our data. Three cycles of CoM sway data were used for the RMS calculation of responses to visual stimuli for each subject.Analysis of the surface- and visual-stimulus trials in the time and frequency domains has been previously described Peterka, . In brieprop, Wvis, and Wvest), neural stiffness (Kp), neural damping (Kd), neural time delay (\u03c4d), and torque feedback (KT) with a low-pass filter time-constant (\u03c4T).We implemented a model-based interpretation of responses to surface- and visual-stimuli by applying a feedback model of the postural control system, which has been described previously Peterka, . Brieflyprop and \u03c4d to vary across the three stimulus amplitudes, but allowing only single values of Kp, Kd, \u03c4T, and KT. These constraints on the optimization fits provided parsimonious descriptions of the experimental FRFs while limiting the total number of free parameters. We also calculated the mean FRF across all subjects and the optimal parameters that fit the mean data.Model parameters were estimated using optimized fits to the FRF data. For both the surface- and visual-stimulus trials, fits were made to the three FRFs from each block simultaneously. For the surface-stimulus trials, optimal fits were performed for each subject individually allowing Wvis to vary across the three stimulus amplitudes, but allowing only single values of \u03c4d, Kp, Kd, \u03c4T, and KT.For the visual-stimulus trials, optimal fits were made only to the mean FRFs for each stimulus amplitude, because the responses to visual-stimulus trials were noisier, and the FRFs fits to individual subjects were not insightful. The visual-stimulus trials were optimized allowing WOff. To determine the effect of medication, we quantified the effect of medication on steady-state postural control mechanisms by comparing the behavior of PDOff to subjects with PD on medication (PDOn). The threshold for significance was p < 0.05 for all statistical tests. All statistical analyses were computed in R .For all statistical analyses, we considered: (1) the effect of PD; and/or (2) the effect of anti-Parkinsonian medication on postural control mechanisms. To determine the effect of PD, we quantified the effect of PD on postural control mechanisms by comparing the behavior of control subjects (C) to PDOff) was assessed with the two-sample Wilcoxon rank-sum test, and the effect of medication  was assessed with the paired Wilcoxon signed-rank test. For statistical testing of the clinical measures of the UPDRS, and sub-scores of the UPDRS, we used a single-sided distribution, because we were testing whether there was an improvement in the UPDRS score on vs. off medication. All other individual comparison tests were calculated with a two-sided distribution.Due to the size of our groups, we could not reasonably test whether our data were normally distributed. Therefore, we used the more conservative non-parametric tests to determine significance of individual comparisons. For individual comparisons, the effect of disease  the time-delay parameter in our feedback control model. In the above three ANOVAs, RMS of CoM displacement, Wprop, and \u03c4d were the dependent variables, respectively. We included factors for group , stimulus amplitude , and an interaction effect . We also included a random factor for subject, accounting for the fact that each subject performed the experiment for all three stimulus amplitudes.We used repeated-measures ANOVAs  to test the hypotheses that PD influences: (1) CoM displacement in response to surface-stimuli, (2) Wprop in response to surface-stimuli. This ANOVA included factors for medication conditions , stimulus amplitude, and an interaction effect. This ANOVA also included a random factor for subject, accounting for the fact that each subject performed the experiment for all three stimulus amplitudes and two medication conditions.Similarly, we used a repeated-measures ANOVA to test the hypothesis that levodopa influenced WOff and control subjects in the anteroposterior direction (p = 0.38) or in the mediolateral direction (p = 0.083). Levodopa increased the RMS of CoP displacement from PDOff to PDOn in the mediolateral (p = 0.023), but not in the anteroposterior direction (p = 0.20), as shown previously . Levodopa also improved the PIGD sub-score of the UPDRS  as well as rigidity , and bradykinesia .As expected, levodopa improved the UPDRS III Motor score  on the RMS of CoM sway. The main effect of disease on the RMS of CoM sway was not significant (p = 0.059), nor was the interaction between disease and stimulus amplitude (p = 0.11).For larger surface-stimulus amplitudes, subjects with PD showed greater RMS sway than controls  accounting for the gain decrease as stimulus amplitude increases and decreasing time delay (\u03c4d) accounting for phase changes at higher frequencies.We used a frequency domain analysis to characterize each subjects\u2019 postural sway over a range of perturbation frequencies. mplitude , top. Thmplitude , middle.mplitude , bottom.Off subject  on sensory-to-motor characteristics of posture control: Kp (p = 0.88), Kd (p = 0.80), \u03c4d (p = 0.74), KT (p = 0.64), or \u03c4T (p = 0.083). Medication (PDOff vs. PDOn) also did not significantly affect Kp (p > 0.99), Kd (p = 0.38), \u03c4d (p = 0.82), KT (p = 0.20), or \u03c4T (p = 0.25). All subject groups showed a significant decrease in proprioceptive weighting (Wprop) with increasing surface-stimulus amplitude (p < 0.001). Although the mean Wprop was larger for controls than for subjects with PD at 1\u00b0 and smaller for controls than for subjects with PD at 2\u00b0 and 4\u00b0, there was no significant main effect of disease (controls vs. PDOff) on Wprop (p = 0.84), and there was no interaction effect between group and stimulus amplitude (p = 0.28). In addition, there was no main effect of medication on Wprop (p = 0.92) and no interaction between medication and stimulus amplitude (p = 0.82).There were no significant effects of disease  and two PDOn subjects  across all stimulus amplitudes. In fact, when off medication, PD8 weighted proprioception more than any control subject for the 2\u00b0 and 4\u00b0 surface-stimulus amplitudes. In the on medication condition, PD4 and PD8 had a larger Wprop than any controls for the 2\u00b0 and 4\u00b0 surface-stimuli. Medication noticeably changed Wprop in two of the eight subjects with PD  of the four PDOff subjects who fell on all attempts at sway-referenced trials had larger Wprop in the 2\u00b0 and 4\u00b0 surface-stimulus trials than the PDOff subjects that did not fall. One of the three PDOn subjects (PD8) who fell on all attempts at sway-referenced trials also had larger proprioceptive weights for all surface-stimulus trials than PDOn subjects who did not fall.Viewing the changing Wsubjects . There wmplitude . This in with PD ; Wprop iprop between control and subjects with PD, we computed the slope of the proprioceptive weights between successive surface-stimulus amplitudes. PDOff subjects\u2019 slope of proprioceptive weighting was less than controls between 1\u00b0 and 2\u00b0 surface-stimulus amplitudes (p = 0.038). However, there was no difference between PDOff and control subjects in the slope of proprioceptive weighting between 2\u00b0 and 4\u00b0 surface-stimulus amplitudes (p = 0.51).Additional differences between control and individual subjects with PD were related to how well they changed proprioceptive weighting between surface-stimulus amplitudes . To quanIn response to visual-stimuli, both PD and age-matched control subjects had decreasing FRF gains with increasing stimulus amplitude , top rowvis with increasing visual-stimulus amplitude  and are unable to change weight when amplitudes of surface stimuli change on tests performed with eyes closed. Bilateral vestibular loss subjects were also unable to change visual weights with changing visual stimulus amplitude. Unilateral vestibular loss subjects were able to decrease Wprop with increasing surface amplitude, but their Wprop values were larger than age-matched controls by an average value of 0.28. Additionally, there was very little overlap in the distributons of Wprop values from unilateral loss and control subjects. These results in vestibular deficient subjects are in contrast to the substantial overlap of Wprop values in subjects with PD and controls at all stimulus amplitudes , were diagnosed from 3 to 36 years ago, were dependent upon levodopa, and seven out of eight showed clinically apparent balance and gait problems. The moderately-to-severely affected patients in our study showed larger spontaneous sway in the mediolateral (ML) direction, especially when taking their levodopa medication, consistent with previous studies  compared to younger control subjects from a previous study  approved the protocol for this experiment, and all subjects gave written informed consent prior to participating.KF contributed to the analysis, interpretation of the results, and preparation of the manuscript. RP and FH both contributed to the research funding and resources, conception, experimental design, data collection, analysis and interpretation of the results, and editing of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The objective of the present study was to analyze the factors associated with non-completion of the hepatitis B vaccine series among men who have sex with men and use geosocial dating apps in Brazil.This was a cross-sectional, population survey-based, analytical study, conducted exclusively online in all the regions of Brazil, with a sample of 1855 men who have sex with men. The data was collected between November 2016 and February 2017, using the social networking website Facebook.p\u00a0=\u20090.007), identification as bisexual , HIV serological status  and frequency of access to health services  were associated with not completing the vaccine series. Low completion of the hepatitis B vaccine series was detected in the population studied.Univariate, bivariate and multivariate analyses showed that 4.7% of the participants reported receiving one dose of the vaccine, 12.5% two doses, 19.4% three doses, and 45.8% did not know. Multivariate analysis showed that level of education  vulnerabilities. Infection by the hepatitis B virus (HBV) continues to be a major health problem. Its estimated prevalence is two billion people worldwide, with associated subclinical and clinical manifestations. Among those who are infected, around 240 million are chronically infected and have a higher risk of incurring serious hepatitis-related complications, such as cirrhosis and hepatocellular carcinoma .The hepatitis B virus is transmitted in two ways: vertically (mother-child transmission) and horizontally, through exposure to contaminated blood or other body fluids, especially through unprotected sexual relations, which is the most common form of exposure . Among tThe vulnerability of MSM to the virus is associated with a higher frequency of several factors, such as engaging in unprotected anal sex, multiple partners, a history of sexually transmitted diseases (STDs), stigma, violence, and difficulty accessing health services , 4.In Brazil, the primary method for prevention is vaccination, which has been provided since the end of the 1990s for children and higher-vulnerability groups. At present, it is universal, through a vaccination series based on three doses. All the vaccination programs focus on the administration of the complete series of doses. However, protective antibody levels are developed after one dose of the vaccine in 30 to 50% of those who are vaccinated, and in 75% after two doses .Although free protection against the virus is ensured at the primary health level, difficulties accessing health services may contribute to low or even incomplete vaccination coverage, especially among vulnerable populations . Based oThis study is part of a multicenter study entitled \u201cBehaviors, practices, and vulnerabilities among men who have sex with men and use geolocation  dating apps in Brazil.\u201d It encompassed all of Brazil\u2019s regions and sought to examine the behaviors and practices of men who have sex with men and use geosocial dating apps, and their vulnerability to HIV, hepatitis B and C, and syphilis.This was a cross-sectional, epidemiological, survey-based, analytical study, since it involved a large contingent of MSM from various states in Brazil, which enabled obtaining primary information on the health status of this group. The study was conducted among MSM who use geosocial dating apps for sexual encounters. The data was collected exclusively online, which promoted the participation of MSM from cities of different sizes and those further away from large urban centers, unlike large epidemiological studies that have previously been carried out with MSM in Brazil, but which have focused on large urban centers and state capitals .The sample was calculated based on the estimated MSM population  \u2013 an es(https://www.facebook.com/taafimdeque/), which was administered by the two researchers responsible for the data collection and provided not only information on the research but also information related to STDs. Only this fixed post with a link to the study was boosted by the researchers. The post also had an invitation for people to participate and it was continually boosted (weekly) to have access to all of Brazil\u2019s regions, which made it possible to reach the necessary sample size to meet the study objectives. The use of the boost feature is a valuable tool for reaching difficult-to-access populations, since it enables highlighting online content or pages. This type of approach attracts the attention of users and increases the number of views.The data was collected between November 2016 and February 2017, using only the Facebook social networking website to publicize the survey. A fixed post was written on a Facebook page The post was accompanied by a hyperlink that provided access to the survey questionnaire, with obligatory and optional questions, which was subdivided into four sections in order to obtain social, demographic and health information on the participants: (1) Personal characteristics; (2) Sociocultural characteristics; (3) Health issues; and (4) Sexual practices. The system was designed so that it would only be possible to move to a new section only if all the obligatory question, selected by the researchers, had been answered; this way, the questionnaire would only be tallied at the end if all the conditions had been satisfied. Therefore, incomplete questionnaires were not saved. To respond to the questionnaire, the participants needed to provide their email, to avoid duplication of responses. The inclusion criteria were: identifying oneself as a cisgender man; being 18\u2009years of age or older; having sexual relation with another man in the last 12\u2009months; and having used apps for sexual encounters at least once in the last 30\u2009days. Users not residing in Brazil were excluded.The description of the outcome (hepatitis B vaccine history) was self-reported by the participants, since the researchers did not have access to vaccine dose records through immunization booklets; however, the participants were instructed to check their booklets before answering. A person was considered vaccinated if the series (three doses) had been completed and recorded in the immunization booklet; not completely vaccinated if they had received \u201cone or two doses\u201d; and not vaccinated in the case of \u201czero doses\u201d or the \u201cI don\u2019t know\u201d response option, as per recommendations from the Brazilian Ministry of Health .For analyses in the logistical model, the information was regrouped into a) complete series - participants who reported receiving three vaccine doses; and b) those who had received less than three doses (one or two doses) or did not know how many doses they had received, defined as an incomplete series, according to the definitions established by the Brazilian Ministry of Health .The data was entered on a Microsoft Excel for Windows worksheet and imported afterward into the data analysis program. The Kolmogorov-Smirnov test was used to assess the normality distribution of the numerical variables . To describe the factors of interest, descriptive analyses were performed for both the numerical variables and the categories.For univariate analysis and analysis of the association between immunization status and categorized vulnerability factors, the chi-square test and Fisher\u2019s exact test were used, with a significance level of 0.05. To build the confidence intervals, a confidence of 95% was used, with the help of the Statistical Package for the Social Sciences (SPSS) IBM\u00ae Version 23.0.Univariate and multivariate logistic regression generated the Odds Ratio (OR) and adjusted OR, indicating the odds of non-completion of the hepatitis B vaccine series. The reference categories were: elementary education for education; heterosexual for sexual orientation; HIV positive for serological status; seeking information from health professionals; seeking information online; and higher frequency of use of health services. This made it possible to verify the odds of negative events such as risk factors and, as protectors, the factors that lead to better care and, thus, less likelihood of not completing the hepatitis B vaccine series.The study was approved by the Research Ethics Committee (Opinion No. 1523003) and strictly complied with all the ethical precepts in Resolution 466/12, with guidelines for research with human subjects in Brazil. The participants read the free and informed consent form online and then signed it, thereby indicating their agreement with the proposed objectives and willingness to participate in the study. This consent was applied and obtained online.n\u00a0=\u20091855), 4.7% reported having received one dose, 12.5% two doses and 19.4% three doses, thus, 36,6% of participants report some type of protection. Another 17.6% reported not having been vaccinated (zero doses), and 45.8% did not know how many doses they had received, as shown in Table\u00a0Among the participants n\u00a0=\u2009855, 4.7%The average age of the participants was 25.7\u2009years old, with a standard deviation of 7.8\u2009years. The majority had completed their higher education (57.8%); did not practice any religion (63.9%); lived with their parents (55.5%); were single (75.2%); and engaged in casual sexual relationships (49.3%). Majority of the participants lived in the southeast region of Brazil (50.3%) Table .p\u00a0<\u20090.001); Brazilian region of residence (p\u00a0=\u20090.023); sexual orientation (p\u00a0<\u20090.001); marital status (p\u00a0=\u20090.011); presence of STDs (p\u00a0=\u20090.003); HIV status (p\u00a0<\u20090.001); use of alcohol during sex (p\u00a0=\u20090.003); and frequency of use of health services (p\u00a0<\u20090.001).Table\u00a0Multivariate analysis Table\u00a0 indicateSelf-reported completion of the hepatitis B vaccine series was low among MSM who participated in the study (19.4%), compared to the number of third doses accumulated in the Brazilian adult population, which was 49.3% according to recent official data . These lHowever, our results should be interpreted considering the Brazilian context that, unlike other countries, offers the hepatitis B vaccine free of charges to children and adolescents since the beginning of the 2000s . Thus, pThe introduction of the hepatitis B vaccine in the Brazilian context has been considered decisive in reducing HBV infection rates, even in the presence of risky sexual behaviors , althougA number of intrinsic factors may be associated with increased vulnerability of MSM to hepatitis B virus infection, such as sociocultural characteristics and sexual behavior, as well as external factors related to difficulty accessing health services, denial of basic LGBT health rights and institutionalized homophobia .As an example, low proportions of hepatitis B vaccination were reported by younger MSM, even though this population has more access to information than the adult population . In contThe predominance of individuals with higher education levels and a higher rate of complete vaccine series (57.8%) corroborates the higher odds of non-completion in participants with only secondary or elementary education. This would indicate that level of education is related to the search for protection and has a direct impact on the percentage of new cases of hepatitis B .HIV-seropositive individuals and those with a history of other STDs presented a higher vaccination percentage , a result complemented by multivariate analysis, which demonstrated that individuals who were unaware of their HIV status were four times more likely to present an incomplete vaccine series. This finding was also reported by other studies that have investigated this population , 21.The association between completion of the vaccine series and a previous STD diagnosis suggests that in the presence of infection, MSM seek to be vaccinated, since during their visit to a specialized health service, screening refers them for further testing and vaccination .The participants who reported going to health units more frequently had a better vaccination history, compared to those who went occasionally (or rarely), which increases the odds of an incomplete vaccine series. This finding demonstrates the importance of health units being prepared to receive LGBT individuals, particularly at the primary care level, since it is the main gateway to the Unified Health System . This reBecause of the growth of STDs among vulnerable populations , initiatOur study shows that the factors associated with completion of the hepatitis B vaccine series included social, individual, and programmatic  vulnerabilities . Thus, oThe findings of this study are subject to limitations. The main limitation of this study stands on the fact that it was based on self-reported information by the participants. This information is subject to memory bias, in the absence of vaccination records for verification. To mitigate this limitation, the participants were instructed to consult their vaccination records.Additionally, the three-dose schedule of the anti-hepatitis B vaccine over a period of months may make it more difficult to remember than other single dose vaccines .Last, it is not possible to generalize these findings to the entire Brazilian MSM population, since the interviewees represented a sample of individuals who used a specific technology for finding sexual partners.Completion of the hepatitis B vaccine series was low among men who have sex with men and use geosocial dating apps in Brazil. The factors associated with non-completion were level of education, identification as bisexual, HIV serological status, use of the Internet and health professionals as sources of health information, and frequency of use of health services.The MSM population is classified as vulnerable to sexually transmitted diseases, since they are more exposed to these infections, including HBV infection. This underscores the need for studies at the national level that address this problem and are able to help provide a clearer overview of the health status  of this population. It is recommended that future studies focus on the use of mobile apps as an environment for campaigns, carrying out interventions through the application itself."}
+{"text": "Canine Bud Extraction (CBE) is a process of removing or gouging children\u2019s healthy canine tooth buds embedded underneath the gum using traditional unsterilized tools. The practice of CBE commonly known as false teeth removal continues to be an adopted cultural intervention of choice, in the prevention of morbidity and mortality from common childhood illnesses. However, it is a practice against the rights of the children with serious consequences. While CBE is associated with the perceived myth of curative gains, the agony emanating from the cultural practice exposes children to ill-health conditions such as dehydration, malnutrition, blood-borne diseases like HIV/AIDs, septicemia, fever and death. This research sought to understand the factors underpinning the practice of CBE among urban slum dwellers.A cross-sectional study was conducted from five randomly selected slums in Makindye division; 298 household heads or guardians with children below 5 years, who had ever suffered from false teeth were interviewed. The variables measured included guardians\u2019 socio-demographic profiles, determinants of CBE, common childhood illnesses assumed to be treated with CBE and the reported side-effects associated with the practice.p\u2009<\u20090.001) had a statistically significant association with CBE. Additionally, number of children  and 2 sets of beliefs  and CBE treats fever  were independent predictors of CBE practice. A total of 55.7% respondents knew that there were side effects to CBE and 31% mentioned death as one of them.Of the 298 respondents with children who had ever suffered from \u201cfalse teeth\u201d interviewed, 56.7% had two or more children below 5\u00a0years and 31.9% were from the central region. The proportion of households practicing CBE was 90.3%; 69.8% of the caretakers mentioned that it was done by traditional healers and for 12.1% by trained health workers (dentists). Number of children  and the belief that CBE is bad (OR\u2009=\u20090.1, 95% CI: <\u20090.001, The high proportion of households practicing CBE from this study ought to awaken the perception that the practice is ancient. CBE in this community as the study suggests was strongly driven by myths. The strong belief that CBE is bad provides an opportunity for concerted effort by primary health care providers, policy makers and the community to demystify the myths associated with false teeth and the gains of CBE. Canine Bud Extraction is a process of removing or gouging children\u2019s healthy canine tooth buds embedded underneath the gum using traditional unsterilized tools. Many terms or names are used to mean Canine Bud Extraction which include; Infant Oral Mutilation (IOM), germectomy, Tooth Bud Extraction (TBE), and Deciduous Canine Tooth Bud Extraction (DCBE) . CaninesThe practice of CBE is a superstitious belief whose origin is unknown. CBE is evident in most of the African and Sub-Saharan African countries with the first cases being recorded as early as 1932 among the Nilotic tribes \u20137, 9\u201311 A survey conducted in 2013 among offspring of Ethiopian immigrants indicated that the prevalence of missing canines and poor dentition (poor teeth formation) is higher among emigrants from Ethiopia than those from Israel living in the same low socio-economic status .Reports received in 2009 from DR. Congo former Zaire showed that CBE was common among people from Aru and Kivu areas and this practice was introduced from Uganda during Idi Amin\u2019s regime when Ugandan refugees entered Congo; the same experience was seen in Burundi and Rwanda . A reporStudies conducted in Uganda show high prevalence of CBE. A study by Tirwomwe  in six dThe study was conducted in the slum areas of Makindye Division because most of the studies conducted on CBE have mainly been in hospitals, villages, Peri-urban settings and urban areas. The slum areas were also selected by the fact that they harbor the urban poor from different regions from Uganda and constitute different nationalities.A cross sectional study design was used where 298 respondents consented before being interviewed; both qualitative and quantitative methods of data collection were used to obtain information regarding the above stated study. A researcher/interviewer administered questionnaire was used and translation to the local language made to accommodate those who were not able to communicate in English. The study was done in households with children under the age of 5 years who had ever suffered from \u201cfalse teeth\u201d living in the five randomly selected slums within  known to be characterized by slums in Makindye Division, Kampala. These are characterized by urban neighborhoods of the lowest socio-economic level populated by migrants in to the city within informal settlements. The decision about CBE is not necessarily made by parents, but rather caretakers of children under the age of 5 years.The researcher used stratified sampling technique using probability proportionate to population size to determine the number of households to be included in the study. Probability proportionate to sample size reduces on the chances of selecting more members from a larger group as opposed to a smaller group. This was used since the selected slums did not have equal number of households and household heads.The study area was first stratified by village, eligible population in each slum by village determined, and the number of household. Proportionate number of household was determined, and simple random sampling used to select the households to be included in the study. For each household visited, a household head/caregiver found with a child below 5 years was included in the study and where there was no eligible participant, the next household found with the eligible participant was considered. The households had to have children below 5 years because the practice of CBE is common among children below the age of 5 years.Prior to data collection, clearance to collect data was sought from the University Research Scientific Committee of International Health Sciences University and the respective heads of the selected villages. Informed consent was also sought from the study participants where participation was voluntary and the choice to withdraw from the study at any point in time observed. Data collected was cleaned on a daily basis to promote good quality data.A total of 298 study participants were enrolled for the study with Namuwongo 102 (34.2%) contributing the highest number of respondents and Wabigalo 28(9.4%) the least. Most of the study participants were female 262 (87.9%), aged 26\u201331\u00a0years 115(38.6%), had primary level education 108(36.2%), were catholic 118(39.6%) and married 22(76.2%); 188(63.1%) were employed and 169(56.7%) had two or more children below 5\u00a0years old. The highest proportion of the respondents was from the central region 95 (31.9%).p-value\u2009=\u20090.036).From Table Up to 269 (90.3%) of the respondents with children who had ever suffered from \u201cfalse teeth\u201d reported subjecting their children to canine bud extraction (CBE); only 29 (9.7%) respondents reported not subjecting their children to canine bud extraction. Participants were further asked where they sought the canine bud extraction services and a majority (69.8%) mentioned that they had gone to traditional healers; 12.1% of the study participants had their children\u2019s canine buds extracted by a health worker. The children had their teeth extracted at 3\u00a0years (48%), 2\u00a0years (33.2%), 4\u00a0years (12.4%), 1\u00a0year (6%) and 5\u00a0years (0.3%).With regards to instruments used during CBE, 82 (27.5%) reported that bicycle spokes were used, 71 (23.8%) said that surgical/razor blades were used, 54 (18.1%) mentioned nails, and 33 (11.1%) mentioned knives; 19.5% did not know what had been used during the CBE process, 56.9% of these had gone to traditional healers.Those who reported not performing canine bud extraction were asked what they had done about the false teeth; 24 (82.8%) of them said that the children\u2019s teeth had been scrubbed while 5 (17.2%) had sought medical attention. Among the things used for scrubbing were herbal medicines (used by 21 respondents), honey and garlic (used by 3 respondents).All research participants reported having ever heard about CBE. The sources of information mentioned by the study participants on the CBE practice included 22 (7.4%) from traditional healers, 10 (3.4%) from health workers, 24  from friends 71 (23.8%) from neighbors and 121 (40.6%) from other relatives  reported knowing the side effects of canine bud extraction whereas 44.3% said they did not know of any side effects of CBE; of those who reported side effects, 17 (10.4%) mentioned included death, 51 (31.3%) poor dentition (which meant funny shaped teeth and overcrowding of teeth in the mouth by the participants), 26 (16%) failure to develop canine teeth, 34 (20.9%) exposure to infections, 16 (9.8%) severe pain and 19 (11.7%) over bleeding. Respondents were asked to verify several statements regarding CBE; 94.3, 92.3, 65.4, 62.4 and 37.3% agreed with the statements \u201cCBE treats diarrhea\u201d, \u201cCBE treats fever\u201d, \u201cCBE treats vomiting\u201d, \u201cCBE treats malaria\u201d and \u201cCBE treats cough\u201d respectively; 57.15% agreed with the statement \u201cCBE leads to poor dentition\u201d .In all, 178 (59.7%) respondents reported that they had cultural beliefs related to false teeth while 120 (40.3%) said that they did not have such beliefs. Of those who reported the existence of cultural beliefs, 120 (66.3%) did not know the beliefs, 13 (7.3%) said that false teeth were caused by germs, 36 (20.2%) claimed that they are caused by \u201cstepping on false teeth when pregnant\u201d, and 8 (5.1%) indicated that it was a family disease. Respondents were further asked whether the canine bud extraction practice was a taboo in their cultures; 267 (89.6%) said that it was not and only 31 (10.4%) said that it was. The reasons given for why CBE practice was a taboo were \u201cit is a foreign cultural practice\u201d mentioned by 10 respondents and \u201cCBE kills\u201d mentioned by 6 respondents and \u201cit is associated with witchcraft\u201d mentioned by 15 respondents.Most of the respondents 173, (58.1%) perceived CBE to be a good practice, yet 22.1% thought that it was a bad practice, 15.1% thought that it should be banned while 4.7% believed that it was a very painful practice.From Table 2\u00a0=\u200912.8, p\u00a0=\u20090.0017), number of children  and CBE treats fever  remained independent predictors of CBE practice even after multivariate analysis.Additionally, belief that CBE treats diarrhea , who were first time mothers and aged 26\u201331\u00a0years (38.6%) with a primary level education; the practice of CBE was high among the less educated which is different from the findings of  where thThe proportion of households that practiced CBE was high at 269 (90.3%) which is higher than what is reflected in other sources . The carThe study revealed that 94.3% of the mothers know that CBE treats diarrhea [OR\u2009=\u20097.5 (2.0\u201327.6)]. These results are similar with that of a study that was conducted in Ethiopia where 68.7% of the study participants said that diarrhea was the major cause of canine tooth bud removal  and in aThe study revealed that 92.3% of the mothers know that CBE is the traditional treatment for fever [OR\u2009=\u200917.1 (4.7\u201361.6)]. Dr. Graham et al.,  the studIt should not be a surprise in the unindustrialized world to associate disease conditions that cause fever to be teething since febrile conditions are among the leading causes of morbidity and mortality, and hence subject their infants to oral mutilation techniques. In this regard, the basis for canine bud extraction would be presumed alleviation of fever among the young children  this wasThe study also revealed that 62.4% of the mothers know that CBE treats malaria [OR\u2009=\u20094.8 (1.4\u201317.3)]. Other findings suggest that education on simple hygiene will counteract some infectious conditions such as malaria, and that families with a good understanding of the causes of malaria could foresee that the relatively rough traditional practices might become less attractive . MalariaWith the era of globalization people move from one part of the world to another, immigrants are interested in cultural socialization while teaching their children about their ethnic customs and traditions  consider\u201cit is a foreign cultural practice\u201d\u2026and \u201cit is associated with witchcraft\u201d.More than half of the respondents reported that they had cultural beliefs related to false teeth, they believed that false teeth were caused by germs, caused by \u201cstepping on false teeth when pregnant\u201d, and that it was a family disease. On the other hand, some respondents still believed that it was a taboo practicing CBE in their culture saying, However, no significant association was established between the socio-cultural factors like the cultural belief concerning the cause of \u201cfalse teeth\u201d and was rather seen to be caused by group influence since majority admitted being drawn to the practice by their neighbors. Tribe of the respondents and whether the practice was considered a taboo in the study respondents\u2019 cultures was not one of the factors associated to the practice. Furthermore, the study findings also indicate that majority of the respondents perceive CBE as a good practice hence the high proportion of households practicing CBE observed.The custom of canine bud removal has detrimental consequences on children\u2019s general health and dental care  in that A refined approach in communication on dental health is required by professional dentists and the Ministry of health in educating parents, guardians and caregivers, as they are key players in upholding cultural norms and traditions. There is need to sensitize health workers particularly those it the lower cadres who may be more likely to practice quackery about the consequences of conducting CBE. The child\u2019s rights should always be prioritized."}
+{"text": "As a result of the treatment, clinical cure or improvement was detected in 98.2% of patients (p < 0.05), while 24.4% had a complete cure. Subsequent observations during 4 years showed that patients who received muramyl peptide statistically significantly increased relapse-free period. Moreover, subsequent relapses of the disease after treatment with muramyl peptide were in much more milder form in the cases of mild psoriasis. The conducted studies showed that monotherapy with muramyl peptide stopped the clinical manifestations of psoriasis, normalized the processes of cytokine-dependent  regulation of the immune response and nonspecific resistance, expressed in a decreasing amount of serum antigens sCD54 [soluble intercellular adhesion molecule-1 (sICAM-1)] to reference values (p \u2264 0.01). Taken together, our research demonstrated the effectiveness of therapy with muramyl peptide and moreover, that elevated levels of sCD54 and MIF (p \u2264 0.01) in the serum of patients with psoriasis considered as potential biomarkers of the severityof psoriasis and control over their dynamics have prognostic significance in determining the effectiveness of the therapy.Psoriasis is a multifactorial disease with a dysregulation in immune system. The aim of this study was to survey the clinical efficacy and safety of muramyl peptide\u2014the ligand of the receptors of innate immunity  in patients with psoriasis. The effect of muramyl peptide on 86 patients with different severity of plaque psoriasis was tested. The Psoriasis Area and Severity Index (PASI), cytokine status and production of nitric oxide in blood serum, and the subsequent course of psoriasis have been evaluated. Evaluation of significance of observed differences was presented by the Student's  Psoriasis is a chronic, noncommunicable, painful, disfiguring, and disabling disease for which there is no cure with negatively impact clinical outcomes and quality of life . The urgIn vitro activation of Nod2 leads to transcription of multiple genes, often mediated through NF-\u03baB activation and mitogen-activated protein kinas signaling, which results in the production of pro-inflammatory mediators and antimicrobial molecules  the function of innate and adaptive immunity , 22. Theolecules , 24. At olecules , 26. NODolecules , 28, incolecules . Williamolecules .The purpose of this study was to study the clinical efficacy and safety of the muramyl peptide in patients with psoriasis, its effect on the cytokine status and production of nitric oxide, and the subsequent course of psoriasis. The limitation of presented investigation rests in the comparison of cytokine levels in serum of patients with psoriasis before and after treatment by muramyl dipeptide with those of healthy donors and lack of comparison with a placebo-treated group of patients with psoriasis.This study was carried out in accordance with the manufacturer's instructions for treatment psoriasis . Protocol was approved by the Ethics Committee of the Pirogov's Russian National Research Medical University . All subjects gave written informed consent in accordance with the Declaration of Helsinki.A total of 86 patients (50 women and 36 men aged 19\u201363 years) received the total treatment (outpatient and inpatient). The duration of the disease varied from 6 months to 45 years. Among the provoking factors, psycho-emotional stress, exacerbations of chronic diseases, acute respiratory viral infections were most often observed. The frequency of relapses averaged 2\u20133 per year. The study of the structure of concomitant diseases did not reveal any peculiarities in comparison with the average statistical distribution in the European part of the Russian Federation. Most often, the patients examined had lymphopenia accelerated by the erythrocyte sedimentation rate (ESR).A vulgar variety of psoriasis is diagnosed in 67 people, represented by various plaques and papules of pink color with silver-white scales on the surface. In 14 patients, during the initial examination, an exudative variety of the disease was revealed, at which the phenomena of pronounced secondary wetness were observed. In 5 patients, a chronic form of the disease characterized by long-standing plaques with significant papular infiltration was defined. In the majority of patients, psoriasis was in a progressive stage, flowing as an undifferentiated type of disease. The PASI index was used as a tool for determining the severity of the course of the pathological process and the effectiveness of the therapeutic measures performed. In accordance with the obtained values of PASI index, slight degree of severity of the disease course was detected in 9 patients (PASI = 7.3 \u00b1 1.8). Among them, 5 have vulgar psoriasis, 2 have exudative and 2 chronic forms of psoriasis. In 60 patients  with moderate severity of psoriasis, the mean PASI was 26.6 \u00b1 4.2. In 17 patients (11 patients with vulgar and 6 with exudative psoriasis) with a severe course of the skin-inflammatory process, the mean PASI value was 43.6 \u00b1 3.9. Patients were treated without \u201cblinding\u201d and untreated or placebo-treated patients were not tested. The distribution of patients according to the type and severity of psoriasis is presented in The level of cytokines and soluble macrophage migration inhibitory factor (MIF) was determined in the blood serum of patients with psoriasis by enzyme-linked immunosorbent assay (ELISA) using Pro-con kits . The content of soluble antigens CD54  was determined by an enzyme immunoassay using the Human sICAM-1/CD54 ELISA kit to determine sICAM-1 levels in serum . The detection limit was 1.56 ng/mL.2, NO3 ions, determined using a spectrophotometer DU-50  at a wavelength of 520 nm.Quantitative analysis of the content of nitric oxide (NO) in the blood serum was assessed by the level of its stable metabolites\u2014NOAs a control, reference values were used, corresponding to the average statistical values of the studies that were established in the laboratory after examination of 50 practically healthy donors aged 18\u201360 years.\u00ae, AO Peptek, Moscow, Russia) was used for 1 tablet (10 mg) for half an hour before meals 2 times a day during 20 days.In the treatment of all patients with psoriasis, a medicine based on N-acetylglucosaminyl-N-acetylmuramyldipeptide , H1-blockers were additionally prescribed (cetirizine 10 mg per oz/day for 7 days). In a number of cases (2 women with exudative psoriasis), during the first 7 days of treatment, topical steroids (cream and 0.1% hydrocortisone emulsion) were used that were applied to individual lesions in the area of the facial skin and open areas of the upper limbs.t-test. P < 0.05 was defined as statistically significant *p < 0.05, **p \u2264 0.01.Statistical analysis and graphical illustration of numerical data was performed using Graph Pad Prism (GraphPad Software Inc.). Data are presented as mean \u00b1 SD, SEM. Statistical significance was determined by Student's The evaluation of the effectiveness of the therapy with muramyl peptide was carried out according to generally accepted criteria . The majThe evaluation of the effectiveness of the therapy with muramyl peptide was carried out according to generally accepted criteria. The disappearance of all clinical signs and symptoms compared with the baseline (improvement of the PASI index by 100%) was regarded as a clinical cure. Reduction in the severity of all clinical signs and symptoms compared with the baseline, in addition to residual effects in the form of mild erythema (improvement in the PASI index of 75% \u2264PASI\u226599%) was defined as a significant improvement. Regression of clinical symptoms of psoriasis in the form of an improvement in the PASI index of 50% \u2264PASI\u226574% was regarded as an improvement. Reducing the intensity of all clinical signs and symptoms compared to the baseline as an improvement in the PASI index of 25% \u2264PASI\u226549% was considered to be a satisfactory improvement. The improvement in PASI was <24% regarded as a minor improvement. In cases of lack of dynamics from clinical symptoms or worsening during psoriasis, it was assessed, respectively, as unchanged or worsening.In 21 (24.4%) patients  after the treatment, there was a clinical cure, consisting in complete absence of manifestations of the pathological process . A signip < 0.01), with an moderate degree from 26.6 \u00b1 2.2 to 3.35 \u00b1 2.4 (p < 0.01), with a slight degree of severity of psoriasis\u2013from 7.3 \u00b1 2.49 to 1.43 \u00b1 0.6 (p = 0.037). Statistical significance in all measurements was p < 0.05 .p < 0.05), which in turn led to a decrease in the production of pro-inflammatory cytokines. Thus, the concentration in the vascular channel of TNF-\u03b1 dropped from 29.6 \u00b1 2.1 pg/ml (p < 0.05), and IL-4\u2014to 17.5 \u00b1 1.4 pg/ml (p < 0.05). After the treatment with glucosaminyl muramyl dipeptide, the blood content of IL-12 increased significantly to 38.4 \u00b1 2.8 pg/ml (p < 0.05). Increased production of IL-12 led to the restoration of an adequate level of natural resistance and normalization of the functional activity of monocytic-macrophagal cells. Thus, therapy with muramyl peptide medication contributed to the normalization of the cytokine-dependent regulatory response and cellular internalization processes. Considering that the factor of inhibition of migration of macrophages (MIF) is a key regulator, acting at the initial stages of the development of the innate and acquired immune response, it seemed to us expedient to study the effect on its production of the drug muramyl peptide. The conducted studies showed that the concentration of MIF in the blood  significantly increased (p \u2264 0.01), practically did not differ from similar values in healthy donors. Thus, the decrease of soluble adhesion molecules in the blood allowed stabilizing the activation processes of immunocompetent cells and cell migration. Studies have shown that the presence of inflammatory and functional changes in psoriasis led to an increase in the production of endogenous nitric oxide to 34.1 \u00b1 1.5 \u03bcmol/L at 19.4 \u00b1 1.4 \u03bcmol/L in healthy donors. A significant increase in nitric oxide compared with the reference values, passing the framework of protective immunity, contributed to the development of inflammatory phenomena in patients with psoriasis. After the therapy with muramyl peptide, the level of nitric oxide in the peripheral blood decreased to reference values , which indicated the stabilization of immune metabolic processes (Studies conducted in 86 patients with psoriasis  revealedncreased  in comparocesses .Treatment the psoriasis patients with glucosaminyl muramyl dipeptide 10 mg twice a day during 20 days promoted statistically significant change in clinical symptoms and in cytokine levels. It should be noted that the dominant group was the vulgar type severe form of the disease and it was in this group that the greatest positive clinical effect of muramyl peptide therapy was observed. The group with chronic psoriasis was the smallest, all patients in this group showed improvement. The obtained data on the clinical efficacy of muramyl peptides in the treatment of psoriasis are consistent with the results of other studies of patients with stable, chronic plaque psoriasis  in the sElevated levels of sCD54 and MIF in the serum of patients with psoriasis and control over their dynamics have prognostic significance in determining both the severity of the disease and the effectiveness of the therapy. The obtained data are consistent with the results of other researchers, indicating the value of serum markers sCD54  and MIF The mechanism of protective activity of glucosaminyl muramyl dipeptide is not fully defined. It is well established the influence of MP in induction of inflammatory processes. The anti-inflammatory properties of muramyl peptides are not widely discussed, although it is known that muramyl dipeptides limit infection and inflammation in murine model of sepsis , via NODThe carried out investigation have shown high therapeutic efficiency and safety of application of muramyl peptide at psoriasis. Based on the results of the conducted studies with full justification, it is possible to recommend the use of the muramyl peptide GMDP in all cases of plaque psoriasis at various stages of its development. It is inappropriate to use it in patients with psoriasis in cases of the emergence of immunodeficiency states after repeated use of immunosuppressive therapy.The pathogenetic efficacy of muramyl peptide in patients with psoriasis is provided by its ability to normalize the balance of immunocompetent cells, cytokines, adhesion molecules, and nitric oxide, involved in the realization of inflammation. The impact of glucosaminyl muramyl dipeptide in the treatment of psoriasis could be of potential therapeutic benefit as it influence on the pathways of maintaining immune homeostasis evolutionary formed during coexistence of commensal microflora and host.SG: idea. VU and AK: design and data collection. SG, VU, and AK: analysis and manuscript writing.SG was employed by the company Peptek. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The failure rate of the laparoscopic sleeve gastrectomy (LSG) is increasing. Gastric pouch dilation is frequently suggested to be one of the causes for the failure. The banded laparoscopic sleeve gastrectomy (BLSG) has been proposed to overcome this complication. This is the first study that reports the long-term outcome (>\u20095\u00a0years) of BLSG in obese and superobese patient population.n\u2009=\u200951, non-banded LSG (NLSG)/n\u2009=\u200996, BLSG) were followed up for 5\u00a0years. Patients were evaluated for % excess weight loss (%EWL), % excess body mass index loss (%EBMIL), weight regain, BMI, and complications. Weight loss analysis was also done between banded and non-banded superobese patient populations.One hundred and forty-seven patients (P\u2009<\u20090.001). There was no statistical significant difference in weight loss between obese and superobese BLSG group. The complication rates were more with BLSG group (14.5%) compared to NLSG group (9.8%); no signs of band slippage, erosion, or migration were seen. There was no mortality seen.There was statistical significant difference between two groups at each given time point in terms of %EWL and %EBMIL. NLSG group had higher weight loss failure rate (35.2%) and weight regain (19.6%) at the 5-year follow-up compared to BLSG group (BLSG surgery was found to be safe and effective in maintaining weight loss on the long term compared to the NLSG group with low incidence of band-related problems. Additionally, the NLSG group had a higher rate of weight loss failure and weight regain at 5\u00a0years compared to the BLSG group. Laparoscopic sleeve gastrectomy (LSG) was first reported as a part of the two-stage approach for high-risk patients undergoing laparoscopic biliopancreatic diversion duodenal switch (BPD-DS) . Soon, iWith longer follow-up of the LSG, the failure rate of this procedure is also increasing , 7. TherWhile the cause of insufficient weight loss or weight regain is multifactorial, an increase in the gastric reservoir size due to long-term gastric pouch dilation is frequently suggested to be one of the causes , 10. In The use of bands or rings over the gastric tube has been known previously in LRYGB, and the results have been promising , 14. BanPatients that had either NLSG or BLSG between May 2010 and July 2017 were analyzed for potential inclusion. All the procedures were performed by one surgeon at a single institute at the AZ Nikolaas, Belgium. Extensive information concerning pros and cons of both procedures were given to patients. Patients signed the specific consent to have the NLSG or BLSG after they made their choice. Each patient also signed the consent to have their data analyzed in a blinded fashion.Patients were followed in a multidisciplinary program with all follow-up data entered in a programmatic database. Follow-up visit took place at 3, 6, 12, 24, 36, 48, and 60\u00a0months post-operatively. Body mass index (BMI) and weight were measured at each follow-up visit. Also, the presence or absence of obstructive sleep apnea (OSA), type 2 diabetes mellitus (T2DM), gastroesophageal reflux disease (GERD), hypertension (HTN), and hyperlipidemia were recorded.t test for quantitative and qualitative variables. We used Student\u2019s t test for mean comparisons between the two groups (NLSG vs BSLG). The comparison was also made between banded and non-banded superobese patient population by using Student\u2019s t test. Data were collected in the form of mean\u2009\u00b1\u2009standard deviation. For all analyses that involved inferential statistics, a P value <\u20090.5 was considered statistically significant.All statistics were run through SigmaPlot statistical software. Descriptive statistics were used to analyze preoperative characteristics such as age, weight, height, and body mass index (BMI). Calculations were made to determine their %EWL and percentage excess BMI loss (%EBMIL). Categorical variables were analyzed using the chi-squared test, Fisher\u2019s exact test, or Student\u2019s Additionally, complications from each patient were also recorded. For analysis, they were divided into those that occurred within the first 30\u00a0days and those that occurred subsequently. Additionally, they were divided into minor and major complications.All operations were done laparoscopically. We begin the dissection on the greater curvature 3\u20134\u00a0cm from the pylorus. Dissection is continued until the left crus of the diaphragm is well visualized. Resection is started about 3\u20134\u00a0cm from the pylorus over a 40-F gastric calibration tube up to the angle of Hiss. A gastric sleeve of less than 100\u00a0ml in volume remains. No staple line reinforcement was done.A silastic ring (MiniMizer Ring\u00ae) is placed 4\u20135\u00a0cm from the gastroesophageal junction. The atraumatic needle of the Minimizer ring is introduced behind the sleeve through the lesser omentum in between the vessels of the lesser curvature. It is closed according to the manufacturer\u2019s instruction and fixed with two non-resorbable sutures. Ring circumference of 6.5 or 7\u00a0cm are used for females, and 7 or 7.5\u00a0cm are used for males. The placement of the ring added less than 5\u00a0min to the operation. To avoid the damage to the posterior wall of the stomach, it is essential that the gastric calibration tube is inside at the moment of the ring closure and that there is 5\u00a0mm space between the ring and the pouch upon closure. No bleeding or damage to the gastric wall was noted Fig.\u00a0.Fig. 1InP\u2009=\u20090.002). Similarly, male to female ratio was also significantly different between the two groups (P\u2009=\u20090.04), with BLSG group having more males than females. Demographic characteristics and rates of comorbidities are seen in Table Of 147 patients, 51 underwent NLSG and 96 underwent BLSG. Patients in the NLSG group were a little older than in the BLSG group (P\u2009=\u20090.001). Similarly, %EWL at 1\u00a0year was 60.6\u2009\u00b1\u200921.8 and 77.4\u2009\u00b1\u200920.5 in NLSG and BLSG, respectively (P\u2009<\u20090.001).The weight loss data were categorized into two sections as demonstrated in Table P\u2009=\u20090.004). Similarly, %EWL at 5\u00a0years was 57.8\u2009\u00b1\u200925 and 86.7\u2009\u00b1\u200911.9 in NLSG and BLSG, respectively (P\u2009=\u20090.003). These results clearly show that the %EBMIL and %EWL decrease over time in the NLSG group, while both parameters continue to increase over time in the BLSG group with a statistical significant difference between two groups. Figure At 5\u00a0years, the patients had an average %EBMIL of 66\u2009\u00b1\u200932.8 and 102.4\u2009\u00b1\u200919.3 in NLSG and BLSG, respectively . After 5\u00a0years in the NLSG group, 80.3% had no increase in BMI points compared to 97.9% in the BLSG group. In the NSLG group, 12% of the patients had an increase of less than 5 BMI points compared to 2% in the BLSG group, while 8% of the NLSG group had an increase of more than 5 BMI points compared to 0 patients in BSLG group (Table The BLSG group had less weight regain (2%) at the 5-year follow-up visit compared to NLSG group (19.6%) (Table The complication rate was higher for the BLSG group 14.5%) compared to the NLSG group (9.8%) . The minimizer ring has an advantage over other rings because of the easy placement and closure and the intraoperative flexibility allowing adjustment to the desired diameter. Ease of placing the ring is assisted by a blunt, silicone covered introduction needle that simplifies retro gastric placement . AdditioIn this current study, overall weight loss after NLSG is within the range mentioned in the literature. The position statement issued by the ASMBS on LSG has shown an EWL after LSG ranges between 53 and 69% with a tendency for weight regain . BohdjalP\u2009<\u20090.001). Some may argue that the impressive difference in the weight regain might be a result of frequent dysphagia in this group. However, as we discussed earlier, the exact level of dysphagia is hard to objectify, and thus it is difficult to conclude if this is one of the reasons for higher weight loss or less weight regain with the BLSG group. Our results also showed that there are almost 35 times as many patients (35.7%) in the NLSG group that end up below 50% EWL bracket after 5\u00a0years than in the BLSG group , the evolution of BMI data shows a divergence between both groups with BLSG patients showing more decrease in BMI post-operatively (25.4 vs 33.1) with a statistically significant difference . However, this trend is also seen in other published series on BLSG. Karcz et al. observed 40% frequency of vomiting in BLSG at 1\u00a0year [For every advantage, there is a cost. In this study, the BLSG group had higher complication rates compared to NLSG group. Since the complications were different in the two groups, it was difficult to compare them except the frequency of vomiting which was higher in BLSG group but not statistically significant  since 2004 and recently published a prospective cohort study comparing BLRYGB with LRYGB  at 5\u00a0yeaThe main limitation of this study is the sample size. Although the sample size for BLSG is 96 and for NLSG is 51, the number of patients at each year is relatively low, with a decreasing number of patients each year, the difference in weight loss of the BLSG compared to the NLSG at 5\u00a0years has been impressive and statistically significant. The other limitation of the study was the lack of quality of life (QOL), satiety questionnaire, and GERD questionnaire data. These questionnaires would have helped to compare the complications more accurately and further the understanding on the mechanism of the banding the proximal stomach. That being said, it is important to note that this is the first paper with long-term outcomes for BLSG patients with a silicone ring. This is also the first study that shows the long-term outcomes of BLSG in severely obese patients. Most importantly, no severe ring-related complications were shown in the study.In summary, the results from this study show that BLSG was more effective in reducing and maintaining weight compared to the NLSG group at 5\u00a0years. More than 97% of the patients in the BLSG group had no weight regain at all, compared to the NLSG group, where only 80% of the patients had no weight regain, but 8% had an increase in BMI of more than five points 5\u00a0years following LSG surgery. Furthermore, the NLSG group had 35.2% of patients who had less than 50% EWL at 5\u00a0years follow-up compared to 0 patients in the BLSG group. This advantage of BLSG comes with a cost of higher late complication rates compared to the NLSG group; however most of these complications were minor and acceptable. There was no ring erosion, slippage, or migration seen with BLSG patients. BLSG surgery was found to be safe and effective in maintaining weight loss on the long term compared to the NLSG group with low incidence of band-related problems. Prospective comparative studies with large sample size are needed to further validate our results."}
+{"text": "We appreciate the comments by Buonocore et al., and the opportunity to respond. We acknowledged in our paper  that disWA models do not represent theoretical exposures related to well density. For the air pathway, calculated WA values are proxies for pollutants assumed to be emitted from well sites, which travel and persist in the air in sufficient concentrations that, upon reaching Pennsylvania residents, could potentially initiate the development of disease. If WA metrics worked as envisioned, \u2018high\u2019 exposure\u2014as a consequence of living closer to more and larger wells\u2013would be evidenced by relatively high concentrations of the pollutants assumed to be emitted from the wells. \u2018Very low\u2019 exposure would be evidenced by relatively low concentrations of air pollutants assumed to be emitted from the wells. This was what we tested in our analysis, which included benzene and almost all of the U.S. Environmental Protection Agency\u2019s criteria pollutants.Our analysis did not assess whether continuous values of well activity (WA) and air pollutant concentrations were correlated. The question we asked was whether there was general agreement between exposure classifications based on WA and air pollutant concentrations, which, at the end of the day, is how potential exposure misclassification can be assessed. We suspect that the WA approach was developed to leverage the rich health outcomes data available from the Geisinger Health System. However, the challenge these researchers faced was that population centers within the Geisinger catchment area are not, for the most part, located in areas of Pennsylvania with significant shale development. Neither are the Geisinger medical centers from which  cases were drawn. In other words, most of the study population included in the Geisinger studies did not live anywhere near shale development. The pollutants included in our analysis \u201chave fairly short atmospheric lifetimes and can only travel short distances.\u201d As a result, only a small proportion of subjects included in these studies could reasonably be expected to have any exposure to these pollutants from shale development operations via the air pathway.Potential exposure from oil and gas (O&G) operations \u201cvary both spatially and temporally, and act over short distances and time scales.\u201d WA models assume that all wells, in the same phase of development , continuously emit pollutants in all directions. There is no consideration of varying meteorological conditions mentioned by Buonocore et al. . None of these are realistic assumptions.The pollutants included in our analysis are not unique to shale development, but rather \u201ccome from a number of sources common in the area including vehicular traffic, combustion of coal and gas for electricity generation and home heating, not to mention natural gas processing and existing conventional O&G wells.\u201d WA models do not take any of these other point and mobile sources into account. This is especially significant given that the models estimate exposure for study subjects who are, for the most part, far from any unconventional development.Why does this matter? Buonocore et al. addressed this in their comments:Based on numbers provided in Casey et al. , we estiWe believe that the points raised by Buonocore et al. actually argue against the validity of WA models for assigning exposure in epidemiology studies, not against the validity of our analysis that evaluated them. These authors list many requirements for proper exposure estimation, yet do not acknowledge the potential for significant exposure misclassification in the Geisinger studies, which included none of these elements. We agree that epidemiology studies have a vital role to play in informing public policy around O&G development. However, if the Geisinger studies suffer from such a fundamental source of bias, their contribution to the assessment of health risks is limited. This is why, in our paper, we urged caution when relying on these studies for risk communication or policy development."}
+{"text": "CWC15. CWC15 associates with core components of the Arabidopsis NTC and its loss leads to inefficient splicing. Consistent with the central role of CWC15 in RNA splicing, cwc15 mutants are embryo lethal and additionally display strong defects in the female haploid phase. Interestingly, the haploid male gametophyte or pollen in Arabidopsis, on the other hand, can cope without functional CWC15, suggesting that developing pollen might be more tolerant to CWC15-mediated defects in splicing than either embryo or female gametophyte.Efficient mRNA splicing is a prerequisite for protein biosynthesis and the eukaryotic splicing machinery is evolutionarily conserved among species of various phyla. At its catalytic core resides the activated splicing complex Bact consisting of the three small nuclear ribonucleoprotein complexes (snRNPs) U2, U5 and U6 and the so-called NineTeen complex (NTC) which is important for spliceosomal activation. CWC15 is an integral part of the NTC in humans and it is associated with the NTC in other species. Here we show the ubiquitous expression and developmental importance of the Arabidopsis ortholog of yeast  In Arabidopsis, the female gametophyte is deeply embedded in sporophytic tissue, whereas the male gametophyte or pollen has to be released from the sporophytic anther tissue for pollination to occur. Upon successful pollen-stigma interaction, the pollen tube grows inside the transmitting tract towards the ovule. Recent research has revealed that several signaling molecules including peptides play a role in the guidance of the pollen tube, attraction by the female gametophyte and burst of the pollen tube tip within one of the two synergid cells. If any of the aforementioned processes is disrupted, fertilization does not take place. Several mutants with disruptions in these processes have been isolated in the past3. Upon successful fertilization, the Arabidopsis zygote initiates a precise developmental program, which results in a heart-shaped embryo already comprising all major seedling organs: two primary leaves or cotyledons, a shoot meristem, a hypocotyl, and a primary root with a root meristem4. This invariant embryo patterning and development is impaired in mutants defective for various cellular response pathways e.g. responses to phytohormones, small RNA pathways, vesicular trafficking, cytoskeletal structure, and cell cycle control9. Furthermore, mutations in genes that are components of the RNA splicing machinery (spliceosome) affect gametophyte function and embryogenesis. For example, mutations such as gfa1/clotho, rtf2, sus2/prp8, or bud13 cause severely reduced transmission of the mutant alleles via the female gametophyte and cause embryo lethality in Arabidopsis14.Angiosperms are the predominant group of land plants. A hallmark of this dominance in the course of evolution is the establishment of a reduced haploid phase  in the life cycle of flowering plants. In free-living gametophytes of mosses, the gametophytic generation forms independently recognizable plants that can even be the dominant structure. In contrast, the gametophyte of flowering plants is reduced to a small dependent structure with an almost minimal number of cells and a short lifetimetrans-esterification reactions, mediated by the spliceosome, a dynamic protein complex containing more than 100 proteins and 5 small nuclear ribonucleoprotein particles (snRNP)15, which is likely highly conserved among eukaryotes. The snRNPs consecutively interact with the pre-mRNA. First, U1 snRNP and U2 snRNP interact with the splice and the branch site, respectively. Then U4/U6-U5 snRNPs and the PRP19-CDCL5 complex  associate, thereby forming the pre-catalytic spliceosome16. After the dissociation of U4 snRNP, the Prp19 complex stabilizes the interaction of U5 snRNP and U6 snRNP with the spliceosome18. Recent studies using cryo-EM uncovered detailed spliceosomal structures during various steps of mRNA splicing. The NTC/PRP19 complex is highly conserved between yeast and human and contains six and seven core proteins, respectively22. Important for the function of the active spliceosome are also the so-called NTC-related (NTR) proteins, of which CWC15 is a member.The pivotal step of splicing\u2014intron removal\u2014constitutes two Schizosaccharomyces pombe and it is synthetically lethal with prp19-1 in Saccharomyces cerevisiae23. Furthermore, in S. cerevisiae it was shown that the core spliceosome components are not equally important for all pre-mRNAs, perhaps explaining why in Arabidopsis the absence of several components might affect tissues differently24. Regarding multicellular eukaryotes, CWC15 was suggested to be important for bovine embryo development25. In Arabidopsis thaliana, CWC15 was not found in a proteomic approach as a member of the NTC26. Many genes coding for components of the core splicing machinery are duplicated in Arabidopsis although mutations in single-copy genes frequently result in gametophytic cell death26. Interestingly, the phenotypic consequences of mutations in spliceosomal genes are different between female and male gametophytes. Mutations in CLOTHO, which is a homolog of the yeast U5-associated Snu114, and ATROPOS, whose homolog has a demonstrated role in U2 assembly27, result in defective female gametophytes, whereas male transmission is less severely affected11.The developmental importance of Cwc15 was shown in yeast as a loss of function of Cwc15 confers lethality in Arabidopsis thaliana. Our results show that CWC15 is associated with homologs of core yeast and human spliceosome components. Furthermore, CWC15 is essential for plant development including embryo development as splicing is affected on a whole-genome level. CWC15 also plays some role in the female gametophyte, however, pollen development proceeds normally in the absence of CWC15.In this work, we address the importance of the predicted splicing factor CWC15 in the model plant 28. Our thorough phylogenetic analysis revealed the evolutionary conservation of CWC15 across all eukaryotes  and transcription factor AUXIN RESPONSE FACTOR 5 (ARF5) and carried out immunoprecipitation followed by liquid chromatography\u2013mass spectrometry (LC\u2013MS). Both IMP\u03b16 and ARF5 are also localized to the nucleus, but functionally distinct from CWC1530. We looked for peptides that were specifically enriched in the CWC15 but absent in the two other immuno-precipitates. The most abundant peptides recovered were Arabidopsis counterparts of the human Prp19 complex (NTC), U5 snRNP, and NTC-related proteins (NTR) (Table 31. In addition to CWC15 itself (Ad-002 in human spliceosome), we found a homolog for the human NTC-related (NTR) protein Aquarius, which like CWC15 is required for embryo viability in Arabidopsis (EMB2765)32. Adding peptides with lower counts to our analysis, we detected a majority of all components of the U5 snRNP, NTC, NTR, and associated splicing factors  RT-PCR  in expression levels , rather than a change in splice-site preference .The analysis of differential splicing through diffSpliSE in SpliSER  enrichment analysis for differentially spliced and expressed genes in pollen and seedlings . When we opened siliques of selfed cwc15-2/\u2212+ plants we found missing and shriveled ovules compared to WT, corresponding to aborted ovules , which suggested that cell identity was not affected in these lines  and a centromeric CenH3-mCherry fusion protein (HTR12-mCherry). Upon fertilization, the HTR10-YFP protein is turned over while zygote and endosperm show mCherry fluorescence at the centromeric chromatin, resulting in distinct foci in the zygote and endosperm nuclei43. CWC15 loss of function resulted in a range of phenotypic consequences in pollen tube perception and fertilization  indicated, as well as the aforementioned reciprocal crosses, that a low percentage of ovules in cwc15-2\u2212+/ plants and their egg cells within can be fertilized. To investigate at which stage cwc15-2\u2212/\u2212 zygote/embryo development might be arrested, we looked at ovules in cwc15-2+/\u2212 plants in self-pollinated flowers 72\u00a0h after pollination. We were able to identify seemingly aborted or delayed embryos at zygote and the earliest embryo stages of development 33. One of the single-copy genes previously associated with the splicing machinery is CWC15. Our thorough phylogenetic analysis indicated that CWC15 is present and conserved in virtually all eukaryotic genomes. Until recently, knowledge about the exact function of CWC15 has been scarce. Protein\u2013protein interaction data revealed CWC15 as a protein associated with yeast and human spliceosomes46. CWC15 was later considered an integral part of the Prp19 complex/NTC through its direct interaction with CDC548. In Arabidopsis, however, co-precipitation with Prp19 could not be demonstrated and CWC15 was therefore deemed not being part of the NTC49. In contrast, our mass spectrometry-based analysis showed co-precipitation of most Arabidopsis NTC components with CWC15, indicating that there is a close interaction of CWC15 with the NTC in Arabidopsis. We also detected other components of the core spliceosomal machinery, which is in line with recent structural data gained from yeast and human spliceosomes. The yeast homolog Cwf15/Cwc15 interacts with several U5 snRNA components and together with Prp45 is thought to be important for the stability of the spliceosomal core or main body52. Like the yeast multi-protein complex, the human CWC15 counterpart Ad-002 is also present at the core region of the human spliceosome53 and might be modified by human spliceosome-specific peptidyl-prolyl isomerases for functional catalytic activity54. Structures of plant spliceosomes have yet to be determined, but Arabidopsis CWC15 possibly has a similarly central role in the spliceosomal multi-protein complex as do the homologous proteins in yeast and human.Although the eukaryotic spliceosome machinery is evolutionarily conserved, there are species-specific differences. The spliceosome and the activating NineTeen complex show differences in both the number and nature of proteins involved between yeast, human and Arabidopsis55. The prevalent form of AS in animals is exon skipping56. We have utilized an approach that allows the detection of specific splice-sites that show aberrant usage between samples40. It has been estimated that 61% of Arabidopsis genes undergo AS, with the majority of AS events being intron retention57 which in turn leads to nonsense-mediated decay (NMD) of the affected transcript56. However, in plants retained introns do not always trigger NMD58. In Arabidopsis, AS can be achieved by cell type-specific expression patterns of splicing factors60 and this has been studied mainly during flowering time61. In our work, RNA sequencing analysis in a hypomorphic mutant background with seedling and adult growth defects showed that a decrease in CWC15 protein abundance causes clear splicing defects. While differences in splicing can lead to expression differences, in cwc15 mutants, the observed differences in gene expression cannot be solely attributed to splicing defects. Additional changes in expression may be secondary effects resulting from splicing abnormalities. The phenotypic severity increased strongly in a putative knock-out mutant of CWC15 which showed pleiotropic fertilization defects and was embryo lethal. It has been previously shown that mutations in splicing factors primarily affect the viability of the female gametophyte63. Likewise, loss of the splicing factor CWC15 caused strongly decreased transmission via the female gametophyte while the pollen was entirely unaffected. Several studies detected new transcripts, differential splicing and even alternative transcriptional start sites in pollen when compared to leaf tissues65. However, transcripts enriched in pollen appear to have roles in splicing which could contribute to increased robustness of the pollen when compared to the egg cell. It has been shown that so-called housekeeping genes can be linked to specific mutant phenotypes as is the case for various splicing factors that affect the development of the female gametophyte66. This could explain why the loss of CWC15, and other splicing factors causes different phenotypes between male and female gametophytes. Curiously, recent research showed that a pair of splicing factors specifically affects the male gametophyte in double mutants but not the female gametophyte67. Future research will show if the composition of the splicing machinery in plants is indeed tissue-specific and is possibly involved in the different needs of various tissue types during development.Alternative splicing (AS) is very common in humans, where essentially 100% of the transcripts have at least two isoforms35. The T-DNA insertion line cwc15-2+/\u2212  was provided by the Nottingham Arabidopsis Stock Centre (NASC). The transgenic marker lines for specific cell types in the female gametophyte pEC1:HTA6-3xeGFP, pNTA\u2009>\u2009>\u2009ntdTomato, and pMEA:3xGFP as well as the multi-color marker were previously described68.The wild-type plant line used was the Col-0 accession and plants were grown as previously described69. Representation of protein sequence alignment in RasMol color and sequence conservation was done with CLC Genomics Workbench software version 10.1.1.Acquisition of protein sequences, sequence alignment, and generation of the phylogenetic tree was performed as shown beforeGIIK-tNOS (CWC15 genomic start and stop primers) and GIIK-3xeGFP-tNOS (CWC15 genomic start and -TAG stop primers), respectively, using restriction enzymes SalI/BclI. GIIK-pRPS5A:CWC15-tNOS was cloned by PCR amplifying the 693\u00a0bp CWC15 coding sequence (CDS) with CWC15 CDS start and stop primers and inserting the CDS into GIIK-pRPS5A-tNOS70 using restriction site BclI. The construct for early embryo expression was cloned by amplifying a 2\u00a0kb promoter element upstream of the AT3G10100 start codon35 with AT3G10100 start and stop primers and inserting the amplicon into GIIK-tNOS, using restriction enzymes XhoI/SmaI. The CWC15 CDS was subsequently amplified with CWC15 CDS start and stop primers, and restriction enzyme BclI was used for cloning into GIIK-pAT3G10100-tNOS.The sequences of primers used in this study are listed in Supplementary Table cwc15-1 seedlings 6\u00a0days after germination (6 dag), using the Qiagen DNeasy Plant Mini Kit. Libraries for DNA Next Generation Sequencing (NGS) were prepared with 1\u00a0\u00b5g DNA, using the Illumina TruSeq DNA PCR-free Low Throughput Library Prep Kit and Single Indexes Set A, and sequenced on an Illumina HiSeq 2000 machine. The transgenic insertion site in cwc15-1 was initially determined by aligning sequencing reads to the Arabidopsis genome (https://www.araport.org/data/araport11) and the border region of the transgenic construct, using CLC Genomics Workbench software version 10.1.1. The insertion site was confirmed by PCR genotyping of border regions, using transgenic and genomic primers , and subsequently by Sanger sequencing of PCR products.Genomic DNA was extracted from pooled cwc15-2 T-DNA allele was genotyped with primers cwc15-2 RP, cwc15-2 LP, and T-DNA-specific primer LBa1 . The cwc15-2\u2212 insertion site was determined by sequencing the T-DNA allele PCR product, using primer LBb1.3.The cwc15-1 mature pollen or pooled seedlings 6 dag, using the Qiagen RNeasy Plant Mini Kit and on-column DNase digest (Qiagen RNase-free DNase Set). Reverse transcription was carried out with 1\u00a0\u00b5g total RNA using the RevertAid RT Reverse Transcription Kit (Thermo Scientific). For sqRT-PCR analysis, the following PCR conditions were used: 94\u00b0 for 5\u00a0min followed by 30 or 35 cycles of 94\u00b0 for 10\u00a0s, 58\u00b0 for 30\u00a0s, and 72\u00b0 for 1\u00a0min with a final extension step 72\u00b0 for 5\u00a0min. For qRT-PCR analysis, we used the intronless and ubiquitously expressed control gene UBQ10 for normalization and the following PCR program: 95\u00b0 for 3\u00a0min followed by 40 cycles of 95\u00b0 for 10\u00a0s, 60\u00b0 for 10\u00a0s, and 72\u00b0 for 20\u00a0s. Gene AT3G08950 as an example for splice-site usage was randomly chosen from among the top sites from Supplementary Dataset AT2G34060 was among the not statistically significant sites. All primers used can be found in Supplementary Table Total RNA was extracted from Col-0 and 71, taking only uniquely mapping reads, with minimum intron size 20, and maximum intron size 6,000. A splice junction BED file was generated using RegTools v0.5.272 with the same intron limits. Each mapped RNA-seq sample was processed with SpliSER v0.1.1 and analyzed using the diffSpliSE pipeline40. To maintain the accuracy of the quantification, a splice site would be filtered out unless each replicate being assessed had at least 10 reads showing evidence of its utilization, or non-utilization. When comparing RNA from wild-type and cwc15-1 seedlings, SpliSER detected 247,741 splice sites with sufficient read coverage in all samples; in pollen 66,191 splice sites were detected with sufficient read coverage in all samples.Gene lists for differential expression and splicing analysis as well as GO terms can be found in the Supplementary Dataset Files 73. Differential gene expression was called using DESeq2 v1.22.274 with read counts normalized using the sizeFactors function. Genes with a corrected p-value\u2009<\u20090.05 and log2FoldChange\u2009>\u2009\u2009\u00b1\u20092 were taken as differentially expressed. Differential gene expression PCA plots used DESeq2 regularized-log transformation read counts (rlog function). Overlaps between gene lists were tested through hypergeometric probabilities. Venn diagrams were generated with Venn Diagram Plotter Software v1.5.5228 (https://omics.pnl.gov/software/venn-diagram-plotter). For gene ontology (GO) enrichment analysis, we took lists of genes that showed differential expression or that contained differentially spliced sites. Gene lists were uploaded to the AgriGO web portal (v2.0)75, and we performed singular enrichment analysis using the TAIR10_2017 background gene set. A corrected p-value less than 0.05 was considered to be significant.For differential gene expression analysis, read counts were extracted from RNA-seq alignments using featureCounts v1.5.143. Images of embryos were taken with a Zeiss Axio Imager. Fluorescent proteins were imaged using Leica TCS SP8, Olympus FV1000, or Zeiss LSM780 NLO confocal laser scanning microscopes and LAS X, FLUOVIEW, or ZEN software respectively. Images were processed using ImageJ version 1.52i and Adobe Photoshop and Illustrator CS6.Images of seedlings and plants were taken with a Canon EOS 1000D camera. Clearing of ovules or embryos and staining with SR2200 were done as previously described77. Briefly, 1\u20132\u00a0g fresh weight seedling material was ground in liquid nitrogen, using mortar and pestle. The resultant seedling powder was suspended in 2\u20133\u00a0ml lysis buffer  containing 20\u201330\u00a0\u00b5l Protease Inhibitor Cocktail . After centrifugation, the supernatant was filtered with Miracloth  and 2\u00a0ml of the supernatant was incubated with 20\u00a0\u00b5l GFP-Trap beads (Chromotek) for 3\u00a0h at 4\u00a0\u00b0C, using a tube rotator. The magnetic beads were washed three times with wash buffer  on a magnetic stand. Bead-bound proteins were eluted by boiling in 1\u2009\u00d7\u2009Laemmli buffer and purified by SDS-PAGE followed by in-gel Trypsin digest. The digested peptides were subjected to LC\u2013MS/MS analysis and MS spectra were processed with MaxQuant package software version 1.5.2.8 with integrated Andromeda search engine78.Precipitation of GFP-tagged proteins from seedlings 6 dag and subsequent mass spectrometry analysis was in essence the exact same procedure as was described previouslySupplementary Dataset File 1.Supplementary Dataset File 2.Supplementary Legends.Supplementary Figure 1.Supplementary Figure 2.Supplementary Figure 3.Supplementary Figure 4.Supplementary Figure 5.Supplementary Figure 6.Supplementary Figure 7.Supplementary Video 1.Supplementary Video 2.Supplementary Video 3.Supplementary Table 1.Supplementary Table 2.Supplementary Table 3.Supplementary Table 4."}
+{"text": "Stable Coexistence under Low Aspiration, Dependent Coexistence under Moderate aspiration and Defection Explosion under High Aspiration respectively. Furthermore, a deep analysis is performed on the local structures which cause defectors\u2019 re-expansion, the concept of END- and EXP-periods are used to justify the mechanism of network reciprocity in view of time-evolution, typical feature nodes for defectors\u2019 re-expansion called Infectors, Infected nodes and High-risk cooperators respectively are found. Compared to fixed aspiration model, dynamic aspiration introduces a more satisfactory explanation on population evolution laws and can promote deeper comprehension for the principle of prisoner\u2019s dilemma.Prisoner\u2019s dilemma game is the most commonly used model of spatial evolutionary game which is considered as a paradigm to portray competition among selfish individuals. In recent years, Win-Stay-Lose-Learn, a strategy updating rule base on aspiration, has been proved to be an effective model to promote cooperation in spatial prisoner\u2019s dilemma game, which leads aspiration to receive lots of attention. In this paper, according to Expected Value Theory and Achievement Motivation Theory, we propose a dynamic aspiration model based on Win-Stay-Lose-Learn rule in which individual\u2019s aspiration is inspired by its payoff. It is found that dynamic aspiration has a significant impact on the evolution process, and different initial aspirations lead to different results, which are called  The emergence and stability of cooperative behavior among selfish individuals is a challenging problem in biology, sociology and economics . The priSince the pioneering work of Nowak and May , spatialOverview, Stable Coexistence under Low Aspiration, Dependent Coexistence under Moderate aspiration and Defection Explosion under High Aspiration. The concept of enduring (END) and expanding (EXP) periods  stands for the sensitivity of aspiration. Higher a means individual\u2019s aspiration is changed more drastically by its payoff. Previous work with fixed aspiration is equivalent to the case a = 0, and a = 1 means that individual\u2019s aspiration totally depends on its payoff from the last step. Considering that one\u2019s aspiration should not be changed too drastically, we set a = 0.01 in our model.(c)n Theory , in a ret are denoted as The step (a)-(c) will repeat 100,000 times in one simulation. The fraction of cooperators and defectors at step A. As the main parameters, we consider the initial aspiration level A and the temptation to defect b. b for different aspiration levels. It is found that the aspiration level has a significant influence on Stable Coexistence under Low Aspiration, Dependent Coexistence under Moderate aspiration and Defection Explosion under High Aspiration could be observed for different values of A. For small values of A (A = 0 and A = 0.8), b is. For large values of A (A \u2265 2.4), cooperators could hardly survive for any b > 1.0. An interesting phenomenon is discovered for moderate values of A (A = 1.6) that when b is lower than 1.6, cooperators could not survive and b is higher than 1.6, cooperation could survive and b is, the harder cooperators survive, which is inconsistent with our experimental results. Above unusual phenomenon is the focus in our paper.Our experiment is performed on the 100 \u00d7 100 square lattice with periodic boundary conditions. In initial, cooperators and defectors are distributed uniformly at random occupying half of the square lattice respectively, and all the nodes are given the same initial aspiration A, individual\u2019s aspiration is easy to be satisfied so cooperators and defectors can coexist. For A = 0, all the nodes are satisfied and never change their strategies, so A = 0.8, there are only a few nodes whose four neighbors are all defectors will be dissatisfied: if it is a cooperator, it will change its strategy to A \u2208  and die out for lower b(b < A) when 1.0 < A \u2264 2.0, which is abnormal because higher b should have meant that it is harder for the cooperators to survive, and it is called Dependent Coexistence under Moderate aspiration. The local structure leading to the defectors\u2019 expansion is that a cooperator is surrounded by one cooperator and three defectors. Dynamic aspiration plays an important role for the above results because a constantly changing individual(Infectors) may make its neighbors\u2019 (Infected nodes) aspirations gradually rise up and they will become Infectors. At the same time, all the other cooperators\u2019 aspirations gradually rise up and they become High-risk cooperators. When a High-risk cooperator neighbors with an Infector, it will become a defector soon and chain phenomenon happens.Three different phases are found. Cooperators and defectors can coexist for small values of Our work provides a new enlightening opinion for the Win-Stay-Lose-Learn strategy updating rule. Dynamic aspiration introduces a more satisfactory explanation on population evolution laws. Under the mechanism of network reciprocity, the defectors\u2019 re-expansion is got attentions. How to avoid such unfavorable phenomenon under moderate aspirations is still a challenging problem. It is hoped that our work offers a valuable method that can help explore the principle behind prisoner\u2019s dilemma better, especially when combining with other rules which use aspiration level for personal decision making such as myopic, other-regarding preference or Pavlov-rule \u201357.S1 File(RAR)Click here for additional data file. 9 Nov 2020PONE-D-20-31850Dynamic aspiration based on Win-Stay-Lose-Learn rule in Spatial Prisoner's Dilemma GamePLOS ONEDear Dr. Wei,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Dec 24 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Jun TanimotoAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2.We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. \u00a0http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.\u00a0 If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website A clean copy of the edited manuscript (uploaded as the new *manuscript* file)http://journals.plos.org/plosone/s/data-availability.3.In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter.4. One of the noted authors is a group or consortium [Lorem Ipsum Consortium]. In addition to naming the author group, please list the individual authors and affiliations within this group in the acknowledgments section of your manuscript. Please also indicate clearly a lead author for this group along with a contact email address.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Although what the authors did report here is simple, this work contains somehow interesting and new findings. The most important kernel in their model is dovetailing PW-Fermi with the concept of WSLS, where an agent updates his strategy by PW-Fermi (Eq. (1)) when he only obtains less than his aspiration; A_i that is individually updated by Eq. (2). This is quite simple, yet no one has ever explored. They presumed spatial game setting, and what-is-called Boundary game where T=b+1, R=1, and P=S=0.The main result is Fig. 1, which delivers enhanced network reciprocity (cooperation fraction) when varying initial aspiration level; A_i(t=0). If the initial A_i is sufficiently less than the payoff, there is no incentive to brush-up his/ her strategy. Thus, initial cooperation fraction, perhaps 0.5, would be preserved. Interestingly, presuming an intermediate A_i, say 1.6, the network reciprocity still shows robust even in higher dilemma region (higher b). In the latter part of MS, the authors discusses why such interesting result happens.As a whole, I feel a positive impression from the MS. Yet, I would like to give several suggestions as below so as to improve the MS more impressive to the audience of Plos One.#1.Although they insisted Prisoner\u2019s Dilemma, what they explored is quite specific game, called Boundary game as I said above, which has only Chicken-type dilemma; Dg\u2019:=(T-R)/(R-P) and zero Stag Hunt-type dilemma; Dr\u2019=(P-S)/(R-P). Although I\u2019ve recognized so many people favored to use Boundary game as archetype of PD under the name of \u2018weak PD\u2019, I would say this is not typical PD at all. Why people favoring is that this specific game ensures single parameter; b=T-R representing dilemma extent. What I\u2018ve always suggested is that one should adopt what-is-called Donor and Recipient (D & R) game where T=b, R=b-c, P=0, and S=-c meaning Dg\u2019=Dr\u2019=c/(b-c). It is because D & R game also allows single parameterization. More importantly, D & R game can be said more appropriate to represent PD since both Chicken- and SH-types dilemmas exist. In fact amid theoretical biologists, D & G game is much more favored as a template.To this end, I strongly suggest the authors to get numerical results based on D & R games where varying Dg\u2019=Dr\u2019 ranging  instead of Boundary game. If it is the case, instead of boring line graph; Fig. 1, the authors can draw the heatmap of cooperation fraction drawn on 2D plane of Dg\u2019=Dr\u2019 and initial A_i, which is much more impressive.Also the authors should explain the concept of universal dilemma strength; Dg\u2019 and Dr\u2019 by citing relevant literature as below for example.Evolutionary Games with Sociophysics: Analysis of Traffic Flow and Epidemics, Springer, 2019.Fundamentals of Evolutionary Game Theory and its Applications, Springer, 2015.Tanimoto & Sagara; Relationship between dilemma occurrence and the existence of a weakly dominant strategy in a two-player symmetric game, BioSystems 90(1), 105-114, 2007.Wang et al.; Universal scaling for the dilemma strength in evolutionary games, Physics of Life Reviews 14, 1-30, 2015.Ito et al.; Scaling the phase- planes of social dilemma strengths shows game-class changes in the five rules governing the evolution of cooperation, Royal Society Open Science, 181085, 2018.Ito et al.; Dynamic utility: the sixth reciprocity mechanism for the evolution of cooperation, Royal Society Open Science 7, 200891, 2020.Arefin et al.; Tanimoto, J.; Social efficiency deficit deciphers social dilemmas, Scientific Reports 10, 16092, 2020.#2.With respect to the mechanism incurring such interesting phenomenon as I mentioned above, the authors should be take insight scope to deepen their discussion. One suggestion is that the concept of END- and EXP-periods that substantially justifies the mechanism of network reciprocity in view of time-evolution. By showing some time-evolution with coherent snapshot aside, further discussion should be explored. When referring to the concept of END- and EXP-periods, the authors should cite following relevant literatures.Wang et al.; Insight on the so-called spatial reciprocity, Physical Review E 88, 042145, 2013.Ogasawara et al.; Effect of a large gaming neighborhood and a strategy adaptation neighborhood for bolstering network reciprocity in a prisoner's dilemma game, Journal of Statistical Mechanics: Theory and Experiment, P12024, 2014.Kabir et al.; Influence of bolstering network reciprocity in the evolutionary spatial Prisoner\u2019s Dilemma game: A perspective, European Physical Journal B 91, 312, 2018.#3.Very recently, there have been reported some theoretical works concerning dynamic aspiration model where aspiration time-evolves like what the authors presumed. The authors should review those. For instance;Arefin et al.; Evolution of cooperation in social dilemmas under the coexistence of aspiration and imitation mechanisms, Physical Review E 102, 032120, 2020.Reviewer #2:\u00a0The manuscript \"Dynamic aspiration based on Win-Stay-Lose-Learn rule in Spatial Prisoner's Dilemma Game\" begins by explaining why the evolution of cooperation is a \"challenging problem\", but then goes on to introduce an evolutionary model in which cooperation cannot evolve (see below). Such a model cannot teach us anything about the evolution of cooperation, and therefore has no place in a respectable journal.The manuscript is riddled with errors. Some are mostly harmless, such as:\u2022 Lorem Ipsum Consortium listed as an author.correspondingauthor@institute.edu>.\u2022 The corresponding author's mail address is given as <\u2022 Sucker's payoff being called suck's payoff.Other errors suggest that the authors don't really know what they are talking about:\u2022 Instead of \"defection is better for selfish individuals to survive in population\", the sentence should say something along the lines of \"defection is favoured by evolutionary selection\".\u2022 The authors say that the evolution of defection in prisoner's dilemma \"is called the tragedy of the commons\". It's not! The tragedy of the commons refers to the overuse of common-pool resources by agents who act in a seemingly rational way.\u2022 Weak prisoner's dilemma is characterised as \"convenient but without losing the accuracy of theresults\". The choice of one evolutionary game over the other has nothing to do with the accuracy of results.Furthermore, the use of English is sometimes beyond interpretable. Some examples of cryptic sentences include:\u2022 \"As a result, the intrinsic structures leading to defectors\u2019 expansion and cooperators\u2019 survival are achieved for different evolution process, which provides a penetrating understanding of the evolution\". What are 'intrinsic structures'? Which 'evolutionary processes'? What is 'penetrating understanding'?\u2022 \"However, we can easily observe numerous cooperation phenomenon in various scenarios\". What are cooperation phenomena?\u2022 \"If one\u2019s payoff is higher than its aspiration, it tends to be increased, otherwise decreased\". What gets increased or decreased?\u2022 \"This is consistent with our normal perception because no one can hold a high aspiration for continued low payoff\". Perception of what? Why aspiration cannot be held high in the face of continued low payoffs?\u2022 \"One can see that although cooperators take advantage in quantity in the process, defectors finally occupy the network when it is stable\". How does one take advantage in quantity? And in what process?The above issues notwithstanding, the biggest problem of this manuscript is that the model doesn't really teach us anything about the evolution of cooperation:\u2022 When the value of the parameter A is small, every agent is satisfied, which effectively halts selection.\u2022 When the value of the parameter A is large, every agent is dissatisfied. Selection proceeds as it normally would, causing defector domination for all but the smallest value of the temptation b.\u2022 Finally, when the value of the parameter A is intermediate, selection can be halted for a large enough number of agents to freeze the system state before all cooperators get wiped out.correspondingauthor@institute.edu>Cooperation in this model can never evolve, it can only be saved from extinction.</**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 16 Dec 2020Response to Editor:\u00a0Thanks for your work! We have read reviewers\u2019 advice carefully and modified the paper with response to reviewers. Besides, our response to Journal Requirements is as below:#1\uff1ahttps://journals.plos.org/plosone/s/latex.Thank you for your advice! We have used your template for LaTeX which is downloaded in #2\uff1aWe have checked our manuscript for language usage, spelling, and grammar carefully and fixed previous errors.#3\uff1aAll relevant data are within the manuscript and its Supporting Information files.#4\uff1aThe author \u201caLorem Ipsum Consortium\u201d is a mistake and we have deleted it.Response to Reviewer #1:\u00a0Thanks for your review to our work. We have read your advice carefully and modified the paper. Our response to your comments is as below:#1.Suggestion: Although they insisted Prisoner\u2019s Dilemma, what they explored is quite specific game, called Boundary game as I said above, which has only Chicken-type dilemma; Dg\u2019:=(T-R)/(R-P) and zero Stag Hunt-type dilemma; Dr\u2019=(P-S)/(R-P). Although I\u2019ve recognized so many people favored to use Boundary game as archetype of PD under the name of \u2018weak PD\u2019, I would say this is not typical PD at all. Why people favoring is that this specific game ensures single parameter; b=T-R representing dilemma extent. What I\u2018ve always suggested is that one should adopt what-is-called Donor and Recipient (D & R) game where T=b, R=b-c, P=0, and S=-c meaning Dg\u2019=Dr\u2019=c/(b-c). It is because D & R game also allows single parameterization. More importantly, D & R game can be said more appropriate to represent PD since both Chicken- and SH-types dilemmas exist. In fact amid theoretical biologists, D & G game is much more favored as a template.To this end, I strongly suggest the authors to get numerical results based on D & R games where varying Dg\u2019=Dr\u2019 ranging  instead of Boundary game. If it is the case, instead of boring line graph; Fig. 1, the authors can draw the heatmap of cooperation fraction drawn on 2D plane of Dg\u2019=Dr\u2019 and initial A_i, which is much more impressive.Also the authors should explain the concept of universal dilemma strength; Dg\u2019 and Dr\u2019 by citing relevant literature as below for example.Evolutionary Games with Sociophysics: Analysis of Traffic Flow and Epidemics, Springer, 2019.Fundamentals of Evolutionary Game Theory and its Applications, Springer, 2015.Tanimoto & Sagara; Relationship between dilemma occurrence and the existence of a weakly dominant strategy in a two-player symmetric game, BioSystems 90(1), 105-114, 2007.Wang et al.; Universal scaling for the dilemma strength in evolutionary games, Physics of Life Reviews 14, 1-30, 2015.Ito et al.; Scaling the phase- planes of social dilemma strengths shows game-class changes in the five rules governing the evolution of cooperation, Royal Society Open Science, 181085, 2018.Ito et al.; Dynamic utility: the sixth reciprocity mechanism for the evolution of cooperation, Royal Society Open Science 7, 200891, 2020.Arefin et al.; Tanimoto, J.; Social efficiency deficit deciphers social dilemmas, Scientific Reports 10, 16092, 2020.Response:We have read some related papers you recommended and know that many researchers were using Donor and Recipient (D & R) game to representative the PD game. However, there are also many researchers using boundary game. For instance,Liu Y, Chen X, Zhang L, et al. Win-stay-lose-learn promotes cooperation in the spatial prisoner's dilemma game[J]. PloS one, 2012, 7(2): e30689.Chu C, Liu J, Shen C, et al. Win-stay-lose-learn promotes cooperation in the prisoner\u2019s dilemma game with voluntary participation[J]. Plos one, 2017, 12(2): e0171680.Yang H X, Tian L. Enhancement of cooperation through conformity-driven reproductive ability[J]. Chaos, Solitons & Fractals, 2017, 103: 159-162.Wu T, Wang H, Yang J, et al. The prisoner\u2019s dilemma game on scale-free networks with heterogeneous imitation capability[J]. International Journal of Modern Physics C, 2018, 29(09): 1850077.Our experiments show that if the sucker\u2019s payoff S is very close to 0 , the Monte Carlo simulation result is almost the same as S=0, and then we assume S=0. The boundary game is a state of PD game where S is close to P and P=b is the only variable parameter. As for Donor and Recipient game, it is a more universal model where both S and P are variable and Dg\u2019=Dr\u2019 can be set to allow single parameterization. Our work focuses on the phenomenon under different values of A and T(=b) and the same value of S. We have found some typical local structures which cause defectors\u2019 expansion under S=0, where infectors and infected nodes play important roles. We also mention the two kinds of game in our revised draft and cite the references all you mentioned(in page 3 of the paper). Besides, we also use the Donor and Recipient (D & R) game to do the Monte Carlo simulation, but since different values of S may lead different results, the experimental phenomena is different from our work. I think using Donor and Recipient (D & R) game is more valuable and we will focus on it in the future.#2.Suggestion: With respect to the mechanism incurring such interesting phenomenon as I mentioned above, the authors should be take insight scope to deepen their discussion. One suggestion is that the concept of END- and EXP-periods that substantially justifies the mechanism of network reciprocity in view of time-evolution. By showing some time-evolution with coherent snapshot aside, further discussion should be explored. When referring to the concept of END- and EXP-periods, the authors should cite following relevant literatures.Wang et al.; Insight on the so-called spatial reciprocity, Physical Review E 88, 042145, 2013.Ogasawara et al.; Effect of a large gaming neighborhood and a strategy adaptation neighborhood for bolstering network reciprocity in a prisoner's dilemma game, Journal of Statistical Mechanics: Theory and Experiment, P12024, 2014.Kabir et al.; Influence of bolstering network reciprocity in the evolutionary spatial Prisoner\u2019s Dilemma game: A perspective, European Physical Journal B 91, 312, 2018.Response: We have learned the concept of END- and EXP-periods from the papers you recommended and used the concept to deepen our discussion for the time-evolution of A=1.6 and b=1.2 in our revised draft (in page 5 of the paper). Besides, some new concept, including Infector, Infected node and High-risk cooperator are introduced in our revised draft (from page 6 of the paper)to explain our results better. The above concepts can help readers to understand why defectors can expand in the dynamic aspiration model together. Here are some of our modifications in the paper:\u201cOne can see that although cooperators can survive in the END period and expand in the EXP period by forming clusters, defectors finally occupy the network when it is stable. The network reciprocity is undermined by dynamic aspirations. In dynamic aspiration models, cooperators' aspirations will become too high to endure defectors' re-expansion because of the long-term satisfaction. which is different from the fixed aspiration model.\u201d (page 6-7 of the paper)\u201cIn the network with random setup, during the END and EXP period, cooperators will survive and expand by the mechanism of network reciprocity. But once there is at least one Infector who has three D neighbors and one C neighbor initially, defectors will re-expand to the whole network.\u201d (page 10 of the paper)\u201cCooperators can survive by forming clusters, but since the values of b is higher, these clusters couldn't expand. The above evolution process only go through the END period and then the network have been stable.\u201d (page 10 of the paper)\u201cTo conclude, for moderate values of A, cooperators will survive and expand in the early stages of evolution when $b$ is lower than A, which we call END and EXP periods respectively. But according to our results, the existence of Infectors may lead to defectors' re-expansion. The core reason for this phenomenon is the cooperators increase their aspirations excessively and become the so-called High-risk cooperators, which needs to be vigilant in the evolution process of cooperation.\u201d (page 11 of the paper)\u201cDynamic aspiration plays an important role for the above results because a constantly changing individual(Infectors) may make its neighbors' (Infected nodes) aspirations gradually rise up and they will become Infectors. At the same time, all the other cooperators' aspiration are gradually rising up and they become High-risk cooperators. When a High-risk cooperator neighbors with an Infector, it will become a defector soon and chain phenomenon happens.\u201d (page 14 of the paper)#3.Suggestion: Very recently, there have been reported some theoretical works concerning dynamic aspiration model where aspiration time-evolves like what the authors presumed. The authors should review those. For instance;Arefin et al.; Evolution of cooperation in social dilemmas under the coexistence of aspiration and imitation mechanisms, Physical Review E 102, 032120, 2020.Response: We have read the paper carefully mentioned in the comments, with some other references about dynamic aspirations. The dynamic aspiration purposed in these papers aim the coexistence of aspiration and imitation mechanisms or how cooperation spreads, which is related but has different concentrations with our work. Our work\u2019s focus is how defectors can expand with the impact of Infectors and High-risk cooperators in dynamic aspiration model. Besides, we have cited these papers you mentioned in our revised draft(in page 2 of the paper).Response to Reviewer #2:\u00a0Thanks for your review to our work. We have read your advice carefully and modified the paper. Our response to your comments is as below:In your review comments, you mentioned some language errors in our paper so that we have checked our paper and fixed them:(1)Suggestion: Lorem Ipsum Consortium listed as an author.Response: \u201cLorem Ipsum Consortium\u201d has been deleted. (page 1 of the paper)(2)Suggestion: The corresponding author's mail address is given as\u00a0.Response: The corresponding author's mail address has been corrected.(page 1 of the paper)(3)Suggestion: Sucker's payoff being called suck's payoff.Response: \u201cSuck's payoff\u201d has been corrected as \u201csucker's payoff\u201d. (page 3 of the paper)(4)Suggestion: Instead of \"defection is better for selfish individuals to survive in population\", the sentence should say something along the lines of \"defection is favoured by evolutionary selection\".Response: The sentence \"defection is better for selfish individuals to survive in population\" is not very appropriate and it has been corrected as \"defection is favoured by evolutionary selection\" by your suggestion. (page 1 of the paper)(5)Suggestion: The authors say that the evolution of defection in prisoner's dilemma \"is called the tragedy of the commons\". It's not! The tragedy of the commons refers to the overuse of common-pool resources by agents who act in a seemingly rational way.Response: We are sorry that we have not figured out the meaning of \u201ctragedy of the commons\" and used it improperly, and \"which is called the tragedy of the commons\" has been deleted. (page 1 of the paper)(6)Suggestion: Weak prisoner's dilemma is characterised as \"convenient but without losing the accuracy of the results\". The choice of one evolutionary game over the other has nothing to do with the accuracy of results.Response: The statement\u00a0\"convenient but without losing the accuracy of the results\" is inaccurate. We have rewritten part 1 of the model section as:\u201cWithout a loss of generality, we set R = 1 and P = 0. And to ensure single parameter, there are some typical representative sub-classes of PD game, e.g., Donor & Recipient (D & R) game which assumes T + R = 1 [43\u201349] and boundary game which assumes T = b and S = 0 . In this paper, we use boundary game because what we mainly study is the impact of T on evolution process. It should be noted that in PD game, S < 0. However, Our experiment shows that if S is close to 0, then the Monte Carlo simulation result is almost the same as S = 0, that\u2019s why boundary game can assume S = 0.\u201d (page 3 of the paper)(7)Suggestion: \"As a result, the intrinsic structures leading to defectors\u2019 expansion and cooperators\u2019 survival are achieved for different evolution process, which provides a penetrating understanding of the evolution\". What are 'intrinsic structures'? Which 'evolutionary processes'? What is 'penetrating understanding'?Response: The expression \u201cintrinsic structures\u201d , \u201cevolutionary processes\u201d and \u201cpenetrating understanding\u201d are inaccurate. We have rewritten the last few sentences in the abstract section as:\u201cFurthermore, a deep analysis is performed on the local structures which cause defector's re-expansion, and the concept of END- and EXP-periods are used to justify the mechanism of network reciprocity in view of time-evolution. As a result, we find some typical feature nodes which we called Infectors, Infected nodes and High-risk cooperators respectively. Compared to fixed aspiration model, dynamic aspiration introduces a more satisfactory explanation on population evolution laws and can promote deeper comprehension for the principle of prisoner's dilemma.\u201d(page 1 of the paper)(8)Suggestion: \"However, we can easily observe numerous cooperation phenomenon in various scenarios\". What are cooperation phenomena?Response: The sentence \"However, we can easily observe numerous cooperation phenomenon in various scenarios\" should have some references. \u201cCooperation phenomenon\u201d in this sentence is a concept from other papers and we have cited it and the complete sentence has been revised as \u201cHowever, we can easily observe numerous cooperation phenomenon in various scenarios, e.g., animals will cooperate to obtain food instead of preying alone [7]; companies will set appropriate commodity prices instead of maliciously cutting prices [8]; humans will choose to obey the order instead of jumping in line, etc [9].\u201d(page 1 of the paper)(9)Suggestion: \"If one\u2019s payoff is higher than its aspiration, it tends to be increased, otherwise decreased\". What gets increased or decreased?Response: The sentence\u00a0\"If one\u2019s payoff is higher than its aspiration, it tends to be increased, otherwise decreased.\" is not clear and we have revised as \u201cIf one's payoff is higher than its aspiration, the aspiration tends to be increased, otherwise decreased.\u201d(page 2 of the paper)(10)Suggestion: \"This is consistent with our normal perception because no one can hold a high aspiration for continued low payoff\". Perception of what? Why aspiration cannot be held high in the face of continued low payoffs?Response: This sentence \"This is consistent with our normal perception because no one can hold a high aspiration for continued low payoff\" doesn\u2019t express accurately enough. We have combined it with the new references we cited as\u201dSome researchers also paid attention to this and had some related researches[37\u201339]. Our view is consistent with the view in [38] that in the middle of a crisis, individuals tend to lower what their aspirations in interactions, vice versa.\u201d (page 3 of the paper)(11)Suggestion: \"One can see that although cooperators take advantage in quantity in the process, defectors finally occupy the network when it is stable\". How does one take advantage in quantity? And in what process?Response: The sentence \"One can see that although cooperators take advantage in quantity in the process, defectors finally occupy the network when it is stable\" has unclear meaning and we have revised it as \u201cOne can see that although cooperators can survive in the END period and expand in the EXP period, defectors finally occupy the network when it is stable.\u201d (page 6 of the paper)(12)Suggestion: The above issues notwithstanding, the biggest problem of this manuscript is that the model doesn't really teach us anything about the evolution of cooperation:\u2022 When the value of the parameter A is small, every agent is satisfied, which effectively halts selection.\u2022 When the value of the parameter A is large, every agent is dissatisfied. Selection proceeds as it normally would, causing defector domination for all but the smallest value of the temptation b.\u2022 Finally, when the value of the parameter A is intermediate, selection can be halted for a large enough number of agents to freeze the system state before all cooperators get wiped out.Cooperation in this model can never evolve, it can only be saved from extinction.Response: Thank you for this detailed suggestion to our work. Your main opinion is that cooperation\u2019s evolution is the most important. In our manuscript, we analyze the social dilemma from another angle. In most previous studies, the re-expansion of the defectors has not been noticed. This paper finds the key local structure that influences the re-expansion of the defectors through related research. I think this is as important as the evolution of cooperation. If such local structures can be noticed and avoided, cooperation can expand and survive in a better environment. Besides, our next step is to focus on how to avoid related structures and their negative impact to promote cooperation. We also make much modification in the paper to deepen our discussion of the relationship between the cooperation\u2019s evolution and our results. Such as:\u201cTo conclude, for small values of A, initial cooperators could coexist with defectors and neither of them could expand. Low aspiration means both strategies and aspirations are long-term stable.\u201d (page 5 of the paper)\u201cOne can see that although cooperators can survive in the END period and expand in the EXP period by forming clusters, defectors finally occupy the network when it is stable.The network reciprocity is undermined by dynamic aspirations. In dynamic aspiration models, cooperators' aspirations will become too high to endure defectors' re-expansion because of the long-term satisfaction. which is different from the fixed aspiration model.\u201d (page 6-7 of the paper)\u201cIn other words, defectors could expand and occupy the network finally even if they are very few initially. This result is different from the result of fixed aspiration model and it may be caused by some special local structures which could lead to the too high aspirations of cooperators.\u201d (page 7 of the paper)\u201cIn the network with random setup, during the END and EXP period, cooperators will survive and expand by the mechanism of network reciprocity. But once there is at least one Infector who has three D neighbors and one C neighbor initially, defectors will re-expand to the whole network.\u201d (page 10 of the paper)\u201cCooperators can survive by forming clusters, but since the values of b is higher, these clusters couldn't expand. The above evolution process only go through the END period and then the network have been stable.\u201d (page 10 of the paper)\u201cTo conclude, for moderate values of A, cooperators will survive and expand in the early stages of evolution when $b$ is lower than A, which we call END and EXP periods respectively. But according to our results, the existence of Infectors may lead to defectors' re-expansion. The core reason for this phenomenon is the cooperators increase their aspirations excessively and become the so-called High-risk cooperators, which needs to be vigilant in the evolution process of cooperation.\u201d (page 11 of the paper)\u201cDynamic aspiration plays an important role for the above results because a constantly changing individual(Infectors) may make its neighbors' (Infected nodes) aspirations gradually rise up and they will become Infectors. At the same time, all the other cooperators' aspiration are gradually rising up and they become High-risk cooperators. When a High-risk cooperator neighbors with an Infector, it will become a defector soon and chain phenomenon happens.\u201d (page 14 of the paper)\u201cUnder the mechanism of network reciprocity, the defectors' re-expansion is got attentions. How to avoid such unfavorable phenomenon under moderate aspirations is still a challenging problem.\u201d (page 14 of the paper)AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 17 Dec 2020Dynamic aspiration based on Win-Stay-Lose-Learn rule in Spatial Prisoner's Dilemma GamePONE-D-20-31850R1Dear Dr. Wei,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Jun TanimotoAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The revise MS seems sufficiently persuasive to all suggestions I gave. Hence, I can nod that this MS can be welcomed to the journal.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0No 23 Dec 2020PONE-D-20-31850R1Dynamic aspiration based on Win-Stay-Lose-Learn rule in Spatial Prisoner's Dilemma GameDear Dr. Wei:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org.If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofProf. Jun TanimotoAcademic EditorPLOS ONE"}
+{"text": "Quantum history states were recently formulated by extending the consistent histories approach of Griffiths to the entangled superposition of evolution paths and were then experimented with Greenberger\u2013Horne\u2013Zeilinger states. Tensor product structure of history-dependent correlations was also recently exploited as a quantum computing resource in simple linear optical setups performing multiplane diffraction (MPD) of fermionic and bosonic particles with remarkable promises. This significantly motivates the definition of quantum histories of MPD as entanglement resources with the inherent capability of generating an exponentially increasing number of Feynman paths through diffraction planes in a scalable manner and experimental low complexity combining the utilization of coherent light sources and photon-counting detection. In this article, quantum temporal correlation and interference among MPD paths are denoted with quantum path entanglement (QPE) and interference (QPI), respectively, as novel quantum resources. Operator theory modeling of QPE and counterintuitive properties of QPI are presented by combining history-based formulations with Feynman\u2019s path integral approach. Leggett\u2013Garg inequality as temporal analog of Bell\u2019s inequality is violated for MPD with all signaling constraints in the ambiguous form recently formulated by Emary. The proposed theory for MPD-based histories is highly promising for exploiting QPE and QPI as important resources for quantum computation and communications in future architectures. Operator theory modeling for MPD-based resources is presented by combining the consistent histories approach of Griffiths ,3,4,5 anN planes is defined as follows:jth plane and for nth trajectory, N planes includes a superposition of different trajectories through the slits. Experiments for entangled histories has just been, for the first time, performed in Reference [The concept of the entangled histories is defined in References ,11 as thIn this article, an important property of MPD-based QPE is, for the first time, presented: Leggett\u2013Garg Inequality (LGI) violations as the temporal analog of Bell\u2019s inequality. One of the fundamental tools to analyze quantum temporal correlations of a system is to check the violations of LGIs . LGIs, aeference  with theC01+C12\u2212Ceference  is left eference  utilizineference ,20,21. BOn the other hand, LGIs are interpreted in a quantum contextual framework in Reference , where tThe other important property of quantum histories is the interference among them denoted by QPI. To the best of the author\u2019s knowledge, theoretical modeling of the interference among quantum history states leading to a counterintuitive observation to be easily verified experimentally has not been previously formulated. Implementation of the theoretically modeled QPI setup will significantly improve our understanding about QM fundamentals regarding time. QPI is the temporal analogue of the spatial interference obtained in Young\u2019s double-slit setup. Destructive and constructive interferences among the paths are observed in the time domain for the QPI case. A special case is modeled such that decreasing the number of photons to diffract through a plane by removing a Feynman path results in an increase in the number of photons diffracting through the next plane due to the interference between two quantum trajectories. This is proposed, for the first time, as a counterintuitive nature of the interference among the quantum histories.introduction and operator theory modeling of two novel quantum resources, i.e., QPE and QPI, denoting temporal correlations and the interference among quantum trajectories, respectively, in MPD while utilizing the tensor product structure for future quantum computing and communication architectures and foundational QM studies;operator theory modeling of MPD-based resources QPE and QPI by combining history-based previous formulations of quantum histories ,3,4,5 witheoretical modeling and numerical analysis of MPD setup for the violation of LGI, with the ambiguous and no-signaling forms recently proposed by Emary in Reference , reachina novel setup, i.e., MPD, violating the ambiguous form of LGI with classical light sources complementing the recent experiment utilizing linear polarization degree of freedom of the classical light  while MPtheoretical modeling and numerical analysis of counterintuitive properties and examples of the interference among MPD-based Feynman paths denoted as QPI promising to be easily verified experimentally in future studies;the modeling and numerical analysis of the coherence properties of the light sources in terms of spatial and temporal dimensions while discussing design issues for MPD setup with coherent light sources; anddiscussion for future applications of QPE and QPI as quantum resources and experimental implementations.The novel contributions of the article are summarized as follows:The paper is organized as follows. We firstly define MPD setup with diffractive projection and measurement operators in N sensor planes, i.e., both diffraction and sensing on the same plane, as shown in MPD setup is formed from cillator :(3)|\u03b1\u232a=ej has ith and jth planes is denoted by z-axis with the velocity given by c, while quantum superposition interference is observed in the x-axis as a one-dimensional model which can be easily extended to two dimensions (2D) [x-axis. Nonrelativistic modeling is assumed. We do not consider the effects of environment dephasing or decohering of the interference pattern for double-slit setups [Each plane is assumed to be capable of performing measurement with photodetectors for counting the number of photons hitting the detector area. Therefore, a plane either allows projective diffraction of light through slits denoted by the operator symbol mplicity ,8 as matt setups ,28. Furtt setups  on the nFree-particle evolution kernel for the optical propagation paths between time\u2013position values  follows ,10 with  follows ,8:(4)K\u2261\u2211njth plane has the operator jth plane at jth plane is defined as the following:Projection operator denotes the light to be in the Gaussian slit in a coarse-grained sense ,33 as foollowing:Mj\u2020Mj\u2261I\u2212\u2211N for N. An operator denoting no detection is defined as There are two different types of detection mechanisms in MPD design denoted by eference  for QC, jth plane for jth plane. A general history state with QPE composed of superposition of trajectories is denoted as follows based on the notation P1,1, theEquation  by usingquations , (27), O1A(t1)\u2261Peference  (Equatioeference ), K=C01+quations , (31), auations \u2261pollowing:KA\u2264KV\u22611+\u2211gedanken experiment shown in a, b, and c are defined with the setups shown in Double-slit interference gives a clear indication of quantumness showing wave-particle duality and spatial interference as emphasized by Feynman. MPD setup presents the complementary phenomenon of the temporal interference among the paths which cannot be explained in any classical way showing that paths interfere in time, destructively and constructively decreasing and increasing the probability of the consecutive events, respectively. A QPI modeling requires the calculation of Equation . The expTwo different calculation scenarios are performed denoted by L such that the time duration is There are two planes (PL-1 and PL-2) as shown in The shift of the slits on PL-1 results in varying levels of temporal correlation for the diffraction through the slits on PL-2. LGI violation (eference  and utilIn It is observed in eference  with invt from the source to the diffraction plane and on the standard deviation of the Gaussian source denoted by The results in  few KHz . On the Equation  dependinquations  and 60)\u224810\u22129\u00d73\u00d71Equation , e.g., AThe three-plane setup  shown in Besides that, similar to the analysis of spatial and temporal coherence properties of the violation of LGI, the parameter set resulting in the maximum constructive and destructive interferences on PL-2 and PL-3, respectively, is analyzed for compatibility with the coherence of practical sources. The inequalities defined in Equations \u201363) in  in 63) iIn this article, two novel resources for quantum technologies, i.e., QPE and QPI, are introduced based on tensor product structure of quantum history states for the simple linear optical setup of MPD. Operator theory modeling is presented by combining conventional history-based approaches of Griffith ,4,5 and eference  utilizineference .gedanken experiments for implementing paradoxes emphasizing the quantum nature with counterintuitive scenarios.Furthermore, QPI is numerically analyzed for a scenario where the decrease in the number of photons diffracting through a plane counterintuitively results in an increase in the number of photons diffracting through the next plane due to interference between two quantum history or trajectory states. MPD design introducing QPE and QPI is providing a test bed to understand the nature of temporal correlations improving our understanding of quantum mechanics and to design novel structures exploiting history-based formulation for practical purposes of quantum technologies. The simplicity of both the setup and proposed theoretical modeling allows varying kinds of MPD has significantly low experimental complexity, relying on light sources of finite spatial and temporal coherence combined with conventional intensity detection or photon counting by promising near-future implementations. The experimental implementation is further simplified based on the mature science of Fourier optics with recent proposals in Reference . ExperimQPE as an entanglement resource promises future applications for computing ,9, commuLGI and wave functions are modeled with FPI modeling , and theThe coherence of the light field is characterized both temporally and spatially . Its temeference .L. Then, spatial coherence distance Spatial coherence depends on the size of the light field source where it is experimentally characterized with double-slit interference experiment as clearly described in Reference , as showeference , more de theorem . It is oIn numerical simulations of nth path in Equation (jth plane instead of utilizing Similarly, the maximum difference between the positions of the slits on PL-1 and PL-2, i.e., the upper slit on PL-1 and the lower slit on PL-2, is calculated by using Equation  by also"}
+{"text": "To the best of our knowledge, studies are lacking on burnout among veterinary students in Serbia, and this is the first study trying to address such a problem. Therefore, the aim of this cross-sectional study was to investigate the predictors of burnout among Belgrade veterinary students.Maslach Burnout Inventory (MBI) and anonymous structured questionnaire addressed to personal data, health habits and stressful influence of educational process were applied among 496 respondents from a total of 1113 students from all grades in spring semester 2014 (response rate 44.6%).The prevalence of burnout was 43.3%. High scores on depersonalization and emotional exhaustion scales of MBI were found among 79.4% and 45.0% students, respectively; low personal accomplishment was reported by 50.5% students. Female students reported higher levels of emotional exhaustion compared to males (p = 0.012). A low score on personal achievement scale of MBI was least frequent among the freshmen and most frequent among sophomores . There were more students with burnout who considered their health as a worsened vs. pre-study period compared to students with no burnout, both concerning mental (61.4% vs. 38.6%) and physical health . There were more smokers among students who suffered from burnout compared to students who did not . A multiple regression revealed an independent dose-response effect of perceived stress at exams on the onset of burnout (moderate stress OR = 2.164 and high stress OR = 3.878). Also, students with the moderate and high stressful effect of communication with teaching staff, as well as, those with worse self-perceived physical and mental health had more than two times higher presence of burnout.The prevalence of burnout among Belgrade veterinary students is relatively high. Primary prevention should be focused on the revealed predictors of burnout. Numerous negative environmental and psychosocial stressors such as excessive academic obligations, lack of free time, constant pressure to succeed, as well as social determinants of health, including low socioeconomic status, social support, neighborhood environments, exposure to violence, and family conflicts, contribute to emerging health disorders among university students \u20133. StresConcerning health professions, the studies on stress among medical students are dominant, while similar studies among veterinary students are lacking ,20. StreThere are concerns about the difficulty of a demanding curriculum, time dedicated to learning and the amount of information on all animal species that a veterinary student is expected to adopt . New curBurnout affects professional development; it may cause reduced professional interest, and further degradation of humanitarian attitudes such as empathy . MonitorIn spite of a relatively high risk of burnout among veterinary students, studies of burnout among them are infrequent. For this reason, we have undertaken this very first study on burnout and its correlates among veterinary students in Serbia. We hypothesize that the prevalence of burnout among Belgrade veterinary students is very high.We performed a cross-sectional study on 496 students , of all grades at the Faculty of Veterinary Medicine, University of Belgrade during the spring semester 2014. They study according to a five-year curriculum adapted to the Bologna system. A student takes one colloquium per semester for each subject, as well as a large number of laboratory exercises and seminars. The response rate was 44.6% (496 respondents from 1113 students). The distribution of respondents according to grade was as follows: 124\u2014first year in school, 108\u2014second year in school, 83\u2014third year in school, 66\u2014fourth year in school and 115\u2014fifth year in school. Students were recruited during their laboratory classes and participation was voluntary. A paper questionnaire was completed at the beginning of a class and the instructions were given by the first author. Prior to filling out the questionnaire, all students provided written informed consent to anonymously participate in the study, as well as, gave permission to researchers for using the data.The study was performed with the permission of the Ethics Committee of the Faculty of Medicine, University of Belgrade (decision No. 29/III-16).Students completed the Maslach Burnout Inventory (MBI) and an anonymous questionnaire. The Serbian version of MBI is a reliable and valid instrument for measuring burnout, with strong psychometric characteristics of the study instrument, confirmed in a recent Belgrade study . The oveThe sample size calculation is based on previous studies. It is assumed that the prevalence of burnout in veterinary students is 30%. The sample size of 341 is sufficient to produce a 95% confidence interval with a width of 10% (precision is 5%) when the sample proportion is 30%. In our study sample size reached 496 students in total.All analyses were performed using SPSS 20 . Descriptive statistics included count (percent) or mean (standard deviation) depending on the data type. Groups were compared using Pearson chi-square or Cochran-Armitage test for trend for attributive data  and t-test and ANOVA for numerical data. Numerical data were examined for normal distribution. Normal distribution was evaluated using graphical methods , descriptive statistics  and tests for normality (Kolmogorov-Smirnov).Multiple regression analysis was used to evaluate the investigated factors that independently correlate with burnout . The dependent variable was a high combined score on subscales EE and DP of MBI . IndepenThe majority of students reported high levels of DP (79.4%); about half of them experienced low levels of PA or high levels of EE  . OverallThere was no significant impact of gender or year of study on the prevalence of burnout. Females more frequently reported higher levels of EE compared to male students. A low PA score was least frequent among freshmen (41.1%) and most frequent among the second year (65.3%) and fourth-year students (50.8%).There was no statistically significant difference neither in mean grade (p = 0.811) nor in the number of passed exams (p = 0.809), physical activity (p = 0.785) and alcohol consumption (0.104) between the students with and without burnout .There were more smokers among students who suffered from burnout (52.0%) compared to students who did not . The majority of students with burnout considered their mental and physical health worsened compared to the pre-study period (p = 0.001) .Student\u2019s responses to the perceived stress impact of exams resulted in a highly significant difference in relation to the presence of burnout (p<0.001) .The highest percentage of students who perceived exams as very stressful was in the group with burnout (58.8%). Also, students with burnout perceived colloquiums, communications with teaching staff and contact with pet owners as more stressful in comparison to students without burnout .Missing value analysis is performed to evaluate missing values in the database. Majority of variables have percent of missing values less than 1%, but variables Passed exams has 24 missings (4.8%), Mean grade 32 (6.5%), MBIPAsum as well as MBIPAlow 39 (7.9%), Physical activity 23 (4.6%), Field work 42 (8.5%) and Contact with animal owners 25 (5.0%). These missing values are assumed to be missing at random.Multiple regression analysis revealed an independent dose-response effect of perceived stress at exams on the onset of burnout (moderate stress OR = 2.164 and high stress OR = 3.878). Also, students with the moderate and high stressful effects of communication with teaching staff, as well as, those with worse self-perceived physical and mental health had more than two times higher presence of burnout .The model reveals that all predictors except gender are significant to predict burnout outcome. Health worsening  significantly favors burnout outcome. Stress- related to examination and communication with teaching stuff category gradation correlates with higher odds for burnout outcome. Stressful effect of fieldwork has a nearly significant relationship (p = 0.062), but only category \u201cmild\u201d vs. no stress at all.The presented model has explained variability 28.1% (Nagelkerke R square = 0.281) and the model is calibrated (Hosmer and Lemeshow test p = 0.878). Based on the area under the curve, the model has good discriminative power .This study investigated the prevalence of burnout and predictors contributing to its experience among Belgrade veterinary students. Our results indicated that 43.3% of participants met the criteria for burnout; this prevalence is higher compared to a recent study among Australian veterinary students  where a Many studies have confirmed that females are more susceptible to stress and burnout compared to males ,34,35. TIn our study, the highest mean value of the EE scale was observed in the third year of study when the curriculum is the most comprehensive and when clinical subjects begin. In most veterinary programs, students of the first year do not start clinical rotations and are not exposed to stressors related to clinical work, such as dissatisfied clients, death of pets or diagnostic errors . AdequatOur result of poorer self-estimated physical and mental health in the group of students with burnout compared to the group without burnout has been confirmed as well as in the other studies like a predictor of anxiety and depression in veterinary students ,33.Health-related habits such as exercise could play important roles in the mediation between psychological distress and coping styles influencing mental health . ReducedRegarding other aspects of health habits, smoking was more frequent among students with burnout compared to students without it (p = 0.013). Our results on healthy habits support the findings of similar studies indicating the connection between smoking and alcohol consumption with stress , but morThere are evidence that major predictors of academic burnout are: the absence of free time, fear of failure, lack of help and support, uncertain future, big pressure due to exams, bad financial situation as well as stressful contacts with patients . ResearcThe study conducted in Australia determined that students of veterinary medicine also seem to suffer from high levels of anxiety and stress and have inadequate strategies for coping with adversity . ModifyiTo the best of our knowledge, this is the first study on burnout and its correlates among veterinary students in Serbia. A variety of different academic and non-academic stressors, such as heavy workload, fitting in with peers, rigorous academic requirements, home sickness, relationship difficulties, and financial strains are common to university students. Thus, the results of our research may be generalized to veterinary students worldwide. However, several limitations should be mentioned. First, the use of cross-sectional design does not allow a causal relationship to be determined among variables. Second, the information on all variables had been self-reported and may have been subject to recall bias. Third, a limitation of the study may be the selection bias because students affected by burnout may be more willing to participate as suggested by other burnout scales not used in our study. Fourth, burnout in the workplace may be also related to administrative policy/procedure that was not measured in our study. Fifth, Serbian students and their families due to a turbulent recent history of heavy economic crisis and war may have improved their resilience to stress compared to the veterinary students from other European regions. Furthermore, resilience, grit and other measures of improved mental wellbeing were not explored in this study, nor the concept of comparing highly and poorly resilient people and their predisposition (or not) to burnout.Notwithstanding all previously mentioned limitations, our study shows that the prevalence of burnout among Belgrade veterinary students is relatively high. In univariate analysis the main correlates of students\u2019 burnout are female gender, smoking, poor subjectively estimated physical and mental health and perceived stress from academic activities. In a multiple regression analysis, the independent dose-response effect on the onset of burnout remained only for perceived stress at the exams.The study results indicate that it is possible to determine proneness to burnout among veterinary students. There are some future considerations concerning curriculum adjustment or a different time planning of colloquiums that can leave more time to relax and lower the risk of burnout. The ntroduction of peer support and culture of acceptance and hospitality may be helpful for students\u2019 better adjustment. 30 Jan 2020PONE-D-19-32894Predictors of burnout among Belgrade veterinary students: a cross-sectional studyPLOS ONEDear Dr. Jankovi\u0107,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Two reviewers have assessed your work. Although one of them advises against the consideration of your paper, I would like to say that after a careful review of the manuscript, I believe  that the work has a certain potential and could be revised by the authors. Thus,\u00a0based in the comments/suggestions provided by this reviewer, please consider performing an extensive revision of the paper. Afterwards, I will submit it for and a second evaluation from two academic reviewers.https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.We would appreciate receiving your revised manuscript by Mar 15 2020 11:59PM. When you are ready to submit your revision, log on to If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsTo enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Sergio A. Useche, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Please provide additional details regarding participant consent.In the Methods section, please ensure that you have specified what type of consent you obtained  and whether the ethics committee approved this consent procedure.If verbal consent was obtained please state why it was not possible to obtain written consent and how verbal consent was recorded. If your study included minors, state whether you obtained consent from parents or guardians.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/AReviewer #2: No**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: this is not an appropriate journal for this type of study. A veterinary or mainstream education journal would be more appropriate. It seems silly for me to keep writing to ensure that minimum characters are met before I can submit this review!!!! PLoS One needs a better system to avoid discouraging reviewers.Reviewer #2: Thank you for the opportunity to review your manuscript. It is an important addition to the veterinary and mental health literature. Please consider these comments for improvement and clarity.Line 47: \"walkability\" is not a commonly used English word and does not transmit a known stressor.Line 49: \"eustress\" is spot-on but uncommonly used. You may consider defining it or selecting a more common word to indicate your intent.Line 78: This is the Knowledge Gap and can be more accurate if \"still lacking\" was changed to \"infrequent\".Line 80: This is the Hypothesis and is somewhat vague due to the suggestion that \"prevalence...is significant\". The remainder of that sentence is not needed as you are not testing interventions.Line 90 and 91: perhaps changing the word \"grade\" to \"year in school\" may be more appropriate.Line 101: The Belgrade study should be referenced. Is this #28?Line 105: Should ref #28 here be ref #30? If so, some rearrangement of reference order is needed.Line 108: Should ref #13 here be ref #18?Line 121L Statistical analysis: The deficiencies here should be addressed to better understand and clarify your approach. A power calculation was not completed or reported and tests for normality were not mentioned. You have chosen parametric statistics but never indicated proof that your data was normally distributed.Line 137: Table 1: There are some inconsistencies which make interpretation very questionable. For instance: the number of male (325) and female (165) participants do not equal the total of all genders (496). Also similarly, the number of male (134) and female (79) participants do not equal the total of all genders (215) with burnout. Many of the N and percentages do not match, therefore, please review and revise all the data in this Table. Without that detail, there is too much inconsistency to believe your data and conclusions.Line 139:Improvement to remind the reader that >= 27 for EE and >=10 for DP are your cut-offs for burnout. \"High\" is relative and the level at which you analyzed your data and made your interpretations must be crystal clear.Line 141: \"Cocarame\" should be \"Cochran\"Line 144: Again, relative relationships must be avoided in Results and are better left to the Conclusions. Please provide specific data instead of \"low\" PA score. This should be the pattern throughout.Line 154: Please insert a comma between the parameter and \"n (%)\" throughout this table. Ensure that the \"n\" is always present. Also in Table 2 and Table 3, the p value is not always clearly indicating which parameters it is comparing. Do you only provide the statistically significant data for the parameter that meets significance? Sometimes the p value appears to be on a specific line and other times it appears to split the line spacing.Line 177&178: This seems to be a nonsequitor. Perhaps it is the right sentiment but needs more explanation to clarify to the reader.Line 187: This study from Tennessee  had 289 students not 389 as written. Also, there are contradictory versions of this study depending on the link followed from pubmed - one abstract is the Tennessee description. Another one follows a report from Oregon State University. Please be sure of your reference and trail of information.Line 189: \"Faculty\" should read \"Kansas State Univeristy College\"Line 200: Ref 33 may suggest investigation into the causes of stress in a students studies or implementation of programs to reduce the stressors is needed - which is it you seek in this line? Please clarify and allow for completion of your thought in this paragraph.Line 207: This is not a study of veterinary students, please amend as it implies that this is known in DVMs but it is not.Line 224: The comment \"(borderline significance)\" is incorrect. Data is either significant upon your predetermined criteria and level or it is not. Amend this, please.Line 251: The limitations can be improved overall. There are many limitations that were not nor are not measured in your study that may contribute to burnout. You may mention other burnout scales or references that suggest those with burnout are more apt to complete the survey. The mention of the recent war in Serbia could also be viewed to improve resilience and not to lowered their ability to cope. You do not mention resilience, grit, or other measures of improved mental wellbeing anywhere in your manuscript. The limitations may be a good place to introduce that concept as you were not, at the outset, looking to compare highly and poorly resilient people and their predisposition (or not) to burnout. Also recent publications that discuss burnout in the workplace that may be most related to administrative policy/procedure and not work load could be mentioned.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,  23 Feb 2020Response to the Reviewer\u2019s CommentsReviewer #2: Thank you for the opportunity to review your manuscript. It is an important addition to the veterinary and mental health literature. Please consider these comments for improvement and clarity.We want to extend our appreciation for reviewer#2 taking the time and effort necessary to provide such insightful guidance. We carefully considered your comments and hope that these revisions improve the manuscript such that you now deem it worthy of publication in PLOS ONE. All our responses are highlighted in yellow.COMMENTSReviewer: Line 47, \"walkability\" is not a commonly used English word and does not transmit a known stressor.RESPONSE: The word \"walkability\" was deleted.Reviewer: Line 49, \"eustress\" is spot-on but uncommonly used. You may consider defining it or selecting a more common word to indicate your intent.RESPONSE: The word \"eustress\" was replaced with \u201cStress in academic institutions may have a positive effect by increasing self-confidence \u201c. Reviewer: Line 78, This is the Knowledge Gap and can be more accurate if \"still lacking\" was changed to \"infrequent\".RESPONSE: The phrase \"still lacking\" was replaced with \u201cinfrequent \u201c.Reviewer: Line 80, This is the Hypothesis and is somewhat vague due to the suggestion that \"prevalence...is significant\". The remainder of that sentence is not needed as you are not testing interventions.RESPONSE: The sentence \"prevalence...is significant\" was changed into \"prevalence...is very high\" and the remainder of that sentence is deleted.Reviewer: Line 90 and 91, perhaps changing the word \"grade\" to \"year in school\" may be more appropriate.RESPONSE: The word \"grade\" was changed in \"year in school\" which is more appropriate.Reviewer: Line 101, The Belgrade study should be referenced. Is this #28?RESPONSE: The Belgrade study is referenced as 28.Reviewer: Line 105, Should ref #28 here be ref #30? If so, some rearrangement of reference order is needed.RESPONSE: The ref #28 is changed into ref #29 (ex ref#30) and we made rearrangement of the reference order. Reviewer: Line 108, Should ref #13 here be ref #18?RESPONSE: The ref #13 is #18, as we changed.Reviewer: Line 121, Statistical analysis: The deficiencies here should be addressed to better understand and clarify your approach. A power calculation was not completed or reported and tests for normality were not mentioned. You have chosen parametric statistics but never indicated proof that your data was normally distributed.RESPONSE: In methods section, Statistical analysis, explanation regarding normality of data is added to clarify chosen tests. Sample size calculation is, also, added into statistical methodology.The following is added: \u201cSample size calculation is based on previous studies. It is assumed that prevalence of burnout in veterinary students is 30%. Sample size of 341 is sufficient to produce 95% confidence interval with a width of 10% (precision is 5%) when the sample proportion is 30%. In our study sample size reached 496 students in total. Numerical data were examined for normal distribution. Normal distribution was evaluated using graphical methods , descriptive statistics  and tests for normality (Kolmogorov-Smirnov). \u201cReviewer: Line 137, Table 1: There are some inconsistencies which make interpretation very questionable. For instance: the number of male (325) and female (165) participants do not equal the total of all genders (496). Also, similarly, the number of male (134) and female (79) participants do not equal the total of all genders (215) with burnout. Many of the N and percentages do not match, therefore, please review and revise all the data in this Table. Without that detail, there is too much inconsistency to believe your data and conclusions.RESPONSE: The database was revised and several inconsistencies about data were found . Consequently, statistical analysis was performed again and changes were made regarding data in all tables. In Results section, new tables are presented instead of the old ones. No significant changes have been observed in new tables, but these tables are consistent and more accurate compared to the old ones. Still, missing values exists in database as expected in anonymous questionnaires. Missing value analysis is performed to evaluate missing values in database. Majority of variables have percent of missing values less than 1%, but variables Passed exams has 24 missing (4.8%), Mean grade 32 (6.5%), MBIPAsum as well as MBIPA.low 39 (7.9%), Physical activity 23 (4.6%), Field work 42 (8.5%) and Contact with animal owners 25 (5.0%). These missing values are assumed to be missing at random. The missing value analysis report is added to Results section.Reviewer: Line 139, Improvement to remind the reader that >= 27 for EE and >=10 for DP are your cut-offs for burnout. \"High\" is relative and the level at which you analyzed your data and made your interpretations must be crystal clear.RESPONSE: It was added as suggested to remind the reader that >= 27 for EE and >=10 for DP are cut-offs for burnout. Reviewer: Line 141, \"Cocarame\" should be \"Cochran\"RESPONSE: We changed \"Cocarame\" in \"Cochran\".Reviewer: Line 144, Again, relative relationships must be avoided in Results and are better left to the Conclusions. Please provide specific data instead of \"low\" PA score. This should be the pattern throughout.RESPONSE: We have provided specific data for the required parameters throughout the Results section. \"A low PA score was least frequent among freshmen (41.1%) and most frequent among second year (65.3%) and fourth year students (50.8%)\u2026..\"Reviewer: Line 154, Please insert a comma between the parameter and \"n (%)\" throughout this table. Ensure that the \"n\" is always present. Also in Table 2 and Table 3, the p value is not always clearly indicating which parameters it is comparing. Do you only provide the statistically significant data for the parameter that meets significance? Sometimes the p value appears to be on a specific line and other times it appears to split the line spacing.RESPONSE: A comma is inserted between the parameter and n (%) in Table 2 and \"n\" is always present. We added new tables instead of the old ones. We have arranged Table 2 and Table 3 so that the p value clearly indicates which parameter it is comparing. We provided the statistically significant data for all parameters, not only for those that meet significance.Reviewer: Line 177 & 178, This seems to be a nonsequitor. Perhaps it is the right sentiment but needs more explanation to clarify to the reader.RESPONSE: Explanation was added.Reviewer: Line 187, This study from Tennessee  had 289 students not 389 as written. Also, there are contradictory versions of this study depending on the link followed from pubmed - one abstract is the Tennessee description. Another one follows a report from Oregon State University. Please be sure of your reference and trail of information.RESPONSE: Thanks for your observation. All suggested changes were made and the reference was checked.Reviewer: Line 189, Faculty\" should read \"Kansas State Univeristy College\"RESPONSE: We changed \"Faculty\" with \"Kansas State University College\".Reviewer: Line 200, Ref 33 may suggest investigation into the causes of stress in a students studies or implementation of programs to reduce the stressors is needed - which is it you seek in this line? Please clarify and allow for completion of your thought in this paragraph.RESPONSE: We clarified ref 33. \u201cThis means that students should better connect with colleagues, mentors and support staff to overcome homesickness. By sponsoring sports events aimed at improving physical health, it would also have a positive effect on students' mental functioning. By providing adequate resources for problem solving and developing collective empathy, the prejudices associated with seeking help for mental health would be overcome \u201c. Reviewer: Line 207, This is not a study of veterinary students, please amend as it implies that this is known in DVMs but it is not.RESPONSE: The text refers to ref 36, not 37, and it was revised.Reviewer: Line 224, The comment \"(borderline significance)\" is incorrect. Data is either significant upon your predetermined criteria and level or it is not. Amend this, please.RESPONSE: We added the p value for smoking habits and deleted \"(borderline significance)\". It seems that alcohol consumption was not significant (p=0.104) in terms of new statistical analyses so we deleted it also. \"Regarding other aspects of health habits, smoking was more frequent among students with burnout compared to students without it (p = 0.013). \" Reviewer: Line 251, The limitations can be improved overall. There are many limitations that were not nor are not measured in your study that may contribute to burnout. You may mention other burnout scales or references that suggest those with burnout are more apt to complete the survey. The mention of the recent war in Serbia could also be viewed to improve resilience and not to lowered their ability to cope. You do not mention resilience, grit, or other measures of improved mental wellbeing anywhere in your manuscript. The limitations may be a good place to introduce that concept as you were not, at the outset, looking to compare highly and poorly resilient people and their predisposition (or not) to burnout. Also recent publications that discuss burnout in the workplace that may be most related to administrative policy/procedure and not work load could be mentioned.RESPONSE: The limitations were revised and improved.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 6 Mar 2020Predictors of burnout among Belgrade veterinary students: a cross-sectional studyPONE-D-19-32894R1Dear Dr. Jankovi\u0107,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.https://www.editorialmanager.com/pone/, click the \"Update My Information\" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact With kind regards,Sergio A. Useche, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #2: No**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2: Thank you for carefully re-evaluating your data and updating the manuscript in a more clear and understandable condition. There are aa few very minor language irregularities in some of the newer text which the editor will likely catch and amend. The concept and information you have presented is in a publishable stage.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: Yes: Karl Jandrey, DVM, MAS, DACVECC 11 Mar 2020PONE-D-19-32894R1 Predictors of burnout among Belgrade veterinary students: a cross-sectional study Dear Dr. Jankovi\u0107:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. For any other questions or concerns, please email Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Sergio A. Useche Academic EditorPLOS ONE"}
+{"text": "To study the influence of structure size and composite forms on the mechanical properties of the composite double honeycomb sandwich structure, a composite double honeycomb sandwich structure was initially designed. The dynamic response of a composite double-layer honeycomb sandwich structure under high-speed impact was studied through theoretical analysis and numerical simulation. Ls-dyna software was used to simulate the initially designed composite structure. According to the numerical simulation results and the proposed method for calculating the fracture energy of the composite double honeycomb sandwich structure, the effects of different composite forms on the mechanical properties were analyzed. The results show that the proposed fracture energy calculation method can effectively describe the variation trend of the honeycomb structure and the micro-element fracture situation in the valid time. The fracture energy curve has a high sensitivity to cell density and material, and the strength of the top core has a great influence on the overall energy absorption. Compared with the traditional honeycomb protection structure, the energy absorption of the initially designed composite honeycomb sandwich structure was improved effectively. Rigid sandwich structures are widely used in military fields such as aerospace, shipping, and armored vehicles because of their high specific strength, specific rigidity, specific energy absorption, and other characteristics. With the continuous advancement of sandwich structure research, there has been much work carried out on the optimal design of the sandwich structure in order to meet the acoustics, thermal, and mechanical property requirements for different fields ,2,3,4. NIn recent years, there have also been breakthroughs in high-speed, hypervelocity, and explosion impacts . Zhang eIn order to improve the protection ability of traditional honeycomb structure, a compound double layer honeycomb structure was designed. The military material 2024 aluminum and 4340 steel are applied to obtain better protection performance. At the same time, a calculation method which can reflect the deformation characteristics of the composite double layer honeycomb structure is proposed. Compared with the energy absorption rate, this method can effectively distinguish the variation trend of similar structures at different times. The best protection structure scheme is obtained.This paper will elaborate the research content through four sections: in In this study, the cells of the composite double-layer honeycomb structure were hexagonal . The honeycomb structure and cells are shown in Where Top represents the upper honeycomb structure, and Bottom represents the lower honeycomb structure. The structure size of the honeycomb sandwich is shown in In this study, a total of 8 kinds of structures were designed to analyze the effects of different structure sizes and material on the mechanical properties, as shown in Where Al/St indicates that the top core material is 2024 aluminum  and the bottom core material is 4340 steel , St/Al means the top core material is 4340 steel, the bottom core material is 2024 aluminum.When the velocity is 50\u20131000 m/s in the collision process, the material is mainly plastic and viscous deformation . During \u03c3 is the plastic flow stress of the material; p\u03b5 is the equivalent plastic strain; T* is the dimensionless temperature; A is the initial yield stress at the reference temperature and the reference strain rate, B is the strain hardening modulus of the material, C is the strain rate sensitivity coefficient, n is the hardening exponent of the material, m is the temperature softening coefficient.Composite double-layer honeycomb structure adopts Lagrangian algorithm, material models are selected JOHNSON_COOK model and GRUNEISEN equation of state. The flow stress of the material is expressed as the product of the strain function, strain rate function, and temperature function. It can reflect the effects of strain hardening, strain rate strengthening, and temperature softening. Its expression is2024 aluminum and 4340 steel were selected as the honeycomb core materials in the composite double-layer honeycomb sandwich structure. The specific parameters of the material model are listed in The composite honeycomb structure adopts hexahedral solid element with eight nodes. Because the composite model is symmetrical, to reduce the number of calculation units, a quarter model is established for calculation. Due to different structural dimensions, there are 302,904 solid elements for 1# and 5#, 245,556 solid elements for 2#, 3#, 6# and 7#, and 217,512 solid elements for 4# and 8#. The displacement of the edge of the composite honeycomb structure is prevented, so the freedom of the solid elements of the edge in the X, Y, and Z directions is limited. The remaining solid elements are all six degrees of freedom, with respect to displacement and rotation of X, Y, and Z. The composite honeycomb structure is formed by bonding two honeycomb sandwich plates of different materials. The finite element model is shown in At present, the energy absorption rate is the main index to measure the mechanical properties of honeycomb structures. With the introduction of the concept of fracture energy, the fracture characteristics of materials are well expressed. Further study on the honeycomb structure found that the energy absorption characteristics of the honeycomb core under high-speed impact are mainly manifested in three aspects: the energy absorbed by the plastic deformation of the honeycomb cell under the impact rod, energy absorbed by friction between impact rod and honeycomb core, and the energy absorbed by the tearing of the honeycomb cells around the impact rod after high-speed impact\u2014this part of energy is called \u2018fracture energy\u2019. The semi-empirical expression for the fracture of composite honeycomb structures is presented below.W is the total energy absorbed by the honeycomb, FW is the energy absorbed by the fracture of the honeycomb cell, PW is the energy absorbed by the plastic deformation of the honeycomb, mW is the energy absorbed by the honeycomb friction.ft) is the plastic deformation energy absorption curve of the honeycomb, mf(t) Is the friction energy absorption curve of the honeycomb.The total energy absorbed by the composite honeycomb structure (2)w=wF+Then the approximate expression of fracture energy isA is the area of the fracture surface perpendicular to the tensile stress direction, and its expression isM is the number of cells covered by the impact rod. Vt)Then the expression of fracture energy isThe fracture energy formula is introduced into the model operation and the results are discussed.In this study, the solver uses ANSYS LS-DYNA18.2. The model is built by the TrueGrid software. Due to the different size of the composite honeycomb structure model to be built, its flexibility is required to be high. Therefore, the parametric modeling method is adopted in this study. Model building, mesh encryption, and control constraints by adding a command in the TrueGrid. Take the modeling of honeycomb core as an example, as shown in In order to analyze the energy absorption characteristics and failure forms of the composite honeycomb structure, a numerical simulation analysis was carried out on a model composed of different structure sizes and materials. The damage results of the structure are shown in In For the 5#\u20138# structure  with theIt can be seen in The calculation time of the composite structure is set to 100 \u03bcs. It can be seen from When the impact rod penetrates into the area where the steel is the honeycomb core, the curve fluctuates greatly. In this area, the fluctuation value of every two curves differs by about twice. By comparing with the structure parameters, it is found that the difference of the curve is related to the cell diameter of the structure, and the relationship is linear. The energy absorption of the eight kinds of structures is calculated. Energy per mass and energy per volume of the structures are shown in 3. The minimum is 4# structure, 26.462 J/g and 78.920 J/cm3. In the case of the same structure size, the structure with the top layer of steel core has a larger energy absorption than the structure with the top layer of aluminum core. It can be seen that the higher the strength of the top layer material, the greater the impact on the overall energy absorption characteristics. At the same time, the energy absorption characteristics are also related to the overall cell density. The 1# and 5# structures with higher cell density have more energy absorption. The 4# and 8# structures, whose cell density is one-half of them. The energy per mass and energy per volume of 4# is 43.2% and 45.9% less than 1#. 8# is 45.7% and 48.3% less than 5#.It can be seen from (1)It is feasible to use TrueGrid software to divide finite element mesh and densified mesh. The finite-element mesh with high-quality mesh can be obtained. The method of increasing the number of iterations can obtain satisfactory numerical simulation results. The proposed method for calculating the fracture energy of the composite honeycomb sandwich structure can well describe the deformation trend and damage of the structure in each time period, especially for the judgment of the skin fracture time.(2)Cell density is one of the main factors affecting the fracture energy of composite honeycomb structure. With the increase of cell density, the greater the fracture energy, but the influence of cell density is less than that of material strength.(3)When the material and structure size of the aluminum core layer are the same, the ratio of the fracture energy in the 4340 steels area is the same as the ratio of the cell diameter in this area.(4)3, which are 9.98% and 23.77% higher than the traditional aluminum honeycomb structure.In the eight kinds of structures, under the same structural size, the structure with 4340 steel on the top layer has a larger energy per mass and energy per volume absorption than the structure with 4340 steel on the bottom layer. The maximum energy per mass and energy per volume are 53.567 J/g and 167.867 J/cmIn this study, TrueGrid was used to mesh and set the boundary conditions of the composite honeycomb structure, and Ls-dyna was used to solve the problem. First, numerical simulation of eight kinds see  composit"}
+{"text": "In this paper, a method of intelligent identification and data smooth processing of flying flexible joint pivoting center based on machine vision is proposed. The intelligent identification is realized by the following process: first of all the geometric center of the two markers attached to the flying body is located on a straight line at a certain angle to the center-line of the measured pivoting body, secondly then continuous image sampling is carried out by industrial camera when the marker swings with the pivoting body, and image data is transmitted through a data interface to an industrial computer, Finally the image processing module de-noises the image, removes the background and locates the markers to obtain the plane coordinates of the markers in the coordinate system of the test system. The data smooth of obtained coordinates is carried outby Matlab software including the following steps: the coordinates of the mark points detected based on machine vision are optimized to obtain the smooth curve by fitting of the parabola and arc. Then the coordinates of the points on the curve are used to optimize the coordinates of the marked points from measurement. The optimized coordinate values are substituted into the calculation module of pivoting center, so the average pivoting center of the sampling interval of two images is calculated according to the mathematical model to approach the instantaneous pivoting center during the motion of the pivoting body. The result processing module displays and records the curve of pivoting center shift directly and effectively. Finally, it is validated by simulation and experiments that the precision of pivoting center measured by such measuring system is ~0.5%. During flight, the deviation of the flying pivoting center will affect the actual clearance of the nozzle swing, the change of the relationship between the stroke of the cylinder and the swing angle, and the change of the power arm, etc.  from the Japanese CBC company can meet the needs of the detection system. The specifications are shown in Based on DMK 31AU03, the structure of detection system is that the industrial camera can be connected directly to an industrial computer via a USB data line. The models of data acquisition, smooth processing and pivoting center calculation on the industrial computer can complete the processing of the original image data to output the pivoting center shift state of the flexible joint at each time with the interface of the human-computer and the data file Zhang, . And theBy analyzing the moving range of the measured body and considering the effective pixel length-width ratio of the camera, we can see that view field of 200 (mm) \u00d7 160 (mm) can meet all requirements for detecting the moving range, so horizontal and vertical resolution Hl, Hv for single pixel can be as:To achieve sub-pixel image positioning accuracy, the horizontal, and vertical image positioning accuracy of the markers (\u03bc) is 0.0195 mm.According to the relevant image experiments, it takes about 20 ms to complete a medium-complex image processing on the industrial computer, which means 50 frames of image processing per second. The data processing speed can keep up with the data acquisition speed for this system with acquisition speed of 30 frames of original data per second, so the system can display the pivoting center shift state in real time without the result output delay.As mentioned above, the technical performance index of this hardware scheme is shown in The commonly used curve smooth processing methods  are all to calculate the minimum value of the objective functions, which has consistent basic ideas  Levin, , 2004. IBecause the data used in this paper are a large number of test points, a smooth curve is constructed by least square method for these data, and the actual pivoting center of flexible joint is calculated from the curve.The dynamic data (each set of data contains the X coordinates and Z coordinates of 100 pcs of point A and point B) obtained from on-site camera are processed as follows: Considering the interference error, the average value of every 5 points is calculated for the original data to obtain 20 sets of processing data.uA, vA) and , then the parabola equation and arc equation are used to smooth processing of these 20 sets of coordinates, so the corresponding coordinates of point A and point B after fitting are expressed as  and , the equations obtained from Matlab are as following:The coordinates of the point A and point B after raw data processing are represented as  and marker B  after smooth fitting are substituted into the pivoting center calculation program to obtain new coordinates.The coordinates of marker A  and  after round i of smooth processing.Let the coordinates of the marker A and B in the XOZ plane be , .Then after round i+1 of smooth processing, marker A and B is recorded as A' and B', and then their coordinates in XOZ plane can be presented as  and , then:Let the coordinates of point C1,K2) can be presented as, respectively:The slopes of straight line AA' and BB'  are:Since the straight line C1P and C2P are:Then the equations of straight line CzA equals to z\u2032A or zB equals to z\u2032B, that is, straight line AA\u2032 or BB\u2032 is horizontal, then the equation of C1P or C2P can be presented as:If xp, zp) can be obtained as:According to 2\u20139, 2\u201310, 2\u201311, the coordinate of test point P can be calculated with substitution of coordinates of marker A and B after round 1 and 2 smoothing fitting  into (Equations 2\u201312). In the same way, the coordinates of all pivoting centers can be calculated.According to above calculation process, the coordinate of first pivoting center (The deviation of coordinates of point A and B before and after smooth processing of parabola fitting and arc fitting (hereinafter abbreviated as \u201ccoordinate error\u201d) is shown in Step 1: Make raw data processing to the coordinates of marker A and B obtained from image acquisition.Step 2: Make smooth processing with parabola fitting and arc fitting for these data.Step 3: Substitute the fitted coordinates (Step 2) into pivoting center calculation program to obtain first two groups of pivoting center coordinates .Step 4: Substitute the coordinates from Step 1 directly into pivoting center calculation program to obtain second two groups of pivoting center coordinates.Step 5: Put them in the diagram: It can be seen from It can be seen from The plane coordinate system (X'O'Z') is used for original displacement sensor test system . The oriSo when comparing two groups of test results, the test results from original displacement sensor test system are transformed from plane coordinate system X'O'Z' to XOZ Yang, .It can be seen that most calculated results from new system are in the range of \u00b18 mm at X-axis, but bigger range for those from original system. The error at Z-axis for new system is ~15 mm deviated from actual position, in the range of \u00b15 mm, but \u00b125 mm for original system.This paper presents a research on shift measurement of flexible joint based on intelligent recognition of machine vision and data smoothing. This research combines the latest research results of machine vision and precision testing technology, and has the following advantages comparing with displacement sensor detection technology: the detection method is non-contact visual measurement, which reduces the requirement of mechanical reference accuracy in the test system; The automatic calibration of the industrial camera system is realized by the diameter size of the circular marker, which simplifies the initialization process after the system is reinstalled. In addition to the hardware optimization such as improving installation accuracy and camera accuracy, one of the key techniques in this study is to reduce the test error of pivoting center by data processing method, and propose a method of smoothing the measuring point coordinates and calculating the pivoting center to eliminate the interference of installation and test errors.It can be seen from It can be seen from The results of the pendulum center test of the displacement sensor test system fluctuate in one direction about 20 mm, and the other direction is mainly random error, within \u22125 to 5 mm.Based on the research methods of machine vision intelligent recognition and test data smoothing, the latest research progress of artificial intelligence recognition and data smoothing is integrated.Compared with the existing technology, it has the following beneficial technical and economic effects:(1) The intelligent identification of the mark points can be completed by collecting data from a single industrial camera, which reduces the link of error caused by contact in the traditional test process.(2) The detection method is non-contact visual measurement, which reduces the requirement of the testing system on the precision of mechanical reference.(3) The industrial camera system is calibrated automatically by the diameter of circular marker, which simplifies the initialization process after the system is reinstalled.(4) By comparing the arc fairing fitting and parabola fairing fitting, it is concluded that although the maximum error of arc fitting process is smaller than that of parabola fitting, the swing amplitude of the pendulum detected after parabola fitting is smaller and the flexibility is better.(5) Through the test, it can be seen that the research method of machine vision intelligent recognition and test data smoothing is compared with the original displacement sensor detection method. The method in this paper has a great advantage in the measurement error and accuracy of the measurement coordinates.The original contributions presented in the study are included in the article/Yb-w was responsible for writing papers, simulation, and experiments. Jp-T was responsible for instructing ideas and directions, and checking papers. Both authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Lassa virus (LASV), an Old World arenavirus, is responsible for hemorrhagic fevers in western Africa. The privileged tropism of LASV for endothelial cells combined with a dysregulated inflammatory response are the main cause of the increase in vascular permeability observed during the disease. Mopeia virus (MOPV) is another arenavirus closely related to LASV but nonpathogenic for non-human primates (NHPs) and has never been described in humans. MOPV is more immunogenic than LASV in NHPs and in vitro in human immune cell models, with more intense type I IFN and adaptive cellular responses. Here, we compared the transcriptomic and proteomic responses of human umbilical vein endothelial cells (HUVECs) to infection with the two viruses to further decipher the mechanisms involved in their differences in immunogenicity and pathogenicity. Both viruses replicated durably and efficiently in HUVECs, but the responses they induced were strikingly different. Modest activation was observed at an early stage of LASV infection and then rapidly shut down. By contrast, MOPV induced a late but more intense response, characterized by the expression of genes and proteins mainly associated with the type I IFN response and antigen processing/presentation. Such a response is consistent with the higher immunogenicity of MOPV relative to LASV, whereas the lack of an innate response induced in HUVECs by LASV is consistent with its uncontrolled systemic dissemination through the vascular endothelium. Mammarenavirus. This genus can be divided into two complexes, depending on their antigenic properties. The New World arenavirus complex contains highly pathogenic viruses, such as the Junin, Machupo, Sabi\u00e1, Chapare, Guanarito, and Whitewater Arroyo viruses [Lassa hemorrhagic fever (LF) is responsible for between 5000 and 6000 deaths every year. The etiological agent of LF is Lassa virus (LASV), a member of the Arenaviridae family isolated in 1969 in Nigeria [ viruses ,3,4,5. T viruses .The genome of these viruses is composed of two single-stranded RNA molecules, a small segment (S) and a large segment (L) . Each seMastomys natalensis [Mastomys natalensis is large, LASV is solely endemic in western Africa . Human-to-human transmission is also possible after contact with contaminated patients [The main reservoir of LASV is the peri-domestic rodent talensis . Human ttalensis ,11. Infetalensis . Althougpatients . Outbreapatients . Currentpatients . For theMopeia virus (MOPV) is an arenavirus closely related to LASV . ComparaThe two main routes of human infection by LASV are the respiratory tract and mucous membranes. Antigen-presenting cells are the first target of LASV ,22,23, aWe further characterized the differences between LASV and MOPV in target cells highly relevant to LASV-associated pathology by analyzing the transcriptomic and proteomic responses of primary ECs to LASV or MOPV infection using RNA sequencing and mass spectrometry. We confirmed that both viruses replicate efficiently and durably in human umbilical vein ECs (HUVECs). However, they demonstrated strikingly different responses depending on the virus. LASV induced moderate and transient activation early after infection, whereas a more intense response evocative of the IFN response and antigen processing/presentation was induced at a later stage by MOPV. These data provide insights on the endothelial dysfunction observed during LF.Strain AN21366 (GenBank accession number JN561684 and JN561685) was used for MOPV infection, and Strain AV (GenBank accession number FR832711 and FR832710) for LASV infection. HUVECs were obtained from three Caucasian donors . Cells were grown using the EC Growth Medium 2 kit  according to the manufacturer\u2019s instructions. HUVECs were infected or not with MOPV or LASV at an MOI of 1 for 1 h. A positive control for activation of the cells was included, consisting of treatment with TNF\u03b1 at a concentration of 20 ng/mL for 18 h. Culture supernatants and cells were collected 18 or 48 h post infection. All experiments performed with LASV were done in the Jean M\u00e9rieux-INSERM BSL4 laboratory . Experiments performed with MOPV were done in the same conditions to ensure reproducibility.2 for seven days with carboxy-methyl-cellulose (1.6%)  in Dulbecco Modified Eagle\u2019s Medium  supplemented with 1.5% fetal bovine serum  and 0.5% penicillin\u2013streptomycin . Cells were fixed with 4% formaldehyde  diluted in phosphate buffered saline  and permeabilized with Triton X-100 . Infectious foci were detected by incubation with monoclonal antibodies (mAbs) directed against MOPV or LASV , followed by PA-conjugated goat polyclonal anti-mouse IgG .Vero E6 cells were infected with sequential dilutions of virus-containing supernatant and incubated at 37 \u00b0C in 5% COViral loads were measured by reverse transcription real-time polymerase chain reaction (RT-qPCR). For MOPV, RT-qPCR was performed using the SensiFAST Probe No-ROX One-Step kit  with the primers 5\u2032-GTCAAGCGTTCTTTGGGAATG-3\u2032 and 5\u2032-TCCAGAAAGACATAGTTTGTAGAGG-3\u2032 and probe: 5\u2032-FAM-TTCCTTTCCCCTGGCGTGTCA-BHQ1-3\u2032. For LASV, RT-qPCR was performed using the Eurobiogreen Lo-Rox qPCR mix kit  with the primers 5\u2032-CTCTCACCCGGAGTATCT-3\u2032 and 5\u2032-CCTCAATCAATGGATGGC-3\u2032. Amplification and reading were performed using a LightCycler 480 II device .g for 15 min, the pellets were reconstituted with NuPAGE LDS Sample Buffer  supplemented with BME (\u03b2-mercaptoethanol) at a final concentration of 2.5%. Cells were also collected after trypsinization, pelleted, and lysed with NuPAGE LDS Sample Buffer supplemented with BME. Samples were heated to 60 \u00b0C for 60 min for viral inactivation.HUVECs were infected or not with MOPV or LASV at an MOI of 1 for 1 h. Culture supernatants and cells from three different donors were collected 18 or 48 h post infection. Immunoglobulins were depleted from the supernatant by antibody purification using a protein G kit  according to the manufacturer\u2019s instructions. Trichloroacetic acid  was added to a final concentration (Vol/Vol) of 10%. After centrifugation at 2000\u00d7 3CN (3.2\u201320% over 100 min followed by 20\u201332% over 20 min) and 0.1% formic acid at a flow rate of 0.2 \u00b5L/min. Data-dependent acquisition analysis of the peptides eluting from the column was performed using a Q-Exactive HF mass spectrometer . Full scans of peptide ions with a 2+ or 3+ charge were acquired at a resolution of 60,000 from m/z 350 to 1500 with a dynamic exclusion of 10 s. Each MS scan was followed by high-energy collisional dissociation and MS/MS scans at a resolution of 15,000 on the 20 most abundant precursor ions.For each sample, obtained from three different cell donors, 30 \u03bcL was subjected to short (5 min) denaturing electrophoresis on a NuPAGE 4\u201312% gradient gel in MES SDS running buffer (50 mM MES 2-N-morpholino ethane sulfonic acid), 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.3). After brief staining with SimplyBlue SafeStain  and de-staining overnight in MilliQ water, each proteome was extracted as a single polyacrylamide band. Each sample was proteolyzed with trypsin Gold  in the presence of ProteaseMax detergent . From the 50 \u00b5L resulting peptide mixture, 4 \u00b5L was injected into a nanoscale C18 PepMap100 capillary column  and resolved with a 120-min gradient of CH\u00ae system, Merck Millipore, Burlington, MA, USA) and multiplex cytokine reagents . The sensitivity of the standards ranged from 2 to 32,000 pg/mL.Concentrations of ADAMTS13, angiopoietin, angiostatin, BMP-9, BNP, Chitinase3 like1, CK-MB, CXCL10, CXCL16, CXCL6, cystatin C, D-dimer, EGF, endocan-1, endoglin, endothelin-1, FABP3/4, FGF-1/2, follistatin, G-CSF, GDF-15, Granzyme B, HB-EGF, IL-12p70, IL-17, IL-18, IL-1\u03b1, IL-1\u03b2, IL-6, IL-8, leptin, LIGHT, lipocalin-2, MPO, myoglobin, NTproBNP, OSM, osteopontin, PDGF-AB/BB, PLGF, procalcitonin, P-selectin, SAA, sAXL, sc-kit, sEGFR, sE-selectin, sHER2/3, sHGFR, s-ICAM1, sIL6-RA, s-neurophilin1, sPECAM1, sTIE-2, suPAR, sVCAM1, sVEGFR1/2/3, tenascin C, thrombospondin-2, TNF\u03b1, TNF-RI, TREM1, troponin1, and VEGF-A/C/D were quantified in cell supernatants using a bead-based immunofluorescence assay  following the manufacturer\u2019s instructions and treated with the DNase I Ambion kit . RNA sequencing was performed using the NEXTFLEX Rapid Directional RNA-seq kit .p\u2013values adjusted using the Benjamini\u2013Hochberg multiple testing correction method [Separate analyses were performed for LASV- and MOPV-infected samples and their corresponding controls and the proteins identified and quantified using MaxQuant software  . MOPV-inn method , which cFunctional enrichment analysis was performed using the Camera6 (competitive gene set test accounting for inter-gene correlation) method to explore gene-set enrichment and pathway analysis based on the limma R package (Bioconductor) . FunctioRNA was isolated from HUVECs and the samples quantified using the Quantifluor RNA system . RNA sample quality control was performed using the Standard Sensitivity RNA Kit on a Fragment Analyzer  and the Pico RNA Kit on a Bioanalyzer . All RNA samples were validated before proceeding to library preparation, with an RNA quality number (RQN) > 7 for all samples and sufficient concentrations/quantities. Libraries were prepared using the NextFlex Rapid Directional library preparation kit for NextSeq . Sequencing of 33 samples was performed on an Illumina NextSeq platform to generate single end 75-bp reads. The read quality of each run was assessed according to Illumina thresholds, for which between 92 and 95% of PF read bases were higher than Q30.After trimming of the adaptors using Cutadapt, v 2.4  , high-qup-value. Raw p-values were corrected for multiple-testing using the Benjamini\u2013Hochberg method. Genes with an adjusted p-value < 0.05 were considered to be differentially expressed (DE) for the given pairwise comparison.Gene expression profiles were analyzed using R software (v 3.6.1)  and several Bioconductor packages , includip < 0.05). A Wilcoxon test was performed to analyze gene expression in each pathway. Mean comparisons between groups was performed using a t-test with Welch\u2019s correction. Growth kinetics were compared by two-way ANOVA followed by Sidak\u2019s multiple comparisons test.The Wald Test (in R with the packages R DESeq\u00b2 and SARTools) was performed to identify genes or proteins significantly under or over expressed  6, 24, and 48 h after infection and observed a modification during the kinetics of the cultures, including in the mock condition A. LASV aWe more finely characterized the response of HUVECs to LASV and MOPV infection by analyzing the expression of genes representative of pathways relevant to the biology of ECs ,38,39. AWe next explored whether the differences in gene expression induced by the two viruses led to differences in protein synthesis. First, we quantified 72 soluble proteins in the cell supernatants using Luminex technology . The quantity of only five differed according to the condition . We deteWe performed a label-free shotgun proteomics analysis with high-resolution tandem mass spectrometry on cell extracts and cell supernatants harvested 18 and 48 h after infection to obtain a deeper insight into the proteomic changes . As the We also compared the proteome of HUVECs according to several pathways relevant to EC biology. The results confirmed that MOPV, but not LASV, induces a robust type I IFN response 48 h after infection . NeitherECs are pivotal in the pathogenesis of viral hemorrhagic fevers, including LF. Indeed, although coagulopathy and thrombocytopenia contribute to the hemorrhagic signs and hypovolemic and hypotensive shock observed during severe LF ,41, vascWe finely characterized the response of HUVECs to both viral infections by analyzing their transcriptome and proteome. LASV stimulated greater synthesis of mRNA than MOPV by cells early after infection and up to 24 h. The transcriptomic profile suggests that RLR-, TLR-, NF\u03baB-, and TNF-signaling pathways were activated 6 h after LASV infection. A number of genes involved in antigen-processing/presentation and cell adhesion was also upregulated 6 h post infection. These results indicate that cell sensors are rapidly triggered after LASV infection, which does not appear to be the case with MOPV. However, this early stimulation was followed by only the modest upregulation of genes and proteins belonging to the type I IFN response in LASV-infected HUVECs, and no further synthesis of mRNA coding for cytokines and chemokines or proteins involved in antigen processing/presentation or cell adhesion was observed from 24 h after infection. We obtained similar results for the corresponding proteins. Such a rapid shutdown of the transcription of genes involved in innate immunity and antiviral responses following LASV infection is consistent with the immunosuppressive exonuclease domain contained in the LASV NP. Indeed, arenavirus NP includes an exonuclease capable of digesting double stranded (ds) RNA, resulting in the absence of cell sensing of the viral infection and type I IFN synthesis ,50,51. TAside from proteins involved in innate immunity, we observed other differences between LASV- and MOPV-infected HUVECs. Low levels of GrzB were released into the supernatants of MOPV-infected HUVECs. This mediator could act on endothelial permeability, as GrzB is known to release vascular endothelial growth factor from the extracellular matrix, resulting in vascular permeability . HoweverOnly a few proteins were found to be differentially secreted into the supernatants of infected cells, but striking differences were observed between the two viruses. Indeed, LASV induced the early release of MAST4, a serine/threonine kinase ; FABP1, Although both LASV and MOPV replicate at substantial levels in HUVECs, the cellular response is dramatically different, with an early moderate response that is rapidly shut down after LASV infection versus a late but more intense response after MOPV infection. The immunosuppressive exonuclease activity encoded in the NP may be responsible for the rapid extinction of the HUVEC response after LASV infection, despite robust and lasting replication. The lower type I IFN response observed at the mRNA and protein levels 48 h after infection with LASV compared to MOPV is consistent with this hypothesis and could explain the rapid shutdown of the other pathways that are mostly linked to the type I IFN response. The robust responses induced at late stages of MOPV infection include the type I IFN response and antigen processing/presentation pathways. This is consistent with the higher immunogenicity of MOPV relative to that of LASV observed in other in vitro models ,21,54,55"}
+{"text": "Crinoids were among the most abundant marine benthic animals throughout the Palaeozoic, but their body size evolution has received little attention. Here, we compiled a comprehensive database on crinoid calyx biovolumes throughout the Palaeozoic. A model comparison approach revealed contrasting and complex patterns in body size dynamics between the two major crinoid clades (Camerata and Pentacrinoidea). Interestingly, two major drops in mean body size at around two mass extinction events (during the late Ordovician and the late Devonian respectively) are observed, which is reminiscent of current patterns of shrinking body size of a wide range of organisms as a result of climate change. The context of some trends (marked declines during extinctions) suggests the cardinal role of abiotic factors (dramatic climate change associated with extinctions) on crinoid body size evolution; however, other patterns  are more consistent with biotic drivers. Not surprisingly, body size is commonly under strong selection pressure; therefore, its evolution is a central focus of evolutionary studies3. Despite long-standing interests in such research, trends in body size of some major marine animal clades and their underlying evolutionary drivers still remain poorly understood.The size of an organism is undoubtedly one of its most prominent features, affecting nearly all aspects of life history, physiology, behaviour, ecology, and evolution4 because of their outstanding high diversity and abundance. Palaeozoic crinoids, due to their high fossilisation potential and a densely sampled fossil record7, present an ideal model for studying long-term body size evolution. Surprisingly, however, though considerable effort has been devoted to examining their diversity and disparity patterns11, studies exploring large\u2010scale body-size trends in fossil crinoids are almost lacking. Although a few relevant datasets are available, they either span only few geological stages12, focus on a local scale and/or within lineage size variation of a specific clade13, or provide global coverage but are hampered by inclusion of fragmentary and out-of-date source of data and lack critical and comprehensive analysis1. The present paper aims to fill this gap by investigating macroevolutionary body-size trends of crinoids across the Palaeozoic times using a comprehensive dataset of calyx biovolumes for 1005 crinoid genera (Supplementary Data Crinoids (Crinoidea), commonly called sea lilies or feather stars, were among the most dominant components of Palaeozoic benthic palaeocommunities. For instance, the Mississippian period is commonly referred to as the \u201cAge of Crinoids\u201d14.Our analyses demonstrate that temporal variation in crinoid calyx size is scale-dependent; i.e., it is related to the considered taxonomic level and temporal duration of sequences. Remarkably, two major declines in body size at around the late Ordovician and the late Devonian extinction events are both evident, corroborating the view that mass extinction may considerably influence body size evolution15. During this interval , crinoids had experienced a mass extinction and a major transition from the so-called Early Palaeozoic Crinoid Evolutionary Faunas (EPCEFs)\u00a0mostly represented by disparids, diplobathrid camerates and hybocrinids to the Middle Palaeozoic Crinoid Evolutionary Faunas (MPCEFs) dominated by monobathrid camerates17. As shown herein, this extinction appears to be size-biased and the observed size decline is mainly governed by extinction of larger camerates  best fit the data  after the Late Ordovician mass extinction  period until the Middle Devonian , when the mean calyx size underwent an essentially continual decline until the end-Devonian  Fig.\u00a0, Table\u00a01ta Table , which iion Fig.\u00a0, which is21 Fig.\u00a0 and to as21 Fig.\u00a0. Also, t22, statistical fitting was also conducted at lower taxonomic levels and/or shorter time spans  (Table Given that short-term and/or low taxonomic-level patterns may be masked over extended time periods or at high phylogenetic levelss) Table . At the s) Table . Camerats) Table . During s) Table .24. However, we found no relationship between crinoid body size and temperature  may in part be also driven by the newly evolving Mississippian-style durophagous predators10.In addition to major climatic disruptions associated with extinction events, leading to shrinking body size, external ecological factors (such as predation pressure) might have contributed to some of the observed trends. For instance, in camerates a driven positive trend in the Silurian-Devonian and stasis in the post-Devonian times seems to mirror a pattern of increasing predation-resistant arm morphologies from the Ordovician through the Devonian, with no significant change in predation resistance following the end-Devonian Hangenberg extinction28.The above data clearly show that crinoids exhibited a complex body size trajectory. Depending on taxonomic levels and temporal scales varying trends within Crinoidea are observed. These heterogenous dynamics might have been affected by a complex network of interacting physical and biological factors, rather than by a single driver (such as temperature). However, shared trends of shrinking body size at around the mass extinction events suggest that crinoid populations were responding similarly to broad-scale abrupt climatic perturbations. If the past can be used to illuminate the future, we may expect similar shrinking body size. Indeed, many species already exhibit smaller size as a result of climate change and many experimental studies suggest that a wide range of organisms, including echinoderms, may respond to unfavourable acidification and deoxygenation either by shrinking in size or by growing at a slower paceWe compiled the respective calyx biovolumes of 1,005 crinoid genera spanning Ordovician\u2013Permian interval into a database  supplemented with more recent taxonomic papers and revisions. Remaining named genera are either poorly illustrated or incompletely preserved.Biovolumes of respective calyces were estimated from the holotypes figured for type species mostly published in the Treatise on Invertebrate Paleontology. However, we also used primary literature when illustrations from the Treatise were insufficient to estimate the biovolumes. Recently described taxa (not included in Treatise) were also measured from figures in source papers. Calyx biovolume was approximated with standard volume calculations for different geometric solids following Brom et al.29. Our dataset was subjected to a time-series analysis using the \u201cpaleoTS\u201d package with joint parametrization  in Rstudio  in order to fit different likelihood models of trait evolution of the time-binned data24. The paleoTS package includes several simple  and complex, shift-including  models. We compared support of these models using the \u201ffit9models\u201d function based on the small-sample corrected Akaike information criterion (AICc) and the Akaike weight. To test whether the support for each model can be related to temporal duration of sequences, and if different evolutionary models might characterize specific (and shorter) time intervals, we also performed model fitting on two \u201bpruned\u2019 datasets encompassing data from the intervals in between mass extinctions.Our database comprises log-transformed biovolumes assigned to their respective geological stages. We included one biovolume estimate for the entire stratigraphic range of a respective genus given that size of the holotype of type species is usually representative for this genus throughout its durationAnalyses were also made between sister lineages (at the subclasses and parvclasses levels), which are nested at different taxonomic levels to determine which (if any) clade(s) are driving the overall trend and/or if any clades reveal dynamics that differ from the predominant pattern among the class Crinoidea.33), red curve from Fig 4 in34, and \u03b418O data (inverse proxy for temperature) ). The effect of temperature on body size was analysed using the GLS  regression models in R using the \u201cnlme\u201d package (v.\u00a03.1-14336), both with a first-order autoregressive model (AR1) to eliminate autocorrelation, and with no autoregressive model (AR0)37. All models were compared through AICc in pairs: one considering temperature as a predictor, and one assuming no such relation (null model). These analyses were performed at various taxonomic ranks (for the entire class and for constituent clades (subclasses: Camerata vs. Pentacrinoidea and parvclasses: Cladida vs. Disparida) and were also conducted separately for time series spanning shorter time intervals.In order to determine the role of climate factors in shaping body size trends, we sampled temperature and oxygen values from published datasets. As multiple estimates from various models and proxies exist, we sampled values independently from three different sources  tests. The effects of extinction and origination on the overall size distribution was assessed following Rego et al.Supplementary Information 1.Supplementary Information 2.Supplementary Information 3."}
+{"text": "Chronic graft-versus-host disease (cGvHD) is a systemic alloimmune and autoimmune disorder and a major late complication of allogeneic hematopoietic stem cell transplantation . The disease is characterized by an altered homeostasis of the humoral immune response. Immunoglobulin G (IgG) glycoprotein is the main effector molecule of the humoral immune response. Changes in IgG glycosylation are associated with a number of autoimmune diseases. IgG glycosylation analysis was done by the means of liquid chromatography in the National Institutes of Health (NIH) cohort of 213 cGvHD patients. The results showed statistically significant differences with regards to cGvHD NIH joint/fascia and skin score, disease activity and intensity of systemic immunosuppression. ROC analysis confirmed that IgG glycosylation increases specificity and sensitivity of models using laboratory parameters and markers of inflammation associated with cGvHD . This research shows that IgG glycosylation may play a significant role in cGvHD pathology. Further research could contribute to the understanding of the disease biology and lead to the clinical biomarker development to allow personalized approaches to chronic GvHD therapy. Chronic graft-versus-host disease (cGvHD) is a serious late complication of the allogeneic hematopoietic stem cell transplantation  associated with an increased non-relapse mortality rate, disturbed physical and functional status and reduced life quality of surviving patients. The disease affects approximately 50% of patients after alloHSCT with clinical features resembling aspects of many different autoimmune disorders. It is caused by a disparate immunological system interacting with a new (and perceivably foreign) host environment in a potentially curative attempt to replace the diseased immunity with a graft from a healthy donor and produce the protective graft-versus-tumor effect. The whole mechanism of this multisystemic disease remains to be elucidated . The disThe National Institutes of Health (NIH) consensus on cGvHD in 2005 (and updated in 2014) enabled standardized and systematic approach to cGvHD and uniform collection of clinical data , and als\u2013omics technologies enable researchers to analyze a large number of samples in a short time period, characteristics most desirable when discussing tracking of the disease dynamics. In the course of the quest for a cGvHD biomarker, the advancement of modern -omics tools should be exploited. One such tool is glycomics, which has been declared a research priority over the next decade since it has been recognized that glycans are directly involved in the pathophysiology of any major disease and that the further development of this scientific discipline is necessary to achieve the goals of personalized medicine  conducted at Center for Cancer Research, National Cancer Institute, NIH). Before entering the study, all subjects signed an informed consent approved by the NIH Ethical Committee. According to the study protocol, all subjects (aged 1-75) went through the 4-day multidisciplinary evaluation of cGvHD. For each patient a detailed medical history was collected, including demographics , pre- and post-transplant details , donor and graft information  and cGvHD characteristics . Subjects who had received intravenous immunoglobulins (IVIg) within 3 months prior to study entry were excluded from this study, to avoid interference with patients\u2019 IgG glycan analysis. After a physical examination by hematologist, a series of specialist examinations were done along with extensive laboratory processing that included the determination of laboratory markers of inflammation. Cryopreserved samples of heparinized blood plasma were sent to Genos Ltd. . IgG was isolated, deglycosylated and glycans analyzed by hydrophilic-interaction ultra-high performance liquid chromatography (HILIC-UHPLC). These methods were described in detail in previous publications  and for individual organs  were determined according to the established 2005 NIH classification for cGvHD : cliniciThe experimental design was carried out using appropriate methods (such as randomization) where gender and age parameters were taken into account. The results of the experiment went through quality checks using replicates and standards before statistical analysis. Appropriate descriptive statistics  was used in the statistical processing of the obtained results.Since IgG glycans often deviate from the normal (Gaussian) distribution, univariate analysis was performed using the non-parametric tests (Wilcoxon) with a goal to detect significant glycan structures. The significance level for the p value was adjusted according to the Bonferroni correction for multiple testing. The results were considered significant if the p value was less than 0.05.glycansPC\u2019). This method enables transforming a large set of variables into a smaller one that still contains most of the information in the large set. A large number of collected laboratory parameters (labsPC\u2019 variables). These variables were used for further analysis by logistic regression in order to assess the discriminatory potential of IgG glycans in the detection of presence/absence of cGvHD in individual organ systems, and disease activity (active/non-active). Scores describing disease severity and activity were also reduced to fewer categories as follows  method was used to obtain condensed uncorrelated glycan variables .ROC curves depicting previously described variables were used to describe specificity and sensitivity of glycans\u2019 discriminatory potential. ROC curves for glycan measurements model were compared to ROC curves built on laboratory parameters model (including markers of inflammation), and finally to the ones combining both of the mentioned. An area below the ROC curve greater than 0.9 indicates an excellent model, while an area of 0.8-0.9 is considered very good.Out of initially 262 blood plasma samples of cGvHD patients received, 20 samples were excluded because of the contamination . AnotherTherefore, IgG glycome composition was analyzed in 213 cGvHD patients . Majority received myeloablative conditioning (56.8%), had related donors (60.1%), peripheral blood hematopoietic stem cells source (77.9%), and history of a previous acute GvHD (66.2%). Most subjects were transplanted because of leukemia (64.8%) or lymphoproliferative disease (28.2%). These characteristics and variables describing the nature of their cGvHD are given in Glycan measurements were tested against all of the patients\u2019 characteristics and information on the onset and course of cGvHD listed in Statistically significant values were observed when comparing the glycans of cGvHD patients with no joint/fascia affected by cGvHD versus those with NIH grade 1 (mild), NIH grade 2 (moderate) or NIH grade 3 (severe) cGvHD of joint/fascia, irrelevant of other organ involvement. The results of the direct measurements as well as the derivative properties show a significant decrease in the proportion of galactosylated structures with higher NIH score.Change was often observed in two or even all three degrees of severity of joint/fascia involvement for the following galactosylated glycan structures GP8, GP14, GP15, GP18, IGP47, IGP48, IGP53, IGP54, IGP56, IGP57. The analysis indicated an increase in the proportion of agalactosylated structures . An increase in the proportion of sialylated structures was also observed , as well as a decrease in the proportion of fucosylated structures . Statistically significant, higher proportion of directly measured structures with branched GlcNAc and derived parameters suggesting an increase in its proportion were also characteristic for the group of patients with joint/fascia cGvHD  Figure\u00a01Significant differences were also observed in cGvHD patients without skin cGvHD compared to patients with mild or severe skin NIH cGvHD scores. In patients with skin cGvHD, the proportion of structures with bisecting GlcNAc was statistically significantly increased . A significantly higher proportion was also observed for IGP30 , whereas GP9, the monogalactosylated structure, showed the opposite trend Figure\u00a02Statistically significant differences were observed when comparing IgG glycans of patients with active versus inactive disease (by clinician\u2019s impression). Inactive disease was characterized by a decreased proportion of agalactosylated structures , as well as an increased proportion of galactosylated structures . An increased proportion of sialylated  and fucosylated structures , and a decreased proportion of structures with bisecting GlcNAc  were characteristic for inactive disease Figure\u00a03Statistically significant changes were visible when comparing patients with no or mild versus patients with moderate or high systemic immunosuppression. Higher immunosuppression was characterized by an increased proportion of agalactosylated structures , and structures with bisecting GlcNAc , as well by a decreased proportion of galactosylated , sialylated  and fucosylated structures  Figure\u00a04No statistical differences were detected when comparing cGvHD activity by therapeutic intent at the time of evaluation (data not shown).The complete list of significant results of the UHPLC analysis is given in Logistic regression models were built for: A) glycan measurements; B) laboratory parameters (including markers of inflammation), and C) glycan measurements and laboratory parameters combined. These models created for involvement of individual NIH cGvHD organ scores and cGvHD activity were evaluated and compared by using ROC curves which describe specificity and sensitivity of glycans\u2019 discriminatory potential.The ROC curves of glycan measurements (by the means of PCA) show the following values: NIH cGvHD skin (0.6922), NIH cGvHD mouth (0.6121), NIH cGvHD eyes (0.5732), NIH cGvHD gastrointestinal system (0.6238), NIH cGvHD liver (0.6626), NIH cGvHD lungs (0.6176), NIH cGvHD joints/fascia (0.7263) and NIH cGvHD genital in women (0.5999). Upgrading the model built for laboratory parameters (PCA) by combining glycan measurements shows an increase in the area under the ROC curve of all individual NIH cGvHD organ systems affected by cGvHD: skin (0.7968 \u2192 0.8271), mouth (0.7882 \u2192 0.7932), eyes (0.6779 \u2192 0.7181), gastrointestinal system (0.7149 \u2192 0.7872), liver (0.9200 \u2192 0.9344), lungs (0.7419 \u2192 0.7654), joints/fascia 0.8056 \u2192 0.8668) and the genital system in women (0.8355 \u2192 0.8636).The ROC curves of glycan measurements for cGvHD activity show the following results: 0.7953 for the clinician\u2019s impression of disease activity and 0.7775 for intensity of immunosuppression. Upgrading the model built by using the main components of laboratory parameters into a model that includes glycan measurements shows an increase in the area below the ROC curve for cGvHD activity parameters: clinician\u2019s impression of disease activity (0.9021 \u2192 0.9140) and intensity of immunosuppression (0.9192 \u2192 0.9418). ROC curves are shown in The results of this study for the first time confirm that N-glycosylation of IgG from plasma of well-defined and evaluated cGvHD patients\u2019 cohort is associated with clinical manifestations of cGvHD.UHPLC glycan analysis of blood plasma samples showed a significant association of individual glycans and changes in their composition with joints/fascia and skin cGvHD, as well as with clinician\u2019s impression of cGvHD activity and intensity of immunosuppression of cGvHD patients.A significant decrease in the proportion of directly measured glycans were observed in patients with cGvHD of joints/fascia. The decrease in the proportion of galactosylated glycans was also visible through by a decrease in the derivative parameters representing the proportion or frequency of glycan structures with one or two galactoses. Particularly interesting glycan could be FA2G2 (GP14) which significant decrease can be observed through all three degrees of joint/fascia cGvHD severity. A decrease in IgG galactosylation has been repeatedly associated with rheumatoid arthritis \u201319, whilAlthough IgG sialylation dynamics usually follows galactosylation since the existence of galactose is a prerequisite for the binding of terminal sialic acid, an increase in the proportion of structures with sialic acid was observed in our study. The increase was not determined by measuring direct properties but was evident from derivative properties that describe the sialylation of galactosylated fucosylated structures with or without bisecting GlcNAc.A reduced proportion of IgG Fc galactosylation was recently described in a longitudinal pediatric study where the authors observed lower levels of galactosylation in transplant patients (both before and after HSCT) versus HSC donors and healthy controls . The chaUnusual dynamics of the sialic acid content could also be explained by its origin from a Fab rather than an Fc fragment of IgG. Studies have shown that in autoimmune  but also in malignant diseases , the number of potential glycan binding sites on the Fab fragment increases . AuthorsAn increase in the total proportion of bisecting GlcNAc is associated with an increased affinity for Fc\u03b3RIIIa and consequently increased antibody-dependent cellular cytotoxicity (ADCC) . SimultaIn our study, similar to changes observed in joints/fascia cGvHD, the trend of decreasing galactosylation is also observed in skin cGvHD, while there is an increase in the proportion of sialylation and bisecting GlcNAc. Skin cGvHD is known to coincide with cGvHD of joints/fascia , and it Regarding cGvHD activity, analysis of the samples indicated a lower proportion of agalactosylated glycan structures, as well as a higher proportion of galactosylated structures in plasma samples of patients whose cGvHD was considered non-active. The same samples are characterized by more sialylated and fucosylated structures and a smaller proportion of structures with bisecting GlcNAc compared to the samples of subjects with active cGvHD. Described changes are a possible consequence of the disproportionate number of active cases  versus non-active cases of cGvHD , as well as the age difference in the two groups. Older age was previously linked with the decrease in the concentration of galactosylated structures .Another indicator of cGvHD activity showed consistent results with the clinical impression of disease activity. In general, statistically significantly higher proportions of agalactosylated structures, reduced proportions of galactosylated and sialylated structures were identified in patients with moderate or high intensity systemic immunosuppression compared to cGvHD patients with mild or no immunosuppression. The increased proportion of glycan structures with bisecting GlcNAc and decreased proportions of fucosylated structures also coincide with the clinical impression of disease activity. Particularly interesting were the structures GP1 (FA1) and GP3(A2B), which were found to be significantly elevated in patients with moderate and high levels of systemic immunosuppression, thus indicating a potentially greater sensitivity to the therapy used and, indirectly, to increased cGvHD activity.Limitations of this study are relatively small number of patients, cross-sectional design of the study, long time after HSCT and long time after cGvHD diagnosis to plasma IgG glycan analysis, including majority of patients with severe and active disease with several previous lines of systemic therapy and intensive current immunosuppression. However, it is a well defined and thoroughly evaluated cohort of cGvHD patients, with many clinical and laboratory details taking into consideration regarding glycan analyses.The specificity and sensitivity of glycan measurements as a potential diagnostic test for cGvHD organ involvement as well as disease activity were tested using ROC curves. The ROC curves of glycan measurements were compared with models built using laboratory markers of inflammation, as well as a model that combines both. The analysis found that glycan measurements, although insufficiently specific and sensitive on their own, successfully upgrade models constructed using laboratory markers of inflammation, contributing to a greater predictive ability to discriminate healthy organ systems from those affected by cGvHD. This applies to all organ systems affected with cGvHD  as well for scores describing disease activity. In most cases, very good models based on laboratory markers of inflammation, are upgraded to excellent models of high specificity and sensitivity when combined with glycan measurements.The results of this study for the first time confirm significant associations of IgG glycan structures with cGvHD manifestations, which may contribute to understanding the biology of the disease and lead to the development of a potential biomarker of cGvHD. Further studies are required, preferentially in longitudinal post-transplant cohorts, in order to validate these associations, determine the effect of post-transplant immunosuppression and treatment, and evaluate the potential practical clinical application in the diagnosis and treatment of cGvHD.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Center for Cancer Research, National Institutes of Health Ethics Committee. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.EP was the principal researcher and executor of the experiment and paper - this paper is part of her dissertation. DP and SP  mentored this research and were clinical researchers of the study. GL, together with previous authors, contributed to the research idea and concept. LD, FP, SM, RV, and DN were part of the clinical research team, also in charge of cGvHD evaluation. IU and MM conducted the statistical analysis. MP-B contributed and supervised the experimental glycan analysis. JR conducted the initial analysis and storage of cGvHD plasma samples. All authors contributed to the article and approved the submitted version.This work is supported by the Unity Through Knowledge Fund project entitled \u201cClinical and Biological Factors Determining Severity and Activity of Chronic Graft-Versus-Host Disease after Allogeneic Hematopoietic Stem Cell Transplantation\u201d, and also, in part, by the Croatian Science Foundation project IP-2016-06-8046 entitled \u201cNew biomarkers for chronic Graft-versus-Host disease\u201d. This work is supported by the Center for Cancer Research, Intramural Research Program of the National Cancer Institute, National Institutes of Health, USA. The opinions expressed here are those of the authors and do not represent the official position of the National Institutes of Health or the US Government.Author EP is currently employed by the company Fidelta Ltd. Authors MP-B, IU and GL were employed by the company Genos Ltd.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Machine learning (ML) is emerging as a feasible approach to optimize patients\u2019 care path in Radiation Oncology. Applications include autosegmentation, treatment planning optimization, and prediction of oncological and toxicity outcomes. The purpose of this clinically oriented systematic review is to illustrate the potential and limitations of the most commonly used ML models in solving everyday clinical issues in head and neck cancer (HNC) radiotherapy (RT).Electronic databases were screened up to May 2021. Studies dealing with ML and radiomics were considered eligible. The quality of the included studies was rated by an adapted version of the qualitative checklist originally developed by Luo et\u00a0al. All statistical analyses were performed using R version 3.6.1.Forty-eight studies  were included in the analysis. The most common imaging modality was computed tomography (CT) (40%) followed by magnetic resonance (MR) (10%). Quantitative image features were considered in nine studies (19%). No significant differences were identified in global and methodological scores when works were stratified per their task .The range of possible applications of ML in the field of HN Radiation Oncology is wide, albeit this area of research is relatively young. Overall, if not safe yet, ML is most probably a bet worth making. Cancers of the head and neck (HN) region involve anatomically complex and functionally essential structures, whose damage may severely compromise quality of life, especially in long-surviving patients . If the Nevertheless, this increasing amount of information is hardly manageable by single practitioners, and there is an unprecedented demand of novel, informatics-based tools to structure and solve complex clinical questions. To this aim, machine learning (ML)\u2014a branch of artificial intelligence (AI) relying on patterns and inference to execute a specific task\u2014could provide Radiation Oncologists (ROs) with accurate models to optimize patients\u2019 care paths .As compared with statistical methods, ML focuses on the identification of predictive patterns rather than on drawing inferences from a sample. Starting from sampling and power calculations, statistical models aim to assess whether a relationship between two or more variables describes a true effect and to interpret the extent of the above-mentioned relationship. A quantitative measure of confidence can therefore be provided to test hypothesis and/or verify assumptions . By contThe choice of the most suitable ML algorithm to solve a given problem starts with the characterization of available data, which can be either labeled  slice contains the contour of the tumor\u201d) or unlabeled . In the first case, the learning problem is of supervised nature, meaning that the algorithm uses labeled data (training set) to assign a class label to unseen, unlabeled instances (test set). Conversely, unsupervised learning uses unlabeled data to identify previously undetected patterns in the data set and reacts to the existence or absence of such patterns in new instances, without the need of human supervision. However, the aim of the model is the same: to assign similar, contiguous pixels with the correct label (PG vs. non-PG) by a computationally efficient and generalizable algorithm. Other than by input data type, models can be categorized according to their output. Broadly, if the output is a number  system), the task is defined as a regression problem, if it is a class , the task is called a classification problem, and if it is a set of input groups , it is a clustering problem.Following the idea of a \u201cbig-data\u201d approach for cancer care, several publications in the field of Radiation Oncology have come to life, with algorithms encompassing segmentation accuracy, treatment planning optimization, and prediction of both oncological and toxicity outcomes , 20\u201322. Segmentation of target volumes and organs at risk (OARs) is a critical component in the Radiation Oncology workflow. Following the recognition of intensity-modulated radiotherapy (IMRT) as a standard of care for HNC , accuratTreatment planning for HNC is challenging: expertise in both the medical  and in the physical field  is required, and timely delivery of radiotherapy (RT) is mandatory not to compromise oncological outcomes . In receOutcome prediction is crucial in the field of Radiation Oncology, especially in the era of personalized treatments. As deintensification strategies are being tested in clinical trials , and bioOther than achieving disease control by the irradiation of the gross and clinical tumor volumes , the optimal radiation treatment plan aims at the preservation of healthy surrounding structures. Although the introduction of modern RT techniques has ameliorated the therapeutic ratio, acute and chronic RT-related toxicities still represent a significant burden for patients\u2019 quality of life and may compromise timely treatment delivery . In receTo this aim, the use of spatial dose metrics, such as gradient and direction, may provide more comprehensive information than the sole absolute mean and maximum doses , 46. AddStudy methodology complied with the outlines of the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) . OriginaElectronic databases  were screened up to May 2021 without date restrictions by an author experienced in bibliographic search (SV). Free text, Boolean operators, truncation, and proximity operators were tested. No filters were applied, in order not to exclude potentially relevant publications. The full-search strategy is provided in Findings from the above-reported search were independently screened and selected based on titles by two Authors ; disagreements were subsequently discussed in presence of three other authors . All types of ML algorithms were considered eligible for the analysis, as well as studies encompassing the use of extracted quantitative imaging features. The selection process is shown in The quality of the studies included in the analysis was rated by an adapted version of the qualitative checklist originally developed by Luo et\u00a0al. for the reporting of predictive modeling in biomedical research . This chp-values corrected for false-discovery rate (FDR) were also provided to account for multiple testing, considering a threshold of 0.05. All statistical analyses were carried out using R version 3.6.1.Descriptive statistics , min, max, standard deviation) were provided for global score and methodological score from the modified Luo classification . Score dForty-eight studies were included in the analysis: publication years ranged between 1998 and 2021; with more than a half having been published after 2018 (56%). Twenty-one (44%) focused on ML algorithms for autosegmentation, four (8%) were dedicated to treatment planning, 12 (25%) to oncological outcomes prediction, 10 (21%) to RT-related toxicity, and one (2%) to the determinants of postoperative RT delays following surgery for HNC.Twenty-one works (44%) considered more than one HNC subsite, while the most common single primary site was the nasopharynx, which was the focus of seven studies (15%). Of note, this information was missing in six cases (12%). The most common imaging modality was CT (40%), followed by magnetic resonance (MR) (10%). Quantitative image features were considered in nine studies (19%) and were mainly CT based (75%). Dosimetric parameters were used in six of the analyzed works, five on toxicity outcomes prediction, and one on the identification of candidates to replanning.Here follows a detailed description of the studies sorted by main topic, with each topic representing a critical step in the modern workflow for HNC patients in Radiation Oncology.The majority of the included studies (21/48) focused on the design of ML algorithms for autosegmentation: seven were for the segmentation of treating volumes (either CTV or GTV) and 13 for OARs. Considering the former, tumor GTV (GTV-T) was the target of prediction for six studies; in one of these, the algorithm was used for the delineation of the nodal GTV (GTV-N) and the CTV as well. Additionally, one study aimed at the sole segmentation of the left and right II\u2013IV nodal levels. A fully automated approach was used in all but one study . OverallAmong algorithms for OAR delineation, studies were heterogeneous in the choice of the target(s) of segmentation. The majority of studies (12/13) considered PG segmentation as a primary endpoint \u201368, withOverall, autosegmentation studies were mainly CT based (13/21); in decreasing order of frequency were MR (three of 21), CT + MR (two of 21), positron emission tomography , and CT + PET (one of 21). Sample size varied considerably, ranging from 5 to 486 .A complete description of individual studies characteristics is provided in Of the included studies, two focused on the identification of predictive factors for replanning , 75. GuiA third study on ML for RT planning was published by Nguyen et\u00a0al.  and focuFinally, Thummerer et\u00a0al.  in theirOverall, 12 of the included studies considered oncological outcomes following curative-intent treatment as their target of prediction. In details, six studies , 78\u201381 aA single disease subsite was considered by two studies, with Zdilar et\u00a0al.  includinLRC was the target of prediction in four cases , 82\u201384; Lastly, the prediction of DMFS was the objective of one study . Wu et\u00a0aA total of 11 studies focused on RT-induced toxicities; in each publication algorithms were developed for addressing the prediction task on a single outcome .Four studies , predominantly encompassing multiple HN subsites, focused on xerostomia prediction; all but one included dosimetric parameters in the data set . The PGsThe remaining studies presented different toxicity outcomes  , 92\u201395. Methods items only, median rank was 22 (IQR: 20\u201325), with the worst and best scores being 15 and 32, respectively. As it can be noted in p = 0.48 and 0.67, respectively; FDR-corrected p = 0.62 and 0.67, respectively). Yet, studies dedicated to outcome modeling and treatment planning achieved numerically lower scores in both the global and methodological assessment.Considering a maximum achievable score of 58 in the adapted Luo rating system for ML applications in biomedical research, median score of the included studies was 39 (IQR: 36\u201344), with minimum and maximum values being 27 and 53, respectively. When analyzing the n = 37) categorized according to the use of texture analysis vs. other imaging-derived metrics or deep learning  were evaluated. Since the analysis of quantitative extracted features usually requires an intensive work of statistical preprocessing, frequently lacking in deep learning studies, we tested the hypothesis that studies extracting features are associated with higher methodological scores. Even though no significant difference was found, a trend favoring texture analysis publications was noted especially for methodological study quality . Not only was the choice of algorithms, features and variables widely heterogeneous, but most studies considered small- to medium-sized datasets and mixed disease subsites. In particular, sample size could strongly affect the quality of ML models as the training sets size is widely recognized as one of the main issues in pattern recognition studies. In fact, as the number of considered features increases, larger training sets become mandatory to avoid the so-called curse of dimensionality . To partConsidering these pitfalls, and the fact that the checklist was not designed to provide a quantitative assessment, relevant findings still emerged. Firstly, studies aiming at toxicity prediction resulted to have the highest quality in both global and methodological scores as compared with those classified in the other categories. Secondly, works incorporating quantitative image features as input parameters had better median methodological scores, which could be at least partially explained by adequate reporting on the preprocessing on imaging data. Finally, works having a nonclinician as first author achieved a higher ranking, with a strong statistical significance. This finding could derive from the scarcity of dedicated educational training on ML and statistics in most medical schools and residency programs.The DSC was the performance evaluation metric used in all works dedicated to autosegmentation, while the AUC was implemented in one study only . ConsideAdmittedly, our work presents some limitations. As for all systematic reviews, eligible publications of the last months may be missing, albeit the search was repeated regularly while the manuscript was being written. Moreover, despite our attempt to perform a comprehensive search, the lack of a common ontology in ML may have led to the exclusion of some works: to overcome this potential bias, cross-references from the included works were screened for eligibility. To conclude, we provided the full search strategy for future reference, as we are aware that several additional works will be published in the upcoming months, given the fast-growing nature of this field.Acknowledging these issues, we do believe that, other than being a full overview of existing literature, the value of our work is to provide a systematic quality assessment of published works, which could be informative for both general and advanced readers. Large-scale datasets, common ontology, study design, and performance reporting will most probably be needed to concretely implement ML in clinical practice, and discussion on this regard is both expected and encouraged. To this aim, the inclusion of dedicated AI courses in the educational track of future ROs would arguably foster the quality of scientific outputs in the field.Finally, ML-based modeling for HNC is a promising and rapidly expanding field, even though more solidly constructed and validated algorithms are warranted to overcome the boundaries of speculative investigation and to open doors to better tailored Radiation Oncology for this subset of patients. Overall, if not safe yet, ML is most probably a bet worth making.The individual scores assigned to all the studies included in the manuscript are available upon request to the corresponding author.SV, MP, MZ, FB, RS, GM, and BJF were responsible for conception and design of the study and wrote the first draft of the manuscript. SV, MP, MZ, and FB were responsible for data acquisition and wrote sections of the manuscript. LJI, DA, SG, AS, ML, and RO wrote sections of the manuscript. All authors contributed to manuscript revision and read and approved the submitted version.The study was fully funded by the University of Milan with APC funds. The Institution of some authors (IEO) was partially supported by the Italian Ministry of Health with Ricerca Corrente and 5 \u00d7 1,000 funds. SV was supported by the Department of Oncology and Hemato-Oncology (DIPO) of the University of Milan with \u201cProgetto di Eccellenza\u201d. MZ received a research grant from the European Institute of Oncology-Cardiologic Center Monzino Foundation (FIEO-CCM), with a project entitled \u201cProton therapy vs. photon-based IMRT for parotid gland tumors: a model based approach with Normal Tissue Complication Probability (NTCP)\u201d outside the current study. SV, FB, and LJI are PhD students within the European School of Molecular Medicine (SEMM), Milan. The sponsors did not play any role in the study design, collection, analysis, and interpretation of data, nor in the writing of the manuscript, nor in the decision to submit the manuscript for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The normative feedback compared participants\u2019 personal anti-vaccine conspiracy beliefs and perceptions of other UK parents\u2019 beliefs with actual normative belief levels. Parents receiving the normative feedback showed significantly reduced personal belief in anti-vaccine conspiracy beliefs at immediate post-test. As hypothesised, changes in normative perceptions of anti-vaccine conspiracy beliefs mediated the effect of the intervention. The intervention, did not directly increase vaccination intentions, however mediation analysis showed that the normative feedback increased perceptions of other parents\u2019 vaccination intentions, which in turn increased personal vaccination intentions. No significant effects remained after a six-week follow-up. The current research demonstrates the potential utility of Social Norms Approach interventions for correcting misperceptions and reducing anti-vaccine conspiracy beliefs among UK parents. Further research could explore utilising a top-up intervention to maintain the efficacy.Anti-vaccine conspiracy beliefs among parents can reduce vaccination intentions. Parents\u2019 beliefs in anti-vaccine conspiracy theories are also related to their perceptions of other parents\u2019 conspiracy beliefs. Further, research has shown that parents hold misperceptions of anti-vaccine conspiracy belief norms: UK parents over-estimate the anti-vaccine conspiracy beliefs of other parents. The present study tested the effectiveness of a Social Norms Approach intervention, which corrects misperceptions using normative feedback, to reduce UK parents\u2019 anti-vaccine conspiracy beliefs and increase vaccination intentions. At baseline, 202 UK parents of young children reported their personal belief in anti-vaccine conspiracy theories, future intentions to vaccinate, and their perceptions of other UK parents\u2019 beliefs and intentions. Participants were then randomly assigned to a normative feedback condition ( Social norms are informal, unwritten expectations about appropriate social behaviour, outlining what is acceptable and not in particular contexts, and are important determinants of attitudes and behaviours \u20133. Two tThe Social Norms Approach (SNA) begins with the premise that individuals are influenced by the beliefs and behaviours of others and often make misperceptions about how much others engage in certain behaviours , 9. For Conspiracy theories are alternative explanations for events that implicate secretive and powerful groups in covering up information to suit their interests . ExampleVaccine hesitancy is defined by the World Health Organisation (WHO) as \u201cthe reluctance or refusal to vaccinate despite the availability of vaccines\u201d and reduces vaccination intentions and uptake . The WHPrevious research into interventions to increase vaccination intentions has been inconsistent . For exahttps://osf.io/cdp53) and the materials and anonymous data can be accessed here: https://osf.io/rhb5p/The current study aims to test the utility of a brief online normative feedback SNA intervention to reduce anti-vaccine conspiracy theories and increase vaccination intentions among UK parents of young children. Cookson et al.  found thd = .35), a sample of n = 174 participants would be required for 80% power. Similarly, a sample size of at least 148 participants is recommended for mediation analysis expecting a small-medium effect . Similarly, a change in perceived conspiracy belief at immediate post-test significantly predicted personal anti-vaccine conspiracy beliefs immediately after the intervention, b = -.22, SE = .04, t(160) = -5.14, p < .001, CI . The direct effect of the normative feedback intervention on personal belief in anti-vaccine conspiracy theories immediately post-test was also significant, b = .19, SE = .08, t(160) = 2.43, p = .02, CI , however, this effect is increased when the mediator (change in perceived norms) is included, b = .32, SE = .08, t(161) = 3.97, p < .001, CI , indicating mediation. Confirming this, the indirect effect is significant, b = .13, SE = .05, 95% CI, showing that the normative feedback reduced perceived norms of other parents\u2019 beliefs in anti-vaccine conspiracy theories which, in turn, reduced personal belief in anti-vaccine conspiracy theories.Mediation analysis was employed to examine the mechanism through which the normative feedback reduced belief in anti-vaccine conspiracy theories at immediate post-test. Specifically, this analysis tested the hypothesis that the change in perceived norms of other parents\u2019 anti-vaccine conspiracy beliefs from baseline to immediate post-test mediates the influence of the SNA normative feedback on personal anti-vaccine conspiracy beliefs. The change in perceived norms of other parents\u2019 anti-vaccine conspiracy beliefs variable was calculated by subtracting participants\u2019 perceived beliefs after the intervention from their baseline perceptions. Therefore, a positive number indicates that perceptions of other parents\u2019 beliefs in anti-vaccine conspiracy theories have decreased. The mediation analysis was conducted using Model 4 the PROCESS macro for SPSS, with 5000 bootstrapped samples . Baselinb = .55, SE = .14, t(161) = 4.02, p < .001, 95% CI . Similarly, a change in perceived vaccination intention norms at immediate post-test predicted personal vaccination intentions immediately after the intervention, b = -2.02, SE = .48, t(160) = -4.23, p < .001, 95% CI . However, neither the direct effect b = -.20, SE = .86, t(160) = -.23, p = .82, 95% CI  or total effect b = -1.30, SE = .87, t(161) = -1.51, p = .13. 95% CI  of the normative feedback intervention on personal vaccination intentions immediately post-test were significant. The indirect effect of the normative feedback intervention on vaccination intentions was significant, b = -1.10, SE = .73, 95% CI . Meaning that the intervention increased perceived norms of vaccination intentions which in turn increasedpersonal vaccination intentions.Mediation analysis was employed again to test the hypothesis that the normative feedback increased perceived norms of other parents\u2019 vaccination intentions from baseline to immediate post-test, which increased participants\u2019 vaccination intentions. The change in perceived vaccination intentions variable was calculated by subtracting participants\u2019 perceived vaccination intentions of other parents at immediate post-test from their baseline perceptions. Therefore, a negative number indicates that perceptions of other parents\u2019 vaccination intentions have increased. The mediation analysis was conducted using Model 4 the PROCESS macro for SPSS, with 5000 bootstrapped samples . BaselinThe current research suggests that anti-vaccine conspiracy beliefs could be reduced via a brief normative feedback intervention based on the Social Norms Approach. Compared to an assessment only control, UK parents of young children who were exposed to the normative feedback intervention showed reduced belief in anti-vaccine conspiracy theories at immediate follow-up. Moreover, mediation analysis demonstrated the predicted mechanism; the intervention reduced perceived norms of anti-vaccine conspiracy beliefs, which in turn reduced personal beliefs. To our knowledge, our work is the first to showcase the possibility that normative feedback (as per the SNA) could be used as a technique to reduce anti-vaccine conspiracy beliefs. However, we also found that the effects of the intervention did not hold at the six-week follow-up, and there was no direct effect of the normative feedback on vaccination intentions. Mediation analysis however showed an indirect effect of the intervention on vaccination intentions; whereby the intervention increased perceptions of other parents\u2019 vaccination intentions, which in turn increased personal vaccination intentions. Thus, further research exploring whether a top-up intervention could effectively maintain efficacy is warranted.Our research has replicated and extended the work by Cookson et al., . SpecifiFurthermore, our findings showcased that the normative feedback intervention was successful in reducing anti-vaccine conspiracy beliefs at immediate post-test . Participants who received normative feedback had a decreased belief in anti-vaccine conspiracy theories at the post-test measure. Our finding is important as this is the first time to our knowledge that a novel SNA type intervention has been used to reduce anti-vaccine conspiracy beliefs. Given the potential dangers of anti-vaccine conspiracy beliefs for health-protective behaviours , an intervention to address conspiracy beliefs has been long-awaited. However, the decrease in personal belief in anti-vaccine conspiracy theories did not hold for the six-week follow-up. At the six-week follow-up, participants\u2019 conspiracy beliefs increased back to where they were at baseline. Previous research has used different lengths of time for a follow-up, and while four weeks had been considered short , as the The current study also provided evidence for the mechanism through which the normative feedback is effective. Supporting hypothesis 3, mediation analysis demonstrated that the normative feedback reduced participants\u2019 perceptions of other parents\u2019 belief in anti-vaccine conspiracy beliefs, which in turn reduced their personal belief in anti-vaccine conspiracy theories. These findings support the focus on correcting misperceptions of anti-vaccine conspiracy beliefs and provide evidence that changing perceived norms directly influence anti-vaccine conspiracy beliefs.beliefs rather than correcting misperceptions of vaccination intentions (M = 5.85 out of 7). Therefore, the participants in this study already had high vaccination intentions before the intervention, even though we attempted to recruit more hesitant participants about vaccines. Future research could focus vaccination interventions more specifically on participants who are hesitant about using vaccines. The analysis did however support hypothesis 4, where an indirect effect of the intervention on vaccination intentions was demonstrated. Therefore, this intervention does have the potential to correct misperceptions of vaccination intentions of other parents, which then in turn increases personal vaccination intentions.However, the normative feedback did not directly increase vaccination intentions, and thus hypothesis 2 was not supported. One reason for this may be because the normative feedback was focused on correcting misperceptions of anti-vaccine conspiracy tentions . TherefoA limitation of the study lies in the way the feedback was presented to participants. In this study, participants in the normative feedback condition were given their normative feedback immediately after the baseline measures. The actual belief of other parents  was taken from previous research by the authors , and theM = 5.85) were similar to those of UK parents measured in a previous study were data collection occurred in 2012 () In conclusion, this study has demonstrated that SNA normative feedback reduced perceptions of anti-vaccine conspiracy beliefs and increased perceptions of vaccination intentions of other parents, which in turn reduced personal anti-vaccine conspiracy beliefs and increased vaccination intentions. Our work demonstrates the utility of normative feedback to address anti-vaccine conspiracy beliefs in UK parents and is the first time, to our knowledge, that this technique has been used in this context. This research, therefore, provides the initial step in utilising normative feedback, where future research should focus on further understanding the use of this type of intervention to combat the dangers of conspiracy beliefs.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S1 File(DOCX)Click here for additional data file."}
+{"text": "Naphthenic acids (NAs) in petroleum pollute aquatic environments and can disrupt hormone activity. Male frogs exposed to NAs had disrupted testicular function and suppressed mating behaviours, despite appearing otherwise healthy. These effects were reversed after the frogs returned to clean water, suggesting that contaminated ecosystems can be recovered. Silurana tropicalis. Courtship primarily consists of males producing low trills and achieving amplexus, a mating position where a male clasps a female. Adult males were exposed for 5\u00a0days to 20\u00a0mg/l NA and injected with human chorionic gonadotropin to induce calling. The duration of calling activity was significantly reduced by NA exposure. Other acoustic parameters such as dominant frequency, click rate and trill length were not affected. Vocalization and amplexus were both inhibited after NA exposure and restored after 2\u00a0weeks of recovery in clean water. To determine possible disruption at the level of the testes, the effects of NA exposure on gene expression of key players in steroidogenesis was determined. Exposure to NAs decreased srd5a on average by ~\u200925%. The enzyme 5\u03b1-reductase, encoded by srd5a, converts testosterone to its more bioactive form 5\u03b1-dihydrotestosterone (DHT), so NAs may be affecting this steroidogenic step. However, the observed upregulation of lhr, star and cyp17a1 suggests that NA-exposed males may be attempting to counteract the reduced potential to produce DHT. Yet, these NA-exposed frogs have dramatically reduced calling duration, so the observed upregulation of star and cyp17a1 is decoupled from the vocalizations. Calling duration and the ability of males to amplex females is reversibly disrupted by NA exposure, implying that environmental reduction and removal of NAs may help improve habitability of contaminated ecosystems.Naphthenic acids (NAs), the carboxylic acids found in petroleum, are of emerging concern as they contaminate coastlines after oil spills, leech into freshwater ecosystems of oil sands areas and have wide industrial applications. They are acutely toxic in fish and tadpoles and may be endocrine disruptors at sublethal levels. We characterized androgen-dependent courtship behaviours and their disruption by NAs in male Western clawed frogs,  Naphthenic acids (NAs) are a diverse group of compounds that encompass all carboxylic acids found in crude oil, accounting for up to 3% of total mass . ConsequPimephales promelas) (Sander vitreus) (Carassius auratus) caged in OSPW containing large amounts of NAs showed elevated plasma cortisol, indicating an endocrine stress response. Plasma levels of testosterone were also reduced in both male and female goldfish  and Western clawed frogs (Silurana (Xenopus) tropicalis) experience 100% mortality after 24-h exposure to 6\u00a0mg/l of a commercial NA preparation  exposed to water-soluble fractions of crude oil from Kazakhstan experienced reduced growth, delayed development, disrupted biochemical pathways and increased mortality ((Lithobates sylvaticus). They experience reduced growth, an LC50 of ~\u20093\u20134\u00a0mg/l, and 100% mortality at 6\u00a0mg/l total NAs , amplexus and vocalization can both be induced by human chorionic gonadotropin (hCG), an analogue of pituitary luteinizing hormone (LH) that triggers gonadal steroid production. In castrated adult males, hCG no longer promotes calling. However, exogenous testosterone (T) and its active androgenic metabolite 5\u03b1-dihydrotestosterone (DHT) both restore calling in castrated males, and laryngeal muscles are dense in androgen receptors, demonstrating that the behaviour is dependent on testicular androgens in X. laevis  were identified by the presence of black stripes on the forearms , a secondary sex characteristic.https://www.boris.unito.it), a video analysis software. Mean swimming speed was not different between control (11.5\u00a0cm/s) and NA-exposed (12.8\u00a0cm/s) male frogs . The experimental NA exposure level is below levels found in tailings ponds and is within the range detected in some groundwater samples and in natural and constructed wetlands in the Athabasca oil sands region of Alberta, Canada. For example, OSPW NA concentrations may be as high as 128\u00a0mg/l  in filtered, dechlorinated water from the University of Ottawa Aquatics facility. Frogs were individually exposed in static glass tanks containing 3 litres of the treatment solution at 26\u2009\u00b1\u20091\u00b0C. Solutions were fully replaced on the third day. For consistency, all experiments used the same batch of the commercial NA extract that we have chemically and biologically characterized extensively , followed by a boosting dose of 100\u00a0IU after 1\u00a0day. Injections were prepared by dissolving the hCG in 0.7% saline for a volume of 50\u00a0\u03bcl per injection. After the boosting injection, the frogs were monitored to screen out non-calling individuals. After 5\u00a0days of recovery, individuals were exposed to NAs for 5\u00a0days. At the beginning of the sixth day, calling was induced with hCG and recorded. A randomized block design was used, that is, at least 1 frog from each treatment was recorded simultaneously to account for potential effects of time and potential uncontrollable variables . Tanks were visually and acoustically isolated with pyramid foam. A hydrophone  was placed in each tank and used in combination with an external interface (UMC404HD) plugged into a computer.n\u2009=\u200936, r\u2009>\u20090.99). Absolute calling duration was measured by summing the duration of each trill. Although there was no quantitative definition of a trill or inter-trill intervals, individual trills are visually and acoustically distinguishable with a clear start and end. Spectral plots were generated by Fast Fourier Transform on pooled calls from an individual frog. The frequency of the highest peak was recorded, obtaining one dominant frequency per frog. Click rate was manually counted over time and averaged over five randomly selected trills from each frog. The four types of S. tropicalis calls were observed (n\u2009=\u20097) and May 2018 (n\u2009=\u200912), frogs were screened 5\u00a0days before the experiment. Since all frogs called, the screening step was not conducted in May 2019 (n\u2009=\u20098), nor in the remaining experiments. Given that NAs supress calling in our frogs (see n\u2009=\u20098), control and NA-exposed males were given the normal priming dose and a boosting dose of 100\u00a0IU hCG after 1\u00a0day, whereas other groups of NA-exposed males were given higher boosting doses of 300 or 600\u00a0IU hCG in an attempt to hormonally rescue the NA-inhibited calling behaviours. For all experiments described thus far, na\u00efve frogs were used.Calls were recorded with multichannel recording software  and exported to audio editing software  to visualize sound waveforms and spectrograms. Audio files were analysed by several blind observers, with a total of 36 files analysed by two different people. The inter-observer repeatability, that is, the correlation between the values obtained by two observers for the same file was very high (observed  and consrogs see  and hCG n\u2009=\u200910), another vocalization assay was conducted and these frogs were kept for further testing. To examine effects of NA exposure on mate competition, pairs of one control and one NA-exposed male were rinsed and placed in 3-litre clean water to remove surface NAs immediately after the vocalization assay. After 1\u00a0h, the pair of males was allowed to freely interact with a sexually receptive female who had been hCG-injected according to the same protocol and was ovulating. The trio was left undisturbed until the female was in amplexus with one of the males. Afterwards, the same male frogs from the competition experiment were maintained under normal, NA-free conditions for 14\u00a0days, then retested to determine if the inhibitory effects of NAs are reversible.In March 2020 . Testes were dissected with the order of sample collection alternated between treatments. Samples were frozen in dry ice and stored at \u221280\u00b0C for later analysis.n\u2009=\u20098 per group) according to manufacturer\u2019s instructions for the RNeasy Mini Kit (QIAGEN). Extracted RNA was re-suspended in 30\u00a0\u03bcl of RNase free water. NanoDrop ND-2000 (Thermo Scientific) was used to determine total RNA concentration as well as the purity of extracted RNA by measuring nucleic acid absorbance ratios A260/280 and A230/260. Extracted RNA integrity as assessed using a 1% (w/v) agarose electrophoresis gel containing 1% SYBR Safe DNA stain (Thermo-Scientific) at 90\u00a0V for 60\u00a0min. All RNA samples were stored at \u221280\u00b0C until used for PCR.Total RNA was isolated from a single testis (5.9\u201316.5\u00a0mg) for each frog (Synthesis of complimentary DNA (cDNA) was performed with the cDNA Maxima Kit (Thermo-Scientific) in a total reaction volume of 20\u00a0\u03bcl. All RNA concentrations were standardized to 125\u00a0ng/\u03bcl prior to reverse transcription and each reaction contained 1\u00a0\u03bcg of total RNA for conversion into cDNA. The cDNA synthesis thermal cycling was performed in the Eppendorf MasterCycler with the following protocol: 10\u00a0min at 25\u00b0C followed by 30\u00a0min at 50\u00b0C and a final deactivation cycle for 5\u00a0min at 85\u00b0C. Samples were stored at \u221220\u00b0C.lhr, star, cyp17a1, cyp19, srd5alpha2 and srd5beta) and one housekeeping gene (rpl8) were designed using NCBI Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and synthesized by Integrated DNA Technologies. The cDNA templates were amplified using Maxima SsoAdvanced SYBR Green qPCR Master Mix (Thermo-Scientific) following the manufacturer\u2019s instructions. All PCR products were sequence-verified. All samples were run in triplicate using 200-\u03bcl tubes. Each 20-\u03bcl reaction consisted of 5\u00a0\u03bcl of cDNA template, 1\u00d7 SsoAdvanced SYBR Green Master Mix, 500\u00a0nM each of forward and reverse primers and nuclease-free water. All RT-qPCR reactions were completed using the BioRad CFX96 qPCR system with the following thermal cycling parameters: an initial Taq polymerase activation step for 30\u00a0s at 95\u00b0C, then 40\u00a0cycles of a 10-s denaturation step at 95\u00b0C followed by a 30-s annealing step at 60\u00b0C. A 2-fold, seven-point standard curve was run for each gene in tandem with sample unknowns to verify reaction efficiencies . Relative mRNA levels were calculated based on Cq values using the relative standard curve method for RT-qPCR. The data were normalized using the NORMA-Gene algorithm  primers (Table 1) for six biologically relevant genes (R (Version 3.6.0). All P values are two-tailed with \u03b1\u2009=\u20090.05. Normality of residuals was tested using the Shapiro\u2013Wilk test and visualized with QQ plots. Homogeneity of variances was tested using Levene\u2019s test and visualized with residual plots respectively. Calling duration between groups was compared with Kruskal\u2212Wallis ANOVA or Mann\u2013Whitney U test on ranks as the data were not parametric. The exception is the data from the May 2018 assay that were parametric and analysed with Student\u2019s t test. The latency data from the rescue experiment were analysed with log-rank comparison of survival curves. Frogs who never called were censored and assigned a latency of 5400\u00a0s (the length of the experiment). Recovery of vocalization was analysed with two-way repeated-measures ANOVA with subject and replicate as random effects and time (after exposure or after recovery) and treatment as fixed effects. The mate competition data were analysed using a binomial probability test, comparing results to 0.5 probability of success expected by random chance.Analyses were conducted using Graph Pad Prism (Version 8.0) and U test on ranks.All data of individual recordings after exposure were pooled: the vocalization assays, the CTL\u2009+\u2009100\u00a0IU hCG and NA\u2009+\u2009100\u00a0IU hCG of the rescue experiment and vocal data from the competition experiment before recovery. The data were normalized by experiment with the lowest value as 0 and the highest value as 1 and analysed with Mann\u2013Whitney lhr, srd5a, srd5b, cyp17a1 and cyp19a1 were log(x\u2009+\u20091) transformed to meet assumptions of normality and homoscedasticity.The gene expression data were analysed as two-way ANOVAs with exposure (control or NA) and injection  as the two factors. The data for S. tropicalis calls previously reported . The pooled averages were 581.4 and 586.1\u00a0Hz for control and NA, respectively . The trills consist of rapid clicking with an average rate of 37 clicks/s . The pooled averages were 37.9 and 36.9 for control and NA, respectively . The average trill length for each frog was calculated as total duration divided by total number of calls and ranged from 0.5\u20138.3\u00a0s/call . No significant differences were found for these parameters , 664.2 and 307.6\u00a0s in May 2018  and 65.27 and 0\u00a0s in May 2019 . Pooling normalized individual vocalization data from all experiments (P\u2009<\u20090.0001). In total, 43/44 (98%) control frogs called, while 27/44 (61%) NA-exposed frogs called (Fisher\u2019s exact P\u2009<\u20090.0001) (P\u2009=\u20090.03). Dunn\u2019s multiple comparisons show that calling duration was lower in the NA-exposed frogs than control (P\u2009=\u20090.04), consistent with previous assays . All three NA-exposed groups were not different from each other (P\u2009>\u20090.99). Controls start calling after ~30\u00a0min (median latency\u2009=\u20091662.5\u00a0s), much earlier than the NA, NA\u2009+\u2009300\u00a0IU hCG and NA\u2009+\u2009600\u00a0IU hCG groups . Log-rank test shows an overall difference in latency between groups . Although there appears to be a dose-dependent rescue effect, the difference between the NA groups is not significant   . In the \u20090.0001) , the cons assays . InjectiP\u2009=\u20090.2) .F1,36\u2009=\u200911.63, P\u2009=\u20090.0016; F1,36\u2009=\u20098.3, P\u2009=\u20090.007; and F1,36\u2009=\u20094.9, P\u2009=\u20090.03, respectively) (P\u2009=\u20090.005), which is consistent with all previous vocalization assays. After recovery, the NA-exposed frogs called more than they did before (P\u2009=\u20090.005) and were no longer different from controls (P\u2009=\u20090.9). The random effect of individual was not significant (P\u2009=\u20091), and the results did not change when it was excluded from the model.Vocalization in NA-exposed frogs was assessed by comparing vocal output before and after recovery. The fixed effects used in the model were treatment, time (after exposure and after recovery) and their interaction. There were significant effects of time, treatment and interaction (ctively) . Tukey\u2019sz\u2009=\u20092.85, P\u2009=\u20090.001). In the second set of trials after 2\u00a0weeks of recovery in clean water, both control and NA-exposed groups of males both amplexed females in 5/10 trials   .lhr mRNA . However, exposure to NA upregulated lhr , with no significant exposure\u2009\u00d7\u2009injection interaction evident . Expression of star . Results from Sidak\u2019s multiple comparisons test showed that both hCG injection and NA exposure upregulated star and that expression was higher in NA-exposed frogs than controls within the hCG injection groups (P\u2009<\u20090.0001). Expression of cyp17a1 . Expression of srd5a . For cyp19a1 and srd5b, there were no significant effects (data not shown).Levels of lhr mRNA  were not of star  was sign cyp17a1  was incrof srd5a  was loweS. tropicalis were resistant to overt toxicity of NAs, considering the high sensitivity of their larvae. Larval S. tropicalis exhibit a LC50 of 11.7\u00a0mg/L NA after 96\u00a0h of exposure to the same commercial NA product  (Lithobates pipiens), leading to a sustained increase in plasma T and 5\u03b1-DHT, along with increased calling and clasping behaviour  . Callingehaviour . These behaviour . Androgeeptivity . Exposureptivity .X. laevis and S. tropicalis. Expectedly, hCG effectively induced calling in control males and we observed the expected increase in the expression of testicular star and cyp17a1. On the other hand, hCG did not affect lhr or srd5a. Surprisingly, NA-exposed frogs showed higher levels of lhr. Moreover, hCG-induced star levels were enhanced by NA exposure, perhaps due to upregulated LH receptors. Both hCG injection and NA exposure upregulated cyp17a1, a major enzyme in androgen production. Exposure to NAs decreased srd5a on average by ~\u200925%. The enzyme 5\u03b1-reductase, encoded by srd5a, converts testosterone to its more bioactive form 5\u03b1-DHT, so NAs may be affecting this key steroidogenic step. On the other hand, the upregulation of lhr, star and cyp17a1 in NA-treated males may be compensatory, and the males may be attempting to counteract the reduced potential to produce 5\u03b1-DHT. Yet, NA-exposed males have dramatically reduced calling duration, so the observed upregulation of star and cyp17a1 is somehow decoupled from the vocalizations. Thus, the consequences of low 5\u03b1-reductase activity should not be overlooked, given its paramount importance in male reproduction  and were therefore highly receptive. Control males would immediately respond to her presence. When the female swam within one body length, the male would orient towards, chase after, and attempt to clasp the female. Within a few minutes of adding her to the tank, the female would be in amplexus with one of the males. The NA-exposed males did not display these behaviours towards the female or make attempts to clasp. Even when the female swam close by or made contact, they would not orient towards or approach her. The control males successfully amplexed the female in all trials but did not necessarily do so by outcompeting the other male, as the exposed males were not observed attempting to mate. We determined that NA-exposed males had normal locomotion and swimming speeds, so this cannot explain and lack of ability to mate with a female. Regardless, suppressed calling duration and a lack of interest in normal, ovulating females indicates disrupted sexual activity in male Lota lota) exposed to the anti-anxiety drug oxazepam showed decreased sheltering behaviour, and the effect was reversed after 5\u20137\u00a0days in clean water  exposed to fresh and aged NA fractions from OSPW as well as commercial NAs all showed immunome disruptions  CGS-M (WSZ), NSERC USRA (EF), NSERC Strategic Grants Programme (STPGP 463041-14 to VLT). Also acknowledged with appreciation are University of Ottawa Research Chair programme and Environment and Climate Change Canada through the Canada-Alberta Joint Oil Sands Monitoring Programme for VLT.All data generated or analysed during this study are included in this published article."}
+{"text": "Caffeine is often used as a stimulant during fatigue, but the standard of characteristic physiological indicators of the effect of caffeine on neuromuscular fatigue has not been unified. The purpose of this systematic review and meta\u2010analysis is to summarize current experimental findings on the effects of caffeine on physiological indexes before and after neuromuscular fatigue, identify some characteristic neuromuscular physiological indexes to assess the potential effects of caffeine.The Preferred Reporting Items for Systematic Reviews and Meta\u2010analyses are followed. We systematically searched PubMed, Google academic, and Web of Science for randomized controlled trials. We searched for studies on caffeine's (i) effects on neuromuscular fatigue and (ii) the influence of physiological indexes changes. Meta\u2010analysis was performed for standardized mean differences (SMD) between caffeine and placebo trials in individual studies.p\u00a0<\u00a0.00001), PTw , and M\u2010wave , and a significant difference (p\u00a0=\u00a0.003) on measures of Peak Power (PP), and insignificant difference on measures of heart rate (HR)  and Maximal oxygen uptake (VO2) .The meta\u2010analysis indicated that caffeine significantly improves voluntary activation (VA)  cannot be used as the characteristic indexes of caffeine on neuromuscular fatigue. This conclusion tends to indicate the effect of caffeine on neuromuscular fatigue during endurance exercise. However, the results of meta\u2010analysis are based on limited evidence and research scale, as well as individual differences of participants and different physical tasks, so it is necessary to interpret the results of meta\u2010analysis cautiously. Therefore, future research needs to explore other physiological indicators and their indicative effects in order to determine effective and accurate characteristic indicators of caffeine on neuromuscular fatigue.The analysis showed that caffeine intake had a relatively large effect on VA, potentiated twitch (PTw), M\u2010wave, which can be used as characteristic indexes of caffeine's impact on neuromuscular fatigue. This conclusion tends to indicate the effects of caffeine on neuromuscular fatigue during endurance running or jumping or muscle bending and stretching. The caffeine intake had a big effect on the electromyogram (EMG) and peak power (PP), and its effect role needs to be further verified, this conclusion tends to indicate the effect of caffeine on neuromuscular fatigue during jumping or elbow bending moment movements. HR, VO To summarize current experimental findings on the effects of caffeine on physiological indexes before and after neuromuscular fatigue; identifying some characteristic neuromuscular physiological indexes to assess the potential effects of caffeine. When the fatigue process stops in the central nervous system, it is called central fatigue. When the fatigue process stops at the neuromuscular junction or distal end, this is called peripheral fatigue Amann, . And cafBased on the above research progress, many scholars have carried out researches on the potential relationship between caffeine and neuromuscular fatigue  used the changes of postexercise voluntary activation (VA) and enhanced 1\u00a0Hz force twitched (TW) as markers of neuromuscular fatigue to explore the influence of exercise level on caffeine\u2010induced neuromuscular fatigue. Franco\u2010Alvarenga et\u00a0al.  validateAlthough there have been some meta\u2010analyses of caffeine's effects on muscle strength and physiological performance  statement .Other search terms, such as \u201cneuromuscular\u201d AND (\u201cfunction\u201d OR \u201cperformance\u201d OR \u201cfatigue\u201d OR \u201cpower\u201d) and \u201cphysiological indexes\u201d AND . We considered all potentially eligible studies for review, Inclusion criteria specified that studies were published in English or were available in translation to English. We also did a manual search, using the reference lists of key articles published in English. When possible, these were combined with a sensitive search strategy to identify trials performed in \u201chumans.\u201dThe inclusion criteria were as follows: (1) employed the randomized, double\u2010blind, crossover design; (2) subjects characteristics without chronic fatigue syndrome or disease; (3) when caffeine and placebo were ingested, there is no other potentially ergogenic compounds interference; (4) the selected studies were published in journal, or a doctoral or a master's thesis, with an experimental trial; (5) exercise/performance test includes neuromuscular fatigue or its manifestations. The following were disregarded: (1) any of the above criteria were violated; (2) review articles or case reports; (3) the\u00a0article did not include an analysis of neuromuscular fatigue or functional studies; (4) the study with samples that had physical problem or bad diets habits; (5) articles with animal studies; and (6) more than 25% subjects\u2019 dropouts.2.2The search in the databases provided 1833 articles. After 1297 duplicates were removed, all titles or abstracts were reviewed for relevance. Of the articles found, 453 were excluded after reading the title and abstract, resulting in 83 articles of which the full text was read. Of these 83 articles, 70 were excluded for the following reasons: no neuromuscular and/or fatigue study, no reference standard included, no placebo, lack of data, belong to review articles. The flow diagram of the search and study selection process are depicted in Figure\u00a0The methodological quality of studies was assessed using the PEDro scale, which has been reported to be valid and reliable , exercise/performance test and the PEDro Scale of study quality, and the basic features of the each selected study are shown in Table\u00a02.3I2 statistic and 95%confidence intervals (95%CI) were used to assess the level of heterogeneity in the included sample. The I2 statistic with values from\u00a0<\u00a050% represents small amounts of inconsistency, 50\u201375% represents moderate heterogeneity, and\u00a0>75% represents high level of heterogeneity. The statistically significant differences threshold was set a priori at p\u00a0<\u00a0.05. The publication bias on the meta\u2010analysis was addressed by the Trim\u2010and\u2010Fill method . Descriptive analysis was performed using Excel 2010, descriptive data of the caffeine and placebo groups are reported as mean \u00b1 standard deviation (SD). The In the forest plot drawn by Revman software in this paper, when most of the prismatic combination effect size indicator patterns of a study fall on the right side of the invalid line, it can be considered that the indicators have an influence on the change of the reflected result.\u00a0When most of the prisms fall on the left side of the invalid line, it can be considered that the index has no influence on the change of the reflected result.2) ; (7) electromyogram (EMG) ; (8) peak power (PP) .The data of neuromuscular physiological indexes were collected according to change from pretest to posttest; statistical analysis was conducted on the (post\u2013pre) /pre \u00d7 100% . Seven studies reported the caffeine dosage was 6\u00a0mg\u00a0kg\u22121, and four studies reported was 5\u00a0mg\u00a0kg\u22121. Time of caffeine ingestion is between 45 min and 75 min before the onset of experimental measurements, but there were two studies reported the time were 15 min and 30 min, respectively. There are many forms of exercise/performance test. The PEDro methodological quality score ranged from 8 to 10; the mean score was 9.5. Only one study received the lowest score (PEDro score\u00a0=\u00a08); this lowest score was categorized as being of \u201cgood methodological quality,\u201d so all studies were categorized as being of \u201cgood/excellent methodological quality.\u201d More detailed individual characteristics of the included studies are reported in Table\u00a0Table\u00a02; and the EMG and PP indexes  between the caffeine and placebo trials on measures of indexes, and a significant difference (p\u00a0=\u00a0.003) on measures of PP, and insignificant difference on measures of HR (p\u00a0=\u00a0.84) and VO2 (p\u00a0=\u00a0.76). The meta\u2010analysis indicated that caffeine significantly improves VA , PTw , and M\u2010wave . And the effects on other physiological indexes are shown in the Table\u00a0I2 statistic showed low heterogeneity for the studies assessing HR  and VO2 . The trim\u2010and\u2010fill method changed the SMD for HR from 0.41  to 0.46  and for VO2 from 0.14  to 0.09 . The SMD, I2, p value, and other statistic of meta\u2010analysis can be found in Table\u00a0Figures\u00a0s Figure\u00a0 had a bi4The results of the meta\u2010analysis were that, overall, caffeine can affect changes in certain physiological indexes during neuromuscular fatigue, but the effects of caffeine on physiological indexes were different. Compared with placebo, caffeine had a better effect on recovery of some physiological indexes, but no effect or even side effects on others. As for the current results, the effects of caffeine on body indicators are related to measurements in different parts of the body, as well as caffeine intake, time of day, different performance tests, number of studies, and journal in which the study was published. The previous meta\u2010analysis focused on the effects of caffeine on muscle strength, power, endurance, and physical performance  observed that after caffeine ingestion, EMG1 observeThe caffeine ingestion showed a significantly improved the PP and further increased response speed, thereby shortening the time tothe PP . So EMGRMS and PP can be used as the characteristic physiological indexes to assess the potential effects of caffeine on neuromuscular fatigue.Although our meta\u2010analysis included few literatures on EMG4.5The MVC was assumed as a global indicator of fatigue . At the same time, similar phenomena have been found in the literature that caffeine increased absolute and relative HR and VO2 compared to placebo , the Scientific research Project of education Commission of Tianjin, China (2020KJ029).All the authors listed have made a substantial, direct, and intellectual contribution to the work, and approved it for publication. Ruishan Sun and Junya Sun contributed equally to this work and shall be considered as cofirst authors.https://publons.com/publon/10.1002/brb3.2529.The peer review history for this article is available at"}
+{"text": "Cancer immunotherapy has emerged in the past decade as a promising strategy for treating many forms of cancer by stimulating the patient's immune system. Although immunotherapy has achieved some promising results in clinics, more efforts are required to improve the limitations of current treatments related to lack of effective and targeted cancer antigens delivery to immune cells, dose\u2010limiting toxicity, and immune\u2010mediated adverse effects, among others. In recent years, the use of nanomaterials has proven promising to enhance cancer immunotherapy efficacy and reduce side effects. Among nanomaterials, attention has been recently paid to mesoporous silica nanoparticles (MSNs) as a potential multiplatform for enhancing cancer immunotherapy by considering their unique properties, such as high porosity, and good biocompatibility, facile surface modification, and self\u2010adjuvanticity. This review explores the role of MSN and other nano/micro\u2010materials as an emerging tool to enhance cancer immunotherapy, and it comprehensively summarizes the different immunotherapeutic strategies addressed to date by using MSN. Considering the increasing potential of cancer immunotherapy and the great attention to mesoporous silica materials as drug delivery systems, numerous silica\u2010based immunotherapies have been developed. This review explores the role of mesoporous silica materials as an emerging tool to enhance cancer immunotherapy by describing the different developed scaffolds alongside the immunotherapeutic applications while discussing the benefits of nanomaterials. Some of its advantages over traditional cancer therapies  are the huge improvement in patients\u2019 quality of life and survival percentage. Yet despite such progress, some drawbacks should be overcome, such as dose\u2010limiting toxicity, and low patient response. In this scenario, the possibility of combining immunotherapy with nanomedicine to enhance the therapeutic effect while minimizing side effects could soon result in immune oncology revolution.1, 2Figure\u00a0+ receptors, which results in T\u2010cell priming and activation to respond to the shown neoantigens. The activated T\u2010cells migrate and infiltrate the tumor bed, recognize cancer cells as foreign bodies and bind to them through the interaction of the T\u2010cell receptor (TCR) with its cognate antigen attached to MHC\u2010I. Finally, cytotoxic T\u2010cells eradicate malignant cells by means of a process named immunological cell death (ICD). This contributes to the release of more neoantigens to, thus, amplify the cycle. The next section explains the cancer immunity cycle in more detail. In addition, the cancer immunity cycle includes the integration of a large number of stimulatory and principally inhibitory regulators in each step  and mesoporous silica rods' (MSRs) scaffolds, attempt to trigger cancer immunity cycle activation while avoiding harming healthy cells. They can serve as vaccine adjuvants; vaccine vehicles for cancer antigens and pathogen\u2010associated molecular patterns delivery to APC; tools for T\u2010cell priming, expanding, trafficking, infiltration, and recognition of cancer cells; agents that cause the release of tumor antigens by photodynamic and photothermal therapies; chemotherapy agents that cause the direct killing of malignant cells or inhibit the immune checkpoint; agents for starvation therapies or a combination thereof.1.11.1.1The cancer immunity cycle is initiated by the release of the neoantigens generated due to the oncogenesis process. Chemotherapy, radiation therapy, photodynamic therapy (PDT), and photothermal therapy (PTT) can induce ICD, a type of cellular demise that triggers the release of tumor\u2010associated antigens (TAA) by stimulating a tumor\u2010specific immune response. The key parameters of ICD are: 1) exposure of \u201ceat\u2010me\u201d signals for dendritic cells (DCs); 2) secretion of ATP, a potent chemotactic signal for macrophage and DC precursors; and 3) the release of end\u2010stage degradation products that bind to the surface of DCs and allow optimal antigen processing and presentation. The capacity of ICD inducers, either alone or in combination with other immunotherapies, to produce potent innate and adaptive responses, has been tested in preclinical cancer models and clinical trials.6, 7+ T\u2010cells, while exogenous antigens presented in MHC\u2010II are recognized by TCR of CD4+ T\u2010cells. However, APC can also present foreign antigens to the CD8+ T\u2010cells in MHC\u2010I during a process known as cross\u2010presentation. In this case, the interaction with CD26\u00a0present in the T\u2010cells with B7\u00a0costimulatory molecules  expressed on the surface of APC is required. Besides, APC express pattern recognition receptors as toll\u2010like receptors (TLR) in their membrane.After the release of neoantigens by ICD, the next step is their internalization (phagocytosis or receptor\u2010mediated endocytosis) by professional APC: DC, B\u2010cells, and macrophages. These cells capture and process neoantigens by exposing them in their membrane through MHC\u2010I or MHC\u2010II to be recognized by T\u2010cells. The endogenous antigens presented in MHC\u2010I are generally recognized by TCR of CD8membrane.8 alterations in the expression of costimulatory molecules, or the attachment of CD80\u00a0and CD86\u00a0to cytotoxic T\u2010lymphocyte\u2010associated protein 4 (CTLA\u20104) (inhibitory molecule) instead of to CD28\u00a0in activated T\u2010cells. In addition, some tumor cells are capable of acquiring APC properties due to the aberrant expression of costimulatory molecules, and professional APC can turn out malignant and maintain their properties as tumor B\u2010cells in lymphomas. Several cancer therapies are directed to reinforce tumor antigen presentation by the delivery of peptidic or DNA vaccines and TLR agonists. The FDA has approved three oncovaccines: BCG, Sipuleucel\u2010T, and IMLYGIC or T\u2010VEC  are the key immune cells for killing cancer cells, while the CD4+ T helpers (Th) cells population, which includes cells Th1, Th2, Th17, and regulatory T\u2010cells (Tregs), plays the role of orchestrating the immune response. The effectiveness of T\u2010cells activation depends on TCR, co\u2010stimulatory molecules, and cytokine stimulation. Different strategies based on the modulation of these factors have been developed. One approach is to use immune checkpoint inhibitors, for instance the antibodies addressed to cytotoxic T\u2010lymphocyte antigen\u20104 (CTLA\u20104) like Ipilimumab. In contrast, another strategy is based on the activation of co\u2010stimulatory receptors like CD27, CD137, and OX40\u00a0with agonist antibodies, such as Urelumab or polynucleotide\u2010based aptamers. Additionally, the administration of immunostimulatory cytokines like recombinant interleukin\u20102 (IL\u20102) has also demonstrated anticancer activity via T\u2010cell activation and expansion in preclinical and clinical studies  secreted by tumors, is a promising candidate to enhance the infiltration of lymphocytes by promoting \u201cvascular normalization\u201d and EC activation .22 Bev1.1.4 Two main approaches for T\u2010cell redirection involve their genetic modification with chimeric antigen receptors (CAR), like Axicabtagene ciloleucel and Tisagenlecleucel, or the use of recombinant proteins designated bispecific T\u2010cell engagers (BiTes), such as Catumaxomab and Blinatumomab  secreted by tumors /programmed death\u2010ligand 1 (PD\u2010L1) interaction, which suppresses T\u2010cell activity (see below). Moreover, other approaches include the inhibition of the enzymes that reduce T\u2010cell activity, such as indoleamine 2,3\u2010dioxygenase (IDO) or arginase, as well as the suppression of transforming growth factor beta  by generating an immunosuppressive effect. FDA approved therapies using monoclonal antibodies to prevent those interactions and, therefore, stimulate antitumor immunity . Targeting these factors may reactivate cells for antitumor immunity Table\u00a0. IDO and38 TGFrs Table\u00a0.) fragments. The data collected showed that DMOHS\u20102S vaccination induced an improvement in both Th1  and Th2\u00a0immunity (IL\u20104\u00a0secretion) in the splenocytes from the C57BL/6\u2010immunized mice versus the controls. These authors also observed delayed tumor occurrence (31\u00a0days), a reduction in tumor size, and an improved survival rate (50%) in the mice vaccinated with DMOHS\u20102S after the B16\u2010F10\u00a0cells injection. Overall, the authors supported the benefits of using a double\u2010shelled organosilica composition for developing antitumor nanovaccines by considering that NPs' hydrophobicity and sustained antigens release were key factors for achieving an enhanced immune response.The potential of dendritic materials has also been analyzed in the work by Yang et\u00a0al.93 The Enhanced cellular uptake compared to the free antigens and successful endosomal escape were confirmed in RAW264.7\u00a0cells. A drop in the GSH levels, along with an increase in the ROS levels, was detected in the GDMON\u2010P\u2010OVA\u2010CpG\u2010vaccinated mice. Besides, GDMON\u2010P\u2010OVA\u2010CpG induced a potent CTL response in mice spleens after 7\u00a0post\u2010vaccination days compared to other groups. To evaluate tumor inhibition, mice were subcutaneously inoculated with B16\u2010OVA cells after being vaccinated twice. A significant reduction in tumor size was obtained with the GDMON\u2010P\u2010OVA\u2010CpG nanodevice. In the same way, Wang et al. developed plain mesoporous silica nanospheres doped with Ca, Mg, and Zn  in which chicken egg OVA was adsorbed to act as an adjuvant. MS\u2010Ca, MS\u2010Mg, and MS\u2010Zn nanospheres showed 20% higher degradation rates than the undoped MS nanospheres in vitro and in vivo, and MS\u2010Zn obtained the highest degradation rate. To perform an in vivo anticancer test, C57BL/6J mice were subcutaneously injected three times with the corresponding adjuvant  mixed with OVA three times. After 14\u00a0days, mice were injected with E.G7\u2010OVA lymphoma cells in the right flank. The MS, MS\u2010Ca, MS\u2010Mg, and MS\u2010Zn nanospheres loaded with OVA showed marked inhibition of cancer growth and higher CD4+ and CD8+ T\u2010cell population levels, and the MS\u2010Zn\u2010OVA gave the highest percentage of CD4+ and CD8+ T\u2010cell activation . The cells from the immunized mice draining lymph nodes (dLN) were co\u2010cultured with OVA for 3\u00a0days and an increase in Th1 (INF\u2010\u03b3) and Th2\u2010type (IL\u20104) cytokines secretion was detected. The OVA\u2010loaded MS\u2010Zn obtained the highest activation rate and the most IFN\u2010\u03b3 secretion (up to 300\u00a0vs 50\u00a0pg\u00a0mL\u22121\u00a0with free OVA). In another interesting work, stellated fibrous MS nanospheres were used to adsorb PIC on their external surface as an immunopotentiator, and F\u2010OVA as an antigen\u2010specific cancer to E.G7\u2010OVA lymphoma cells, to yield MS\u2010OVA\u2010PIC. Cellular uptake demonstrated that the OVA\u2010loaded NPs were efficiently internalized by BMDC and promoted BMDC maturation in vitro, which gave a bigger CD11c+CD86+ cell population compared to the controls (sodium phosphate buffer [PBS]) (80%\u00a0vs 53%). C57BL/J6\u00a0mice were treated with MS\u2010OVA\u2010PIC by subcutaneous injection three times. After 14\u00a0days, the E.G7\u2010OVA cells were injected into mice. The results showed that the mice immunized with MS\u2010OVA\u2010PIC achieved greater anticancer immunity than the control groups (OVA\u2010 and OVA\u2010PIC\u2010treated mice). Besides, the splenocyte analysis confirmed the presence of bigger CD4+ and CD8+ T\u2010cell populations and, thus, confirmed anticancer immunity.The next step on the way to obtain an efficient vaccine is to combine both adjuvants and antigens in the same material, as well as safer scaffolds able to be easily degraded in the body. This was the case of Lu et al., who designed biodegradable GSH\u2010depletion mesoporous organosilica NPs functionalized with PEI and loaded with OVA and with CpG ODNs (GDMON\u2010P\u2010OVA\u2010CpG).94 EnhUndoubtedly silica\u2010based nanomaterials with the appropriate cargo can induce a potent immune response (both in vivo and in vitro) and generate immunological memory. They have been demonstrated to be effective as vaccines and generate a greater immune response than free antigens/adjuvants. Among the different reviewed scaffolds, the dendritic materials offer the principal advantage of most of them being biodegradable as well as allowed the sustained release of antigens, which are key for an enhanced immune response.3.1.2Another approach to improve cancer immunotherapy is based on the development of injectable or implantable 3D materials for the spatio\u2010temporal modulation of immune cell populations, including DC and cytotoxic T\u2010cells. This strategy provides an in situ repository of the patient's own immune cells in the tumor that can promote and maintain robust and long\u2010lasting immune responses. In this context, biomaterials based on MSR assembly have recently stood out for their larger surface area and improved loading capacity for the development of immunomodulatory scaffolds. They prepared bare high\u2010aspect\u2010ratio MSR (88\u00a0\u00b5m\u00a0\u00d7\u00a04.5\u00a0\u00b5m length and diameter) co\u2010loaded with GM\u2010CSF (a chemoattractant to immune DC), CpG\u2010ODN, and OVA to examine their potential as cancer vaccines. These authors demonstrated the ability of MSR to spontaneously form 3D platforms in vivo by observing the formation of a nodule (\u224825\u00a0mm3) in female C57Bl/6J mice 4\u00a0h after their subcutaneous injection. An analysis of the host immune cells recruited to the scaffold over time showed a significant increase for MSRs with high\u2010aspect ratio compared to the controls . Moreover, the population of activated DC (CD11c+ and CD86+) in dLN increased about twofold. The serum levels of the OVA\u2010specific IgG1\u00a0and IgG2a also increased twofold, which confirmed the induction of the Th1\u00a0and Th2\u00a0adaptive immune responses. The vaccine enhanced the CTL population in the spleen threefold compared to the empty MSR. Finally, the C57BL/6\u00a0mice were immunized with the MSR vaccine and were inoculated 10\u00a0days later with EG7.OVA lymphoma cells in the back of the neck to study the material's tumor protective activity. The MSR vaccine inhibited fivefold tumor growth and prolonged animal survival (\u224890% on day 30\u00a0after immunization) compared to the unencapsulated vaccine.The earliest study using MSRs scaffolds to recruit immune cells was conducted by Kim et\u00a0al.97 TheFigure\u00a0 For that purpose, MSR were functionalized with 3\u2010aminoproyltriethoxysilane (APTES) to add primary amine groups, which were modified with methoxy\u2010terminated PEG12. The PEG\u2010modified MSR were then reacted with integrin\u2010binding ligand Arg\u2010Gly\u2010Asp (RGD), a peptide that mediates cell attachment. RGD/PEG modification induced more proinflammatory cytokine production (eightfold increase in interleukin\u20101beta [IL\u20101\u03b2]). In vivo studies revealed that PEG\u2010MSR scaffolds recruited more cells than the unmodified and PEG RGD/RDG modified scaffolds. However, the unmodified scaffolds contained more activated DC and macrophages (2.5\u2010fold increase in CD11c+ and CD86+) compared to the PEG\u2010modified MSR, which attracted a larger population of myeloid cells/neutrophils (1.3\u2010fold increase). This was attributed to the response of foreign material and of in vivo myeloid cells/neutrophils attraction to the scaffold. Overall, these results suggest that MSR surface chemistry determines the profile of immune cells infiltrated in the support and, thus, the vaccine's response.1\u00a0year later, the same group studied the effect of the surface modification of MSR on modulating the immune response Figure\u00a06.).In a subsequent study, Xu et\u00a0al. developed a revolutionary virus\u2010like mesoporous silica nanoparticles (VH\u2010MSNs), whose unique topological structure on the NP surface offered the advantage of enhancing cellular uptake and amplifying the immune response.110 VHIn conclusion, the use of mesoporous silica materials offers a very high potential for developing nanosystems based on chemo\u2010 and immuno\u2010therapy. Systems with large pore volumes allow chemotherapeutic and immunomodulatory co\u2010encapsulation, providing an excellent synergistic therapy with better outcomes than traditional chemotherapy. In addition, the surface of NPs can be chemically modified in many ways, which results in the generation of nanosystems like bacteria or viruses that enhance immunological effects.3.3.2 In this first approach, the anti\u2010PD\u2010L1\u00a0antibody was encapsulated using ultralarge pore MSN (UPMSNP). Pores were capped with ferumoxytol (Fer) (Fer\u2010ICB\u2010UPMSNP) to allow the sustained release of the drug and to provide magnetic resonance imaging (T2\u00a0contrast). The authors evaluated the synergistic antitumoral effect of the designed NPs in a Tramp C1\u00a0prostate cancer mice model by a sequential approach using standard chemotherapy, followed by treatment with Fer\u2010ICB\u2010UPMSNP NPs. After tumor formation, cabazitaxel (Cbz) chemotherapy was injected intratumorally into mice to increase the expression levels of immunogenic cell death markers and to achieve the up\u2010regulation of PD\u2010L1\u00a0in cancer cells. After 72\u00a0h, Fer\u2010ICB\u2010UPMSNPs were intratumorally injected and guided by magnetic resonance to the central tumor region. Tumor\u2010specific immune response was significantly activated with nanoimmunotherapy after Cbz treatment (5.5\u2010fold) compared to systemic anti\u2010PD\u2010L1\u00a0antibody administration (2.5\u2010fold) with subsequent greater tumor growth inhibition. These findings indicate the usefulness of using a high porous scaffold to encapsulate big immunotherapeutics, which allows drug protection to the target site and, thus, enhances the antitumoral effect.Immunotherapy based on checkpoint blockade has been one of the most successful approaches to cancer treatment. The combination of MSN with these checkpoint inhibitors can have added value to effectively target and kill cancer cells. This concept was exploited for the first time by Choi et\u00a0al.111 In This strategy combines the effect of cancer vaccines with systemic PD\u20101\u00a0blockade therapy. For this purpose, the authors used a layer\u2010by\u2010layer self\u2010assembly route to integrate a cancer antigen (OVA) and an immunopotentiator  or a checkpoint inhibitor antibody (anti\u2010CTL4) into the stellated pore channels of a mesoporous silica core capped with a pH\u2010sensitive MOF gatekeeper composed of Zn2+ and 2\u2010methylimidazole. Different combinations of NPs were prepared to evaluate their antitumoral activity and immune response activation in a prophylactic mouse model. Although the NPs containing anti\u2010CTL4\u00a0achieved an excellent immunoresponse when compared with the negligible outcome of free anti\u2010CTL\u20104, the cancer vaccine (MS@OVAinMOF)@(polyICinMOF) exhibited the best results. In a second step, the cancer nanovaccine was evaluated in a combined therapy with anti\u2010PD\u20101\u00a0in an E.G7\u2010OVA tumor\u2010bearing mice model. The combined immunotherapeutic effect using NPs and a low anti\u2010PD\u20101\u00a0dose (20\u00a0\u00b5g/mouse) was compared to free OVA plus anti\u2010PD\u20101\u00a0at an equivalent dose (20\u00a0\u00b5g/mouse) or a higher dose (200\u00a0\u00b5g/mouse), respectively. The best results in tumor volume, survival rate (40\u00a0days compared to 20\u00a0days in the other groups), tumor volume and IL\u20102\u00a0secretion (approximately eightfold\u2010change) in tumor, and CD8+ T\u2010cell population (approximately sixfold change) in spleen were exhibited by the mice treated with OVA and the high anti\u2010PD\u20101\u00a0dose (200\u00a0\u00b5g/mouse), and interestingly with the nanovaccine plus anti\u2010PD\u20101\u00a0at a lower dose. After studying specific cytotoxic CD8+ T\u2010lymphocyte activity (CTL) to E.G7.OVA\u2010cells, the data revealed that the mice injected with (MS@OVAinMOF)@(polyICinMOF) and anti\u2010PD\u20101\u00a0presented the greatest cytotoxicity to E.G7\u2010OVA cancer cells.Following a similar premise, using MSN with a large porous framework to protect and deliver immune checkpoint inhibitors, Li et\u00a0al. developed metal\u2013organic\u2010framework (MOF)\u2010gated MSN (MS@MOF) to generate durable antitumor immunity.112 ThFigure\u00a0 MSN were modified with thiol groups and loaded with axitinib (Axi), an inhibitor of tyrosine kinase. The Cas9\u00a0protein was derivatized with succinimidyl\u20103\u2010(2\u2010pyridyldithio) propionate and sgRNA that targets the PD\u2010L1\u00a0encoding gene (sgPD\u2010L1) and was conjugated to the surface of MSN through disulfide bonds. Finally, the system was coated with a lipid layer  to protect the Cas9\u00a0system during blood circulation and to enhance cell internalization by tumor cells (VLN\u2010sgPD\u2010L1@Axi).\u00a0The nanosystem's efficacy was evaluated in a tumor\u2010bearing mice model. C57BL/6\u00a0mice were subcutaneously inoculated with melanoma B16F10\u00a0cells in the mammary fat pad and intravenously injected with NPs. The VLN\u2010sgPD\u2010L1\u00a0nanosystem exhibited tumor growth suppression efficacy (<1000\u00a0mm3\u00a0compared to the control groups that obtained 2000\u00a0mm3). The Western blot and immunofluorescence analyses of tumor tissues confirmed the in vivo PD\u2010L1\u00a0knockout effect exhibited by VLN\u2010sgPD\u2010L1. Tumors had higher CD8+ infiltrating T\u2010lymphocytes and cytokine levels (IFN\u2010\u03b3 and TNF\u2010\u03b1) (\u22482.5\u2010fold increase). Regarding the synergistic activity of VLN\u2010sgPD\u2010L1\u00a0combined with axitinib, the mice treated with VLN\u2010sgPD\u2010L1@Axi showed even higher survival rates and tumor growth suppression, with a reduction of 500\u00a0mm3\u00a0in tumor volume compared to the groups of monotherapies in which volumes were 1500\u00a0mm3. In addition to PD\u2010L1\u00a0editing, VLN\u2010sgPD\u2010L1@Axi down\u2010regulated the expression of axitinib targets pAKT and pERK, and the marker of suppressive Treg lymphocytes, VEGF, thus, resulting in the increase in infiltrated CD8+ T\u2010lymphocytes and cytokine secretion, and in a decrease in the immunosuppression associated with Tregs in the TME.Recently, virus\u2010like core\u2013shell MSN were used by Li et al. to apply CRISPR\u2010Cas9\u2010based cancer immunotherapy Figure\u00a010.[11 The combined treatment resulted in an improved survival rate in melanoma tumor\u2010bearing mice compared to the control groups, and also in significant decreased tumor growth. Besides, a significant increase in the CD80\u00a0and CD86\u00a0markers associated with DC maturation was found in the animals treated with CMSN\u2010GOx plus PD\u20101\u00a0therapy . These findings agree with the results obtained from the tumor\u2010infiltrating lymphocyte profile characterization and showed an effective CD4+ to CD8+ T\u2010cell ratio in the mice treated with combined therapy, approximately twofold compared to the PD\u20101\u00a0monotherapy and, thus, confirms the stronger antitumor immune response.The few reports described above used MSN to deliver checkpoint blockade therapeutics, mainly in strategies combined with previous standard chemotherapy or vaccination. All these findings confirm the versatility of MSN as a scaffold to allow combining advanced strategies, such as immunotherapy via CRISPR\u2010Cas9\u00a0technology, as well as drug release for enhancing cancer treatment. MSN can also be suitable for previous ICD to enhance the efficacy of combined PD\u20101\u00a0checkpoint blockade therapy. In this case, Xie et al. used MSN to perform starvation therapy, followed by PD\u20101\u00a0checkpoint blockade for improved cancer therapy. MSN were loaded with glucose oxidase (GOx) (for starvation therapy) and coated with membranes from melanoma B16\u2010F10\u00a0cells (CMSN\u2010GOx).114 Th3.3.3PDT is a noninvasive anticancer treatment that uses photosensitizers (PS) agents activated at a specific wavelength of light to generate cytotoxic ROS, which cause tumor cell death and release TAA, as well as DC recruitment. The main advantages of using nanotechnology in PDT lie in the increase of the PS at the target site, while reducing the toxicity of normal tissues/cells. In addition, controlled release allows a constant PS delivery rate to be maintained which, thus, enhances the effects of PDT.115 The group of mice treated with CAGE, plus laser irradiation, showed fourfold greater tumor growth inhibition than the mice treated with CAGE without light or CAGE (without CpG), plus laser, as well as a 100% survival rate for 28\u00a0days. In a similar study, Ding et al. designed a nanovaccine using large\u2010pore mesoporous\u2010silica\u2010coated \u03b2\u2010NaYF4:20%Yb,2%Er upconverting NPs (UCMS) co\u2010loaded with MC540\u00a0and CT26\u00a0TF as a tumor antigen of colorectal carcinoma (denoted as UCMSs\u2010MC450\u2010TF). To evaluate the potential immunoadjuvant of the nanovaccine, CT26tumor\u2010bearing Balb/c mice were subcutaneously immunized with three injections of UCMSs\u2010MC540\u2010TF, plus near\u2010infrared (NIR) laser irradiation. The studies revealed that, unlike the other control groups, the whole NP treatment achieved tumor clearance after 18\u00a0treatment days and a 100% survival rate after 65\u00a0days.Considering the potential of PDT, advances in the integration of MSN with PS, such as merocyanine 540 (MC540) and chlorin e6 (Ce6), in combination with vaccine adjuvants has allowed the generation of promising nanovaccines to achieve PDT and immunological synergetic therapy. Im et al. engineered a hypoxia\u2010responsible nanodevice with Ce6\u00a0covalently attached in the inner pores of MSN and the CpG oligonucleotide adsorbed by electrostatic interactions (CAGE). Tumor growth inhibition was evaluated using B16.Mo5\u00a0cells subcutaneously inoculated in the right flank of C57BL/6\u00a0mice and NPs were intravenously administered.116 ThFigure\u00a0 Biodegradable MSNs (bMSNs) were synthesized using a heterogeneous oil\u2013water biphase reaction system and the external surface was decorated with aminopropyl moieties. Mesopores were loaded with CpG and Ce6. The surface was modified with orthopyridyl disulfide PDP\u2010PEG\u2010succinimidyl ester, through the formation of amide bonds, and decorated with Adpgk (neoantigen peptide of the MC\u201038\u00a0carcinoma tumor) by disulfide bond formation (bMSN(CpG/Ce6)\u2010Adpgk). Ce6\u2010loaded bMSN showed efficient singlet oxygen generation by 660\u00a0nm laser irradiation. The therapeutic efficacy of the bMSN vaccination was investigated using a bilateral two\u2010tumor model with MC\u201038\u00a0colon cells. The C57BL/6\u00a0mice were inoculated with MC\u201038\u00a0cells in the right flank, followed by the inoculation of MC\u201038\u00a0cells in the contralateral flank on day 8. The first vaccination was administered intravenously via the tail vein on day 9, and only the tumor of the right flank was treated with laser irradiation. This was repeated on day 16. When laser irradiation combined with the bMSN(CpG/Ce6)\u2010Adpgk vaccine was used instead of a soluble vaccine , tumor volume reduced ninefold. Moreover, median survival increased from 25\u00a0days to more than 40\u00a0days. Moreover, the greatest antigen\u2010specific CD8+ T\u2010cells response was observed in the PBMCs  from the animals treated with the bMSN vaccine (5.5\u2010fold greater than the soluble vaccine). Tumor\u2010infiltrating CD8+ T\u2010cells and activated intratumoral CD11+ CD86+ DC were detected at a high frequency (threefold higher than the soluble vaccine).Furthermore, Xu and collaborators developed a nanovaccine for PDT\u2010immunotherapy combined with image\u2010guided therapy by positron emission tomography to facilitate quantitative cancer diagnosis Figure\u00a011.[11Figure\u00a0 The system was based on hollow silica NPs with the enzyme catalase (CAT) encapsulated, as well as Ce6\u00a0doped into the silica network (CAT@S/Ce6). The mitochondrial targeting molecule (3\u2010carboxypropyl)triphenylphosphonium bromide, CTPP) was covalently conjugated to APTES, and then mixed with CAT@S/Ce6\u00a0to yield CAT@S/Ce6\u2010CTPP. Finally, CAT@S/Ce6\u2010CTPP was coated with the pH\u2010responsive anionic polymer, PEG/2,3\u2010dimethylmaleic anhydride\u2010co\u2010poly (DPEG), to give the final solid CAT@S/Ce6\u2010CTPP/DPEG. The authors demonstrated in NPs that CTPP allowed to target mitochondria, and CAT triggered the transformation of endogenous hydrogen peroxide (H2O2) into O2\u00a0to, thus, overcome hypoxia, which improved the effectiveness of PDT. Afterward, the synergistic effect of the combination of PDT using CAT@S/Ce6\u2010CTPP/DPEG and PD\u2010L1\u00a0checkpoint blockade immunotherapy was evaluated. For this purpose, Balb/c mice were subcutaneously injected with 4T1\u00a0cells into the left and right flanks of each mouse. After tumor formation, mice were treated with CAT@S/Ce6\u2010CTPP/DPEG, and the left\u2010flank tumors were irradiated with 660\u00a0nm light 24\u00a0h later. In addition, the anti\u2010PD\u2010L1\u00a0antibody was intravenously injected on days 1, 3, and 5. The results revealed that only the treatment with CAT@S/Ce6\u2010CTPP/DPEG, plus light, in combination with the antiPD\u2010L1\u00a0antibody generated fourfold more CTLs in the irradiated primary tumor and the non\u2010irradiated distant tumor (compared to the control treatments). Furthermore, only the synergistic treatment was able to suppress the growth of both tumors, which evidences the potential to inhibit metastasis.Another strategy consists of combining PS and checkpoint blockade immunotherapy using MSN. Following this concept, Yang et al. developed a smart nanoreactor system for PDT combined with antiPD\u2010L1\u00a0immunotherapy Figure\u00a012.[11The studies above have shown that using mesoporous silica materials for the co\u2010administration of PS and immunomodulators triggers a more effective antitumor response than separate administration. One main limitation of PDT is its use in disseminated cancer. However, the combination of PDT and immunotherapy in a nanodevice results in an effective synergistic effect to achieve complete primary tumor inhibition and the eradication of metastatic tumors.3.3.42O2\u00a0into the harmful hydroxyl radical (a type of ROS) by Fenton/Fenton\u2010like reactions using CDT agents. In this way, Li et al. developed a nano\u2010catalytic system for the synergy between ferroptosis, an antitumor therapy that promotes TAA release, and immunotherapy. The authors used dendritic MSN (DMSN) loaded with ultrasmall CaO2\u00a0and Fe3O4\u00a0NPs, coated with a pH\u2010responsive lipid membrane (CaFe@DMSN/C). The coating consisted of a PEOz\u2010liposome prepared from lecithin, cholesterol, and 1,2\u2010distearoyl\u2010sn\u2010glycero\u20103\u2010phosphoethanolamine (DSPE). In the acidic microenvironment of tumor tissues, the lipid coating was removed, followed by H2O2\u00a0production by CaO2\u00a0NPs, which was subsequently transformed by Fe3O4\u00a0NPs into harmful hydroxyl radicals through a Fenton\u2010like reaction to induce ferroptosis. Besides, the pH increment induced by proton consumption by NPs provoked the polarization of tumor\u2010associated macrophages from M2 (promoted tumor metastasis) to M1 (activated the antitumor immune response). To stimulate the efficiency of TAA uptake by phagocytes, NPs were also loaded with the anti\u2010CD47\u00a0antibody, an immune checkpoint blockade (CaFe/aCD47@DMSN/C). In vivo experiments were carried out in Balb/c mice subcutaneously injected with 4T1\u00a0tumor cells and intravenously injected with CaFe@DMSN/C. pH changes in tumor tissue revealed the ability of CaFe@DMSN/C to neutralize acidic the TME with subsequent M1\u00a0macrophage polarization. Furthermore, antitumor efficacy studies have demonstrated the superiority of the CaFe@DMSN/C system. While the mice treated with CaFe@DMSN/C were still alive on day 80, the mice in the other groups were almost all dead by 72\u00a0days. To evaluate the antimetastatic effect of CaFe/aCD47@DMSN/C NPs containing aCD47, 4T1\u00a0cells were intravenously injected. While no lung metastasis signs were observed in the CaFe/aCD47@DMSN/C treatment group, all the other groups displayed more than 30\u00a0metastatic nodules. Macrophage polarization and memory cells were increased 1.5\u2010 and 2\u2010fold, respectively, after the CaFe/aCD47@DMSN/C combination therapy (compared to the other groups). Complete tumor growth inhibition was achieved.Following a similar concept, chemo\u2010dynamic therapy (CDT) has emerged as a potential strategy for killing cancer cells via the conversion of HT agents.120 In3.3.5 The immunostimulatory effect of Au@XL\u2010MSN\u2010CpG/PEG was evaluated in BMDC, and greater activation of DC was accomplished with increased levels of pro\u2010inflammatory cytokines. Finally, the therapeutic effect was evaluated in the B16\u2010F10\u00a0tumor\u2010bearing mice. After tumor formation, mice were treated with Au@XL\u2010MSN\u2010CpG/PEG and NIR irradiation was applied for 5\u00a0min. The results showed greater inhibition for tumor growth (\u2248700\u00a0mm3), as well as a longer survival time (until day 40) in mice compared to the control groups, where tumors were 1000\u20131500\u00a0mm3\u00a0and animals survived until day 20\u201325. Greater synergistic therapy efficacy was attributed mainly to the cytotoxic effect from PDT by destroying tumor cells, which released tumor antigens at tumor sites. This effect combined with the delivery of immunopotentiator CpG\u2010ODN also resulted in the greater activation of tumor\u2010residing DC.PTT, based on NIR light irradiation to induce cancer cell death, can also be combined to enhance the immune response in cancer therapy. MSN combining PTT with immunotherapeutics have been recently described by Ong et\u00a0al. In this case, small gold NPs were adsorbed on the external surface of amino\u2010modified extralarge pore MSN (XL\u2010MSNs). Then thiolated CpG\u2010ODN, as a potent immunopotentiator, were loaded on Au@XL\u2010MSNs by gold\u2010thiol bonding. Finally, thiolated\u2010PEG was used to further decorate the surface of NPs to, thus, yield Au@XL\u2010MSN\u2010CpG/PEG.122 Th The nanodevice was composed of polydopamine (PDA) core NPs  coated with a mesoporous silica shell onto which gardiquimod was loaded and the external surface was coated with 1\u2010tetradecanol (Gardi\u2010mPDA). The nanomaterial capabilities were investigated in vivo in melanoma tumor\u2010bearing mice. Mice were intratumorally injected with PBS, PDA@SiO2, LT680\u2010mPDA, or Gardi\u2010mPDA and irradiated, or not, with an 808\u00a0nm laser (14\u00a0mW\u00a0mm\u22122). The group treated with Gardi\u2010mPDA\u00a0+\u00a0NIR irradiation presented the highest survival rate (until day 45) and tumor growth completely inhibited compared to the controls with tumor volumes of \u2248500\u00a0mm3\u00a0and a lower survival rate (until day 25). Moreover, when mice were later rechallenged on the opposite flank to generate a secondary tumor, more resistance to tumor growth was observed in the group injected with Gardi\u2010mPDA\u00a0+\u00a0NIR irradiation. These findings are mainly attributed to the ability of NPs in the triggered TAA release from tumor cells, as corroborated in the B16\u2010F10\u00a0cells treated with NPs in the presence of NIR. The results confirmed the ability of NPs to release the cargo, triggered by the melting of the 1\u2010tetradecanol shell, and to stimulate the tumor antigen release from the treated cells at the same time. Immunostimulatory capabilities were confirmed by BMDC activation after the treatment with the cell culture supernatant of B16\u2010F10, which contains TAAs as determined by increased IL\u20106\u00a0production.In another innovative approach, Seth et\u00a0al. prepared NIR\u2010responsive core\u2013shell NPs for the photothermal induction of the TAA release from tumors and the delivery of immune adjuvant gardiquimod.123 Th Biodegradability studies of CD@MSNs showed gradual degradation, which accelerated after NIR\u2010laser irradiation (808\u00a0nm). The authors demonstrated increased tumor growth inhibition (<500\u00a0mm3) in 4T1\u00a0tumor\u2010bearing mice in the CD@MSNs + NIR\u2010treated mice (intravenous injection) and no lung metastasis after 14\u00a0treatment days compared to the control groups (tumor volumes\u00a0\u2248>\u00a0000\u00a0m3). The stronger immuno\u2010stimulatory effect was attributed to the fact that NIR promoted the biodegradation of NPs into small debris capable of absorbing large quantities of TAA to make organs immune and to promote immunotherapy compared to the typical MSN scaffold. The presence of CD45+ and CD49b+ cells (T\u2010cells) and activated NK cells (twofold increase) confirmed these findings. A remarkable increase in macrophages took place in the spleen, liver, and lungs.Similarly, Qian et al. designed biodegradable NPs for photothermal synergistic immunotherapy. For this purpose, the authors incorporated carbon nanodots (CDs) into mesoporous silica frameworks (CD@MSNs).124 Bi For this purpose, two NPs were prepared for primary and distant tumor treatment. One was based on the MSN loaded with indocyanine green  and sepantronium bromide  to yield MSNs\u2010ICG\u2010YM155. For the second NP, the authors covalently anchored the anti\u2010CD47\u00a0antibody (which blocks CD47\u00a0expressed on cancer cells surfaces and promotes recognition of cancer cells by the immune system) by amide bonds to MSN containing magnetic NPs (MNP@nSiO2\u2010anti\u2010CD47). Both the immune responses and the antitumor effect induced by synergistic therapy were evaluated in vivo in B16F10\u00a0tumor\u2010bearing mice. For this purpose, a primary tumor model was established by a subcutaneous injection of B16F10\u00a0cells into the left flank region. A distant tumor model was developed 7\u00a0days later by injecting melanoma cells into the right flank. Significant tumor suppression (\u224850% of tumor suppression) in both primary and distant tumors was observed after treatment with MSNs\u2010ICG\u2010YM155 + NIR + MNP@SiO2\u2010anti\u2010CD47, as was a prolonged survival time compared to the other groups and, remarkably, conjugation of anti\u2010CD47\u00a0in NPs resulted in \u224810% increased effectiveness compared with the free administration. The results can be ascribed as MSNs\u2010ICG\u2010YM155 + irradiation inducing the highest DC maturation level and higher levels of inflammatory cytokines and tumor\u2010infiltrating immune cells to, thus, enhance antitumor immune response.Y. Zhang et\u00a0al. developed a nanosystem for synergistic cancer immunotherapy by combining PTT and genotoxic chemotherapy.125 Fo2\u2010PFP\u2010PEG (CPPs), for photoacoustic, and ultrasound PTT and the imaging diagnosis of breast cancer. MDA\u2010MB\u2010231\u00a0tumor\u2010bearing mice were used in combination with immunotherapy agent anti\u2010PD\u20101 . The photoacoustic and ultrasound signals generated by CPPs in tumor regions after laser irradiation confirmed that CPPs could be a very effective contrast agent for cancer diagnosis, while laser\u2010activated CPPs in mice produce substantial tumor cell apoptosis and low cell proliferation. Primary and distant tumors, indicators of metastasis, were suppressed with the combined therapy, which was not achieved by PTT alone. Survival rates (more than 50\u00a0days) improved. Furthermore, CPP\u2010based PTT + anti\u2010PD\u20101\u00a0immunotherapy increased the percentage of cytotoxic T CD8+ cells in both cytokine secretion and DC maturation in primary and distant tumors. Overall, the antitumor effect of combined CPP\u2010based PTT and immunotherapy provoked a significant enhancement in all the antitumor parameters.The versatility of the MSN scaffold also allows the combination of different therapeutic approaches with imaging. Zhan and co\u2010workers designed core\u2013shell copper sulfide (CuS) mesoporous silica nanocomposites loaded with perfluoropentane (PFP), CuS@mSiOt cancer.126 MDFigure\u00a0 DLMSNs were loaded with CuS NPs, and the immune adjuvant resiquimod (R848). The loaded DLMSN were further coated with cancer cell membranes from mouse TNBC 4T1\u00a0cells and finally modified with antiPD\u20101\u00a0peptide AUNP\u201012. The final NPs (AM@DLMSN@CuS/R848) were capable of combining photothermal ablation and immune remodeling. The synergistic capabilities of AM@DLMSN@CuS/R848\u00a0were tested in vitro in co\u2010cultures of splenic lymphocytes and BMDC, 4T1\u00a0cells, and in a TNBC mice model with an excellent immune response and apoptosis in 4T1, which led to complete tumor eradication. In line with the research aim, to suppress TNBC metastasis, in a final assay a metastatic TNBC model was established by pretreatment with the subcutaneous injection of 4T1\u00a0cells into the right hips of female Balb/c mice and an intravenous injection of Luc\u20104T1\u00a0cells to develop primary and lung metastatic tumors. The AM@DLMSN@CuS/R848\u00a0NIR\u2010treated mice manifested reduced growth for both primary and secondary tumors. Besides, the synergistic therapy triggered the best immune response, and the expressions of markers Ki67, CD8, and CD49\u00a0were found in the metastatic tumor, and blood  and CD44+CD62L\u2212 memory T\u2010cells in the spleen. DC and T\u2010lymphocyte activation was confirmed in the TNBC mice model. Interestingly, the AM@DLMSN@CuS/R848\u2010irradiated group exhibited the fewest metastatic nodules, the greatest inhibition of Luc\u20104T1\u00a0cells (75% cellular reduction), and enhanced infiltration of the CD8+ CLTs in the lung metastatic tumor. Taken together, these results reveal that the AM@DLMSN@CuS/R848\u2010based photothermal ablation of the primary tumor generates long\u2010term systemic antitumor immune responses, which can help to prevent metastases.More recently, Cheng and collaborators designed a synergistic nanoplatform based on dendritic large\u2010pore MSN (DLMSN) to suppress triple\u2010negative breast cancer (TNBC) metastasis Figure\u00a013.[124 Recent advances in immunotherapy have led to the FDA approving immunotherapy drugs, such as immune checkpoint inhibitors and CAR\u2010T, for a variety of cancer types. However, the drawbacks of the approved agents, such as patients' acquired resistance, toxicity, and low responses, highlight the need for new immunotherapy strategies. Nanotechnology has been an outbreak in this field and MSN have been demonstrated to be excellent platforms for the transportation and controlled release of large amounts of bioactive agents. Furthermore, mesoporous silica devices offer many advantages over other supports, such as enhanced biocompatibility, controllable biodegradability, improved targeting properties, and immune cell recruitment and activation.Cancer immunotherapy emerges as an innovative precise treatment that is usually safer than traditional methods .28 Rec It is noteworthy that nanovaccines that target lymph nodes are a potential strategy to induce better immune responses. In this case, NPs from 10\u00a0to 80\u00a0nm, and modified with a neutral charge, improve targeting, and thus, cargo delivery to this system. In this way, intradermal administration, which favors the diffusion to lymph nodes, and the use of MSR have offered excellent results for developing a cancer vaccine.In this scenario, we herein reviewed the use of silica NPs in cancer immunotherapy applications and an increasing number of examples are expected in the near future. Overall, the results exhibit the potential of MSN with large porous scaffolds (HMSN or DMSN) to develop cancer vaccines, in which biomolecules like OVA, CpG\u2010ODN, or other TAA can be encapsulated to favor their protection and to enhance the immune response. Besides, MSN can serve as adjuvants to boost immunostimulation, which can also be enhanced by proper surface modification. In general, subcutaneous or intramuscular injections are used to administer cancer nanovaccines to obtain a better response because they promote a more efficient presentation of foreign bodies to macrophages and DC, and generate higher antibody titers.128 ItAccordingly, at the beginning of cancer immunotherapy, initial nanoimmunotherapy focuses on the development of cancer vaccines, and extensive reports have been published. Moreover, in the last few years, and considering emerging novel therapies and the possibilities of mesoporous silica materials, advanced nanosystems have been developed. The unique characteristics of MSN allow the design of milliards of combined synergistic therapies to enhance not only immunotherapy, but also PDT, PTT, etc., for killing cancer cells. Despite as simple as possible nanodevices being preferred to clinical applications, complex systems exhibit remarkable effects and, in some cases, combined therapies results in the complete eradication of primary tumors and prevents metastasis. Until a few years ago, the scientific community assumed that MSN accumulated in the body with a poor removal rate. Nowadays, it is widely described that after MSN are administered, they usually tend to accumulate in major organs like liver, spleen, and lungs, and reach their target (tumor), regardless of the administration route, and are removed from the body by renal and hepatobiliary excretion. All these recent findings suggest that MSN do not accumulate, which accomplishes FDA regulations to achieve clinics. In fact, in the last years, the number of clinical trials using silica NPs has remarkably increased. The advances made in developing bMSN by tuning their structure would be a key factor to take these NPs closer to real applications. Regarding synthetic procedures, another limiting factor to delay the clinical translation of MSN relies on scalability and reproducibility. Methods to carry out the reproducible manufacturing of MSN with narrow variability need to be established and industrial production has to be overcome.Overall, these findings evidence the potential of MSN to be used to combine different synergistic therapies, and vaccine development with MSN as adjuvants or immune recruitment/modulating scaffolds, which may overcome many limitations of current approaches and create new therapeutic options for patients. Although increasing preclinical research with MSN has shed light on the safety and suitability of silica NPs for further clinical translation, there are still challenges to be overcome in clinical practice.109 Un The next few years will provide insight into the clinical potential of MSN in cancer nanoimmunotherapy to improve oncological patient care to develop highly efficacious personalized medicine.The first human trials with silica NPs have started a few years ago and most of them are still ongoing. Besides, NPs combined with immunotherapy are in the initial stage and more efforts are needed to elucidate the complexity in immune system\u2010nanomaterial interactions and the ability to intrinsically modulate innate and adaptive immunity, and to reinforce NPs' delivery to intended tissues.135 ThThe authors declare no conflict of interest."}
+{"text": "Oral lichenoid lesion (OLL) is a term used to describe oral lesions that have clinical and/or histopathological features similar to oral lichen planus (OLP), but it is thought to be caused by specific triggers or systemic conditions and presents higher malignant\u00a0transformation rate\u00a0than OLP. To date, OLL simultaneously complicated with Castleman\u2019s disease (CD) and papillary thyroid carcinoma (PTC) has not been reported. Reporting from such disorders is crucial to avoid misdiagnosis and help in timely intervention.We report a rare case of a 39-year-old female with extensive ulcerated lesions on the oral mucosa, diagnosed as OLL by histopathology. Routine oral treatment was scheduled to control the OLL, while the oral lesions remained unhealed. Computed tomography examination was\u00a0performed after the oral treatment and\u00a0revealed thyroid and mediastinal masses, which were then surgically removed and pathologically diagnosed as PTC and CD, respectively. Two months after complete excision of the neoplasms, the oral lesions showed obvious alleviation. With subsequent treatment for oral lesions, the patient\u2019s OLL healed.This is the first reported OLL case simultaneously associated with CD and PTC. This case reminds us to focus on the underlying etiologies of OLL and the multidisciplinary\u00a0collaboration for oral lesions associated with systemic diseases. Oral lichenoid lesion (OLL) is a chronic inflammatory disease of unknown etiologies or pathogenesis with varied disease severity, which appears as dotted grey-white streaks, reticulated and plaque-like keratotic papules, accompanied by mucosal congestion, erosion, ulceration, atrophy and blistering , 2. The OLL and oral lichen planus (OLP) share several clinical and pathological characteristics as well as oral treatment regimens . The hypCastleman\u2019s disease (CD) is a rare heterogeneous lymphoproliferative disorder, and occasionally co-occurs with oral changes such as paraneoplastic pemphigus, Sj\u00f6gren\u2019s syndrome, and OLP \u201312. OLL A 39-year-old female presented painful ulceration on the oral mucosa for the past two months and visited the Hospital of Stomatology, Sun Yat-sen University in November 2021. She had received treatment for this condition with a systemic administration of corticosteroids for more than one month in other hospital without efficacy. She denied any history of other systemic medications, dental restorations, radiotherapy, smoking and tobacco use. She had no family history of relevant conditions and malignancies. Physical examination revealed extensive ulcerated lesions on the tongue dorsum, bilateral tongue and\u00a0buccal mucosa as well as the lower lip, and Nikolsky\u2019s sign was negative  confirmed the thyroid mass and revealed a mediastinal mass unexpectedly , and presents a higher risk of malignant transformation compared with OLP , 17. DiaThe oral cavity can be regarded as the mirror of systemic health, since many systemic diseases may have manifestations on the oral mucosa . In thisBefore her first visit to our department, she had received oral corticosteroid treatment for more than one month in other hospital without efficacy and suffered from refractory OLL. After initial systemic treatment with thalidomide for oral ulceration, the oral lesions still persisted. Therefore, in addition to timely adjusting the treatment regimen, the elimination of potential provoking factors is an important step in the management of OLL. After the excision of thyroid and mediastinal neoplasms, the oral lesions gradually\u00a0got remission. With subsequent treatment for stubborn ulcerated lesions, the patient\u2019s OLL showed an obvious healing. Hence, clinicians should pay attention to the treatment of systemic diseases as well as oral lesions.Collectively, we present a rare OLL case with CD and PTC simultaneously. This case reminds us to focus on the identification of underlying etiologies, especially for patients with systemic diseases. Multidisciplinary collaboration is needed to diagnose and treat such patients. Furthermore, with respect to the malignant potential, OLL should be regularly monitored as well as systemically treated."}
+{"text": "Erosion is one of the most common and basic lesions of oral mucosal diseases. Long-term refractory oral erosions, induced by autoimmune blistering diseases, infectious diseases, malignant diseases, and some rare conditions, may substantially reduce the quality of life of patients or even constitute a life-threatening condition, resulting in a clinical dilemma regarding the accurate diagnosis and precise management of these diseases. As a special type of malignant lymphoma, most lesions of follicular lymphoma (FL) in the oral mucosa present as masses or swelling of the oral mucosa, while emerging novel presentations lead to intractable diagnoses. Hence, diagnostic algorithms for such diseases are clinically required.\u00a0A 55-year-old female patient presented to the clinic with long-lasting oral mucosal erosions and proliferative lesions. Blood tests, pathological examinations of oral lesions including haematoxylin\u2013eosin (HE) staining, and direct immunofluorescence precluded all of the potential diagnoses described previously. Unexpectedly, positron emission tomography/computed tomography (PET/CT) and abdominal CT of the patient revealed a dense mass in the retroperitoneal area, and the final diagnosis of the retroperitoneal mass was FL. After three courses of chemotherapy conducted by the haematologist, the erosion and proliferative lesions in the patient's oral mucosa had significantly improved. HE and immunohistochemical staining results of intraoral lesions also confirmed it as oral FL. The successful diagnosis of FL in this case is of great clinical significance, as the oral and abdominal FL were treated in a timely manner to avoid unfavourable outcomes.To the best of our knowledge, this is the first case of FL that exhibited widespread erosions interspersed with proliferative lesions. Clinicians should be aware of oral FL or seek systemic factors in the presence of similar refractory oral erosions when treatment is non-responsive and the diagnosis is intractable. Oral mucosal diseases are characterised by their high incidence and wide extent of involvement. For example, the prevalence of recurrent aphthous ulcer (RAU) ranges from 5 to 25% , and theApart from these common aetiologies contributing to oral erosions, such as oral lichen planus (OLP), a small proportion of persistent oral erosions may be oral manifestations of systemic diseases or other factors. In recent years, oral medicine clinicians and pathologists have faced emerging challenges owing to refractory and complicated oral erosions. First, regular inquiry of medical history and oral examination are insufficient to obtain the actual diagnosis of some challenging oral erosions. Second, the definite diagnosis of some non-specific oral signs may require biopsy, which must include normal-appearing tissue and have adequate depth in addition to diseased tissue, after which haematoxylin\u2013eosin (HE), direct immunofluorescence (DIF), and immunohistochemistry (IHC) might be required to reveal the actual disease. Thus, the accuracy of the whole process is largely dependent on the experience of dental clinicians and oral pathologists. Third, besides the detection of biopsied lesions, some adjuvant examinations are recommended to identify systemic factors responsible for the oral erosions, encompassing computed tomography (CT), ultrasonography, blood testing, whole exome sequencing, and so forth. Finally, for refractory oral erosions that cannot be diagnosed through the aforementioned measures, multi-disciplinary team consultation, diagnostic treatment, and further biopsy may be required to achieve an adequate diagnosis , 7\u20139.A large number of oral mucosal diseases can be characterised by oral mucosal erosion, including oral allergic diseases , oral inWe recently reported a woman with multiple refractory and scattered oral erosions accompanied by several proliferative and nodule-like lesions who had failed to respond to conventional treatment regimens  and was finally diagnosed with oral manifestations associated with abdominal follicular lymphoma (FL) after a multidisciplinary consultation. FL is a lymphoid tissue systemic malignancy that exhibits germinal center B B-cell differentiation, and a small proportion of patients with FL might have poor outcomes . Non-HodA 55-year-old woman presented to our oral medicine clinic with refractory and recurrent erosions of the oral mucosa persisting for more than 2\u00a0years. Her condition had gradually worsened over the past 6\u00a0months, with almost no healing period for the oral erosions. The patient complained of severe and obvious pain after eating irritating food. Upon clinical inspection, a region of erosion with a surface area of 40\u00a0mm\u2009\u00d7\u200920\u00a0mm was observed on the dorsum of the tongue, interspersed with several proliferative or nodule-like lesions with diameters ranging from 4 to 6\u00a0mm. The height of nodules was about 5\u00a0mm above the mucosal level, which was palpated and considered to be of moderate texture Fig.\u00a0A. LinearIn terms of potential diagnosis, given the atypically widespread and refractory erosions on the oral mucosa, autoimmune blistering diseases, special infections such as human immunodeficiency virus (HIV) and syphilis, OLP, or malignant lesions, came up as the initial impression based on our clinical experience. Next, several examinations were suggested to achieve the diagnosis, including routine blood tests, glucose tests, biochemical tests, bullous disease antibodies against Dsg1, Dsg3, and Bp180, and testing for HIV and syphilis; negative findings were indicated in these tests. Furthermore, chest computed tomography (CT), abdominal ultrasonography, and biopsy of the inner mucosal lesions of the right upper lip were performed.Meanwhile, the patient required medication during the process of receiving further tests. This course included 30\u00a0mg of prednisone per day for one week, 50\u00a0mg of thalidomide per day for 10\u00a0days and 0.1\u00a0mg/mL dexamethasone mouthwash; however, no significant recovery of the oral erosions and proliferative lesions was observed at the revisit, which emphasized the complexity of the disease and the potential systemic nature. For the biopsy, the inner-side mucosa of the right upper lip was selected because of the co-existence of erosion and white striae, which was not visibly present on the tongue. After HE staining, nodular aggregation of lymphocytes and plasma cells was observed in the subepithelial connective tissue and around the blood vessels under a microscope Fig.\u00a0A. The DIThe patient was then referred to haematology department for further treatment of FL, and 0.1\u00a0mg/mL dexamethasone together with 2% sodium bicarbonate mouthwash was recommended for topical treatment of oral lesions. After meticulous evaluation by a haematologist, the patient was treated with a rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) regimen as follows: rituximab 500\u00a0mg D0, vinorelbine 30\u00a0mg D1, pirarubicin 60\u00a0mg D1, cyclophosphamide 1\u00a0g D1, hydrogenated prednisone 40\u00a0mg D1, D5. Over three courses of chemotherapy, the intraoral lesions improved significantly, the nodule-like lesions on the dorsum of the tongue disappeared, and the oral erosions were also controlled. The patient was then recommended routine visits to the haematology clinic every 2\u00a0months, and no further recurrence of oral lesions was observed in the follow-up visits until May 2022 (the third year after the onset of disease)  or PAMS , oral inBased on the features of the aforementioned diseases and the systemic findings, the oral presentations of the patient and differential diagnosis were made, and the ultimate conclusion was oral manifestations of FL, one of the most frequent NHL. In Western countries, FL accounts for approximately 5% of all haematologic neoplasms and about 20\u201325% of all newly diagnosed NHL . Up to 4The pathogenesis of FL that leads to oral mucosal erosion and proliferative lesions is unknown. However, this process may be associated with the tumour immune microenvironment. In FL, the tumour microenvironment is one of the main contributors to tumour cell survival and proliferation. These important components of the microenvironment, such as follicular germinal centers, helper T cells, macrophages, and FDCs, play crucial roles in the formation of oral FL lesions . In FL wBased on the diagnostic process of this particular case and the logistics of differential diagnosis, we have summarised a flowchart of the diagnostic algorithm for patients with refractory oral erosions Fig.\u00a0, thus enThe clinical manifestations of intraoral FL are mostly masses or swelling of the oral mucosa . This ca"}
+{"text": "Inflammatory bowel diseases are chronic conditions characterized by periods of remission, alternating with episodes of exacerbation, in which the primary therapeutic target is mucosal healing. Although colonoscopy is currently considered the gold standard for assessing disease activity, it presents a significant number of disadvantages. Over time, various inflammatory biomarkers have been proposed to detect disease activation, but current biomarkers have many limitations. Our study aimed to analyze the most commonly used biomarkers for patient monitoring and follow-up both independently and taken together as a group, in order to propose an improved activity score that more accurately reflects the changes occurring at the intestinal level, in order to limit the number of colonoscopic interventions. By applying logistic regression as a method of statistical analysis to the retrospectively collected data, we obtained an easy-to-calculate improved score that quantifies the chance that a given patient may be in remission or in a period of endoscopic activity. To achieve a widely accessible score that is easily accessible in clinical practice, we have included only the most commonly used clinical and biological parameters. Inflammatory bowel diseases (IBD) are chronic conditions that affect the gastrointestinal tract and are characterized by periods of remission, alternating with episodes of exacerbation . These dGiven the recurrent evolution of exacerbation episodes, these patients require a continuous follow-up, with periodic evaluation to immediately detect and treat any possible recurrence. The therapeutic target is mucosal healing, which is a good predictor of disease remission . CurrentVarious clinical activity scores have been developed for the long-term follow-up of disease progression ,6,7. HowFecal calprotectin is a protein secreted by neutrophils that, to date, best correlates with intraluminal changes. However, its major drawbacks are the significant intra-individual variability , as wellC-reactive protein is an acute-phase protein that is highly sensitive to inflammation. However, in the case of IBD patients with episodes of exacerbated disease activity, circulating CRP levels may often increase insufficiently for an accurate evaluation of mucosal lesions .As a result of the limitations of current biomarkers, finding non-invasive ways to evaluate intestinal changes before the appearance of clinical symptoms would be of real benefit to both patients and physicians. If effective, this strategy might also reduce the economic and social burden imposed by disease reactivation.Our study aimed to analyze different markers of inflammation used during the process of disease monitoring and patient follow-up in inflammatory bowel diseases. Our approach was to evaluate them by logistic regression, both independently and as a group, in order to propose an activity score that more accurately reflects the changes occurring at the intestinal level.An analytical retrospective study was designed and approved by the ethics committee of the University of Medicine and Pharmacy \u201cIuliu Ha\u021bieganu\u201d of Cluj-Napoca.All included subjects had a confirmed diagnosis of IBD, based on clinical, colonoscopic, histopathological and imaging criteria. At the time of presentation, they had performed a colonoscopy and a fecal calprotectin measurement had been scheduled at maximum 3 days prior to the endoscopic examination. Other laboratory assays had been performed the week before the colonoscopy, preferably close to the endoscopic investigation. At the moment of inclusion, the patients were on their chronic treatment.Excluded subjects were those with indeterminate colitis, a history of bowel surgery for other causes than IBD, pregnant women, or patients with other conditions susceptible of influencing the levels of inflammatory markers .Medical files were retrospectively collected from the Regional Institute of Gastroenterology and Hepatology Cluj-Napoca hospital database. The search was carried out over a period of 6 years, between January 2015 and December 2020.The classification of patients according to the state of clinical and endoscopic activity was based on previously validated severity scores, widely used in clinical practice .The clinical characteristics of the studied patients were evaluated using Montreal score .For patients with CD, clinical activity was evaluated by the \u201cCrohn\u2019s disease activity index\u201d (CDAI) . PatientFor patients with UC, the partial Mayo score  was usedMucosal healing was defined in the case of a SES-CD score < 2, and a Mayo score of 0, respectively.The \u201cSimple endoscopic score for Crohn\u2019s disease\u201d (SES-CD)  was usedThe inflammation markers frequently used to evaluate these patients were also registered. Thus, for each patient, the values of the following parameters were recorded: the number of leukocytes , erythrocyte sedimentation rate (ESR) at 1 and 2 h , C-reactive protein  and fecal calprotectin (reference range < 50 \u03bcg/g).For statistical analysis, we used SPSS .To assess the normality of the distribution of quantitative variables, we used the Kolmogorov\u2013Smirnov test. The mean and standard deviation were calculated for normally distributed variables and the median was used for variables not following a normal distribution.The differences between groups were evaluated using non-parametric tests or the Student test, depending on data distribution. ROC (receiver operating characteristic) curves were performed to measure the ability of each parameter to predict changes at the intestinal level and the corresponding areas under the curve (AUC) was measured. Logistic regression was used to combine the effect of different parameters, currently used to monitor inflammatory bowel diseases.For each parameter, a value of \u201c0\u201d or \u201c1\u201d was assigned, depending on whether it was situated below, or above the cut-off values, respectively. Following regression analysis, relative weights were established for each parameter and then included in the calculation of the proposed diagnostic score.p-value < 0.05 was considered significant.A A total of 209 subjects were included in this study. Among them, 72 patients were diagnosed with CD and 137 with UC. In 23 subjects, the values of ESR were not available, and in one patient, the value of CRP was not recorded. Otherwise, the other variables were collected according to the study protocol.The clinical characteristics of the patients are summarized in Non-invasive parameters for the evaluation of IBD activity, according to the endoscopic classification as activity or remission episodes, are presented in p < 0.05) were found in both FC and CRP values, between patients in remission and those in the active disease phase, for both IBD types.The median FC values were 410 \u03bcg/g for CD and 740 \u03bcg/g for UC, whereas the median CRP values were 0.85 mg/dL in CD and 0.50 mg/dL in UC. Statistically significant differences ) and ulcerative colitis (Equation (2)), using only the linear component of the logistic regression, in order to simplify their use by the practicing physicians:p < 0.001), while for UC, it implies a sensitivity of 0.904 and a specificity of 0.917 (p < 0.001).The ROC curves corresponding to the activity scores developed for CD and UC are presented in p < 0.001). As a result, we compared the distribution and median values for each condition, in remission versus activity. Using the Kolmogorov\u2013Smirnov test, we noticed that the obtained scores did not have a normal distribution  were evaluated as potential indicators of endoscopic remission in CD patients, treated with anti-tumor necrosis factor (TNF). The best diagnostic performance was obtained using the following score: fecal calprotectin (\u03bcg/g) + 60 \u00d7 HBI, which had a sensitivity of 86% and a specificity of 82%. However, its diagnostic accuracy was not significantly different from that of fecal calprotectin alone, which had a sensitivity of 84% and a specificity of 74% . MoreoveA recent study by de Bruyn et al. used binary logistic regression and combined several biomarkers of inflammation, such as serum neutrophil count, CRP, cathelicidin LL-37 and chitinase 3-like 1 to increase the diagnostic performance in the evaluation of mucosal healing in UC patients, undergoing anti-TNF treatment. Their proposed response index had a sensitivity of 54% and a specificity of 92% . The majChen et al. used multiple linear regression to combine several clinical and biological parameters  in order to obtain an activity score that best predicts endoscopic activity in patients with UC or with the ileocolonic form of CD. Performing the following calculations: 0.2 \u00d7 FC + 50 \u00d7 CAI and 0.8 \u00d7 FC + 4.6 \u00d7 CDAI, for UC and CD, respectively, resulted in a sensitivity and specificity above 90% for both disease categories .In order to detect inflammation at the intestinal level, other studies tried to combine biological markers, such as FC, with a questionnaire for the evaluation of the quality of life  , or the Although the score developed in the present study showed higher diagnostic performance than each individual parameter, its validation is mandatory, before it could be used in the clinical setting. Also, cost-effectiveness studies are needed to estimate the percentage of endoscopic investigations that could be avoided, using this activity score. One such study, performed for the evaluation of FC alone, concluded that its assay could avoid an important number of endoscopic interventions and reduce the cost by 1010 USD/patient, over a period of 18 months .A major limitation of our study lies in its retrospective character. It is possible that the relatively low incidence of both diseases in our study may be due to an insufficient awareness about those disorders among primary care physicians and, subsequently, an underdiagnosis of inflammatory bowel disorders in our region. Furthermore, for a more precise analysis of the monitored parameters, the subjects were divided into four groups, according to the degree of endoscopic activity , resulting in a relatively small number of patients in each subgroup. We may speculate that better diagnostic performance of the proposed activity scores might be observed with an increase in the number of studied patients, for both conditions. Also, in patients with ileal Crohn\u2019s disease, colonoscopy cannot assess the mucosal changes in the small intestine, which may lead to misclassification of the subjects in remission or activity phases. Finally, we must consider the degree of subjectivity of current clinical and endoscopic scores, besides the performance of endoscopic investigations by different practitioners, which may further interfere with patient classification among the different phases of disease activity.In conclusion, although several inflammatory biomarkers may be used for patient follow-up with the purpose of limiting the number of colonoscopies, these parameters cannot entirely replace endoscopic investigations. By applying logistic regression as a statistical analysis method to retrospectively collected data, we obtained a relatively easy-to-calculate score that quantifies the chance that a given patient may be in remission or in a phase of endoscopic activity, for each of the studied diseases. Contrary to other similar activity scores, we only included the most frequently used clinical and biological parameters, in order to obtain an improved score, widely accessible in clinical practice."}
+{"text": "Mimicking the complex architecture of salivary glands (SGs) outside their native niche is challenging due their multicellular and highly branched organization. However, significant progress has been made to recapitulate the gland structure and function using several in vitro and ex vivo models. Hydrogels are polymers with the potential to retain a large volume of water inside their three-dimensional structure, thus simulating extracellular matrix properties that are essential for the cell and tissue integrity. Hydrogel-based culture of SG cells has seen a tremendous success in terms of developing platforms for cell expansion, building an artificial gland, and for use in transplantation to rescue loss of SG function. Both natural and synthetic hydrogels have been used widely in SG tissue engineering applications owing to their properties that support the proliferation, reorganization, and polarization of SG epithelial cells. While recent improvements in hydrogel properties are essential to establish more sophisticated models, the emphasis should still be made towards supporting factors such as mechanotransduction and associated signaling cues. In this concise review, we discuss considerations of an ideal hydrogel-based biomaterial for SG engineering and their associated signaling pathways. We also discuss the current advances made in natural and synthetic hydrogels for SG tissue engineering applications. Salivary glands (SGs) are exocrine organs which are responsible for the production and secretion of saliva\u2014a complex, multifunctional, extracellular fluid that helps in the maintenance of oral homeostasis. In humans, SGs are categorized into major and minor glands, which are mainly based on the size of the gland and the volume of saliva they secrete . There aMimicking the complex architecture of the SGs outside its native niche is quite perplexing. Over the past two decades, significant progress has been made to recapitulate the gland structure and function using several in vitro and ex vivo models ,15,16,17In this narrative review, we discuss the criteria for tuning an ideal hydrogel-based biomaterial for SG tissue engineering based on our current knowledge of other highly branched organs systems. We mainly discuss the different hydrogel properties, such as their biocompatibility, stiffness, pore size, architecture, etc., that suit specific SG cell functions and their association with key mechanotransduction proteins and pathways. Finally, we oversee the current advances made in natural and synthetic hydrogels including our contributions to SG tissue engineering applications.In general, an ideal biomaterial used in SG tissue engineering should: (1) support the cell proliferation and migration within the matrix, (2) maintain the phenotypic characteristics of SG cells, (3) stimulate selective differentiation of SG stem/progenitor cells, (4) enable cell assembly and reorganization (cell polarization and lumen formation), (5) support matrix remodeling (permissible hydrogels), and (6) allow duct expansion (promote branching morphogenesis) . For bioTo successfully fulfil the abovementioned criteria, we need to consider two crucial parameters in terms of biomaterial selection: (1) the biochemical/bioactive component and (2) the mechanical-physicochemical properties of the hydrogels. The hydrogels must be biocompatible, stable, and biodegradable and support living cells, biological factors (such as growth factors), and ensure the correct nutrient and oxygen exchange. They should be developed using mild preparation strategy and note should be taken that the hydrogel degradation by-products should not be toxic to cells or microtissues .The presence of anchorage sites or specific cellular binding motifs within the hydrogel matrix/scaffold are pivotal to support adhesion proteins or junction proteins to ensure the establishment of the subsequent steps in cell biology processes such as proliferation, migration, self-assembling, and, most importantly, polarization. The absence of adhesion sites driving to poor/null cell attachment can potentially lead to anoikis of the cells . SG epitAppropriate hydrogel stiffness is a key aspect which regulates all cell activities and functions including cell phenotype maintenance , prolifeA variety of signaling cascades are activated in response to mechanical stimuli from the ECM, of which the most important pathways that might determine the hydrogel characteristics for SG engineering include the FAK, Rho Kinase (ROCK), Yes Associated Protein (YAP), and Wnt/\u03b2-catenin signaling. Sequeira et al. isolated and cultured embryonic SMGs on PLGA nanofibers and evaluated branching morphogenesis, epithelial proliferation, and FA protein expression . They foYAP is a key protein involved in tissue regeneration in various organs . EctopicSimilarly, the Wnt/\u03b2-catenin signaling is a well-studied pathway in SG biology and is known to play a crucial role in SG stem cell maintenance and long term expansion in vitro . In thisThe ability to fabricate hydrogels with varying pore sizes constitutes another reason for their use as cell scaffolds and three-dimensional culture platforms. Three-dimensional matrix pore size is determinant in multicellular organization, migration, and transport of nutrients and soluble cues within its three-dimensional architecture . This isGenerally, smaller hydrogel pore sizes have been shown to cause diffusion of FA complexes and proteins into cell cytoplasm, as opposed to into the cell membrane . A similTunable viscoelastic properties are necessary to support and harbor the cells to promote spreading, proliferation, and differentiation ,64. The Hydrogel architecture plays an essential role in defining how the cell self-assembles into a regulated functional, complex three-dimensional structures in cultures . SG epitSeveral biomaterials have been used to culture mammalian cells for tissue engineering and regenerative applications. There are more comprehensive reviews about different types of hydrogels and their applications in tissue engineering using different cell types, such as breast cancer cells, neuronal cells, pancreatic tissue, etc. ,75,76,77Matrigel is a commonly used biomaterial in 3D culture. In the SG field, Matrigel plays a critical role in SG development and morphogenesis , promotiOther BM-derived peptides, such as laminin in combination with fibrin hydrogels, have shown to promote SG spheroid formation, branching, and functionality . Fibrin Other naturally occurring protein-derived hydrogels, such as collagen, fibrin gel, or their combination, have been used to culture SG cells to form acinar- or ductal-like structures ,85. EvenChicken egg derivatives have been used to create hydrogels for SG culture as an accessible, low-cost alternative to current three-dimensional hydrogel-based platforms. Our lab has tested egg yolk plasma (EYP) and egg white material (EW) to grow immortalized human SG acinar cells (NS-SV-AC) and human SG fibroblasts inside of EYP gels. Cells mixed within EYP showed high viability, while the NS-SV-AC reorganized as a spheroid-like structure while fibroblasts formed sheet-like structures within the EYP gel. Mixing both EYP and EW also promoted the proliferation of three-dimensional SG spheroids. However, using EYP as a gel for SG culture is not ideal for imaging and spheroid tracking due to the opacity of the gel ,87. FurtGelatin, a product derived from the partial hydrolysis of collagen, is a suitable material for biomedical applications due to its biodegradability, biocompatibility, and reabsorption by the host. The viscoelastic property of this polymer allows cell-mediated stromal remodeling (such as in SG acinar assembly) by deposition of ECM proteins. The limited temperature window for its sol\u2013gel transition makes its manipulation difficult and limits its use in bioprinting when large, complex three-dimensional models are built up at room temperature. Combining gelatin with other polymers allows one to improve their mechanical properties, such as the use of crosslinkers such as genipin or the addition of methacrylate. Gelatin-methacrylamide (GelMA), with other combinations such as polycaprolactone (PCL), silver ink, or alginate, has been used widely in tissue engineering applications. Cells grown in GelMA composites have shown the ability to proliferate, maintain viability, differentiate, and perform key cell functions .Alginate is another naturally occurring bioinert material used in several tissue engineering applications. This carbohydrate enables mechanical reinforcement that allows the development of gels with controlled stiffness via ionic crosslinking using divalent ions . This reaction is reversible by applying highly coordinated divalent ions chelators (such as citrates or EDTA), allowing the recovery of pure three-dimensional spheroids/organoids for future tissue engineering applications . The croHA is a hydrophilic non sulphated glycosaminoglycan (GAG) which is found in the ECM, especially surrounding the mesenchyme. HA is bioactive with several cell binding sites for different cell surface receptors which direct cell adhesion, migrations, and morphogenesis . CD44, aWhile naturally derived hydrogels provide inherent biological properties, such as bioactivity, biocompatibility, biodegradability, and cell signaling properties leading to cell survival and performance, their batch-to-batch variability and the presence of various endogenous epitopes and cues within these biomaterials largely affect cell function. Synthetic biomaterials with an exact known composition with high tunability and reproducibility have been used for SG tissue engineering.PLGA and PEG (polyethelene glycol) have been tested as synthetic biomaterials in SG engineering ,61,99. PPolymerized PEG, using methacrylate, has been shown to induce significant loss of submandibular gland cell viability. This challenge was overcome by thiol-ene polymerization, which led to better SG cell encapsulation. Still, both types of hydrogels failed to re-organize primary single cells into SG cell clusters or organized acini . PEG hasPolycaprolactone (PCL) is another synthetic material used as a scaffold in periodontal and bone tissue engineering due to its high mechanical strength . A robusOther strategies employed in SG engineering are the use of well defined SG acinar spheroids derived from one of these above-mentioned hydrogels and their transfer into micro- or nano-fabricated templates. A seminal work using matrix metalloproteases (MMP) degradable PEG hydrogels with micro bubble (MB) array technology was recently reported . This buTo conclude, to successfully devise a hydrogel for the purpose of developing a fully functional multicellular SG, it is essential to consider several key factors. These include, but are not limited to, the hydrogel composition, preparation, availability of binding sites, stiffness, pore size, stress relaxation, and matrix architectural features. Most hydrogel-based matrix/scaffold development focuses on successfully creating functional SG organoids or spheroids by self-reorganization of epithelial cells or progenitor cells, exploiting low FA-mediated interactions with ECM and high cell\u2013cell interactions forming adherent and tight junctions. However, recently published results from single-cell RNA sequencing of embryonic SGs shines evidence on the need for maintaining a low cell\u2013cell interaction and robust cell\u2013matrix integrin mediated signaling to promote budding and branching morphogenesis. Combined, these findings suggest that no one single hydrogel composition can attain all the canonical physicochemical interactions necessary to replicate each stage of SG morphogenesis. It is fundamental to independently study and understand the mechanical cues required by each SG cell type, following their subsequent interaction with the ECM microenvironment to regulate cell function and fate. Utilizing our current knowledge of cell modulation via mechanotransduction from other branched, multicellular organ systems, combined with advances in three-dimensional SG culture, their associated signaling pathways, and soluble cues, could potentially progress our ultimate goal of engineering a SG. Additionally, a combination of hydrogel platforms could be useful to first construct separately a secretory acinar and ductal branching units with their respective niche associated progenitor/stem cell markers. These structures can then be re-adapted by providing adequate mechanosignalling for each outcome desired, which can be combined using the recent advances in multicellular-multimaterial three-dimensional bioprinting and integrated chip systems to develop a fully functional SG."}
+{"text": "Lactobacillus increased, whereas the relative abundance of Helicobacter and Stenotrophomonas decreased after being treated with DWP and DWPP. The correlation between intestinal microflora and physiological indexes showed that chao1, ACE, and observed species indexes in the \u03b1 index were positively correlated with weight gain velocity, SOD activity, and thymus index. The relative abundance of Lactobacillus was positively correlated with SOD and thymus index but negatively correlated with MDA. The relative abundance of Stenotrophomonas was opposite to that of Lactobacillus. The Anaerobiospirillum, Fusobacterium, and Dubosiella had a significant positive correlation with the weight gain velocity. The study provided a deeper more profound understanding of the potential use of DWP and DWPP in senescence delays.The prolongation of life span has attracted more and more attention in the current world. Gut microbiota is considered one of the most critical elements and is essential in regulating life span and quality. The effects of donkey whey protein (DWP) and donkey whey hydrolysate (DWPP) on physiological functions and gut microbiota of D\u2010galactose\u2010induced aging mice were investigated to find new strategies for resisting aging. Our results showed that DWP and DWPP could increase the body weight gain velocity, superoxide dismutase (SOD) activity, and thymus index, whereas decrease the level of reactive oxygen species (ROS) and malondialdehyde (MDA), and improve the aging of the body in the liver congestion, oozy draw focal sclerosis of chronic inflammation. The effects of medium and high concentrations of DWP and low and medium concentrations of DWPP were the same as the vitamin C (Vc)\u2010positive control group. It was found that both DWP and DWPP could change \u03b1\u2010diversity; the relative abundance of  DWP and DWPP could increase the body weight growth rate, antioxidant activity, immune function, and against chronic hepatitis damage in aging mice. However, it is still a global challenge to improve the health span of people , taken to the laboratory within 1\u00a0h, and stored at \u221220\u00b0C for further use. All other chemicals and reagents used in this work were provided locally and were of analytical grade.2.22.2.1g\u00a0(4\u00b0C) for 30\u2009min. The upper fraction (milk fat) and a down fraction (milk whey and granule) could be visualized after centrifugation. Upper milk fat was discarded, and the pH of left skim milk was adjusted to 4.6 with 1\u00a0M HCl, followed by incubating in the water bath (40\u00b0C) for 20\u2009min. Then, skim milk was centrifuged at 12,000 g at 4\u00b0C for 20\u2009min, and supper milk whey (MW) was collected and then lyophilized. The MW powder was stored at 4\u00b0C until further use.For the DWP preparation, donkey milk was centrifuged with a centrifuge  at 4700 g for 10\u00a0min, and the upper fraction (DWPP) was collected, then lyophilized and stored in the fridge (4\u00b0C) for the following experiments.For DWPP preparation, 0.5\u00a0g DWP was dissolved in pure water and the final concentration was adjusted to 30\u2009mg/ml. Then, it was incubated at 90\u00b0C for 5\u00a0min, followed by cooling down to 50\u00b0C by stirring with a magnetic stirrer, and adjusted pH to 7.0. The concentration of neutral protease was carefully adjusted to 4000\u2009U/g. Hydrolysis lasted for 5\u00a0h; during the hydrolysis, pH was kept to 7.0. After hydrolysis, the reaction system was heated to 100\u00b0C for 10\u00a0min to inactivate the protease. Then, the reaction system was centrifuged at 15,000 2.2.2The Kjeldahl method determined the protein content AOAC,\u00a0. The con2.2.3N\u2009>\u20092, M\u00a0=\u00a0N\u20102; N\u00a0=\u00a01, M\u00a0=\u00a00,All  healthy female Kunming mice  were provided by the Experimental Animal Center of the Institute of Genetics and Developmental Biology of the Chinese Academy of Sciences . The mice were kept under standard laboratory conditions and housed in an environmentally controlled room 24\u2009\u00b1\u20091\u00b0C) with 55\u2009\u00b1\u200910% relative humidity in a 12\u2009h light/dark automatic lighting cycle. They could access the standard pellet diet and drink water ad libitum throughout the study. The Research Ethics Review Committee approved all animal and biological experiments of the College of Life Science and Engineering, Northwest Minzu University ; ethical approval number: xbmu\u2010sm\u20102019002. Mice were subcutaneously injected with 10% D\u2010galactose solution (1.25\u2009g/kg/day) for 6\u2009weeks to establish aging models. Subsequently, 54 of 65 animals were randomly divided into nine groups: non\u2010treatment control group (NS), negative control (Aging), positive control , low\u2010, middle\u2010, and high\u2010concentration donkey milk whey protein (DWP) treatment group , and low\u2010, middle\u2010, high\u2010concentration donkey milk whey peptide (DWPP) treatment . All groups except for NS were sequentially injected with 10% D\u2010galactose solution (1.25\u2009g/kg/day) by subcutaneous injection. In parallel, different doses of vitamin C, DWP and DWPP were intragastrically supplemented to the aging models for 7\u2009weeks. All experimental designs are presented in Table\u00a0\u00b0C with 5Next\u2010generation sequencing (NGS) of the 16S rRNA gene amplicons method was utilized to check the gut microbiota in the intestinal contents collected from three mice (they were selected from every group randomly).2.2.4The superoxide dismutase (SOD) activity and malondialdehyde (MDA) content were determined with the commercial kit manufactured by Nanjing Jiangcheng Bioengineering Institute  according to the instructions.g for 10\u00a0min, and the absorbance of the sample was measured with a Microplate Reader . As for MDA content, the sample and reagents were added into the tubes and incubated at 95\u00b0C for 40\u2009min. After cooling to room temperature, they were centrifuged at 1360 2.2.5ROS level was determined according to the method described in the previous study  staining of the liver was performed according to the method described in the previous study  was utilized to extract the total DNA in fecal samples. The quality of DNA was detected by running an agarose gel (1%). DNA was quantified using NanoDrop\u2122 2000/2000c Spectrophotometers (Thermo Scientific\u2122). Qualified DNA samples  was fragmented through ultrasonication (approximately 300\u2009bp in length), and a V3\u2013V4 region library of the 16S rRNA gene was constructed based on the DNA templates by using TransStart Fastpfu DNA Polymerase (TransGen Biotech). The primer sequences for the polymerase chain reaction were as follows: the 515 (5\u2032\u2010GTGCCAGCMGCCGCGGTAA\u20103\u2032) and 806 (5\u2032\u2010GGACTACHVGGGTWTCTAAT\u20103\u2032). The polymerase chain reaction assay was performed using the following program: initial denaturation at 95\u00b0C for 10\u00a0min, followed by 30\u2009cycles of 95\u00b0C for 15\u2009s, annealing at 60\u00b0C for 15\u2009s, and extension at 72\u00b0C for 30\u2009s; final extension at 72\u00b0C for 5\u00a0min. Three technical duplicates with negative controls for each gene were conducted under the same conditions. The target fragments of DNA were collected by GeneJET RNA Purification kit (Thermo Scientific) according to the manufacturer's instructions. The Qubit2.0 (Life Tech) and Agilent 2100 Bioanalyzer (Agilent) were used to determine the densities of the collected fragments and execute quality control, respectively. The efficiency of the adapters was evaluated by qPCR. The sequencing process was accomplished using the IonS5TMXL system (Thermo Fisher Scientific).2.2.8https://www.arb\u2010silva.de/) to identify and delete chimeric and nontarget region sequences using UCHIME (version 4.1). The sequences were classified using the Uparse software  and classified into different operational taxonomic units (OTUs) based on the sequence similarity cut\u2010off value . The abundance (reads number) of OTUs in each sample was calculated and the OTUs containing more than two reads were used for further analysis. The alpha\u2010diversity analysis  and beta\u2010diversity analysis  were analyzed by QIIME (v1.8.0) software. The unweighted UniFrac distance of beta\u2010diversity index, SILVA rRNA database (http://www.arb\u2010silva.de/) on Mothur website (http://www.mothur.org/wiki/RDP_reference_files), and Ribosomal Database Project (RDP) classifier (80% confidence) were used to calculate the principal coordinates analysis (PCoA), the annotation of the OTUs, and OTUs relative abundances (from phylum to species level), respectively.The raw data were filtered using Cutadapt (V1.9.1) quality\u2010controlled process to remove barcode, sequences of 5\u2032\u2010end primer mismatch base number >1, sequences with length \u2264150\u2009bp, sequences with a continuous equal number of bases >8, and ambiguous sequences. Then, the reads were submitted to the Silva database  test was used for analysis. Duncan's multiple\u2010range test was performed in multiple comparisons using IBM SPSS Statistics 22.0 (SPSS Inc.). The significant difference was determined at 33.1The chemical composition and hydrolysis efficiency were determined and results are shown. The protein content was 10.4\u2009\u00b1\u20090.6\u00a0g/100\u2009g, lactose content was 78.9\u2009\u00b1\u20090.8\u00a0g/100\u2009g, and fat content was 0.396\u2009\u00b1\u20090.14\u2009g/100\u2009g. The hydrolysis efficiency was 10.2%.3.2p\u2009<\u2009.05; Figure\u00a0It is attractive to investigate the effects of DWP and DWPP on the physiology of D\u2010galactose\u2010induced aging mice, since donkey milk has been demonstrated to play an essential role in maintaining body functions. As shown in Figure\u00a0As shown in Figure 3.3p\u2009<\u2009.05).Firstly, the raw data were filtered and nonspecific amplified fragments and chimeras were removed; thus, quality control data were obtained Table\u00a0. It showMeanwhile, the results of the alpha\u2010diversity analysis showed that the richness of the microbial community in aging is lowest by comparison with other groups according to alpha\u2010diversity indexes, including Shannon index, Simpson index, chao1, and ace. For DWP\u2010 and DWPP\u2010treated groups, except DWPH and DWPPH, other groups had increased Shannon value, Simpson value, chao1 value, and ace value compared with aging Figure\u00a0; the res3.4Lactobacillus, Helicobacter, and Stenotrophomonas were the most abundant in all groups by comparison with other bacteria   Figure\u00a0. These r3.5p\u2009<\u2009.001), .601 (p\u2009<\u2009.001), and .449 (p\u2009<\u2009.05), respectively. Good coverage was negatively correlated with weight gain velocity. No significant correlation was found among other groups; it was found that SOD and thymus index and weight gain velocity have the same trend, while MDA was the opposite. The results showed that the physiological indexes were related to the diversity of intestinal flora. The relative abundance of Lactobacillus was positively correlated with SOD  and thymus index , while negatively correlated with MDA . The relative abundance of Stenotrophomonas and Helicobacter was opposite to that of Lactobacillus, and only Stenotrophomonas and SOD had statistical differences, while the others had no statistical significance. The body weight gain velocity was significantly positively correlated with that of Anaerobiospirillum, Dubosiella, and Fusobacterium. The results showed that antioxidant activity was positively correlated with the abundance of intestinal Lactobacillus and negatively correlated with Stenotrophomonas. However, it can be seen that SOD and thymus index and weight gain velocity have the same trend, while MDA has the opposite. The results showed that the physiological indexes were related to the diversity of intestinal flora  increase oxidative stress (Toyomizu et al.,\u00a0The thymus index can reflect the body's immune function from the side. Subcutaneous injection of D\u2010galactose\u2010induced osmotic pressure and mitochondrial dysfunction in mice, and the formation of hydrogen peroxide reduced SOD level, resulting in oxidative stress and chronic inflammatory reaction (Azman & Zakaria,\u00a0Lactobacillus in mice (Boscaini et al.,\u00a0The gut microbiota is crucial in regulating energy homeostasis and intake to control body functions (Wang et al.,\u00a0High diversity of intestinal flora is associated with health, low diversity is associated with different diseases, and community diversity is negatively correlated with the vulnerability of the elderly (Jackson et al.,\u00a0Bifidobacterium and Lactobacillus, which are healthy and beneficial, decreased significantly. In this study, different concentrations of donkey whey powder and its hydrolysates greatly influence the relative abundance of dominant bacteria in the intestinal flora of D\u2010galactose\u2010induced aging mice, such as Lactobacillus, Stenotrophomonas, and Helicobacter. Compared with other groups, MDA and SOD in the aging group prepared with D\u2010galactose were significantly increased, while the abundance of beneficial Lactobacillus in the intestinal tract was significantly decreased, while the harmful bacterial flora Stenotrophomonas and Helicobacter were significantly increased, indicating that the aging organism was in a state of oxidative stress and intestinal flora disorder. After the treatment with different concentrations of donkey whey powder and its hydrolysates, the serum MDA and SOD of the mice decreased significantly. At the same time, the abundance of beneficial Lactobacillus in the intestinal tract increased significantly, while the harmful bacteria of Stenotrophomonas and Helicobacter decreased significantly. It was found that the relative abundance of Lactobacillus was positively correlated with SOD and thymus index but negatively correlated with MDA. The relative abundance of Stenotrophomonas\u00a0was opposite to that of Lactobacillus. At the same time, donkey whey powder and its hydrolysate improved chronic inflammation in the liver of aging organisms. These results are consistent with the theory of Kong et al.\u00a0(Lactobacillus contributes to the improvement of oxidative stress in the body and chronic inflammation in the liver. These results suggest that donkey whey powder and its hydrolysates may regulate the composition and abundance of Lactobacillus in the intestinal flora of aging bodies, thus showing a better antioxidant effect and improving the chronic inflammatory response in the liver of aging bodies.The structure of intestinal flora is affected by many factors, such as country, region, diet habits, gender, and disease, but it is still considered to be one of the crucial factors in determining longevity (Han et al.,\u00a0g et al.\u00a0. and Sagg et al.\u00a0. respect5Lactobacillus and decrease the relative abundance of Stenotrophomonas and Helicobacter. The concentration remarkably influences the effects of DWP and DWPP on gut microbiota and physiological functions in aging mice. The study highlights the importance of DWP and DWPP in improving the health status of aging settings and opens new opportunities for future advances in developing novel strategies that slow down aging.The present work explored the effects of donkey whey protein and peptides on the composition and abundance of gut microbiota in D\u2010galactose\u2010induced aging mice. The result showed that DWP and DWPP could change the alpha diversity and the relative abundance of gut microbiota in D\u2010galactose\u2010induced aging mice. DWP and DWPP can improve antioxidative activity. DWP and DWPP increase the relative abundance of Data curation, Li Luo; Formal analysis, Xiaojing Tian; Investigation, Li Song; Methodology, Zhongren Ma; Project administration and Resources, Fumei Zhang; Software and Writing\u2014original draft, Xueyan Zhou; All authors read and approved the final manuscript.The authors have no conflicts of interest to declare.Table S1Click here for additional data file."}
+{"text": "There is documented evidence of the increase of alcohol and substance use among college students globally. Increased morbidity and associated maladaptive socio-occupational outcomes of the habit with early dependence and mortality have also been reported. Majority of the substance use related studies conducted in low- and middle- income countries mainly look at health- related risk behaviour control mechanisms that focus on the social environment domain, with few or almost none focusing on those embedded within the person (self- control). This study focuses on the relationship between substance use and personality traits (in the self-control domain), among college students in a low- middle- income country.Design. A cross- sectional descriptive study that used the self- administered WHO Model Core and the Big Five Inventory Questionnaires to collect information among students in Colleges and Universities in Eldoret town, Kenya.Setting. Four  tertiary learning institutions were randomly selected for inclusion.Subjects. Four hundred students, 100 from each of the 4 institutions; selected through a stratified multi-stage random sampling, who gave consent to participate in the study. Associations between various variables, personality traits and substance use were tested using bivariate analysis, while the strength/ predictors of association with substance use was ascertained through multiple logistic regression analyses. A finding of p \u2264 0.05 was considered statistically significant.Catha edulis) (5%), tranquilizers 19 (4.8%), inhalants 18 (4.5%), cocaine 14 (3.5%), with heroin and opium at 10 (2.5%) each. Among the 13 participants who reported injecting drugs, 10 were female and only 3 were male; this finding was statistically significant (p = 0.042).The median age was 21 years , approximately half 203 (50.8%) were male, with majority 335 (83.8%) from an urban residence and only 28 (7%) gainfully employed. The lifetime prevalence of substance use was 41.5%, while that of alcohol use was 36%. For both, a higher mean neuroticism score  showed increased odds of lifetime use, while a higher mean agreeableness score  showed decreased odds of lifetime use. A higher mean age  of the students also showed an 8% increase in odds of lifetime alcohol use. The lifetime prevalence of cigarette use was 8.3%. Higher mean neuroticism  and openness to experience  scores showed increased odds of lifetime cigarette smoking, whereas being unemployed  had a decreased odd. Other substances reported included cannabis 28 (7%), sedatives 21 (5.2%), amphetamines 20 (The prevalence of substance use among college and university students in Eldoret is high and associated with high neuroticism and low agreeableness personality traits. We provide directions for future research that will examine and contribute to a deeper understanding of personality traits in terms of evidence- based approach to treatment. Data from research findings reveal relatively high prevalence rates of alcohol and substance use among college and university students in Kenya. For instance, a 2009 study  reportedOf note is that majority of the substance use studies \u20136 conducIncreasingly, evidence \u201323 has aThis study focuses on the relationship between substance use and personality traits (in the self-control domain), among college students in a low- middle- income country. The benefits\u2019 emanating from identifying these self- control mechanisms are twofold; on the one hand it would stimulate further research and provide evidence- based approach to prevention and management of substance use disorders; while on the other improve quality of life and overall outcome, including family and socio-occupational functioning, of those living with the habit.A cross- sectional descriptive study design involving the administration of two instruments was used. The study was carried out between October and November 2014.The study was carried out at four tertiary level institutions in Eldoret town, Uasin Gishu County; situated 320 km North West of Nairobi, the capital city of Kenya. The four learning institutions consisted of the Moi University Medical School town campus , offers Medicine, Dentistry, Nursing and Public Health degree courses; a private institution (Alphax College) offering degree, diploma and certificate courses (off Iten Road); and two government- run institutions; a National Polytechnic  that offers various technological training courses; and a Technical Training Institute , off Kaptagat Road, that offers courses at diploma and higher National diploma levels. These four institutions, with a total student population of 10,121, were selected from a sampling frame of all tertiary learning institutions in Eldoret Municipality through simple random sampling. We proceeded as follows. A serialized list of all the tertiary learning institutions in Eldoret Municipality was prepared. Each of the identifying number on the list was then copied onto small individual pieces of paper or tickets. All these tickets were then folded to conceal their content, placed in a bowl, and mixed thoroughly; four tickets were thereafter drawn at random out of the bowl. These represented the four institutions mentioned above.A sample size of 379 students was calculated using Fisher\u2019s formula with a confidence interval of 95% and the prevalence of personality disorders at 55.7%   self- administered Model Core Questionnaire  was usedThe Big Five Inventory (BFI) is the second instrument \u201328 used Approval Number: 00012823). After assurance of absolute confidentiality, questionnaires were given and administered to the selected participants and thereafter checked for completeness before they were collected upon completion. Written informed consent was obtained from all study participants.The Institutional Research and Ethics Committee at Moi Teaching and Referral Hospital and Moi University conducted ethical review of the study. Permission was also sought and granted from the Heads of the respective institutions  namely; Moi University College of Health Sciences (MUCHS), Eldoret National Polytechnic (ENP), Alphax College (AC), and Rift Valley Technical Training Institute (RVTTI), participated in the study. The median age was 21 years , approximately half 203 (50.8%) were male, with only 28 (7%) gainfully employed. As shown in Analysis to determine the distribution of sociodemographic data by the college attended was additionally done. Those participants from the CHS were significantly (p = 0.002) much younger than those from the other colleges who showed a skewed distribution; including slightly older participants. The median age for the participants from CHS  and AC  was 21 years, while that for those from RVTTI  and ENP  was 22 years. There were significantly (p = 0.02) more female (61%) participants than males at AC as compared to the other colleges; CHS (49%); RVTTI (48%); ENP (39%). Those from ENP had significantly  lower number of years of formal education; 13 years  as compared to the others; AC and RVTTI 14 years ; while CHS had 14 years . A third (33%) of the participants from RVTTI were from a rural residence, whereas 22%, 6%, and only 4% of the participants at ENP, AC, and CHS respectively, were from a rural residence. This relationship was statistically significant (p = 0.001).Personality traits among the participants in this study showed statistically significant differences with respect to gender and the college they attended. For instance, female participants had a statistically significantly (p < 0.001) higher mean score 34.68 (s. d. 6.59) in agreeableness trait as compared to their male 32.09 (s. d. 7.35) counterparts. Those from MUCHS attained statistically significantly (p = 0.005) higher mean conscientiousness scores 27.88 (s. d. 3.11) when compared to the mean scores from the other colleges. Participants from RVTTI showed a significantly (p < 0.001) higher mean agreeableness trait score, 36.11 (s. d. 7.31), and a significantly (p < 0.001) lower mean neuroticism trait score, 19.93 (s. d. 5.22), when compared to the mean scores attained by participants from the other colleges. There was no significant association between personality traits and any of the other sociodemographic variables. Among the participants in this study, 166 (41.5%) reported having used at least one substance in their entire lifetime. Those with low mean scores on neuroticism trait , high mean scores on agreeableness trait (p = 0.008), and those from the RVTTI college (p = 0.001) had statistically significantly lower lifetime use of any substance. Interestingly, a comparison of the mean personality trait scores between the different colleges also reveals statistically significant trait score differences (p < 0.001); those from RVTTI showed a much higher mean agreeableness and much lower mean neuroticism personality trait scores as compared to the scores from the other colleges.Among the 400 participants in this study, 144 (36%) reported lifetime alcohol use. There was no statistically significant variation of alcohol use with gender or any of the other socio-demographic variables. The median age of onset of drinking was 16  years, with the youngest age of onset of drinking being 7 years.A total of 33 (8.3%) out of the 400 participants in this study admitted to have smoked cigarettes or used any other tobacco at least once in their lifetime. The median age of first cigarette was 16  years, with the youngest age of onset being 8 years. There was no statistically significant variation of cigarette use with any of the socio-demographic variables.Catha edulis) 20 (5%), tranquilizers 19 (4.8%), inhalants 18 (4.5%), heroin and opium at 10 (2.5%) each, and cocaine 14 (3.5%). As shown in Other substances reported included cannabis 28 (7%), sedatives 21 (5.2%), amphetamines (One hundred and sixty-six participants in this study (41.5%) reported using at least one substance in their lifetime. As shown in One hundred and forty- four participants (36%) in this study reported lifetime alcohol use. As shown in Some of the predictors of cigarette smoking included being unemployed  which had a decreased odds in lifetime cigarette smoking of 77%, while a higher mean neuroticism personality trait score  and a higher mean openness to experience personality trait score  showed increased odd of lifetime cigarette smoking of 6% and 13% respectively. This study found a lifetime substance use prevalence rate 41.5%) which is similar to the rate found among high school students (41.5%) during the early nineties in Kenya , and muc.5% whichThis slow downward shift in prevalence trend is not only unique to the mentioned local studies as it was also observed by the National Authority for the Campaign Against Drug Abuse (NACADA) during their last two (2012 and 2017) Rapid Situation Assessments of Drugs and Substance Abuse in Kenya . The preThe college attended by the participants was the only sociodemographic variable significantly associated with lifetime substance use. Those from the RVTTI college had statistically significantly (p = 0.001) lower lifetime use of any substance, while being in MUCHS or ENP showed increased odds of lifetime substance use. The locations of both MUCHS and ENP can conceivably entertain suggestions that there\u2019s easy accessibility and availability of substances in the two colleges. Eldoret National Polytechnic is located in the neighborhood of the largest slum area (Langas) in Eldoret, that has many informal \u2018outlets\u2019 for selling and using substances. The MUCHS is similarly located within a 4-minute walking distance from the Central Business District in Eldoret town and may plausibly be predisposed to such experiences too. Almost half (44.6%) of the college students participating in a recent study  in a neiAlthough it was beyond the scope of this study to determine the enforcement and implementation of the different institutional alcohol and drug abuse policies, this could most probably vary and significantly affect or contribute to the differences observed in the odds of lifetime substance use among the colleges. Elsewhere, Otieno et al in a 2015 thesis  on impleStudents with a much higher neuroticism personality trait score showed increased odds of lifetime substance use while those with a much higher agreeableness personality trait score had decreased odds of lifetime substance use. Interestingly, those from RVTTI showed both protective aspects in their mean trait scores; a much higher agreeableness personality trait mean score and a much lower neuroticism personality trait mean score as compared to those from other colleges; as mentioned earlier students from RVTTI also showed statistically significantly lower lifetime substance use. Generally, research \u201316 has sNeuroticism is thought to be an internalizing tendency, that manifests as emotional instability coupled with restlessness. These individuals tend to lack the ability and resources to cope with life stressors, thereby increasing their vulnerability and the use of substances as a form of \u201cself- medication\u201d; to forget and escape it all. Agreeableness on the other hand is politeness and cooperativeness. There are vast resources that accompany this trait; including good stable relationships, a trusting and forgiving nature, reliable social support systems, easily available rescue systems that quickly step in to prevent unfavorable negative events or outcomes. Those with a high agreeableness trait will therefore cope very well and have no need for substances while navigating through life. However, the cross-sectional design of the current study does not support causal inference.In this study female participants showed a statistically significantly higher agreeableness personality trait as compared to their male counterparts. However, contrary to our expectation, there was no statistically significant difference in their pattern of using substances when compared to their male counterparts; as was evidently shown among the colleges. Perhaps experimentation with the need to be accepted or fit into a \u201csorority\u201d and appear fashionable, coupled with the decay of cultural etiquette among the females in this study could support this finding. In fact, more females as compared to males in this study  reported using cannabis though this difference was not statistically significant p = 0.386). As shown in 6. As shoThose from MUCHS also showed a statistically significantly higher mean conscientiousness trait score as compared to the others. Facets involved in determining the BFI conscientiousness domain score include; \u201cdoing a thorough job, reliable, not careless, organized, not lazy, efficient with perseverance until the task is finished, makes plans and follows through, and one that is not easily distracted\u201d. Some authorities \u201344 suppoThe prevalence rate of lifetime alcohol use in this study was 36%. This is similar to the rate (36.3%) found among Debre Berhan university students in neighboring Ethiopia  and sligIn this study, those from RVTTI had a decreased odds of lifetime alcohol use, while their counterparts from MUCHS and ENP had increased odds of lifetime alcohol use. Those with a higher mean neuroticism personality trait score and a lower mean agreeableness personality trait score also showed increased odds of lifetime alcohol use. A lower mean agreeableness personality trait score was similarly associated with lifetime alcohol use in the Nigerian study mentioned earlier . HoweverAdditionally, there was an increased odds in lifetime alcohol use among those with a higher mean age, raising the possibility that the rates of alcohol use increase with age. As expected in any society, including among the college student population, drinking alcohol is condoned among those who are much older. Of note too, was that the availability of financial resources appeared not to impact on lifetime alcohol use; as 50% of the gainfully employed had used, whereas 50% had equally never used alcohol. In this study, the median age at first alcoholic drink was 16 years, with the youngest reported age being 7 years; suggesting that the child might have been raised in a family or environment that used traditional African distilling and brewing methods as their means of earning a living. This early exposure is usually associated with an increased risk of dependence and other biological, psychological and social complications of the habit. Notable though was that there was no statistically significant difference between male and female students regarding their lifetime alcohol use. Like earlier mentioned, this trend suggests a shift and change in expectable cultural roles that may reflect the effects of urbanization and peer influence on alcohol use.The lifetime prevalence of cigarette smoking in this sample was 8.3%, which is much lower than what was reportedly found in similar settings , 33, 50.Despite the relatively low lifetime prevalence for the use of other substances in the current study, the findings are much higher than those found in an earlier study in the same locality . They arSome of the reasons given for substance use in an earlier study  among coThis is the first study in the east and central African region to provide epidemiological information on the relationship between personality traits and substance use. Apart from contextualizing the instruments used, the study also generates important information that is useful in implementation of policy, planning, and resource allocation regarding substance use in our country and in the region. The information obtained here is also very useful in informing future research.Among the limitations encountered in this study was the fact that we used self- administered questionnaires to collect the data that we have presented here. Some of the information, including that regarding substance use, was not validated using any other measures. However, these instruments have been used locally and elsewhere under similar circumstances, and as such the results are comparable to those found in similar studies.Another key limitation of this study, like mentioned earlier, is the study\u2019s cross- sectional design which precludes causal inference and generalizability. Of note too, is the heterogeneity of the institutions that participated in this study pointing to the need of a much larger study to fully describe the substance use pattern among college students in Kenya. However, the information generated from this study is very useful in informing future research.Information concerning \u201creasons for using substances\u201d, \u201coutcomes of using substances\u201d, and associated psychiatric disorder was also not collected in this study. This would have been invaluable in determining if there is an evidence- based relationship between personality traits and psychiatric disorders, reasons for use or complications of use. It would have further enabled comparison with findings from other settings.This study has demonstrated a high prevalence of substance use among college students in western Kenya. The most commonly used substances were alcohol, cigarettes and cannabis. It has also demonstrated a gravitation towards \u201chard\u201d (illicit) drugs among college and university students in this low- middle income country; highlighting the risk of severe dependence. Universities and other tertiary-level colleges should increase prevention and targeted interventions that incorporate student support services in order to reduce the associated stigma and improve the opportunities for care. Enculturation of the youth, and especially the girls, in traditional Kenyan values beginning in early childhood and continuing advocacy through mass media; including the internet, would have a sustained positive impact on their life skills. High neuroticism and openness to experience personality trait scores were shown to predisposed to substance use, whereas agreeableness personality trait was found to be protective; hence the need for a prospective study to ascertain pliability of these traits. As such, further research that will examine and contribute to a deeper understanding of personality traits is recommended in the future; and would also be important with regard to the development of evidence- based therapeutic interventions. Sadly, the age of onset of use of substances was reported to be as young as 7-years-old in this study. Health promotion and prevention programs on substance use should therefore begin as early as in lower primary and continue all the way to university, the workplace, and even routinely in community outreach services. This would ultimately lead to a customized interventional plan for those with alcohol and substance use disorders. Follow up studies on challenges in the implementation of institutional policies on alcohol and substance use would also be invaluable. Finally, there is an urgent need to increase the National Health budget allocation to Mental Health in Kenya to match the international median health financing of USD 2.04 per capita per year.S1 Data(CSV)Click here for additional data file. 29 Mar 2023 <div> PONE-D-23-03977 </div>  <div> PERSONALITY TRAITS AND SUBSTANCE USE AMONG COLLEGE STUDENTS IN ELDORET, KENYA. </div>  <div> PLOS ONEDear Dr. Kinyanjui,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by May 13 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0 </div> A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Violet Naanyu, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at\u00a0https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and\u00a0https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained . If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.http://journals.plos.org/plosone/s/data-availability.3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.\"Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter.4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.Additional Editor Comments:Thank you for a study that focusses on a very important matter. Consider the length of your manuscript and the methodological concerns expressed by reviewers. Consider additional biostatistics support/co-author and run (and report) the analyses in a flowing build up from univariate to multivariate analyses. Ensure all your recommendations directly emanate from the study results.Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0In the background, there is clearly a difference in prevalence of substance use disorders between public colleges and a private university, which are from two separate studies. Give explanations for two differing prevalence.In the background, substantiate or put into perspective the statement \u201cAs shown, these documented problems would clearly have a negative impact on the disability- adjusted life70 years (DALYs) of this cohort. What of these problems have a bearing on the disability or premature mortality component of the DALYs? Are the DALYs in this cohort known and will they be computed in this study, and if not are there available DALYs estimates from the literature.In the Background, This sentence needs rephrasing to refer to \u201cof substance use\u201d: \u201cOf note is that majority of the studies [1- 6] conducted locally mainly look at health- related risk behaviour control mechanisms that focus on the social environment domain\u2026.\u201dIn background, may need to expound on what different meanings and implications of \u201cdimensional approach (traits) personality\u201d as opposed to \u201ca categorical (disorders) assessment of personality.\u201dIt is not clear how understanding the relation between personality trait and substance use aids in \u201cimprove quality of life and overall outcome, including family and socio-occupational functioning, of those living with the habit.\u201dIn methods, while selection of four learning institutions of heterogeneous levels of learning and students helps accumulate the sample size easily it introduces some variability that may need to be addressed during the statistical analysis.In methods, stratified multi- stage random sampling, would mean that even the four institutions were being randomly preselected from many other institutions, followed by selection of 100 participants from each one of them. Reading your description, you settled on the four institutions without prior sampling from a list, similar to purposive selection, and so this may simply be described as \u201cStratified random sampling\u201d because sampling is only at the level of each institution.In methods, how is the World Health Organization (WHO) self- administered Model Core Questionnaire, different from Alcohol, Smoking and Substance Involvement Screening Test (ASSIST) and has it been tested for validation and reliability in Kenya? Please describe this in the methods if data is available.I would put the descriptions for the 5 OCEAN traits in the BFI, as by Sattler and Schunck in a table and refer to the table in the methods text, to cut down on word count.How is the BFI scored? Do you sum up the Likert ratings for each trait, and do you then sum total? Do you have a way of generating discrete categories from these scores? These details are not provided in the methods.The section referred to as procedures should be something like \u201cEthics approval\u201d and move the timeline for the study up to where the design was described.In the sociodemographic table, how do these characteristics differ across the recruiting sites.The variability in the prevalence of substance use across the recruiting institutions reported in the results may related to the sociodemographic factors above. This is worth exploration and accounting for in the analysis.The reporting of the results is all mixed or all over the place and needs to follow some sequence, eg what are the study characteristics of the participants; do these characteristics differ according to sites/instructions, what is the prevalence of substance use and of do personality traits, does this prevalence differ by site and by sociodemographic characteristics. Is there an association between substance use and traits of personality disorders; do these associations remain significant after accounting for site heterogeneity and sociodemographic factors.In the discussion, the lower rates of substance use are attributed to national initiatives to control substance use, but is it possible this could also be due to methodological differences including different settings. It is obviously difficult to establish if the control initiatives worked in the case of your study.I expect that the discussion should change a bit following the suggested analysis approach and presentation of results.The discussion is also too long and will need to be shorted a bit.The author list is too short for a quantitative analysis that involved data collection etc. Have the authors read the ICMJE criteria to be sure that no eligible investigators who meets the authorship criteria was left out.Reviewer #2:\u00a0The manuscript is well written, though in the abstract line 40 to 41 and 43 to 44 need to be supported with values of the adjusted odds ratios.Recommendation on line 52 to 53 is not based on current study findings. The author should focus on recommendations based on the personality traits.On line 84 till 86 it would be good to explain further on the flexibility and malleability of the personality traits based on previous studies.Sentence 88 to 90 is unnecessaryIn the methods section a general understanding of the different tertiary institutions as regards courses undertaken would shed more light on diversity of the population.In the discussion section: Line 294 to 295 The Alphax college is not discussed much. Line 318 to 325 seems a repetition. It would be more helpful to discuss on why high agreeableness is protective and vice versa for high neuroticism.Recommendations in line 458 to 462 do not emanate from the current study findings. You may need to rephrase and mention follow-up studies that look into institutional policies on substance abuse. Finally, which interventional plans are you proposing to be implementedReviewer #3:\u00a0The article presents valuable information, on association of personality traits and substance use. Below are my suggestions on how the manuscript can be improved.AbstractThe authors can try to summarize to make it shorter, especially the background.Line 41- \u2018\u2026..showed increased odds of lifetime use- not clear lifetime use of whichsubstancein the conclusion- change the words \u2018drug abuse\u2019 to substance use for uniformity.IntroductionThe last two paragraphs can be combined to one, since they present information that is related.Also, can leave out the author name for the different citation, since it is already captured in the citation which does not require mention of authors names.MethodsThe subsection on design can come first at the top of the section.The section labelled design better fits as \u2013 outcome measurements/ data collection tools. To first mention and describe the outcome, then describe the data collection tool used.In the subsection labelled procedure, 6o separate the ethics statement so that it appears as a separate subsection.Then provide more details on the procedure sufficient enough for the reader to understand and allow replicability of the study.ResultsI suggest to first present the descriptive statistics, then results for the bivariate/ multiple regression analysis. This makes it easier for the reader to follow eg first sees the prevalence/ distribution of use then the associations of substance use with the various factors assessed.Summarize the information in the narrative to highlight major findings and the refer to the table for more details. Avoid repenting a lot of what is already presented in the tables.DiscussionOverall the discussion can be made shorter.In the first paragraph summarize the major findings with regards to the study objectives.There is the mention of college being more statistically associated with substance use. There is need to explain what this means in terms of specific interventions that can be put in place eg inform policy on treatment/prevention strategies.Paragraph with lines 296-308: as the authors state, this is not within study objectives, hence should be excluded. If to include, the authors need to incorporate it with specific findings in the study eg data presented in the previous paragraph that talks about difference in locations.Paragraph with lines 309-317: this paragraph appears not to be linked with any specific study findings. If related to the previous paragraph, it can be combined so that they appear as one paragraph. If not, expand on the discussion on the next paragraph beginning at line 318-326. Also, the authors can expound more on the application of the significance factor with regards to one college -RVTTI- how can this information be applied to improve substance use treatment or prevention strategies among the study population?In the paragraph beginning line 352- provide more details on the application/relevance of this finding in the study setting.Paragraph beginning line 418-428: this paragraph gives details of findings from a previous study. the authors need to explain how this is related to the current study.********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0NoReviewer #3:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 20 Apr 2023Response to ReviewersWe thank the editor for taking time to review our manuscript; and for making constructive comments and suggestions on how the manuscript can be improved. We have revised the manuscript to address the concerns raised, and below is a point-by-point response to the comments.A. Editor\u2019s reviewJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf-This has been done2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained . If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.-This has been done and highlighted, line 183-184.-Our study did not include minorsIf you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.-We are not reporting a retrospective studyhttp://journals.plos.org/plosone/s/data-availability.3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.\"Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see -Our study\u2019s minimal underlying data set has been uploaded as supporting information fileshttp://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter.4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.-Our study\u2019s minimal underlying data set has been uploaded as supporting information filesAdditional Editor Comments:Thank you for a study that focusses on a very important matter. Consider the length of your manuscript and the methodological concerns expressed by reviewers. Consider additional biostatistics support/co-author and run (and report) the analyses in a flowing build up from univariate to multivariate analyses. Ensure all your recommendations directly emanate from the study results.- We have put this into considerationB. Reviewers1. We thank the reviewer for taking time to review our manuscript; and for making constructive comments and suggestions on how the manuscript can be improved. We have revised the manuscript to address the concerns raised by the reviewer, and below is a highlighted point-by-point response to the comments.Reviewer #1: In the background, there is clearly a difference in prevalence of substance use disorders between public colleges and a private university, which are from two separate studies. Give explanations for two differing prevalence.-Differences between the geographical locations, time- lines and settings, possible changes in legislation over time that may influence behaviour, methodology used, and the accompanying vulnerabilities and opportunities could plausibly account for the differing prevalence. This has been highlighted, lines 62-64In the background, substantiate or put into perspective the statement \u201cAs shown, these documented problems would clearly have a negative impact on the disability- adjusted life70 years (DALYs) of this cohort. What of these problems have a bearing on the disability or premature mortality component of the DALYs? Are the DALYs in this cohort known and will they be computed in this study, and if not are there available DALYs estimates from the literature.-This has been corrected and highlighted, line 73-78- We have added the DALYS for this cohort and a reference too, line 75-78; 558- 560In the Background, This sentence needs rephrasing to refer to \u201cof substance use\u201d: \u201cOf note is that majority of the studies [1- 6] conducted locally mainly look at health- related risk behaviour control mechanisms that focus on the social environment domain\u2026.\u201d-This has been corrected and highlighted, line 79In background, may need to expound on what different meanings and implications of \u201cdimensional approach (traits) personality\u201d as opposed to \u201ca categorical (disorders) assessment of personality.\u201d- This has aptly been done in the ensuing section and highlighted, line 84-85; 88-91It is not clear how understanding the relation between personality trait and substance use aids in \u201cimprove quality of life and overall outcome, including family and socio-occupational functioning, of those living with the habit.\u201d-This emanates from the successful implementation of the first benefit. It is hoped and entirely conceivable that in the near future there might/ will be innovative and successful ways of approaching and managing these malleable personality traits. The first benefit is therefore to the scientific community, whereas the second is to the patient, their kin, and invariably their ability to function.In methods, while selection of four learning institutions of heterogeneous levels of learning and students helps accumulate the sample size easily it introduces some variability that may need to be addressed during the statistical analysis.- It would be important to also mention that it was not possible to compare the students by their various socio- demographic variables prior to selection for inclusion into the study; that information about student populations in the various institutions in Eldoret is not available in the public domain.-However, the variability has been addressed as suggested and various significant findings by recruiting site/ college have been reported after analysis with the possible implications in terms of interventions, policy, etc., mentioned too. In methods, stratified multi- stage random sampling, would mean that even the four institutions were being randomly preselected from many other institutions, followed by selection of 100 participants from each one of them. Reading your description, you settled on the four institutions without prior sampling from a list, similar to purposive selection, and so this may simply be described as \u201cStratified random sampling\u201d because sampling is only at the level of each institution.- The four institutions were randomly selected from a list of all 29 similar tertiary level institutions in Eldoret Municipality at the time. This was stated, expounded and highlighted, line 133-138.In methods, how is the World Health Organization (WHO) self- administered Model Core Questionnaire, different from Alcohol, Smoking and Substance Involvement Screening Test (ASSIST) and has it been tested for validation and reliability in Kenya? Please describe this in the methods if data is available.-We have been unable to find a way of mentioning ASSIST in the context of the current study\u2019s methodology and manuscript since the WHO self-administered Model Core questionnaire was the instrument that we used in collecting the data. We also are of the opinion that a comparison of the two WHO instruments and aligning them to the current manuscript may also be beyond the scope of this study.- Regarding the testing for validity and reliability in Kenya; this data was not available. However, the WHO Model Core Questionnaire has been used severally in the same locality. In fact, an earlier study that was carried-out in the same setting and has repeatedly appeared in various sections (literature/ methodology/ discussion) of this manuscript used the WHO Model Core Questionnaire. It maintains and provides a better chance for comparability in substance use research. The published local studies that used the same questionnaire have also been cited and highlighted, lines 161-163I would put the descriptions for the 5 OCEAN traits in the BFI, as by Sattler and Schunck in a table and refer to the table in the methods text, to cut down on word count.-This has been corrected and highlighted, line 176How is the BFI scored? Do you sum up the Likert ratings for each trait, and do you then sum total? Do you have a way of generating discrete categories from these scores? These details are not provided in the methods.-This has been corrected in the methods and highlighted, lines 167-170The section referred to as procedures should be something like \u201cEthics approval\u201d and move the timeline for the study up to where the design was described.-This has been corrected and highlighted, lines 177; 122In the sociodemographic table, how do these characteristics differ across the recruiting sites.-The analysis of the sociodemographic characteristics by the colleges/ recruiting sites has been performed and results included and highlighted, lines 203-214The variability in the prevalence of substance use across the recruiting institutions reported in the results may related to the sociodemographic factors above. This is worth exploration and accounting for in the analysis.- This has been done throughout the results sectionThe reporting of the results is all mixed or all over the place and needs to follow some sequence, eg what are the study characteristics of the participants; do these characteristics differ according to sites/instructions, what is the prevalence of substance use and of do personality traits, does this prevalence differ by site and by sociodemographic characteristics. Is there an association between substance use and traits of personality disorders; do these associations remain significant after accounting for site heterogeneity and sociodemographic factors.-This has been corrected and presented in the suggested format, lines 193- 289In the discussion, the lower rates of substance use are attributed to national initiatives to control substance use, but is it possible this could also be due to methodological differences including different settings. It is obviously difficult to establish if the control initiatives worked in the case of your study.- That and similar other possibilities have been addressed, mentioned and the corrections highlighted, lines 310- 312I expect that the discussion should change a bit following the suggested analysis approach and presentation of results.- The discussion largely involves the association of the recruiting sites and other statistically significant factors with the main outcome measures e.g., lines 473-475The discussion is also too long and will need to be shorted a bit.- Having completely overhauled the results section as suggested and with the corrections in the discussion section, there appears to be a good flow that covers the study findings. As such, we might not be able to shorten this section further.The author list is too short for a quantitative analysis that involved data collection etc. Have the authors read the ICMJE criteria to be sure that no eligible investigators who meets the authorship criteria was left out.-The authors have read the ICMJE criteria and are certain that no eligible investigators that fulfill the authorship criteria have been left out.2. We thank the reviewer for taking time to review our manuscript; and for making constructive comments and suggestions on how the manuscript can be improved. We have revised the manuscript to address the concerns raised by the reviewer, and below is a highlighted point-by-point response to the comments.Reviewer #2: The manuscript is well written, though in the abstract line 40 to 41 and 43 to 44 need to be supported with values of the adjusted odds ratios. -This has been corrected and highlighted, lines 39- 42Recommendation on line 52 to 53 is not based on current study findings. The author should focus on recommendations based on the personality traits.-This has been corrected and highlighted, lines 55- 56On line 84 till 86 it would be good to explain further on the flexibility and malleability of the personality traits based on previous studies.-This has been done with changes effected in both the explanation as well as the references; that section has been re-done with explanations based on previous studies, as instructed. This is highlighted in lines 95- 112; 591- 613Sentence 88 to 90 is unnecessary-The sentence... \u201cIt also incorporates the use of a dimensional approach (traits) as opposed to a categorical (disorders) assessment of personality\u201d \u2026... has been excluded. In the methods section a general understanding of the different tertiary institutions as regards courses undertaken would shed more light on diversity of the population.-This information has been included in the methods section and highlighted, lines 127- 131 In the discussion section: Line 294 to 295 The Alphax college is not discussed much. Line 318 to 325 seems a repetition. It would be more helpful to discuss on why high agreeableness is protective and vice versa for high neuroticism.-Being in Alphax college seems to have had no predictive effect on the use of substances and this has been mentioned and highlighted in line 346- As suggested, line 318 to 325 have been removed and replaced with a discussion on the effects of neuroticism and agreeableness and how they may lead to the use of substances. This has been corrected and highlighted, lines 373-381Recommendations in line 458 to 462 do not emanate from the current study findings. You may need to rephrase and mention follow-up studies that look into institutional policies on substance abuse. Finally, which interventional plans are you proposing to be implemented. -We have rephrased to reflect follow- up studies instead; highlighted, line 533- 535-This has been corrected; recommendations are now in-line with the study findings; proposed interventional plans have also been included and highlighted, lines 519- 523; 526- 532 3. We thank the reviewer for taking time to review our manuscript; and for making constructive comments and suggestions on how the manuscript can be improved. We have revised the manuscript to address the concerns raised by the reviewer, and below is a highlighted point-by-point response to the comments.3. Reviewer #3: The article presents valuable information, on association of personality traits and substance use. Below are my suggestions on how the manuscript can be improved.AbstractThe authors can try to summarize to make it shorter, especially the background.- The last sentence in the background has been excluded and the conclusion is shorter too.Line 41- \u2018\u2026..showed increased odds of lifetime use- not clear lifetime use of whichsubstance-Line 41 has been corrected and is clearer now with the addition of the AOR; indicating that it is both substance use and alcohol use in the conclusion- change the words \u2018drug abuse\u2019 to substance use for uniformity.-The conclusion has been changed and no longer uses the phrase \u2018drug abuse\u2019IntroductionThe last two paragraphs can be combined to one, since they present information that is related.Also, can leave out the author name for the different citation, since it is already captured in the citation which does not require mention of authors names.- The last two paragraphs in the introduction have been combined to one and highlighted, lines 113- 118- The author names for the different citations have been left out MethodsThe subsection on design can come first at the top of the section.- This has been corrected and the design subsection appears first in the methods section and is highlighted, line 120The section labelled design better fits as \u2013 outcome measurements/ data collection tools. To first mention and describe the outcome, then describe the data collection tool used.-This has been corrected as instructed and is highlighted, lines 148 and 154In the subsection labelled procedure, 6o separate the ethics statement so that it appears as a separate subsection.-This has been corrected and highlighted, line 177Then provide more details on the procedure sufficient enough for the reader to understand and allow replicability of the study.-This has been done; with more details especially on the sampling procedure used, that have been included towards the end of the site section and this has been highlighted, lines 134-138ResultsI suggest to first present the descriptive statistics, then results for the bivariate/ multiple regression analysis. This makes it easier for the reader to follow eg first sees the prevalence/ distribution of use then the associations of substance use with the various factors assessed.Summarize the information in the narrative to highlight major findings and the refer to the table for more details. Avoid repenting a lot of what is already presented in the tables.-This has been done in the results section, lines 193- 289DiscussionOverall the discussion can be made shorter.- Having completely overhauled the results section as suggested and with the corrections in the discussion section, there appears to be a good flow that covers the study findings. As such, we might not be able to shorten this section further.In the first paragraph summarize the major findings with regards to the study objectives.- This may entail an additional paragraph at the beginning of the discussion to summarize the major findings. However, there appears to be a good flow of ideas in the manner this section is presented now; following the changes effected in the results section. Additionally, there are requests to shorten the discussion section. There is the mention of college being more statistically associated with substance use. There is need to explain what this means in terms of specific interventions that can be put in place eg inform policy on treatment/prevention strategies.-This has been done and highlighted, lines 344- 348Paragraph with lines 296-308: as the authors state, this is not within study objectives, hence should be excluded. If to include, the authors need to incorporate it with specific findings in the study eg data presented in the previous paragraph that talks about difference in locations.-This is a very important paragraph that has a bearing on national as well as local strategies for prevention, including policy implications. The authors had incorporated it with the study findings through the statement\u2026 \u2018this could most probably vary and significantly affect or contribute to the differences observed in the odds of lifetime substance use among the colleges\u2019 This has been highlighted, lines 350-352Paragraph with lines 309-317: this paragraph appears not to be linked with any specific study findings. If related to the previous paragraph, it can be combined so that they appear as one paragraph. If not, expand on the discussion on the next paragraph beginning at line 318-326.-This paragraph is actually complete and compares the current study findings with others elsewhere in the world; and they appear to seemingly concur. This has been highlighted, lines 369-372Also, the authors can expound more on the application of the significance factor with regards to one college -RVTTI- how can this information be applied to improve substance use treatment or prevention strategies among the study population?-This has been expounded on and highlighted, lines 344-348; 519-523 In the paragraph beginning line 352- provide more details on the application/relevance of this finding in the study setting.-The relevance and applicability of the finding reported in line 352 has been discussed in lines 414- 417Paragraph beginning line 418-428: this paragraph gives details of findings from a previous study. the authors need to explain how this is related to the current study.-From the preceding paragraph that talks about a global village concept and borrowing from other studies elsewhere regarding where to easily find and interact with this age group, we are suggesting telemedicine/ teletherapy as a possible and appropriate mode of intervention in this cohort.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 10 May 2023PERSONALITY TRAITS AND SUBSTANCE USE AMONG COLLEGE STUDENTS IN ELDORET, KENYA.PONE-D-23-03977R1Dear Dr. Kinyanjui,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Violet Naanyu, PhDAcademic EditorPLOS ONEReviewers' comments:All your revisions are well noted and appreciated.Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The explanations and responses given by the authors are satisfactory. I checked that the revisions have also been made in the revised manuscript.Reviewer #2:\u00a0(No Response)Reviewer #3:\u00a0The authors have addressed all questions previously raised and manuscript formatting meets the journal specifications.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0NoReviewer #3:\u00a0No********** 15 May 2023PONE-D-23-03977R1 Personality traits and substance use among college students in Eldoret, Kenya. Dear Dr. Kinyanjui:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProf. Violet Naanyu Academic EditorPLOS ONE"}
+{"text": "Aim: To identify the pyroptosis-related long non-coding RNAs (lncRNAs) in ovarian cancer and construct a prognostic signature based on them.Methods: Expression data from TCGA was used to explore differentially expressed pyroptosis-related lncRNAs in ovarian cancer. A risk signature was established by LASSO and cox regression analysis and then validated. Databases such as ESTIMATE, CIBERSORT, TIMER, XCELL were used to identify the relation between this signature and the immune microenvironment of ovarian cancer. Gene Set Enrichment Analysis was introduced to identify the pathways and functions that the signature may participate in. Based on miRcode and starBase databases, microRNAs related to the lncRNAs in our signature and the positively co-expressed pyroptosis- related genes were screened and a competing endogenous RNA (ceRNA) network was then constructed. Quantitative reverse transcription PCR was conducted to validate the expression levels of two lncRNAs in this ceRNA network.Results: A 13 pyroptosis-related lncRNA prognostic signature  was constructed. Patients in high-risk group had a significantly worse prognosis than that of low-risk (P<0.0001). Immune infiltration analysis found that patients identified as high-risk had a higher infiltration of macrophages and tumor-associated fibroblasts. Further pathway analysis revealed that the signature may be involved in epithelial mesenchymal transition, extracellular matrix receptor interaction, and focal adhesion. Finally, a competitive endogenous inhibition relationship was discovered between LINC01094, KRT7-AS, MYCNOS, ZNF32-AS2, AC012236.1 and pyroptosis- related genes such as IRF1, NOD1, GSDMC, NLRP1, PLCG1, GSDME and GZMB, in which LINC01094 and KRT7-AS were found to be overexpressed in three ovarian cancer cell lines.Conclusion: We constructed a pyroptosis-related lncRNA signature and correlate it to the immune microenvironment. A ceRNA regulatory network related to pyroptosis was also constructed, which provides novel insights useful for the study of pyroptosis in ovarian cancer. Ovarian cancer is the deadliest gynecological malignancy Pyroptosis, also known as inflammatory necrosis, is a type of programmed cell death. It is a special way of death induced in macrophages, neutrophils, and other phagocytes when the body is fighting against a pathogenic invasion Long non-coding RNA (lncRNA) is a kind of non-coding transcript with more than 200 nucleotides. Although lncRNAs cannot be directly translated into proteins, they can affect gene expression by affecting DNA replication, transcriptional regulation, and post-transcriptional regulation, thus play an unignorable regulatory role in various life activities of cells Therefore, we use the ovarian cancer data in TCGA to comprehensively analyze the lncRNAs related to pyroptosis in this research. After prognostic analysis, emerging prognostic markers and potential therapeutic targets related to pyroptosis were obtained, and a prognostic signature with clinical application value was constructed. In addition, we also explored the potential pathways of pyroptosis-related lncRNAs in ovarian cancer and the ceRNA network that interacts with them, providing a basis for elucidating the molecular mechanism of pyroptosis in ovarian cancer. In addition, real time quantitative PCR (rt-qPCR) was applied to verify the expression levels of two lncRNAs between three ovarian cancer cell lines and one normal ovarian cell lines. Figure https://portal.gdc.cancer.gov). Among them, 379 samples had complete Clinical information. We have obtained the gene expression data (RNAseq-TOIL RSEM expected counts) of 88 normal ovarian tissues in the Genotype-Tissue Expression (GTEX) database from UCSC Xena website (https://xenabrowser.net). The \"normalizeBetweenArrays\" package of R was used to normalize the data from TCGA and GTEX, and then merge the data for subsequent difference analysis. The RNAseq data included both mRNA and lncRNA transcriptome data and the Ensembl human genome browser GRCh38.p13 (http://asia.ensembl.org/index.html) was introduced to distinguish them.We downloaded the transcriptome expression data  of 427 patients with ovarian cancer from The Cancer Genome Atlas database  were obtained from existing studies An R package named \"clusterProfiler\" was applied to conduct Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis on 29 PRGs. The enrichment results with P-value<0.05 and q-value<0.05 were considered to be statistically significant and visualized with the \"ggplot\" and \"GOplot\" R package packages.First, the univariate Cox regression analysis was performed to identify pyroptosis-related lncRNAs that are significantly associated with the overall survival of ovarian cancer patients (P<0.05). Next, we grouped the ovarian cancer samples with complete clinical information in the TCGA into two groups. After deleting five duplicate samples of ovarian cancer patients, we separated the remaining 374 samples into a training group (n= 225) and a testing group (n=149) at a ratio of 6:4. In the training group, we used the \"glmnet\" R package to conduct LASSO analysis on 34 prognostic-related lncRNAs, and further screened and removed them based on the best penalty factor (\u03bb). Finally, through stepwise multivariate Cox regression analysis, we conducted a final screening of these lncRNAs and established a risk signature consisting of 13 LncRNAs. The risk score for each patient was assessed according to the following calculation formula:In the above formula, n indicates the number of lncRNAs in the signature, \u03b2 indicates the coefficient of each lncRNA, and EXP indicates the detected expression level of each lncRNA. Patients in the training and testing cohorts were divided into high- and low-risk groups based on the median risk score. The overall survival rates of the high- and low-risk groups was compared by log-rank test of Kaplan-Meier analysis. The value of risk scores for predicting 1-, 3-, 5-, and 10-year survival in ovarian cancer patients was analyzed using time-dependent ROC curves by the \"survivalROC\" package.To assess whether risk score can be used as an independent risk factor for predicting prognosis in patients with ovarian cancer, we performed univariate and multivariate cox regression analyses using \u201cSurvival\u201d and \u201cSurvMiner\u201d R packages for risk score, age, FIGO stage, grade of differentiation, tumor residue, and race in the training and testing groups. Using the \"survivalROC\" package, a time-dependent ROC curve was used to compare the predictive value of risk score against patient age, FIGO stage, pathological grade, and tumor residual for 1 -, 3 -, 5 -, and 10-year survival.To better apply the risk score to the clinic, we used the \"survival\" and \"regplot\" packages to draw a nomogram in the overall cohort based on risk score, age, FIGO stage, differentiation grade, and tumor residual status. The calibration curve was used to assess the agreement between the predicted overall survival and the actual one. Using the \"rms\" and \"rmda\" packages, we also conducted decision curve analysis (DCA) to compare the effectiveness of nomogram and risk score and other individual clinicopathological indicators in predicting patient prognosis.http://timer.comp-genomics.org) website, we downloaded the infiltration scores of various immune cells in the samples from TCGA database calculated by seven platforms including TIMER, CIBERSORT, Cibersort-ABS, QUANTISEQ, MCPCOUNTER, XCELL and EPIC. In addition, we used single-sample gene set enrichment analysis (ssGSEA) to assess the different immune function scores of each sample in TCGA-OV Using the \"ESTIMATE\" R package, we calculated the immune score and stromal score of each sample in TCGA-OV based on the expression profile data, and the sum of the two is the ESTIMATE total score. Finally, the tumor purity of each sample was assessed based on the above scores, that is, the higher the immune and stromal score, the lower the tumor purity https://www.gsea-msigdb.org/gsea/msigdb/index.jsp). Using GSEA software (version 4.0.3), the expression profiles of the high and low risk groups were compared with the two gene sets respectively, and the related HALLMARK and KEGG pathways related to the prognosis signature were analyzed. The number of random sample permutations was set to 1000. Using P<0.05 and FDR-q<0.25 as criteria, the pathways significantly associated with the high-risk group and the low-risk group were screened out, respectively.We obtained Hallmark gene sets (hav7.4.symbols.gmt) and KEGG gene sets (c2.cp.kegg.v7.4.symbols.gmt) from the Molecular Signatures Database  and starBase  websites, miRNAs that interacted with lncRNA and PRGs were screened and compared to identify miRNAs that interacted with both lncRNA and PRGs. Finally, Cytoscape (Version 3.7.2) was introduced to visualize the ceRNA network. Among them, miRcode is a comprehensive website for deducing mircoRNA target sites in the complete GENCODE annotated transcriptome. It is mainly used to predict the interaction between lncRNA and microRNA, which contains 10419 lncRNAs We first used Pearson's r\u22650.2, P<0.05 as the threshold to identify PRGs that were significantly positively related to each lncRNA in the signature. In miRcode  and its concentration was detected by NanoDrop Lite spectrophotometer (Termo Scientifc). Total RNA was reverse transcribed using the PrimeScript\u2122 RT Reagent Kit  for synthesis of cDNA. SYBR Green\u2122 Premix Ex Taq\u2122 II  was used to amplify the samples on a real-time fluorescent quantitative PCR machine . Each reaction well was provided with three different wells. The melting curve was used to determine the specificity of the primer. Using GAPDH as an internal reference, the relative expression level was calculated using the 2-\u25b3\u25b3Ct method. The primers of lncRNA and GAPDH are as follows: KRT7-AS-Forward: 5'-TCCAACGCCTATGTTCCAGTTC-3', KRT7-AS-Reverse: 5'-ACATTGTGCCACGGACATCTTG-3'; LINC01094-Forward: 5'-AATCCCAGTTGCTCTTCCAGTCATC-3', LINC01094-Reverse: 5'-CAGTGTTGTCCTCAGTTGCTCTCC-3'; GAPDH-Forward: 5'-GCACCGTCAAGGCTGAGAAC-3', GAPDH-Reverse: 5'-TGGTGAAGACGCCAGTGGA-3'.The ovarian cancer cell line  and normal ovarian cell line HOSEpiC were obtained from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences . 10% fetal bovine serum  and 90% medium were prepared into complete medium for cell culture, among which OVCA3 and SKOV3 cell lines were cultured in RPMI 1640 medium , while ES2 and HOSEPIC cell lines were cultured in McCoy's 5A medium . The cells were incubated at 37 \u00b0C, 5% COAll statistical analysis and visualization of results were conducted using R software (version 3.6.1), and p<0.05 or 0.01 was defined as statistically significant. Chi-square test was used to analyze count data, and Wilcox test was used to analyze measurement data. The Kaplan-Meier curve was used for survival analysis, and the log-rank method was applied to compare survival between the two groups. Cox regression model was used for univariate and multivariate analysis.Using the transcriptome database of TCGA-OV, we identified 1122 lncRNAs that were significantly related to the expression of 52 PRGs with the absolute value of R\u22650.30 and P<0.05 as the threshold. The correlation between these lncRNAs and PRGs is shown in Next, we analyzed the differential expression of 52 PRGs, using absolute value of logFC \u2265 1, FDR <0.05 as the threshold, and found 29 genes that are dysregulated between ovarian cancer and normal ovarian tissues. These include nine genes with significantly lower expression in ovarian cancer and 20 genes with higher expression in ovarian cancer . Figure We performed KEGG and GO enrichment analysis on 29 differentially expressed PRGs in ovarian cancer, with q-value\u22640.05 as the threshold, and found that these genes were mainly enriched in apoptosis, NOD-like receptor signaling pathway, platinum drug resistance, and p53 signaling pathway.  + (-0.176696*EXPAL161772.1) + (-0.1364156*EXPUSP30-AS1) + (0.495127*EXPMIR223HG) + (-0.400991*EXPANF32-AS2) + (-0.536123*EXPAC068733.3) + (0.052420*EXPKRT7-AS) + (-0.187234*EXPAC012236.1) + (0.369327*EXPPTPRD-AS1) + (-0.492214*EXPAC015802.5) + (0.099398*EXPLINC01094) + (-0.152476*EXPKIAA1671-AS1) + (-0.491793*EXPAC013403.2).Among the 225 samples in the training group, we conducted LASSO regression analysis on 34 prognostic-related lncRNAs, and selected 22 lncRNAs to be included in the subsequent stepwise multivariate cox regression analysis , FIGO Stage , Grade , Race  and Residual tumor  and then performed kaplan-Meier survival analysis in each group based on risk scores. In addition to Stage I , Other/Unknown Race , tumor residual 11-10 mm  these three groups, the pyroptosis related signature can distinguish the overall survival of patients according to the risk scores  regulatory network. The ceRNA regulatory network has been proven by many studies to play an important role in a variety of tumors. The theoretical basis is that certain mRNA and lncRNA in the cell have the same miRNA response element, and a competitive relationship can be formed between the two. Since miRNA has a negative regulatory effect on the expression of its target genes, the expression of a pair of competitive mRNA and lncRNA with the same miRNA response element is positively correlated. The process of constructing a ceRNA regulatory network related to pyroptosis in ovarian cancer is shown in Figure Next, we conducted preliminary rt-qPCR verification on two poor prognosis-related lncRNAs in this ceRNA network. The results indicated that compared with the normal ovarian cell line HOSEPIC, the expression of LINC01094 in the three ovarian cancer cell lines was significantly upregulated Figure E, P<0.05Pyroptosis was originally found in pathogen-infected mouse macrophages and monocytes In this work, we identified 29 PRGs with dysregulated expression level between ovarian cancer and normal ovarian tissues. In the gasdermin family, GSDMA  and GSDMC  was significantly overexpressed in ovarian cancer, while the expression of GSDMD  and GSDME  was significantly lower in ovarian cancer . At presNext, we screened the lncRNAs related to pyroptosis and performed prognostic analysis on the differentially expressed ones. After further screening by LASSO and multivariate cox stepwise regression analysis, 13 lncRNAs were included in the final signature construction, including four ovarian cancer prognostic risk lncRNAs , and 9 prognostic protection lncRNAs . MIR223HG is also known as LINC223. Studies have found that its expression in acute myeloid leukemia is significantly down-regulated and has the function of inhibiting cell cycle progression and promoting the transformation of acute myeloid leukemia cells into monocytes +T cells, which belong to anti-tumor immune cells Tumor microenvironment (TME) is a complex environment for the survival and development of tumor cells. It is mainly formed of surrounding immune cells, inflammatory cells, fibroblasts, stromal cells and microvessels, which play a role in assisting the occurrence, growth and metastasis of tumor. Our analysis found that the risk score of TCGA ovarian cancer samples was significantly positively associated with immune score and Stromal score, while significantly negatively correlated with tumor purity, indicating that the prognostic signature was involved in the tumor microenvironment of ovarian cancer. As a kind of inflammatory cell death, pyroptosis is the main mechanism of body defense. Cells will release a large amount of IL-18 and IL-1\u03b2 when pyroptosis occurs, so it is essential for bridging innate immunity and adaptive immunity In addition, existing studies have shown that pyroptosis-related molecules are related to a variety of immunomodulatory effects, and the inflammatory factors IL1\u03b2 The ceRNA hypothesis was first proposed by Leonardo Salmena in 2011. It posits that competitive endogenous RNA (ceRNA) existing in cells can competitively bind to the same miRNAs through the same microRNA response elements (MRE), thus regulating each other's expression levels In this study, 34 pyroptosis related lncRNAs that have an impact on the prognosis of ovarian cancer patients were identified through comprehensive analysis of TCGA database. The prognostic signature constructed using 13 pyroptosis related lncRNAs can not only accurately predict the survival of ovarian cancer patients but also is related to the high infiltration of macrophages and tumor-associated fibroblasts in ovarian cancer. In further analysis of the mechanism, we found that the signature may be related to the metastasis of ovarian cancer, and a pyroptosis related ceRNA network provides a basis for subsequent experimental studies. LNC01094 and KRT7-AS were observed to be overexpressed in ovarian cancer cell lines.Supplementary figure and table legends.Click here for additional data file.Supplementary tables.Click here for additional data file."}
+{"text": "Various analytical techniques were utilized to evaluate the effectiveness of these modifications. Design expert software and response surface methodology (RSM) was employed for data analysis and operational variable optimization, leading to improved CO2 adsorption performance of the modified zeolites. The adsorption capacity of the modified zeolites was assessed under different temperatures, pressures, and amine concentrations using a test device. The\u00a0optimal adsorption capacity of 4A-DEA adsorbent is found to be 579.468\u00a0mg/g, with the optimal operational variables including a temperature of 25.270\u00a0\u00b0C, pressure of 8.870\u00a0bar, and amine concentration of 11.112\u00a0wt%. The analysis shows that the adsorption process involves both physisorption and chemisorption, and the best kinetic model is the fractional-factor model.This study focuses on optimizing the CO By 2100, it could increase to 26 billion tons per year. This forecast has consequently emphasized the importance of prioritizing the capture and adsorption of CO2 from an environmental perspective1. The ongoing release of CO2 into the atmosphere has resulted in long-term changes in the global climate, including rising temperatures, sea levels, and more frequent occurrences of extreme weather events. Four primary methods for CO2 separation have emerged: absorption, adsorption, cryogenic, and membrane technologies3. The choice of the suitable CO2 capture technique relies on several factors, encompassing the origin of CO2, the magnitude of the capture process, the desired level of purity for the captured CO2, and the envisioned application of the captured CO24. At present, absorption and adsorption represent the prevailing methods employed for CO2 capture, whereas cryogenic and membrane technologies are still in their nascent stages of development5. Researchers are actively engaged in investigating diverse methodologies to adsorb CO2 as a means of mitigating its emissions6. Porous materials such as zeolite7, silica8, MOF9, carbon10, and polymer11 have been used to adsorb CO2, each of which has its advantages and disadvantages.Rising CO12. It contains aluminosilicate minerals and exhibits a distinctive three-dimensional framework with well-organized pores and channels. Zeolites have crystal structures with a rigid framework that includes pores and channels formed as TO4, where T can be silica and aluminum. Aluminum atoms attract the oxygens and produce an excellent site for cation transfer13. Cation in the structure of zeolites plays a crucial role in CO2 capture because it can attract CO2 into the zeolite6. Zeolites are promising CO2 adsorbents with high surface area, suitable pore size, and excellent thermal and chemical stability14. Multiple types of zeolites have undergone thorough investigation to assess their potential in adsorbing CO2 gas generated from industrial processes. Zeolite 4A15, zeolite 13X16, ZK-517, ZSM-518, \u03b2-zeolite19, and Na-X20 are among the zeolite types that have demonstrated potential in applications related to CO2 capture. These zeolites possess distinctive pore structures, substantial surface areas, and excellent thermal stability, rendering them highly desirable options for CO2 adsorption. Zeolite 13X has demonstrated exceptional selectivity for CO221. ZK-5 possesses a distinctive cage-like structure that can be modified to improve its adsorption properties for CO222. Similarly, ZSM-523 and \u03b2-zeolite24 have exhibited significant CO2 adsorption capacity in the studies. Additionally, Na-X has shown good stability and regeneration properties25. Zeolite 4A is characterized by a substantial concentration of adsorption sites attributable to the presence of aluminum atoms within its framework. These sites exhibit a robust affinity towards CO2 molecules, facilitating effective capture and retention of the gas.Zeolite is a material with a crystalline structure that can be either naturally occurring or synthesized26. Kaolin-based zeolites have high adsorption capacity due to their combination of mesoporous and microporous structures. Its natural abundance makes it a cost-effective option for large-scale applications, and its environmentally friendly properties make it a sustainable choice for CO2 capture solutions. The unique characteristics of kaolin-based zeolite allow for customization and tailored modifications, resulting in enhanced CO2 capture performance28.There are several methods for synthesizing zeolites, such as hydrothermal synthesis, sol\u2013gel synthesis, microwave-assisted synthesis, and organic template synthesis. The hydrothermal Method is the most commonly used technique for synthesizing zeolite when working with kaolin2 capture capabilities34. Other modifications, such as carbon modification35, silica modification7, MOF modification36, acid treatment37 and ion exchange38 have also been investigated, showcasing their potential in improving the CO2 adsorption performance of zeolites. Structural modifications achieved through various techniques, as demonstrated in relevant research studies40, can improve the adsorption performance of Zeolite 4A. presents a comprehensive analysis of the advantages and disadvantages of these modifications.In recent literature, the modification of zeolites with amine functional groups was studied, and it was demonstrated to enhance their COTable 2 adsorption capabilities. The interaction between amine-modified zeolites and CO2 occurs through chemisorption, wherein a chemical bond forms between the CO2 molecule and the amine group on the zeolite surface43. As mentioned in presents a comprehensive analysis of the advantages and disadvantages of these modifications.The incorporation of amines onto the surface of zeolites can significantly enhance their CO2 adsorption capacity, selective CO2 capture, High regeneration, and low energy consumption44. Amine functionalization of zeolites can be achieved through two main methods: grafting and impregnation. The grafting method is a well-established approach that involves attaching amine-containing molecules to the zeolite surface via covalent bonds45. This method typically results in higher degrees of functionalization, increased stability of the amine groups, and improved selectivity. However, there may be a reduction in CO2 adsorption capacity\u00a0and difficulties in regeneration due to high pressure46. Compared to the grafting method, impregnation is less complex and easier to implement. It allows for a straightforward introduction of functional groups onto the zeolite surface, making it a practical choice for modifying the material45. Impregnation method involves immersing the zeolite in a solution containing the desired amine compound to deposit amine-containing molecules onto its surface. After impregnation, the zeolite undergoes washing and drying. Impregnation is a straightforward and versatile approach, but it may result in lower levels of functionalization and less stable amine groups compared to grafting. Amine impregnation involves incorporating amines, such as MEA, DEA, and TEPA, into the pores of a zeolite material47. Fashi et al. utilized 2% piperazine to modify zeolite 13X and improve its CO2 adsorption capabilities48. Babaei et al. examined Na-Y zeolite with a silicon-to-aluminum ratio of 2.5, utilizing varying quantities of amine. When comparing NaY-2-MAE to NaY-2-DEA, they found that the steric barrier is reduced in NaY-2-MAE, leading to increased adsorption. Moreover, five functional groups in TEPA resulted in higher adsorption levels49. Ahmad et al. studied the modification of zeolite \u03b2 by incorporating melamine to enhance its CO2 adsorption performance. The modified zeolite demonstrated a significant CO2 adsorption capacity of 162.36\u00a0mg/g at 298\u00a0K and 1 bar, attributable to the increased number of active sites and the improved hydrophobicity of the zeolite surface resulting from the modification50. Panda et al. worked on modifying zeolite 4A with different amines such as propylene amine, butyl amine, pentyl amine, isopropyl amine, isobutyl amine, and isopentyl amine. The optimum result of modified-zeolite by butylamine and iso-butylamine was 108.68 and 112.64\u00a0mg/g at 298\u00a0K and 1 bar51. Garshasbi et al. prepared 13\u00a0\u00d7 zeolite and acid modification of Iranian kaolin, which showed an adsorption capacity of 352\u00a0mg/g21. Thakkar et al. synthesized ZSM-5, Y, and SAPO-34 zeolites using kaolin and modified them using TEPA amine to increase CO2 adsorption27. Murge et al. synthesized and modified zeolite Y by amine TEPA, the best adsorption performance related to Z-Y-3 at 303\u00a0K and 1 bar was 114\u00a0mg/g52.Table Table 56. Pashaei et al. demonstrated the effectiveness of RSM in optimizing the CO2 absorption process into piperazine solutions5. Gill et al. used the RSM to evaluate the effect of parameters such as activation temperature and burning degree on CO2 absorption capacity57. Karimi et al. used the RSM method to model the CO2 adsorption capacity by modifying a commercially activated carbon58. Khajeh et al. used RSM to optimize the operational conditions, reactor temperature and pressure, and acid concentration for activating the surface and wt% NaOH to raise the adsorption capacity performance59. The influence of amine loading on the adsorbent structures derived from kaolin-modified zeolite for CO2 capture has received limited attention in previous studies, especially using RSM. This article aims to fill this research gap by investigating the effects of amine loading on these structures and evaluating their capability for CO2 adsorption.Researchers frequently utilize the response surface methodology (RSM) as a statistical modeling technique to better understand the behavior of chemical systems and improve their performance. RSM is considered a valuable tool for optimizing chemical processes2 adsorption capacity of zeolite synthesized from kaolin. Our focus was on using two specific amines, Tetraethylenepentamine (TEPA) and Diethanolamine (DEA), as modifiers for the zeolite. RSM was utilized to optimize the experiments and operating conditions for the modified zeolites and evaluate their CO2 adsorption capability. Furthermore, we analyzed the kinetic and thermodynamic characteristics of CO2 capture of adsorbents.In this study, we aim to enhance the COIranian Kaolin was employed to synthesize 4A-zeolite. Sodium hydroxide (NaOH) and methanol were procured from Merck. Tetraethylenepentamine (TEPA) and diethanolamine (DEA), both of analytical grades, were used as amines during the adsorbent synthesis and obtained from Sigma Aldrich.27. The synthesis process involved the calcination of Iranian Kaolin at a temperature of 600\u00a0\u00b0C for 2\u00a0h, with a heating rate of 5\u00a0\u00b0C/min. Subsequently, 5\u00a0g of metakaolin were immersed in 100\u00a0mL of 2M NaOH solution in a round-bottom flask, and treated by stirring under reflux for 48\u00a0h at a temperature of 100\u00a0\u00b0C. The resulting mixture was then washed with deionized water until the pH reached 7, after which it was dried at 100\u00a0\u00b0C for 12\u00a0h. The resulting product was a highly porous 4A-zeolite. The synthesis process is illustrated in Fig.\u00a0Zeolite 4A was synthesized using a prescriptive method described in reference2 adsorption experiments, including temperature, pressure, and amine loading, were determined using Design Expert software to create an experimental design. Modified zeolites were then prepared based on the data generated by the software, with an amine loading of 5\u201325\u00a0wt%, to meet the specific requirements of the experimental design. For preparing amine-modified zeolite, we used the wet impregnation route. In this method, 4A-zeolite was modified with five different loadings of 5, 10, 15, 20, and 25\u00a0wt% tetraethylenepentamine (TEPA) and DEA (diethanolamine). In the preparation of 4A-25%TEPA, a solution comprising 0.33\u00a0g of TEPA and 100\u00a0mL of methanol was mixed and subjected to stirring for 20 min at 60\u00a0\u00b0C. One gram of prepared 4A-zeolite was added to the mixed solution. The solution was continuously stirred for 4\u00a0h at 500\u00a0rpm in a 100\u00a0mL beaker. The resulting mixture is dried at 100\u00a0\u00b0C for 12\u00a0h and placed in an oven to obtain a soft white powder. We repeated the process for DEA loadings of 5, 10, 15, 20, and 25\u00a0wt%. The schematic of this process is shown in Fig.\u00a0The optimal conditions for CO2 adsorption/desorption method is a scientific method used to determine the surface area of solid materials. This test is used for measuring the adsorption of gas molecules onto the zeolite's surface at varying pressures, which is then used to calculate the specific surface area using the BET equation60. This test was achieved by the ASAP 2020 model at 77\u00a0K. The FTIR (Fourier Transform Infrared Spectroscopy) test is a popular analytical technique used in various fields to analyze the chemical composition of a zeolite. The test involves passing infrared radiation through a sample and measuring its absorption or transmission at different wavelengths to determine the chemical bonds present in the sample. The infrared spectrum generated from the analysis presents a distinctive identifying characteristic of the sample's composition, thus enabling the identification of unfamiliar compounds, assessment of purity, and tracking of chemical reactions. X-ray diffraction (XRD) analysis is a technique that is used for the investigation of crystal structure in materials across a broad spectrum is facilitated. This test determines the composition, purity, crystallinity, and phase identification of kaolin, zeolite, and modified zeolite61. The test device for this analysis worked at 40\u00a0mA and 40\u00a0kV. Scanning Electron Microscopy (SEM) is an electron microscopy technique that enables the acquisition of high-resolution images of the surface of a zeolite. The resulting image provides detailed information about the zeolite's morphology, topography, and composition with sub-nanometer resolution.The N2 adsorbed on zeolites through a CO2 adsorption test pilot, as depicted in Fig.\u00a02 was introduced into the chamber for 30\u00a0min before introducing CO2 gas, which flowed over the adsorbent for 3600\u00a0s. The experiments were performed at various pressures and temperatures. During the investigation, the temperature of the CO2 gas was regulated using an electric heater, and changes in temperature and pressure were continuously recorded by a computer. Upon achieving equilibrium, which took approximately one hour, the device recorded the internal pressure (Pf). Subsequently, the adsorption parameters were determined using the recorded data62. The experiments were repeated three times, and the data average was reported to minimize experimental error.This study evaluated the quantity of CO2 adsorption percentage and\u00a0adsorption capacity of adsorbents are calculated using Eqs. (The COing Eqs.  and 2),,2 adsorpPi as the initial pressure, Pf as the equilibrium pressure, V is the reactor volume, 2, R is a gas constant, m is the mass adsorbent, T is the temperature, and Z is the compressibility coefficient. The compressibility factor is obtained from virial equations [Eqs.\u00a0(The equation involves ns [Eqs.\u00a0\u20136)]. Ta]. TaPi a56. The investigation conducted in this research involved an examination of the effects of various factors, such as temperature, pressure, and loading percentage of two different amines on 4A-zeolite, to enhance the performance of CO2 capacity. RSM was implemented to optimize these factors, utilizing a central composite design (CCD) based on a four-factor approach, which included temperature (A), pressure (B), amine wt% (C), and amine type (D), as detailed in Table RSM is the statistical technique to model and optimize complex relationships between multiple input variables and output responsesTotal of 52 tests Table ]7\\docume0 is the intercept, ai is the regression coefficient for the n predictor variable xi, and aii is the coefficient for the squared term of each predictor, aij is the coefficient for the interaction terms, and \u03b5 represents the residual error term. The formula suggests that the dependent variable y is a function of the importance of the predictor variables, the regression coefficients, and the error term. In linear regression, the aim is to determine the values of the regression coefficients that minimize the sum of the squared differences between the predicted and actual values of y. RSM has been used to predict experimental data by fitting a mathematical model to the observed data, which can then be used to make predictions for new combinations of input variables. By employing this approach, we can ascertain the optimal conditions necessary to achieve a desired response and assess the responsiveness of the response to variations in the input variables.In this formula [Eq.\u00a0] y is th2 adsorption\u2013desorption results of 4A-zeolite and modified zeolites indicate in Table 63, and the results are present in Fig.\u00a0N\u22121 corresponds to the O\u2013H stretching vibration of adsorbed water molecules, indicating the presence of water in the zeolite. In the spectrum of the modified zeolite with DEA and TEPA, some several additional peaks and troughs can be identified and analyzed. The peak at around 3417\u00a0cm\u22121 corresponds to the O\u2013H stretching vibration of adsorbed water molecules, similar to the commercial zeolite 4A. The peak at around 1544\u00a0cm\u22121 corresponds to the N\u2013H bending vibration of the amine groups, further confirming the presence of the amines64. Comparing the spectra of the modified zeolites with the unmodified 4A-zeolite reveals changes in peak intensity and position. For the FT-IR structure of 4A-zeolite, the vibration bands at 1001\u00a0cm\u22121 and 570\u00a0cm\u22121 could be assigned to the stretching vibration of Si\u2013O or Al\u2013O units and the vibration of Si\u2013O\u2013Al units in the 4A-zeolite structure, respectively63.The FT-IR spectrum of Fig.\u00a065. All zeolites exhibit additional peaks when compared to the untreated 4A-zeolite. The samples used for 4A, 4A-TEPA, and 4A-DEA were free of impurities, as confirmed by the similarities observed in their XRD patterns.Figure\u00a02. The effect of amine in 4A-zeolite determines in Table In Fig.\u00a02 adsorption by two modified zeolite 4A adsorbents with TEPA and DEA. The investigation employed a factorial design incorporating four factors temperature, pressure, the percentage of amine used for surface modification, and the type of amine, resulting in a total of 52 tests. The study findings include the values of the independent factors and the CO2 adsorption capacity. The amount of change shown by the response variables in the assimilation process indicates the magnitude and direction of their influence, as determined by the corresponding signs. The values about the TEPA and DEA factors were obtained using Eqs.\u00a0(This research study utilized response surface methodology (RSM) based on central composite design (CCD) to explore and optimize COing Eqs.\u00a0, 9, respIt is imperative to assess the significance of the model, its independent parameters, and any interactions and second-order terms that may exist within it for a desirable response.2 adsorption capacity, and efficiency. Statistical analysis conducted on the model yielded a Model F-value of 34.19, which suggests that the model is significant. The likelihood of an F-value of this magnitude occurring due to random error is only 0.01%, indicating a high degree of confidence in the model's validity. In line with established conventions, model terms with p-values below 0.0500 consider statistically significant36, while those with p-values greater than 0.1000 deem insignificant. Accordingly, in the present analysis, the terms A, B, AD, and A2 consider significant contributors to the model.The ANOVA analysis Table 2 uptake capacity indicates a satisfactory agreement between the correlation coefficients and experimental data. The difference between the predicted R2 of 0.7300 and the adjusted R2 of 0.8943 is within 0.2, indicating a good match. Additionally, Adeq Precision, which gauges the signal-to-noise ratio, should exceed 4, But in this case, it measures 28.981, indicating an adequate signal. Hence, this model can be applied to explore the design space. Ratio more significant than 4 is desirable; a ratio of 28.981 indicates an adequate signal. This model can be used to navigate the design space. The performance of a proposed model for CO2 adsorption evaluates using residual plots and a comparison of actual and predicted values. Figure\u00a02 adsorption under various operating conditions.In contrast, those with p-values greater than 0.1000 are deemed to have no significant impact. The model terms of temperature and pressure have F-values of 10.46 and 403.20, respectively. In other words, the high F-values provide evidence that the model is meaningful, as the model terms have a substantial influence on the response variable. The correlation coefficient (0.9212) obtained for the COIn order to further assess the reliability of the final model, a residual plot was generated by plotting the predicted response values against the residuals, as shown in Fig.\u00a02 adsorption capacity of modified-zeolites. We evaluated both zeolite modifications at different temperatures and pressures, ranging from 25 to 65\u00a0\u00b0C and 1 to 9\u00a0bar, respectively. Afterward, we analyzed the obtained data using Design Expert software. The analysis revealed that an increase in pressure caused increasing in CO2 adsorption for both modifications, while higher temperatures resulted in a reduction in adsorption capacity. We also examined an amine concentration of 15% for both adsorbents.Researchers in the RSM often use three-dimensional response surfaces to study and determine the best conditions. These surfaces can analyze the connections between factor variables and responses. Researchers can examine the impact of variables on a system in great detail by focusing on the response functions of two parameters while keeping all other parameters constant. Figure\u00a02 capacity of DEA, whereas an increase in pressure (B) enhances CO2 capture. Furthermore, Fig.\u00a0The deviation plot illustrates the comprehensive impact of all process parameters on the response function, with the central point (0) serving as the midpoint of the operating range. This outcome offers valuable insights into the overall behavior of the studied system. Figure\u00a02 adsorption capacity. Tables This study aimed to identify the optimal combination of independent variables, namely pressure, temperature, and wt% of amine, to achieve maximum adsorption performance. The Response Surface Methodology (RSM) optimization technique is proposed by conducting a series of tests. Input parameters were given ranged values to achieve the maximum response of CO2 adsorption capacity is the main objective of this study. Optimizing variable components is one of the methods to enhance CO2 adsorption efficiency in modified zeolites. Table 2 adsorption process when TEPA and DEA utilize to modify 4A-zeolite.Determining the optimal operating and structural conditions for modified zeolites to achieve the maximum COAfter obtaining the optimal conditions, we plan to perform isotherm, kinetic, and thermodynamic modeling on the modified zeolites.2 molecules through chemisorption, resulting in enhanced CO2 capture performance. By incorporating amine functional groups, more sites for CO2 adsorption are introduced that improve the adsorption capacity through increased surface interactions. Amine loading plays a direct role in CO2 adsorption efficacy as amines are the primary active sites for CO2 adsorption in solid adsorbents that are amine-based and functionalized. Very high loading of amine functional groups can lead to steric hindrance, limiting access to the amine sites and reducing CO2 adsorption efficiency66. Therefore, careful optimization of TEPA or DEA loading is essential to balance the benefits of increased loading without negatively affecting adsorption performance. The CO2 adsorption capacity of the adsorbents at different DEA and TEPA loadings is shown in Fig.\u00a067. The broadest pore size distribution, which enhances TEPA dispersion and CO2 molecule diffusion, is 4A-15%TEPA . The Freundlich isotherm model is characterized by the parameters kF (mg\u00a0g\u22121\u00a0bar\u22121/n), Pe (bar), and n (Freundlich isotherm constant). The D\u2013R isotherm model characterizes by two parameters, namely the constant of the model (\u03bb) in mol2/J2, and the Polanyi potential (\u03c9) in KJ/mol units.The parameters q2 adsorption isotherms using these models plot at 298 K and pressures ranging from 1 to 9 bar, as depicted in Fig.\u00a02 adsorption. Table 2 correlation coefficients for all coefficients of isotherm parameter models. Based on the nonlinear regression technique and the R2 values, the theoretical isotherms rank in order of effectiveness for explaining and predicting adsorption for the behavior of modified zeolite as Freundlich\u2009>\u2009Langmuir\u2009>\u2009D\u2013R. The Freundlich isotherm model's ability to fit well with the adsorption data indicates that the modified zeolite surface is not uniform and has a wide range of adsorption energies. This behavior explains the heterogeneous surface with broad adsorption energy distribution through the Freundlich constant and exponent parameters. A high Freundlich constant shows that the modified zeolite has a high adsorption capacity, while a low exponent means a more linear adsorption isotherm. In conclusion, the Freundlich isotherm model provides valuable information about CO2 adsorption on amine-modified zeolites and can help optimize their design and performance for CO2 capture applications.CO69. In the case of reaction models, experimental data fit with differential equations such as pseudo-first order, pseudo-second order, etc. , internal diffusion or intraparticle diffusion , and mass action 69. The variables qt, k1, k2, and kA use represent the adsorption capacity and rate constants of the first-order, second-order, and fractional-order models. In addition to n, a, and b use employing mean the kinetic model parameters, that important in characterizing the adsorption process's kinetic behavior and understanding the underlying mechanisms.The analysis of the adsorption rate, through kinetics, is crucial in determining the required residence time for evaluating the adsorption reaction. In the study of adsorption data, two primary categories of mathematical models are commonly utilized: adsorption reaction models and adsorption diffusion models. Although both models describe the kinetic process of adsorption, they represent different aspects of the kinetic analysisc. Table , which h2 value of the latter model decreases, as shown in Table 70. The Rate Controlling Model has been commonly used to analyze mass transfer mechanisms and has established intraparticle diffusion as the sole determining factor in regulating the process rate71. Based on the data presented in Table 2) values of the kinetic models, it is evident that the fractional-order adsorption kinetic model is the best-suited approach for describing the CO2 adsorption capacity and reaction time. This model provides a more thorough and accurate description of adsorption phenomena that deviate from integer order kinetics  ranging from 0.97470 to 0.99337 at 5 bar  suggest that the fractional-order adsorption kinetic model provides the best fit. Table The first-order model assumes that the rate of solute uptake changes proportionally to the difference in saturation concentration and the amount of solid uptake over time, indicating a physical adsorption process. If the Rics Fig.\u00a0. It cons21. Equations\u00a0(L) against the inverse of temperature (1/T) and can be used to calculate \u0394G\u00b0. The universal gas constant (R) and the absolute temperature (T) are represented by 8.314 J/mol K and K, respectively.The thermodynamic parameters, including Gibbs free energy (\u0394G\u00b0), Enthalpy (\u0394H\u00b0), and Entropy (\u0394S\u00b0), are essential for understanding the adsorption processquations\u00a0 provide 23. For 4A-zeolite, the \u0394G\u00b0 values shift inversely with temperature, indicating decreased adsorption feasibility at higher temperatures. The \u0394G\u00b0 values for 4A-zeolite are between \u2212\u00a09.219 and \u2212\u00a09.648\u00a0kJ/mol, suggesting physical adsorption. However, for DEA-4A and TEPA-4A, the \u0394G\u00b0 values increase with temperature, indicating both physical and chemical adsorption. By using  as a function of (1/T)  Fig.\u00a0. \u0394H\u00b0 val2 adsorption, employing various recent adsorbents. The outcomes of various similar studies were consolidated and presented in Table 2 capture applications.This section involved a comparative analysis between the current study and other relevant investigations focused on CO2 on amine-modified 4A-zeolite involves the chemisorption of CO2 molecules onto the amine groups present on the surface of the zeolite. The TEPA molecule comprises both primary amine (R1NH2) and secondary amine (R1R2NH) functional groups, both of which can participate in the reaction with CO2 and yield a carbamate ion, as shown in Fig.\u00a01R2NH functional group, which is secondary amine and is responsible for the chemical reaction between the amines and CO2. The presence of amine groups enhances the adsorption capacity of the material for CO2, while the increased hydrophilicity of the modified zeolite surface promotes the physisorption of CO2 molecules. The van der Waals forces between the zeolite and CO2 molecules, influenced by the Si and Al atoms in the zeolite structure, also play a role in the adsorption mechanism by attracting and holding CO2 molecules on the surface49. The strength of the interaction between CO2 molecules and the amine groups on the zeolite surface influenced factors such as the type of amine used for modification, the amine loading, and the pore size of the zeolite. Efficient capture of CO2 by amine-modified zeolites attributed to a combination of chemisorption and physisorption mechanisms.The adsorption mechanism of COThe ability to reuse the adsorbent is essential for industrial applications. Amine-based adsorbents may degrade or leach amines under harsh conditions, potentially affecting their long-term performance and reusability. In a series of ten adsorption cycles at 298\u00a0K and 5\u00a0bar, both types showed a slight decrease in adsorption potential after recycling at 410\u00a0K for 8\u00a0h. The 4A-15%TEPA adsorption potential was reduced by 3%, and the 4A-10%DEA adsorption potential decreased by approximately 2% Fig.\u00a0. These r2 in this study. To characterize the synthesized samples, we utilized several analytical techniques, including scanning electron microscopy (SEM), X-ray diffraction (XRD), Fourier-transform infrared spectroscopy (FT-IR), and Brunauer\u2013Emmett\u2013Teller (BET) testing. Our study assessed the effectiveness of modifications in enhancing the CO2 adsorption capacity of 4A-zeolite and tested the adsorption capacity of the modified zeolites at different temperatures and pressures. Utilizing Response Surface Methodology (RSM), we evaluated the CO2 adsorption performance of the modified zeolites by optimizing the operating conditions. CO2 adsorption experiments were performed at varying temperatures, pressures, and amine concentrations. The optimal adsorption capacity of the 4A-TEPA adsorbent is 477.342\u00a0mg/g, achieved at a temperature of 25.05\u00a0\u00b0C, pressure of 8.991 bar, and amine concentration of 15.275\u00a0wt%. Similarly, the 4A-DEA adsorbent exhibits an optimal adsorption capacity of 579.468 mg/g, with optimal operational variables of 25.270\u00a0\u00b0C, 8.870 bar, and 11.112\u00a0wt% amine concentration. After subjecting the adsorbents to recycling in an oven at 410 K for 8\u00a0h, the 4A-15%TEPA adsorption potential experienced a reduction of 3%, while the 4A-10%DEA adsorption potential showed a decrease of approximately 2%. The high R2 value of 0.9212 confirmed the excellent agreement between the experimental data and the model employed in this study. Furthermore, the kinetic and thermodynamic analyses have shown that the adsorption process of the modified zeolites is affected by both physisorption and chemisorption mechanisms. After analyzing various kinetic models, it was determined that the fractional-order adsorption model was the most appropriate. Overall, the results of this research highlight the promising potential of amine-functionalized 4A-zeolite as an effective adsorbent for CO2 capture. The material demonstrates notable advantages such as cost-effectiveness, high CO2 adsorption capacity, and a lack of reagent requirements. The method proposed in this study has the potential to facilitate the production of high-performance zeolites for various industrial applications.We successfully synthesized and modified 4A-zeolite from kaolin to improve its performance in capturing COSupplementary Information."}
+{"text": "The effects of operating parameters, including temperature, pressure, LiOH particle size and LiOH loading, on the CO2 capture in a fixed-bed reactor have been experimentally explored using response surface methodology (RSM) based on central composite design. The optimum conditions obtained by the RSM for temperature, pressure, mesh and maximum adsorption capacity were calculated as 333\u00a0K, 4.72\u00a0bar, 200 micron and 559.39\u00a0mg/g, respectively. The experiments were evaluated using isotherm, kinetic and thermodynamic modeling. Isotherm modeling showed that Hill model could deliver a perfect fit to the experimental data, based on the closeness of the R2-value to unity. The kinetics models showed that the process was chemical adsorption and obeyed the second order model. In addition, thermodynamic analysis results showed that the CO2 adsorption was spontaneous and exothermic in nature. In addition, based on the density functional theory, we investigated the chemical stability of LiOH atomic clusters and examined the effects of LiOH nanonization on the physical attraction of carbon dioxide.In this work, the potential of monohydrate Lithium hydroxide (LiOH) as a high capacity adsorbent for CO The most important sources of CO2 emissions are power plants generating electricity from fossil fuels, cement plants, chemical and petrochemical industries, steel industry, etc.2. It is necessary to inexpensively eliminate or reduce carbon dioxide emissions3, and so, global actions against climate change must be carried out under the climate change convention and the Kyoto protocol. In 1997, various countries agreed on reducing the uncontrolled production of carbon dioxide under the Kyoto protocol targets. According to the treaty, industrialized countries pledged 2.5% reduction of their greenhouse gas emissions compared with 19904. So far, different technologies have been introduced for CO2 capture and storage, among them physical adsorption, chemical adsorption and membrane distillation have proved to be leading choices6. On the other hand, CO2 adsorption using adsorbents, which has demonstrated to be more efficient than other methods, suffers primarily from the lack of an efficient and scalable configuration process9. Due to low cost, less corrosion, and easier recovery, this method has attracted numerous attention as a potential bid for separating carbon dioxide10. In the recent decades X, Y, A, ZSM-zeolites, chabazites, metal oxides, various carbons, etc. have been widely studied11. Among the possible candidates, solid adsorbents available for CO2 adsorption, such as calcium hydroxide (Ca(OH)2), potassium hydroxide (KOH) and sodium hydroxide (NaOH), are strong bases12, which can readily react with CO2 to form calcium carbonate, potassium carbonate and sodium carbonate, respectively14. The reaction of CO2 with hydroxides proceeds as follows10:Carbon dioxide is the main greenhouse gas, and its production is increasing every year. It is well-known that CO2 and hydroxides produces pure carbonate by high adsorption capacity, low thermal chemical adsorption, which is able to adsorb CO2 at ambient temperature and pressure10. Lithium hydroxide has been used for CO2 adsorption due to its high CO2 storage capacity (30 wt.%), with applications in space life support systems, space shuttle environmental control and submarine scrubbing systems15, . In these applications, air or oxygen laden with CO2 from human or animal respiration is forced to move through a bed of lithium hydroxide granules. CO2 is removed and the carrier gas is returned to the environment. The reactions of water and carbon dioxide with lithium hydroxide are as follows16:The reaction between CO2 absorbed. Reaction  by alkali and alkaline earth metals. A fixed-bed adsorption apparatus was used to obtain more information about the effects of impregnated cations. So that, modified zeolites had greater adsorption capacities than ACs, despite their smaller surface areas, because of the electrostatic interfaces between zeolites. The intensity of the electrostatic field, and the charge density in particular, increases in the sequence of K+\u2009<\u2009Na+\u2009<\u2009Li+, resulting in enhanced electrostatic fields and greater CO2 adsorption capacities29. Cho et al. in 2015, modified the commercial zeolite of 13X and 5A with lithium hydroxide (LEZ-13X and LEZ-5A) to remove carbon dioxide in the indoor simulated examined. The BET levels of zeolite adsorbents after modification with lithium hydroxide are higher than unmodified zeolite types, as a result, it showed an increase in the adsorption capacity30. Krishnan et al.31 in 2015, proposed a system that made of activated carbon filter consists of a matrix board, lithium hydroxide and calcium hydroxide. The summarized adsorption of carbon dioxide with solid adsorbents and adsorbents modified with LiOH and are presented in Table\u00a0Adsorption of COThe low heat of reaction for the reaction between carbon dioxide and LiOH compared to other hydroxides, as well as the lower risks of keeping the lithium hydroxide adsorbent in a closed environment to adsorb carbon dioxide, greater compatibility with the environment and human living environment, the ability to adsorb in temperature and the ambient pressure is more justified than sodium hydroxide, potassium hydroxide and other physical and chemical adsorbents.2 adsorption by LiOH was investigated experimentally and theoretically. In the design and statistical evaluation of experiments, response surface methodology (RSM) can be exploited for process modeling and optimization. RSM based on the central composite design was applied in order to design the experiments, build models and measure the optimum modification conditions to achieve desirable responses32. The main objective of this work is to explore the influence of modification parameters on the CO2 adsorption performance of the solid adsorbents in a fixed-bed reactor. In addition, the adsorption process of carbon dioxide by lithium hydroxide atomic cluster has been simulated. The simulations were performed based on the density functional theory. The simulation results are about the type of interaction between CO2 and lithium hydroxide at room temperature, and the effect of the size of grains on the adsorption of carbon dioxide gas.In this work, the kinetic, thermodynamic and isotherm of CO3, 20\u00a0\u00b0C and 12.8\u00a0g/100\u00a0g, respectively.Lithium Hydroxide (LiOH) was purchased from Merck chemical Co., and purified carbon dioxide gas (99.98%) was supplied by Sabalan Gas Co. . LiOH is a solid powder and density, melting point, and solubility of LiOH sorbent in water are 2540\u00a0kg/mThe solids and liquids were analyzed to identify the links and chemical structure. Laboratory FTIR spectrometer system, is able to pass and adsorption spectra of liquid, solid and powder. The FTIR spectroscopy analysis was performed using a spectrometer  to identify surface functional groups in LiOH. X-ray diffraction is used to identify the chemical composition and properties of crystalline crystals, ceramics, metals, alloys and synthetic materials widely used in chemical engineering.2 adsorption experiments were performed by Lithium hydroxide with mesh of No70. The laboratory set up includes three parts: (1) gas infusion device, (2) CO2 reactor device, (3) investigation of CO2 pressure changed in the reactor during uptake process. The reactor length, inner radius and the internal volume were 9\u00a0cm, 3\u00a0cm and 255\u00a0cm3, respectively. At the beginning of the test, CO2 transferred from the cylinder to the reactor encasement via pressure current supervisors. As well as, the required temperature for each experimental run was provided by thermocouple linked to the reactor body and controlled via regulating the set point for the system. Changing in the temperature and pressure for 1\u00a0h of the reactor comprising solid adsorbent were analysis and control online during the process. All data were stored in separate Excel files in a reference computer with the temperature, pressure, time and the date. The pressure, temperature and amount of the adsorbent ranged between 1 and 9\u00a0bar, 298\u2013363\u00a0K and 2.4\u00a0g, respectively. When pure CO2 was injected to the reactor containing solid adsorbent, adsorption process was began and CO2 was captured through the solid adsorbent. During the CO2 adsorption process, the pressure in the reactor was decreased. The CO2 adsorption rate as the difference between initial and final of CO2 pressure by the gas sensor was measured. The adsorption capacity of the adsorbent was calculated through the following equation:Kd is the distribution coefficient (cm3/g). The distribution coefficient was calculated through the following equation:w is the weight of adsorbent. qe is the adsorption capacity (mg/g), Pi is the initial pressure (bar), Pe is the equilibrium pressure (bar), m is the dosage of adsorbent used (g) and v is the volume of the gas (L-1). The adsorption percentage of CO2 was calculated as follows:Pi and Pf are the initial and final pressure, respectively. Also, the correlation coefficient (R2), which represents the variability percentage in the dependent variable (the variance about the mean) is employed to analyze the fitting degree of isotherm and kinetic models with the experimental data , respectively.All CO41. The nanonization effects of LiOH salt on carbon dioxide adsorption was investigated. To investigate the effect of carbon impregnated with lithium hydroxide on carbon dioxide capturing, we performed modeling based on density functional theory (DFT). The calculations are based on the B3LYP functional46, and the electron density is modelled with the LANL2DZ basis set48. Our DFT simulations are performed using the Gaussian software package49.The density functional theory (DFT) was applied for analysis of carbon dioxide adsorption by LiOH atomic clusters. Previously, using the density functional theory, extensive research has been done on the interaction of carbon dioxide and lithium compounds2 adsorption capacity was explored using the central composite design. These variables, along with their respective regions of interest, were selected based on the literature and preliminary investigations50. Table\u00a0The effects of the three independent variables, including temperature, pressure and LiOH particle size (mesh size), on the CO\u22121, 1576.70\u00a0cm\u22121, 997.10\u00a0cm\u22121. Accordingly, these peaks can represent oxygen and O\u2013H bonds. It should be noted that at 3568.14\u00a0cm\u22121, in lithium hydroxide, a larger peak is shown in comparison with Li2CO3. Peak 3568.14\u00a0cm\u22121 is related to O\u2013H link. But in the analysis of Li2CO3 FTIR, peaks 3568.01, 2363.67, 1443.40 and 863.15\u00a0cm\u22121 are well visible, respectively, for O\u2013H, C\u2261C, C=O, and C\u2013H bonds. Due to the presence of carbon and oxygen bonds in lithium carbonate, carbon-rich peaks in FTIRs were well visible. Li peak will appear at less than 300\u00a0cm\u22121, according to the existing device, it is not possible to display peaks less than 400\u00a0cm\u22121. The only LiOH product was before the adsorption process  explores the relationships between input variables including temperature, pressure and LiOH particle size (mesh size) and CO2 capture performance should be determined in details  and Hill. The constant values of Langmuir, KL and qm of the K and n constants for the Freundlich, the qm and E constants for Dubinin-Radushkevich, and so on, the constants for the Hill, models at 303\u00a0K, are given in Table\u00a0e is the amount of CO2 adsorbed at equilibrium (mg/g), qm is the maximum adsorption capacity of the adsorbent (mg/g), L is the Langmuir adsorption constant that relates to the free adsorption energy (1/bar)55. The Freundlich isotherm model is the earliest known relationship that presents a non-ideal and reversible adsorption process56. Freundlich is applicable to the multilayer adsorption, and it is based on an assumption that the adsorption energy will exponentially decrease with an extent of the adsorption process57. The model can be expressed by Eq.\u00a0 isotherm can be used to describe adsorption on both homogenous and heterogeneous surfaces. The isotherm equation can be expressed by Eq.\u00a0.Following the introduction of the isotherms, the Hill isotherm model, originated from the NICA modeld by Eq.\u00a059:12\\doc2 values, the suitability of these models in predicting the sorption behavior follows the order of Hill\u2009>\u2009D-R\u2009>\u2009Freundlich\u2009>\u2009Langmuir. Furthermore, the computed value of nF\u2009<\u20091 implies that the CO2 adsorption onto the LiOH is a chemisorption process, whereas if the value is larger than 1, it suggests a physisorption process61. In Table\u00a02 is in the range of 0\u20131, which shows that CO2 adsorption is desirable or not. According to R2, the most suitable models for predicting adsorption behavior are Hill\u2009>\u2009D-R\u2009>\u2009Freundlich\u2009>\u2009Langmuir. Perez et al. suggested that Langmuir\u2019s model is the best one for describing the chemical reactions due to its limitation to one layer. While Freundlich primarily represents the process of physical adsorption because it allows adsorbent molecules to form a continuous layer on the adsorbent surface. The CO2 adsorption is shown in the range of 0\u20132 by a 1/n constant Freundlich. The value of 1/n\u2009<\u20091 shows that the CO2 adsorption onto the adsorbent is chemical adsorption. While for the value of 1/n\u2009>\u20091, the adsorption would be a physical process. The D-R isotherm provides useful information about energy parameters. E is defined as the energy of free adsorption. Accordingly, the value of E\u2009<\u20098\u00a0kJ/mole corresponds to a physical adsorption, the value in the range of 8\u2009<\u2009E\u2009<\u200916 indicates that the adsorption is controlled by the ion exchange mechanism, and the value of E\u2009>\u200916\u00a0kJ/mol shows that the adsorption is due to the influence of particle penetration64 and it is a chemical adsorption.In a component isotherm study, determining the best-fitting model is the key analysis to mathematically describe the adsorption system. With respect to the R2 adsorption , \u0394S\u00b0 is entropy change, \u0394H\u00b0 is enthalpy change, T is the absolute temperature (K), R is gas constant (kJ/mol\u00a0K). The standard free energy values was calculated using Eq.\u00a0, Gibbs free energy change (\u0394G\u00b0) and entropy change (\u0394S\u00b0) can be estimated using equilibrium constants changing with temperature. The distribution coefficient at constant temperature was calculated using Eq.\u00a0.17\\documsing Eq.\u00a0.18\\documKd) versus (1/T) as presented in Fig.\u00a02 on LiOH is endothermic. The free energy value for all the temperatures is negative, and the decrease in the value of \u0394G\u00b0 with increase in temperature shows that the reaction can be done easier at high temperatures.The values of the enthalpy change and entropy change are calculated from the slope and intercept of the plot of Ln. Due to this, the adsorption capacity of CO2 was determined at an optimal adsorbent of 2.4\u00a0g. Since the CO2 adsorption reaction with lithium hydroxide is associated with the production of water, the production of water during the reaction requires heat, and the overall reaction is a thermal one. Hence, by increasing the amount of the adsorbent, the heat required for the second reaction is provided. Similarly, Fig.\u00a0The effect of different LiOH loadings on CO2 adsorption capacity. The solid lithium hydroxide was crushed using a mortar and passed through a mesh strainer. The particle size was determined in meshes of 200, 300, 500 and 800 microns. Reducing the particle size of the Lithium Hydroxide powder leads to an increase in the CO2 adsorption capacity  at 6\u00a0bar and 303\u00a0K. The analysis of CO2 adsorption capacity is shown in Fig.\u00a02 on LiOH is chemical adsorption. The catalytic effect of water on the adsorption of CO2 has been proved by Miller and Piatt69 to have a substantial effect on the reaction, as exhibited in the Eq.\u00a02, Li3(OH)3, Li4(OH)4 and Li4(OH)5, are shown in the optimal structures obtained by density functional theory calculations. Note that the Li4(OH)5 cluster is the smallest salt crystal that can be seen repeatedly in the lithium hydroxide crystal structure.In Fig.\u00a0By examining the chemical hardness of the above atomic clusters, we can conclude that the above structures have acceptable chemical stability. The chemical hardness can be obtained for each atomic cluster of lithium hydroxide using the following relationship.For each of the introduced atomic clusters, the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO) and the HOMO\u2013LUMO gap and finally the chemical hardness were obtained (Table\u00a04(OH)5 is shown in Fig. By observing the chemical hardness of lithium hydroxide atomic clusters, we conclude that these structures are chemically stable. Usually, with the nanonization of materials their chemical reactivity increases; but with the nanonization of lithium hydroxide, it turns from a salt structure into covalent atomic clusters. For the above structures, there are no imaginary vibrations 5 cluster, which, as mentioned, is the smallest crystal structure of lithium hydroxide salt. You see the binding energy for this structure is different and lower than the other clusters in the table, almost half of the value of the similar structure i.e. Li4(OH)4. Because for this cluster, we assumed the optimal position of the carbon dioxide molecule in a position where the carbon dioxide is close to the hydroxide part of the salt. This assumption was different from the situation that existed for other clusters because in those clusters, carbon dioxide approaches the lithium atoms of the cluster from its oxygen side. The reason for this assumption is that in the crystal structure, lithium atoms are placed in the inner part of the salt structure, and the outermost part of the salt crystal is the hydroxide part placed on the lithium atoms  attained by the LiOH solid which is significantly higher than the amount obtained in the pressure of 1\u00a0bar (156.242\u00a0mg/g). Hill isotherm model to the closest fit to the experimental data was two-parameter model. The second-order closest model to fit the experimental data was a kinetic one. An increase in temperature led to an increase in the chemical CO2 uptake of the solid lithium hydroxide. The values of \u0394H\u00b0 and \u0394S\u00b0 were calculated from the slopes and intercepts of linear regression of Ln kd versus 1/T, based on which \u0394H\u00b0\u2009=\u2009\u2212\u200913,681\u00a0j/mol and \u0394S\u00b0\u2009=\u2009\u2212\u200972\u00a0j/mol\u00b7K were obtained, representing that the exothermic chemical reaction is between carbon dioxide and lithium hydroxide. Also, our DFT simulations show that with the nanonization of lithium hydroxide, are formed stable atomic clusters, and the smaller the dimensions of these clusters, the greater the attraction between them and the carbon dioxide molecule.A remarkable difference was observed in the COSupplementary Information."}
+{"text": "Cetaceans are species of scientific interest for many reasons. First, they can be useful to assess environmental health and, second, they have peculiar features which also make them interesting for human comparative pathology. In the last decades, extracellular vesicles have been studied as important carriers in cell-to-cell communication, and many studies in human and veterinary medicine have focused on their role in pathophysiological mechanisms or as biomarker to diagnose diseases. In vitro studies are good models to explore extracellular vesicles. However, cell lines have been poorly used and investigated in these species. For these reasons, here we describe for the first time the isolation of extracellular vesicles from two cetacean cell lines established from bottlenose dolphin and Cuvier\u2019s beaked whale. We also compare two different techniques to isolate extracellular vesicles, reporting the difference in the yield and quality of the obtained sample. This preliminary study on extracellular vesicles isolated in vitro aims to be the basis for future research to deepen our understanding on cetacean pathophysiology.Cetaceans are of scientific interest because they are good candidates as environmental bioindicators. However, in vivo research is arduous and in vitro studies represent a rarely used valid alternative. Extracellular vesicles (EVs) are membrane-bound structures playing roles in cell-to-cell communication. Despite being a promising investigative tool in different fields of science, EVs have been poorly studied in cetaceans. To fill this gap, we describe the preliminary characterization of EVs isolated from a bottlenose dolphin and a Cuvier\u2019s beaked whale cell line. EVs have been isolated with ultracentrifugation (UC) or size exclusion chromatography (SEC) and characterized with nanoparticle tracking analysis (NTA), Western blotting (WB), and scanning transmission electron microscopy (STEM). UC and SEC allowed the isolation of mainly small EVs (<200 nm). A higher number of particles were isolated through UC compared to SEC from both cell lines. At WB, all EVs expressed the EV-markers CD9 and integrin-\u03b2. Only EVs isolated with UC were positive for TSG101. In conclusion, we isolated for the first time EVs from a bottlenose dolphin and a Cuvier\u2019s beaked whale cell line using two different techniques. Further studies on cell-derived EVs will be useful to deepen our knowledge on cetacean pathophysiology and health status assessment. Extracellular vesicles (EVs) are membrane bound nano-vesicles originating from cells and released in the extracellular space . They arMost of the studies have investigated EVs in humans for their characterization and classification, to elucidate their role in physiological and pathological processes , and as diagnostic biomarkers or therapeutical vehicles ,6,7. HowBalaenoptera acutorostrata, Balaenoptera physalus, Megaptera novaeangliae, Orcinus orca, Ziphius cavirostris) and of two pinnipeds , with the aim of finding possible biomarkers to assess the health status of these species [Among animal-derived EVs, a few preliminary studies have been performed on sea mammal-derived EVs isolated and characterized from the sera of five whales  cell line and from a Cuvier\u2019s beaked whale (Ziphius cavirostris) cell line using two different EV isolation methods; however, the presence of EVs in the plasma of some cetacean species has already been reported [Therefore, considering the still few in vitro studies on cetacean cell lines and the lack of in vitro studies on cetacean-derived EVs, we isolated and characterized for the first time EVs from a bottlenose dolphin , one derived from a bottlenose dolphin and one from a Cuvier\u2019s beaked whale, were cultured in 1\u00d7 Dulbecco\u2019s modified Eagle\u2019s medium F12 (DMEM F12)  containing 10% fetal bovine serum  and 1% penicillin/streptomycin  [Two skin-derived fibroblast immortalized cell lines  . Cell li6 cells. Then, 24 h before EV isolation, cells were washed twice with PBS and the cell culture medium was replaced with FBS-free (FBSf) medium, in a volume of 25 mL for EV isolation with UC and of 16 mL for EV isolation with SEC.To isolate EVs from each cell line, two p150 petri dishes were seeded with 3 \u00d7 10g and at 2000\u00d7 g for 10 min at 4 \u00b0C, to remove any cell/cell debris. For EV isolation through UC, the supernatant was transferred to a 39 mL ultracentrifuge tube  and ultracentrifuged at 100,000\u00d7 g for 90 min at 4 \u00b0C . The supernatant was discarded, and the EV-enriched pellet was resuspended in 100 \u03bcL of 0.2 \u03bcm double-filtered PBS (dfPBS). To perform EV isolation with SEC, the supernatant was centrifuged with 100 kDa ultrafiltration tubes , and the concentrated medium was collected and loaded in the top of qEVoriginal/70 nm columns . SEC was then performed according to manufacturer\u2019s instructions and fractions #7, #8, #9, and #10 pooled and centrifuged with a 100 kDa ultrafiltration tube . Concentrated fractions were finally collected and resuspended in 100 \u03bcL of dfPBS.EVs were isolated from two plates with semi-confluent cells by UC or SEC, as already described . Briefly6 and 109 per mL; ratio of valid particles to total particles higher or equal to 1/5. To test differences between the groups, a statistical analysis was performed with ANOVA using GraphPad Prism 8 software. The level of significance was fixed as p < 0.05.After EV isolation, EVs obtained with UC or SEC from both cell lines were quantified and evaluated for particle concentration and size distribution using NanoSight NS300 . EV samples were progressively diluted in dfPBS until the correct dilution to gain reliable measurements by NTA was reached. For each sample, camera level was set at 12, and three movies of 60 s each were recorded and analyzed using the 3.4 NTA software. For particle quantification, measurements were considered reliable when within the following instrument optimal working ranges: particles per frame from 20 to 120; particle concentration between 10For each cell line, cell proteins were extracted from a 15-cm plate with 90% confluent cells using 2 mL of radioimmunoprecipitation assay buffer (RIPA buffer) (Thermo Fisher Scientific) supplemented with protease inhibitor  according to the manufacturer\u2019s protocol. Proteins from EVs isolated with UC or SEC were resuspended in 30 \u00b5L of RIPA buffer supplemented with protease inhibitor immediately after EV isolation.Cells and EV-derived protein concentrations were calculated using a Pierce BCA protein Assay Kit (Thermo Fisher Scientific), according to the manufacturer\u2019s protocol.For WB, 20 \u03bcg of proteins extracted from cells or EVs were first denatured at 70 \u00b0C for 10 min or at 95 \u00b0C for 5 min and then resolved using NuPAGE 4\u201312% Bis\u2013Tris gel (Thermo Fisher Scientific) and transferred to a nitrocellulose membrane. To block nonspecific binding sites, blots were incubated for 90 min in 5% non-fat dry milk in TBS-T (TBS containing 0.05% Tween-20) at room temperature. Then, blots were incubated at 4 \u00b0C overnight with rabbit or mouse primary antibodies against human Integrin-beta 1 , TSG101 , CD9 , and calnexin  diluted in TBS-T containing 1% non-fat dry milk. Then, membranes were incubated with a peroxidase-conjugated secondary antibody  diluted in TBS-T for 1 h at room temperature. Reactive bands were visualized using the SuperSignal West Pico PLUS Chemiluminescent Substrate detection kit (Thermo Fisher Scientific) with the iBright instrument (Thermo Fisher Scientific).Scanning transmission electron microscopy (STEM) was performed on isolated EVs, resuspended in dfPBS, to analyze their ultrastructural morphology. According to the proper dilution to obtain the best image quality, the samples were adsorbed onto 300 mesh carbon-coated copper grids  for 10 min in a humidified chamber at room temperature. Vesicles on grids were then fixed in 2% glutaraldehyde (Electron Microscopy Sciences) in PBS for 10 min, then briefly rinsed in Milli-Q water and negative stained with 2% phosphotungstic acid brought to pH 7.0 with NaOH. Grids with adhered EVs were examined with a Zeiss GeminiSEM 500 equipped with a scanning transmission electron microscopy (STEM) detector .After EV purification with UC and SEC, the concentration and size of the isolated particles were measured by NTA. Results are shown in The size distribution of particles after both the UC and SEC isolation procedure showed size ranges within the size of EVs, with the mode size of the diameter ranging from 85 to 106 nm in all samples, demonstrating the isolation of mainly small EVs .11 +/\u2212 2.7 \u00d7 1010 and 4.7 \u00d7 1011 +/\u2212 2.8 \u00d7 109, respectively   .WB was performed to characterize EVs isolated by UC and SEC from both bottlenose dolphin and Cuvier\u2019s beaked whale cells. As a control, proteins extracted from both cell lines were used .CD9 and integrin-beta 1, transmembrane proteins commonly used as EV markers, were detected in EVs isolated with UC and SEC from both cell lines and also in their cellular counterpart. TSG101, a cytosolic EV marker, was detected only in cells and EVs isolated with UC from both cell lines. Calnexin, a marker of the endoplasmic reticulum commonly used as negative control for EVs and as a positive control for cells, was not detected in EVs but was detected in both bottlenose dolphin and Cuvier\u2019s beaked whale cells as expected .STEM further showed in the presence of intact and rounded EVs in all of our samples, as confirmed by the unbroken lipidic bilayer, that appears as a thin white filament enclosing electron dense material . The iso11 particles/mL compared to SEC EVs, which had a concentration of 109 particles/mL. These results are partially similar to those present in another study of our research group, focused on the characterization of EVs isolated with UC and SEC from a canine mammary tumor cell line. Despite the fact that the particle concentration of UC EVs at NTA was similar, if slightly higher (7 \u00d7 1011 particles/mL), the SEC EV concentration from canine mammary tumor cells was higher (1010 particles/mL) than the concentration SEC EVs from cetaceans (ref). This might be explained by the fact that cancer cells have been demonstrated to generally shed more EVs [The aim of this study was to isolate and characterize EVs from two cetaceans\u2019 cell lines using two different isolation techniques. Similar studies have already been performed on other in vitro models . Howevermore EVs .In all our samples, particles mainly measured between 50\u2013800 nm in diameter, a size included in the recognized size range of EVs, where EVs smaller than 200 nm of diameter are classified as small EVs and particles larger than 200 nm are classified as large EVs . ConsideConsidering the protein expression, both EVs isolated with UC or SEC from bottlenose dolphin or Cuvier\u2019s beaked whale cells expressed the EV membrane markers CD9 and integrin-beta, and all the EV samples were negative to the negative control calnexin. The absence of this protein in the endoplasmic reticulum in our samples, which was expressed instead in cells, implies the absence of a relevant quantity of cell debris. TSG101, a cytosolic marker of EVs, was only expressed on EVs isolated with UC. It is commonly recognized that UC allows researchers to collect more EVs compared to SEC and, each isolation technique can purify different subtypes of EVs, which might express different EV markers and have different biological functions ,26. As sStudying EVs in vivo is arduous due to their high complexity and heterogeneity. However, EVs isolated from tissues ex vivo have the advantage of coming from different cell types and, therefore, represent the tissue\u2019s in vivo situation. However, until now, we had little information on tissue-derived EVs because of the tissue complexity and possible cell rupture that can contaminate the final EV sample . EVs isoTursiops truncatus caused by bacterial  or protozoal  agents [Both the species included in our study are relevant for conservation policies and scientific interests, but they are difficult to investigate in field conditions. Bottlenose dolphins are top predators, living in coastal environments and feeding on commercial species or interacting with fisheries and many other human related activities. For these reasons and because they are also included in Annex II of the Habitat Directive (EU Directive 92/43/CEE) they could be considered good candidates as a sentinel species to monitor both environmental and human health, taking advantage of the bioaccumulation phenomena ,30,31. A) agents ,33,34,35) agents ,37. On t) agents ,39,40. A) agents ,42. It s) agents ,45.As described above, the EV isolation techniques included in this study have some limitations mainly related to the lower purity of the EV sample obtained by UC and to the lower yield of the EV isolated by SEC. Both isolation methods are sized-based and apply centrifugal forces with or without a gradient. Additional systems for EV isolation, such as immune-based methods could also be applied for comparison. In future studies, it would also be interesting to assess the functional effect of cetacean cell-derived EVs, investigating cellular uptake and response to external stimuli, which were not included in this preliminary investigation.In this preliminary EV isolation and characterization study, we demonstrated for the first time that bottlenose dolphin and Cuvier\u2019s beaked whale cells can release EVs in vitro, like other mammalian cells. We believe that in vitro and EV study can become an additional tool to deepen our knowledge on these threatened and physiologically unique species. Future studies will aim to expand the use of EVs in cetaceans\u2019 cell lines to investigate their role as markers after exposure to several natural and artificial conditions, such as underwater pressure, diseases, or chemical substances, also comparing them with results obtained in vitro in other species, including human beings."}
+{"text": "The aim of this paper was to evaluate semen parameters from Czech Fleckvieh bulls used in artificial insemination in the Fleckviehpopulation. The ejaculate was collected from bulls only once a week, which isnot usual. Respectively, the effects of age and season of collection on semenparameters were tested. The average volume of ejaculate by Fleckvieh bullswas 8.72\u202fmL, which is higher than results in studies of bulls which werecollected usually more than once a week. The average total motility was 72.82\u202f% and progressive motility was 67.99\u202f%. Sperm concentration reached onaverage  Insemination can be considered one of theoldest biotechnological methods that have significantly affected animalproduction worldwide . Currently,insemination is the most widely used reproductive technology withinteresting benefits and costs . Artificialinsemination is one of the most important reproductive biotechnologies,especially for dairy cattle, because the reproductive efficiency of dairycows is very important for the economic success of dairy operations. Even in beef production systems, goodreproductive performance is essential for efficient management andproduction . The method also has disadvantages, namelythat some bulls may excrete viruses in their semen without any clinicalsymptoms . This reproductive technology allows animals tohave more offspring, which reduces the need for parent animals .\u00aeCASA system is used to evaluate the quality of fresh sperm, which isconsidered a better method due to faster measurement but also in termsof accurately measuring more dimensions of sperm fertility . Sperm quality can be evaluated on its basic properties bymacroscopic or microscopic examination .There are many factors that can affect insemination. Bull fertility is oneof the important factors in cattle reproduction . It ismuch more important than in cows because one bull can be used to breed cowsin natural mating or potentially hundreds of thousands of times throughartificial insemination . The property of sperm can affectthe conception rate in dairy cows . The quality ofsperm is important, which depends mainly on the choice of bull . The quality and quantity of semen in bulls is responsible for apercentage of reproductive failure in cattle production . Each bull has different quality sperm. When collecting sperm fromcertain bulls, the sperm may be of acceptable quality, but when cryopreserved, thesperm does not survive, as the freezing and thawing process can adverselyaffect the nucleus, plasma membrane, and acrosomal and mitochondrial membranesof sperm. It may adversely affect the processes required for successfulfertilization . A Sperm Class AnalyzerBull semen quality parameters include volume, density, initial motility,sperm concentration, motility before filling, and motility after thawing. Some have added other parameters to this, namely theintegrity of the sperm membrane and the integrity of the sperm chromatin. Poorsperm quality is associated with subfertility . One of themost important criteria in quality assessment is sperm morphology . Sperm concentration is important to achieve optimalfertility during insemination. A low concentration of insemination doses leadsto reduced viability after thawing. The reduction of sperm viability indoses may be affected by fresh sperm volume, sperm count, and seminal plasmalevels after final dilution. The number of sperm needed to achieve optimalfertility is one of the main things for insemination .Sperm quality can also be affected by the age of bulls, as sperm quality inolder bulls decreases with age due to testicular degeneration, which leadsto loss of quality . The age of the bull can have asignificant effect on volume, motility, concentration, and sperm production.As the age of the bulls increases, the volume of sperm increases up to theage of 7. On the contrary, from the age of 3 and with increasing age, thesperm concentration of the bull decreases . Thelargest volume, motility, concentration sperm, and live sperm are usuallyobtained at the age of 5\u20137\u00a0years . The body enlargesand at the same time there is rapid growth of the testicles, so the amount of ejaculateincreases in older animals. With increasing age, small sperm defects mayappear, but in most cases the defects decrease with age .The season can also have a significant effect on cattle reproduction.Periods of high temperatures can lead to damaged spermatogenic cells which can resultin testicular degeneration and reduced spermatogenesis efficiency, resultingin poor sperm quality . Sperm morphology is better inspring and winter than in autumn and summer . Inperiods of drought such as spring and summer, it may result in a higherincidence of sperm head abnormalities, anomalies, and sperm counts, comparedto the rainy season . Overall, it is known that spermconcentration, sperm count, and motile cells per ejaculate are higher inspring and winter than in summer. The seasonal effect is not easy tocontrol, so it is important to know the other factors that are part of thiseffect, such as temperature, humidity, and day length, so that we have informationfor improved conditions in bulls .The aim of this study was to describe the quantitative and qualitative semenparameters from Czech Fleckvieh bulls and evaluate the effect of age andseason of collection on bull semen parameters.22.1\u00ae CASA system. All ejaculates were collectedusing the sampling method into an artificial vagina on a dummy. For sexualstimulation, bulls were allowed on false mounts and a standard artificialvagina was used  station ISB Bohdalec (Czech Republic) wereevaluated in our study. In total, 1029 samples were assessed using the SpermClass AnalyzerFor the purpose of testing the effect of season of collection, the bulls weredivided into four groups: winter, spring, summer, and autumn. There were 248bulls in the winter group (December\u2013February), 348 bulls in the spring group(March\u2013May), 183 bulls in the summer group (June\u2013August), and 250 bulls in theautumn group (September\u2013November). The effect of age was tested by dividing bullsinto four groups. The youngest group contained bulls up to 500\u202fd old (278bulls), in the second group there were bulls aged 501\u2013750\u202fd (304 bulls),in the third group there were bulls aged 751\u20131200\u202fd (221 bulls), and the oldestgroup contained bulls above 1200\u202fd old (226 bulls).2.2All descriptive statistics and general linear model (GLM) analysis were performed in SAS 9.1program . Pearson correlation coefficients and Box\u2013Cox transformations wereperformed in the program Statistica 12 . The volume and total motility afterthawing showed a normal distribution. In the case of total motility, progressivemotility, concentration, and total count of sperm, a Box\u2013Cox transformation wasperformed before using GLM analysis for testing the significance of explanatoryvariables (Table\u00a02).The effect of the chosen factors (explanatory variables) were tested via the GLMformula as follows:3The descriptive statistics of the primary dataset are shown in Table\u00a01. The generalmean of the volume was 8.72\u202fmL of ejaculate with a standard deviation of 3.15\u202fmL, and theaverage total motility was 72.82\u202f% (standard deviation of 14.11\u202f%).The progressive motility was lower, with an average value of 67.99\u202f% and a standarddeviation of 14.94\u202f%, which is close to the standard deviation of totalmotility. The average concentration of sperm per 1\u202fmL wasThe effects of age, season, and year of collection and the effect of the bull were testedfor each monitored parameter. The significance of these effects are shownin Table\u00a02. All effects had a significant influence on volume, total motility,and progressive motility. The effect of the bull was the most important explanatoryvariable for all traits, the percentage of the explained total variability by theeffect of the bull was from 29\u202f%\u201330\u202f%  to 50\u202f%  and about 32\u202f%\u201339\u202f% incase of volume, concentration, and total count of sperm. It shows that for thetotal motility after thawing there was a lower impact of the bull's effect for thesetraits. The rest of the explanatory variables  had a small impact on the total variability of the model in all observedparameters.The effect of the age of the bulls at the collection time, divided into four age groups,had a statistically significant influence on the volume of ejaculate (The year of collection (2019\u20132021) had a statistically significant influence onvolume ,spring (March\u2013May), summer (June\u2013August), and autumn (September\u2013November). The volume of ejaculate was highest in autumn (8.89\u202fmL) and the lowest inwintertime (7.87\u202fmL). Respectively, the total motility and progressive motility havethe same tendency; the highest was in summer (76.02\u202f% and 71.92\u202f%)and the lowest in autumn (71.51\u202f% and 66.10\u202f%). The concentration ofsperm per milliliter reached values from In general, in winter, the lowest values in volume of ejaculate andtotal count of sperm was reached. In autumn, there were lowest values in the case oftotal motility, progressive motility, concentration of sperm per milliliter,and total motility after thawing. No lowest values were observed in springtime. Also, no maximum values were observed in winter and spring. The highestvalues were in the summertime for total motility, progressive motility,concentration of sperm, and total motility after thawing. In autumn, the highest value in the volume of ejaculate was observed. Most of the parameters hadhighest values in the summer season, and highest values were mostly observed in theautumn season. In our study, the effect of motility after thawing showed nosignificance among seasonal categories, and on the other hand the season hadsignificant influence on the volume of ejaculate.3.3The relationships among sperm parameters are expressed in Table\u00a05, usingPearson correlation coefficients. Correlation between progressive and totalmotility was 0.99, there was a strong relationship between these two traits.A high correlation was between the total count of sperm and concentration (0.71).The total count of sperm had a moderate correlation to volume (0.54). A moderatecorrelation was also between total motility after thawing and, respectively, the totalmotility and progressive motility (0.48 and 0.49). All otherparameters are uncorrelated between each other, the correlation coefficientsreached values from 4Suyadi et al. (2020) described the volume parameters in different seasons andage of bulls in Indonesia. They stated that the volume was constant from 2\u20134\u00a0years old, then slightly increased from 5\u20138\u00a0years old and again increaseduntil 10\u00a0years old. A similar pattern was observed for sperm motility. On the other hand, sperm concentration was constant for all age categories. In ourstudy, all these parameters of volume, sperm concentration, and motilitycontinuously increased until the age category of 751\u20131200\u202fd old (until 3\u00a0years), and above 1200\u202fd old it slightly decreased (volume and motility) orincreased (sperm concentration). A significant effect of season was alsomentioned by Suyadi et al. (2020), but due to a different climate in Indonesia,there was a different trend.Fuerst-Waltl et al. (2006) analyzed the effects of age and environmental factorson semen parameters of Austrian Simmental bulls. The volume of ejaculate wasfrom 5.1 to 6.9\u202fmL. These values are smaller than our results (8.72\u202fmL)due to higher frequency of semen collection from the Austrian bulls.Semen samples analyzed in our research were collected once a week. The totalnumber of spermatozoa in the Austrian population was from Zamuna et al. (2016) evaluated sperm parameters in different breeds,including the Simmental breed in Indonesia. The volume of ejaculate by Simmentalbulls was 6.9\u202fmL. The average of total sperm was Sankhi et al. (2019) described the effect of age on semen parameters. Inthis study, the bulls were divided to three age categories: 3\u20134, 5\u20137, and 8\u20139\u00a0years old. The volume of ejaculate was lowest in the first group at 5.12\u202fmL, the second group had the highest volume of 6.72\u202fmL, and the third group had 5.98\u202fmL. This trend was similar to our results, but it is not comparable becauseof different age categories. In our research, younger bulls were included.The oldest age group from our study equals to the youngest group in the study by Sankhiet al. (2019). In this study, the highest concentration of sperm and motilitywere highest in the second age group. Our results also pointed to an increasingvalue of motility in the higher age group and decreasing of motility in the oldest agegroup. The concentration of sperm continuously increased from the youngest to oldestage category in our study. An analysis of bull semen parameters of differentbreeds in Ireland showed that the volume and concentration grewconsiderably from 10\u00a0months of age to 50\u00a0months of age .Murphy et al. (2018) observed total motility before freezing and afterthawing in different age categories in Holstein cattle. Both motilities werelowest in the category up to 1 year of age of the bulls. In other categories,there were similar values of total motility. The difference between youngestand other age categories was approximately 2\u202f%. In the case of totalmotility before freezing, it showed the same trend compared to our results, butafter thawing, the total motility was lowest in the last age category in ourstudy. The lowest value of total motility in different ages was more than 80\u202f% before freezing and more than 52\u202f% after thawing in the study ofMurphy et al. (2018). On the contrary, in our study, values of total motility indifferent ages were between 69.26\u202f% and 76.78\u202f% before freezing andfrom 39.98\u202f% to 43.91\u202f% after thawing. The volume of ejaculate showed asimilar trend in a study by Murphy et al. (2018), when there was an increasing ofvolume of ejaculate from the youngest to oldest age category, but the values ofvolume were in general lower than in our study. It could be due to a higherfrequency of sperm collection in the study by Murphy et al. (2018). For spermconcentration, there were different results in the study by Murphy et al. (2018),where up to 2\u00a0years of age the concentration increased and then slightlydecreased.Murphy et al. (2018) assessed the effect of the season on bull semen parameters.This study showed a significant effect on sperm concentration, total spermcount, and post-thaw motility. No significant influence of the season on the volumeof ejaculate was observed.Berry et al. (2019) described a phenotypic correlation among semen parametersfrom bulls in Ireland. The correlation between sperm concentration and volumeof ejaculate was 5Sperm parameters of Czech Fleckvieh bulls were comparable to otherpopulations of dairy and dual-purpose breeds. Due to a long interval betweensemen collection (once a week), particularly the volume of ejaculate was highercompared to similar studies. The total motility of spermatozoa was 72.82\u202f%, and 24\u202fh after thawing, it decreased to 40.88\u202f%. There was anobserved statistically significant influence of environmental factors of the seasonof collection and also the influence of age and individuality of the bull on semenparameters. The effect of age had no statistically significant influence onspermatozoa concentration, and the seasonal effect did not show a significantinfluence on total motility after thawing."
\ No newline at end of file