diff --git "a/deduped/dedup_0200.jsonl" "b/deduped/dedup_0200.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0200.jsonl"
@@ -0,0 +1,49 @@
+{"text": "Reinforcement - a process that helps prevent interbreeding between hybridising populations - is an important and little understood mechanism driving the completion of speciation Reinforcement, like sympatric speciation see , has chaSympatry\u2014Area(s) of overlap in the ranges of populations, enabling potential interbreeding.Allopatry\u2014Area(s) of population ranges that do not overlap with one another, preventing interbreeding.Sympatric speciation\u2014Speciation that occurs within a range of sympatry.Reinforcement\u2014The evolution of mechanisms that prevent interbreeding between newly interacting incipient species, as a result of selection against hybrids (narrow definition) or interspecific matings (broad definition) (See ion) See .Conspecific sperm precedence\u2014Disproportional fertilization of a female by sperm of a conspecific male, when that female has mated with both conspecific and heterospecific males.Much of the appeal of both reinforcement and sympatric speciation lies in the way they unite micro- and macroevolution. Reinforcement, a concept popularized by Reinforcement provides a pathway toward the completion of the speciation process. Imagine that two divergent populations  come into contact after a period of allopatry . If the If the isolating mechanisms between these populations are only partially complete, extensive hybridization may occur. This can result in fusion back into a single population, or in the swamping of one population's gene pool by the genes of the other (extinction). But there is another possibility, one that can cause the speciation between the two populations to proceed. Remember that if the populations have been separated for long enough, it is likely that hybrids between them will have relatively low fitness. Individuals who mate with members of the opposing population will therefore produce offspring of poor quality, and hence have lower fitness than individuals that mate within their own population. This favors the evolution (or further divergence) of characteristics that cause mating within, rather than between, populations . SpeciatThis process, the evolution of premating isolation after secondary contact due to selection against hybrids, is reinforcement sensu Despite the substantial progress in our understanding of reinforcement that has been achieved over the last few decades, many questions remain about the process. These questions lend themselves to exploration by a broad variety of disciplines , approaches  and taxonomic systems.Doubtless, the most important unanswered question about reinforcement is how often it occurs. It is very difficult to prove that reinforcement is occurring, or has occurred, between two species. Reinforcement occasionally leaves a signature, called reproductive character displacement, in which mating characteristics have diverged between populations in areas of sympatry but not areas of allopatry  the rel. In sympDrosophila pseudoobscura and D. persimilis (Several isolated examples of reinforcement between specific pairs of species have been demonstrated, fairly conclusively, in a variety of taxa including rsimilis , flycatcrsimilis , sticklersimilis , spadeforsimilis , and walrsimilis  (see alsrsimilis . These sDrosophila (While examples such as these provide essential information about reinforcement, their slow rate of compilation and biased reporting do not provide efficient ways to assess how often reinforcement occurs in general. Comparative approaches, which examine patterns across a broader taxonomic group, can also provide support for reinforcement without these detailed mechanistic analyses (review in osophila . By compAnother area where further research is essential is the determination of which biological factors promote reinforcement, as opposed to population fusion. Theoretical studies, using mathematical models and computer simulations, are proving useful in pinpointing the effects of many factors such as migration rates and patterns, the type of selection against interspecific mating, and the genetic basis of premating isolation (reviews in In recent years, exciting developments have started to take place in the analysis of the genetics of reinforcement (reviewed in PLoS Biology illustrates the extent of the insights that can be made with this approach. Using high-resolution genetic mapping the authors have identified the locations of genes that cause increased discrimination against Drosophila persimilis males by D. pseudoobscura females, due to reinforcement in sympatry. Surprisingly, these genes map to very different areas of the chromosomes than do genes that cause a basal level of mating discrimination between the species in allopatry. Among other insights, the position of these genes suggests that the reinforced discrimination is based on odor, not on the mechanism used in allopatry, male song. This leads to the novel conclusion that reinforcement is not just increasing the strength of an already existing mechanism of species discrimination, but is occurring through the development of a new discrimination system. These kinds of developments can also motivate more realistic theoretical models of the reinforcement process.Genetic analysis is also allowing a new understanding of the mechanisms by which reinforcement might be taking place in specific cases. Work by What if, when our assessment of the frequency of reinforcement is improved, it turns out to have been a rare occurrence in the generation of current biological diversity? The study of reinforcement is broad and varied enough that many of our findings about the process would still have wide-reaching implications.First, recall the claim, at the start of this article, that studying reinforcement reveals much about the role of microevolution in the macroevolutionary process of speciation. Knowledge gained about this relationship is not only directly applicable to the very similar process of sympatric speciation, but can also tell us a great deal about speciation caused by ecological adaptation and sexual selection, which are critical components of reinforcement in many systems e.g., . StudiesSecond, analysis of reinforcement clarifies the interactions between levels of reproductive isolation that occur at different stages in the life cycle. Reinforcement, broadly defined, can be driven by isolation at the postzygotic level or by incompatibilities that occur between mating and zygote production (postmating-prezygotic incompatibilities; Finally, regardless of whether reinforcement has been a common pathway in speciation, its relevance may be increasing. Reinforcement is a possible outcome anytime species that are capable of hybridization come into contact. Human activity is increasing the incidence of secondary contact by altering habitat and introducing invasive species. This contact often results in hybridization (reviews in"}
+{"text": "The relationship of reproductive factors, such as nulliparous vs ever-parous status, age at first birth, and total parity, with morphologic prevalence of fibrocystic changes were examined using autopsy material from three ethnic/racial groups at varying risks for breast cancer. Although there was a trend toward a protective effect of ever-parous status, there was no statistically significant difference in the prevalence of fibrocystic disease in any group defined by parity status. The ethnic differences in the prevalence of fibrocystic changes were not explained by the differences in parity status distribution for the three ethnic/racial groups."}
+{"text": "Long-standing inequities exist in the amount of research on diseases that affect the developed world and those\u2014such as leishmaniasis and schistosomiasis\u2014that affect nonwhite populations who live in the developing world. These inequities have also been perceived to exist when white and nonwhite populations coexist in developed countries.Ethnic groups differ in their susceptibility to particular diseases. These differences can be genetic\u2014the result of gene mutations that are more prevalent in some ethnic groups. They may also be due to social factors\u2014in industrialized countries, for example, ethnic minorities are often poorer, less educated, and more frequently unemployed than their white counterparts. Studies in white populations, therefore, cannot necessarily be extrapolated to other ethnic groups.Cardiovascular disease is a major cause of death for all ethnic groups in developed countries, and the risk is especially high in those originating from South Asia. In the UK, for example, early deaths from coronary heart disease in Indians, Bangladeshis, Pakistanis, and Sri Lankans are about 50% higher than the national average. For Caribbeans and West Africans, on the other hand, the rates are much lower than average.Meghna Ranganathan and Raj Bhopal systematically reviewed the scientific literature over the past decades to assess the extent to which different ethnic minorities were included in cardiovascular cohort studies in Europe and North America.They identified 72 studies, 39 of which started after 1975 . Forty-one studies were conducted in Europe and 31 in North America, and one study involved participants from both continents.Overall, the researchers found, there is little information on cardiovascular research in ethnic populations\u2014just ten studies compared white and nonwhite populations, and only five focused on one nonwhite ethnic group. All 15 of those were conducted in the United States. Despite the high risk of cardiovascular disease in ethnic minorities in Europe, not one European study so far has investigated the disease specifically in these populations.In general, it seems that issues of race or ethnicity have rarely been taken into account. Decisions about which ethnic groups to include were not often a part of the study design nor were they made explicit in the study report, and few articles gave details of the ethnic composition of the study population. Even when nonwhite participants were included in studies, there were often too few of them to allow for analysis by ethnicity.In some cases, researchers were open about their aim to study only white populations. In others, by selecting participants based on employment status or by conducting studies in rural settings, researchers were unlikely to include many participants from nonwhite ethnic groups that tend to cluster in cities.In cardiovascular disease, in particular, clear ethnic variations in risk mean that studying nonwhite populations is crucial if their health needs are not to be neglected, say the authors.The first step toward better understanding why some ethnic groups are more susceptible to disease is acknowledging the need for studying the question. Because such studies are expensive and challenging, say Ranganathan and Bhopal, they will only be done when there is a demand for them."}
+{"text": "Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition and OCA2, tyrosine-positive albinism, is the most prevalent type found throughout Africa. Due to the lack of melanin, people with albinism are more susceptible to the harmful effects of ultraviolet radiation exposure. This population must deal with issues such as photophobia, decreased visual acuity, extreme sun sensitivity and skin cancer. People with albinism also face social discrimination as a result of their difference in appearance. The World Health Organization is currently investigating the issues concerning this vulnerable population.Systematic electronic search of articles in PubMed concerning albinism in Africa. Furthermore, a World Health Organization (WHO) pilot survey of albinism was drafted in English, French and Portuguese, and distributed to African countries through WHO African Regional Offices (AFRO) in an attempt to gather further information on albinism.Epidemiologic data on albinism, such as prevalence, were available for South Africa, Zimbabwe, Tanzania and Nigeria. Prevalences as high as 1 in 1,000 were reported for selected populations in Zimbabwe and other specific ethnic groups in Southern Africa. An overall estimate of albinism prevalences ranges from 1/5,000 \u2013 1/15,000. In addition, both the literature review and the survey underscored the medical and social issues facing people with albinism.The estimated prevalence of albinism suggests the existence of tens of thousands of people living with albinism in Africa. This finding reiterates the need for increased awareness of and public health interventions for albinism in order to better address the medical, psychological and social needs of this vulnerable population. Oculocutaneous albinism (OCA) encompasses a heterogeneous group of genetic conditions with an autosomal recessive inheritance. It is characterized by hypopigmentation of the skin, hair and eyes due to a reduced or lack of cutaneous melanin pigment production . ConsequThere are two types of OCA: tyrosinase negative OCA1) and tyrosinase positive (OCA2). In OCA1, there is little or no melanin production due to the lack of a functional tyrosinase, the critical enzyme required in the melanin biosynthetic pathway. In the more prevalent OCA2 type [ and tyroThere is growing evidence of social discrimination and stigmatization directed towards this population ,5. Alongalbinism, albino(s), Africa, epidemiology, population study, prevalence, health, cancer, social and psychological.We conducted a literature search using PubMed with no date or language limitations. The search was conducted from June to July of 2005. The key terms used in this first set of searches included: References which were not peer reviewed, did not specifically relate to Africa and/or albinism, were duplicates or focused only on basic scientific aspects of albinism, were excluded. For a small number of articles, only the abstracts were included because the full texts were unavailable.After reviewing the remaining abstracts and full texts of our first search, we only found pertinent information for the following countries: South Africa, Zimbabwe, Tanzania, Nigeria. Therefore, we extended the search in a country-specific manner and used key words including the countries listed above, along with the term \"albinism\". Efforts were made to contact some of the authors who study and had published articles concerning Albinism in Africa. Additionally, a manual search of reference lists was conducted but no additional useful references were identified.We attempted to follow the guidelines outlined by the MOOSE group  but sincA pilot questionnaire was drafted to augment the limited results of the literature search on albinism. This is shown in Appendix 1. The topics covered included data availability, medical issues, health care access, social stigmatization, economic status and community support/outreach programs. The survey was available in English, French and Portuguese and distributed via the WHO African Regional Office (AFRO) to its African Member States.The search yielded a total of 306 publications. 76 publications without abstract, mainly letters and commentaries, were excluded. After application of the inclusion and exclusion criteria, only 15 publications with full texts remained. These publications were chosen because they contained epidemiological information and/or data on medical/social consequences of living with albinism. The epidemiological, medical and social concerns facing this population were analysed, by country. Prevalence data by country were abstracted and entered into a table. Information on non-quantitative issues of interest for this review were abstracted in a similar way and summarized for presentation and discussion.Seven publications  contained epidemiological data on prevalence for South Africa, Zimbabwe, Tanzania and Nigeria, as shown in Table In 1982 Kromberg et al. studied prevalence in the ethnic groups in Soweto and Johannesburg, South Africa. 206 individuals with albinism were surveyed and the 1970 census data for Johannesburg 803,511) was used to calculate the overall prevalence of 1 in 3,900 [ was usedHigh prevalence does not seem to exclusively occur in urban regions. A prevalence of 1 in 1,515 was reported from a prospective study of congenital anomalies of liveborn neonates in Sovenga, a more rural region in Northern Transvaal, South Africa . This isA school-based study in Zimbabwe ascertained 157 albinism cases among 772,758 primary school pupils, giving a prevalence of 1 in 4,922. Similar results  were found among secondary school students. However, there was a substantial difference in the prevalence when the data were analysed by provinces: the prevalence in Matabeleland South  was only half of that found in Mashonaland East  .Similar to South Africa, there was also a sizeable difference between rural and urban populations in Zimbabwe, most of which was due to Harare's high prevalence of 1 in 2,792 and 1 in 2,661 in the primary and secondary schools, respectively. Overall, urban schools, including Harare, had a prevalence of 1 in 3,268 compared to 1 in 4,694 in the rural schools . As mentAlthough there have been some studies addressing the health conditions of people with albinism in Tanzania, the data available on prevalence are not as extensive as for South Africa or Zimbabwe.A study of individuals with albinism who were registered in the Tanzania Tumour Centre in Dar-es-Salaam estimated a prevalence of 1 in 1,400. However, this estimation is difficult to extrapolate to the entire population, given the data's limitation only to those individuals enrolled in the registry .Nigeria's data on the epidemiology of albinism were also sparse. A prevalence of 1 in 15,000 has been reported for the East Central state through a study investigating people with albinism attending the hospital with dermatological problems. To these individuals, a questionnaire concerning demographical information such as age and gender as well as knowledge of other persons with albinism was distributed. Then, the authors expanded the investigation to educational, health and religious institutions and markets in order to reach a broader population . The preFindings of higher prevalence in urban areas may be due to various factors. Given the higher population density, it may have simply been more feasible to collect comprehensive data from urban areas. Migration to urban areas for education, health care and indoor occupations may also be contributing factors.In addition, since many of the studies were school-based, one must consider the role of attendance. For example, urban families may have a greater ability to send their children with albinism to school. There may be more schools in urban areas that accommodate for the visually disabled and for the UV protection needs of this population. On the other hand, some families may only be able to send one or a limited number of children to school, in which case it is possible that the affected child will not be chosen in the majority of families. All of the above situations introduce bias into the prevalence estimates.Ethnic differences also influence prevalence estimates. In Zimbabwe, given that the majority (83.1%) of people with albinism belonged to the Shona tribe, the diversity in the observed prevalence may be due to a founder effect or genetic drift since the Shona population have generally limited their residence to southern Africa . KromberAside from the limited geographic mobility, consanguinity, along with other traditional marriage practices, may also be factors to consider in evaluating current and future prevalence trends of albinism ,8,9,11.Several publications report a relatively greater number of individuals with albinism in the younger age groups (below 30 years). In the East Central state of Nigeria, 89% of identified people with albinism were in the age range of 0 \u2013 30 years . A mean Also in Cameroon, Nigeria and Tanzania, observations indicate a low number of people with albinism in age groups above 30 ,10,17.Whether this truly points to an increased mortality of people with albinism at a younger age  could only be evaluated on the basis of more specific mortality data. However, such data are missing.In this particular population, ocular problems are ubiquitous. In some studies, visual difficulties have been reported to occur in 100 % of people with albinism ,15. Due Aside from the visual handicaps, UV exposure is highly detrimental to the hypopigmented skin. Lack of melanin predisposes this population to severe skin damage. The majority of these lesions are in the most sun-exposed parts of the body such as the face, ears, neck and shoulders. Skin lesions include sunburns, blisters, solar elastosis/keratosis, ephelides, lentiginosis, and superficial ulcers. Ultimately, squamous cell, and less frequently basal cell, carcinomas may occur -18.In addition to their health concerns, people with albinism must also deal with psychological and social challenges. In Nigeria, one study collected written accounts of people with albinism. These individuals stated that they tended to be more withdrawn from social situations to avoid being noticed. They were more emotionally unstable and had less assertive personalities than people without albinism. Also, they considered their society to be generally unkind and rejecting, even though they did have close friends .Much of the social discrimination appears to stem from the communities' lack of education about albinism's etiology. There is limited awareness of its genetic inheritance and therefore, traditional myths and superstitions are numerous . For exaFurthermore, their family members may also experience discrimination from the community. In light of the traditional myths concerning albinism's etiology, mothers of affected children may be subjected to a great deal of stigma and psychological distress.WHO drafted and distributed a survey see  to the AThe following 12 countries returned surveys: Cameroon, Congo, Equatorial Guinea, Ghana, Guinea Bissau, Mali, Mauritius, Mozambique, Niger, Rwanda, Sao Tome and Principe, and Tanzania. Respondents were either medical doctors affiliated with the Ministry of Health  including dermatologists (Mauritius), Ministry of Health officials , WHO Country Officers (Guinea Bissau) or NGO personnel/other .We distributed three language versions of the WHO Pilot Survey: English, French and Portuguese. Among the survey responders, the Francophone countries included Rwanda, Niger, Mauritius, Mali, Equatorial Guinea, Congo, Cameroon. The Anglophone countries included Ghana and Tanzania and the Lusophone countries included Sao Tome and Principe, Mozambique and Guinea Bissau. The countries were divided into Francophone, Anglophone and Lusophone groups purely on  language grounds. There was no intent to use this grouping for comparative analyses.Prevalence data were unavailable for the majority of the countries. A few countries did report the prevalence of albinism, but there was much variation and, in comparison to published data, the reported high estimates appeared somewhat unrealistic. Furthermore, the data sources of these estimates were not specified.In terms of health care, survey respondents felt that much more needs to be done to address the needs of people with albinism. None of the countries, aside from Tanzania, had specialized clinics to handle the dermatological consequences of albinism. Five countries  reported that they provide some advice on UV radiation protection for people with albinism in clinics and hospitals. Overall, however, the care was felt to be incomprehensive due to the lack of medical personnel's awareness of albinism, discrimination against people with albinism and/or a lack of resources such as sunscreens. Also, the aid was only provided if actively sought. This passive approach raises concern considering many persons with this condition may not seek regular medical attention.Most of the surveys reported a lack of trained medical personnel. Challenges to better health care also included the barriers existing among the health workers in approaching people with albinism (lack of sensitization), lack of finances and education among this population, high cost of protective products such as sunscreens and hats/medications and social preconceptions and marginalization. Seven of the surveyed countries  reported the use of traditional medicines by people with albinism. However, the information in the survey was limited and it could not be substantiated whether people with albinism use traditional medicines differently from the general population, both in terms of frequency and rationale.The discrimination of people with albinism is not only limited to the health care arena. The surveys report a great amount of stigmatization in schools from fellow students and teachers and even within their own families. Stigmatization stems from traditional explanations of albinism of which there are many (see above) . In addiIn light of these difficulties, it is not surprising that many surveys reported abuse and psychological problems within this population.However, there is some evidence of social support for people with albinism. This includes dedicated NGOs such as \"SOS Albinos in Mali\" and \"SOS enfants vulnerables sans frontiers\" in Congo. Tanzania and Congo reported that children with albinism who have visual difficulties may enroll in specialized schools for the blind. Community outreach programs exist in some surveyed countries .Albinism is a disorder that affects individuals and their families medically, socially and psychologically. For some, these latter issues may be more of a burden than the actual medical complaints. While the medical issues have been studied for decades, we have tried, through this review, to shed light upon the dearth of currently available epidemiological and public health data on albinism in Africa. Given this lack of data, a prevalence range for the general population from 1/5,000 \u2013 1/15,000 seems plausible, indicating that tens of thousands of people in southern Africa are affected. Though low in comparison with other major health problems, these figures and the even larger numbers of indirectly affected persons, qualify albinism as a public health issue deserving further attention to increase the awareness of and information about this condition.Our survey results augment the literature review. The main focus was on health service and social issues, and responses clearly indicate a range of particular problems for people with albinism. One concern is that health care systems appear to lack responsiveness to the needs of people with albinism in most of the countries surveyed, but there are notable exceptions. In terms of social status the survey reports that people with albinism frequently are disadvantaged, and several associated factors were noted by respondents. However, also here the picture may be broader: across Africa there are numerous examples of people with albinism in high socioeconomic strata, as professionals, politicians, musicians etc. Some have used their public status to support action for people with albinism.In terms of our survey, there are several limitations. The number of responding countries was small and due to the dissemination mechanism employed, we had little influence on the choice of actual respondents to the survey. Therefore, it is likely that not all respondents were fully aware of the scope and depth of problems facing the population of people with albinism in their country. Accordingly, we found varying degrees of detail and specificity in the responses. The responses should be seen as anecdotal rather than based on scientific studies; in this pilot survey we did not ask for specific supporting scientific evidence. Nevertheless, the survey provided some valuable information and shed light on the gaps in knowledge. These can serve as a guide for more detailed assessments and programmes in the future.A multidisciplinary approach is recommended for future research and intervention programmes . EpidemiPublic health programmes need to take into account the various challenges facing people with albinism. Currently, there are some programmes in place to address the medical concerns of this population in certain parts of Africa. For example, the Regional Dermatological Training Center (RDTC) in Moshi, Tanzania runs a mobile skin care clinic where a doctor and a nurse regularly visit villages to check the skin of people with albinism and provide education on protection from UV exposure . Also, iHowever, further efforts in more African countries are required to adequately address health and social needs of people with albinism. Many of the following recommendations have been mentioned in previous publications ,6. Our s\u2022 Conduct research/surveys to determine the prevalence of albinism in the country\u2022 Based on research information, develop appropriate strategies for assisting people with albinism that include the following: Integrate albinism awareness in the school curricula, especially to correct misconceptions about the etiology of albinism Educate counsellors in schools about albinism Train health care providers at clinics and hospitals about albinism and the effects that UV exposure can have on this condition Encourage community self-help support groups Implement programmes to aid people with albinism in finding indoor occupationsWHO's INTERSUN programme  providesAlbinism, especially in Africa due to extreme sun exposure, is a condition that requires further attention than in the past. Although prevalence data are scarce and further epidemiologic research is needed, the number of people living with albinism in Africa is likely to be as high as tens of thousands. Our findings underscore the need to better address the already known medical problems facing people with albinism, but also issues of social discrimination against this population. Some progress has been made thus far in terms of medical and social care but we hope to further increase the awareness of albinism throughout African societies in the future. Public health action should focus on educational, medical and occupational settings.The author(s) declare that they have no competing interests.MR developed the project idea. EH and MR formulated the questionnaire. EH performed the literature review. EH and HZ organized and analysed the survey, drafted and critically reviewed the paper. MR provided sections to introduction and discussion. All authors reviewed and agreed on the final version.The pre-publication history for this paper can be accessed here:Albinism: Information Survey WHO 2005. The pilot survey was drafted in English, French and Portuguese and then distributed through the WHO Regional Offices in order to gather further insight into the problems facing people with albinism and any available epidemiological information throughout Africa.Click here for file"}
+{"text": "Cohort studies are recommended for understanding ethnic disparities in cardiovascular disease. Our objective was to review the process for identifying, including, and excluding ethnic minority populations in published cardiovascular cohort studies in Europe and North America.We found the literature using Medline (1966\u20132005), Embase (1980\u20132001), Cinahl, Web of Science, and citations from references; consultations with colleagues; Internet searches; and RB's personal files. A total of 72 studies were included, 39 starting after 1975. Decision-making on inclusion and exclusion of racial/ethnic groups, the conceptual basis of race/ethnicity, and methods of classification of racial/ethnic groups were rarely explicit. Few publications provided details on the racial/ethnic composition of the study setting or sample, and 39 gave no description. Several studies were located in small towns or in occupational settings, where ethnic minority populations are underrepresented. Studies on general populations usually had too few participants for analysis by race/ethnicity. Eight studies were explicitly on Caucasians/whites, and two excluded ethnic minority groups from the whole or part of the study on the basis of language or birthplace criteria. Ten studies were designed to compare white and nonwhite populations, while five studies focused on one nonwhite racial/ethnic group; all 15 of these were performed in the US.There is a shortage of information from cardiovascular cohort studies on racial/ethnic minority populations, although this has recently changed in the US. There is, particularly in Europe, an inequity resulting from a lack of research data in nonwhite populations. Urgent action is now required in Europe to address this disparity. A systematic review reveals a shortage of information on racial and ethnic minority populations. This compromises the relevance of the evidence underlying health policies and guidelines for nonwhite patients. Cardiovascular disease is the most common cause of death in most industrialised societies and is either the leading or a dominant cause of death for all racial and ethnic groups in the US and the UK. The risk is especially high amongst those originating from the Indian subcontinent\u2014South Asians .http://www.migrationinformation.org/GlobalData/countrydata/data.cfm). The inclusion of minority groups in such cohort studies is important not only to compare differences in health status between groups but also to assess risk factor-outcome relationships within such groups. Levy [Research on ethnic group differences and similarities may potentially help advance understanding of the relationships between risk factors and cardiovascular disease. Cardiovascular cohort studies have been one of the key approaches for achieving such understanding ,3. Most ps. Levy .The main objective of this review was to identify how the major cardiovascular cohort studies in North America and Europe included or excluded ethnic minority populations. The methods and aims of this review could be extended, but these geographical areas were chosen because cardiovascular cohort studies have been pioneered by groups in these locations .There is no clearly defined line between what is, and what is not, a cardiovascular cohort study, and individual judgment is required to make that determination. For the purposes of this review, cardiovascular cohort studies were defined as prospective studies in defined populations, with a primary aim of studying risk factor-outcome relationships for major diseases such as stroke and coronary heart disease. Studies included are summarised in Cohort studies with a multipurpose aim, those focused on other diseases, and those arising from studies originally designed as cross-sectional surveys or trials were generally excluded, as were studies of populations in which the investigators had little or no control over the sample , although they may have yielded some cardiovascular data. A list of the studies that were given careful consideration but excluded, with reasons given, is in The starting point was a preliminary list prepared by RB in 1999. Both authors searched for studies independently between the period April 2000 through September 2005, using a variety of sources and repeated searches. Articles were identified using the electronic databases Medline , Embase (1980\u20132001), Web of Science, and Cinahl using the following keywords: \u201ccardiovascular disease\u201d or \u201catherosclerosis\u201d or \u201ccoronary heart disease,\u201d and \u201ccohort studies\u201d or \u201cepidemiological studies\u201d or \u201cprospective studies\u201d. The search was repeated with the words \u201cethnicity\u201d or \u201cethnic groups\u201d or \u201cracial groups\u201d added. In Medline the search used free text and MESH terms. This led to more than 150 references in each database. The keywords \u201cethnicity and cardiovascular disease\u201d used in the Web of Science database yielded more than 300 references. We examined the bibliographies of retrieved articles such as the meta-analysis of prospective observational studies by the Oxford Collaborative Group [The search was limited at the outset to papers in English, as the authors cannot read other languages and most major cohort studies are published in English-language journals. Database filters for English papers only were not applied. Papers with titles in non-English languages were not considered further. Although a count of such papers was not made, our impression is that they were few. Nonetheless, it is unlikely that any important European studies published in languages other than English have been missed. At the Migrant Health in Europe International Conference held in Rotterdam in 2004, RB led a workshop discussing the potential development of a European multiethnic cardiovascular cohort study. Separately, RB presented this paper. The audience of knowledgeable participants were unaware of similar studies in Europe. At the conference many papers on cardiovascular diseases were presented, but none reported such studies. Professor Marc Bruijneels has collected information across Europe, for a proposed European project to compile data by ethnic group but he found no cardiovascular cohort data by ethnic group .Studies were eligible for consideration that were designed to examine prospectively the relationship between risk factors and cardiovascular disease outcomes (coronary heart disease and stroke) in population samples. By population samples we mean natural living populations and exclude studies of people with existing diseases. In view of the nature of this study reflecting how investigators made decisions on who to include and exclude in the sample, studies without a sampling frame based on volunteers were excluded, as investigators would have little decision-making latitude in such circumstances. Some studies were concerned with multiple outcomes, and where publications showed an emphasis on cardiovascular diseases these were included, e.g., the Nurses Health Study . Cohort In total, 72 cardiovascular cohort studies in the US/North America and Europe were included. This review focused on papers describing the design and rationale of the study. For example, the Framingham Study has hundreds of secondary papers, but a few discussing methods were identified. This approach is justified on both scientific and pragmatic grounds. Scientifically, inclusion/exclusion of particular populations is a design issue that is handled at the planning stage. Pragmatically, it would have been inefficient to examine multiple papers for information that ought to be provided in the baseline paper. Only one paper per study is cited here, although sometimes several were examined. Studies based on combining existing cohorts, e.g. the Sleep, Heart and Health Study , are notThe research questions that guided data collection from the studies are listed in Wherever possible and appropriate, the terminology used for ethnic group classification has been quoted directly from the paper, even when this is not in agreement with currently accepted terminology and is potentially offensive. Similarly, we have accepted the concepts of race and ethnicity provided by authors, but for reasons discussed by Senior and Bhopal we have tended to use the word ethnicity rather than race, and we apply the concepts as discussed in their paper .Our use of the term nonwhite reflects our focus on populations that do not have European ancestral origins , and would not describe themselves, or be perceived as, white. This focus reflects long-standing, widespread concern about inequities in health and health care that are particular to such populations.The main aim of each study, with slight variations, was to determine the incidence of coronary heart disease and/or stroke and study risk factor-outcome relationships.http://www.migrationinformation.org/GlobalData/countrydata/data.cfm, and knowledge of ethnic variations in cardiovascular disease was appearing in Europe. Studies numbered 41 in Europe, 31 in North America, and one (the Seven Countries study) in both. Ten studies were designed to compare white and nonwhite populations, while five studies focused on one nonwhite racial/ethnic group; all 15 of these were conducted in the US.Studies seldom provided details on the racial or ethnic composition of the study setting or sample, and when they did the details were minimal; 39 gave no description at all. Several studies were located in small towns or in occupational settings, whereas minority populations tend to live in cities and work in a restricted range of workplaces. The investigators in some studies saw the population homogeneity of such locations as valuable. Studies that were based on general populations usually had too few participants for analysis by race or ethnicity. The process by which decisions on inclusion and exclusion of racial/ethnic groups were rarely made explicit. Eight studies explicitly stated they were on Caucasians or whites, and two excluded ethnic minority groups using language and birthplace criteria. One study  excludedNone of the studies done in Europe mentioned studying nonwhite racial or ethnic variations in their aims. The ethnic composition of the source population for the sample was not described or discussed, but sometimes the text showed awareness of the issue of ethnic heterogeneity; e.g., the Paris Prospective Study  was explMost North American studies gave some attention to the issue of ethnicity and race, usually in relation to the sample rather than the racial/ethnic composition of the setting of the study. The assignment of racial/ethnic group, and its validity, were not made explicit. Five studies focused on one nonwhite group: the Meharry Cohort Study  focused Ten studies compared one or more ethnic groups simultaneously: the Evans County Study , the ARIThe study of ethnic variations in disease is long established, with a research base founded in the 19th century and strengthening in the 20th century, particularly in North America. The cardiovascular research community has been aware for some decades of important variations in the frequency, causes and consequences of cardiovascular diseases in non-European origin ethnic minority populations. Well-publicised government reports and academic papers discussed these issues in the mid-1970s and 1980s, e.g., heart attacks in East London were shown to be high in Asians (mainly from the Indian subcontinent) and low in Caribbeans . MortaliSince this review was limited to papers published in English, there was the potential to miss relevant, large-scale cardiovascular cohort studies in Europe and North America published in other languages. The reference lists of papers examined did not, however, cite them, and consultations around Europe did not identify them see . Bias frUnpublished (grey) literature has not been included in this review, with the exception of the Jackson Study , which lThe review answered the research questions . There aAlthough the sample size may be too small to produce analysis by ethnic group, inclusion of minority populations is still important. Such cohorts are population-based and should be generalisable to populations similar to that from which the sample has been drawn; without information on ethnic composition, generalisability becomes more difficult. Such studies can also provide a foundation for larger studies focusing on minority populations, and potentially could lead to analysis by ethnic group after pooling of data.Analysis of data by ethnic group requires adequately powered studies, and these will be large-scale, expensive, and challenging. Such studies will be funded only when there is agreement on the need for them. There are more than 30 European cohort studies, many started within the last 20 years when ethnic variations were already described, yet collectively or singly they are unable to provide analysis by ethnic group. This paper contributes to the needs assessment.http://www.migrationinformation.org/GlobalData/countrydata/data.cfm). This is especially so in European studies, e.g., those set in major cities such as London, Amsterdam, and Paris. This observation applies to studies started after the mid-1970s when understanding about the needs of minority groups was substantial, many cohort studies on white populations were in place, and knowledge about causes and control of cardiovascular disease in white populations was already advanced. The studies that were designed to study racial/ethnic minority groups were all in the US, and were started more recently, in response to an increasing recognition of the needs of ethnic minorities.Many cohort studies have focused on white populations despite being set in multiracial/ethnic nations and regions , and the possibility of indirect or direct discrimination. In many ways the issues highlighted echo those applying to women until recently. These explanations require further analysis and research.Data are vital to assess the needs of ethnic minority groups; to implement, evaluate, and adjust the necessary health policies; and to provide excellent clinical care based on valid risk prediction models. The Race Relations (Amendment) Act 2000 in the UK  and lawshttp://www.ukbiobank.ac.uk/). This paper raises broader questions that merit debate on how the research community responds to the increasing ethnic diversity of populations internationally.A Lancet commentary has called for cohort studies in such groups . The traTable S1Found at 10.1371/journal.pmed.0030044.st001 (139 KB DOC).Click here for additional data file.Table S2Found at 10.1371/journal.pmed.0030044.st002 (41 KB DOC).Click here for additional data file.As a result of migration, mostly for economic reasons, populations in many countries around the world are becoming increasingly diverse. In many cases, ethnic minorities differ in their socio-economic circumstances, culture, lifestyle, and genetic make-up from the majority population . These differences in risk factors (such as diet and smoking) can influence a person's susceptibility to disease. For some diseases, such as heart disease, it is well known that particular ethnic groups are at higher risk than others. It is not always clear, though, whether this high risk is due to socio-economic circumstances, culture, genes, lifestyle, or a combination of these factors.Cardiovascular disease, which can cause heart attacks and strokes, is the most common cause of death in the US and most European countries. Rates of cardiovascular diseases vary substantially between different countries, and also between different ethnic groups in ethnically diverse countries such as the UK and the US. Researchers and health policy makers need to understand more about the variations in cardiovascular disease. To ensure the best possible health care for the entire population, they need to know how exactly the risks differ between different ethnic groups and what causes those differences. One key research tool to address these questions are so-called cohort studies (a cohort refers to a specific group of people that are studied over time). Cohort studies are \u201cforward looking\u201d\u2014they typically enroll a large number of healthy participants who are then followed over a number or years to study long-term health outcomes. Over the past decades, a number of cohort studies have focused on cardiovascular disease. In this study, researchers wanted to find out whether these cohort studies included or excluded ethnic minority groups.They searched the medical literature for cohort studies on cardiovascular disease. They found 72 that met their criteria and analyzed them in detail. The researchers discovered that most of the cohort studies did not provide detailed information on the ethnic composition of the broader populations from which the participants were recruited. Most of them also did not state whether minority groups were included in or excluded from the study. Additionally, the researchers found that many of the studies did not give details on the ethnic composition of the participants themselves, or on how the participants' ethnicity was determined. Studies with participants that were representative of diverse populations usually were not large enough to answer the kinds of questions necessary to determine differences between different ethnic groups. However, ten of the studies were designed specifically to compare white and nonwhite participants, and five studies focused on nonwhite minority groups specifically. All 15 of those studies were done in the US.Despite the knowledge that ethnicity matters in cardiovascular disease, most cohort studies have not been designed to further explore this connection. The situation in the US seems to be changing, with a number of recent studies designed to add data on cardiovascular disease risks and causes among minority populations. No such studies have yet been reported in Europe. Research strategies in Europe should be adjusted to meet this need.The following Web sites provide information on minority participation in health research.Office of Minority Health Research at the US National Heart, Lung, and Blood Institute:http://www.nhlbi.nih.gov/about/omha/Center of Excellence in Minority Health and Health Disparities at Harvard Medical School:http://www.mfdp.med.harvard.edu/coe/The Migration Information Source provides data on the composition of the populations for many countries:http://www.migrationinformation.org/Department of Health, England:http://www.dh.gov.uk/PolicyAndGuidance/EqualityAndHumanRights/fs/en/South Asian Health Foundation:http://www.sahf.org.uk/events.html"}
+{"text": "In the UK, all ethnic minority groups have higher rates of diabetes than the general population. Although there have been a number of projects to assess diabetic care amongst minority ethnic groups in the United Kingdom, little is known about the extent to which the needs of ethnic minority groups are actually met by the National Health Service (NHS) Scotland. Therefore we conducted this study to understand of the current situation for diabetes care available to minority ethnic groups in Scotland.We conducted this cross-sectional study in all health boards in Scotland. A questionnaire was designed based on expert comments. It was completed by Local Health Care Cooperatives (LHCC) managers, chairs, diabetes specialist nurses and public health practitioners.57 of questionnaires were returned (response rate = 69.5%). Of these LHCCs, 71% responded that diabetes was part of their LHCC plan. However 69% answered that ethnic group was not recorded by community services and GPs, and 80% of LHCCs did not monitor trends of complications of diabetes by ethnic group.Improvement is needed in quality, completeness, and availability of minority ethnic group data for diabetes at a national level, particularly if NHS Primary Care Organisations are to be responsible for providing diabetes care as laid out in the Scottish Diabetes Framework. The prevalence of diabetes worldwide varies from approximately 2 to 50% within different ethnic groups ,2. In thBecause there was no specific tool to assess the current situation for diabetes care generally and in particular for ethnic minority groups in Scotland, a questionnaire needed to be designed. Therefore we gathered ideas and comments from experts in this field. The first version of the questionnaire was designed, then it was sent to three LHCCs where Managers, Chairs, Diabetes Specialist Nurses and Public Health Practitioners completed and made comments. One of the recommended additions was to have some questions about availability of Scottish Intercollegiate Guidelines Network for Diabetes (SIGN Guideline 55) in the final version of the questionnaire. The questionnaire as distributed consisted of twelve closed questions in addition an open question. A total of 82 questionnaires were posted out to all LHCC managers in Scotland in March 2003 with a covering letter requesting completion of the questionnaire and an addressed envelope for return. Two weeks later, this was followed up with a reminder letter.57 (69.5%) questionnaires were received representing: 22 urban, 16 rural and 19 mixed rural and urban setting  LHCCs. One LHCC provided a development plan. Non-respondents were 25 LHCCs representing: 10 urban, 7 rural and 8 mixed rural and urban setting . A total of 28 comments were submitted by six LHCCs. Their comments were summarised into: Issues related to collecting information about ethnic group (N = 6); Size of minority ethnic groups (N = 4); Information systems' inability to collect and store ethnic data (N = 8); Use of Interpreters (N = 3); Training of staff (N = 3); Health promotion materials (N = 4). The Table The findings of the present study indicate that recording of ethnic group has not been considered a priority by LHCCs despite the importance of ethnicity in determining prevalence and complications of diabetes.Of the LHCCs 66% did not collect data based on the 2001 census Ethnic Categories. Without this basic information, it is difficult for LHCCs to even begin to identify their demographic profile in order to assess the health needs of their minority ethnic population, although a demographic profile is a basic requirement of providing culturally sensitive and competent services.The high response of GP practices and community services indicating that they do not record ethnic group (69%) can, in part, be attributed to current information systems. However, there seems to be some inconsistencies in respondents' responses, as 58% state that SIGN-55 guidelines , which iAs percentage very low (referring to Minority Ethnic Groups) there is no specific section within the LHCC plan. All patients are treated equally within the LHCC,\" and another: \"Numbers are so small we do not have a specific programme for ethnic groups,\" and another: \"As patient records are confidential don't know what SIGN-55 data is recorded.\"From the comments section, there is also evidence that altering attitudes of NHS organisations requires ongoing change management, education and training. In some LHCCs numbers appear to be small as some respondents concluded: \"...The findings that only 55% of LHCCs have access to interpreters, 55% do not record cultural/religious requirements, 24% have no culturally appropriate dietetic counselling and 33% have no appropriate health information materials available suggests that much is still required in improving the patient journey for ethnic minorities within the NHS.Ensure that NHS staff are professionally and culturally-equipped to meet the distinctive needs of people and family groups from minority ethnic communities\". Therefore, it is concerning that 42% of respondents report that their LHCC staffs are not trained in diabetes in relation to Minority Ethnic Groups and 13% are unsure. Patients normally have their first contact with Primary Care staff, who manage 90% of patient contacts within the NHS.Training and development of NHS staff are needed to help bring about such radical service improvements, giving people at the frontline the opportunity to develop appropriate skills and resources to do a better job . This buSimilar to all research, this study had limitation. Since there was lack of census data on the number of ethnic minorities in each LHCC, therefore we could not compare and analyse the differences between LHCCs.This study indicates that cultural health care practices should be improved and staff attitudes changed by the delivery and uptake of effective and appropriate training, and as part of this effort community participation by minority ethnic groups should be encouraged to assist in identifying their specific needs for targeted health services and related information.The author(s) declare that they have no competing interests.JJ and HRB developed questionnaires and performed the data collection. HRB analysed the data and wrote the first manuscript. RG and RPKJ participated in the development of study design, editing and revising the manuscript. All authors contributed to and have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Sheikh discusses a new study that found that the main barrier to the participation of minority ethnic people in research lies in their reduced likelihood of being invited to participate. Most economically developed nations are now multiethnic, and, given current demographic trends, there is reason to believe that societies will continue to become more ethnically and culturally diverse. For example, the 1991 and 2001 UK censuses, which both included a mandatory question on ethnic identity, revealed that the proportion of the UK population classifying themselves as belonging to a non-white minority ethnic group increased by 53% over this 10-year period, from 3 million to 4.6 million (or 7.9% of the UK population) [We have more than two decades of research highlighting ethnic inequalities for a range of long-term disorders , such asPLoS Medicine by David Wendler and colleagues investigates one possible source of under-representation\u2014the willingness of ethnic minorities to participate in health research [Why this is the case is almost certainly dependent on an array of complex socio-economic factors . Hamperiresearch .Previous work has shown that reporting of the ethnic profile of research participants in trials and other studies has been poor in both the US and the UK . This poBut Wendler and colleagues' study provides strong empirical evidence to challenge the assumptions that have to date dominated discussions in this area . In theiThe key strength of this work is the rigorous systematic review methodology used to identify studies and extract and summarise data. Its main limitation relates to the failure to contact authors who collected, but did not publish, relevant data on ethnicity and consent rates. Contacting authors in this way to obtain additional data that might not be published, and also in an attempt to uncover additional unpublished material, is standard practice in most rigorously conducted systematic reviews. In addition, the fact that this work confines its focus to the US situation renders it difficult to know to what extent the findings may be generalised beyond the US experiences. As the authors point out in their discussion, the US does not guarantee universal access to health care, and perhaps individuals from ethnic minority groups may be more likely than non-Hispanic whites to use participation in research as a way to obtain access to physicians and health care.The findings from this study clearly have important and wide-ranging implications for the US research community (and possibly elsewhere as well). Funders must, for example, appreciate that to meaningfully involve ethnic minority groups in health research carries financial costs. For example, inviting individuals from these groups to participate in a study, and ensuring that they fully understand what participation involves, requires the use of interpreters and the generation of translated materials about the study\u2014both of which are costly. Also, if sub-group analyses by ethnic groups are considered important, this will typically require considerable inflation of the sample sizes needed, thereby also increasing costs . SimilarThere are now sufficient examples of studies on marginalised communities that clearly show that it should really be possible to engage with people, irrespective of their ethnic background, and encourage them to participate in research that is ultimately in their and/or their community's best interests. What is now needed is less blame directed at already marginalised people. Instead, those with the power to change the way in which research is conducted should translate the important insights provided by Wendler and colleagues' study into significantly more invitations extended to minority ethnic and racial groups to participate in the research endeavour."}
+{"text": "Concerns have been raised about low participation rates of people from minority ethnic groups in clinical trials. However, the evidence is unclear as many studies do not report the ethnicity of participants and there is insufficient information about the reasons for ineligibility by ethnic group. Where there are data, there remains the key question as to whether ethnic minorities more likely to be ineligible (e.g. due to language) or decline to participate. We have addressed these questions in relation to the Birmingham Rehabilitation Uptake Maximisation (BRUM) study, a randomized controlled trial (RCT) comparing a home-based with a hospital-based cardiac rehabilitation programme in a multi-ethnic population in the UK.Analysis of the ethnicity, age and sex of presenting and recruited subjects for a trial of cardiac rehabilitation in the West-Midlands, UK.Participants: 1997 patients presenting post-myocardial infarction, percutaneous transluminal coronary angioplasty or coronary artery bypass graft surgery.Data collected: exclusion rates, reasons for exclusion and reasons for declining to participate in the trial by ethnic group.Significantly more patients of South Asian ethnicity were excluded . This difference in eligibility was primarily due to exclusion on the basis of language (i.e. the inability to speak English or Punjabi). Of those eligible, similar proportions were recruited from the different ethnic groups . There was a marked difference in eligibility between people of Indian, Pakistani or Bangladeshi origin.Once eligible for this trial, people from different ethnic groups were recruited in similar proportions. The reason for ineligibility in the BRUM study was the inability to support the range of minority languages. Proportional representation of research participants by race is a requirement of The National Institutes of Health in the USA . HoweverMuch research on ethnicity has focused on testing hypotheses about differences in outcome by race or ethnicity whilst the issue that participants of trials should represent the population that will be receiving an intervention has been relatively neglected. This is essential for the generalisability of the results ,9, and tThere are some unanswered questions with respect to the low representation of patients from minority ethnic groups in clinical trials. Firstly, compared to the majority white population, are patients from ethnic minority groups less likely to meet the eligibility criteria for a trial (e.g. because of language)? Secondly, are patients from ethnic minority groups more likely to refuse to participate in randomized trials ? BirmingThe BRUM study recruited 525 (26.3%) participants from the 1997 patients who presented following a myocardial infarction, percutaneous transluminal coronary angioplasty (PTCA) or coronary artery bypass graft (CABG) surgery to one of four West Midland hospitals from February 2002\u2013January 2004 . The hosBasic demographic data including self-defined ethnic group was sought on all presenting patients. Ethnic status was recorded using the same categories as the 2001 UK Census . Data onTable Compared with the white ethnic group, the relative risk (95% CI) for eligibility was 0.42  for South Asians table . CompareIn each ethnic group  women were less likely to be eligible for the study than men table . This waThe reasons for and rates of exclusion varied markedly between the three main South Asian groups, with exclusion rates of 29%, 63% and 70% among people of Indian, Pakistani and Bangladeshi origin respectively  patient information and the translation and validation of the Hospital Anxiety and Depression Scale into Punjabi. It is possible that those excluded on the grounds of language would have refused to participate in the trial, but we have no evidence to support or refute this possibility. Of those excluded as a result of language, 74% described themselves as of Pakistani origin and thus would have been catered for by the provision of Urdu and Mirapuri . The socio-economic status of the presenting patients this is clearly a potential confounding factor, with people from minority ethnic groups who do not speak English being more likely to be of lower socio-economic status . PresentWe found no significant differences in the proportions of people from the three main ethnic groups who gave the reason for their refusing to participate as 'not wishing to take part in research.' This result differs from the evidence from the USA, which suggests that people from minority ethnic groups are less likely to agree to participate in clinical research because of a lack of trust . The UK In addition, our findings provide further support for the limited evidence base that patients from ethnic minority groups can be recruited in a similar proportion to the majority population, once they have fulfilled the trial's eligibility criteria ,8. OtherThis research raises the issue of feasibility versus inclusivity. In this study, even with considerable effort, time and resources to try to recruit a representative population to the trial, we were unable to meet the wide language requirements. This must be considered in the context that this was a trial of a behavioural intervention with a psychological questionnaire as a main outcome measure. In other trials, with only objective clinical measurements as endpoints, it might be possible to exclude less patients due to language restrictions. In a geographical area of ethnic diversity, a number of languages would need to be supported to achieve equivalent recruitment rates for different ethnic groups, which has considerable cost and methodological implications. The importance of achieving a sample that is ethnically representative will depend on the research question and the context.The author(s) declare that they have no competing interests.All the authors were involved in the design and conduct of the trial. KJ undertook the analysis and drafted the paper. All the authors read and commented on the paper.The pre-publication history for this paper can be accessed here:"}
+{"text": "Sunscreens are being widely used to reduce exposure to harmful ultraviolet (UV) radiation. The fact that some sunscreens are photounstable has been known for many years. Since the UV-absorbing ingredients of sunscreens may be photounstable, especially in the long wavelength region, it is of great interest to determine their degradation during exposure to UV radiation. Our aim was to investigate the photostability of seven commercial sunscreen products after natural UV exposure (UVnat) and artificial UV exposure (UVart).2, was placed between plates of silica. The area under the curve (AUC) in the spectrum was calculated for UVA (320\u2013400 nm), UVA1 (340\u2013400 nm), UVA2 (320\u2013340 nm) and UVB (290\u2013320 nm) before (AUCbefore) and after (AUCafter) UVart (980 kJ/m2 UVA and 12 kJ/m2 of UVB) and before and after UVnat. If theAUC Index (AUCI), defined as AUCI = AUCafter/AUCbefore, was > 0.80, the sunscreen was considered photostable.Seven commercial sunscreens were studied with absorption spectroscopy. Sunscreen product, 0.5 mg/cmThree sunscreens were unstable after 90 min of UVnat; in the UVA range the AUCI was between 0.41 and 0.76. In the UVB range one of these sunscreens was unstable with an AUCI of 0.75 after 90 min. Three sunscreens were photostable after 120 min of UVnat; in the UVA range the AUCI was between 0.85 and 0.99 and in the UVB range between 0.92 and 1.0. One sunscreen showed in the UVA range an AUCI of 0.87 after UVnat but an AUCI of 0.72 after UVart. Five of the sunscreens were stable in the UVB region.The present study shows that several sunscreens are photounstable in the UVA range after UVnat and UVart. There is a need for a standardized method to measure photostability, and the photostability should be marked on the sunscreen product. Sunscreens give good protection against sunburn, actinic keratosis and squamous cell carcinoma. The results for preventing cutaneous malignant melanoma (CMM) and basal cell carcinoma are less conclusive -3. One ePrevious studies have shown that some sunscreens lose part of their protection when exposed to UV radiation -10. SeveThe aim of this study was to investigate the photostability of commercial sunscreen products after UVnat and after UVart.Seven commercial sunscreens were included, all available on the Swedish market. Three sunscreens contained only organic chemical filters, three sunscreens had a combination of inorganic and organic chemical filters, and one sunscreen contained solely inorganic chemical filters. In Table 2. The absorbance was too high for proper measurements when the recommended amount of 2 mg/cm2 was applied, causing distortion in the absorption spectrum. For this reason a thinner layer was applied. A previous study has shown that the result were independent whether an application thickness of 1 or 2 mg/cm2 was used [The sunscreen was weighed and placed between two plates of polished fused silica (quartz) with diameter 25 mm and thickness 5 mm. The amount applied was 0.5 mg/cmwas used .For UVA radiation, a UVASUN 2000  was used. The output is mainly between 340 and 400 nm.For UV radiation (including UVB), an Essh\u00e5 Corona Mini (Sweden), equipped with two fluorescent tubes, Philips TL 12 (20 W), was used. This is a broadband radiation source from 280 to 380 nm with a major peak at 313 nm. There are strong mercury peaks at 313 nm and 365 nm.2 when measured from a distance of 25 cm. Twenty minutes' exposure gave a dose of 980 kJ/m2. This corresponds to the UVA dose that reaches the earth's surface during one sunny summer day in Gothenburg [2. Twenty minutes of exposure gave a dose of 12 kJ/m2 UV radiation (including UVB). This corresponds to 45 Standard Erythema Doses (SED) when further weighted by the CIE action spectrum [The irradiance at the exposure plane was measured with an International Light IL 1350 Radiometer/Photometer using a probe named SED 240 for UVA and a probe named SED 015 for UVB radiation. The fluence rate of the UVA lamp was 820 W/mthenburg . We alsospectrum . This isspectrum  or what For UVnat, samples were placed horizontally outdoors when the weather was sunny. This was done in early July in Gothenburg (latitude: 57\u00b0 42' N). The total exposure time was 120 min . It is a two-beam spectrophotometer without integrating sphere, which measures the transmission by scanning over the wavelength range of interest. Without integrating sphere the measured absorbance includes also some scattered radiation. Therefore, the spectra of samples with inorganic filters, which scatter light, may show a too high absorbance.before) and after (AUCafter) UVart (980 kJ/m2 UVA and 12 kJ/m2 of UV radiation (UVB included) and before and after UVnat. If the AUCI (AUCI = AUCafter/AUCbefore) was >0.80, the sunscreen was considered photostable.The AUC for UVA, UVA1 (340\u2013400 nm), UVA2 (320\u2013340 nm) and UVB was calculated for each spectrum before  [2 we considered the product photostable if the AUCI was higher than 0.8.Maier et al. used the difference between the spectral transmission before and after a defined UV exposure, \u0394T. A product was labeled photounstable if the mean photoinstability was higher than 5% (1 mg/cmas used) . In our The photostability of the sunscreens tested varies considerably. The photounstable sunscreens start to degrade rather rapidly when exposed to the sun. After 30 min of UVnat, Sunscreens 1 and 3 are unstable (AUCI <0.80). Sunscreens containing inorganic chemical filters are more photostable in our study than sunscreens with organic chemical filters with the exception of Sunscreens 3 and 5Sunscreens 5, 6 and 7 are photostable after UVnat; in the UVA range the AUCI was between 0.85 and 0.99 after 120 min and between 0.92 and 1.0 in the UVB range. Sunscreen 4 shows in the UVA range an AUCI of 0.87 after UVnat but 0.72 after UVart.Sunscreens 1, 2 and 3 are unstable. They show after 90 min UVnat an AUCI between 0.41 and 0.76 in the UVA range and between 0.30 and 0.69 in the UVA1 range.Sunscreens 2, 4, 5, 6 and 7 are stable in the UVB region whereas Sunscreens 1 and 3 are not. During exposure, absorption ranges of Sunscreens 1, 2 and 3 are shifted towards shorter wavelengths Fig. .In Table This is true for all three samples, after both UVnat and UVart. Sunscreen 4 is more unstable after UVart than to UVnat Fig. .The spectra were normalized by dividing the maximum value of the spectrum before irradiation by itself, so that the peak value of the spectrum before irradiation was set to 1.The temperature was higher, during exposure to the UVart than during exposure to UVnat, but the temperature did not influence the absorption. Sunscreens 5, 6 and 7 were stable both after UVart and after UVnat. Sunscreens 6 and 7 were very little influenced by UV exposure Fig. . In agreIn most cases UVnat compared to the UVart gave qualitatively similar results. However, UVnat, with a lower fluence rate than UVart, gave similar yields of degradation. In addition, the fluence rate of the UVAart was higher than that of the UVAnat, which could be expected to degrade the sunscreens faster. But this is not the case, except for Sunscreen 4. Since the dose of UVAart was higher than UVAnat, Sunscreen 4 probably provides sufficient protection for the consumer.Commercial sunscreens generally have low viscosity in order to be easy to apply. The temperature increase of the samples during UV exposure, especially after UVart, may lower the viscosity further. This may result in reductions of the optical path lengths of the samples. However, this was not the case in our study since samples kept on a heating plate for 20 min at 50\u00b0C showed a similar spectrum before and after heating.2. If the particles are too small they may lose their scattering effect and, consequently, not give as good protection as larger particles. This may be the case for Sunscreen 5  to influence the absorption spectrum in the visible range. Small particles of TiO2 are expected to give maximal scattering in the UVB or UVC region. Larger particles can cause significant scattering also in the UVA and visible region. It follows that the small nanoparticles cannot give good protection in the UVA region in this case.Sunscreen 5 is photostable but does not contain any metallic oxide particles. This may be due to a vehicle that successfully prevents degradation and/or due to microstructures of the emulsion itself Fig. . It is i2 particles. The reported stabilizing effect of 4-Methylbenzylidene camphor (MBC) [The peak between 350 and 375 nm in the absorption spectra of Sunscreens 3, 4 and 5 Figs. , 2, 3a cor (MBC)  does not2, a third UVA absorber, terephthalylidene dicamphor sulfonic acid (TLDCSA), which can stabilize BMDBM. It has also been shown that TiO2 may stabilize ketoprofen and may be used in protecting photounstable species [The photostable Sunscreen 6 contains, in addition to BMDBM and TiO species .Many commercial sunscreens give, according to the manufacturers, good UVA and UVB protection. However, the photostability of the sunscreen in the UVA range is not always adequate. Most sunscreens offer good protection against UVB while the UVA photostability of some products decreases substantially during UV exposure. The potential toxicity of the photoproducts also needs to be investigated further.For the consumer it is very difficult to know what product to choose, since the photostability varies between different brands and the photostability is not marked on the bottle. To know which photoactive compound the sunscreen contains is not good enough. The stability also depends on factors like preservatives, oxygen radical scavengers, and base formulation. It is not reasonable that the ordinary consumer should have knowledge of this. If the product claims to give broadband protection, this protection should remain also after sun exposure. The fact that sunscreens are photounstable has been known for many years. Our study clearly shows that there are still many photounstable products on the market. When buying a sunscreen, the consumer should automatically receive a photostable product.2 particles seem to be more photostable, with Sunscreens 3 and 5 as exceptions. Special focus should be on the commonly used UVA absorber BMDBM. In three out of six sunscreens in our study this molecule was degraded during UV exposure. Stabilizers of BMDBM may work, but not under all conditions. There is a need for a standardized method to measure photostability and the photostability should be marked on the sunscreen product.The present study shows that several commercially available sunscreens are not photo stable. Degradation is clearly manifested in the absorption region in the UVA range after solar irradiation. In general, sunscreens with TiOThe author(s) declare that they have no competing interests.HG and NT-W have made contributions to conception of design and interpretation of the data. They carried out the experimental set-up during the absorption studies and wrote the main part of the manuscript.BS carried out some of the absorption studies and drafted the manuscript.AR have made substantial contributions to conception of design, interpretation of the data and drafting and revising the manuscript. AR also participated in the coordination of the study.AJ, JM, OL and A-MW have made substantial contribution to concept of design and drafting and revising the manuscript critically.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Evidence strongly suggests that the neighbourhood in which people live influences their health. Despite this, investigations of ethnic differences in cardiovascular risk factors have focused mainly on individual-level characteristics. The main purpose of this study was to investigate associations between neighbourhood-level environmental stressors , and blood pressure (BP) and hypertension among different ethnic groups.Individual data from the Amsterdam Health Survey 2004 were linked to data on neighbourhood stressors creating a multilevel design for data analysis. The study sample consisted of 517 Dutch, 404 Turkish and 365 Moroccans living in 15 neighbourhoods in Amsterdam, the Netherlands.Amongst Moroccans, high density housing and nuisance from drug misuse were associated with a higher systolic BP, while high quality of green space and social participation were associated with a lower systolic BP. High level of nuisance from drug misuse was associated with a higher diastolic BP. High quality of green space was associated with lower odds of hypertension. Amongst Turkish, high level of crime and nuisance from motor traffic were associated with a higher diastolic BP. Similar associations were observed among the Dutch group but none of the differences were statistically significant.The study findings show that neighbourhood-level stressors are associated with BP in ethnic minority groups but were less evident in the Dutch group. These findings might imply that the higher BP levels found in some ethnic minority groups might be partly due to their greater susceptibility to the adverse neighbourhood environment in which many ethnic minority people live. Primary prevention measures targeting these neighbourhood stressors may have an impact in reducing high BP related morbidity and mortality among ethnic minority groups. Cardiovascular disease (CVD) is the leading cause of death in industrialised countries. High blood pressure (BP) is one of the important causes of cardiovascular diseases and its role is set to continue . The risAs in most CVD epidemiology, investigations of high BP in ethnic groups have focused mainly on individual level characteristics such as obesity, education and genes ,10. The There are also indications that the impact of the neighbourhood environment on ill health is greater in ethnic minority population groups than in European populations ,14. For There are several mechanisms through which neighbourhood environment may be linked to the development of high BP, for example, through their influence on health related behaviours or through psychosocial pathways. Recent studies indicate a possible role of neighbourhood environments in influencing physical activity -21 and dPerception of environmental stressors may differ between different ethnic groups due to differences in culture, language, migration history and socio-economic positions ,27. NeigTurkish and Moroccans are two of the largest ethnic minority groups in the Netherlands. They came to the Netherlands in the 1960s and early 1970s as labour migrants. The initial period of labour migration was followed by a period in which many guest workers brought their spouses and children over to the Netherlands. A large percentage of Turkish and Moroccan especially first generation immigrants have lower educational levels, poor Dutch language proficiency, and tend to stay within their own culture .The data in this study were collected at two levels. The individual (first) level included information on demographics, body mass index (BMI), BP and hypertension. The contextual (second) level included information on environmental stressors. These two levels were linked by neighbourhood, creating a multilevel design for data analysis.The individual level data came from the Amsterdam Health Survey 2004. This cross-sectional study was carried out by Amsterdam Municipal Health Service (GGD Amsterdam) in collaboration with the National Institute for Public Health and Environment (RIVM) to monitor the health of the Amsterdam general population aged \u226518 years. The study sample was drawn from the Amsterdam municipal registers in five city districts in Amsterdam .Blood pressure was measured with a validated oscillometric automated digital device (OMRON HEM-711). Using appropriate cuff sizes, two readings were taken on the left arm in a seated position after the subject had been seated for at least five minutes. Trained nurses performed all the medical examinations. The mean of the two readings was used for analysis. Hypertension was defined as SBP \u2265 140 mm Hg, or DBP \u2265 90 mm Hg, or being on anti-hypertensive therapy. Education level was determined during the interview. Body mass index (BMI) was calculated as weight (kg) divided by height  and were provided by the Department of Research and Statistics of Amsterdam Municipality (O+S Amsterdam). The aggregated data were dichotomised (coded low = 0 and high = 1), with low representing the eight neighbourhoods with the lowest scores and high representing the other seven neighbourhoods with the highest scores  in the past 12 months, being bothered by excessive motor traffic, nuisance from frequent alcohol and drug misuse, living in a neighbourhood with cramped housing (housing density), involvement in at least one of the activities of formal or informal organisations  and quality of green space. Quality of green space was based on a scale of 1 to 10 (from very ugly to very beautiful). We calculated the mean score for each neighbourhood. To allow for the non-linear effects, and the relative smaller number of neighbourhoods, the neighbourhood-level stressor variables were dichotomised for each ethnic group. In the Netherlands, neighbourhoods are areas with a similar type of building, often delineated by natural boundaries. As a result, they are socio-culturally quite a homogenous group .Because different ethnic groups may differ in response to the same stressor , the anaAbout 95 per cent of the Turkish and the Moroccan ethnic groups were first generation migrants. Table Table Among Turkish, high crime and nuisance from motor traffic were associated with a higher diastolic BP in both models Table . Among MTable Little is known about the effects of neighbourhood-level environmental stressors on BP and hypertension in different ethnic groups in Europe. Our findings show that neighbourhood-level stressors are associated with BP in ethnic minority groups but were less evident in Dutch people living in Amsterdam, the Netherlands.Some limitations within this study should be acknowledged. As in numerous epidemiological surveys our BP levels were based on two measurements at a single visit, which might have overestimated the BP levels and the prevalence of hypertension. A further limitation was the cross-sectional nature of the study design, which indicates that causal associations can only be made with caution. In addition, our contextual stress variables were based on the overall assessment of the Amsterdam general population. It is possible that the assessment of these contextual variables might vary between the ethnic groups, which might further affect our study conclusions. Other potential sources of bias could have resulted from the relatively low response rate. Nonetheless, the response rate of the survey is comparable to several national surveys in the Netherlands ,35, indiEvidence suggests that the health advantage of foreign-born people may be explained by the healthy migrant effect . Nearly In addition, we were unable to assess factors such as internal migration within the study area, the degree of residential segregation, and multiple dimensions of socio-economic deprivation over the life course, which might also affect our study conclusions. For example, the impact of internal migration between neighbourhoods within Amsterdam is likely to lead to underestimation of the observed associations in our study. Nevertheless, evidence suggests a weak association between selective migration and health in the Netherlands ,38.Despite these limitations, the study findings provide important information on the effect of environmental stressors on BP and hypertension among different ethnic groups. As far as we are aware, this is the first study that has assessed the effect of neighbourhood level stressors on BP and hypertension among ethnic minority groups. The neighbourhoods considered in our study were socio-culturally rather homogenous communities . It has Our findings of associations between neighbourhood crime, nuisance from alcohol and drug misuse and BP among the ethnic minority groups add to the existing literature documenting associations between neighbourhood factors and cardiovascular risk factors -17,40. FAlthough the evidence for the associations between neighbourhood environment and cardiovascular risk factors are mounting, the explanations for these associations still remain unclear. Two main interpretations have, however, been proposed for the relative bad health of people living in disadvantaged neighbourhoods: a neo-material perspective and a psychosocial perspective. According to the proponents of the neo-material theory, impaired health of residents of some neighbourhoods is the result of accumulation of exposure and experiences that have their roots in the material world . Under tOur findings support the psychosocial perspective and are consistent with other studies that have demonstrated associations between neighbourhood-level psychosocial factors and other health outcomes -45. For The associations between housing density, motor traffic, and BP seem to suggest that living in neighbourhoods characterised by a poor quality built environment is associated with psychosocial stress which, in turn, may place one at greater risk for developing high BP. The reasons for the stronger associations between neighbourhood stressors and BP in the ethnic minority groups as compared with their Dutch counterparts are unclear. However, it is possible that the ethnic minority groups in this study live in more disadvantaged and stressful parts of the same neighbourhood or have less effective coping mechanisms than their Dutch counterparts, which might have contributed to the stronger associations observed in this study. These findings may also be a reflection of concentration of other deleterious elements of the neighbourhood environment that, through various mechanisms, shape BP. These findings may also reflect residential segregation, as well as differential exposure to other factors such as racism -49. StudIn contrast, our findings show that living in a neighbourhood with a high quality of green space and social participation was associated with a lower systolic BP and lower odds of hypertension in the Moroccan group. Similar non-significant associations were also observed amongst the Dutch and Turkish ethnic groups. It is likely that the quality of neighbourhood built such as green space provides an opportunity for more outdoor recreation and encourage healthier lifestyles. Takano et al's study also found that living in a neighbourhood with greenery filled public areas positively influenced the longevity of urban senior citizens . It is wSeveral neighbourhood stressors were strongly associated with BP among Turkish and Moroccan people as compared with Dutch people. This may reflect concentration of multiple stressors in disadvantaged neighbourhoods where many ethnic minority people live.The findings of this study have important public health and clinical implications. It has been estimated that reducing the mean population BP level by even as little as 2\u20133 mmHg could have a major impact in reducing associated morbidity and mortality . For exaThe findings from this study show associations between neighbourhood stressors and BP among Turkish and Moroccan ethnic groups whereas no associations could be observed among the Dutch group. The findings might indicate that the higher BP levels found in some of the ethnic minority groups (such as African descent populations and Hindustanis Surinamese) in Europe and elsewhere may be partly due to their greater susceptibility to the adverse neighbourhood environment in which many minority people live. Primary prevention measures targeting these neighbourhood attributes may have an impact in reducing high BP related morbidity and mortality especially among ethnic groups.The author(s) declare that they have no competing interests.All were responsible for study concept and design. JU and EL were responsible for data collection. CA, CH, WW, KS and MD were responsible for analysis and interpretation of data. CA drafted the manuscript and all were involved in critical revision of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "However, these traditions have waned over the years. The young state of Israel adopted a \"melting pot\" approach to fashion Jews from all over the world into Israelis.The Holy Land has absorbed millions of immigrants in recent centuries: Jews from East and West, Druze, Circassians, Muslim and Christian Arabs. The land is unique and diverse in geographical location and ethnic groups, and also in its cultural characteristics, including traditional medicine and use of materia medica of different ethnic groups  are reviewed in this paper, as well as the ethno-botanical survey , and the matching ethno-pharmacological survey (conducted in the late 1990s) covering the medicines sold in stores.The traditional medicine and materia medica have hardly lasted three generations.Present-day healers are usually not young and are believed to be the end of the chain of traditional medical knowledge. The ethno-diversity of Israel is becoming blurred; modernity prevails, and ethnic characteristics are fading. The characteristic lines of traditional medicine and A salient former dividing line between ethnic groups, namely their use of different medicinal substances, paradoxically becomes a bridge for conservative users of all groups and religions. Shops selling these substances have become centers for \"nostalgia\" and preserving the oriental heritage, traditional medicine, and medicinal substances! Other different ethnic groups such as Bosnians and Circassians were deported from their homelands to the Holy Land by the Ottomans in the 18th and 19th centuries, the most important ethnic group that stayed in Israel being the Circassians. Later, in the 19th and 20th centuries, at the end of Ottoman rule and under the British mandate, Muslim Arabs and fewer Christian Arabs immigrated from neighboring Arab countries in parallel with Jewish immigration, because of the improvement of the economic situation and opportunities for work.The Land of Israel has absorbed millions of immigrants at the last several centuries. Bedouins and the Druze arrived on account of internal Middle Eastern politics in the early Ottoman period  and most recently Ethiopian Jews (1990s) and Jews from Argentina (2002\u20132004).Jewish immigration to the Holy Land from Eastern Europe started in 1882, and was followed by several subsequent waves. Yemenite Jews came later, at the beginning of the 20These events, which are not the main subject of the article, along with the religious-political history of the Holy Land, have created a unique mosaic of a wide range of ethnic and religious groups. Their existence in such a small land caused unfortunate and familiar disputes, though from a purely academic point of view this circumstance creates an opportunity for research in many fields, among which we can cite anthropology and ethno-pharmacology.The land itself is unique, in its natural diversity due to its geographical location at the meeting point of three continents , the desert and the Mediterranean Sea, and the Rift Valley. Different climatic, phyto-geographic, and zoo-geographic zones converge here, creating great biological multi-diversity . The regmateria medica has also been researched, and it displays notable variety These form the biggest minority group in Israel, numbering about one million . This ethnic group is geographically concentrated in two major centers, Galilee and north central Israel . The Musth century CE. Today they live mainly in two centers: the Negev desert  and a much smaller center in the Galilee   . This phi Arabia .Clearly, present-day healers, regardless of origin or religion, are not young, and rarely are their children willing to learn from them! In my opinion, the current generation of traditional healers in most of the aforementioned ethnic groups represents the end of a chain of medical knowledge that started in prehistory. In today's world, where modern Western medicine dominates, it is the task of the ethno-botanist and ethno-pharmacologist to collect the remnants of information and knowledge and conserve them for use in the future.materia medica and the pharmacology derive from Arabic sources. Examples are books by the medieval Jewish (Karaite) physician Ibn Abi 'l-Bayan, al-Dustur al-Bimaristani  [Minhaj al-Dukkan (The store guide) [The healing methods are varied  and are not the topic of this article. In most cases, though, they are based on medieval Arab medicine -50 whichandbook)  and by ae guide) , and clae guide) . One hise guide) . Interese guide) . A survee guide) ; anothere guide) .Another phenomenon is that the drug shops are usually operated by young people (30\u201350), sometimes the third generation of drug sellers; yet their education is not of a high level and they lack crucial knowledge. When they are asked a specific question, they look at one of the above-mentioned books or call their elderly parents who consult the book at home! I have seen several cases of a seller who learned about the medical use of one of the plants in his shop from a client, and conveyed it to the next customer when asked about its uses.materia medica trade it is common, for example, to see Arab Muslim or Christian dealers from Nazareth, Acre, or Jerusalem buying imported Indian products from a shop in Tel Aviv owned by a Jewish Yemeni. Sometimes they will sell the same products to Ethiopian or Moroccan Jews, as well as Arab Muslim and Christian women, in their shops the next day.In the special inter-religious/ethnic relationship in the materia medica, mostly imported from Ethiopia by specialized traders [The number of shops in the Arab sector and the Jewish sector has been falling steeply, although the number of modern shops selling spices and \"modern\" alternative medicinal materials is increasing . The large and well established shops have survived this process by selling other goods besides spices, grains, and medicinal substances. Lately, as mentioned above, a few new specialist shops have opened near neighborhoods with a high percentage of new immigrant Ethiopian Jews. These shops supply food, spices and  traders ,47.Customers are from all religious and ethnic groups, though traditionally they would look for a shop holding stock comprising the special material of their own ethnic group.No major differences were found in the traditional medicine habits of the different minority religions . However, diversity enhanced by geographical location (geo-diversity) is a common feature, mainly expressed in gathering plants in the wild.materia medica [materia medica at Arab shops. At first this occurred mainly in the big cities, where Arabs lived alongside Jews, for example, Acre, Beer Sheba, Jerusalem, Nazareth, Lod, Ramlah, and Tel Aviv-Jaffa. Later, new shops were opened by members of the ethnic group, some of whom traded with their home countries, (in many cases hostile to the state of Israel) in order to supply the demand for special ethnic materials.The inventories of the Jewish ethnic groups when compared with surveys made in their countries of origin showed, not surprisingly, that the Jewish communities practice similar traditional medicine, both in healing methods and medicinal substances. The explanation lies in the history of the region: in the Middle Ages the Islamic world, where for centuries Syria, Iraq, and Egypt consecutively constituted the center, Jews and Muslims maintained very close relations, including business partnerships. Many Jews were physicians, pharmacists, drug sellers, and potion makers, and they ran international businesses, trading mainly in a medica . Jews tra medica . Accordimateria medica have hardly lasted three generations in modern Israel. Here is one example from my experience: young Ethiopian students who were born in Israel have no knowledge of, nor any desire to learn, the traditional medicine of their ethnic group. Moreover, some of them can hardly communicate with their grandparents due to lack of adequate language abilities .Over the years modernization, globalization, and inter-communal marriage have blurred the main ethnic characteristics and differences such as appearance , language , and customs . The typical features of traditional medicine and the inventory of Several ethnic groups have not been studied, and their unique knowledge of traditional medicine and medicinal substances has not been recorded. These include mainly Jews from Morocco, Libya, Algeria, Syria, Lebanon, Egypt, India, Ethiopia, and other eastern parts of the world. With the help of academics these communities should make a last-ditch effort to preserve their knowledge for future generations.materia medica. They would exchange information, mainly those at the great seaports around the Mediterranean, about demand and prices, and act accordingly [Inter-ethnic and religious borders are fading rapidly with time; many medicinal materials described in the books no longer exist on the market. The cause is economic: without real demand, the drug vendors will not make any effort to buy these substances in Israel or abroad. The same picture is elicited from the Cairo Genizah in letters of Jewish traders in ordingly .The borders of Israel, Jordan, Egypt, and Morocco are open today, so theoretically it is possible buy, indirectly, any desired medicinal substances from any Arab country. However, buying exotic and expensive substances bears unnecessary financial risks \u2013 especially in the present-day Middle East, which is unlike modern Europe where the border-crossing is unhindered. Anyone entering any Middle Eastern country is subjected to stringent customs and security checks. Therefore, the market in special products from Morocco, Iran, and lately Ethiopia, which flourishes today, will dwindle markedly in the next few years as the rising generation loses interest in such products.materia medica, medicinal knowledge, and actual demand at the time they were made. Information on wild medicinal plants was gathered in a few ethno-botanical surveys.The study of folk medicinal materials available in shops uncovered the remains of ancient medical practices that still exist in traditional societies and ethnic groups in Israel and in various other countries and cultures around the world. Due to its geo-diversity, bio-diversity, and ethno-diversity, the Land of Israel is an in-situ laboratory for a variety of processes that are studied by scholars of different fields, and should continue to be studied by more. The ethno-pharmacological surveys conducted in the Middle Eastern countries in the last 15 years are important. They recorded the materia medica. It also features in the sense of using similar healing techniques , the importance of beliefs in saints, magic, admiration of holy graves or trees, use of amulets, etc.Differences between the traditional medicine of various ethnic groups, slight as they are, still exist, and were presented above in the sense of medicinal plants used uniquely by them according to their origin (in the case of the different Jewish ethnic groups) or subsequently, in the case of local Arab inhabitants, according to their geographic (latitude) locations. Similarity among these ethnic groups lies first of all in the use of the same basic group of medicinal substances, presented above as the \"core inventory\" of materia medica appear to have hardly survived three generations. At the very start of the third millennium only a small minority of the population of each ethnic group, in the Jewish sector as well as in the Muslim and Christian ones, practice traditional medicine at all. We can assess that the present users as well as the healers are mostly old people (70\u201380 years old) and their second generation (50\u201370 years old). Member of the youngest generation, in most cases, ignore or are even ashamed of these channels of healing and prefer to use modern medical services.However, the main traits of traditional medicine and An interesting issue, however, is that one of the most distinct former dividing lines between ethnic groups, namely the use of different medicinal substances, has paradoxically become a bridge linking conservative users of all groups and religions. Shops selling these substances have nowadays become centers for \"nostalgia\" and the preservation of the eastern heritage, folklore, food, spices, traditional medicine, and medicinal substances!"}
+{"text": "Aziz Sheikh and colleagues report on a qualitative study in the US and the UK to investigate ways to bolster recruitment of South Asians into asthma studies, including making inclusion of diverse populations mandatory. There is international interest in enhancing recruitment of minority ethnic people into research, particularly in disease areas with substantial ethnic inequalities. A recent systematic review and meta-analysis found that UK South Asians are at three times increased risk of hospitalisation for asthma when compared to white Europeans. US asthma trials are far more likely to report enrolling minority ethnic people into studies than those conducted in Europe. We investigated approaches to bolster recruitment of South Asians into UK asthma studies through qualitative research with US and UK researchers, and UK community leaders.Interviews were conducted with 36 researchers (19 UK and 17 US) from diverse disciplinary backgrounds and ten community leaders from a range of ethnic, religious, and linguistic backgrounds, followed by self-completion questionnaires. Interviews were digitally recorded, translated where necessary, and transcribed. The Framework approach was used for analysis. Barriers to ethnic minority participation revolved around five key themes: (i) researchers' own attitudes, which ranged from empathy to antipathy to (in a minority of cases) misgivings about the scientific importance of the question under study; (ii) stereotypes and prejudices about the difficulties in engaging with minority ethnic populations; (iii) the logistical challenges posed by language, cultural differences, and research costs set against the need to demonstrate value for money; (iv) the unique contexts of the two countries; and (v) poorly developed understanding amongst some minority ethnic leaders of what research entails and aims to achieve. US researchers were considerably more positive than their UK counterparts about the importance and logistics of including ethnic minorities, which appeared to a large extent to reflect the longer-term impact of the National Institutes of Health's requirement to include minority ethnic people.Most researchers and community leaders view the broadening of participation in research as important and are reasonably optimistic about the feasibility of recruiting South Asians into asthma studies provided that the barriers can be overcome. Suggested strategies for improving recruitment in the UK included a considerably improved support structure to provide academics with essential contextual information , and the need to ensure that care is taken to engage with the minority ethnic communities in ways that are both culturally appropriate and sustainable; ensuring reciprocal benefits was seen as one key way of avoiding gatekeeper fatigue. Although voluntary measures to encourage researchers may have some impact, greater impact might be achieved if UK funding bodies followed the lead of the US National Institutes of Health requiring recruitment of ethnic minorities. Such a move is, however, likely in the short- to medium-term, to prove unpopular with many UK academics because of the added \u201chassle\u201d factor in engaging with more diverse populations than many have hitherto been accustomed to.Please see later in the article for the Editors' Summary In an ideal world, everyone would have the same access to health care and the same health outcomes . However, health inequalities\u2014gaps in health care and in health between different parts of the population\u2014exist in many countries. In particular, people belonging to ethnic minorities in the UK, the US, and elsewhere have poorer health outcomes for several conditions than people belonging to the ethnic majority . For example, in the UK, people whose ancestors came from the Indian subcontinent  are three times as likely to be admitted to hospital for asthma as white Europeans. The reasons underpinning ethnic health inequalities are complex. Some inequalities may reflect intrinsic differences between groups of people\u2014some ethnic minorities may inherit genes that alter their susceptibility to a specific disease. Other ethnic health inequalities may arise because of differences in socioeconomic status or because different cultural traditions affect the uptake of health care services.Minority ethnic groups are often under-represented in health research, which could limit the generalizability of research findings. That is, an asthma treatment that works well in a trial where all the participants are white Europeans might not be suitable for South Asians. Clinicians might nevertheless use the treatment in all their patients irrespective of their ethnicity and thus inadvertently increase ethnic health inequality. So, how can ethnic minorities be encouraged to enroll into research studies? In this qualitative study, the investigators try to answer this question by talking to US and UK asthma researchers and UK community leaders about how they feel about enrolling ethnic minorities into research studies. The investigators chose to compare the feelings of US and UK asthma researchers because minority ethnic people are more likely to enroll into US asthma studies than into UK studies, possibly because the US National Institute of Health's (NIH) Revitalization Act 1993 mandates that all NIH-funded clinical research must include people from ethnic minority groups; there is no similar mandatory policy in the UK.The investigators interviewed 16 UK and 17 US asthma researchers and three UK social researchers with experience of working with ethnic minorities. They also interviewed ten community leaders from diverse ethnic, religious and linguistic backgrounds. They then analyzed the interviews using the \u201cFramework\u201d approach, an analytical method in which qualitative data are classified and organized according to key themes and then interpreted. By comparing the data from the UK and US researchers, the investigators identified several barriers to ethnic minority participation in health research including: the attitudes of researchers towards the scientific importance of recruiting ethnic minority people into health research studies; prejudices about the difficulties of including ethnic minorities in health research; and the logistical challenges posed by language and cultural differences. In general, the US researchers were more positive than their UK counterparts about the importance and logistics of including ethnic minorities in health research. Finally, the investigators found that some community leaders had a poor understanding of what research entails and about its aims.These findings reveal a large gap between US and UK researchers in terms of policy, attitudes, practices, and experiences in relation to including ethnic minorities in asthma research. However, they also suggest that most UK researchers and community leaders believe that it is both important and feasible to increase the participation of South Asians in asthma studies. Although some of these findings may have been affected by the study participants sometimes feeling obliged to give \u201cpolitically correct\u201d answers, these findings are likely to be generalizable to other diseases and to other parts of Europe. Given their findings, the researchers warn that a voluntary code of practice that encourages the recruitment of ethnic minority people into health research studies is unlikely to be successful. Instead, they suggest, the best way to increase the representation of ethnic minority people in health research in the UK might be to follow the US lead and introduce a policy that requires their inclusion in such research.http://dx.doi.org/10.1371/journal.pmed.1000148.Please access these Web sites via the online version of this summary at minority health in the US, including an interactive game about minority health issuesFamilies USA, a US nonprofit organization that campaigns for high-quality, affordable health care for all Americans, has information about many aspects of minority healthThe US Agency for Healthcare Research and Quality has a section on health inequalities and a recent report on the experiences of patients in Black and minority ethnic groupsThe UK Department of Health provides information on ethnicity and healthThe UK Parliamentary Office of Science and Technology also has a short article on NIH Revitalization Act 1993 is availableInformation on the NHS Evidences Ethnicity and Health has a variety of policy, clinical, and research resources on ethnicity and health There is now a considerable body of evidence to show that minority ethnic people in the UK, US, and many other countries have overall poorer health outcomes for a range of conditions than the majority population p<0.0001) Evidence from the UK, however, indicates that minority ethnic people are markedly under-represented in research, raising important ethical and legal concerns and also potentially limiting the generalisability of study findings It has been suggested that these differences may be due to differences in research policy between the US and UK, in particular the possible impact of the National Institutes of Health's (NIH) 1993 Revitalization Act see  [11]. EqThe 1993 NIH Revitalization Act (enforced from 1994 and revised in 2001) resulted in the NIH instituting a policy that \u201crequires all grants, contracts, and intramural projects conducting clinical research to address the Inclusion of Women and Minorities.\u201d The NIH defines clinical research as: \u201c(1) Patient-oriented research. Research conducted with human subjects  for which an investigator (or colleague) directly interacts with human subjects. Excluded from this definition are in vitro studies that utilize human tissues that cannot be linked to a living individual. Patient-oriented research includes: (a) mechanisms of human disease, (b) therapeutic interventions, (c) clinical trials, or (d) development of new technologies. (2) Epidemiologic and behavioral studies. (3) Outcomes research and health services research.\u201dThe NIH policy places a responsibility on principal investigators to \u201cassess the theoretical and/or scientific linkages between gender, race/ethnicity and their topic of study\u201d in order to:\u201censure that women and members of minorities and their subpopulations are included in all human research;for Phase III clinical trials, ensure that women and minorities and their subpopulations must be included such that valid analyses of differences in intervention effect can be accomplished;not allow cost as an acceptable reason for excluding these groups; andinitiate programs and support for outreach efforts to recruit these groups into clinical studies.\u201dWe sought to understand possible reasons explaining these differences in recruitment rates between the UK and US and to offer insights to help guide the development of strategies to facilitate the recruitment of minority ethnic people into future UK studies by undertaking a qualitative case study focusing on the UK's South Asian population in the context of asthma research. This group was selected because South Asians now represent the UK's largest minority ethnic grouping and it is the population for which inequalities in asthma are best described and most pronounced.Ethics approval was obtained from St Mary's Hospital research ethics committee and research governance approvals were obtained from London, Brent, Harrow, Lothian, Tower Hamlets, Barts and The London and Charing Cross and Westminster research and development boards. Signed informed consent was obtained from all participants.In order to explore these considerations we decided on using a qualitative interpretivist approach, as we were particularly interested in identifying and understanding people's ideas, experiences, and perceptions on the importance (or otherwise) of this subject In-depth interviews were conducted with asthma researchers from the UK and US. We provided a supplementary questionnaire to researchers and the invitation to post anonymised comments onto a Web site, thereby providing the opportunity to offer additional comments confidentially. In addition, we interviewed UK-based South Asian community leaders. A database of principal investigators of recent (2001\u20132006) asthma projects was compiled through conducting Medline searches, searching the databases of the US NIH and UK National Research Register, Asthma UK, and the Cochrane Airways Group, and contacts with experts. Purposeful sampling was employed to identify researchers from a wide range of disciplinary backgrounds , and likely expertise in and experiences of recruiting minority ethnic people into research. We constructed a sampling matrix and began by recruiting broadly across these potentially relevant data fields and then sampling to fill in any important gaps; subsequent sampling was then guided by the emerging findings.We purposefully recruited South Asian \u201ccommunity leaders\u201d ensuring that we had males and females, those from key relevant ethnic  and faith  backgrounds, and those occupying formal and informal national and more local UK leadership roles. Ethnic and faith identity were self-described by participants. Study information materials were translated into the main relevant languages .Interviews with researchers and community leaders were conducted either face-to-face or by telephone by an experienced qualitative researcher and social anthropologist who is of Indian Muslim Gujarati origin (LH). Topic guides, which were developed through our readings of the academic and policy literature and previous experiences of undertaking research with minority ethnic populations over a number of years, were used to help guide discussions see  and S2; Face-to-face and telephone interviews were digitally recorded, translated where necessary, and transcribed together with accompanying field notes. Data were analysed using the Framework approach, a method developed for social policy research and particularly suited to handling large datasets Care was taken throughout the process of designing the study, identifying co-investigators, developing data collection techniques, sampling, data generation and analysis to ensure that we considered our own potential biases and that we did not force our own preconceived notions on participants or allow our views unduly to colour our interpretation of these data A total of 43 (21 UK and 22 US) invitations were sent out to asthma researchers. Four (two US and two UK) invitees did not respond. Of the 39 that responded, three (US) declined. Given that relatively few UK researchers had any research experience of working with minority ethnic people, we additionally sampled three UK social science researchers with substantive experience of working with minority ethnic people. Thirty-three asthma researchers (16 UK and 17 US) and a further three UK social scientists participated in the study, and of these 26 completed the supplementary questionnaire. Researchers were recruited from a wide range of disciplinary backgrounds see . A totalWe first discuss the data arising from the perspectives of asthma researchers and then proceed to consider the findings from the community leader interviews.Key issues to emerge from these interviews that can help to explain the differences in recruitment rates between the UK and US include: the importance assigned by researchers to the issue of recruiting minority ethnic people; stereotypes and prejudices; different political contexts; and, above all, the impact of the NIH's policy in the US The interviews with UK researchers revealed a wide range of opinions on the subject of minority ethnic recruitment. The views can broadly be divided into three categories: (i) a minority who did not see targeted inclusion of ethnic minorities as having any scientific value except, possibly, in some very specific contexts; (ii) those articulating views that were in general supportive of broader inclusion for most studies , but with concerns about the practicality of recruiting subjects, viewing the imposition of targets as impractical and even counter-productive; and (iii) those who were committed to a policy of inclusion similar to that introduced by the NIH. The majority of UK researchers tended to fall into the second category, whereas the majority of US researchers tended to fall into the third category.politicians responding to the political correctness brigade\u201d (AR05). Another researcher also expressed concern about the NIH targets, commenting \u201cI think it is probably pandering to political correctness\u201d (AR23); after a discussion on the pros and cons of mandatory targets, the researcher concluded, \u201c\u2026so I think I would not be in favour of \u2026funder led guidelines.\u201d The following parody, introduced in a discussion on the relative merits of positive discrimination, reflects some of the concerns that were expressed: \u201cSo I've got two to go, I need one fat white bald smoker and I need one thin young Asian woman, non-smoker \u2026 maybe we should be recruiting more people with multi-pathologies. I bet we don't have enough hypertensives in our asthma studies\u201d (AR13). This researcher went on to emphasise that the issue was: \u201cNot just about ethnic minorities!\u201d. Such views were barriers to more inclusive recruitment practices and one researcher suggested that \u201cit has to be a societal change and most of these changes cannot come by enforcing it, it comes by people wanting to change it\u201d (AR39). The practices of a number of UK researchers pointed towards lack of commitment, interest, or will. For most researchers, \u201cthe issue hasn't been given much thought\u201d (AR24). As one researcher said, \u201cnot recruiting minorities is sort of left over from having a very cohesive mono-culture\u201d (AR29).Some UK researchers displayed a degree of antipathy towards NIH-type targets for inclusion that were perceived to be introduced for political rather than scientific reasons, describing this as \u201cI think there is now a strong likelihood that we will discover important differences and for that reason I think it is important to try to push [for inclusion of minority ethnic people]\u201d (AR41).In contrast, US researchers were, on the whole, more positive about the importance of recruiting minority ethnic people on scientific grounds than their UK counterparts as reflected, for example, in the views of this researcher: \u201cOur study also found evidence that some UK researchers' perceptions of, and attitudes towards, ethnic minorities may have played a role in influencing recruitment decisions, some of which are considered below.First generation migrants direct from the Indian sub-continent tend not to have the skills \u2026to deal with and process information in a digestible form\u201d (AR14). Earlier on in the interview, this researcher had however pointed to the differences in trying to engage with more established subgroupings within the South Asian population, this in turn reflecting their integration within society as a whole: \u201cTheir [Indian] children move fast, because when they came to England. Most of them got jobs, they like the Bengalis they have a big sense of family, but unlike the Bengalis they do their best to ensure that their children will have a good education and go to university and get a good job. Whereas the Bengalis don't really give a s***!\u201dReflecting on some of the barriers to participation in studies or engaging with research, one researcher drew on his own experiences of caring for large numbers of South Asians in his practice; \u201cThey are more orientated towards their family and less towards society as a whole, or possibly, which is even worse, that they are only willing to contribute to the society where they come from\u2026\u201d (AR15). He went onto describe South Asian people as \u201c\u2026a little bit selfish,\u201d this reflecting, more generally, their perceived relative lack of engagement in society.One researcher, in the context of a discussion contrasting Western European philosophies and society with Eastern self-interested societies, presented ethnic minorities as lacking altruism saying: \u201cWhen you have people who are unreliable for whatever reason, they should be excluded and that's not a racial thing, it is just a judgement on reliability\u201d (AR05).There was also a feeling among some researchers that ethnic minorities may not comply with instructions and that they are unreliable, which was raised in the context of a discussion on illegal immigration and the use of pseudo-names: \u201cIn contrast, the attitude of most US researchers is reflected in the views of these researchers:We have to accept that these people [ethnic minorities] are part of the population and that means respect and it means learning to live with diversity and pluralism\u201d (AR35).\u201c\u201cAnd I think the other thing is, and again this sounds very simple, I think it's just, you know, as you would treat anybody, you treat them with considerable dignity\u2026And I think that becomes very, very important and you recognise their special needs\u2026Very, very important. And you try to be obliging without being overbearing\u201d (AR27).hassle\u201d with considerable implications in relation to \u201ctime, effort and resource\u201d (AR05). There was, in general, also considerably more optimism from US researchers when compared to UK researchers regarding their ability to engage with minority communities, which seemed to be a reflection of both greater commitment and the confidence resulting from previous successful engagements. Several researchers thus noted that the logistical barriers were not insurmountable, their experiences indicating that ethnic minorities do participate if appropriately approached. As one US researcher noted:The numerous challenges associated with recruiting ethnic minorities led several UK and US researchers, irrespective of their personal commitment to the idea, to view it as a major \u201cWe may, we'll make up to 50, 60 telephone calls trying to get somebody. I mean, this is extremely labor intensive. We will, if we get set someone enrolled and we need to collect data and they can't do it by telephone, we send someone to their house. We take it very, very seriously\u2026it's not just a matter of ringing someone up once or twice and if it doesn't work calling it a day. You know, you have to be ready, and this costs money\u2026\u201d (AR02).\u201cI don't believe any of that!\u201d (AR38).This view of increased costs associated with recruiting minority ethnic people was, although widespread, not universally shared by US researchers. One researcher, for example, who was committed to the importance of inclusiveness in research, when asked about increased costs associated with recruiting minority ethnic people, retorted: \u201cYou know, most \u2013 I find it hard to\u2026 I find it hard to accept there are researchers who will not work with an Asian population or an ethnic diverse population or however you want to group them\u201d (AR35).Finally, US researchers frequently expressed concern at the possibility of excluding minority ethnic people, as for example, reflected by this researcher: \u201cthe Tuskegee study is still a legacy that sticks with our community in terms of research particularly when a lot of our researchers are White\u201d (AR37) Both US and UK researchers either pointed out or accepted the fact that the demographic profile of ethnic minorities, their histories, political engagement, influence, and the way the health services are configured in the two countries also contribute to differential recruitment rates in the two countries. For example, one participant said: \u201cThe US population is largely served by the private health sector through insurance. As minorities are less likely to be insured, participating in an asthma study potentially has the added advantage of receiving free medical attention making it more attractive for minorities in the US to participate in research:Most of our people living in the inner city have you know, government supported insurance\u2026.So that helps that it means they'll get their drugs covered, you don't charge for visits, you know, that's  as really the gold standard\u201d (AR37). Thus although pharmaceutical companies are not bound by quotas they are answerable to the Food and Drug Administration (FDA), which requires \u201c\u2026evidence that the drug's not acting differently in one group than another\u201d (AR29).Though only NIH funded studies are required to recruit and report on ethnicity, the policy appears to have had a wider impact beyond NIH funded studies. \u201cI think it was entirely political\u2026\u201d (AR41). \u201cThey [researchers] hated it \u2026 and they wrote every excuse in the book of why they shouldn't have to do it\u201d (AR12). \u201cIt was clearly difficult for us in the beginning\u201d (AR41). However, with new evidence emerging, there seems to be more conviction in the US. \u201cIt's hard to argue that having a reasonable amount of demographic diversity isn't scientifically revealing. I think now there is a strong likelihood that we will discover important differences and for that reason I think it's important to try to push even if it's a political argument for pushing\u201d (AR41).There was resentment in the US when NIH policy was first introduced as it was seen as a political move. \u201cthey'd go right back\u201d (AR12) if the NIH no longer insisted on the need for recruitment of minority people.A few researchers felt that it would be better if they did not have to pursue targets for certain studies. Nevertheless, not a single US researcher questioned the benefits of minority inclusion or called for it to be eliminated. In spite of the apparent commitment, it was felt by some that \u201cThe overall importance and impact of the NIH policy was well summarised in the following words:\u201cAll of us who are working with NIH grants, we have to indicate the percentage of minority people that will be involved in our grants and we have to report on a quarterly basis how we are doing on recruitment. And if we're not doing well on recruitment we hear from our programme officer and one can lose a grant if recruitment isn't as it needs to be and this is because NIH had a lot of difficulty in years past with giving grants and at the end people would say, well you know what, we just couldn't recruit the people and so NIH said well we don't think it's a good investment of our money\u2026\u201d (AR02).Unlike the US, there is no comparable policy existing in the UK. Most UK researchers did not believe that existing laws and guidelines required them to include ethnic minorities in their study though some did express the view that the Race Relations Amendment Act just simply advertise\u201d (AR20) and \u201crecruit people regardless of their ethnicity as they come through the clinics\u201d(AR24) and have not \u201cparticularly monitored the ethnic minorities within the group \u2026 [they] used\u201d (AR07). \u201cAs long as you capture the data that's fine, but to deliberately go out and say, \u2018I must recruit X number of Asian \u2026\u2019 just doesn't make sense\u201d (AR05).UK researchers did not specifically target or monitor ethnic minorities unless the study question specifically required them to do so. Most researchers \u201cWe never put positive discrimination \u2026 you know we haven't done historically \u2026 you get people who come\u201d (AR17).The standard response, even from those who whole-heartedly supported the idea of inclusion, was that this consciousness was not translated into action in terms of research strategies. \u201cSupplementary questionnaires see  were comThe main themes to emerge from the interviews with community leaders included a lack of awareness of and/or opportunities to participate in research, a general expressed willingness to get involved if invited to do so, particularly if cultural sensitivities and logistical considerations were adequately attended to. There was, however, some concern from those who had helped facilitate research that involvement carried opportunity costs, which were not always adequately recognised or reciprocated. These issues have policy implications in relation to the skills and resources researchers need to make such relationships mutually fulfilling.A number of the community leaders had little experience of being asked to help recruit participants or, for that matter, personally being invited to participate in research, whether in the context of asthma or indeed any other research.Well first of all I think the most important thing is the media. It should be put through the media because people must know what is asthma. The Asian community and where they can go and how they can come forward if there's any research going on. Nobody knows about it. I don't know anything about it. Personally I don't know anything about it unless somebody approached me and talked to me to tell me what it is, then I would know it\u201d (CL03).\u201cThis lack of engagement with research appeared to be widespread, often resulting in the lack of any broader opportunities to learn informally through friends and family members, for example about research participation and what it might entail.I: Have you ever been approached for any health research projects?CL02: No.I: Never?CL02: No.I: \u2026Do you know of anyone who's ever participated in health research?CL02: No, not that I know of, no. (CL02)Those who had some connection with the medical profession, either themselves being doctors or working with medical colleagues or through their respective organisations, were in contrast more likely to have been approached to help recruit participants, although such approaches tended to be relatively infrequent. Given the relatively high proportion of South Asian doctors in the UK, drawing on the support of such individuals could prove very useful, although there is the associated risk of possible gatekeeper fatigue (discussed below).Oh absolutely essential. I think one of the problems is that we don't know enough formalised studies. We don't know enough about people generally, you know, what they think, how they're perceived and so forth\u2026\u201d (CL04).There was widely held and strongly expressed support for the involvement of minority ethnic communities in research, which was argued for on the grounds of fairness and justice, the need to reduce the high and disproportionate levels of morbidity, and, more generally, in order to better understand the changing nature of minority ethnic communities. Responding to a question on the appropriateness or otherwise of this enquiry, one leader, for example, commented that such studies were: \u201cthe Race Equality Scheme\u201d and the \u201cCommission for Equality and Human Rights\u201d (CL11), which were mentioned to underscore the importance of fairness for all members of society There was amongst some leaders, although certainly not all, a detailed appreciation of discrimination and equality legislation, which they were able to draw on to inform their responses in the context of discussions on research. Reference was in this respect made to, amongst other considerations, \u201cA sense of responsibility towards community members also served as an important motivating factor:But there is a lot of ways we can help you. We will do our best to assist you in whatever way we can. We are here to see our community benefit. Doesn't matter whether it's Pakistani, Indian, Bengali. We work with every one of them. So we will try and help as much as possible from this office. So our doors are open to you at any time\u201d (CL03).\u201cPerhaps, ever more telling, was that a number of the community leaders interviewed went out of their way to help recruit people with asthma and carers for the focus group component of this work.There were a number of suggestions made on how recruitment might best be encouraged centring on the need to ensure that the language needs of minority ethnic communities were adequately met and that cultural and religious and cultural values, such as the need for gender segregation, were respected:Particularly, if you're handling the women, you have to be very careful. You know that, in Islam, there are certain things that the women don't like. They'd rather they be handled by a female doctor, rather than handled by a male doctor\u201d (CL03).\u201cThe need to think about convenience, recognising that people had busy lives, was also emphasised particularly as many are disadvantaged and hence would find it difficult to meet transportation costs, for example. Interviewees also reflected on the lack of capacity that their respective organisations had to facilitate such additional noncore work and that if they did engage with such requests this would have opportunity costs.Many mosques and centres don't have that capacity because of the constraint in financial sources\u2026they don't have enough people\u2026we are encouraging our mosques and centres to work with the local community, local council, local service providers like hospitals and others and it's gradually getting through, but there has to be reciprocal attempt from the service provider\u201d (CL05).\u201ca carrot\u201d of some sort for the organisation was suggested as potentially important in helping to address such barriers; the community organisations' needs in this respect tended to be relatively modest such as \u201chall hire\u2026for a Sunday afternoon\u201d or paying for \u201ca dinner\u201d (CL06). Although these suggestions were in keeping with the types of activities already being undertaken by many US researchers, such initiatives would require new ways of working by UK academics and funding bodies, as such activities have funding implications that are typically not budgeted for in research applications.Finding \u201ctokenistic\u201d or \u201clast gasp\u201d attempts when other approaches had failed. This then led her to question her personal involvement: \u201cYou know after years and years of taking part and then thinking \u2018Well you know what does happen with all that stuff?\u2019 Nobody ever gets back to us about it\u2026So since then I have been very cynical and very careful and I ask a lot of questions and I would want to know what it is that we are going to get out of this\u201d (CL13).One of the leaders who had the most experience of facilitating research in the past was, while retaining appreciation of the importance of the subject, very negative about many of her own organisation's experiences as the approaches were often seen as \u201cThis study has revealed a wide gap between the US and UK in terms of policy, attitudes, practices, and experiences in relation to the inclusion of minority ethnic people in asthma research. These differences should not, however, mask the broader convergence of policy and scientific interest in relation to the question of inclusiveness of diverse populations, which was evidenced in the views expressed by a number of US and UK academics. There was also a similarity in views on the logistical and resource implications of broadening recruitment beyond the majority white population. Whereas the NIH policy appears to be a major driving force for the more inclusive ethos in the US, the absence of such a policy in the UK coupled with antipathy, inexperience, and apprehension contribute towards the marked relative under-representation of ethnic minorities in UK asthma studies. Our findings suggest that a US-style legislative-based approach could, if suitably adapted for a UK context, bolster recruitment of minority ethnic people into UK research, both in relation to asthma and possibly in other areas. Focusing attention on this issue would also, it seems, eventually promote engagement of researchers with minority ethnic communities in mutually respectful and fulfilling ways.This is the first trans-Atlantic study of its kind, to our knowledge, which builds on previous quantitative work and consequently sheds light on a question that we believe is of international importance. This study complements the previous descriptive work and offers insights into why the now well-described differences in recruitment rates between the US and UK exist. Given the nature of the insights obtained and that these differences between the US and UK have also been noted in research in conditions other than asthma, our findings are likely to be transferable to other disease areas and contexts There is a small, but nonetheless inevitable risk that, given the sensitive nature of the question under study, participants may have at times felt obliged to give \u201cpolitically correct\u201d answers. On a related point, the views of the research team on the importance of thinking about ethnicity considerations in the context of research are well known and so these views could also have acted as a bar to frank discussion. We anticipated the potential importance of these issues and so took care to ensure that interviews were conducted in a nonjudgmental manner thereby allowing free and frank conversation; we made clear to participants that members of the research team other than the interviewer would only have access to anonymised material, and offered interviewees the option of completing an electronic questionnaire (together with the option of posting completely anonymised comments onto a dedicated Web site) after the interview. Of related importance, care needs to be taken in interpreting the data from questionnaires as they were obtained from nonrepresentative samples, which limits the ability to generalise from these data. Bearing in mind the main aim of the questionnaire, it was encouraging that there were no additional major issues arising that had not previously been covered in the interviews; the absence of researchers' anonymised comments on an offered Web site may suggest that a public forum was superfluous, but it may alternatively reflect the fact that researchers were unconvinced that comments could not be attributed or that they were too busy to engage further with this study.The difficulties of defining who is and who is not a \u201ccommunity leader\u201d are well recognised. Part of the problem in this respect is the concern that there are sometimes self-defined leaders who have relatively little direct influence on their communities. In order to try and work around this issue we sought to recruit individuals with both formal and informal positions at national and local levels. We were also keen to recruit community leaders from across the three main faith groups of interest\u2014Muslims, Hindus and Sikhs\u2014and for this reason we, in particular, sampled those of Indian background (as the overwhelming majority of Pakistani and Bangladeshi community leaders are Muslims). The interviews with the community leaders in which they expressed a willingness to participate in research need also to be interpreted cautiously as it is well recognised that there is often a gulf between intentions and actual practice; nevertheless, the overwhelming majority of the community leaders who were invited to participate in this study agreed to do so, which bodes well for other similar approaches. Furthermore, many of these individuals actively helped with recruiting people with asthma for the focus groups.More fundamentally, some may question the main premise underpinning this research, namely that taking ethnicity into consideration when recruiting into research is in itself of importance. It has for example recently been argued by Epstein, among others, that the scientific arguments underpinning this drive to promoting inclusion are of questionable scientific value We may also be criticised for focusing on South Asians and thereby excluding other minority ethnic populations. Our decision to focus on this population was taken, as discussed in the introduction, on the basis of demographic considerations and also on the well-recognised and persistent asthma inequalities experienced by South Asians. There were, however, also more pragmatic considerations; in particular, the considerable difficulties in obtaining support for research of this kind and in the face of limited resources, the need to begin this research somewhere, while also ensuring that it was undertaken in a way that was sensitive  to the communities under study. Our hope is that in due course we will be able to extend this enquiry to other minority ethnic populations. The focus of this work, which was in relation to bolstering recruitment of minority ethnic people into UK research and the logistical constraints discussed above, also guided our decision to only recruit UK community leaders. Future research could usefully explore the perspectives and experiences of US community leaders.There is also the risk that through focusing attention on ethnicity that we may inadvertently be exacerbating the problems of marginalisation of these minority communities. Although we acknowledge this as a potential risk, particularly in the short-term, overall we believe that in the medium- to longer-term highlighting exclusion issues will result in more benefit than harm.Finally, there are, as with all qualitative work, questions about how generalisable the findings are beyond the participants included in this study. The underlying factors identified in explaining these differences do suggest, however, that our findings are potentially transferable to other minority ethnic populations and other disease contexts.A key question that arose from the literature and our early interviews was whether the NIH guidelines played a central role in the US. It is important in this respect to note that the NIH is the world's biggest research funder with an annual budget of >US$28 billion. Our subsequent data showed that the policy not only played an important role in the way NIH funded research is conducted, but it also appears to have had a ripple effect in relation to non-NIH funded research. This policy seems to have consequently increased researchers' experience, expertise, and confidence in approaching and interacting with \u201chard to reach\u201d  populations, and funders' appreciation of the cost implications of broadening participation. This work echoes the findings of Wendler et al. \u2026the right to choose whether or not you want to take part in medical research\u201d Our data indicate that the possible benefits of participating in research  in the US may make participation attractive to those who are uninsured (more commonly minorities). As there are no such tangible benefits in the UK , participants may not see the same direct benefits. On a related note, there appears to be a general unease about the offer of financial incentives or funding to community groups to host events, which could facilitate recruitment, because of concerns that this may result in coercion to participate. Exclusion of ethnic minorities is, however, contrary to the spirit and letter of the Race Relations (Amendment) Act and Human Rights Acts Our findings also resonate with the findings reported by Hussain-Gambles et al. The crucial question from a policy perspective is whether the UK needs or is indeed ready for an NIH-type policy on recruitment of minority ethnic groups. This work demonstrates that such a policy would be unpopular in the UK. However, the US example suggests that if introduced appropriately, initial resentment can give way to conviction and a change of attitudes.The fact that many other US funding bodies and academic institutions now implicitly require inclusion of minority ethnic people\u2014even though the law does not require them to do so\u2014suggests that there is a degree of commitment to the idea of inclusion among the leaders and policy makers in the US scientific community. An NIH-type policy, backed with legislation and funding and other technical support Given the considerable concerns expressed by UK researchers about any move towards a mandatory NIH-type policy, it might be argued that it is best initially to continue with the UK's voluntary codes of best practice exhorting researchers to recruit minority ethnic people into their studies. However, given the degree of scepticism and worries about logistics identified, and the US experiences, we believe these voluntary codes are unlikely to translate into improved outcomes unless there is considerable accompanying support for researchers both in relation to ready access to expertise and also financial and material support to develop long-term relationships with the communities of interest. For inclusionary recruitment to occur, funding bodies will need to both recognise its importance and appreciate the use of funds being used to support the range of community initiatives necessary to implement research.If, however, such voluntary measures prove unsuccessful\u2014which is certainly possible\u2014we hypothesise that an NIH-type approach is a credible one that should be considered, as it will most probably translate into substantial improvements in recruitment rates. As with any hypothesis, however, it would need to be tested to examine its credibility and also to ensure that such an initiative does not inadvertently result in more harm than good.Although the focus of this work was on comparing and contrasting experiences between the UK and US, we suspect that the implications of our findings will also apply to many other multi-ethnic societies. Research funders, policy makers, researchers, and the minority ethnic communities themselves in other parts of the world should therefore consider the implications of our work and, if necessary, critically evaluate and reformulate the recruitment procedures currently being supported and employed.Text S1Topic guide for interviews with researchers.(0.03 MB DOC)Click here for additional data file.Text S2Topic guide for interviews with community leaders.(0.03 MB DOC)Click here for additional data file.Text S3Supplementary questionnaire for researchers.(0.03 MB DOC)Click here for additional data file."}
+{"text": "In this paper we seek to tease out differences in socioeconomic position between ethnic groups. There are 3 main reasons why conventional socioeconomic indicators and asset based measures may not be equally applicable to all ethnic groups:1) Differences in response rate to conventional socioeconomic indicators2) Cultural and social differences in economic priorities/opportunities3) Differences in housing quality, assets and debt within socioeconomic strataThe sample consisted of White (n = 227), African-Caribbean (n = 213) and Indian and Pakistani (n = 233) adults aged between 18 and 59 years living in Leeds as measured in a stratified population survey. Measures included income, education, employment, car ownership, home ownership, housing quality, household assets, investments, debt, perceived ability to obtain various sums and perceived level of financial support given and received.Response rates to education and income questions were similar for the different ethnic groups. Overall response rates for income were much lower than those for education and biased towards wealthier people. There were differences between ethnic groups in economic priorities/opportunities particularly in relation to car ownership, home ownership, investment and debt. Differences in living conditions, household assets and debt between ethnic groups were dependent on differences in education; however differences in car ownership, home ownership, ability to obtain \u00a310 000, and loaning money to family/friends and income from employment/self employment persisted after adjustment for education.In the UK, education appears to be an effective variable for measuring variation in SEP across ethnic groups but the ability to account for SEP differences may be improved by the addition of car and home ownership, ability to obtain \u00a310 000, loaning money to family/friends and income from employment/self employment. Further research is required to establish the degree to which results of this study are generalisable. Research on ethnic differences in health and other social indicators has been criticised for failing to adequately take into account socio-economic differences between groups. -8 More rThe issue of how SEP and ethnicity are related is further vexed by major shifts in indicators of SEP, with much greater emphasis on how traditional indicators like income and education translate operationally into assets, living conditions and resources that may directly impact on health. This is reflected in asset based surveys such as Breadline Britain  and the In this paper we seek to improve understanding of the appropriate use of measures of socioeconomic position for studying health differentials between ethnic groups in the UK. There are three main reasons why conventional socioeconomic indicators and asset-based measures may not be equally applicable to all ethnic groups:1) Differences in response rate to conventional socioeconomic indicators;2) Cultural and social differences in socioeconomic position including work, investment and access to funds;3) Differences in housing quality, assets and debt within socioeconomic strata.The paper addresses these issues in three sections. The first section examines ethnic group differences in response rates to questions about education and income. The second section examines ethnic group differences in housing quality, assets and debt. The third section explores whether ethnic group differences in living conditions, assets and debt vary by level of education.The survey of white (n = 227), Indian and Pakistani (n = 233) and African Caribbean (n = 213) adults aged 18\u201359 years living in Leeds, UK was part of a larger study which aimed to examine the relationship between ethnicity, health and SEP carried out as part of the Economic and Social Research Council Health Variations Program. Details of the study sample have been reported previously.[Nam Pehchan sensitivity 88\u201396% and Positive predictive validity of 59\u201367% against names from Yorkshire), [There is no statutory requirement for primary care to collect data on ethnicity. In the absence of ethnic monitoring, different approaches needed to be taken to identify people to be included in the white sample and the Indian and Pakistani sample, compared to the African-Caribbean sample. In the current study, names were used to allocate individuals to the White and the Indian and Pakistani groups from which random samples were drawn. Patients with South Asian names were identified with the aid of a software package (kshire),  with addFollowing difficulties in reaching the required numbers, additional interviews were undertaken using quotas to ensure that the sample had an appropriate level of representation of each group. This involved targeting potential interviewees living around a number of identified sampling points through random walks as well as snowball sampling in the electoral wards. Response rates for the pre-selected sample were 27.1% and 41.3% for the quota sample. The overall response rate was 33%. The proportion of people selected by each recruitment method varied between ethnic group . There was no interaction between ethnicity and sample strategy on any socioeconomic variable except home ownership. Among white people the primary sample were slightly more likely than people in the quota sample to own their own homes but the opposite was true for minority ethnic groups.The ethnicity designation of participants was confirmed using self-identified categorisations that were then mapped into the 2001 census categories. The results are presented here for White, African-Caribbean groups, and, due to small numbers, for Indians and Pakistanis as one group. People of mixed origin were generally assigned to minority rather than white groups. Of the 247 White participants, 241 identified as British, 2 as Irish, 1 as French and 3 as other White. Of the 232 Indian and Pakistani participants, 92 identified themselves as Indian, 129 as Pakistani, 3 as African, 2 as any other Asian background, 1 as Any other mixed background; 1 as British, 1 as British Sikh 1 as East African Asian and 2 as White and Asian. Of the 212 African-Caribbeans, 167 identified themselves as Caribbean, 21 identified themselves as African, 3 as Black British, 7 as British Caribbean and 6 as of other black backgrounds. The remainder identified themselves as being of mixed origin, including 8 as White and Black Caribbean. Each person was only allowed to be in one category. People identifying in two categories where one was a minority were allocated to the minority group. Small sample size meant that there were only sufficient numbers for three groups; White, African Carribbean and Indian and Pakistani. This may limit the generalisability of the results and potentially subgroup differences within ethnic groups.The instrument used in the community survey was developed following preliminary analysis of the qualitative data that had been collected in the previous phase of the research and a detailed review of existing published and unpublished survey instruments used to assess socioeconomic position. The questionnaire included sections on ethnicity, socioeconomic position, social resources, discrimination and health. DemograpThe survey was conducted by a commercial market research company using face to face interviews to complete each questionnaire. Interviewees and interviewers were matched on the basis of language and gender. Most interviews took place in people's homes.All analyses were conducted in Intercooled Stata version 10.0. Binomial logistic and linear regressions were used to examine ethnic differences in the response rate to income and education  and university) questions by home ownership, car ownership, savings of more than \u00a31000 and can not afford household goods. All SEP measures were coded dichotomously.Binomial logistic and linear regressions were used to examine ethnic differences in car ownership, home ownership, poor quality housing, worry about losing home, can not afford household goods, investments, no debts, able to get \u00a310 000, owe money to family/friends, lent money to family/friends, welfare and employment/self-employment. All variables were coded dichotomously. People who reported that their house was too damp, uncomfortably cold in winter or too small were classified as having poor housing quality. The measure for can not afford household goods was based on whether the respondent said their household lacked the following goods because they could not afford it; telephone, washing machine, freezer/fridge, dishwasher, mobile phone, cable/satellite television, video recorder, central heating, tumble drier/washer, burglar alarm, compact disc player or home computer. Investments included personal pension, PEP/TESSA/stocks/shares, savings, jewellery, property other than home, community savings scheme and other. Debts included credit card, catalogue, hire purchase, bank loan, family/friend loan, other loan, overdraft and mortgage/rent arrears. The welfare measure included family benefit, income support, job seekers allowance, housing benefit.Further analysis was conducted to assess the effect of ethnic difference on these SEP measures taking education into account. Rates and means adjusted for age and sex were calculated using adjprop and adjmean procedures. Age was coded into three categories . Age was further reduced to two categories for some variables, because there were no cases among younger people. Age  adjusted rates as well as odd ratios are reported, to clarify differences between groups.[The response rate to the question about highest level of education was 97%. Although there appeared to be a slightly lower response rate for the Indian and Pakistani group this difference was associated with a greater number of first generation immigrants among the Indian and Pakistani group.Across all ethnic groups studied only 42.2% of people responded to questions about personal income and 22.1% responded to questions regarding household income. There were no substantial differences in response rates between ethnic groups: White 46.1% (95%CI 40.0\u201352.3%), Indian and Pakistani 37.7% (95%CI 31.8\u201344.1%) and African Caribbean 37.8% (95%CI 31.8\u201344.1%).People who responded to the personal income question were more likely than people who did not respond to own a car , a home  and to be able to obtain \u00a31000 from their savings  regardless of ethnicity. However there were no differences in being able to afford household goods .Overall the results suggest that missing responses to income questions are not independent of SEP in any ethnicity. Accordingly education may be a better than income at measuring socioeconomic status across ethnic groups.The Indian and Pakistani group was more likely than the White group to own one car . The Indian and Pakistani group were more likely than the white group to own their homes at all levels of education . There was no interaction between ethnicity and education and home ownership.Poor quality housing was not related to education . The Indian and Pakistani group were more likely than the white group to report having poor quality housing . There were no clear differences between the African Caribbean group and the white group. There were no differences in worry about losing home either due to education or ethnicity.The proportion of people with investments increased with level of education . People educated to above secondary school level were less likely to have no debts than people with lower levels of education .University educated people were more likely than people educated to secondary level or below to be able to obtain \u00a310 000 . There were no other significant differences due to education or ethnicity nor were there any significant interactions.The ability to afford household goods was relatively consistent across levels of education . There were no differences in being able to afford household goods due to ethnicity.People educated above secondary level were more likely that people educated below secondary level to receive income from employment/self employment . African Caribbeans were less likely than the white group overall to receive income from employment/self employment . There were no differences between Indians and Pakistanis and the white group. There was an interaction between ethnicity and education with the apparent benefits of being educated above secondary level in terms of receiving income from employment/self employment being far smaller for the African Caribbeans  and the Indian and Pakistani  groups than the white group.Overall the results suggest that response rates to conventional indicators were relatively consistent across ethnic groups. Response rates to questions about education were high across ethnic groups. On the other hand there was a tendency in all ethnic groups for people who had fewer assets to be less likely to respond to income questions. This effect was more marked in the white group. This suggests that income might be a biased indicator in all ethnic groups unless considerably better response rates can be achieved than in this study.The extent to which education reflects socioeconomic well-being may depend on the proportion of immigrants in different ethnic communities or at least the extent to which immigrants' qualifications are obtained in the UK. Accordingly the results of this study in regard to education may not be generalisable to samples with high proportions of immigrants or people whose qualifications were obtained outside the UK. There was also some evidence of ethnic variability in perceptions of the usefulness of educational qualifications in gaining employment. It should also be noted that there are many other factors such as household composition that might modify the SEP effects observed.There were clear differences between ethnic groups in home ownership, a finding consistent with extant literature.,20 The rPrevious research has noted the importance of informal economy and 'support in kind' to working class, including South Asian families.  InformalDifferences in socioeconomic indicators by ethnicity were examined within education categories. In general controlling for education did account for most of the variation in SEP between ethnic groups. Differences in assets, debt and investments did not persist when education was taken into account nor were there any significant interactions. Some differences in car and home ownership, ability to obtain \u00a310 000, loaning money to family/friends and income from employment/self employment did persist. This suggests that these variables, in addition to education, might provide an effective basis for capturing socioeconomic position in different ethnic groups. However it should be noted that the sample size in the current study was relatively small limiting our ability to estimate the degree of residual confounding.Overall the results support the contention that the relationship between ethnicity and socioeconomic position is complex.,15 RespoThe authors declare that they have no competing interests.MK conducted the analysis and drafted the manuscript. SP participated in the design and management of the study. HL, WA, GDS assisted in the design of the study and helped draft the manuscript."}
+{"text": "High blood pressure (BP) is now an important public health problem in non-industrialised countries. The limited evidence suggests ethnic inequalities in BP in adults in some non-industrialised countries. However, it is unclear whether these ethnic inequalities in BP patterns in adults reflect on adolescents. Hence, we assessed ethnic differences in BP, and the association of BP with body mass index (BMI) among adolescents aged 12\u201317 years in Paramaribo, Suriname.Cross-sectional study with anthropometric and blood pressure measurements. A random sample of 855 adolescents  were studied. Ethnicity was based on self-reported ethnic origin.Among boys, Maroons had a lower age- and height-adjusted systolic BP than Creoles, and a lower diastolic BP than other ethnic groups. However, after further adjustment for BMI, only diastolic BP in Maroons was significantly lower than in Javanese (67.1 versus 70.9 mmHg). Creole boys had a lower diastolic BP than Hindustani (67.3 versus 70.2 mmHg) and Javanese boys after adjustment for age, height and BMI. Among girls, there were no significant differences in systolic BP between the ethnic groups. Maroon girls, however, had a lower diastolic BP (65.6 mmHg) than Hindustani (69.1 mmHg), Javanese (71.2 mmHg) and Mixed-ethnic (68.3 mmHg) girls, but only after differences in BMI had been adjusted for. Javanese had a higher diastolic BP than Creoles (71.2 versus 66.8 mmHg) and Mixed-ethnicity girls. BMI was positively associated with BP in all the ethnic groups, except for diastolic BP in Maroon girls.The study findings indicate higher mean BP levels among Javanese and Hindustani adolescents compared with their African descent peers. These findings contrast the relatively low BP reported in Javanese and Hindustani adult populations in Suriname and underscore the need for public health measures early in life to prevent high BP and its sequelae in later life. The increasing prevalence of cardiovascular diseases (CVD) is putting a tremendous pressure on already overburdened resources in non-industrialised countries.  High bloIn children, BP tracking patterns confirm that persistent BP increase may be related to hypertension in adulthood. -5 IncreaSuriname's population is made up of several ethnic groups. As in industrialised countries, -12 the lSuriname is located in Northern South America. It borders French-Guyana to the east, British-Guyana to the west, Brazil to the south and the Atlantic Ocean to the north Figure . It has Data were collected in nine schools among healthy adolescents between the ages of 12 to17 years. All schools were randomly selected from the 103 government schools' list. The schools were visited prior to data collection to obtain permission from the relevant school principals as well as from the pupils. After agreeing to this, participants were advised not to smoke, drink alcohol or take vigorous exercise during the 30 minutes preceding the BP measurement. Data collection took place during normal school hours. Verbal informed consent was sought from each participant before measurements were taken. None of the children refused to participate in this study. Forty three children were excluded because they were below 12 years old, and one child was excluded because she reported suffering from severe heart disease. The Ethical Board of the Ministry of Education in Suriname approved the study protocols.2). Overweight and obesity were defined using the sex- and age-specific BMI criteria of the International Obesity Task Force. [Height was measured without shoes with a measuring tape to the nearest 0.01 metre. Weight was measured to the nearest 0.1 kg after removal of shoes, jackets, heavy clothing and pocket contents . BMI was calculated as weight divided by height squared . Javanese originate from Indonesia (East Asia). Creoles are descendants of West Africans who live in Paramaribo. The Maroons are descendants of West Africans who fled the colonial Dutch forced labour plantations in Suriname and established independent communities in the interior rainforests. They have retained a distinctive identity based on their West African origins. There are no secondary schools in their villages, so they attend schools in Paramaribo. Because of the important differences between these two West African descent groups in terms of lifestyle and history, we have separated these groups. Physical activity was based on the frequency of leisure physical exercise per week outside of school. The same trained final year medical student made anthropometric and blood pressure measurements in all schools.P-value < 0.05 was considered statistically significant. All statistical analyses were performed using SPSS for Windows version 14.2  and STATA 9.2 .Age specific mean systolic BP and diastolic BP levels were determined for boys and girls. Multivariate linear regression analysis enabled age, height and BMI adjusted comparisons of systolic BP and diastolic BP levels to be made between different ethnic groups. Multiple linear regression analyses were performed separately for each ethnic group to assess the relationship between BMI and BP adjusted for other factors. All statistical tests were two-tailed and P = 0.03) and Mixed-ethnicity boys (P = 0.05). Maroon boys were more likely than other boys to exercise 5\u20137 days/week. Creole girls were taller than all the ethnic groups (P < 0.001). Maroon girls had a higher BMI than Hindustani girls (P = 0.03) and Javanese (P < 0.01) girls.Table The mean systolic BP and diastolic BP increased with age in both boys and girls Figure  and 2b. P = 0.04). Creole boys had a relatively low age- and height-adjusted mean diastolic BP compared to other boys. After further adjustment for BMI, the differences became more pronounced between Creole and Hindustani boys (P = 0.04) and Javanese boys (P = 0.02).Figure P < 0.01). Maroon girls had a significantly lower mean diastolic BP than all ethnic groups, except for Creole girls, but only after differences in BMI had been adjusted for. There were no significant differences in mean systolic BP between the ethnic groups.Among girls, Javanese had a significantly higher age- and height-adjusted mean diastolic BP than all other ethnic groups except for Hindustani girls. The differences persisted after further adjustment for age, height and BMI (Maroon boys and Hindustani boys and girls had a relatively low prevalence of high BP compared with other ethnic groups although the differences were not statistically significant Figure  and 5b.As far as we know, this is the first study on BP patterns amongst adolescents in Suriname, and one of the few studies in adolescents comparing different ethnic groups in a non-industrialised country. Maroon boys had a lower BP than all ethnic groups including Creoles with similar West African descent. The lower BP in Maroon boys as compared to other ethnic groups was accounted for by their lower BMI. This might reflect differences in environmental factors such as lifestyle between Maroons and other ethnic groups. Maroon adolescents moved from the Suriname interior to Paramaribo to continue their education. Most Maroon people in Suriname interior still live traditional African lifestyles with female subsistence horticulture and male hunting and fishing.  Most MarStudies in adults have consistently shown higher BP levels in African descent people than in other ethnic groups. ,9-11 StuThe explanations for the different patterns of BP in adolescents and adulthood among African descent populations are unclear and require a cohort study to unravel the possible mechanisms underlying these differences. These observations suggest that environmental factors may be very important. The higher BP among Javanese adolescents was unexpected given the lower BP reported among the Javanese adult population in Suriname. The reason for the higher mean BP among Javanese adolescents is unclear. One possible explanation may relate to generational differences or changes in lifestyles. This requires further study. Left unchecked, the comparatively high BP among Javanese adolescents may abolish or reverse the current lower BP advantage enjoyed by the Javanese adult population in Suriname. These observations clearly indicate the need for early intervention in adolescents for preventing high BP in later life. The relationship between BMI and BP is well established in children and adolescents. -17 The sOur study has limitations. As in many epidemiological studies, our BP level was based on an average of two measurements at a single visit. A more precise estimate of BP level would be obtained by multiple measurements obtained during several visits. Also, evidence suggests that during puberty BP increases more rapidly, with a significant gender difference in the age of onset.  In the pThe study findings indicate a higher mean BP among Hindustani boys and Javanese boys and girls whereas in the adult population these groups have lower mean BP levels in Suriname. BMI was positively related to BP in all the ethnic groups. These observations underscore the urgent need for public health measures early in life to prevent high BP and its sequelae in later life. BP reductions in adolescents can be achieved by weight loss through reducing excessive energy intake  and incrThe authors declare that they have no competing interests.All were responsible for study concept and design. EO and WJ were responsible for data collection. CA, JFW, EO and KS were responsible for analysis and interpretation of data. CA drafted the manuscript and all were involved in critical revision of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The search for a habitable extrasolar planet has long interested scientists, but only recently have the tools become available to search for such planets. In the past decades, the number of known extrasolar planets has ballooned into the hundreds, and with it, the expectation that the discovery of the first Earth-like extrasolar planet is not far off.Here, we develop a novel metric of habitability for discovered planets and use this to arrive at a prediction for when the first habitable planet will be discovered. Using a bootstrap analysis of currently discovered exoplanets, we predict the discovery of the first Earth-like planet to be announced in the first half of 2011, with the likeliest date being early May 2011.predictive scientometric techniques to understand the pace of scientific discovery in many fields.Our predictions, using only the properties of previously discovered exoplanets, accord well with external estimates for the discovery of the first potentially habitable extrasolar planet and highlight the the usefulness of  The search for a habitable extrasolar planet has long interested scientists, but only recently have the observational tools become available to search for such planets While many, astronomers included, have speculated about when the first habitable planet might be discovered Of course, predicting future scientific and technological progress is a slippery and difficult process. While there have been many such successes, such as Moore's Law Here too there are many difficulties. Estimating the habitability of planets is itself a complicated process with many parameters Using the calculated mass and temperature of a planet, we constructed a simple habitability metric, The formulas for the submeasures that makes up Each sub-measure is simply the product of two opposing modified logistic curves with some rescaling, which yield functions of the forms seen in Note that while a nominal temperature, Calculations of planetary surface temperature involve assumptions of stars on the Main Sequence and black body radiation models, and were as follows Using these metrics, In order to create a robust estimate of the date of discovery of the first Earth-like planet, the following factors were considered:The extrasolar planets considered were detected by two methods: radial velocity (RV) and transit. The radial velocity method detects a planet using the Doppler effect to determine the motion of the planet's star, and the transit method detects a planet using changes in brightness of the star due to the planet's transit in front of it. While the transit method provides accurate estimates of the mass, Any estimate of the detection of the first Earth-like planet will necessarily be dependent on the vagaries of those planets which were previously discovered. If other stars were examined, a different set of of planets, and therefore A bootstrap analysis was conducted, which accounts for the To predict when the first habitable planet . This allows us to determine what the likeliest date of the discovery of an Earth-like planet would have been predicted to be, if the analysis were conducted throughout the previous decade. The median dates of discovery are shown in The creation of a single metric of habitability, A great deal of current interest is focused on NASA's ongoing Kepler mission In order to determine how useful Kepler will be in the search for a habitable planet, we reran our prediction analysis using only those planets discovered using the transit method. And it turns out that the method is unable to converge on a likely date of discovery, due to the paucity of the data (62 planets) and the low It must be noted that by publicizing our prediction, there is a concern that it will become accurate, simply due to the well-studied Hawthorne Effect Therefore, it is reasonable to use the habitability metric curve as a rough prediction for when the first potentially habitable planet will be discovered, in this case, as early as May 2011, and likely by the end of 2013."}
+{"text": "As in other Western countries, the number of immigrants in the Netherlands is growing rapidly. In 1980 non-western immigrants constituted about 3% of the population, in 1990 it was 6% and currently it is more than 10%. Nearly half of the migrant population lives in the four major cities. In the municipality of Rotterdam 34% of the inhabitants are migrants. Health policy is based on the ideal that all inhabitants should have equal access to health care and this requires an efficient planning of health care resources, like staff and required time per patient. The aim of this study is to examine ethnic differences in the use of internal medicine outpatient care, specifically to examine ethnic differences in the reason for referral and diagnosis.We conducted a study with an open cohort design. We registered the ethnicity, sex, age, referral reasons, diagnosis and living area of all new patients that visited the internal medicine outpatient clinic of the Erasmus Medical Centre in Rotterdam (Erasmus MC) for one year (March 2002\u20132003). Additionally, we coded referrals according to the International Classification of Primary Care (ICPC) and categorised diagnosis according to the Diagnosis Treatment Combination (DTC). We analysed data by using Poisson regression and logistic regression.All ethnic minority groups  living in Rotterdam municipality, make significantly more use of the outpatient clinic than native Dutch people .Immigrant patients are more likely to be referred for analysis and treatment of 'gastro-intestinal signs & symptoms' and were less often referred for 'indefinite, general signs'. Ethnic minorities were more frequently diagnosed with 'Liver diseases', and less often with 'Analysis without diagnosis'. The increased use of the outpatient facilities seems to be restricted to first-generation immigrants, and is mainly based on a higher risk of being referred with 'gastro-intestinal signs & symptoms'.These findings demonstrate substantial ethnic differences in the use of the outpatient care facilities. Ethnic differences may decrease in the future when the proportion of first-generation immigrants decreases. The increased use of outpatient health care seems to be related to ethnic background and the generation of the immigrants rather than to socio-economic status. Further study is needed to establish this. Health policy is based on the ideal that all inhabitants should have equal access to health care. US studies have found ethnic differences in the use of health care with lower consumption rates for people from ethnic minorities ,2. EuropDifferences in consumption rates could be based upon differences in the incidence of diseases. For some diseases, like diabetes, it has indeed been shown that there are ethnic differences in incidence -15. HoweSince the number of immigrants in the industrialized countries is growing, it is also of growing importance to obtain data on ethnic differences in the use of health care, referral patterns en diagnoses. E.g., in the Netherlands the proportion of non-western immigrants increased from about 3% in 1980, to 6% in 1990 and more than 10% in 2005. A limitation of previous studies is their reliance on self-reports of health care utilization. Although self-reports have been shown to be a valid estimate of health care utilization across socio-economic strata , there iThe ethnic minority populations in the western European countries mainly exist of immigrants who entered the country in the period between 1955\u20131985 when there was a severe shortage of people to do the unschooled jobs in these countries (first-generation immigrants). In the case that ethnic differences are found, it would also be worthwhile to know whether these differences also persist in the younger generations or whether the consumption rates in younger generations will be more alike those in the majority population.Using hospital registration data for an outpatient clinic for internal medicine we investigated the following research questions:(1) Are there differences between ethnic groups in the use of outpatient health services?(2) Are there differences in reasons for referral and diagnosis between ethnic groups?new patients that visited the outpatient clinic of the department of Internal Medicine, Erasmus Medical Center (Erasmus MC), a university hospital in Rotterdam, the Netherlands, was registered (N = 3985). Definition of new patients: no referrals in the previous 14 months and referral for medical signs and symptoms that were not examined or treated in an earlier stage. Age of all patients was 15 year and over. This is because children under 15 year do not visit Erasmus MC, they go to a specialised hospital for children.From March 2002 to March 2003 the ethnicity of all Based on the next inclusion criteria the study population was selected out of the 3985 patients:1. Age under 71 year, as the older age groups contained very few immigrants. (N = 3270)2. The living area, based on zipp codes, is restricted to the municipality of Rotterdam. (N = 1592)3. Patients ethnicity: Six ethnicities were included: Surinamese, Turkish, Moroccan, Aruban/Antillean, Cape Verdean and Dutch. (N = 1332)The research proposal, including the plan of data collection, was authorised by the research ethics committee of the Erasmus MC. We used the country of birth of the patient and both parents to assign ethnicity. We applied the standard definition of ethnicity of Statistics Netherlands and considered a person to be Non-Dutch if at least one parent was born abroad . During The patient population was divided into two groups: residents from the referral area of the Erasmus MC and patients living in the municipality of Rotterdam. The referral area is part of the municipality of Rotterdam as a whole; the inhabitants of the referral area constituted about 12% of all inhabitants living in the municipality of Rotterdam. The referral area consists of the neighbourhoods surrounding the Erasmus MC, which is for the greater part a deprived area, for which the hospital has a local community service.Medical reports sent to the general practitioners, when the diagnostic analysis was completed, were scrutinized in order to collect the reason for referral and diagnosis. Both paper medical record and electronic records were used complementary in order to collect the data. Complete data were available for 1070 of 1332 patients. Absence of reports was equally distributed over all ethnic groups. After looking into more detail, 82 patients were not new patients. In total, referral reasons and diagnosis were collected for 988 new patients. Referral reasons were coded according to the International Classification of Primary Care (ICPC) and diagnosis according to the Diagnosis Treatment Combination (DTC). The latter is a system used to finance hospitals in the Netherlands. It is based on formation of groups of patients that have a homogeneous health care use profile. We designed meaningful categories by aggregating ICPC and DTC codes, in order to obtain groups of sufficient size for the analyses. In the appendix the original codes and structure as well as the aggregated categories for ICPC and DTC are presented.In the Netherlands general practitioners are the gatekeepers to most other health services. Almost all Dutch inhabitants have a health insurance, at least in the period of this study. That means that there are no financial barriers for seeking professional health care help. In Rotterdam there are, besides Erasmus MC, four more hospitals that offer health care services. However, inhabitants of the referral area mainly visits the Erasmus MC, because of it's local community service for this area.from their relative distribution in the population. In order to estimate rate ratios (Relative Risks) and 95% confidence intervals (CI) of health care use by ethnicity, in research question 1, Poisson regression analyses were carried out. Ethnicity was the independent and use of health care the dependent variable, while adjusting for age, sex and socio-economic status. For the Poisson distribution, the patients constituted the numbers of observed events (numerator). A base group (as a reference) represents the rate (denominator) at which these events occur. The population of the municipality of Rotterdam, including the ethnic distribution of it, constituted this group. For analyses restricted to the referral area, the population of the referral area was the base group. Both base groups were exactly defined grounded on six-digit zip codes. The composition  of the base groups was obtained from Statistics Rotterdam. We used the multiplicative (relative) risk, which is the standard Poisson regression model. The statistical package used was EGRET (version 2.0.1).With regard to research question 1 it was examined whether ethnic minority groups had a higher or lower use of the outpatient clinic than could be expected within the study population of patients. For the research questions about ethnic differences in referrals and diagnosis, the reference consisted of the patient group. We did not have the data to estimate odds ratios for the population of Rotterdam, that is why we restricted these analyses to the patient population. For these questions logistic regression was used in SPSS (version 11). Ethnicity was the independent variable and reason for referral respectively diagnosis was the dependent variable . We adjusted for age, sex and socio-economic status.With regard to research question 2, we examined whether there were ethnic differences in reasons for referral and diagnosis The analyses of research question 1, concerning the population of Rotterdam, were restricted to people aged 15\u201370, as the older age groups contained very few immigrants. In the models we adjusted for sex, age (10-year age categories), and socio-economic status . The analyses concerning differences in generation were restricted to people 15\u201345, as the second-generation immigrants contained very few people above 45 years.In total, 4438 new patients visited the outpatient clinic. From these 4438 patients, ethnicity was registered for 3985 patients (90%). Only residents of the municipality of Rotterdam were included (40%). Six ethnicities were included: Surinamese, Turkish, Moroccan, Aruban/Antillean, Cape Verdean and Dutch (33%). Among the ethnic minorities Surinamese was the largest, and Antillean/Aruban accounted for the smallest group of patients. All patients were referred by their GP, because of the gatekeeper role of the GP in the Netherlands. In table For the referral area of the Erasmus MC, immigrant people have an increased use of the outpatient clinic compared to Dutch people, adjusted for sex and age. The increased use was expressed by relative risks of consultations, which ranged from 1.29 in the Cape Verdean group to 1.82 in the Turkish group. The difference was statistically significant only for Surinamese, Turkish and Moroccan people.For the municipality of Rotterdam, all immigrant groups included in this study, had a significantly increased use of outpatient care, adjusted for sex and age. Again Turkish immigrants had the highest rates; relative risks ranged from 1.65 in the Antillean/Aruban group to 1.97 in the Turkish group. In table Additional adjustment for socio-economic status hardly changed the estimates table . The larIn table After adjusting for socio-economic status ethnic differences only decreased slightly, indicating that ethnic differences in socio-economic status hardly explained the differences in referral reasons for patients that were referred to the Erasmus MC.In table Ethnic differences in risk for 'liver diseases' are partly explained by differences in socio-economic status; after adjusting for socio-economic status the differences in risk became smaller. For 'liver diseases' the risk decreased from 1.96 to 1.75, but retained a borderline significance. For 'analysis without diagnosis' the risk decreased slightly after adjustment for socio-economic status (from 0.62 to 0.67), it retained statistical significance.Finally, we also analysed ethnic differences in the risk of getting a certain diagnosis given the referral reason and looked for ethnic differences in this relationship. There appeared to be no differences between the ethnic groups under study, except for the category 'gastro-intestinal signs & symptoms', in which immigrant patients were more likely to receive a diagnosis in the category 'liver' (data not shown).There is a higher number of new patient referral visits of Surinamese, Turkish and Moroccan immigrants, living in the referral area of the Erasmus MC, compared to native Dutch people than could be expected from their relative distribution in the population. In Rotterdam municipality the five largest ethnic minority groups all demonstrate a higher use of the outpatient care facilities. This increased use can be predominantly ascribed to the first-generation immigrants; second-generation immigrants do not appear to have an increased use of health care services. Immigrant patients who visited the outpatient clinic were more likely to be referred because of 'gastro-intestinal signs & symptoms' and less likely to be referred because of 'diffuse and ambiguous signs'. Regarding ethnic differences in diagnosis, we noted an increased risk of 'liver related diagnosis' and a decreased risk of 'analysis without diagnosis' for immigrant patients.referral reasons and diagnosis. In the results of research question 2 no ethnic differences were found for the referral reason 'risk factor vascular disease'. However, looking in more detail shows large differences between the ethnic minority groups for more specific referral reasons. Surinamese and Cape Verdean patients often are referred with the most prevalent underlying risk of vascular diseases, namely hypertension. The same holds with regard to ethnic differences in diagnosis: we found no different risk of diagnosis 'risk factor vascular diseases' regarding ethnicity. But the underlying codes showed that diabetes mellitus was significantly more prevalent among referred immigrant patients and dyslipidemia more common among Dutch patients. Odds ratios have to be interpreted in a relative sense, because they were calculated for the closed group of patients that visit the outpatient clinic of Erasmus MC. An apparent lower odds ratio might be the result of higher rates in other groups of diagnosis.We have to consider a few limitations of the current study. Although over 4000 new patients were registered in the hospital, numbers for those eligible for the study were small for some ethnic groups, and especially for second-generation immigrants. Therefore, not all research questions could be examined for the ethnic groups separately, nor could the first-generation be distinguished from second-generation immigrant for all research questions. For our second research question it was necessary to aggregate all ethnic groups to one 'immigrant' group. The aggregation was justified by the outcomes of table In the second place ethnicity is based on countries of birth. Although this is a well-accepted definition ,26-28 weWe approximated socioeconomic status at the individual level by making use of mean neighbourhood incomes, a variable at the ecological level. This measure may not be equally good for all ethnic groups. In some groups, the place of residence is determined by the mean socioeconomic status of a neighbourhood, whereas in others it is predominantly determined by the ethnic composition of a neighbourhood. In that case, neighbourhood income may be a less valid indicator of socioeconomic status. For Antilleans this does not seem to be the case, however for Turks, Moroccans and Surinamese a somewhat larger proportion (5 to 15%) of the population belonged to the lowest income quintile according to the measure at the ecological level than according to the measure at the individual level. This means that the place of residence of Turks, Moroccan and Surinamese may be more strongly determined by factors other than neighbourhood income. As the discrepancy was fairly small, the influence of the differential validity on the outcomes of this study would be limited .in referral reasons for both areas separately (data not shown). The findings at least indicate that there are no ethnic differences in referral reasons between the referral area and Rotterdam as a whole. Herewith a correct inference for the population of Rotterdam municipality is deduced, since the assumption for representativeness of the patient sample seems to be supported.Besides Erasmus MC, there are four more hospitals in Rotterdam that offer health care services. Differences in preference for Erasmus MC could have introduced the differences in health care use. For at least the referral area, this seems hardly the case. A survey among general practitioners in the referral area reported a slightly different referral pattern among different ethnic groups to Erasmus MC and other hospitals in Rotterdam (unpublished data). General practitioners send immigrant patients more often than Dutch patients to the internal medicine outpatient's care of Erasmus MC. The difference is (at most) 5% and cannot explain the increased use of 80% by immigrant patients. Additional support for our assumption that potential differences in referral patterns (due to preferences or the reputation of the Erasmus MC) between ethnic groups in Rotterdam municipality, have had little influence on the outcomes of our study comes from the analysis of the ethnic differences Remarkable is that the ethnic differences in likelihood of being referred are higher when focussing on Rotterdam municipality than when focussing on the referral area. It is uncertain whether this can be attributed to the prevalence of certain diseases, which require special care. Erasmus MC is also a university hospital and delivers tertiary medical care.use of health care differ from the results of Stronks et al., who reported no differences in the use of outpatient care [The results of this study regarding the ent care , likewisent care The results of our study are in agreement with the results of some other studies. Both Manna  and WeidA possible explanation for the higher use of outpatient care among immigrants might be a direct reflection of a higher incidence and prevalence of certain diseases. We did not have information about health status, but previous studies have reported a higher incidence of infectious diseases , hyperteBesides the differences in health care use between native Dutch and ethnic minority groups, there also appear to be differences among the ethnic minority groups themselves. Additional analyses showed that Cape Verdean immigrants have a statistically significant lower use of health care than Surinam, Turkish and Moroccan immigrants. Further research is needed to explore why Cape Verdean immigrants are more similar to the native Dutch population regarding health care use.Because our data are limited to one particular outpatient care unit and moreover to a university hospital, we must be cautious in generalizing the results and the hypotheses generated by this study require further study.We conclude that especially first-generation immigrants make significantly more use of the outpatients' care in internal medicine. Ethnic differences might decrease as the share of first-generation immigrants decreases. Concerning this point, it is warranted to monitor the risks of diseases associated with prosperity in the future among immigrant groups. Ethnic differences in referral reasons and diagnosis might be based on a higher prevalence of diseases. Further study is needed to establish this. We found no evidence that the increased use is based on referrals for non-medical reasons, on the contrary. As long as the increased use of outpatient health care is related to ethnic background and the generation of the immigrants rather than to socio-economic status, health professionals have to take ethnicity into account in their daily medical practice. Moreover, they should take the main differences in prevalence of diseases among immigrants into account during the consultations.LCL drafted the manuscript. and performed the statistical analysis. AHB participated in the design of the study. SWJL and JPM both conceived of the study, and participated in its design. IJ participated in the conceive of the study, participated in its coordination and helped to draft the manuscript. All authors read and approved the final manuscript.Weakness, tiredness general, feeling ill, pain general/multiple sites, nausea, feeling anxious/nerves/tense, feeling depressed, feeling/behaving irritable/angry, sleep disturbance, memory disorderAbdominal pain/cramps general, abdominal pain epigastric, heartburn, rectal/anal pain, perianal itching, abdominal pain localized other, dyspepsia/indigestion, flatulence/gas/belching, vomiting, diarrhoea, constipation, haematemesis/vomiting blood, maelena, rectal bleeding, incontinence of bowel, change in faeces/bowel movements, abdominal mass nos, abdominal distension, viral hepatitis, injury digestive system other, congenital anomaly digestive system, oesophagus disease, duodenal ulcer, peptic ulcer other, stomach function disorder, appendicitis, hiatus hernia, abdominal hernia other, diverticular disease, irritable bowel syndrome, chronic enteritis/ulcerative colitis, anal fissure/perianal abscess, liver disease nos, cholecystisis/cholelithiasis, disease digestive system other.Elevated bloodpressure, hypertension uncomplicated, hypertension complicated, lipid disorder, diabetes insulin dependent, diabetes non-insulin dependent, ischaemic heart disease with angina, acute myocardial infarction, ischaemic heart disease without angina, stroke/cerebrovascular accident, cerebrovascular disease, artherosclerosis/peripheral vascular disease, pulmonary embolism, heart failure.All rest codes occurring at the outpatient department of internal medicine.Hypertension, stroke (not specified as haemorrhage or infarction), embolism and thrombosis of arteries, aneurysmas, atherosclerosis peripheral, other arterial disorders, post thrombosis syndrome, ischaemic heart diseases, unstable angina, myocardial infarction, heart failure, dyslipidaemia, riskfactors vascular disease, thrombophilia, diabetes.Diseases of liver: Hepatitis B/C, alcoholic hepatitis, livercirrhosis, liver tumours.GastroenterologyDiagnostic procedures generated no diagnosis. All diagnostic procedures in the beginning were based on signs (i.e. pain) or symptoms Endocrine System Diseases, without diabetes mellitus.White rule remaining diagnosisThe pre-publication history for this paper can be accessed here:"}
+{"text": "Metabolic syndrome (MS) is combination of medical disorders that increase people's risk for cardiovascular disease and diabetes mellitus. Little data exists on the prevalence of MS of rural original adults in Ningxia of China.A cross-sectional survey method was used and the participants were interviewed by trained health workers under a structured questionnaire in rural of Ningxia in 2008. The number of research subjects was 1612. MS was defined by International Diabetes Federation IDF (2005).The age-adjusted prevalence of the metabolic syndrome was 11.8%, whereas ethnic-specific prevalence was 10.3% in Han ethnic group and 13.7% in Hui ethnic group. Components of MS and MS were more common in Hui ethnic group than Han ethnic group. The mean levels and prevalence of abnormal value increased with increasing age in both ethnic groups .The prevalence of MS was high in rural residents' adults in Ningxia. Clustering of MS components and MS was increased with age. The components of MS have big differences among different ethnic groups. It is well accepted that the metabolic syndrome is a condition that promotes atherosclerosis and increases the risk of cardiovascular disease and diabetes mellitus -3. Each Several studies had illustrated a high prevalence of diabetes, impaired glucose tolerance, obesity, and hypertension among Chinese -9. HowevThe study was a chronic disease and nutrition survey carried out in the province of Ningxia in china . Data collection started in May 2008 and ended in March 2009. To control the precision of sampling, stratified cluster sampling was applied. First, different levels of economic income region (Wuzhong city and Guyuan city) were selected among the total five regions in Ningxia, then one Hui ethnic village and one Han ethnic village were randomly selected in each region. Sampling database was based on the age-ethnic distribution of the Ningxia province by local government Statistical department (census 2005). The target group was all Ningxia original rural peoples aged \u2265 25 years who resided in countryside for at least fourth generations before the date of survey. During the study period, 2082 inhabitants from the area and without any clinical evidence for cardiovascular disease were randomly selected by computer to participate in the study; finally 1612 were enrolled through whole study. Thus, 22.5% of those who were eligible did not participate due to several reasons  that were not related to the hypothesis tested. Among them, 928 were Han ethnic group and 684 were Hui ethnic group. The subjects did not report chronic viral infection, cold or flu, acute respiratory infection, dental problems, or any type of surgery in the week preceding the study. All participants were interviewed by trained person with a standard closed-ended questionnaire.The study protocol has been approved by The Medical Ethics Review Committee of Ningxia Medical University and there are no activities against ethical policies in China. All participants have signed the consent on enrolment after they received written and verbal information about the trial.2. Obesity was defined as BMI \u2265 30 according to WHO standard guidelines [Standing height was measured once using a portable ruler (made in china), body weight was also measured once using a weight scale (made in china). All measurements were performed by the study investigators. Body mass index (BMI) was calculated as kg/midelines . ArteriaIn International Diabetes Federation (IDF 2005) definition, a participant was defined as having metabolic syndrome if he or she had central obesity (waist circumference \u2265 90 cm for men or \u2265 80 cm for women in Chinese people) plus at least 2 of the following criteria: (1) triglyceride level \u2265 1.7 mmol/L; (2) reduced HDL-C levels of less than 1.03 mmol/L in men, less than 1.29 mmol/l in women; (3) raised systolic or diastolic blood pressure of 130/85 mm Hg or higher or previously diagnosed hypertension; and (4) raised fasting plasma glucose level of 5.6 mmol/L or higher or previously diagnosed type 2 diabetes mellitus.2 test and Cochran-Artimage test for trend analysis, while differences in biochemical and clinical indexes between categorical variables were tested by ANOVA. All reported p values are based on two-sided tests with a significance level of 5%. All data were input into Epidata first and then exported into SPSS. SPSS  was used for all statistical analysis. To facilitate comparisons with other published data, all prevalence rates were age-adjusted by direct method [Continuous variables are presented as mean values \u00b1 standard deviation and categorical variables are presented as absolute and relative frequencies or prevalence. Associations between categorical variables were tested by \u03c7t method  with stet method .P < 0.05, Han ethnic group P < 0.01).Table This study shows, for the first time, a high prevalence of MS (11.8%), based on the IDF2005 definition, in Ningxia original rural population . The results obtained in our study are similar to that published in a general China survey reported The prevalence of the MS was higher among Hui ethnic group compared with Han ethnic group in Ningxia original rural population. Among different Americans, the prevalence of MS in African-Americans and Mexican-Americans were higher than other ethnic groups -17. The Over half of rural adults have abnormality in HDL cholesterol level, and Han ethnic group was less than Hui ethnic group. This may have several causes, such as elevated triglycerides, overweight and obesity, diabetes and physical inactivity, many of which are associated with insulin resistance -22. NingOur figure is likely to be an underestimate of the true prevalence of the MS in normal Ningxia rural population because the population studied in Ningxia is more representative of rural communities where the society consists of tribal people living together with high levels of social networking. Since 1980s and soon after the Reform and Opening in china, people's living levels were developed rapidly, leading to personal income growth, better housing, and overall improvements in the population's socioeconomic conditions.The prevalence of abnormal obesity was remarkably higher among Hui ethnic group than Han. This might be partially explained by the difference in genetic predisposition between two ethnics. However, the influence of diet habit can't be excluded. The special cultural and social restrictions in Chinese Hui ethnic group often require them to be segregated in the whole Chinese population, especially in the undeveloped original rural areas. They are not severely influenced by the Han population living around in the same area. Meantime, actually both Hui and Han population living in the same area normally took very similar physical activities. The main difference is still diet habit. For example, Hui have preferred animal fats (butter and mutton fat) and deep-fried foods for very long history. The difference in such lifestyle might be considered as the key factor leading to the difference in the prevalence of MS, these need further investigation.It should be noted that our results are obtained by using cross-sectional data; no simple and causal relationships can be easily concluded. The sample consists of only Ningxia rural people, and might not be represented for the whole populations in Ningxia; we mainly selected adults in rural area who were farmers. However, this population represented a large inhabitant group with average living quality with stable income and living condition, lower educational background and lower health awareness in rural area in Ningxia of China.In conclusion, the age-adjusted prevalence of MS was more than 11.8% of rural adults in Ningxia of China. The present study reveals that the MS and components of MS was higher in Hui ethnic group than that in Han ethnic group; clustering of MS components and MS increase with age. This study demonstrated that epidemic of MS is not limited to the developed countries. Thus, more developing countries should expect significant burden from chronic diseases. Such findings should be taken into account when planning new or expansion of existing health service and when implementing future chronic disease prevention and control programs.The authors declare that they have no competing interests.ZYH designed research, wrote paper, analyzed data and performed field works. ZY performed field works, lab works, and analyzed data and wrote paper. YJJ performed field works. LXY performed lab works. XHX performed field and lab works. JJ performed field works.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/140/prepubResults from analysis of data collected from adult: Mean values, SD, and percentage of subjects with the components of the metabolic syndrome (IDF) and BMI (WHO) by age group and ethnic group among 928 Han ethnic group and 684 Hui ethnic group.Click here for file"}
+{"text": "To the Editor: Picornaviruses (family Picornaviridae) are small, nonenveloped viruses with single-stranded, positive-sense genomic RNA. They are divided into 12 genera: Enterovirus, Aphthovirus, Cardiovirus, Hepatovirus, Parechovirus, Erbovirus, Teschovirus, Sapelovirus, Senecavirus, Tremovirus, Avihepatovirus, and Kobuvirus. The genus Kobuvirus consists of 2 officially recognized species, Aichi virus  <3 weeks of age in a herd of 400 animals in central Hungary. At this farm, merino ewes from Hungary were mated with blackhead meat rams from Germany. At the time of sampling, no clinical signs of diarrhea were reported. Reverse transcription\u2013PCR was performed by using generic kobuvirus screening primers (UNIV-kobu-R/F) reported previously (www.megasoftware.net). The sequence for kobuvirus/sheep/TB3-HUN/2009/Hungary was submitted to GenBank under accession no. GU245693.On March 17, 2009, a total of 8 fecal samples were collected from young, healthy, domestic sheep  were positive for kobuvirus. The partial 3D region (216 nt) was genetically identical for all 5 strains. The 3\u2032 continuous nucleotide sequence of the partial 3D (688 nt) and 3\u2032 UTR (174 nt) regions of strain kobuvirus/sheep/TB3-HUN/2009/Hungary  was determined. TB3-HUN had 59%\u201366% (862) nt and 77%\u201384% aa identities to Aichi and porcine kobuviruses, respectively. Strain TB3-HUN had 89/97% nt/aa and 86% nt identities to bovine kobuvirus in the 3D/3\u2032 UTR (862 nt) and 3\u2032 UTR (174 nt) regions, respectively. Phylogenetic analysis of the overlapping partial 3D/3\u2032 UTR nucleotide sequence of TB3-HUN from sheep and of reference bovine, porcine, and human kobuviruses confirmed that ovine kobuvirus strain TB3-HUN is related to bovine kobuviruses .The nucleotide sequence of the partial 3D/3\u2032 UTR region of kobuvirus in sheep has high nucleotide identity to bovine kobuviruses and forms the same lineage (but a different sublineage) with the kobuvirus strains in cattle. This result raised the following questions: can a highly similar kobuvirus be present in (and pathogenic for) 2 animal species (cattle and sheep), or is this result a consequence of natural contamination? The concept of sheep as host is supported by the high prevalence of kobuvirus in young healthy sheep; by the sublineage position of the sheep strain on the phylogenetic tree according to the most conserved genetic region; and by the genetic relation between the 2 potential ruminant hosts, cattle and sheep. The existence of 1 pathogen in 2 host species (cattle and sheep) is well known, e.g., for bluetongue virus, adenoviruses, ovine herpesvirus type 2, and foot-and-mouth disease picornaviruses ("}
+{"text": "The increasing ratio of ageing population poses new challenges to healthcare systems. The elderly frequently suffer from severe infections. Vaccination could protect them against several infectious diseases, but it can be effective only if cells that are capable of responding are still present in the repertoire. Recent vaccination strategies in the elderly might achieve low effectiveness due to age-related immune impairment. Immunosenescence affects both the innate and adaptive immunity.Beside individual variations of genetic predisposition, epigenetic changes over the full course of human life exert immunomodulating effects. Disturbances in macrophage-derived cytokine release and reduction of the natural killer cell mediated cytotoxicity lead to increased frequency of infections. Ageing dampens the ability of B cells to produce antibodies against novel antigens. Exhausted memory B lymphocyte subsets replace na\u00efve cells. Decline of cell-mediated immunity is the consequence of multiple changes, including thymic atrophy, reduced output of new T lymphocytes, accumulation of anergic memory cells, and deficiencies in cytokines production. Persistent viral and parasitic infections contribute to the loss of immunosurveillance and premature exhaustion of T cells. Reduced telomerase activity and Toll-like receptor expression can be improved by chemotherapy. Reversion of thymic atrophy could be achieved by thymus transplantation, depletion of accumulated dysfunctional naive T cells and herpesvirus-specific exhausted memory cells. Administration of interleukin (IL)-2, IL-7, IL-10, keratinocyte growth factor, thymic stromal lymphopoietin, as well as leptin and growth hormone boost thymopoiesis. In animals, several strategies have been explored to produce superior vaccines. Among them, virosomal vaccines containing polypeptide antigens or DNA plasmids as well as new adjuvanted vaccine formulations elicit higher dendritic cell activity and more effective serologic than conventional vaccines responses in the elderly. Hopefully, at least some of these approaches can be translated to human medicine in a not too far future. Herpesviridae), bacteria (e.g. Mycobacteria) or fungi (e.g. Candida) reactivate and opportunistic infections manifest themselves at increased rates .Both innate and adaptive immune responses are affected by age-related deficits. Deterioration of the innate immunity appears to be the prevalent mechanism associated with age-related infections, while humoral immunity retains most of its original activity throughout the life span ,20. It iInnate immunity is a key element of the immune response including several cellular components such as macrophages, NK cells, and neutrophils, which provide rapid first-line defence against pathogens. The function of these cells declines with age. Although their production increases with age, in the elderly macrophages have a reduced ability to secrete tumour necrosis factor (TNF), a key inflammatory cytokine . Macrophdim. Proliferation of NK cells primarily occurs in the bone marrow from the same common progenitor cells as T lymphocytes. Immature NK cells undergo a serial maturation process. Finally, full functional capabilities are acquired before they are released into the circulation. Survival of mature NK cells is cytokine-dependent: IL-15 appears to prolong survival via the anti-apoptotic factor Bcl-2 .+ T lymphocytes have decreased CD40L, a critical co-stimulatory ligand for T-B cell interactions. IL-2 enhances CD40L expression , decrearefs. in . CD28 lorefs. in . These c members . Collect members .Reversion or block of age-related atrophy of the thymus might be one of the promising therapeutic measures to reconstitute immune functions in the elderly. It was reported that in mice transplantation of aged thymuses into juvenile recipients led to reconstruction of the structure and function of the thymus . MoreoveArtificial replacement of cytokines, chemokines, and some of the hormones having a basic role in maintaining healthy the immune system or their induction by drugs might prevent or at least partially reconstitute immune impairment in the elderly. IL-7 seems to be the most important of such factors to protect and stimulate B and T cells. The decline in IL-7 expression levels that occurs in the elderly makes it a target for therapeutic interventions to rejuvenate thymopoiesis. It has been shown that IL-7 can reverse thymic atrophy in old animals, ensuring increased thymic output to replenish the peripheral T lymphocyte pool and improving immune responses . Human IBy studying other biological response modifiers, it has been shown that intrathymic injection of an IL-10 expressing adenovirus can prevent thymocyte apoptosis and the thymic atrophy induced by sepsis in mice . Leptin Concerning the effect of hormones on the dysfunctional aged immune system, it has been demonstrated that significant boosts in cellularity and decreased adiposity of bone marrow occurred in aged mice treated with recombinant growth hormone. In addition to its ability to stimulate aged bone marrow stroma, this hormone can also have a positive effect on early T cell lineage progenitors and stimulate thymopoiesis in aged mice, bone marrow transplant mice, and bone marrow colonised foetal thymus organ cultures . Sex stein vivo, among which are infections with immunosuppressive viruses that establish latency such as CMV, EBV, HBV and HCV. These viruses can chronically stimulate T cells and may be responsible for the presence of oligoclonally expanded virus-specific CD8+ T cells, the majority of which dysfunctional or anergic, in the elderly [+ T lymphocytes and macrophages and establish lifelong latency and persistence in these cells. HHV-6A transactivates HIV enhancing AIDS progression and oncogenic human papillomavirus types facilitating cervical cancer development. HHV-6A, along with CMV, is frequently reactivated in immunocompromised patients, especially transplant recipients aggravating their CMV disease. HHV-6 variants are believed to be cofactors in chronic disorders such as multiple sclerosis and lymphomas frequently seen in elder people. HHV-7 infects CD4+ T lymphocytes alone, establishes life-long persistence and reactivates HHV-6. The products of early genes of HHVs and consequently, the altered cytokine release by infected cells play roles in the transactivating effect on other viruses [Anelloviridae. An amazing epidemiological feature of these newly recognized viruses is that they produce an apparently life-long high-titre, often mixed plasma viraemia in essentially all people regardless of age, health status and other variables. The prototypes of these viruses, torquetenoviruses, have been shown to replicate extensively, if not solely in haematopoietic cells, and it is believed that the other members of the family share the same tropism. Although formal proof has yet to be obtained similar to all the other viruses that lack an external cell-derived envelope, the anelloviruses are likely to be cytocidal for the cells in which they replicate. In any case, their florid replication in the haematopoietic cell compartment throughout life may represent a remarkable stress for the progenitor and precursor cells from which all the immune cells originate. In turn, even though the formidable regenerative potential of haematopoietic cells may prevent the clinical emergence of cell damage for long periods of time, in the long run this continued replication is likely to contribute significantly to the decay of immune responsiveness that becomes appreciable late in life [Several environmental factors may drive T cell senescence  elderly ,7,9,89.  elderly . A recen elderly . It is n elderly . In some viruses . It is c in life . Long-te+CD28+ T lymphocytes that accumulate in the elderly and that seem to be anergic and apoptosis-resistant may be restored to functional competence directly ex vivo by culturing them with IL-2. In this respect, they behave like anergic T cells that can be found in many experimental situations of chronic antigen exposure; notably, in at least some such situations several approaches, including the blocking of inhibitory receptors such as PD-1, can restore T lymphocyte functions [Strategies to reduce the chronic infectious antigenic load would seem to offer a reasonable approach to restoring appropriate immune functions and might also benefit naive T cell production. Targeting these viruses and any other infectious agents that have established a persistent infection may be of clinical benefit both directly by reducing the pathological consequences of the infections and in terms of improving responses to vaccinations. Unfortunately, the continuous administration of antiviral drugs did not alter the course of progressive accumulation of virus-specific exhausted memory T cells in old mice . As CMV unctions . One optunctions . A recenunctions .ex vivo exhibited a decrease in IFN-\u03b3+ T cells and in the secretion of IFN-\u03b3 by individual cells when compared to young adults (aged 20-50 years). Expansion of CD8+ T cells was also reduced in the aged, who also produced fewer antibodies in response to influenza virus [One of the greatest practical health-care challenges in the elderly is to ensure that vaccinations are optimally effective. Increasing the efficacy of vaccination would have an enormous impact on health and well-being . Developza virus . In mousza virus . Patientza virus . In the za virus . During za virus .2 production by DCs, considerably enhanced vaccine efficacy, selectively inhibiting the Treg promoting arm of innate immunity [The second prong on the assault on the problem would be to develop vaccines especially designed for the elderly. Several strategies have been explored, including the use of high dose of the immunogens , DNA vacimmunity ,21. Muchimmunity .ex vivo treated DCs. Another new field is the vaccine-like approach that is being explored as a means of containing Alzheimer disease. Since the plaques deposited in the brain of patients originate from a neuronal membrane-bound protein, the amyloid precursor protein, experimental vaccines consist of analogues of the \u03b2-amyloid peptide coupled to a carrier. The aim is to raise antibodies which recognise plaques, A\u03b2 deposits and \u03b2-amyloid in brain blood vessels, but do not see the amyloid precursor protein or A\u03b2 [The cancer vaccines that are currently under development differ from the vast majority of those against infectious diseases, because they are administered after the onset or detection of disease, thus they are correctly regarded as therapeutic rather than prophylactic vaccines. They contain tumour cell lysates or defined cancer antigens. The latter vaccines are usually a single antigen that is delivered by one of a number of delivery systems that include recombinant proteins and viral vectors, peptides, or in or A\u03b2 .Frequent and severe microbial infections influence the quality of life of elderly individuals and their families, and have a deleterious financial impact onto the health-care system. Theoretically, several types of infectious diseases might be prevented by vaccinating old people. Lately it has become evident that vaccination or re-vaccination in this age group is not only a political agenda or financial matter, because age-related alterations of the immune system would render most vaccines ineffective in the majority of subjects. An improved understanding of immune dysfunction in human ageing will increase the probability of discovering means to restore appropriate function and alleviate the burden of infectious diseases later in life. Prevention of immunosenescence or at least partial reconstitution of the immune activities are required if a vaccination regimen is introduced in these people, who very often suffer of multiple important comorbidities. Experimental data and clinical observations outlined above demonstrate that both innate and adaptive immunity can be improved in the elderly. Any successful intervention might possibly boost other immune reactions due to several feed-back mechanisms. Activation of the exhausted immune system by using cytokines and judicious application of hormones appear to be promising practical approaches to combat chronic infection with immunosuppressive persistent viruses. Furthermore, new types of vaccine formulation, especially virosomal vaccines and adjuvanted vaccines, permit improved antigen presentation and cytotoxic activity against intracellular pathogens. Hopefully, at least some of the approaches outlined here will be translated to human medicine in a not too far future.The authors declare that they have no competing interests.Both authors drafted the manuscript and approved the text."}
+{"text": "Malaria is the number one public health problem in Nigeria, responsible for about 30% of deaths in under-fives and 25% of deaths in infants and 11% maternal mortality. This study estimated the economic burden of malaria in Nigeria using the cost of illness approach.A cross-sectional study was undertaken in two malaria holo-endemic communities in Nigeria, involving both community and hospital based surveys. A random sample of 500 households was interviewed using interviewer administered questionnaire. In addition, 125 exit interviews for inpatient department stays (IPD) and outpatient department visits (OPD) were conducted and these were complemented with data abstraction from 125 patient records.From the household survey, over half of the households (57.6%) had an episode of malaria within one month to the date of the interview. The average household expenditure per case was 12.57US$ and 23.20US$ for OPD and IPD respectively. Indirect consumer costs of treatment were higher than direct consumer medical costs. From a health system perspective, the recurrent provider costs per case was 30.42 US$ and 48.02 US$ for OPD and IPD while non recurrent provider costs were 133.07US$ and 1857.15US$ for OPD and IPD. The mode of payment was mainly through out-of-pocket spending (OOPS).Private expenditure on treatment of malaria constitutes a high economic burden to households and to the health system. Removal of user fees and interventions that will decrease the use of OOPS for treatment of malaria will significantly decrease the economic burden of malaria to both households and the health system. Malaria is a major public health problem in Africa and one of the leading causes of avoidable death, especially in children and pregnant women In Nigeria, malaria is holo endemic, with only a small area in the middle belt at a 3% risk of epidemic Given this magnitude of disease burden, estimating the economic burden of malaria is necessary to provide a basis or platform for advocacy with Ministries of Finance and donors for increased investments in addressing public health problems such as malaria In Nigeria, malaria has been shown to account for over 40% of the total monthly curative healthcare costs incurred by households compared to a combination of other illnesses; the cost of treating malaria and other illnesses depleted 7.03% of the monthly average household income, and treatment of malaria cases alone contributed 2.91% of these costs This paper provides new information about the economic burden of malaria treatment borne by households and providers  in Enugu state, southeast Nigeria using a cost of illness approach. It specifically examines the direct medical, direct non-medical and indirect costs per episode of malaria to both the households and the health system.Ethical approval for the study was obtained from the Ethics Review Board, University of Nigeria. Each respondent gave a signed informed consent. In addition, the heads of each facility gave an informed consent before data was abstracted from each of them. Consent was obtained from the hospital authorities to use anonymized data extracted from the hospital database for the study. The IRB approved the study based on written consent obtained from the hospital authorities and based on the anonymous nature of the data abstraction. Some patients that were interviewed during the study also had information obtained from their medical records and these respondents gave their consent both for the interviews and the data abstraction. About a quarter of the patients who were interviewed also had data abstracted from their records.The study was conducted in Enugu State southeast Nigeria. Enugu state has an estimated population of 3.3 million and a total land area of 7,618 sq. km Achi and Oji urban are malaria holo-endemic communities with an average malaria incidence rate of 15% The study was a cross-sectional study comprising both household and hospital based surveys. The household survey involved households with children less than five years residing in the communities while hospital based survey involved patient exit interviews, retrospective and prospective data abstraction from case records. A pre-tested questionnaire was used to elicit information from patients leaving the health facilities after consultation and treatment for malaria.A list of all the households with children under five years in the two selected communities was compiled, so as to get a sampling frame. Systematic random sampling was used to select 500 households for the study. The primary caregivers or any other household representatives in each of these households were interviewed.Six health facilities  were purposively selected based on their geographic region and patient load. A total of 125 exit interviews were administered to caregivers of children that had been diagnosed with malaria after consultation and treatment. A proportionate sampling technique was used to assign the number of exit interviews carried out in the respective health facilities. This was complemented with retrospective and prospective data abstraction from 125 in-patient and out-patient case records.In the household survey, information was collected on the demographic characteristics of the respondents in each selected household, the malaria status of children under the age of five years, cost of treating malaria episode, household assets and monthly food expenditure. Data on transportation costs to and from the facility where treatment was sought and any other costs incurred in the course of seeking treatment for malaria was also collected.At the facilities, consent was obtained from the hospital authorities to use anonymized data extracted from the hospital database for the study. The IRB approved the study based on written consent obtained from the hospital authorities and based on the anonymous nature of the data abstraction. Some patients that were interviewed during the study also had information obtained from their medical records and these respondents gave their consent both for the interviews and the data abstraction. About a quarter of the patients who were interviewed also had data abstracted from their records.Similar information as in the household survey was also collected from exit interviews and in addition any costs incurred in treatment of malaria before attending the facility. In-patient data on costs of malaria treatment  were abstracted from case records within a year (11 months retrospective and 1 month prospective). Information on costs to the health care system-drugs, investigations, facility running costs (recurrent and non-recurrent) was abstracted from the accounts records and these were validated by both the head of accounts department and the facility head. The capital cost of the buildings were estimated by an estate valuer and a health economist. Depreciation rates were applied to both buildings and vehicles. Estimation of vehicles and laboratory equipment were not applicable to the health centre facilities as they run only out-patient services.N.B. Questionnaires will be made available to readers on request.Data analysis was undertaken and frequency distributions analyzed. Summary statistics at both the household and provider levels were computed. For continuous variables, the mean and standard deviation were calculated while numbers and percentage were determined for categorical variables. The direct medical costs that were computed consist of drugs cost, diagnostics, administration fees and other costs incurred as a result of the treatment of malaria. The direct non- medical cost consisted of transport fare only. The household's indirect cost of treatment was the cost attributed to time lost when taking care of a sick child. Principal component analysis (PCA) was conducted to generate a socioeconomic status (SES) index and wealth quintiles based on per capita food expenditure and household asset ownership.Note: 154.06 Naira\u200a=\u200a1USD The average recurrent provider costs incurred to treat one malaria case in OPD and IPD were $30.42 USD and $48.02 USD respectively .The capital cost to the provider to treat one case of malaria for a year was $133.07 USD for OPD and $1857.15 USD for IPD .The total costs  for OPD and IPD sum up to $176.04 USD and $1928.37 USD respectively.This study estimated what an episode of malaria costs for OPD and IPD treatment from the demand and supply side respectively, using the cost of illness approach. The total costs are enormous given the prevalence and the high transmission rate of malaria in this area and also given that a significant proportion of the population live below the World Bank poverty line. With several episodes of malaria, the household and provider recurrent costs are increased further. This high cost burden has also been reported in other studies in Nigeria and some other African countries It was found that indirect costs  by the respondents were greater than direct medical and direct non medical costs put together for IPD and OPD. This could be partly due to the free maternal and child health care (FMCH) services offered in most public facilities in the state The treatment cost per IPD case was greater than that for OPD expectedly, as this also includes hospitality costs. However it may have been biased upwards by additional treatment of co- morbidities and other systemic complications that can arise from severe malaria which make patients spend more time in the hospital thereby incurring more costs than out patients Most of the respondents being farmers and petty traders and most likely poor, may have suffered catastrophic health spending for malaria treatment as a result of these costs borne by households The major mode of payment for health services was out of pocket and none of the respondents had health insurance. Although, the national health Insurance scheme was launched in Nigeria years ago to reduce the burden of illness borne by individuals, none of the respondents had any form of health insurance. This goes to emphasize the low financial risk protection in the country and the lack of which will deplete the meagre resources of the poor leaving them impoverished from health spending Due to the free maternal and child health program (FMCH) going on in the state, the provider bears some recurrent costs for the treatment of malaria. The cost of laboratory and diagnostic tests is higher in OPD than IPD. This is because in OPD most of the tests done are rapid diagnostic tests (RDTs) which the patients do not pay for and so the provider bears the cost while in the IPD, tests carried out are mainly microscopy and this is paid for out of pocket. This means that in areas or states where free MCH is non-functional, additional costs are shifted to the household. This is also sometimes the case in the study areas when the facilities experience drug stock-outs and patients are forced to purchase their drugs from drug shops or other itinerant drug sellers. This further impoverishes poor households.In health systems where financial risk protection is in operation, the cost of treatment will be predominantly incurred by the provider at the point of need but this is not the case in this study. In urban areas where there has been minimal uptake The cost of malaria treatment is high in the study sites in Nigeria and currently, households bear a greater portion of this cost due to a high level of indirect costs. To some households this may be catastrophic. There is need to buffer this with some sort of financial risk protection mechanisms and the health care system needs to be strengthened to function more effectively and decrease overall consumer and provider economic burden of malaria.Since free MCH is not operative in all states of Nigeria, these findings may not be generalisable to the whole country. However, given the uniform high disease burden and holo-endemicity, the gross cost burden is likely to be similar. Further studies are required to determine the level to which co-morbidities may have biased the results and also to determine how households cope with these high costs of malaria treatment. Retrospective data abstraction may have been prone to inaccuracy but this was controlled by a one-month prospective in-patient data collection which was comparable.In conclusion, the cost of treating malaria is high both to the household and to the health system. Where costs are shifted to the health system, they constitute a significant portion of the healthcare budget which could have been efficiently used in other areas of healthcare delivery. Multipronged approaches are needed to address the high level of economic burden of malaria through concerted and sustained malaria preventive efforts; use risk protection mechanisms to buffer both direct and indirect costs of treatment; and health system and policy research for best practices of risk pooling and risk protection mechanisms that are suited to the developing country context."}
+{"text": "Pictorial stimuli standardized for Chinese children are still absent although it is needed in order to test the development of children's cognitive functions. This study presents normative measures for Snodgrass and Vanderwart pictures, viewed by 4- and 6-year old Chinese children. Name agreement, familiarity, and visual complexity were obtained for each age group. The data indicate substantial differences between young and older children in name agreement based on expected name, familiarity and visual complexity. The correlation pattern of the variables collected in the present study were consistent with children's norms in other languages and norms of Chinese adults, while there are cross-age and cross-culture differences in specific variables. The obtained measures represent a useful tool for further research on Chinese children's pictorial processing and constitute the first picture normative study for children in this language. Picture norms are necessary when psychologists want to employ pictures to investigate the development of cognitive functions. Pictures of everyday objects are more often used in both semantic and episodic memory tasks In the past two decades, a great many studies have provided cross-cultural validation for Snodgrass and Vanderwart's As far as Chinese is concerned, Shu, Cheng, and Zhang Following these norms collected for Chinese adults, we chose Snodgrass and Vanderwart Among all the above picture norms from different cultures, only a few focused on children. This is surprising as pictorial stimuli are very often used to test children, given that pictures are more age-appropriate than words for pre-reading children. There has been evidence that name agreement, familiarity, and visual complexity differ between young children and adults To build such norms, first we need to define the suitable age for our data collection according to the picture norms of children collected in other cultures. Berman et al. Children's picture naming performances have been proposed to be influenced by different picture attributes such as visual complexity Name agreement is an essential predictor of naming difficulties during the process of picture naming, thus it is important in investigating recall, recognition and verbal coding There have been three different methods on the name agreement measurement. The first is the classic H statistic, which offers information for the variability of responses in a group of participants The present study aims to create a normative database for pictorial materials that will be useful in a wide range of cognitive experiments with Chinese preschool children. This goal has been achieved by providing the following normative data of pictorial stimuli for Chinese children.M\u200a=\u200a4.11, SD\u200a=\u200a0.45) and third year  participated in the study. All children were native Chinese Mandarin speakers, and their language abilities are typically developing as assessed using the Verbal Index of Revised Chinese version of the McCarthy Scales of Children's Abilities (MSCA-CR) . Written informed consent from the next of kin, caretakers, or guardians on the behalf of the children participants were obtained. After task completion subjects received small gifts. The protocol was approved by the Institutional Review Board (IRB) at the Institute of Psychology, Chinese Academy of Sciences.Sixty-six children in kindergarten first year , each of which took from 20 to 30 minutes to complete. Order of the sessions was counterbalanced across subjects. The child viewed one picture at a time on the laptop computer screen. The picture remained on the screen until the child provided the experimenter with information about the name, familiarity, and visual complexity of the picture. Children were given at least five minutes of rest between sessions. Some children were tested two sessions each day in two continuous days according to his/her state of attention.  Instructions were adapted from those published by Cycowicz et al. For the naming task, children were told to give the first name that came to mind, and that a name could consist of more than one word. When a child could not name the picture, questions were asked that would aid in determining whether the child did or did not know the concept. This is important because young children comprehend many concepts that they fail to express verbally. The experimenter asked questions like \u2018\u2018what can you do with it?\u2019\u2019 or \u2018\u2018Where do you see it?\u2019\u2019 If the answer indicated that the child did have knowledge about the object, then the naming was recorded as \u201cDKN\u201d (don\u2019t know name) and he/she was asked to answer the familiarity and the visual complexity questions. For cases in which the child did not recognize the object depicted at all, the naming was recorded as \u201cDKO\u201d (don\u2019t know object) and the next picture was presented.We followed Cycowicz et al. For the familiarity rating, the child was asked \u2018\u2018how often do you see or think about this object?\u201d (\u201cNi jing chang kan dao huo xiang dao ta ma?\u201d in Chinese). Answer choices ranged from \u2018a lot\u2019 (scored 5) to \u2018sometimes (scored 3) to \u2018very little\u2019 (scored 1), as in Cycowicz et al. For the visual complexity rating the child was asked \u201cHow difficult is it to draw or to trace this picture?\u201d (\u201cyao hua ta huo zhe miao ta nan ma?\u201d in Chinese). Answer choices ranged from \u2018hard\u2019 (scored 5) to \u2018medium\u2019 (scored 3) to \u2018easy\u2019 (scored 1). The children were told that if the picture contains many small lines, they should answer \u201chard,\u201d even if they are very good at drawing or tracing. They were told to pick \u201ceasy\u201d if the picture had very few lines, even if they did not like to draw. The \u201cbee\u201d and \u201cballoon\u201d pictures were shown in the practice block as examples of hard and easy pictures, respectively.We asked children to rate the image agreement (IA) in our pilot study. Following Snodgrass and Vanderwart's The following information was obtained for each picture of objects.The expected name corresponds to the most frequent name given in a language, in this case Chinese, for a pictured object. Among all the available picture naming norms for Chinese adults, only Yoon et al. A modal name is defined as the name given by the majority of subjects. In order to compare modal names with the corresponding expected names, the scheme provided by Snodgrass and Vanderwart The number of Chinese characters in the modal name constituted word length.i is the proportion of participants who gave each name. The computation of H does not take into account \u201cdo not know name\u201d (DKN) or \u201cdo not know object\u201d (DKO) responses , as there are high rates of no responses in young children Number of responses on \u201cdon\u2019t know name\u201d and \u201cdon\u2019t know object,\u201d which has been described in the Procedures section.The criteria used for counting different instances of names were a combination of those used in Snodgrass and Vanderwart As noted above, participants used a 3-point  rating scale to indicate their degree of familiarity with each object, as in other children picture norms It was also indicated in a 3-point  rating scale. When subjects did not know the object depicted (DKO), a rating of visual complexity was unavailable. As for familiarity, such occurrences were not included in computing the means.We took the word frequencies of 246 expected names from Cai and Brysbaert The objective ages of acquisition of 221 of the 260 Snodgrass and Vanderwart The data of young children and older children were analyzed separately. Independent samples t-tests were used to compare the data of the young children with the data of older children. Then we conducted Pearson correlation analysis to explore the relationship between the various variables. Finally, we compared our norm with Chinese adults from Liu et al. After excluding the DK responses (DKN & DKO), the minimum and maximum numbers of responses for each picture are 14 and 32 in K1 children, and are 19 and 34 in K3 children respectively. The children from K1 provided modal names that differed from the expected names for 88 of the 260 stimuli (33.85%). More than half of the cases (46) were classified as superordinate; for example, young children gave name \u8863\u670d [clothes] to six items, including blouse, jacket, coat, shirt, sweater and vest. Eight concepts were classified as synonyms, for example, \u76d2\u5b50 [box] for \u7bb1\u5b50 [box]. Fifteen concepts were classified as Failures, for example, \u8f66 [car] for \u70ae [cannon]. Coordinate names occurred 15 times and included naming substitutions such as \u767d\u83dc [cabbage] for \u82b9\u83dc [celery] and \u82f9\u679c [apple] for \u6843\u5b50 [peach]. Two modal names given were component names of the concept such as \u7ebf [thread] for \u7ebf\u8f74 [spool of thread]. The remaining two names were subordinate, such as \u7ea2\u65d7 [red flag] for \u65d7[flag].The children from K3 provided modal names that differed from the expected names for 73 of the 260 stimuli (28.08%). Thirty-two concepts were classified as superordinate, for example, \u7434[musical instrument] for \u624b\u98ce\u7434 [accordion] and \u7ad6\u7434 [harp]. Coordinate names occurred 13 times and included naming substitutions such as \u841d\u535c [radish] for \u80e1\u841d\u535c [carrot]. Twelve concepts were classified as synonyms, for example, \u8682\u86b1 [locust] for \u8757\u866b [locust]. Ten concepts such as \u76d2\u5b50 [box] for \u9762\u5305\u673a [toaster] were classified as Failures. Four modal names given were component names of the concept such as \u811a [foot] for \u817f [leg]. Two concepts were classified as subordinate; for example, \u516c\u9e21 [cock] for \u9e21 [chicken]. The numbers of the modal names classified into different categories are shown in There was a tendency for younger children to provide more superordinate names than older children as you can see from There are 14 items which none of the subjects could name with the expected names, including \u951a [anchor] (Item 4), \u68d2\u7403\u6367 [baseball bat] (Item 19), \u9a86\u9a7c [camel] (Item 43), \u96ea\u8304 [cigar] (Item 58), \u9999\u70df [cigarette] (Item 59), \u957f\u7b1b [flute] (Item 92), \u5706\u53f7 [French horn] (Item 99), \u70eb\u8863\u677f [ironing board] (Item 124), \u9509\u5200 [file] (Item 152), \u7535\u63d2\u5934 [electric plug] (Item 177), \u6c34\u8200\u5b50 [water ladle] (Item 179), \u5531\u673a [record player] (Item 184), \u706f\u7f69 [lampshade] (Item 230) and \u811a\u8dbe [toes] (Item 235). Another 6 items were named as the expected names by all the subjects, including \u5927\u8c61 [elephant] (Item 84), \u811a [foot] (Item 94), \u773c\u955c [eyeglasses] (Item 105), \u8611\u83c7 [mushroom] (Item 150), \u889c\u5b50 [sock] (Item 211), and \u592a\u9633 [sun] (Item 222).t (518)\u200a=\u200a.55, p\u200a=\u200a.582) based on the items . However, the percentage measure of name agreement showed significant difference between them (t (518)\u200a=\u200a\u22122.542, p<.05, Cohen's D\u200a=\u200a\u2212.222), with the older children  higher than the young children .The measure of name agreement expressed by the information statistic H showed no significant differences between the young children and the older children in the independent-samples t-test (t (518)\u200a=\u200a3.669, p <.01, Cohen's D\u200a=\u200a0.322) and DKO (t (518)\u200a=\u200a5.341, p<.001, Cohen's D\u200a=\u200a0.469) of the two age groups both revealed significant differences. This indicates that the failure number of naming  and recognizing pictured objects  is higher among younger children compared to older ones.The maximum number of DKN is 11 in K1 children regarding to two items \u95e8\u628a\u624b[door knob] (Item 77) and \u71a8\u6597 [iron] (Item 123), and is 9 in K3 children regarding to the item \u5531\u7247\u673a [record player] (Item 184). The maximum number of DKO is 12 in K1 children regarding to the item \u7eba\u8f66 [spinning wheel] (Item 213), and is 7 regarding to two items \u6539\u9525 [awl] (Item 56) and \u7eba\u8f66 [spinning wheel] (Item 213). Put together, the maximum number of DK responses (DKN & DKO) is 18 in K1 children regarding to the item \u6539\u9525 [awl] (Item 56), and is 15 in K3 children regarding to the item \u7eba\u8f66 [spinning wheel] (Item 213). The number of DKN ((t (518)\u200a=\u200a\u22120.749, p\u200a=\u200a0.454. Young children  gave similar number of alternative names with older children . Cannard et al. Alternative names given for each picture by each age group are presented in t (518)\u200a=\u200a\u22125.254, p<.001, Cohen's D\u200a=\u200a\u22120.462). Familiarity was lower in young children  than in the older children .The difference of familiarity between young children and older children was significant (t (518)\u200a=\u200a9.923, p<.001, Cohen's D\u200a=\u200a0.872). Visual complexity was larger for young children  than for the older children .The difference of visual complexity between young children and older children was also significant (Each of the variables measured plays an important role in various cognitive tasks. It is necessary to know the relationships among the measures. The two measures of name agreement (H and %) show a high negative correlation as it should be. For the percentage measure, a higher number signifies greater name agreement. However, for the H measure, a lower number signifies greater name agreement. Thus the significant correlations between each of two name agreement measures (H and %) with other variables are always in opposite direction. Variables of Familiarity, Visual Complexity, Frequency and AoA are all correlated with both name agreement measures. The correlations between AoA and name agreement measures indicate that for concepts acquired at an early age the level of name agreement is high. Children's name agreement measures correlate less with word frequency than with AoA, which is similar to the finding of Cycowicz et al. t (220) \u200a=\u200a18.99, p<.001, Cohen's D \u200a=\u200a2.56). Preschool children rated lower familiarity  than adults . No statistically significant difference was found in other variables.Correlation between Chinese K1 and K3 children in the current study with Chinese adults \u200a=\u200a28.97, p<.001, Cohen's D\u200a=\u200a3.60), complexity (t (259)\u200a=\u200a\u221213.32, p<.001, Cohen's D\u200a=\u200a1.65) and H statistic (t (259)\u200a=\u200a10.73, p<.001, Cohen's D\u200a=\u200a1.32). Chinese children had higher familiarity  and H statistic  than American children , but lower complexity  than American children . Compared to French 4- and 6- years old children, Chinese children had significant lower  Agreement based on Expected Name \u200a=\u200a3.46, p<.001, Cohen's D\u200a=\u200a0.58; K3, t (142)\u200a=\u200a7.09, p<.001, Cohen's D\u200a=\u200a1.19).However, significant differences were found between Chinese and American children in familiarity Click here for additional data file.Appendix S2Alternative Names Given by K1 and K3 Children for 260 pictures.(XLSX)Click here for additional data file.Table S1Yoon Modal Names Replaced by New Names as Expected Names(DOCX)Click here for additional data file.Table S2Summary Statistics of Variables for Young Children (K1) and Older Children (K3)(DOCX)Click here for additional data file.Table S3Numbers of Modal Names Classified into Different Categories(DOCX)Click here for additional data file.Table S4Correlations Among the Variables collected in this study(DOCX)Click here for additional data file.Table S5Correlation of Variables in the Present Norm with the Variables in Chinese Adult Norms(DOCX)Click here for additional data file.Table S6Correlation of Variables in the Present Norm with the Variables in American and French Children Norms(DOCX)Click here for additional data file."}
+{"text": "The relative standard deviations (RSDs) of PAHs in water by using anthracene-d10 as internal standard, were in the range of 4-11% for most of the analytes (n = 3). Limit of detection (LOD) for different PAHs were between 0.03 and 0.1 ngmL-1. The method was successfully applied for the analysis of PAHs in mineral water samples collected from Tehran.Dispersive liquid-liquid microextraction (DLLME) combined with gas chromatography\u2013mass spectrometry (GC\u2013MS) was used for the extraction and determination of 13 polycyclic aromatic hydrocarbons (PAHs) in mineral water samples. In this procedure, the suitable combination of extraction solvent (500 \u00b5L chloroform) and disperser solvent (1000 \u00b5L acetone) were quickly injected into the water sample (10.00 mL) by Hamilton syringe. After centrifugation, 500 \u00b5L of the lower organic phase was dried under a gentle stream of nitrogen, re-dissolved in chloroform and injected into GC-MS. Chloroform and acetone were found to be the best extraction and disperser solvent, respectively. Validation of the method was performed using spiked calibration curves. The enrichment factor ranged from 93 to 129 and the recovery ranged from 71 to 90%. The linear ranges for all the PAHs were 0.10-2.80 ngmL Polycyclic aromatic hydrocarbons (PAHs) are a group of various cyclic organic compounds with two or more fused aromatic rings in their structures . PAHs arNaphthalene is the most abundant PAH in water and the U.S. Department of Health and Human Services has concluded that it is reasonably anticipated to be a human carcinogen. However, PAHs show an extensive range of toxicities. For example, according to the international agency for research on cancer (IARC) classification system, benzo[a]pyrene (BaP) as one of the most known is classified in group 1 and some of them are also categorized as group 2A or 2B carcinogens , 14. DueDue to low solubility, the concentration of organic pollutants, especially PAHs in water is extremely low (A). Therefore, despite the use of exceedingly sensitive analytical devices for the analysis of samples the results will not have enough accuracy and precision . Consequet al. in 2006. In this procedure a suitable combination of dispersive and extraction solvents  is pushed into an aqueous sample using a microsyringe. After forming a cloudy solution and centrifugation, the content of the lower phase can be analyzed by an appropriate analytical method  -28, solil method . DLLME pl method . In thisReagents and materialsNaphthalene (Naph.), acenaphthene (Ace.), flourene (Fl.), phenanthrene (Phen.), anthracene (Ant.), anthracene-d10 (Ant.d10), pyrene (Pyr.), benzo[a]anthracene (B[a]A), chrysene (Chy.), benzo[b]fluoranthene (B[b]F), benzo[k]fluoranthene (B[k]F), benzo[a]pyrene (B[a]P), dibenzanthracene (D[ah]A) and benzo[ghi]perylene (B[ghi]P) with purity higher than 98% were purchased from Sigma-Aldrich/Fluka/ Supelco (Germany). HPLC grade isooctane, toluene, acetonitrile, dichloromethane, tetrachloroethylene, n-hexane, ethanol, 2-propanol, methanol, acetone and chloroform were obtained from Chem-lab Belgium. Ultrapure water was obtained from a Milli-Q plus ultra-pure water system . Mineral water samples were collected from Tehran and used without any prior treatment. Stock standard solutions of PAHs were individually prepared by dissolving 10 mg of each in 10 mL toluene of HPLC grade . Calibration standards-1) of the PAHs were prepared in toluene. All the solutions were transferred to amber glass vials and stored at 4\u00b0C. They were kept for 30 min. at ambient temperature prior to their use. A mixed intermediate standard solution at a concentration of 100 ngmL-1 was prepared via appropriate dilution of the stock solutions in methanol. This solution was used as a spiking solution for validation experiments. Spiked calibration standards at concentration levels of 0.35, 0.7, 1.4, 2.8, and 5.6 ngmL-1 were prepared by addition of 35 \u03bcL, 70 \u03bcL, 140 \u03bcL, 280 \u03bcL and 560 \u03bcL of mixed standard stock solution to 10 mL of blank water samples in each case.Individual stock standard solutions . Helium with a purity of 99.99% and a flow rate of 1 mLminMethod validation-1. Recovery and repeatability were determined at concentration levels of 0.4, 1 and 2.5 ngmL-1. Each concentration level was repeated 3 times per day, and this was performed for three consecutive days. Internal standard (anthracene-d10) was used at a concentration equal to 0.7 ngmL-1. Blank sample (n = 3) was analyzed along with other samples every day. For each compound, the mass fragment (m/z) with the highest intensity was selected as quantifier ion and its peak area at different concentration levels was used to construct the calibration curve. Limits of detection (LODs) and Limits of quantification (LOQs) were calculated based on the signal-to-noise ratio of equal to 3 and 10, respectively. The validation parameters were compared to EU provision No. 836/2011  at concentrations 1 and 0.5 \u00b5gmL-1, respectively. A mixture of 500 \u00b5L chloroform and 1000 \u00b5L acetone  was quickly injected into the sample solution in three portions, with a 500 \u00b5L Hamilton syringe. A cloudy solution was formed after adding the mixture of extraction and disperser solvent in the test tube. The test tube containing ultrapure water, extraction and disperser solvent was centrifuged (Hettich Zentrifugen Universas 320R) for 3 min at 2500 rpm. The upper layer was discarded and 500 \u00b5L of the lower phase (extraction solvent) was removed by a Hamilton syringe and transferred to 1.5 mL amber glass vial. The content of the vial was dried under a gentle stream of nitrogen at room temperature and re-dissolved in 70 \u00b5L chloroform. The vial was placed in auto sampler and 2 \u00b5L of the contents was injected into the gas chromatograph in splitless mode. The approximate volume of the sedimented phase was about 550 \u00b5L.Calculation of enrichment factor and extraction recoverysed.) and the spiking level (C0)  is defined as the ratio between the analyte concentration in the sedimented phase (Cvel (C0) . The Csesed. \u00d7 Vsed.) to total analyte amount in aqueous solution (Vaq \u00d7 C0) (The extraction recovery (ER) is defined as the percentage of the total analyte amount in the sedimentedphase (Caq \u00d7 C0) .Gas chromatography mass spectrometry determination\u22121 and kept for 0.5 min, then increased to 290\u00b0C at 5\u00b0C min\u22121 and hold for 10 min at the final temperature. Data acquisition was delayed for 12 min. The ionization was performed in ion source with electron impact mode (70ev). The ion source and triple quadrupole mass analyser temperature were kept at 230 and 280\u00b0C, respectively. A mass range of m/z 50-500 was scanned to find the retention time and diagnostic ions (quntification and confirmation ions) of the analytes. Retention time and mass spectrum of each of the standards were used to identify and confirm them. For quantitative determination, PAH standards and samples were analyzed in selected ion monitoring (SIM) mode. The retention time, diagnostic ions and quantification ion for each analyte are presented in Analysis was accomplished in the SIM mode based on the use of one target as quantification ion and two confirmation ions. PAHs were recognized according to their retention times, target and confirmation ions . The quaMethod validation-1, respectively. The coefficients of determination (r2) were between 0.983 and 0.999 for all PAHs. It shows that the extraction process and analytical method after validation have enough efficiency for the determination of PAHs at trace levels. In the present study, we used spiked calibration standard approach to overcome the problems caused by the matrix. In this approach, calibration standards are prepared by the addition of standard solution to blank water samples that are subjected to the same sample preparation procedure which is intended to be used for unknown samples. In this way, the standard sample matrices will have the same composition as the unknown samples and therefore the effect of matrix is reflected in both standards and unknown samples. The calibration curve is constructed using these spiked calibration standards and it is easily used to calculate the concentration of analyte (s) in unknown sample without being concerned about the matrix effects. The developed method has the advantage of using spiked calibration curves that minimize the matrix interferences.According to the calibration graphs, the linearity for Naphthalene, Acenaphthene, Flourene and for Phenanthrene, Anthracene, Pyrene, Benz[a]anthracene, Chrysene, Benzo[b]fluoranthene, Benzo[k]fluoranthene, Benzo[a]pyrene, Dibenzanthracene, Benzo[ghi]perylene were observed over the concentration range of 0.1-2.8 and 0.35-2.8 ngmL2, LODs, LOQs and HORRAT of the method under optimized conditions are summarized in tables 2 and 3. As shown in these tables, all of the validation parameters examined were in compliance with EU provision No. 836/2011 (Limits of detection (LODs) and Limits of quantification (LOQs) were calculated based on the signal-to-noise ratio of equal to 3 and 10, respectively. Recovery, repeatability, RSD%, R836/2011 . TherefoDispersive liquid-liquid microextraction optimization-1 of each PAH and 0.70 ngmL-1 of antracene-d10 as internal standard. All the optimization trials were performed three times.The recovery rate is an important indicator at the extraction process. It was usually used to evaluate the efficiency of the DLLME procedure. There are many parameters that affect the recovery. In the present study, the effect of different factors such as the type and volume of extraction and disperser solvent, rpm and time of centrifuge on the recovery were evaluated and optimized. To evaluate the effect of these parameters on the recovery, we used 10.00 mL of ultrapure water containing 1.00 ngmLThe kind of extraction solvent In order to have efficient extraction, the selection of a suitable extraction solvent is essential. The extraction solvent must have some characteristics including: low solubility in water, low volatility, High affinity to extract the desired compounds and the ability to form a clear and detectible peak in the chromatogram . In thisExtraction solvent volumeTo evaluate the effect of extraction solvent volume on the recovery values of the studied analytes, different volumes of chloroform  were examined. In this study, three spiked samples were prepared for each of the volumes of the extracting solvent. At all the experiments a constant volume of 1000 \u00b5L of the dispersive solvent was applied. The extraction and centrifugation processes were done according to procedure described in section 2.3. As shown in The kind of disperser solventThe selection of an appropriate disperser solvent is very important for the efficient extraction. The disperser solvent must have some characteristics including: the ability to be distributed in aqueous samples in order to form very small droplets and increase the surface area in contact between the analytes and the extracting solvent and solubility in the aqueous samples and the organic extraction solvents. In addition, the compound should also be not expensive and highly toxic. Therefore, the ability to form a cloudy solution or an effective emulsion depends significantly on the amount and type of the disperser solvents. In this work, acetone, acetonitrile, methanol and ethanol were tested and their influence on the recovery values were evaluated . For thiDispersive solvent volumeIn DLLME procedure, the dispersive solvent volume is a critical parameter and its effect should be determined on the efficiency of extraction. For examining the effect of this factor on the recovery values of the 13 PAHs, five spiked samples were prepared for each of the dispersive solvent volume. In this work, the different volumes  of acetone as dispersive solvent containing 500 \u00b5L chloroform as the extracting solvent were applied for extraction. The extraction and centrifugation processes were accomplished based on the aforementioned technique in Section 2.3. The settled phase was collected completely and dried, then re-dissolved in 70 \u00b5L of chloroform. As shown in Centrifugation timeIn order to assess the effect of centrifugation time on the extracting efficiency, a range of centrifugation times  were tried. For each of the mentioned times, five spiked samples were prepared. For extraction, a mixture containing 500 \u00b5L chloroform and 1000 \u00b5L acetone were used as the extracting and disperser solvents, respectively. The extraction process was accomplished according to the described procedure. All of the experiments were performed at 5000 rpm. The results  are shown in Analysis of real sampleset al.  were lower than the LOQ in all the samples. There are only few published papers for determination of PAH in mineral water. In one of these studies, Humood F. Al-Mudhafa et al. . No treatment was conducted such as filtration on the samples, prior to extraction process. Extraction process, centrifugation and analysis were accomplished according to the described procedure. A blank and three spiked ultrapure water at concentration of 1 ngmLa et al.  analyzedet al.  above the maximum concentration allowed for bottled waters by the Turkish legislation. But in some studies, some contamination have been found in mineral water. For example, In one of these studies, Ma Teresa Pena et al.  determint et al.  detectedytGuler,  found thConsidering the few studies regarding PAHs contamination in drinking water in Iran, to get a clear picture of contamination of drinking water, comprehensive monitoring of PAHs in water in different provinces and seasons are suggested.In the present study, dispersive liquid-liquid microextraction (DLLME) procedure coupled with gas chromatography mass spectreometry was used for determination of trace amounts of thirteen polycyclic aromatic hydrocarbons in water samples. After optimization of the parameters affecting the extraction and analysis efficiency, the identification and quantification of the PAHs were carried out by applying the mentioned techniques for the analysis of mineral water samples. The results showed that these two techniques in combination, result in a satisfactory recovery and precision. No contamination of mineral water samples with PAHs were found among the samples. However, considering the high risk of contamination with PAHs in Iran, a comprehensive survey for PAHs in water is recommended."}
+{"text": "Pistosaurus longaevus, from the Middle Triassic of Poland and Germany. This is the oldest recognition of septic necrosis associated with septic arthritis in the fossil record so far, and the mineralogical composition of pathologically altered bone is described herein in detail. The occurrence of septic necrosis is contrasted with decompression syndrome-associated avascular necrosis, also described in Pistosaurus longaevus bone from Middle Triassic of Germany.Avascular necrosis, diagnosed on the basis of either a specific pathological modification of the articular surfaces of bone or its radiologic appearance in vertebral centra, has been recognized in many Mesozoic marine reptiles as well as in present-day marine mammals. Its presence in the zoological and paleontologic record is usually associated with decompression syndrome, a disease that affects secondarily aquatic vertebrates that could dive. Bone necrosis can also be caused by infectious processes, but it differs in appearance from decompression syndrome-associated aseptic necrosis. Herein, we report evidence of septic necrosis in the proximal articular surface of the femur of a marine reptile,  Pistosaurid remains have been found in Europe, North America and China \u201310, docuDecompression syndrome (DCS), known also as Caisson's disease or \u2018the bends\u2019 , affectsDecompression syndrome-associated bone necrosis is also called aseptic necrosis, to distinguish it from another form of AVN, septic necrosis. The latter is caused by an infectious process referred to as septic arthritis. It usually resulted in abnormal new bone formation with cauliflower-like appearance  and charPistosaurus longaevus limb bones. A classic bends-related AVN was present in a humerus, and a partially preserved pistosaur femur was investigated in detail, showing evidence of infection type of bone necrosis. We applied high-resolution X-ray microcomputed tomography (XMT) to demonstrate infection-mediated abnormal bone formation (herein referred to plaque) and joint surface collapse due to decompression syndrome. Moreover, we have examined the chemical composition of the necrotic plaque and non-altered bone, showing differences resulting from new bone tissue formation in the pathological conditions.Herein we present two of the mentioned types of bone necrosis, recognized in 2.2.1.SUT, Museum of Geology, Silesian University of Technology ; NME, NaturkundeMuseum Erfurt ; SMF, Naturmuseum Senckenberg ; MHI, Muschelkalk Museum Hagdorn Ingelfingen ; GIUS, Department of Paleontology, Faculty of Earth Science, University of Silesia .2.2.The unusual appearance of proximal joint surfaces  captured the interest of the present authors  on the detailed drawings of pistosaur long bones from Bayreuth in H. Meyer's treatise on Middle Triassic reptiles [2.3.Pistosaurus longaevus is based on personal observation (DS), referencing comparative bone material from the Museum of Natural History, Berlin, Germany. Moreover, three other pistosaur long bones  from Germany were studied macroscopically. As reference samples in spectral studies, we presented carbonate host rock surrounding specimen SUT-MG/F/Tvert/43-1 (herein referred to host rock) and the femur of an extant Gal\u00e1pagos marine iguana . The extant bone tissue used in our study was collected as an isolated bone with the permission of the appropriate local authorities for research purposes (see Ethics).The proximal part of the femur (specimen no. SUT-MG/F/Tvert/43-1) studied here in detail came from the Boruszowice Formation of Rybna, district of Tarnowskie G\u00f3ry town, located in Upper Silesia, southern Poland. Its designation as 2.4.The historical pistosaur findings from Tarnowskie G\u00f3ry area (Upper Silesia) come from the Wilkowice and Boruszowice formations (Illyrian/Fassanian), similar in age to that of the German localities. According to Szulc , the Bor2.5.The specimen SUT-MG/F/Tvert/43-1 was treated with 99.9% pure, non-buffered acetic acid , diluted in demineralized water to a concentration not more than 10%. The proximal epiphyseal part of the specimen was submerged  in acetic acid solution to remove limestone sediment (host rock residuum), subsequently rinsed in demineralized water and dried in a desiccator with moisture absorbing silica gel.2.6.\u03bb\u2009=\u2009532\u2009nm) and a CCD camera  were applied to determine the degree of bioapatite crystallinity and, indirectly, the chemical composition through analysis of phosphate and carbonate groups. An air Olympus MPLAN (50\u00d7/0.76NA) objective and monochromator with a 600 line\u2009mm\u22121 grating were used. All spectra were accumulated by 20 scans with an integration time of 120\u2009s and a resolution of 3\u2009cm\u22121. The spectrometer's monochromator was calibrated using the Raman scattering line of a silicon plate (520.7\u2009cm\u22121). The fluorescence and baseline correction, as well as peak fitting analysis by Voigt function, were performed using the GRAMS software package.A WITec confocal Raman microscope CRM alpha 300 equipped with solid-state laser  in the 4000\u2013400\u2009cm2.8.olumeShare software. The dataset of initial CT scanning is not shown in the paper.The initial computed tomography (CT) studies of specimen SUT-MG/F/Tvert/43-1 were performed with a GE Healthcare Discovery CT750 HD 64-channel computed X-ray tomograph unit . The sample was exposed at 44.07 mGy, at 640\u2009mA. CT scans were recorded as DICOM image files and processed and analysed using the GE Healthcare AW V2.9.econstructor software . For 3D imaging of bone, serial XMT sections were obtained with Avizo 7.0 Fire Edition software.The more detailed microtomographic data of specimen SUT-MG/F/Tvert/43-1 were collected with an XRadia MicroXCT-200 imaging system equipped with a 90\u2009kV/8\u2009W tungsten X-ray source in the Laboratory of Microtomography, Institute of Paleobiology, Polish Academy of Sciences, Warsaw. The scans were performed using the following parameters: voltage, 80\u2009kV; power, 8\u2009W; exposure time, 45\u2009s; voxel size, 46.11\u2009\u00b5m. Radial projections were reconstructed with the XMR3.3.1.a) from Bindlach, ascribed to Pistosaurus longaevus, with collapse (subsidence) of the articular surface defect of the type seen with avascular necrosis from bends was examined. The margins are continuous, surrounding a depressed articular surface, which has collapsed onto underlying bone.An isolated, complete humerus a from Bi3.2.b) from Bad Sulza is characterized with irregular, discontinuous margins surrounding a collapsed area with irregular base. Irregular disruption of that base with new bone formation and a draining sinus as well as cauliflower-like appearance is characteristic of an infectious process .A complete femur b from Ba3.3.c) is characterized with extremely altered joint surface at the proximal end with numerous draining sinuses and islets of thin, amorphous pathological plaque .The complete femur c is char3.4.d). The host rock covering the region of interest  was partially removed by chemical dissolution (acetic acid) instead of mechanical preparation to avoid damage of the fragile, pathologically affected area. The focal depression manifests as a thin plaque with rare  nutritional foramina, appearing as black spots  and at least two split-like draining sinuses on the surface of the dead bone . The surface is characterized by a filigree periosteal reaction , documenting the infectious origin of the pathology. The detailed XMT scans of SUT-MG/F/Tvert/43-1, of the pathologically altered joint surface and the opposite  side of the same specimen, reveal details of the internal bone structure . Channels can be distinguished within bone tissue, manifest as darker smudges . These intraosseous channels seem to contact directly with the bottom of one draining sinus .This is the proximal part of a pistosaur femur, 80\u2009mm long, 56\u2009mm in the widest section with focal depression of the proximal articular surface d. The ho figures\u00a0d, and 2a3.5.Pure acetic acid and limestone host rock samples were examined to rule out input of chemical treatment or host rock-derived carbonate substitutions on the result of spectroscopic studies of analysed samples  and non-altered bone . These data were compared with referenced spectra of the host rock and extant bone sample from a marine iguana . The Raman spectrum of the host rock clearly indicates calcium carbonate (a) as a typical phase for the environment in which fossils from the marine Middle Triassic are usually preserved [\u22121, related to the symmetric P\u2013O stretching \u03bd1 (PO4)3\u2212 modes of stoichiometric hydroxyapatite (HAp) [b). These features are also sensitive to carbonate (\u22121) centred around 969\u2009cm\u22121 is observed in the extant bone, which, due to fluoridation, is shifted towards higher wavenumber and is assigned to fluorapatite (FAp) [\u22121 is assigned to octacalcium phosphate (OCP) [c,d) reveals two bands located at 969 and 940\u2009cm\u22121 which result from, respectively, monophasic calcium phosphates or FAp [b), as well as the non-altered fossil sample (c), is strongly linked to diagenetic processes and dissolution or transformation of the latter compound to the typically bone-forming phase. In the pathological plaque sample, the spectrum is dominated by a strong band located at 949\u2009cm\u22121 and lower intense ones at 958\u2009cm\u22121 and 920\u2009cm\u22121 (d). The two lower bands originate from non-crystalline ACP or OAp [\u22121 is associated with residual non-altered HAp. The other bands located in the 450\u2013400, 1080\u20131020 and 635\u2013560\u2009cm\u22121 regions originate from, respectively, the \u03bd2 symmetric bending, \u03bd3 asymmetric stretching and \u03bd4 asymmetric bending modes of the (PO4)3\u2212 groups [\u22121, Raman features are derived from translations of the O-Ca-O, O-P-O, OH\u2212 ions, as well as liberations of (PO4)3\u2212 ions. More detailed studies of extant and non-altered fossil bone spectra reveal bands in the 1590\u20131280\u2009cm\u22121 region, as well as at approximately 870\u2009cm\u22121, which, respectively are associated with organic compounds  in extant samples [3)2\u2212 groups incorporated into the crystal structure of calcium phosphates . Bands located at 1093 and 878\u2009cm\u22121 on the spectrum of modern bone sample represent (CO3)2\u2212 anions partially occupying OH\u2212 positions (A-type), while the band detected at 1078\u2009cm\u22121 reflects partial (PO4)3\u2212 substitution (B-type). Similar findings present in non-altered fossil bone confirm predominance of carbonated apatite in this type of bone  \u201328,33,34te (HAp) ,36 (figu content  and shou content . A stronte (FAp) . The moste (OCP) . HAp is te (OCP) . Examinas or FAp , as wells or FAp . The chal sample c, is str920\u2009cm\u22121 d. The twP or OAp  and the \u2212 groups . Below 3 samples  in fossi of bone  [27,29\u20133\u22121) on the reference infrared spectrum of host rock  and on non-altered fossil bone  are associated with water adsorbed on the surface or hydroxyl groups of the HAp structure. However, the low hydroxyl signal of non-altered fossil bone suggests a relatively low content of hydroxylated apatite with augmentation of the carbonate component of fluorine apatite's concentration. The extant bone sample (figure\u00a03f) reveals a series of bands originating from methylene groups (3000\u20132800\u2009cm\u22121), amide A and B (3400\u20133000\u2009cm\u22121) and water molecules , similar to those previously linked to adsorbed water on the surface or a hydroxide of HAp structure. A few relatively strong bands with high values of FWHM centred at 3449, 3327, 3179\u2009cm\u22121 in the pathological bone (figure\u00a03h) are attributed to the stretching vibrational mode of molecular water arranged within the strongly modified structure of calcium phosphates. Here, the infrared spectrum indicates also four strong and narrow quantities  associated with the vibrational modes of OH\u2212 groups as well as with the H-bonding pattern formed due to the interaction between proton and oxygen from phosphate units. In addition, a strong hydration might also generate a special type of molecular interaction (repulsive type of interaction) between the hydroxide units, which provides a shift towards higher wavenumber [The low intense bands  and beyond the scope of this study. Moreover, the necrotic plaque in SUT-MG/F/Tvert/43-1 occupies the subsidence area, confirmed by macroscopic and XMT observation.The presence of decompression syndrome-related avascular necrosis in pistosaur limb bones and the occurrence of pistosaurid remains all around the globe in the Triassic times suggests that these animals were active swimmers. Although their remains are limited to near-shore sediments ,6,8\u201310, se, Sues  illustra4.2.The region of bone where septic AVN was found initially suggested decompression syndrome-associated aseptic necrosis. However, detailed examination of the surface of SUT-MG/F/Tvert/43-1, as well as macroscopic examination of specimens MHI 931 and NME 78.341, reveals periosteal reaction in a filigree-type pattern, characteristic of infection .a\u2013h) and detailed XMT studies in three planes revealing a filigree or mesh-like pattern confirm that the thin plaque is pathologically modified bone tissue, not calcified cartilage, which is characterized by a more globular or sinusoidal pattern [d,e,g).Owing to the fragmentary nature of pistosaur remains from Upper Silesia, it is not possible to study the opposing joint surface. X-ray microcomputed tomography revealed that the thin plaque at the articular surface is associated with bone tissue during life and not foreign matter fused to bone during fossilization. The presence of draining sinuses a\u2013h and d pattern . Moreoved) and strongly modified bone phosphate material, apparently caused by the pathological (infectious) alteration of bone tissue.Furthermore, the pathologically altered bone fragment is characterized by lack of carbonate bands d and strSeptic arthritis is an infectious process of the synovium around joints, producing pressure, reducing or shutting off blood flow to the infected area, with resultant necrosis and consequent destruction of articular cartilage and erosion of the joints. It may be caused by several pathogens, most commonly bacterial , rarely fungal. Septic arthritis has been so far described in extant crocodilians ,48 and m4.3.1 stretching region of (PO4)3\u2212 and determination of the I(960)/I(949)+I(979) ratio document an opportunity to estimate lower crystallinity rate of apatite of pathological plaque in relation to non-altered fossil and extant bone samples.The Raman spectrum of the pathological plaque differs from that of non-altered fossil and extant bones, with strong structural modification of initial phosphate apatite. The extant sample is dominated by fluoro-, carbonated- and hydroxyapatites, while non-altered fossil bone reveals predominance of the hydroxylated counterpart. The integral band intensities of the \u03bd\u22121 suggests increased structural vacancies in ACP or OAp due to the removal of carbonate groups and fluorine ions. The decrease of typical Ap band intensity and shift towards lower wavenumber and broadening (compare a\u2013c) indicate that the variety of ions generating the homogeneous Increased band intensity at 949\u2009cm compare a\u2013c indic\u22121) showed predominant contribution of OH\u2212 groups. In the non-altered fossil bone only a water signal, typically observed in fossilized bone apatite [g,h). Hence, higher incorporation of hydroxyl moieties into the apatite-like phase structures correlates with an increase of structural distortion in pathological bone. Oxygen metabolism has a significant role in the pathogenesis of arthritis [\u2212), are very common [Infrared analysis of hydroxyl region (3800\u20132800\u2009cm apatite , was detrthritis ,54 and rrthritis . Among Ry common .5.Pistosaurus longaevus underwent dysbaric stress, with resultant avascular necrosis. Moreover, we conclude that these animals seem to be susceptible to joint infections, because of the diagnosis of septic arthritis in the three case studies presented herein. Furthermore, we demonstrated the apparent role of hydroxyl radicals in the pathophysiology of this ancient septic arthritis.The results of our study show two different types of bone necrosis in the stem group of Sauropterygia and comprise the earliest record of septic bone necrosis in a fossil tetrapod, as well as the oldest case of bends-related avascular necrosis within the Sauropterygia clade. As with many other marine reptiles,"}
+{"text": "The mean age at delivery has increased over the latest half of a century. Women of advanced maternal age have increased obstetrical risks and increased risk of chromosomal abnormalities and some other specified diagnoses in the offspring. The aim of this study was to assess the association between maternal age and overall child morbidity according to main diagnosis groups.We conducted a national cohort study including 352 027 live firstborn singleton children. The children were born between Jan 1994 and Dec 2009 and followed to Dec 2012. Children were divided into groups according to maternal age: 15\u201324, 25\u201329, 30\u201334, and 35+ years. Poisson regression analyses calculated adjusted incidence rate ratios (IRR) of child morbidities according to main diagnoses groups A-Q of the International Classification of Disease 10 with adjustment for year of birth, body mass index, smoking, and mother\u2019s level of education.Average follow-up time was 11 years. Compared to children born to women 25\u201329 years, firstborn children to mothers aged 35+ had higher child morbidity in 8 of 19 main diagnosis groups and firstborn children to mothers 15\u201324 years had higher child morbidity in 12 of 19 main diagnosis groups. Thus, for a majority of diseases a U-shaped correlation was found, with lowest rates in women 25\u201329 years.Firstborn children to both older and younger mothers have higher overall morbidity as compared to children born by mothers 25\u201329 years. The average age at first delivery has in Denmark increased from 22.7 years in 1965 to 29.1 years in 2013 [Advanced maternal age has been associated with several adverse maternal and perinatal outcomes, such as reduced fertility, increase in risk of miscarriages, preterm birth, large for gestational age, stillbirth, and to increase the rate of Caesarean sections and instrumental delivery \u20136. FurthYoung maternal age has been associated with a significantly lower risk of preeclampsia, post-partum haemorrhage, instrumental delivery, a decreased rate of Caesarean section, an increased risk of preterm birth, and a significantly increased risk of fetal death \u201315.Adverse pregnancy exposures are believed to affect long-term health in the offspring ,17. FinaTherefore, the aim of this study was to assess the association between maternal age and overall child morbidity for each of the main diagnosis groups A-Q within the ICD10 among all live born in Denmark. We conducted our analyses on firstborn singleton children.st of January 1994 through December 31st, 2009 and followed the children till December 31, 2012. The children were grouped according to maternal age at childbirth: 15\u201324, 25\u201329, 30\u201334, and 35+ years. Overall child morbidity was measured counting ICD-10 diagnosis codes and was categorized according to the first letter in the diagnosis codes A-Q, each letter categorising a specific area of disease, for example F covering all mental disorders. We counted both primary and secondary diagnoses among the children. Diagnoses with a typical short disease period were counted several times, after a restriction period of 12 weeks. We considered bacterial infections, non-bacterial infections, benign tumors, anemia, and ear diseases as such diagnoses. All other diagnosis groups were defined as chronic diseases and only counted once at the time of first diagnosis. Since diagnosis only counted once or after a restriction period of 12 weeks, transfers between hospitals were thus taken into account.We conducted a National cohort study including all live born singletons in Denmark from 1We defined mothers at 35 years or older as mothers of advanced age. Smoking was categorized as either current smoker or non-current smoker. Body mass index was categorised according to World Health Organisation; <18.5 Underweight, 18.5\u201324.9, normal range (reference) \u226525\u201330, overweigh \u226530 Obese. Smoking and BMI were registered in first trimester of pregnancy. Educational length had four levels: a) unknown or no education, b) primary education or lower secondary education, c) upper secondary education or post secondary non-tertiary education, and d) first- or second stage of tertiary education.We collected data from two National registers; The National Health Register holds by law information on discharge diagnoses and hospital stay from all public and private hospitals, including information on antenatal care, childbirth, and the post-partum period. The register contains all discharge diagnosis since 1977 and since 1995 also all outpatient diagnoses, main as well as secondary diagnosis. The National Health Register is maintained by the Health Data Board and all information registered is delivered continuously throughout the country. The register is used to measure hospital activity, monitor diseases and treatments, and to aid in medical research. The National Health Register delivered information on maternal age, maternal body mass index, and smoking at the time of pregnancy, and for the children; birth weight, gestational age, and ICD-10 diagnosis codes. Status on emigration and maternal education was delivered from Statistics Denmark. Statistics Denmark works as an independent unit under the Danish government, providing official accessible statistics. Statistics are used in politics and research. Data from the registries were linked by unique identification numbers given to all Danish citizens at birth or when accepted citizenship is achieved by immigrants.st, 2012. However, those who moved back to Denmark contributed with person-time also while emigrated. Relative risks of child morbidities were calculated by Poisson regression using SAS 9.4 with children born by mothers 25\u201329 years as reference. Children\u2019s age was used as risk time to account for differences in follow-up time.Children were followed from birth until time of emigration, time of death, or December 31The analyses were adjusted for possible confounding influence from year of birth, maternal body mass index, smoking, and educational length. Being born preterm and small for gestational age were considered a consequence of maternal age (mediators) and therefore not adjusted for. As parity is known to influence child morbidity, firstborns being associated with increased morbidity, our main results were made on only firstborn children. Stratified analyses were made to assess effect modification from maternal education on the association between maternal age and child morbidity. The study was approved by the Danish Data Protection Agency, journal number 2012-41-0605 and approved by Statens Serum Institute. Since the study only uses data already registered for clinical use, no further ethical approval was necessary.During the 16-year study period, 1 017 577 singletons were born in Denmark. After exclusion of stillborn, 1 014 280 children remained, including 99.7% of all newborn singletons in Denmark. Of the 1 014 280 delivered children, 352 027 were firstborn . The chiFirstborn of mothers of advanced age had a statistically significantly increased morbidity in eight of 19 main diagnosis groups including mental disorders, cerebral-, eye-, heart-, circulatory-, rheumatic-, neonatal diseases, and congenital malformations . IncidenAmong firstborn children to young mothers aged 15\u201324 years) we found higher morbidity in 12 of 19 main diagnosis groups, as compared to children to mothers 25\u201329 years old . Our results match a study by Hollier et al. demonstrating an increased risk of both chromosomal and non-chromosomal malformations in children born by older mothers . AnotherWe found no previous study investigating the association between maternal age and overall child morbidity of cerebral-, eye-, heart-, circulatory-, and rheumatic diseases, all of which were statistically significantly increased in children to mothers 35+. The 29% (5\u201358%) increased risk of heart diseases among children to older mothers should be confirmed and evaluated in future studies. Airway disease was the only diagnosis group with statistically significantly decreased morbidity in children to mothers aged 35+. Airway diseases include all respiratory tract infections, asthma, and allergies affecting the respiratory tract system.In our study malignant diseases and benign tumours showed no association to maternal age. Several studies have investigated the association between maternal age and risk of childhood cancer. A large cohort study from Sweden, including 4.3 million children born from 1961 to 2000 found a positive association between advanced maternal age and retinoblastoma and leukaemia . AnotherAmong mothers 15\u201324 years, we found increased morbidity in 12 of 19 main diagnosis groups. We found no study assessing the same association to maternal age, except to mental disorders as described above.In Denmark educational level is generally a better measure of socioeconomic status than income. Educations are government paid all the way through university, thereby in principle making higher education accessible for all citizens, regardless of social class.Blackburn et al found an inverse association between socioeconomic status and child morbidity . We founA large number of comparisons were carried out and some associations could therefore be due to chance. However, the consistency in our findings, support the overall conclusion of a small increased risk of child morbidity among children of older and young mothers.We cannot exclude the possibility of spurious associations caused by potential unknown confounding factors, and studies within other populations should be carried out before causality can be established.Our study examined associations to disease groups rather than to specific diseases, which could hide associations to specific sub-diagnoses. Opposite associations between maternal age and specific diseases would, when combined into one disease group, hide specific associations. It is likely that the observed associations are driven by the more common diagnoses within a diagnosis group. Future studies analysing a level deeper in the main diagnosis groups could clarify more specific associations. However, our main objective with this study was to assess the association between maternal age and overall child morbidity.Validity differs between common diagnoses. That circumstance, however, will not affect the tested association to maternal age since registration validity of diagnoses should not be associated to maternal age. We were not able to adjust for differences in health behaviour among maternal age groups, and results should therefore be interpreted cautiously. Our study holds no information about the age of the father. The strong correlation between maternal and paternal age implies, that the demonstrated associations reflect a combined association to maternal age as well as paternal age. We were only able to adjust for a handful of possible confounders, other disease specific variables were not adjusted for and spurious findings among the results are possible.Among the strengths were the generally high validity of discharge diagnoses from our hospitals , the comIt should be stressed, that our study aimed to assess the influence of maternal age by itself, and not the secondary offspring consequences due to age differences according parity, plurality and infertility, the two latter of which burden older delivering women, while parity burden younger women\u2019s offspring.In conclusion, firstborn children to both older (ages 35+) and younger mothers (aged 15\u201324) had slightly higher overall morbidity as compared to children born by mothers 25\u201329 years. We found an inverse association between level of maternal education and child morbidity in a majority of the main diagnosis groups. If these findings reflects biological mechanisms, they add to the list of consequences by early- as well as postponed parenthood, and it seems that the optimal maternal age for a child to be born considering child morbidity is between 25 and 34 years.S1 Table(PDF)Click here for additional data file."}
+{"text": "JBS, MIM #243800) is a very rare autosomal recessive disorder characterized by exocrine pancreatic insufficiency, nasal wing hypoplasia, hypodontia, and other abnormalities. JBS is caused by mutations of the UBR1 gene (MIM *605981), encoding a ubiquitin ligase of the N\u2010end rule pathway.Johanson\u2010Blizzard syndrome  analysis of the UBR1 gene and analyzed the copy number status of all 47 UBR1 exons.Molecular findings in a total of 65 unrelated patients with a clinical diagnosis of UBR1 alleles. Six patients with a highly suggestive clinical diagnosis of JBS and unsolved genotype were included in this study. MLPA analysis detected six alleles harboring exon deletions/duplications, thereby raising the mutation detection rate in the entire cohort to 97.7% .Our previous studies using Sanger sequencing could detect mutations in 93.1% of 130 disease\u2010associated JBS\u2010associated UBR1 mutations.We conclude that single or multi\u2010exon deletions or duplications account for a substantial proportion of  UBR1 gene  are the molecular basis of JBS  is a clinically distinct, autosomal recessively inherited congenital malformation syndrome. The major clinical hallmarks of this multisystem disorder are exocrine pancreatic insufficiency (EPI), nasal wing hypo\u2010/aplasia, and oligodontia of permanent teeth. Hearing impairment, scalp defects, cognitive impairment of variable degree, short stature, hypothyroidism, microcephaly, intrauterine growth restriction, congenital heart defects, urogenital and anorectal malformations, renal anomalies, and diabetes with onset during adolescence are additional features of the syndrome  by Sanger sequencing of coding exons and flanking intronic regions (\u00b120\u00a0bp). Mutations included 37 nonsense, 30 splice site, 32 missense, and 19 frameshift mutations, as well as three small in frame deletions. In nine UBR1 alleles no mutations were detected by Sanger sequencing.Based on the large cohort consisting of 61 patients from 50 families that was published by our group in 2014  assay for the UBR1 gene. Using such an MLPA approach facilitates relative quantification of nucleic acid fragments. Hence, it is possible to detect copy number changes caused by duplications and deletions of the genomic target region like the exons of a gene. MLPA based detection of exon deletions and duplications was first described by Schouten et\u00a0al. (UBR1 according to the protocol by MRC\u2010Holland (https://www.mlpa.com) . Denaturation, hybridization, ligation, and MLPA\u2010PCR were performed in an iCycler  .In this cohort, three unrelated patients with a highly suggestive clinical diagnosis of JBS remained without a detectable n et\u00a0al. . The undn et\u00a0al.  for eaches Table\u00a0. For eacCA) Fig.\u00a0. SALSA MUBR1 gene  was identified in the patient _(3209+1_3210\u20101)del), while the probe for exon 30 indicated an increased dosage in the patient and in the maternal sample  in exon 44 in one allele of this patient by Sanger sequencing Fig.\u00a0. The leuUBR1 allele that does not harbor the missense mutation, probably due to a mutation that could not be detected by conventional sequencing. This patient had a clinical diagnosis of JBS based on the combination of EPI, nasal wing hypoplasia, oligodontia of permanent teeth, and progressive hearing loss  by Sanger sequencing, but no mutation in the second allele could be detected  detected no homozygosity at the UBR1 locus and by western Blot analysis no reduction in UBR1 protein expression could be demonstrated (data not shown).Patient 6 was clinically described by Takahashi et\u00a0al. . He showUBR1, thereby expanding the mutational spectrum of the UBR1 gene. The six unrelated patients investigated in this study had a typical JBS phenotype but no UBR1 point mutation detectable by Sanger sequencing in either one allele (n\u00a0=\u00a03) or both alleles (n\u00a0=\u00a03), together representing a total of nine JBS\u2010associated UBR1 alleles without a detectable mutation. MLPA analysis was able to identify the underlying mutation in six of nine previously unsolved alleles. Considering the entire cohort of 65 unrelated patients . However, if there is indeed a second gene associated with JBS, its patient\u2010wide contribution is very small.The remaining 2.3%  that were not solved may be explained by mutations in the promoter region, intronic mutations that are not close to the splice sites or larger genomic rearrangements  of the UBR1 gene in patients with a distinct JBS phenotype, if point mutation screening does not reveal a UBR1 mutation in one or both alleles.In conclusion, we recommend deletion/duplication analysis of the The authors declare no conflict of interest.Appendix\u00a0S1. Material and methods.Table\u00a0S1. MLPA probes for analysis of the UBR1 gene.Table\u00a0S2. UBR1 probemixes (for deletion/duplication screening).Table\u00a0S3. Prediction of pathogenicity of the UBR1 missense variant p.Leu1597Arg (c.4790T>G) using various online prediction tools.Figure\u00a0S1. Schematic overview of an MLPA procedure.Figure\u00a0S2. Multiple protein alignment of human UBR1 and its orthologues around position 1597.Click here for additional data file."}
+{"text": "Escherichia coli. This work provides insight into the threshold for tolerance of specific mistranslation events that were previously predicted to be broadly neutral to proteome integrity. Furthermore, these data reveal the effects of mistranslation beyond the general unfolded stress response, leading to global translational reprogramming.Errors in protein synthesis have historically been assumed to be detrimental to the cell. While there are many reports that translational errors are consequential, there is a growing body of evidence that some mistranslation events may be tolerated or even beneficial. Using two models of mistranslation, we compare the direct phenotypic effects of these events in  Escherichia coli proteome, with potentially catastrophic effects on fitness and viability. Tolerance for Ala mistranslation appears to be much lower than with other translational errors, consistent with previous reports of multiple proofreading mechanisms targeting mischarged tRNAAla. These results demonstrate the essential role of aminoacyl-tRNA proofreading in optimizing cellular fitness and suggest that any potentially beneficial effects of mistranslation may be confined to specific amino acid substitutions.Mechanisms have evolved to prevent errors in replication, transcription, and translation of genetic material, with translational errors occurring most frequently. Errors in protein synthesis can occur at two steps, during tRNA aminoacylation and ribosome decoding. Recent advances in protein mass spectrometry have indicated that previous reports of translational errors have potentially underestimated the frequency of these events, but also that the majority of translational errors occur during ribosomal decoding, suggesting that aminoacylation errors are evolutionarily less tolerated. Despite that interpretation, there is evidence that some aminoacylation errors may be regulated, and thus provide a benefit to the cell, while others are clearly detrimental. Here, we show that while it has been suggested that regulated Thr-to-Ser substitutions may be beneficial, there is a threshold beyond which these errors are detrimental. In contrast, we show that errors mediated by alanyl-tRNA synthetase (AlaRS) are not well tolerated and induce a global stress response that leads to gross perturbation of the  Throughout all domains of life, mechanisms have evolved to minimize errors in protein synthesis. Translational fidelity is maintained at two distinct steps of protein synthesis, surveillance of accurate aminoacyl-tRNA (aa-tRNA) pairing and cognate A site tRNA recognition during ribosome decoding . While iEscherichia coli genome contains 20 aaRS genes, one for each of the proteinogenic amino acids. As a result of the shared chemicophysical properties of many amino acids, half of the aaRS enzymes can potentially misactivate numerous noncognate amino acids  whose function was originally characterized to prevent d-amino acid aminoacylation was found to have proofreading activity against Gly-tRNAAla . These enzymes are responsible for pairing free amino acids in the cell and ligating them onto their cognate tRNAs . aaRSs pence Ile . AlternaIle  in mice was shown to lead to neurodegeneration  proofreading site becomes oxidized, leading to an overall decrease in ThrRS fidelity    into a lbundance  and aminbundance  are simi in mice . When mi tRNASer . The resE. coli, previously characterized mutations in both the AlaRS and ThrRS proofreading domains were made in isogenic MG1655 genetic backgrounds. Architecturally, these enzymes are predicted to share similar proofreading domains  was mutated to alanine, E. coli was sensitized to noncognate serine stress  was performed. Intriguingly, there was no observed significant difference in transcript levels  sigma E (2.6\u00d7), CpxR (1.3\u00d7), RcsB (2.6\u00d7), BaeR (3.3\u00d7), and PspF (1.7\u00d7) . It has E. coli . The obsE. coli  39, 40), 40E. coIt has also been shown that genetic loci of membrane proteins will spatially coordinate toward cellular membranes, consistent with the transertion model of cotranscriptional and cotranslational processing directly into the inner membrane . In addiin vivo to prevent mischarged tRNAAla species from accumulating. Additional factors, such as ProXPST1, have also been identified to have proofreading activity in vitro against these aa-tRNAs, but their role in vivo has yet to be well characterized  mutation were embryonic lethal  does not support the penalty of an inaccurate proteome. This is further supported by the numerous genomically encoded secondary mechanisms to minimize Ala mistranslation, which to date is unique to AlaRS.E. coli ThrRS has recently been shown to lose proofreading activity through at least two different mechanisms, during oxidative stress  and thrS (\u223c1.9 kbp) were amplified from MG1655  and thrS (1544TGC\u2192GCG) by inverse PCR . The resulting plasmids were then transformed into the diaminopimelic acid (DAP) auxotroph donor strain MFDpir (r) colonies that grew in the absence of DAP were selected at 37\u00b0C, which represented recombinants where the suicide vector had integrated into the E. coli chromosome by a single-crossover event. Camr recombinants were then transformed with the helper plasmid pSceH, a derivative of pSLTS (r) transformants were selected at 30\u00b0C in the presence of anhydrotetracycline (aTc) to induce I-SceI expression. The surviving colonies were then screened to identify recombinants that had lost the Camr marker, indicative that the integrated R6K vector had been deleted by a second recombination event. Multiple Cam-susceptible (Cams) recombinants were subsequently tested by PCR and Sanger sequencing to identify mutants that had inherited the new alaS and thrS alleles.To construct new \u201d method  were com\u201d method  that usem MG1655  genomic m MG1655 . This mom MG1655 . The deserse PCR . DNA seqn MFDpir . These tof pSLTS , which ehfq was deleted in the alaS mutant background by P1 transduction of an hfq::kan allele from NR633  was used for all experiments in rich medium. M9 minimal medium was prepared for all minimal medium experiments. M9 contained 1\u00d7 M9 salts, 2\u2009g/liter glucose, 1\u2009mg/ml thiamine, 1\u2009mM MgSOmM CaCl2 , 64. AmimM CaCl2  were pur600) were taken for each saturated culture, and the starting inocula were normalized to an OD600 of 0.05. Cultures were grown with aeration at either 37\u00b0C or 42\u00b0C for heat stress analysis. OD600 values were measured at the indicated time points using a CO8000 cell density meter (WPA). The data plotted in For all growth experiments, overnight cultures of the respective strains were grown to saturation in either LB or M9 minimal medium with antibiotics supplemented when applicable. Prior to commencing growth analysis, measurements of the optical density at 600 nm . To generate mistranslating tRNASer variants, the pLK-serW (Ser) vector was used as the template for site-directed mutagenesis (Stratagene), and the anticodons were mutated to translate at either the alanine or threonine codon. All three serW variant plasmids were transformed into MG1655 for growth analysis.A 195-bp DNA fragment containing the  E. coli . The afobla) were amplified from pUC18 and cloned into pSMART-LCKan by blunt ligation (Lucigen). The resulting pLK-Amp vector was then subjected to site-directed mutagenesis to generate the inactive Bla S68A variant. Both the pLK-Amp and pLK-Amp S68A vectors were transformed into MG1655 and MG1655 AlaRS C666A while maintaining selection using the kanamycin resistance cassette on the plasmid.It has previously been shown that mutation of an essential serine in \u03b2-lactamase (Bla) will inactivate the enzyme , which cIn vivo mistranslation was monitored by streaking MG1655/pLK-Amp/Amp S68A and MG1655 AlaRS C666A/pLK-Amp/Amp S68A on LB plates containing either kanamycin or kanamycin and ampicillin. Plates were grown for 2 days at 37\u00b0C to allow sufficient time to observe growth by the MG1655 AlaRS C666A strains.E. coli cultures were grown to an OD600 of 1.0 and harvested by centrifugation. The resulting pellet was frozen at \u201380\u00b0C for downstream processing. For cell lysis and protein digestion, cell pellets were thawed on ice, and 2\u2009\u03bcl of cell pellet was transferred to a microcentrifuge tube containing 40\u2009\u03bcl of lysis buffer . Cells were lysed by vortexing for 30\u2009s, and disulfide bonds were reduced by incubating the reaction mixture for 30\u2009min at 55\u00b0C. The reaction mixture was briefly quenched on ice, and 16\u2009\u03bcl of a 60\u2009mM indole-3-acetic acid (IAA) solution was added. Alkylation of cysteines proceeded for 30\u2009min in the dark. Excess IAA was quenched with 14\u2009\u03bcl of a 25\u2009mM DTT solution, and the sample was then diluted with 330\u2009\u03bcl of 183\u2009mM Tris-HCl buffer (pH 8.0) supplemented with 2\u2009mM CaCl2. Proteins were digested overnight using 12 \u03bcg of sequencing-grade trypsin. Following digestion, the reaction was then quenched with 12.5\u2009\u03bcl of a 20% trifluoroacetic acid (TFA) solution, resulting in a sample pH\u2009of <3. The remaining ALS reagent was cleaved for 15\u2009min at room temperature. The sample (\u223c30\u2009\u03bcg protein) was desalted by reverse-phase cleanup using a C18 UltraMicroSpin column. The desalted peptides were dried at room temperature in a rotary vacuum centrifuge and reconstituted in 30\u2009\u03bcl of 70% formic acid\u20130.1% TFA (3:8 [vol/vol]) for peptide quantitation by UV280. The sample was diluted to a final concentration of 0.2\u2009\u03bcg/\u03bcl, and 5\u2009\u03bcl (1\u2009\u03bcg) was injected for liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis.To monitor changes in protein abundance, 20-ml 18-AQ column (Maisch), using methanol as the packing solvent. Peptide separation was achieved using mixtures of 0.1% formic acid in water (solvent A) and 0.1% formic acid in acetonitrile (solvent B) with a 90-min gradient of 0/1, 2/7, 60/24, 65/48, 70/80, 75/80, 80/1, and 90/1 . At least one blank injection (5\u2009\u03bcl of 2% B) was performed between samples to eliminate peptide carryover on the analytical column. One hundred\u2009femtomoles trypsin-digested bovine serum albumin (BSA) or 100\u2009ng trypsin-digested E. coli wild-type K-12 MG1655 proteins were run periodically between samples as quality control standards.LC-MS/MS was performed using an Acquity ultraperformance liquid chromatography (UPLC) M-Class system (Waters) and Q Exactive Plus mass spectrometer. The analytical column employed was a 65-cm-long, 75-\u03bcm-internal-diameter PicoFrit column (New Objective) packed in house to a length of 50\u2009cm with a 1.9-\u03bcm ReproSil-Pur 120-\u00c5 Cm/z 300 to 1,700\u2009scan range; for data-dependent MS2, 17,500 resolution, 1e6 AGC target, top 10 mode, m/z 1.6\u2009isolation window, 27 normalized collision energy, 90 s of dynamic exclusion, and unassigned and +1 charge exclusion. Data were searched using MaxQuant version 1.6.1.0, with acetyl (N-term), deamidation (NQ), oxidation (M), and phospho (STY) as variable modifications and carbamidomethyl (C) as a fixed modification with up to 3 missed cleavages, 5 amino acids (aa) minimum length, and 1% false-discovery rate (FDR) against the UniProt E. coli database. Searches were analyzed with Perseus version 1.6.2.2.The mass spectrometer was operated with the following parameters: for MS1, 70,000 resolution, 3e6 AGC target, and E. coli cultures when they reached an OD600 of 0.7. Cell pellets were resuspended in SDS loading dye and boiled for 10 min before equal volumes of total cellular material were loaded on a 10% SDS-polyacrylamide gel and separated by electrophoresis. Proteins were transferred onto a 0.45-\u03bcm nitrocellulose membrane (Amersham) before blocking for an hour in 5% milk in Tris-buffered saline with Tween 20 (TBST). E. coli AlaRS (96\u2009kDa) was probed with an anti-E. coli AlaRS antibody  and anti-rabbit horseradish peroxidase . Membranes were stripped using the Abcam mild stripping protocol and reprobed with an HRP-conjugated anti-sigma70 (70\u2009kDa) antibody  as a loading control. HRP signals were developed using Clarity electrochemiluminescence (ECL) substrate (Bio-Rad) and monitored using ChemiDoc and the accompanying software (Bio-Rad). Western blot densitometric quantification was performed using the ImageJ software  sample. Simultaneously, chloramphenicol was added to the remaining cultures  and continued to grow. At the indicated time points, samples were removed, pelleted, and frozen until all samples were collected. To quantify the relative protein stability, densitometric analysis was performed and normalized to the abundance of protein at T0 for a given biological replicate. The data plotted are the average stability of three independent biological replicates, with error bars indicating the standard deviation of the replicates.Protein stability assays were performed essentially as described above, with minor modifications. Cells were grown to an OD600 of 0.7 prior to pelleting. Bacterial pellets were resuspended in RNAlater (Ambion) and stored at 4\u00b0C overnight. The pelleted cellular material was resuspended in buffer containing 20\u2009mM sodium acetate (pH 5.2), 1% SDS, and 0.3\u2009M sucrose and extracted in equal-volume acid phenol chloroform at 65\u00b0C. The aqueous phase was subsequently reextracted with acid-phenol chloroform at room temperature before one final chloroform extraction. RNA was precipitated in 1 volume isopropanol and 1/10 volume sodium acetate. DNA was removed from samples using Turbo DNase (Invitrogen), and RNA was extracted using acid-phenol chloroform prior to ethanol precipitation. Reverse transcription was performed using 100\u2009ng RNA and SuperScript IV (Invitrogen), following the manufacturer\u2019s recommendations. Transcript abundance was determined using primers specific for target mRNAs and SsoAdvanced Universal SYBR green supermix (Bio-Rad), and target mRNAs were analyzed using a CFX96 real-time PCR detection system (Bio-Rad). Data were analyzed using the Pfaffl method  after growing cells to at 37\u00b0C to mid-log phase and subsequently inducing expression with 500\u2009\u03bcM isopropyl-\u03b2-d-thiogalactopyranoside (IPTG) for 4\u2009h. Harvested cells were resuspended in buffer A  and EDTA-free cOmplete mini protease inhibitor (Sigma) prior to lysis by sonication. Clarified lysate was passed over a Talon metal affinity column (TaKaRa), washed with buffer A, and finally eluted with buffer B . Proteins were dialyzed in two stages to remove imidazole and to store the enzyme in 50% glycerol.The effect of the AlaRS C666A substitution on protein structure was determined by monitoring the stability of recombinant protein. Wild-type or mutant 14C]alanine (PerkinElmer), pyrophosphatase, and 1\u00d7 buffer . The reaction mixtures were incubated at 37\u00b0C for 20 min before filtering through a Protran BA 45 nitrocellulose membrane (Whatman). Filter disks were prewashed with 0.5\u00d7 buffer and subsequently washed three times with 0.5\u00d7 buffer after sample filtration. The disks were dried, and radiolabeled signal was quantified using scintillation counting.Initial enzyme concentrations were determined by active-site titration . Briefly0) and after (T60) incubating the enzyme at 37\u00b0C for 60 min prior to analysis. The stability of the enzyme was determined by plotting the change in activity after incubation at 37\u00b0C (activity at T60/activity at T0)  .g for 15 min at 4\u00b0C to remove Tris and glycerol, which are incompatible with CD analysis. The centrifugation was repeated three times with the addition of 200\u2009\u03bcl of 100\u2009mM potassium dihydrogen phosphate after each spin. The concentration was determined using a NanoDrop spectrophotometer, and a final concentration of 0.5\u2009mg/ml was used for the CD experiments.Changes in protein stability were also monitored using circular dichroism (CD). Wild-type and mutant proteins were resuspended 100\u2009mM potassium dihydrogen phosphate and transferred to a 0.5-ml Amicon Ultra centrifugal filter tube. Both proteins were then centrifuged at 10,000\u2009\u00d7\u2009mT). The molar ellipticity was measured at 222\u2009nm, which captures the extent of alpha helicity present in the protein. A range of temperatures from 25\u00b0C to 95\u00b0C was selected. The values of molar ellipticity obtained were converted to fraction folded using the following equation:T is the molar ellipticity at 222\u2009nm at any temperature, \u03b8F is the molar ellipticity at 222\u2009nm of the completely folded form (at 25\u00b0C), and \u03b8U is the molar ellipticity at 222\u2009nm of the completely unfolded form (at 95\u00b0C). The fraction folded versus temperature was plotted, where the mT, the temperature at which 50% of the protein is folded, was estimated.Variable temperature measurement was performed on the Jasco J-815 circular dichroism spectrometer, where the change in molar ellipticity of the protein was measured as a function of temperature to determine the melting temperature  were placed on the bacterial lawn. Following the overnight incubation, plates were imaged, and the distance of disk diffusion was measured using ImageJ.600 of 0.8. Cells were gently pelleted at 3,000\u2009rpm for 5 min. Pellets were prefixed in 4% electron microscopy (EM)-grade buffered formaldehyde for shipping and storage. Bacterial pellets were subsequently fixed in 2.5% glutaraldehyde\u20130.1 M phosphate buffer at 4\u00b0C. Pellets were then washed three times for 5 min in 0.1\u2009M phosphate buffer, placed in 1% aqueous osmium tetroxide for 90 min, and then reduced with ferrocyanide for 60 min at room temperature. Pellets were washed three times with water, dehydrated in a graded acetone series, and embedded in Spurr\u2019s resin. Sections were cut to 60\u2009nm thin, collected on Formvar-filmed copper grids, and stained with 2% uranyl acetate and Reynold\u2019s lead citrate. Bacterial sections were imaged at 80\u2009kV in a Zeiss EM10 using a Gatan Erlangshen charge-coupled-device (CCD) camera.Strains were back diluted from a saturated overnight culture and grown to an OD"}
+{"text": "Gpr39), kisspeptin-1 receptor (Kiss1r), kisspeptin (Kiss1), as well as synaptic plasticity-associated Lkaaear1 (Lkr) and Neurod2 mRNA were described on the basis of qPCR results. The greatest alterations were observed on day 3 ipsilaterally, when orofacial mechanical allodynia reached its maximum. This corresponded well with patterns of neuronal (Fosb), microglia (Iba1), and astrocyte (Gfap) activation markers in both TRG and TNC, and interestingly also in PBMCs. This is the first description of up- and downregulated genes both in primary and secondary sensory neurones of the trigeminovascular system that might play important roles in neuroinflammatory activation mechanisms. We are the first to show transcriptomic alterations in the PBMCs that are similar to the neuronal changes. These results open new perspectives and initiate further investigations in the research of trigeminal pain disorders.Orofacial pain and headache disorders are among the most debilitating pain conditions. While the pathophysiological basis of these disorders may be diverse, it is generally accepted that a common mechanism behind the arising pain is the sensitization of extra- and intracranial trigeminal primary afferents. In the present study we investigated gene expression changes in the trigeminal ganglia (TRG), trigeminal nucleus caudalis (TNC) and peripheral blood mononuclear cells (PBMC) evoked by Complete Freund's Adjuvant (CFA)-induced orofacial inflammation in rats, as a model of trigeminal sensitization. Microarray analysis revealed 512 differentially expressed genes between the ipsi- and contralateral TRG samples 7 days after CFA injection. Time-dependent expression changes of G-protein coupled receptor 39 ( Orofacial pain and headache disorders are among the most debilitating pain conditions. While the pathophysiological basis of these disorders may be diverse, it is generally accepted that a common mechanism behind the arising pain is the sensitization of extra- and intracranial trigeminal primary afferents. The trigeminal nerve provides most of the sensory innervation to the face and oral cavity as well as the meninges where the nociceptive primary afferents are closely associated with the vasculature. The cell bodies of these neurons are located in the trigeminal ganglion (TRG) and their central projections terminate in the trigeminal nucleus caudalis (TNC). It has been described that there is convergence of extra- and intracranial primary afferents in the TNC  weighing between 200\u2013300 g were used. Animals were kept under standard light-dark cycle (12-h light/dark cycle) and temperature (24\u201325\u00b0C) conditions, food and water were provided The study was carried out in accordance with the Ethical Codex of Animal Experiments of the University of P\u00e9cs and the 1998/XXVIII Act of the Hungarian Parliament on Animal Protection and Consideration Decree of Scientific Procedures of Animal Experiments (243/1988). The protocol was approved by the local Ethics Committee on Animal Research of University of P\u00e9cs (license No.: BA02/2000-9/2011).Orofacial inflammation was induced by unilateral s.c. injection of 50 \u03bcl complete Freund's adjuvant  into the whisker pad of male rats, while under ketamine (72 mg/kg) and xylazine (8 mg/kg) anaesthesia. In the second series of experiments, a control group received the same volume of saline injection.n = 8). Animals were anaesthetized with thiopental (100 mg/kg i.p.) and sacrificed by exsanguination. TRGs were excised and snap-frozen in liquid nitrogen. Contralateral sides of CFA-injected rats served as controls. Total RNA were isolated from snap-frozen samples using RNeasy Mini Kit  and high-quality samples (RIN > 8.0) were used for subsequent expression analyses. Sample labelling, array hybridization and primary data analysis was performed by ArrayStar Inc. . Briefly, total RNA samples were amplified and labelled with Cy3-dCTP. Labeled amplicons were purified, fragmented and hybridized to rat LncRNA Array v1.0  slides. One-color microarray-based gene expression analysis was used. After hybridization slides were washed, fixed and scanned. Gene expression data files were deposited to NCBI's Gene Expression Omnibus /saline (n = 3) injection. Animals were lightly restrained using a soft cotton glove in order to allow an easier habituation, then a set of calibrated nylon monofilaments  was used with increasing strengths (0.8\u201312 g) to measure facial mechanosensitivity. Filaments were applied in ascending order, starting from the 5.2 g filament during control measurements and the 0.8 g filament after CFA treatment. The mechanonociceptive threshold was defined as the lowest force evoking at least two withdrawal responses (face stroking with the forepaw or head shaking) out of five stimulations.In a second experiment, mechanical pain thresholds of the orofacial region were determined with a series of von Frey filaments. Tests were performed on days 0 (control day) before and 1, 3, 7 after CFA (n = 3) were anaesthetized with thiopental and blood was collected by cardiac puncture. Tissue samples  were quickly frozen in liquid nitrogen and stored at \u221280\u00b0C until RNA extraction and real-time PCR processing.At each time point  animals  manufacturer's instructions. Fresh anticoagulant-treated blood and an equal volume of balanced salt solution  were transferred to 15 ml sterile centrifuge tubes. The mixture was carefully overlaid on 5 ml Ficoll-PaquePREMIUM and centrifuged 40 min at 2,100 RPM, 20\u00b0C. The mononuclear layer was transferred into a new 15 ml centrifuge tube, suspended with approximately 6 ml of salt solution and centrifuged 15 min at 2300 RPM, 20\u00b0C. The supernatant was removed and the pellet was resuspended in another 6 ml of salt solution, followed by another centrifugation . After the removal of the supernatant the cells were resuspended with 1 ml of TRI Reagent  and transferred to Eppendorf and stored at \u221280\u00b0C until use.Gapdh), hypoxanthine phosphoribosyltransferase 1 (Hprt1), beta-2-microglobulin (\u03b22m) and Peptidyl-prolyl cis-trans isomerase (Ppia) were detected in all samples. Ppia and Hprt1 for PBMCs and \u03b22m, Hprt1 for TRG and TNC samples were eventually chosen as internal controls, the geometric mean of their Cq values was calculated. Primers of similar efficiencies were used and 2\u2212\u0394\u0394Cq fold change values were calculated. Sequences of primers used for qRT-PCR are given in Supplementary Table Purification of total RNA was carried out according to the TRI Reagent manufacturer's  protocol up to the step of acquiring the aqueous phase. Briefly, tissue samples were homogenized in 1 ml of TRI Reagent, and then, 200 \u03bcl of bromo-chloro-propane  was added. RNA was purified from the aqueous phase using the Direct-zol RNA MiniPrep kit  according to the manufacturer's protocol. Briefly, 400 \u03bcl of the aqueous phase was mixed with 400 \u03bcl absolute ethanol, the mixture was loaded onto the column, washed, and the RNA was eluted in 50 \u03bcl of RNase-free water. The quantity and purity of the extracted RNA were assessed on Nanodrop ND-1000 Spectrophotometer V3.5 . 200 ng of PBMCs/TRG and 250 ng of TNC total RNA was reverse transcribed using Maxima First Strand cDNA Synthesis Kit  according to the manufacturer's instructions. qRT-PCR was performed on a Stratagene Mx3000P qPCR System . PCR amplification was performed using SensiFast SYBR Lo-ROX Kit (Cat. No. BIO-94020). Transcripts of the reference genes glyceraldehyde 3-phosphate dehydrogenase  followed by Tukeys' multiple comparison tests on RT-PCR data and in case of mechanical pain threshold detection two-way ANOVA with repeated measures followed by Bonferroni's post-test for time-matching samples were performed using GraphPad Prism software . Probability values p \u2264 0.05 were accepted as significant. Results are presented as the mean \u00b1 standard error of the mean (SEM). Log2 mRNA fold change data measured by qPCR were further analysed by hierarchical cluster analysis (1-Pearson correlation and average linkage method) and then visualised by heat map using the free web tool Morpheus (Morpheus)The raw microarray data were analysed using R and Bioconductor   and the estrogen receptor 1 (Esr1) genes as well as long non-coding RNAs.The microarray data analysis identified 512 differentially expressed (319 up- and 191 downregulated) transcripts between the control  and 7-day CFA  samples from TRG at a statistically significant level (p \u2264 0.05) and with fold change |FC|> 2 (Supplementary Table p \u2264 0.001) between the control  and 7-day CFA  samples from TRG were functionally annotated based on gene ontology (GO), KEGG Pathway and Reactome terms to gain an overview of the affected biological processes and pathways , as the threshold change was lower on day 7 , kisspeptin (Kiss1) and kisspeptin-1 receptor (Kiss1r) (microarray data not shown). The relative fold changes (up-regulated) of Gpr39 and Lkaaear1 for CFA TRG samples were 3.04 and 4.01 respectively, while the relative fold changes (down-regulated) of Kiss1, Kiss1r and Neurod2 were \u22121.74, \u22122.63, and \u22129.2 , Glial fibrillary acidic protein (Gfap) and Calcitonin gene-related peptide (Cgrp) were not listed in microarray data, meaning no significant changes between the two groups of interest, we analysed the variation of these mRNA levels as well. No significant differences were detected on day 7 related to the mentioned genes which further confirmed the consistency and reliability of the microarray data.To validate the microarray results, the transcription levels of five differentially expressed, microarray-identified genes were further determined using quantitative real-time RT-PCR. The following genes were chosen for validation: Table Gpr9, kisspeFosb), glial (Iba1), and astrocyte (Gfap) activation markers compared to saline-treated control group. By day 3, seven genes reached their maximum at a level of 9.18- (Gpr39), 2.97- (Lkaaear1), 9.51- (Kiss1), 14.31- (Kiss1r), 117.82- (Cgrp), 7.40- (Fosb), and 27.80- fold (Gfap). Iba1 reached a 3.6-fold peak at day 1 before declining. mRNA levels of Lkaaear1, Kiss1r, Iba1 gradually decreased at last time point until reaching a non-significant level compared to saline-treated control side . There was no significant difference in mRNA abundance of Kiss1r on different time points  at each time point due to CFA treatment, while Gfap only on day 7  for most genes.Fold change data were plotted on a heat map to summarize changes in mRNA levels measured by qPCR Figure . Genes wTo our knowledge, this is the first comprehensive study which compared gene expression changes in the TRG, TNC and peripheral blood leukocytes in an inflammatory orofacial pain model. Simultaneous measurement of the transcriptional changes of PBMCs had been suggested to reflect alterations in the CNS , among many others as well as long non-coding RNAs (lncRNA) putatively involved in gene regulation.Our microarray study revealed a high number of differentially expressed olfactory, taste and pheromone receptor genes between the ipsi- and contralateral sides 7 days after CFA treatment. A large number of transcripts of chemoreceptors had been detected in murine and human TRGs using next-generation sequencing  and the most downregulated (Neurod2) gene with qPCR. Transcripts of genes with possible roles in nociception, which also have the potential to be future drug targets, were also chosen to be studied, such as two G-protein-coupled receptors (Gpr39 and Kiss1r) and the neuropeptide kisspeptin (Kiss1). Lkaaear1 encodes an LKAAEAR motive containing protein with unclear function. It is highly expressed in the brain and testis and during organ development (NCBI Gene database)Neurod2 is involved in neuronal differentiation and has been implicated in synaptic plasticity  expressed in various cells such as monocyte/macrophages and activated T lymphocytes, is mostly used as a microglia marker (Kelemen and Autieri, Gfap as a blood biomarker. It was first presented in acute stroke diagnosis in adults (Niebr\u00f3j-Dobosz et al., Gfap changes at the periphery is not a specific diagnostic tool and it is too early to draw a final conclusion on its utility at this stage. However, it would be interesting to see in future studies whether it could have a prognostic value to predict the conversion of orofacial pain or headache conditions from episodic to chronic. In our model, Gfap expression remained high even at the end of the experiment which could reflect a persistent neuroinflammation.Besides allodynia, as the main functional parameter, neuronal and glial activation markers were also assessed by comparing their gene expression profiles. Therefore, we determined the widely-used neuronal activation marker In conclusion, the main novelty of the present findings is the description of some up- and downregulated genes at the levels of both primary and secondary sensory neurones of the trigeminovascular system that might play important roles in neuroinflammatory activation mechanisms. Furthermore, we are the first to show transcriptomic alterations in the PBMCs that are similar to the changes detected in the neuronal tissues. These results open new perspectives and initiate further investigations in the research of trigeminal pain disorders.ZH, KB, and \u00c9S: Study concept and design; KB, TA, and \u00c9S: Animal model, behavioural studies and sample collection conducted by; JK, SJ, AG, TR, TA: Microarray/qPCR analysis and interpretation of genetic data; ZH and TR: Funding. All authors contributed to the analysis of the results, drafting of manuscript and approved the final version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "N = 172, 83 men, 89 women) was created by quota sampling an adult Czech population. Morphological variables of the texts showing differences (M-W test) between the non-depressive and depressive groups were incorporated into predictive models. Results: Across all participants, the data best fit predictive models of depressivity using morphological characteristics from the informal text \u201cletter from holidays\u201d (Nagelkerke r2 = 0.526 for men and 0.670 for women). For men, models for the formal texts \u201ccover letter\u201d and \u201ccomplaint\u201d showed moderate fit with the data (r2 = 0.479 and 0.435). The constructed models show weak to substantial recall (0.235 \u2013 0.800) and moderate to substantial precision (0.571 \u2013 0.889). Morphological variables appearing in the final models vary. There are no key morphological characteristics suitable for all models or for all genres. The resulting models\u2019 properties demonstrate that they should be suitable for screening individuals at risk of depression and the most suitable genre is informal text (\u201cletter from holidays\u201d).This study examines the relationship between language use and psychological characteristics of the communicator. The aim of the study was to find models predicting the depressivity of the writer based on the computational linguistic markers of his/her written text. Respondents\u2019 linguistic fingerprints were traced in four texts of different genres. Depressivity was measured using the Depression, Anxiety and Stress Scale (DASS-21). The research sample ( The 10th Revision of International Classification of Diseases ICD-10, which is the basis for diagnosing mental disorders in the Czech Republic, classifies depression as an affective disorder (mood disorder). The disorder can have three forms: mild, moderate and severe forms of depression. One of the first symptoms is a change in mood toward the negative pole: the individual feels sad, needless, and/or unimportant. The disorder significantly affects self-confidence, which is often reflected in social relationships. It is typically accompanied by vegetative symptoms which can manifest as gastrointestinal problems , tremors, sweating, or dry mouth. Sleep is also affected: the individual may have problems falling asleep, waking up, or staying asleep through the night. The effects of depression extend beyond the individual patient, with negative impact on patients\u2019 employers, spouses, and children .According to the World Health Organization, depression is the most common mental disorder. Currently, 300 million people suffer from depression . The preWorldwide, the prevalence of depression in the population is growing, with an increase of 18% between 2005 and 2015 . At the Early detection of an individual at risk of depression in initial stages and in mild form is beneficial both for the individual and society. Our study contributes to screening of individuals at risk of this disease. The study provides the original way of depression screening based on an analysis of how the writer uses the language to enable the automatic detection of writer\u2019s risk of depression.A frequent type of study focusing on the relationship between text variables and mood disorders  is a case-study. Case studies analyze texts written spontaneously by authors  suffering from depression. An important example of this approach is k = 21, N = 3758) of correlations between first person singular pronoun use and individual differences in depression  were conducted by r = 0.13), this effect is not moderated by demographic factors, such as gender and there is little to no evidence of publication bias in this literature.Automatisation of the processing of linguistic data has recently enabled the use of extensive research strategies. For example, Several studies e.g.,  show thaExisting studies do not only show relationships between the way of writing a text and mood disorders , but also a reciprocal healing effect of writing certain types of texts. For example, Studies in clinical psychology clearly show that research on the relationship between the user of a language  and their text is meaningful and has potential for the future. A worldwide and rapidly developing approach is the detection of the personality of authors from their texts, involving the design of predictive models based on correlations between quantifiable text parameters and individual psychological traits . The preThe study presented here focuses on discovery of the relationship between linguistic characteristics of a written text and the level of the emotional state of depression (depressivity) of its author. The focus is on non-content (non-semantic) computational linguistic markers of a written text. The main objective of the study is to find out which texts (and whether or not) can predict depression and what linguistic characteristics are involved in the eventual model. The key step is to create and evaluate predictive models to detect individuals at risk of depression from written texts. Into the models it is necessary to insert only a limited number of variables , therefoGender differences: Due to the fact that there are gender differences in depression  as well Genre differences: Quantitative linguistic markers of a text are affected by the genre . Thus, tNecessity and innovativeness of conducting the present study in Czech: Most research on the relationship between the linguistic properties of a text and its author\u2019s personal traits have been conducted with texts in English . There is also research on texts in Chinese, Arabic, Spanish, Dutch, French, German, Italian, Russian, Turkish, and Serbian e.g., . Accordidid not apply to me at all; 3 = applied to me very much or most of the time). Thus, a respondent can get 0 to 21 points for each subscale. The DASS-21 is based on a dimensional rather than a categorical conception of psychological disorders. The assumption on which the scale was developed (and which was confirmed by the research data) is that the differences between depression, anxiety and stress experienced by normal subjects and clinical populations are essentially differences of degree : \u201cYou have found a job offer that captivated your interest and you aspire to be hired for this position. Therefore, you are going to write a letter to the company\u2019s director as a response to his/her offer trying to persuade the director that you are the right candidate for this position.\u201dLetter from holidays : \u201cYou are enjoying your time on an amazing vacation. Everything is going well, as expected, and you fully indulge in your popular activities. Therefore, you have decided to write a letter to your friend and convince him/her to come over and enjoy this perfect time with you.\u201dComplaint : \u201cUntil recently, you were satisfied with living in your apartment (or your house), not missing anything. Nevertheless, recent issues have made a hell out of a pleasant living. Although you originally strived to sort out the issues in a polite way, it did not help. Therefore, you decided to write an official complaint to the appropriate authorities.\u201dLetter of apology : \u201cYou have done something that substantially harmed your relationship with a person you were very close to for a long time. You had promised something that you did not fulfill. You feel sorry and you know that you made a mistake. Because you do not want to lose your close friend, you have decided to write a letter of apology to him/her.\u201dThe analyses were conducted on 688 texts that create a corpus of 99,481 words. In all texts, quantitative linguistic variables on various levels of classification  were automatically detected in the process of lemmatization with morphological tagging .Quantitative linguistic variables are included in the analyses in the form of relativized isolated features (ratios) and compound indicators  as described in the following lists.Ratios (input = 16 items):\u2013words per sentence: the number of words divided by the number of sentences,\u2013lemmas per sqrt words: the number of different lemmas (basic forms) divided by the square root of the number of words,\u2013sentence complexity: the number of finite verbs divided by the number of sentences,\u2013punctuations per sentence: the number of punctuation marks divided by the number of sentences,\u2013exclamation per sentence: the number of exclamation marks divided by the number of sentences,\u2013AN per ANNA: the number of adjective-noun pairs divided by the number of all pairs (adjective-noun plus noun-adjective),\u2013colloquial words per sentence: the number of colloquial words divided by the number of sentences,\u2013singularity index: the number of words in singular divided by the number of all words which have the grammatical category of interest ,\u2013singularity P index: the number of possessive singular words divided by the number of all possessive words,\u2013vocative index: the ratio of words in vocative to the sum of all other words that have the grammatical category of interest,\u2013negativity index: the ratio of negative sentences to negative plus affirmative sentences,\u2013passive index: the number of words in passive divided by the number of words in passive and active,\u2013imperfectum index: the ratio of perfectum to perfectum plus imperfectum,\u2013dem per words: the number of diminutive words divided by the number of all words,\u2013vul per words: the number of vulgarisms divided by the number of all words,\u2013clq per words: the number of colloquial words divided by the number of all words.Special metrics (input = 8 items):\u2013\u2217 sentence) /(3 entence) ,\u2013pronominalisation index: the ratio of the total number of pronouns to the total number of nouns ,\u2013formality metric: is calculated using the formula F = (noun + adjective + preposition + article - pronoun - verb \u2013 adverb - interjection + 100)/2 ,\u2013trager index: number of verbs/number of adjectives ,\u2013readiness to action: number of verbs/number of nouns ,\u2013aggressiveness index: number of verbs/number of all words ,\u2013activity index: number of verbs / (number of verb + adjective + adverbs),\u2013autosemantic index: number of autosemantic words  in relation to number of words .Participants were recruited using leaflets and advertisements on social networks. The participants were couples of people older than 15 who enrolled in the study voluntarily. After the study, they were awarded about 50 USD. Data collection was conducted in the controlled environment of a university on weekends from September 2016 to April 2017.A battery of self-report psychological tests was administered with 4 fictive letters placed randomly between test blocks. The conditions of administration were always identical  and relatively naturalistic to make the participants feel comfortable . The maximum level of structure and identity of situation were strictly obeyed to eliminate the impact of structure of the situation on the correlation between linguistic markers of a text and its writer\u2019s personality  and number of sentences (<5) were discarded. Reduction of variables, step one: low variability variables exclusion. Descriptive statistics for the studied QL variables were calculated and variables showing low level of variability were discarded from further calculations (if at least one of the following conditions were fulfilled: mdn = 0 or coefficient of variation sd/m < 0.05 or iqr/mdn < 0.05). Assessment of normality: A Kolmogorov\u2013Smirnov (K\u2013S) test was conducted. Lowering granularity of depressive scale: The depression subscale of the DASS-21 (min\u2013max = 0\u201321) was transformed to DASS21_01 , see The analysis was conducted in seven steps. Reduction of variables, step two: exclusion variables with non-significant intergroup differences (depressive vs. non-depressive). This comparison was done using the Mann\u2013Whitney test. It was conducted the 8 tests for four genres and two genders. Variables that didn\u2019t show significant differences in any of the 8 tests were excluded. Creation of models. Eight models were created using logistic regression (for four genres and two genders). Predictive models included only variables showing significant differences between the depressive and non-depressive group in the M\u2013W test (see step 5).Evaluation of models: The criterion of the quality of each regression model was defined by the Nagelkerke coefficient r2> 0.4. To assess the predictive power of a model, the following coefficients were calculated: precision  and recall . These coefficients are suitable for an unbalanced  sample  sample . The pre) sample . The varIn each type of text, 1\u20134 outliers were detected see , a totalThe stated conditions for variability were fulfilled by 13 quantitative linguistic variables out of the 24 followed ones. These 13 were included in further calculations.As expected, the studied variables were not normally distributed . Due to the non-normal distribution of data, only non-parametric/non-linear procedures were used in further calculations.m = 5.14, mdnm = 5, minm = 0, maxm = 17), women . Based on their results on the depression subscale, respondents were divided binarily into non-depressive and depressive groups .The depressive and non-depressive groups were compared using a Mann\u2013Whitney U test . The test was conducted separately for men and women as well as for each type of text. There was a significant difference in mean rank between the depressive and non-depressive groups for each of the selected linguistic variables (except for the coherence index) in at least one text. The only exception is the coherence index, which according to the result of M\u2013W test does not differentiate between depressive and non-depressive groups in any of the texts, and thus will be excluded from further calculations. Contrary to our expectations, a higher number of significant differences were found among men compared to women, and more often in formal texts (TXT1 and TXT3).Eight regression models were created (for four texts among men and four texts among women). The quality of individual models is described in The only model that fulfilled all the defined criteria is the model created on TXT2  among women. The stated criteria are approximated by three models for men, namely models based on TXT1 (cover letter), 2 (letter from holiday) and 3 (letter of complaint).The present study focuses on the relationships between linguistic properties of a written text and the level of its writer\u2019s currently experienced depressivity . The chosen methodology is novel: (a) the source for analyses were texts written on an assigned topic under strictly controlled experimental conditions , (b) only formal, quantitative linguistic syntactical and morphological variables were subject to analyses , (c) the research sample was representative of an adult population with respect to age and education (quota selection). We have not come across a study conducted using the same methodological basis. Methodologically similar studies are very scarce  of non-depressive and depressive people, except one. The exception is index of coherence. Contrary to our expectations, the present study does not validate the index of coherence  as a suiThirteen linguistic variables  were included into the predictive models. Eight predictive models (for 4 different texts and 2 genders) were created and compared with each other. The results show that acceptable level of accuracy show models predicting depression in men sample from texts TXT1 (cover letter), TXT2 (letter from holidays) and TXT3 (complaint), and in women sample from TXT2 (letter from holidays). Across these 4 models, the probability that an individual will be detected as depressive when he/she is not (type II error) is lower than 0.2. The models for men sample show lower quality in criterion recall  than models for women sample. In other words, models built on texts written by men are more likely to fail to detect an individual with depression (type I error) than to erroneously classify an individual as depressive (type II error). Based on these results, it seems justified to state that, pursuant to the morpho-syntactic characteristics of the text, it is more confident to identify depressive women than depressive men.For explanation, we need to look at gender differences in general and in our study as well. Most current studies show that women experience more depression than men do e.g.,  or the lThe literature has repeatedly described that men and women generally differ in the preference of using some linguistic morpho-syntactic elements in their texts e.g., . LitvinoIn our study, for women the model predicted depression from TXT2  was of apparently higher quality then models predicting from other texts, while predictive models for men were of comparable quality  across all the different texts. This result could be related to findings in other research. In this context Nor does this knowledge help explain differences found; it provides clear that models predicting the depression differ depending on gender, and that in the future it is necessary to take into account the moderative/mediatory influence of the writer/speaker\u2019s gender in modeling relationships between depression  and text.Overall, our results indicate that TXT4 (letter of apology) is not a suitable text for creation of a reliable and accurate model predicting depression. On the contrary, TXT2 (letter from holidays) seems to be suitable for creating a good fit predictive model for both men and women.The present study was conducted on a quota-selected sample of Czech native speakers. Generalization of the findings to Slavonic languages requires further research and generalization to non-Slavonic languages is not recommended. An unexpected limit of this study is the higher percentage of depressive men in the research sample. Due to the relatively small size of the research sample, we did not further verify the results .The leading motivation for our research is to find ways to use automatic analysis of texts  to create predictive models that will reliably detect individuals at risk of a mental disorder (such as depression in the present study) so that they can be provided with help as early as possible. In the present study, we calculated four regression models to predict a higher emotional state of depression. The quality of our models indicates that depression can be predicted from informal text written about a holiday and that the quantitative linguistic characteristics that are most strongly suited to the proposed models for men are the pronominalisation index (the ratio of pronouns to nouns) and readiness to action index (the ratio of verbs to nouns) and for women are sentence complexity (the ratio of finite verbs to number of sentences) and punctuation (the ratio of number of punctuation to number of sentences). We plan to extend our future research to a clinical population to analyze the texts of people with a diagnosed mental disorder, especially with depression or phobias. Given our results and the results of other research e.g.,  we plan The datasets generated and analyzed in this study are available on request from the authors of the article. If interested, please contact the corresponding author.The project was approved by the Ethics committee of the University of South Bohemia  that confirmed the project was carried out in accordance with the recommendations of the Ethical code of the University of South Bohemia in \u010cesk\u00e9 Bud\u00e9jovice. All subjects gave written informed consent in accordance with the Declaration of Helsinki.DK brought the original idea and was the main solver of the grant project. JMH and JH formulated the goals of the study and all authors studied and discussed the relationship between the text and its writer. DK arranged a complete collection of quota sample data. JMH arranged a complete collection of clinical sample data. DK, JH, and JMH designed the online collection, pre-processing, and retention of the data. JMH and PH wrote the introduction. JH designed the data processing procedure, performed all the mathematical and statistical calculations, and described the results. JMH thought out and wrote the discussion and all authors improved the content and formulations of the manuscript. JMH formatted the text and DK ensured professional proofreading and uploading of the manuscript for the review process.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Herein, we found that salidroside suppressed hypoxia\u2010inducible factor 1 alpha (HIF\u20101\u03b1) and lysyl oxidase\u2010like protein 2 (LOXL2) within human pancreatic cancer BxPC\u20103 cells cultured both under normoxia and hypoxia condition. To investigate the effect of salidroside on tumorigenesis of BxPC\u20103 cells and whether HIF\u20101\u03b1 and LXCL2 were involved in this process, cells transfected with or without LOXL2 overexpression vector, were treated with 50\u2009\u03bcg/mL of salidroside or 50\u2009\u03bcM of KC7F2 (a HIF\u20101\u03b1 inhibitor) under hypoxia. Cell viability and invasion were assessed using CCK\u20108 and Transwell chamber assay, respectively. Expression of E\u2010cadherin and matrix metalloproteinase 2/9 (MMP 2/9) was determined, by Western blot analysis, to assess cell mobility at molecular levels. We confirmed that hypoxia increased LOXL2 and induced tumorigenesis of BxPC\u20103 cells, as evidenced by promoted cell proliferation and invasion, enhanced MMP2/9 while reduced E\u2010cadherin. Interestingly, hypoxia\u2010induced carcinogenesis was significantly retarded by both salidroside and KC7F2, however, enhanced with LOXL2 overexpression. Besides, salidroside and KC7F2 reduced LOXL2, and reversed the tumorigenesis of BxPC\u20103 cells induced by LOXL2 overexpression. Given the inhibitory effect of salidroside on HIF\u20101\u03b1 expression, our data suggested that: (1) LOXL2 was the mechanism, whereby salidroside and KC7F2 showed inhibitory effect on cancer progression of BxPC\u20103 cells; (2) salidroside exerted its anticancer effect, most likely, by a HIF\u20101\u03b1/LOXL2 pathway. In conclusion, salidroside was a novel therapeutic drug in pancreatic cancer, and downregulation of HIF\u20101\u03b1 and LXCL2 was the underlying mechanism. HIF\u20101\u03b1 is a master regulator of oncogenes or several key mechanisms that are closely related to PC carcinogenesis.Rhodiola rosea L, possesses antioxidant and antihypoxic properties.Phytochemicals can be used in adjuvant therapies in conventional anticancer treatment.In our present study, BxPC\u20103 cells, one of human PC cell lines, were stimulated with hypoxia. Cell proliferation and invasion were measured to assess tumorigenesis of BxPC\u20103 cells. KC7F2 was used for intervening HIF\u20101\u03b1 effects according to reported studies.22.12 at 37\u00b0C for 2 days followed by serum\u2010starveling 1 day prior the further experiments. For cell invasion assay, cells grew in Dulbecco's modified Eagle's medium (DMEM) without FBS. In hypoxia studies, the choice of experimental conditions was supported in a reported study.BxPc\u20103 cells  grew in a medium containing 89% of Roswell Park Memorial Institute (RPMI)\u20101640 (Hyclone), 10% of fetal bovine serum (FBS), and 1% mixing liquid of penicillin /streptomycin . In log\u2010phase growth, BxPc\u20103 Cells were exposed to hypoxia (0.5% oxygen) and normoxia (21% oxygen), and maintained in 5% CO2.2Total RNA from BxPc\u20103 cells was extracted via trizol regent , and reverse\u2010transcribed using RevertAid First Stand complementary DNA (cDNA) Synthesis kit . Messenger RNA (mRNA) levels of LOX, LOXL1, LOXL2, LOXL3, LOXL4, HIF\u20101\u03b1, E\u2010cadherin, MMP2, and MMP9 were quantified using a SYBR Green PCR Mix  on ABI Prism 7300 SDS system . Related primer sequences were listed in Table 2.3Protein level in lysis supernatant of BxPc\u20103 cells was determined by bicinchoninic acid (BCA) protein assay kit (Thermo), and 25\u2009\u03bcg of which was separated on 10% to 15% of sodium dodecyl sulfate\u2010polyacrylamide gel electrophoresis (SDS\u2010PAGE). Electrophoretic pure of HIF\u20101\u03b1, LOXL2, E\u2010cadherin, MMP2, and MMP9 were transferred onto nitrocellulose (NC) membranes (Millipore), and incubated with antibody against HIF\u20101\u03b1 , anti\u2010LOXL2 antibody , antibody against E\u2010cadherin , antibody against MMP2 , antibody against MMP9 , anti\u2010\u03b2\u2010actin antibody , and anti\u2010GAPDH antibody  at 4\u00b0C overnight followed by horseradish peroxidase\u2010conjugated antibodies  for another 1\u2009hour at 25\u00b0C. Immunoreactive bands were qualified by enhanced chemiluminescence (ECL) system . We chose \u03b2\u2010actin as a \u201cloading\u201d control (instead of GAPDH) in hypoxic studies, accordingly to a reported study.2.4Protein activity of HIF\u20101\u03b1 was measured using a commercially available HIF\u20101\u03b1 transcriptional factor assay kit  according to the manufacturer's instructions.2.53/100\u2009\u03bcL/well) in a 96\u2010well culture plate were cultured overnight. After treatment at 0, 24, 48, 72\u2009hours, 10\u2009\u03bcL of CCK\u20108 working solution was added to each well. Optical density (OD) values were recorded by a microplate reader (Bio\u2010Rad) at 450\u2009nm.Before cell viability assay using the Counting Kit\u20108 (CCK\u20108) method, BxPc\u20103 cells (3.0\u2009\u00d7\u2009102.64) in 0.2\u2009mL of serum\u2010free RPMI\u20101640 were added to the upper chamber. After 48\u2009hours. Cells passing through the membrane were fixed with 4% of formaldehyde, dyed using crystal violet (0.05%), and counted using a light microscope (x100 magnification) in eight randomly selected fields.The ability of BxPc\u20103 cells to invade Matrigel  was determined using Transwell chambers . Briefly, 0.7\u2009mL of RPMI\u20101640 with 10% FBS was added to the lower chamber, whereas, BxPc\u20103 cells (5.0\u2009\u00d7\u2009102.7DNA fragment encoding LOXL2 mRNA (AF117949.1) was amplified from human cDNA with the primers 5\u2032\u2010CGGAATTCATGGAGGGCTACGTGGAGG\u20103\u2032 (forward) and 5\u2032\u2010CGGGATCCTCAGGTAGCAGCCCCCCATG\u20103\u2032 (reverse), which was inserted into pLVX\u2010Puro (Clontech). The pLVX\u2010puro without LOXL2 expression was used as control vector. pLVX\u2010Puro\u2010LOXL2 (1000\u2009ng), psPAX2 (100\u2009ng), and pMD2G (900\u2009ng) were cotransfected into 293T cells (ATCC) using Lipofectamine 2000 at 1:2 according to supplier's protocol (Invitrogen). About 1.5\u2009\u03bcg of high\u2010titer recombinant lentiviruses with LOXL2 expression was transfected into BxPc\u20103 cells using Lipofectamine 2000 reagent. After 48\u2009hours transfection, transfected efficiency was assessed using RT\u2010PCR and Western blot analyses.2.86 cells, 100\u2009\u03bcL) and randomly divided into three groups: control group, salidroside (25\u2009mg/kg) group, and salidroside (50\u2009mg/kg) group. After tumors formation (approximately 1\u20102 weeks later), tumor volume (mm3) was calculated every 3 days from 12th day to 39th day. When the tumor volume reaching 100\u2009mm\u00b3\u2009, mice in the control group was normal fed without any treatment, mice in two salidroside groups were intragastrically administrated with salidroside  Co., Ltd, Shanghai, China) at a dose of 25\u2009mg/kg and 50\u2009mg/kg, respectively. Three weeks later, all the mice were killed. Tumor weight were calculated and metastasis in lung was assessed using hemotoxylin and eosin (H&E) staining according to a reported study.Eighteen nude mice  were subcutaneously injected with BxPc\u20103 cells  technology. Briefly, deparaffinized and hydrated tissue section (4\u20107\u2009\u03bcm) on slides was incubated with TUNEL working solution (Roche) at 37\u00b0C for 1\u2009hour, then rinsed with phosphate\u2010buffered saline (PBS) (3\u2009minutes\u2009\u00d7\u20093). Cell nucleus were double stained using DBA substrate kit  followed by hematoxylin . IMS image system  was used for visualization and analysis.2.10t test was used to compare between two groups, and one\u2010way analysis of variance (ANOVA) with post hoc Tukey's test was used to compare between two or more groups. P\u2009<\u20090.05 was statistically significant.Each experiment was repeated at least three times, and data were expressed as mean\u2009\u00b1\u2009standard error of the mean. Two\u2010tailed unpaired 33.1LOX family genes  was measured by the RT\u2010PCR. As shown in Figure LOX family genes with maximum effect being obtained on LOXL2 when compared with the BxPC\u20103 normal control group .BxPC\u20103 cells were treated with 0, 20, 50\u2009\u03bcg/mL of salidroside, after 24\u2009hours, mRNA expression of 3.2P\u2009<\u2009.01). In this study, we chose 50\u2009\u03bcg/mL as an ideal concentration for salidroside to treat BxPC\u20103 cells. After treatment, protein levels of HIF\u20101\u03b1 and LOXL2 were determined at 0, 6, 12, 24, and 48\u2009hours. Figure BxPC\u20103 cells were treated with 0, 10, 20, 50, and 100\u2009\u03bcg/mL of salidroside, after 24\u2009hours, protein expression of HIF\u20101\u03b1 and LOXL2 were measured by Western blot analysis. Figure We further studied the roles of salidroside in regulating HIF\u20101\u03b1 and LOXL2 in BxPC\u20103 cells under hypoxia condition. Our data suggested that in comparison with normoxia, hypoxia time\u2010dependently enhanced the expression of HIF\u20101\u03b1 and LOXL2 and transcriptional activity of HIF\u20101\u03b1. However, hypoxia\u2010induced the promotion of HIF\u20101\u03b1 and LOXL2 was significantly reversed and restored by salidroside to almost normal level at 6, 12, and 24\u2009hours, respectively . Figure 3.4LOXL2, E\u2010cadherin, and MMP2/9 are involved in cancer cell invasion and metastasis. BxPC\u20103 cells transfected with LOXL2/control vector were treated with salidroside or KC7F2 under hypoxia, and then protein levels of E\u2010cadherin, MMP2, and MMP9 were assessed, using Western blot analysis. Figure 3.5B), increased cell apoptosis , suggesting the antigrowth and antimetastatic effect of salidroside in vivo.Evidence suggests that lung is one of the main sites for \u201cmetastases\u201d manifestation when human BxPC\u20103 cells are injected into nude mice.s Figure C, reduces Figure D, and sis Figure E and 5F,4).LOXL2, a tumor promoter in PC progression, is a biomarker and therapeutic target in PC.Hypoxia is a dominant regulator of HIF\u20101\u03b1 and LOXL2  in the progression of various cancers., and enhanced mobility property of BxPC\u20103 cells through repressing E\u2010cadherin , while enhancing MMP2 and MMP9 expression  probably through induction of LOXL2.Taken together these results, salidroside suppressed BxPC\u20103 cell proliferation and invasion by downregulating MMP2 and MMP9 while upregulating E\u2010cadherin. Salidroside may be a therapeutic agent targeting HIF\u20101\u03b1 and LOXL2 in PC chemoprevention.It has no conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication.The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request."}
+{"text": "This paper investigated the effect of blast furnace slags (BFS) characteristics on the properties achievement after being alkali activated. The physical and chemical characteristics of BFS were determined by X-ray fluorescence (XRF), X-ray Diffraction (XRD) and laser granulometry. Multi-technical characterizations using calorimetry, XRD, Fourier Transform Infrared Spectroscopy (FTIR), Thermogravimetry (TG-DTG), scanning electron microscope (SEM), nitrogen sorption and uniaxial compressive strength (UCS) were applied to give an in-depth understanding of the relationship between the reaction products, microstructure and BFS characteristics. The test results show that the microstructure and mechanical properties of alkali activated blast furnace slags (BFS) highly depend on the characteristics of BFS. Although the higher content of basic oxide could accelerate the hydration process and result in higher mechanical properties, a poor thermal stabilization was observed. On the other hand, with a higher content of Fe, the hydration process in alkali activated BFS2 lasts for a longer time, contributing to a delayed compressive strength achievement. Meanwhile, an excessive CaO content has been reported to be detrimental to the properties of AAM. The content of MgO also shows a similar advantage to the properties of AAM, and Chen Y et al. ) after being alkali-activated. The EDX analysis The characteristics of the BFS can significantly affect the properties of AAS.(2)2O3 and MgO, BFS1 enjoys a higher basicity index and hydration modulus, which accelerates the hydration process, accompanying a higher early compressive strength and compact microstructure. However, the thermal stabilization of AAS1 is poor, resulting from the hydration gel composition, which is mainly C\u2013(A)\u2013S\u2013H oriented.Due to the higher content of reactive oxide components, such as CaO, Al(3)The higher thermal stabilization and delayed strength development of AAS2 occurred mainly due to the higher content of Fe in BFS1, which either acts as a filler, integrates with the hydration gel or is incorporated into the tetrahedral network to form another gel type during the alkali-activated process.This study investigated the effect of blast furnace slags (BFS) characteristics on property achievements after being alkali-activated. Two types of BFS with different physical and chemical characteristics, activated with 6 M NaOH solution were used for the experiments, and XRD, FTIR, TG-DTG, SEM, nitrogen sorption and UCS were applied to study the relationship between the reaction products, microstructure and BFS characteristics. The main conclusions from this work are as follows."}
+{"text": "Edge-to-edge repair for mitral valve regurgitation is being increasingly performed in high-surgical risk patients using minimally invasive mitral clipping devices. Known procedural complications include chordal rupture and mitral leaflet perforation. Hence, it is important to quantitatively evaluate the effect of edge-to-edge repair on chordal integrity. in this study, we employ a computational mitral valve model to simulate functional mitral regurgitation (FMR) by creating papillary muscle displacement. Edge-to-edge repair is then modeled by simulated coaptation of the mid portion of the mitral leaflets. in the setting of simulated FMR, edge-to-edge repair was shown to sustain low regurgitant orifice area, until a two fold increase in the inter-papillary muscle distance as compared to the normal mitral valve. Strain in the chordae was evaluated near the papillary muscles and the leaflets. Following edge-to-edge repair, strain near the papillary muscles did not significantly change relative to the unrepaired valve, while strain near the leaflets increased significantly relative to the unrepaired valve. These data demonstrate the potential for computational simulations to aid in the pre-procedural evaluation of possible complications such as chordal rupture and leaflet perforation following percutaneous edge-to-edge repair. Mitral valve regurgitation (MR) is a highly prevalent disorder which is associated with significant morbidity and mortality if left untreated. However, 49% of patients are turned down for conventional treatment of MR with surgical mitral valve (MV) repair or replacement due to high surgical risk . MinimalThe left atrium receives oxygen-rich blood from the lungs and pumps it to the left ventricle through MV. The MV is therefore responsible for maintaining forward flow of blood from the lungs to the rest of the body. The mitral apparatus is composed of the left atrial wall, the annulus, the leaflets, the chordae tendineae, the papillary muscles, and the left ventricular myocardial wall. The MV alone is a complex structure which is composed of (1) the anterior and posterior mitral leaflets, 2) a sub-valvular apparatus consisting of chordae tendineae and papillary muscles (PMs). The anterior leaflet is comprised of one contiguous scallop and the posterior leaflet is comprised of the smaller P1, P2, and P3 scallops . MV clos a sub-vaThere are two primary etiologies for MR: degenerative MR (DMR) and ischemic MR  . DMR occEdge-to-edge (E-to-E) repair is a surgical MV repair technique first introduced in the 1990s in which the anterior and posterior MV leaflets are sutured together at the precise location of the regurgitant jet to improve leaflet coaptation, thus creating a double orifice MV and reducing the degree of MR . The inhMitraClip  is currently the only FDA-approved catheter-based MV repair system for the treatment of DMR, and has been performed in over 40,000 patients worldwide . The devDespite the growing clinical experience, there are still some key challenges associated with transcatheter E-to-E repair. in particular, placement of a mitral clip device may increase the risk for rupturing the mitral leaflets or chordal apparatus. This risk is elevated in the presence of mitral leaflet tethering . The intTo understand the mechanics governing MV function, finite element analysis was introduced decades ago for normal , diseaseTo increase computational efficiency, most current models of the MV use simplified element types to represent chordae tendineae and leaflet geometry. Models commonly take advantage of the chordal cable-type structure to justify the use of rod elements and the thinness of the leaflets to justify the use of shell elements ,34,35,36We have recently developed and validated an ex vivo MV imaging methodology and associated computational platform, wherein the subject-specific MV geometry can be modeled with an unprecedented level of leaflet and chordal detail. For the first time, secondary and tertiary chordae are incorporated into FSI simulations of MV closure using a detailed finite element model ,37,38,39While computational modeling of transcatheter E-to-E repair has been performed on simplified, symmetric valve representations where the chordae are either modeled as spring elements or excluded altogether ,42,43, EA computational model by Votta et al. also simulated annular dilation with E-to-E repair and noted an increase in axial stress in the chordae near the E-to-E repair . Our stuA novel technique for treating MV specimens in preparation for micro computed tomography , while large deformation in the solid mitral valve was simultaneously solved with the IMPETUS Afea Solver\u00ae. Both the solvers use a commodity GPU for parallel processing. All solid elements were fully integrated removing the possibility of hourglass modes and element inversion that plagues the classic under-integrated elements. Standard numerical methods for solving FSI problems with high number of degrees of freedom are more challenging to parallelize [Fluid motion and boundary interaction was solved with the IMPETUS Afea SPH Solverallelize .Both fluid and solid domains and their interaction were solved with an explicit integration scheme. All simulations were solved on a standard workstation. Parallel acceleration was achieved with a Tesla K40 GPU with 12 GB of Graphic DDR memory and 2880 CUDA Cores. To confirm that convergence was reached, h-refinement of the finite element mesh was performed and the solution was found to yield same results.The fluid particles were confined in a pipe-like rigid structure surrounding the model, and two pistons moved within the pipe at a prescribed velocity . The nodThe constitutive model for the material properties utilized a three-dimensional splay invariant, based on an approximation of a three-dimensional Gaussian distribution of fibers . The matThe results of the FSI simulations using the above described model and its material properties have been validated against experimental data in two ways. Firstly, the direction and magnitudes of PM forces were compared with experimental measurements  and, secT images .\u00ae has been used to simulate the functional MV regurgitation by incrementally displacing the PMs. To simulate the E-to-E repair, again the IMPETUS Afea Solver\u00ae was used to pull the leaflets together using spring elements. Subsequently, an FSI analysis using the IMPETUS Afea SPH Solver\u00ae was performed for each increment with differing distance between the PMs with and without E-to-E repair.Following reconstruction of a healthy mitral valve, the IMPETUS Afea SolverTo define the change in ROA, healthy MV closure was first simulated. Nodes along the mitral leaflet coaptation line were selected forming a coaptation line boundary. The ROA was estimated by calculating the total (3D) area bounded by these same nodes in subsequent simulations.As observed in the results, the highest strain values on the chordae tendineae were found close to the PMs and leaflets. For comparison, after each FSI simulation the strain values were recorded on each chorda close to both the leaflets and PMs. The values near the leaflets were then averaged to compare the resulting value with the average one near the PMs. All measurements were performed for valves with and without E-to-E repair with varying distance between PMs (resulting in varying ROA). It can be seen that the difference in ROA becomes significant when the distance between the PMs is twice the distance in the healthy valve model without PM dilation.The effect of E-to-E repair on the regurgitant orifice area (ROA) that resulted from dilated PMs can be seen in The axial strain in the points evaluated close to the PMs showed little variation between the percutaneous E-to-E repaired and unrepaired model, see In this study, we employed a form of computational modeling known as FSI analysis to model the subject-specific device-tissue interaction following transcatheter E-to-E repair. Our study focused on evaluating the efficacy of E-to-E repair in subject-specific models of FMR. We simulated varying levels of PM displacement, and measured the resultant ROA following E-to-E repair. We utilized a unique computational model that maintained the subject-specific 3D chordal structures, retained mesh element integrity, and used FSI analysis to simulate the MV closure. Hence, we have demonstrated that computational modeling can identify potential areas of failure in E-to-E repair based on the underlying MV pathology.Our simulations of FMR appropriately increased the ROA, suggesting that the alterations to our model successfully simulated functional MV pathology. When E-to-E repair was applied, the ROA values reduced significantly compared to the values measured on the unrepaired model. As the inter-papillary muscle distance increased, the ROA increased regardless of whether the E-to-E repair technique was applied. However, this increase in ROA was of significantly smaller magnitude as compared to the unrepaired FMR model. The E-to-E repair is commonly performed with an undersized annuloplasty which stabilizes the repair and reduces stress on the E-to-E suture. Without annuloplasty, the freedom from re-operation or recurrent MR is lower and has been reported to reduce from 95% to 79% [The strain values of select chordae near the leaflets and papillary muscles were evaluated as the distance between the PMs was increased. The strain in the chordae near the leaflets was observed to nearly double when the E-to-E repair was applied. However, the strain in the chordae near the papillary muscles remained consistent. Without E-to-E repair, the strain values decreased as PM distance increased. This is an expected finding, since a larger ROA corresponds to more regurgitant flow and therefore decreased forces imparted on the MV leaflets and chordae by the fluid.We also found that the areas near the leaflets can have a higher potential of chordal rupture due to cross-sectional area differences and/or leaflet proximity. Additionally, when the fold change in PM distance was larger than reported, a chordae also ruptured in the model. Therefore, this computational study corroborates the clinical findings that clipping the mitral leaflets in patients with severe PM displacement and leaflet tethering can lead to chordal rupture. in particular, the additional strain placed on the upper chordae by the E-to-E repair can significantly impact future MV integrity.By all means, limitations of the methods and models used need to be listed. The model is based on a single patient-specific geometry. Hence, this is a single case study. More models need to be processed for statistically significant results. The MV used to create the model was excised from a healthy porcine heart. Therefore, while the geometry is patient-specific, the material properties are based on previously published measurements of a healthy porcine MV. For that reason, MV material properties used here are assumed to be well representative as well. In one of our studies, we showed that even when two different species are used, the results obtained are comparable . Current\u03bcCT . Next, rPercutaneous E-to-E repair with mitral clipping devices is often the only option for high risk patients with severe, symptomatic MR. The E-to-E repair technique is currently being used effectively to treat both FMR and DMR patient populations. in this study, we simulated the FMR etiology by creating PM displacement in a subject-specific MV model. However, the mitral annular size remained unchanged in our FMR model. it is expected that with left ventricular dilation in the setting of FMR, the mitral annulus would increase in size as well. However, this annular dilation would yield even larger chordal strain values after E-to-E repair than what were observed in this study. Regardless, future investigations can assess the impact of annular dilation on chordal and leaflet rupture following E-to-E repair.Despite the limited risks of leaflet and chordal rupture, percutaneous E-to-E repair remains a very effective method to reduce MR in high risk patients with no alternative surgical options. Recently, computational modeling of the MV has been advancing towards patient specific simulations. Altering our existing model with patient specific MV parameters is the next step towards personalizing these simulations. Herein, we have demonstrated that modifications to a normal MV model can successfully produce FMR in silico. We have also shown that modeling E-to-E repair can effectively reduce the simulated MR. in total, these data demonstrate the potential for computational simulations to aid in the pre-procedural evaluation of possible complications such as chordal rupture and leaflet perforation following percutaneous E-to-E repair."}
+{"text": "Polistes biglumis and its parasite Polistes atrimandibularis exemplify this type of co-evolutionary system. Here, we used genetic markers to examine the genetic population structures of these wasps in the western Alps. We found that both host and parasite populations displayed similar levels of genetic variation. In the host species, populations located near to each other were genetically similar; in both the host and the parasite species populations farther apart were significantly different. Thus, apparent dispersal barriers  did not seem to restrict gene flow across populations as expected. Furthermore, there were no major differences in gene flow between the two species, perhaps because P. atrimandibularis parasitizes both alpine and lowland host species and annually migrates between alpine and lowland populations. The presence of strong gene flow in a system where local populations experience variable levels of selection pressure challenges the classical hypothesis that restricted gene flow is required for local adaptations to evolve.The co-evolution of hosts and parasites depends on their ability to adapt to each other\u2019s defense and counter-defense mechanisms. The strength of selection on those mechanisms may vary among populations, resulting in a geographical mosaic of co-evolution. The boreo-montane paper wasp Polistes biglumis and its social parasite Polistes atrimandibularis, which have evolved local defense and counter-defense mechanisms to match their antagonist. In this work, we study spatial genetic structure of P. biglumis and P. atrimandibularis populations at local and regional scales in the Alps, by using nuclear markers  and mitochondrial sequences. Both the host and the parasite populations harbored similar amounts of genetic variation. Host populations were not genetically structured at the local scale, but geographic regions were significantly differentiated from each other in both the host and the parasite in all markers. The net dispersal inferred from genetic differentiation was similar in the host and the parasite, which may be due to the annual migration pattern of the parasites between alpine and lowland populations. Thus, the apparent dispersal barriers  do not restrict gene flow as expected and there are no important gene flow differences between the species, which contradict the hypothesis that restricted gene flow is required for local adaptations to evolve.The co-evolutionary pathways followed by hosts and parasites strongly depend on the adaptive potential of antagonists and its underlying genetic architecture. Geographically structured populations of interacting species often experience local differences in the strength of reciprocal selection pressures, which can result in a geographic mosaic of co-evolution. One example of such a system is the boreo-montane social wasp  A close association of species which instigate a selection pressure on each other is one of the main drivers of evolution, particularly when the interaction is antagonistic ,2,3. CoeSpatial population structure is an important factor influencing evolutionary outcomes, including between-species interactions . Gene flPrimitively eusocial wasps that lack morphological castes are a long-standing model system for studying the evolution and maintenance of sociality in general e.g.,  and theyPolistes biglumis is a boreo-montane social wasp .Third, mitochondrial markers in In this study, we described the genetic population structure in two paper wasps engaged in a co-evolutionary arms race, with the aim to test the classical population genetic hypothesis about the prerequisite for the evolution of local adaptations. Gene flow turned out to be strong among local host populations and at similar level in the host and parasite systems. We also tested which of the antagonists had more genetic variation, but could not find major differences in the level of nuclear variation between host and parasite populations in the relatively small sample of markers studied. Mitochondrial sequence variation was, however, lower in the parasite compared to the host and showed traces of historical gene flow. Thus, our results largely contradict our predictions derived from the assumptions based on the biology of this host-parasite system, spacing of populations, including the landscape they live in with important dispersal barriers (high mountains), and the assumption of restricted gene flow for local adaptations to evolve. As our findings did not support this prediction, we revisit our assumptions. Polistes may not apply to P. biglumis and P. atrimandibularis to a similar extent as to other Polistes. P. biglumis nests are founded and controlled by a single foundress and reproducing females produced during the previous season do not seek inclusive fitness benefits by teaming up with their natal nestmates to found a nest [P. atrimandibularis is not constrained by the need for co-founding a nest with their relatives [P. biglumis nor P. atrimandibularis is constrained by the necessity of co-operative breeding and may be smaller than in most paper wasps.First, arguments for female philopatry in d a nest ,42,43. Selatives ,43. ThusP. atrimandibularis, wasps are faced with the same geographic constraints. However, the \u201chill topping\u201d effect [Second, an important reason to predict significant genetic differentiation among host populations was the topography of our study area. Within the major valleys, the difference in altitude among our local populations was considerable (up to >500 m in some cases) and they were sometimes also separated by mountains much higher (>3000 m) than wasps can conceivably cross, forcing them to seek longer dispersal routes along minor valleys. In \u201d effect  may faciP. biglumis populations may have smaller long-term effective sizes and consequently less genetic diversity compared to what is expected in a stable population system. Conversely stronger gene flow across the parasite populations than expected may increase the effective population size in P. atrimandibularis from expected based on current population sizes. Thus, an unexpectedly good long-distance dispersal ability of the host and replenishment of the parasite populations from the lowland and/or cryptic populations could largely explain both the similar level of dispersal across major valleys and the current level of genetic diversity in the host and the parasite. Detailed studies on wasp dispersal would help to understand the dynamics of this host-parasite system better.Third, current host population sizes may not reflect well their long-term effective sizes. Local extinctions and recolonizations are common in marginal populations , causingbiglumis-atrimandibularis system [Finally, classical population genetic models predict that local adaptations can evolve only under restricted gene flow e.g., ,11, but s system , is a dys system ,15. Thuss system ,31,34,41s system .Polistes wasps are stronger flyers than anticipated and even parasitic wasps can apparently cover considerable distances, should they opt to disperse from their natal area. Stronger gene flow than expected would explain both the lack of spatial population structure in the host across regional scale and the similar level of genetic diversity in the two systems. Consequently, our results on the biglumis-atrimandibularis system actually support the suggested lack of asymmetry in evolutionary potential in social insects [To conclude, we found that  insects ,19. Geno"}
+{"text": "Vascular endothelial senescence induced by high glucose and palmitate (HG/PA) contributes to endothelial dysfunction, which leads to diabetic cardiovascular complications. Reduction of endothelial senescence may attenuate these pathogenic processes. This study is aimed at determining whether Ginseng-Sanqi-Chuanxiong (GSC) extracts, traditional Chinese medicine, can ameliorate human aortic endothelial cell (HAEC) senescence under HG/PA-stressed conditions and further explore the underlying mechanism. We found that GSC extracts significantly increased antisenescent activity by reducing the HG/PA-induced mitochondrial ROS (mtROS) levels in senescent HAECs. GSC extracts also induced cellular mitophagy formation, which mediated the effect of GSC extracts on mtROS reduction. Apart from this, the data showed that GSC extracts stimulated mitophagy via the AMPK pathway, and upon inhibition of AMPK by pharmacological and genetic inhibitors, GSC extract-mediated mitophagy was abolished which further led to reverse the antisenescence effect. Taken together, these data suggest that GSC extracts prevent HG/PA-induced endothelial senescence and mtROS production by mitophagy regulation via the AMPK pathway. Thus, the induction of mitophagy by GSC extracts may provide a novel therapeutic candidate for cardiovascular protection in metabolic syndrome. Diabetes mellitus is a metabolic disease characterized by elevated levels of glucose and free fatty acids, and it has become a major threat to human health due to its severe cardiovascular complications . AccumulMitophagy is a form of selective autophagy, which can mark damaged mitochondria for autophagy recognition and degradation, playing a key role in mitochondrial and cellular homoeostasis . The damAdenosine monophosphate-activated protein kinase (AMPK), as an energy sensor and regulator, plays a fundamental role in cellular and organismal energy metabolism . The mamThe traditional Chinese medicine Ginseng-Sanqi-Chuanxiong (GSC) is composed of Panax ginseng C. A. Mey., Panax notoginseng (Burk.) F. H. Chen, and Ligusticum chuanxiong Hort. at a ratio of 2\u2009:\u20093\u2009:\u20094, which has been applied for cardiovascular and diabetic treatment. Recently, pharmacological studies have shown that the active ingredients of these three drugs have antiaging effects \u201321. Our GSC consists of three herbs, and the mixed proportion of respective herbs in GSC is illustrated in 2. The cultured media were changed every 48\u2009h. Cells used in the experiments were from passages 4 to 6. HAECs were cultured in the presence of HG  and PA  with different doses of GSC extracts and metformin for 48\u2009h. In all experiments involving treatment with PA-BSA, BSA served as control. Chemical inhibitors or activators, CCCP (20\u2009\u03bcM), bafilomycin A1 (5\u2009nM), Mdivi-1 (2\u2009\u03bcM), and compound C (5\u2009\u03bcM), were added as indicated in Results. For adenoviral infection, Ad-GFP-LC3  was used following the manufacturer's instructions.Human aortic endothelial cells  were purchased from ScienCell Research Laboratories (USA) and cultured in endothelial cell medium  supplemented with 5% FBS and penicillin/streptomycin antibiotic solution; endothelial cells were grown in a humidified environment at 37\u00b0C and 5% CO3 cells/well) were seeded in 96-well plates. After adherence, the cells were incubated in ECM with or without HG/PA and GSC extracts. After 48\u2009h of incubation, 10\u2009\u03bcL of CCK-8  solution and 90\u2009\u03bcL of ECM were added to each well, and the cells were further incubated in the CO2 incubator at 37\u00b0C for 2 or 3\u2009h. The absorbance was measured at 450\u2009nm using a Synergy H1 Automatic Microplate Reader .HAECs .SA-\u03b3-H2AX  or Parkin  antibody overnight at 4\u00b0C. Following incubation with Alexa Flour 488 secondary antibody for 1\u2009h at room temperature, the cells were incubated with DAPI stain for 5\u2009min to stain the nucleus. Next, cells were observed under a FV1000 confocal microscope .After 48\u2009h of treatment, HAECs were fixed with 4% paraformaldehyde for 15\u2009min, followed by three washes with DPBS. Cells were permeabilized with 0.1% Triton-X 100 for 10\u2009min and blocked with 5% BSA for 1\u2009h at room temperature. After blocking, the cells were incubated with For mitophagy detection, GFP-LC3-transfected cells were incubated with 100\u2009nM MitoTracker\u2122 Red CMXRos  that was diluted in serum-free media at 37\u00b0C for 30\u2009min. Afterwards, they were analyzed by confocal microscopy.\u03bcM MitoSOX reagent working solution for 10\u2009min at 37\u00b0C in the dark. Then, cells were washed gently three times with warm buffer. Red fluorescence was measured at the excitation/emission maxima of approximately 510/580\u2009nm using a confocal microscope.The production of mtROS was measured by MitoSOX Red mitochondrial superoxide indicator . HAECs were incubated with 5\u2009MMPs were assessed using the Mitochondrial Membrane Potential Assay Kit with JC-1 . HAECs were seeded and treated for 48\u2009h. After experimentation, cells were treated with JC-1 staining working solution in a dark environment for 20\u2009min and washed twice with cold staining buffer. Green fluorescence reflected the monomeric form of JC-1, and red fluorescence reflected the aggregated form of JC-1. The cells were monitored using a confocal microscope.\u03b1 , p-AMPK\u03b1 , mTOR , p-mTOR , p70S6K , p-p70S6K , and \u03b2-actin . All membranes were washed with TBST three times and incubated for 1\u2009h at room temperature with a secondary antibody  that had been dissolved in TBST. Finally, the membranes were washed three times with TBST. The blots were then developed using an ECL detection kit . The developed blots were subjected to grayscale analysis by Image Lab 6.0 and normalized with an internal control.HAECs were lysed with RIPA buffer, protease inhibitor, and phosphatase inhibitor. The protein concentrations were measured with the BCA method. Equivalent amounts of total protein were separated by SDS-PAGE and transferred to PVDF membranes. Nonspecific binding was blocked with 5% nonfat milk (dissolved in PBS) for 1\u2009h and then incubated overnight at 4\u00b0C with antibodies: p16 , p21 , LC3B , p62 , PINK1, Parkin, AMPK8 TU and 1.0 \u00d7 108 TU, respectively. HAECs were transfected with each shRNA and incubated at 37\u00b0C. At 8\u2009h posttransfection, the media were refreshed, and HAECs were treated for 48\u2009h with HG/PA, GSC extracts, or metformin.Coding sequences for shRNA targeted to prkaa1 or for scrambled shRNA were inserted into the plenti-U6-egfp-puro plasmid, which also encoded with enhanced green fluorescent protein (EGFP). The shRNA target sequences were 5\u2032-GCAGAAGTATGTAGAGCAATC-3\u2032. The constructed plenti-prkaa1 shRNA and plenti-Scramble shRNA were cotransfected with 293T cells with a lentiviral backbone plasmid at a mass ratio 3\u2009:\u20095. The 293T cells were in a 100\u2009mm culture dish and were treated with replaced fresh complete medium (DMEM + 10% FBS) after 8\u2009h, and the supernatant was collected at 48\u2009h and 72\u2009h, respectively. After being filtered, concentrated, and resuspended, the virus particles were collected at -80\u00b0C. The titers of LV-prkaa1 shRNA and LV-Scramble shRNA were 2.5 \u00d7 10t-test. For comparisons involving more than two groups, one-way analysis of variance (ANOVA) with a post hoc Bonferroni multiple comparison test was used to assess the difference. All statistical analyses were performed with GraphPad Prism version 6.0 software. P < 0.05 was considered statistically significant.All results were expressed as the means \u00b1 SE. Comparisons between two groups were calculated using Student's \u03b2-gal activity. On the other hand, cotreatment with GSC extracts led to decreased numbers of SA-\u03b2-gal blue-stained cells and staining was nearly absent at the treatment with a concentration of 200\u2009mg/L . In this study, we investigated whether treatment with GSC extracts led to any changes in mitophagy via colocalization of autophagy marker GFP-LC3 (green) and the MitoTracker probe (red). After treatment with GSC extracts, there was little colocalization (yellow dots) of autophagosome marker LC3 and mitochondria in senescent HAECs treated with HG/PA or GSC extracts. To verify the defective mitophagy in senescent HAECs, we found that treatment with CCCP (a well-known inducer of mitophagy) can reduce the colocalization of LC3 and mitochondria in HG/PA-treated HAECs, whereas the colocalization was highly induced after cotreatment with 200\u2009mg/L GSC extracts; this indicates that damaged mitophagy was restored by GSC extracts Figures .PINK1-Parkin pathway is the main mechanism of mitophagy, which can recruit autophagosome to the damaged mitochondria \u201328. Ther\u03b2-actin expression, and cotreatment with GSC extracts could dramatically increase the expression of LC3B-II/\u03b2-actin in the presence of bafilomycin A1. In addition, the ubiquitin-binding receptor protein p62 accumulated on the depolarized mitochondria and facilitated the recruitment of damaged mitochondria to lysosomes by binding to LC3, which thereby completed the selective clearance of mitochondria. The level of p62 is inversely proportional to autophagy flux. Immunoblotting analysis showed that the expression of p62 protein in HAECs treated with GSC extracts and HG/PA was significantly reduced, indicating that GSC extracts could manifest the induction of autophagosome formation without impairing autophagy turnover.Next, we further investigated the formation of autophagosomes and autophagic flux. When autophagosomes were formed, the cytosolic protein LC3-I was converted to LC3-II by enzymatic hydrolysis, and the elevation of LC3-II represented the initiation of autophagy. Bafilomycin A1 could prevent the formation of the autophagosome-lysosome complex, which helped us to determine whether the increase of autophagosomes is solely due to the induction of autophagy itself or simply due to impairment in autophagy turnover. As shown in Figures Overall, these data strongly suggest that by regulating the PINK1/Parkin pathway, GSC extracts might not only restore mitophagy but also induce autophagic activity, which is partly impaired by chronic HG/PA stimulation.\u03bcM) abolished the induction of mitophagy by GSC extracts. As shown in Figures To further determine whether impaired mitophagy is involved in the cytoprotective effect of GSC extracts in HG/PA-induced cellular senescence, the specific mitochondrial division/mitophagy inhibitor Mdivi-1 was applied in following study. Pretreatment with Mdivi-1 , AMPKed HAECs . These rgic flow . Moreove Figures . Togethe\u03b2-gal, p16, and p21 but increased cell proliferation in a dose-dependent manner. Additionally, DNA damage marker was also decreased in HAECs cotreated with GSC extracts.This study is the first to demonstrate that GSC extracts can attenuate HG/PA-induced cellular senescence in HAECs by inducing mitophagy via activating the AMPK signaling pathway. Endothelial cellular dysfunction is identified to be a major hallmark of vascular injury, which leads to the development of vascular complications in diabetes , 30. PrePrevious studies have reported that HG or PA usually induces oxidative stress, thereby damaging the cell by increasing the production of intracellular ROS. Excessive ROS is mainly generated by dysfunctional mitochondria and leads to oxidative damage of membranes and macromolecules (such as DNA and proteins), which in turn accelerates cellular senescence . In the Mitophagy is activated by mitochondrial membrane depolarization, and it is then followed by stabilization of PINK1 on the mitochondrial outer membrane, recruitment of E3 ubiquitin ligase Parkin from the cytosol, and amplification of the initiation signals of mitophagy . MitophaImpaired mitophagy is responsible for accumulation of damaged mitochondria and cellular senescence. Both PINK1 and Parkin knockout mice show elevated ROS levels and mitochondrial dysfunction , 41. In In subsequent studies, molecular mechanism involved in the GSC extract-mediated induction of mitophagy was analyzed. AMPK widely presents in eukaryotic cells and is a highly conserved serine/threonine kinase that cooperates with downstream molecules to play an important role in the regulation of mitophagy , 17, 43.In summary, our senescent HAEC model of poorly controlled type 2 diabetes, using chronic exposure to glucose and palmitate, revealed that these nutrients impaired mitophagy and increased oxidative stress, resulting in cellular senescence. All results provide evidence of a critical role of GSC extracts in antisenescent actions by inducing mitophagy via the AMPK signaling pathway in HG/PA-stressed HAECs . To our However, the present study has some limitations. First, autophagy is a double-edged sword in diseases, so dynamic changes of mitophagy needed to be observed in subsequent studies, and further investigation of the effects of GSC extracts on endothelial aging in vivo is also clearly needed. Such experiments will help us to evaluate whether GSC extracts modulate mitophagy via the AMPK signaling pathway in vivo."}
+{"text": "Regular intense exercise is known to induce cardiac hypertrophy in some dogs engaged in different physical activities, but the cardiovascular response in dogs that routinely carry out aerobic exercise in the form of bikej\u00f6ring (a form of dryland mushing) is unknown. The pre- and post-competition clinical examinations usually carried out in canine athletes include an electrocardiogram due to its diagnostic value, but some cardiac structural disturbances may go unnoticed at rest, especially in the early stages of disease. In our study, changes in systolic, mean and pulse pressure were detected after exercise, while diastolic blood pressure remained stable. Numerous changes in echocardiographic variables  were also found. No association was found between the sex of the animals and the differences in the data. Our findings lead us to recommend theLVF introduction of echocardiograms for the clinical evaluation of canine athletes competing in this form of mushing. Furthermore, by including echocardiograms in clinical examinations during physical training, knowledge of the individual cardiovascular response after exercise can be improved.Bikej\u00f6ring is a type of dryland mushing requiring high-intensity aerobic effort, with speed peaks close to 42 km/h. Greysters (crosses between the German Shorthaired Pointer and the Greyhound) often participate in such events and perform well. The objective of this comparative study was to evaluate the clinical use of non-invasive methods in assessing the cardiovascular health of 22 Greyster dogs in physical training, by determining the differences between different cardiovascular parameters before and after physical training. Blood pressure, heart rate and echocardiographic results were compared. The mean age of the dogs was 4.4 years \u00b1 1.8% and 54.5% were female. All participating dogs regularly participated in bikej\u00f6ring. Post-exercise increases were observed in systolic blood pressure (SBP), mean arterial pressure (MBP) and pulse pressure (SBPD), with diastolic blood pressure (DBP) remaining stable. Changes of clinical interest were observed in numerous echocardiographic variables such as left ventricle fractional shortening (LVFS), left ventricule ejection fraction (LVEF), E-point to septal separation (EPSS), cardiac output (CO), cardiac index (CI), posterior wall thickness at end-diastole (PWd) and major/minor axis ratio (MA/ma), including a decrease in the shortening fraction and an increase in EPSS after exercise. These clinical findings were observed in both males and females; they do not appear to be associated with dilated cardiomyopathy, but rather with a cardiovascular response to physical training. This study derives from the real interest of clinical veterinarians who care for highly trained canine athletes. It contributes to an increase in knowledge of the different cardiac adaptations of such dogs after intense exercise and serves to differentiate these from pathologic conditions. Regular intense exercise is known to be able to induce cardiac hypertrophy in dogs engaged in different physical activities, such as that of search and rescue ,2 or spoIn recent years, there has been an increase in the participation of canine athletes in other types of mushing, taking place on dry land rather than snow. One of these, bikej\u00f6ring, has significantly increased in popularity in Central European countries, with optimal weather conditions being present there for this sport. In this discipline, cyclists are assisted by one or two dogs which pull the bicycle along and there are organized races which may be sprints (up to eight kilometers) or ones of medium distance (approximately 30 km).In these competitions, the Greyster is a popular breed and yet this is not one of those typically studied in the literature, which has primarily focused on sled dogs running on snow. These dogs were originally bred in Norway in the 1980s, from a series of crossings between the German Shorthaired Pointer and the Greyhound, for the original purpose of participation in sledging races. As with other such breeds, they have been adapted and selected for their occupation through improved endurance, cardiac function, blood flow and cognitive performance .Greysters have been shown to be highly competitive mushing dogs, demonstrating great athletic performance. There are no data in the scientific literature regarding exercise-induced hemodynamic changes in Greyster dogs, but a high degree of training would be expected to lead to altered echocardiographic values in these dogs in comparison with the usual values for sedentary dogs. These echocardiographic changes could make these dogs appear to have cardiomyopathies, which could carry a risk in competition. Given that, in the pre-competition examination, the veterinarians attending the races do not have enough time to individually evaluate each of the participating dogs, we propose the performance of a cardiovascular clinical study in the field, imitating the real conditions in order to study cardiovascular changes in physical training.The objective of this comparative study was therefore to perform a clinical evaluation of different cardiovascular parameters before and after physical training of 22 Greyster dogs, using non-invasive methods.Healthy adult Greyster dogs (>18 months of age) who regularly take part in bikej\u00f6ring (minimum 3 h/week) were included in this study. One dog initially included had to be excluded due to a recent injury, so 22 dogs were ultimately enrolled on the full study. All of them were of the same breed and engaged in the same sporting activity. The study was conducted on the same day for all dogs, during the final phase of the sports season. The dogs belonged to a total of twelve owners, with two of them owning 13 of the dogs, more than half of the sample. All the dogs were from the same geographical area, with the same orography and similar training systems.The physical training consisted of completing an identical route of 4.37 km. Each dog wore a sports harness and was attached to the owner\u2019s bicycle (or \u201cmusher\u201d) by a shooting line. The equipment is approved by the International Federation of Sleddog Sports for this sport.All records were taken without sedation or restrictions. The owner was always with the dog and the animals were allowed a period of time (less than 1 min) to adapt to the procedures for taking blood pressure, heart rate and echocardiography to minimize the effect of excitation.Post-exercise measurements were made individually, over three consecutive days with temperatures ranging from 0 \u00b0C to 5 \u00b0C. Average speed and maximum speed during exercise session were recorded for each pair (dog-musher). A maximum speed of 42.6 km/h was reached in the 4.37 km race.\u00ae RS6 automatic blood pressure monitor was used, whose length covers 80% of the perimeter of the thoracic limb of these dogs.For the measurement of blood pressure, an OmronFor the pre-exercise measurement (T0), we waited three minutes after fitting the monitor before taking the measurement. The sphygmomanometer was placed on the left forelimb, near the elbow joint, on the superficial brachial artery. The post-exercise blood pressure measurement (T1) was performed immediately after the exercise was completed.\u00ae CardioScout three-channel electrocardiograph connected via Bluetooth with the associated SRM\u00ae software. The electrocardiogram was performed on each dog on the right lateral decubitus and the electrodes were attached to the skin folds using suitable forceps, and the areas of the skin in contact with the electrodes were impregnated with an alcohol solution. The electrodes were fixed on the palmar surface of the right and left thoracic limbs at the olecranon and on the internal surface of the groin. A six-lead baseline ECG recording at 25 mm\u00b7sg\u22121 and with a calibration of 0.1 mV\u00b7mm\u22121 was obtained. The rhythm and heart rate at rest, the electrical axis, the amplitude and duration of the P, Q and R waves and the QRS complex were analyzed, as well as the duration of the PR and QT intervals. Checks for possible conduction disturbances were made.One of the veterinarians devoted herself exclusively to performing the electrocardiographic recordings, before (T0) and immediately after exercise (T1). ECGs were recorded and analyzed with an SRM\u00ae EDGE II portable device. The following parameters were evaluated in TM-mode in the right parasternal window on the transverse axis: the interventricular septum thickness at end-diastole (IVSd) and end-systole (IVSs), the diameter of the left internal ventricle in diastole (LVIDd) and systole (LVIDs), the left ventricle free wall in diastole  and systole  and the separation of the septum from point E (EPSS).A transthoracic echocardiographic study was also performed before (T0) and after (T1) exercise, using a SonositeThe device automatically calculated the shortening fraction (LVFS) and the ejection fraction (LVFE-left ventricle ejection fraction). The diameter of the left atrium (LA) and the aorta (Ao) was calculated in mode B. The continuous doppler mode was selected for the assessment of the left ventricular outflow (LVOT). Finally, color Doppler enabled a visual assessment to be performed of the presence of abnormal flows in systoles in the mitral and aortic valve area. All echocardiographic studies were performed with the dogs in the right lateral decubitus position.t-tests, paired t-tests and Pearson\u2019s correlation coefficient, were performed, using the IBM SPSS Statistics 24 software. First, the relationship between sex and all the blood pressure, heart rate and echocardiographic variables was tested, before and after exercise, in order to determine if the sample could be studied as a single group. Paired t-tests were carried out to determine if there were statistical differences between the pre- and post-exercise blood pressure, heart rate and echocardiographic variables. Finally, Pearson\u2019s correlation coefficient was calculated for specific variables.A descriptive statistical analysis was carried out, with means and standard deviations being recorded and inferential statistical tests, such as independent Before starting the exercise training, body data and measurements were obtained from all 22 dogs, 12 females (54.5%) and 10 males (45.5%). The mean age was 4.4 years \u00b1 1.8. Zoometric measurements such as height at the withers (70.6 cm \u00b1 5.4) and thoracic perimeter (73.5 cm \u00b1 4.7) were recorded. All the animals were weighed, with the mean weight being 29.9 kg \u00b1 5.5.All teams (musher and dog) completed the exercise challenges without difficulties or abnormal symptoms.The results of the complementary tests are shown below in the order in which they were performed On rare occasions, some specific measurements do not appear in tables, either because the parameter was not properly recorded or due to technical failure. In such cases, the data are counted as missing, invalidating that animal for that specific measurement. In this respect, it is important to note that it such measurement errors did not always occur with the same dog (which would have enabled us to exclude this dog from the study).A descriptive analysis of the variables related to blood pressure was carried out, with their mean values, standard deviations and the minimum and maximum values being recorded.This analysis was undertaken for sample as a whole without taking sex into account, since, as is discussed below, no significant differences were found between any of the variables in the three sections  with regard to the sex of the animals.The values obtained were, before and after exercise, respectively: for heart rate, measured in beats per minute, 104.1 \u00b1 22 and 153.1 \u00b1 27.5; for systolic blood pressure, 115.7 mm Hg \u00b1 20.6 and 129.5 mm Hg \u00b1 17.8; for diastolic blood pressure, 76 mm Hg \u00b1 14.9 and 76.9 mm Hg \u00b1 14.3; and for mean blood pressure, 64.5 mm Hg \u00b1 11 and 94.4 mm Hg \u00b1 14.3.t-test was performed to determine the existence of sex differences for the variables of heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MBP) and pulse pressure (SBPD), before and after exercise. As can be seen An independent The Pearson\u2019s correlation coefficient between the heart rate and systolic blood pressure was calculated before and after exercise see , obtainiFour mean difference tests were performed for related samples of the following variables: HR, SBP, DBP, MBP and SBPD, before and after exercise.A descriptive analysis of the electrocardiographic variables was performed, and their mean values and standard deviations recorded. The mean pre- and post-exercise values were, respectively: for the amplitude (mV) of the R wave, 2.5 \u00b1 0.79 and 2.67 \u00b1 0.80; for the Q wave, 0.83 \u00b1 0.40 and 0.74 \u00b1 0.36; and for the QT interval duration (ms), 0.21 \u00b1 0.01 and of 0.18 \u00b1 0.02.t-test was performed to determine the existence of sex differences for the HR, R Wave, Q Wave and QT Interval variables, before and after exercise. As can be seen in An independent Four Pearson\u2019s correlation coefficients were calculated: for the QT interval and the VS, both pre- and post-exercise and for the QT interval and heart rate, also both pre- and post exercise. A significant correlation was only found between the post-exercise QT interval and heart rate, as can be seen in For the pre- and post-exercise values for the R waves, Q waves and the QT intervals, a significant difference was not found in the case of the Q wave but was present in the other two cases see . For theA descriptive analysis of the echocardiographic variables was performed and their mean values, standard deviations and the minimum and maximum values of each of them are in t-test was performed to determine the existence of sex differences for the following echocardiographic variables: LVFS, LVFE, EPSS, LA/AO, MA/ma, SV, CO, CI, LVIDd, LVIDs, PWd, PWs, IVSd, IVSs, LVOT. As shown in As in the previous sections, an independent t-tests and significant differences were found in the cases of LVFS, LVFE, EPSS, MA/ma, CO, CI and PWd. Thus, the left ventricular shortening fraction (LVFS) and the left ventricular ejection fraction (LVFE) present lower post-exercise values  values. In horses, a lower shortening fraction immediately after exercise has been associated with a decrease in physical performance . This haE-point-to-septal-separation (EPSS) is a valuable additional parameter for the diagnosis of dilated cardiomyopathy (CMD), enhancing the diagnostic capabilities of TM-mode and performing as well as the Sphericity Index . EPSS haIn our study, EPSS is significantly higher after exertion  and is also accompanied by an increase in the MA/ma ratio after exercise. Those results are consistent with the previous study  in that In addition, unsurprisingly, cardiac output was significantly higher post-exercise. This is due to cardiovascular changes, which occur at both the cardiac and peripheral levels. The first modification that dynamic exercise training such as bikej\u00f6ring produces is an increase in the beating volume and, therefore, also in the cardiac output at a given heart rate. This is accompanied by an increase in end-diastolic volume as measured by echocardiography, which may be associated with a decrease in end-systolic volume, accompanied by an increase in the thickness of the ventricular wall .The behavior of the aorta in sports dogs is currently unknown, but we found no significant differences for LVOT between males and females in 2D-mode, unlike those described in humans . In humaLikewise, no significant differences were found in the LA/AO ratio before and after exercise. This ratio is useful to detect possible left atrial enlargement and predicts the risk of congestive heart failure . In our Intense physical exercise produces acute cardiovascular changes that can have an impact on the health and performance of canine athletes. In Greysters, this proposed exercise test provides useful information that enables their cardiovascular responses to be determined in real situations. No sex-based differences were observed in the pre- and post-exercise data, enabling us to consider the group as a whole. No changes in blood pressure were found which would indicate cases of hypertension. Immediately after exercise (bikej\u00f6ring), the Greyster dogs presented changes in systolic pressure, while diastolic pressure remained stable. The electrocardiographic data indicated no pathologic changes. Finally, the echocardiographic data allowed us to improve our understanding of some of the morphologic and functional responses that Greyster dogs experiences by participating in the sport of bikej\u00f6ring, adding to our knowledge of their normal values and enabling the assessment of possible cardiac damage after strenuous exercise.Echocardiography, therefore, has shown itself to be an indispensable complementary test for the evaluation of structural or functional changes in the dogs studied, although reference intervals for transthoracic echocardiography in the Greyster are required.Given the difficulties in carrying out a stress test in dogs, the field test carried out in this study reveals some hemodynamic changes related to physical exercise. We have thus been able to record the echocardiographic, electrocardiographic and blood pressure changes produced after physical training in 22 Greyster dogs. However, more research is required to understand the influence of diet, training, and genetics in relation to hemodynamic changes, and so to fully understand the impact of exercise on the canine heart structure."}
+{"text": "They pose a diagnostic challenge to surgeons and put them in demanding circumstances for successful extraction.\u2022High index of suspicion of perforations should be there in all rectal foreign bodies. Iatrogenic bladder injuries give excellent results when repair suitably.\u2022Prompt diagnosis and immediate intervention to remove the foreign bodies are quintessential in all rectal foreign bodies with evidence of perforation. Rectal perforations due to foreign body impalement are infrequently encountered in practice. Accidental or intentional foreign body insertions pose a diagnostic challenge to surgeons and put them in demanding circumstances for successful extraction.We report a case of a 60-year-old male with alleged history of accidental foreign body insertion into the rectum. Radiographs showed a linear metallic foreign body with crooked end. Computed Tomography (CT) with rectal contrast revealed contrast extravasation indicating anterior wall perforation of upper rectum. Patient was taken urgently for exploration and foreign body removal. Intra-operatively, bladder was injured inadvertently. Primary repair of enterotomy and loop sigmoid-ostomy was done besides bladder repair. Patient tested positive for COVID-19. Patient was observed in critical care unit for two days. Post-operative period was unremarkable apart from midline abdominal wound gape for which secondary closure was done. Patient was discharged with urinary catheter in-situ. Patient followed-up with a normal cystourethrogram and a well-functioning stoma. Stoma closure after two months was uneventful.A thorough history and clinical examination is required and one should raise a high index of suspicion of perforation in patients with rectal foreign bodies, which should be managed appropriately and promptly to prevent sepsis and multi-organ dysfunction. Inadvertent bladder injuries are common with lower-midline incisions. However, give good results when repaired suitably.The rationale behind this report is to explicate the complexity and hurdles in the surgical management of rectal foreign bodies causing impalement injury. Rectal 2A 60-year-old male presented with alleged history of inability to remove the accidentally lodged foreign body in the rectum. Patient gave history of self-administration of enema in the bathroom earlier, following which he slipped and landed on a bucket which had a long linear metallic rod with a crooked end standing upright. After failed attempts of removing the foreign body manually, patient developed pain in the lower abdomen and anal region which gradually progressed and forced the patient to seek medical care. Past history was unremarkable apart from chronic intermittent constipation and an open surgery done for left ureteric calculus 31 years back.Patient was hemodynamically stable. There was mild tenderness present in the lower quadrants of the abdomen and a metallic foreign body was found hanging out through the anus. Per rectal examination  confirmeManipulation and trans-anal removal attempts were avoided taking into account the crooked end perforated the upper rectum which might cause further injury. Blood investigations were within normal limits. The patient and relatives were explained about the complexity of surgical intervention needed to remove the foreign body and stoma formation, if needed.Patient was taken urgently for Exploratory laparotomy. While exploring the pelvis the bladder was cut inadvertently with monopolar diathermy. Entire small bowel and large bowel was examined meticulously. On examining the rectum, it was found that the crooked end had perforated the anterior wall and was residing outside it, with the rest of the object inside the lumen. . RepeatePatient\u2019s rt-PCR result came positive for COVID-19 post-operatively and was shifted to dedicated COVID-19 care centre and monitored in Intensive Care Unit (ICU) for 2 days. Enteral feeds started on Post-operative day (POD) 2. Stoma started functioning from POD 2. The repeat COVID-19 swab came negative after 5 days. A wound gape developed on POD 9 for which secondary suturing done on POD 21. Patient was taught stoma care and advised to keep urinary catheter in-situ for 3 weeks. Sutures were removed after 14 days. Patient reviewed with normal micturating cystourethrogram after 3 weeks showing normal bladder drainage with no extravasation or communication with rectum. Hence, the urinary catheter was removed.Patient followed up for stoma closure after 8 weeks. Closure of loop sigmoid-ostomy was done with no complications. Post-operative period was uneventful. Patient passed flatus and stools on POD2. Patient was discharged on POD 5. On following up, patient is leading a normal life with unaltered bladder and bowel habits .Fig. 5De3Rectal impalement encompasses foreign body trauma to the anus or rectum resulting in intra- peritoneal and extra-peritoneal injuries . It occuTraditionally, impalement injuries are divided into three types: type I injuries that occur when a person in motion bums against an immobile object, type II when a mobile object collides with an immobile person and type III that results from an impact between a mobile object and a mobile person . The preAll rectal foreign bodies should be considered as potentially hazardous. Comprehensive history-taking, detailed information about the mechanism of foreign body ingestion/insertion and systematic clinical examination is mandatory to delineate the nature of foreign body and possible complications associated with it. In our case, the patient presented with mild pain in the anal region with a foreign body found hanging through the anus.The most important step in the management of rectal foreign bodies is detecting whether there is perforation or not. By far, all the algorithms suggest that in case of perforation or peritonitis, patient should be taken to Operating Room (OR) immediately for either laparotomy or diagnostic laparoscopy. Many extraction techniques are available depending on the location of foreign body. Low lying foreign bodies can be attempted to evacuate per-anally in the emergency room itself. After excluding the perforation, High lying foreign bodies can be extracted under vision with adequate analgesia or conscious sedation either manual manipulation or with surgical instruments present in the emergency room .Kyle et al. (2012) proposed an algorithm which suggested all failed cases after trans-anal or endoscopic extraction methods should undergo either mini-laparotomy/laparoscopy with direct pressure or laparotomy regardless the presence or absence of signs of peritonitis .In our case, the patient\u2019s CT confirmed anterior wall-upper rectal perforation. Hence patient was taken up for surgery without delay. Although, the complex nature of the foreign body and the mechanism of insertion, the foreign body did not cause any sphincter injury, intra-peritoneal or extraperitoneal damage. Urinary bladder is the most frequently injured organ during pelvic surgeries . Prompt Primary Repair (PR) with or without anastomosis of all colorectal injuries should be attempted initially unless the colonic tissue itself is inappropriate for repair due to severe oedema or ischemia. Even though primary repair was done in our case, considering the age, iatrogenic bladder injury and to avoid the complications like post-operative leak, Diversion Colostomy (DC) was done which was successfully restored after 2 months. Despite abundant reports on anorectal foreign bodies, there have been no cases in the literature authenticating a distinctive instance such as ours, i.e., an elderly male with COVID-19 positive status who sustained an accidental rectal impalement injury leading to an anterior rectal perforation without any other major structural injury by one of the longest foreign bodies reported.4Impalement injury presenting with rectal foreign body is a rare experience for surgeons. Our case-report is a very unique and a rarity in routine practice owing to the complexity of the nature, dimensions of foreign body and the mechanism of insertion. Judicious fluid resuscitation and instantaneous surgical intervention is quintessential in all rectal foreign bodies with evidence of perforation. Surgeons should approach the lower midline incisions in a cautious manner. All cases of colorectal injuries, iatrogenic bladder injuries should be attempted with primary repair, provided there is no gross contamination, presence of tissue oedema/ ischemia or other unfavourable factors. With the aforesaid means, the fatality rate in rectal foreign bodies and impalement injuries is maximally reduced and the recovery rate hits almost hundred percent.None.None.This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.Not applicable.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.Dr. Shirish Bhagvat: Study design, Performed the surgeryDr. Amol Wagh: Study design, Assisted for surgeryDr. Saurabh Jain: Study design, Assisted for surgeryDr. Hemant Jawale: Assisted for surgery, Data collectionDr. Keerthika Reddy: Assisted for surgery, Data collectionDr. Balamurugan Ganesan: Assisted for surgery, Data collection, Writing the paperNot applicable.Balamurugan Ganesan.Not commissioned, externally peer-reviewed."}
+{"text": "Staphylococcus aureus is a notorious pathogen that colonizes implants (orthopedic and breast implants) and wounds with a vicious resistance to antibiotic therapy. Methicillin-resistant S. aureus (MRSA) is a catastrophe mainly restricted to hospitals and emerged to community reservoirs, acquiring resistance and forming biofilms. Treating biofilms is problematic except via implant removal or wound debridement. Nanoparticles (NPs) and nanofibers could combat superbugs and biofilms and rapidly diagnose MRSA. Nanotheranostics combine diagnostics and therapeutics into a single agent. This comprehensive review is interpretative, utilizing mainly recent literature (since 2016) besides the older remarkable studies sourced via Google Scholar and PubMed. We unravel the molecular S. aureus resistance and complex biofilm. The diagnostic properties and detailed antibacterial and antibiofilm NP mechanisms are elucidated in exciting stories. We highlight the challenges of bacterial infections nanotheranostics. Finally, we discuss the literature and provide \u201cthree action appraisals\u201d. (i) The first appraisal consists of preventive actions (two wings), avoiding unnecessary hospital visits, hand hygiene, and legislations against over-the-counter antibiotics as the general preventive wing. Our second recommended preventive wing includes preventing the adverse side effects of the NPs from resistance and toxicity by establishing standard testing procedures. These standard procedures should provide breakpoints of bacteria\u2019s susceptibility to NPs and a thorough toxicological examination of every single batch of synthesized NPs. (ii) The second appraisal includes theranostic actions, using nanotheranostics to diagnose and treat MRSA, such as what we call \u201cmultifunctional theranostic nanofibers. (iii) The third action appraisal consists of collaborative actions. Staphylococcus aureus is a notorious resistant pathogen that emerged from hospitals to communities, forming implant and wound biofilms. Nanotheranostics are \u201cgame-changers\u201d combating this resistance and tolerant biofilms via rapid diagnosis and multimodal therapeutic mechanisms.Appropriate stewardship considering our three action appraisals would beat the global resistance and biofilm battle.Staphylococcus aureus is a substantial etiological agent of implant-associated infections [S. aureus is a dire pathogen because of its potential to acquire resistance to antibiotics [mecA gene and production of a specific penicillin-binding protein (PBP2a) fortify S. aureus, resisting penicillinase-resistant \u03b2-lactams (methicillin or oxacillin) [S. aureus (MRSA) have mainly been confined within hospital settings  and to immunocompromised patients. Then, MRSA outbreaks emerged from hospitals to community reservoirs. Healthy people could contract community-acquired MRSA (CA-MRSA) [mec (SCCmec) type IVa and some carrying Panton-Valentine leukocidin (PVL) locus, producing PVL toxins [fections ,2,3,4,5,fections ,7,8,9,10fections , sepsis,fections . S. aureibiotics ,14,15. Facillin) ,17,18,19CA-MRSA) ,14,20,21CA-MRSA) ,23,24, aCA-MRSA) . CA-MRSAL toxins ,27. PVL L toxins . The MRSL toxins , facilitL toxins ,33,34,35L toxins ,37,38, bL toxins . If bactL toxins ,40,41. IL toxins ,43, and L toxins ,45. A cuWhat are the mechanisms behind the ruthless antibiotic resistance of bacteria? Evidence suggests that the essential mechanisms facilitating intrinsic  bacterial antibiotic resistance are (i) alterations of bacterial membrane permeability and deoxyribonucleic acid (DNA), (ii) multidrug efflux pumps, and (iii) the inactivation of enzymes ,47,48. OS. aureus is a key biofilm producer [S. aureus is called accessory gene regulator (agr), encoding the production of a diffusive distinct autoinducer molecule . This agr quorum-sensing system plays a pivotal role in the pathogenicity of S. aureus [What inflames the bacterial antibiotic resistance or tolerance puzzle is the existence of biofilms in most chronic bacterial infections  ,54,55,56producer ,57,58,59. aureus ,61 via c. aureus . Biofilm. aureus ,64,65,66. aureus ,63,65,67. aureus ,69 or en. aureus ,71, as s. aureus ,72,73,74. aureus ) without. aureus ,71,73,76hip is a high persister mutant), constituting a toxin\u2013antitoxin (TA) locus in the workhorse model organism, Escherichia coli. Throughout normal bacterial replication, protein toxins are bound to their antitoxins (protein or RNA), inhibiting toxin activity. Throughout the persister scenario, toxins are liberated, inhibiting DNA replication and mRNA cleavage that inhibits global bacterial protein transcription and translation [S. aureus? Consistent with the TA module signaling pathway in E. coli, Corrigan et al. [S. aureus via inhibiting GTPases. The inhibition of GTPases reduces the growth and amount of mature 70S ribosomes of cells and increases the antibiotic tolerance of cells. Surprisingly, Conlon et al. [S. aureus. The unexpected finding was that persisters emanated from a stochastic process of bacterial entrance into the stationary phase and associated with a decrease in the intracellular level of adenosine triphosphate, losing energy and developing antibiotic tolerance. Persisters also have the following hallmark features. (i) The biphasic killing curve is a heterogenous non-uniform killing rate of bacteria that describes the rapid killing of most bacterial within 25 min. The remaining cells are killed after a longer time, up to 6 h [rpoS (RNA polymerase sigma factor)-mediated stress cause their slow growth and protection against environmental stressors and chemical agents [The biofilm matrix structure contains open fluid channels, resembling the circulatory system and delivering nutrients to deeply embedded bacterial cells ,63,77. Tnslation ,86. The n et al.  have alsn et al.  noted thp to 6 h ,82,85.  thp to 6 h ,94,95; l agents ,98) withl agents ,56,65,94l agents ,71; and magic bullets\u201d still dominates a significant area of interest within the field of pharmaceuticals [There is a robust demand to research novel antibacterial agents that defeat the global antibiotic resistance crisis to avert returning to the pre-penicillin era  or entereuticals ,105. Thieuticals . In termeuticals ,102. If NPs could combat the bacterial resistance and biofilm dilemma, then how would nanotheranostics potentially revolutionize medicine? It is necessary here to first clarify what is meant by theranostics. The term \u201ctheranostics\u201d is commonly referred to as a combination of diagnostic and therapeutic properties into a single component ,107 and S. aureus resistance and biofilm  in a grasping narrative context supported by our constructed informative, artistic figures. Therefore, this review makes several significant contributions to the more in-depth understanding of the emergent resistant bacterial infections, specifically MRSA and their tolerant biofilms associated with implants (orthopedic and breast) and wounds. The present review explores the critical roles of different antibacterial nanotheranostics in curbing bacterial resistance and biofilm dilemmas. We provide essential insights on the challenges dampening the progress of such antibacterial nanotheranostics that are usually overlooked in studies. Ultimately, we reflect on our critical perspectives, highlight research gaps, and answer the big question in this field: How can we solve S. aureus resistance and its tolerant biofilms? In contrast to extensive theranostic research on different cancer types, there is much less information about theranostic effects against bacterial infections and their biofilms, which also pose a growing public health concern worldwide. However, antibacterial nanotheranostics can play a pivotal role in tackling this bacterial antibiotic resistance quandary and their biofilms via detecting (sensing) the presence of bacterial infection and consequently facilitating treatment . NanotheS. aureus, which is the most vicious bacterial infection associated with osteomyelitis and PJIs [S. aureus biofilms and offer a chance for biofilm cells to switch into persisters [S. aureus SCVs were isolated from four patients with a history of previous treatment with gentamicin beads. The treatment strategies for patients with SCVs end in failure, even though the administered antibiotics were effective in vitro against S. aureus progenitors  and recurrent infections. Conversely, patients with no SCVs suffered no recurrent infections [S. aureus (wild-type and SCV) strains were recovered from a patient with an implanted knee suffering PJI during the acute and recurrent phases. The resistance of S. aureus SCVs overweighs the resistance of the wild-type strain via multi-complex protective approaches against the host inflammatory and oxidative responses. Examples of such protective approaches of SCVs are (i) possessing a stringent response characterized by an inhibition of DNA replication and post-transcriptional regulation via decreased ribosomal assembly, inhibiting bacterial cell growth. (ii) Virulent expression of toxins, including phenol soluble modulins , alpha- and delta-hemolysins, and the agr locus. (iii) Upregulation of genes detoxifying the host oxidative stress response. (iv) Downregulation of genes involved in the cell wall regulon vraRS, orchestrating antibiotic resistance and switching SCVs from acute to chronic infections [Staphylococcus strain [One of the major problems ensuing orthopedic implant surgery is a bacterial infection, resulting in osteomyelitis and prosthetic joint-associated infections (PJIs) . Gentamiand PJIs . Althougand PJIs ,116, itsand PJIs , and pooand PJIs ,116. Muland PJIs ,118. Thiand PJIs , and it and PJIs . PMMA beand PJIs ,116,118.and PJIs . The mairsisters . Severalrsisters  using Exrsisters . Howeverrsisters ,114. Morfections . Tacklinfections . A more s strain ? The suss strain ,123. Anos strain .The human breast contains endogenous flora originated from the nipple ducts, similar to that of the healthy skin . StaphylThe skin stays the largest and most exposed human body organ ,130,131,S. aureus), enabling a final release of pro-inflammatory cytokines from T lymphocytes [S. aureus is the most prevalent universal bacterial insult to chronic wounds [S. aureus (VRSA) in the USA. All infected patients embraced chronic underlying conditions, such as chronic skin ulcers and diabetes, a history of infection with MRSA and vancomycin-resistant enterococci (VRE), and a previous treatment with vancomycin. The authors suggested that VRE transferred the vanA gene to S. aureus via plasmid conjugation. This vanA gene transfer was proven [Enterococcus faecium) donated the non-integrated vanA gene to MRSA. Neopane et al. [S. aureus isolated from wounds of hospitalized patients possess a spectacular ability to form biofilms and multidrug resistance (86.7% of isolates), where 43.3% of S. aureus in biofilms were identified as MRSA. It has also conclusively been shown that [S. aureus in biofilms halt wound healing via delaying wound re-epithelialization. Even though inflammatory cells (such as macrophages) at the wound site incur tissue repair and regeneration, dysregulation of the inflammatory response can plausibly occur, converting the wound into chronic . Chronicphocytes ,140 and phocytes . A previphocytes  has estaphocytes , and limphocytes . Previouc wounds ,142,143.c wounds  have ides proven  in studie et al.  demonstrown that  S. aureuInvestigators have recently examined the properties of nanotheranostics, including antibacterial agents such as antibiotics, NPs, antibacterial peptides or polymers , photodynamic therapy (PDT), and photothermal therapy (PTT) , as showNobel metal NPs, such as silver (Ag), gold, and platinum, have long been used as therapeutic antibacterial agents ,112. GolS. aureus using aptamer-conjugated GNPs (60 nm) followed by a bead-based amplification. They used a light scattering-sensing system to detect the amplified GNPs, detecting single bacterial cells within 1.5 h. Wang et al. [S. aureus. They combined copper-based metal\u2013organic framework (Cu-MOF) NPs (size of 550 nm) modified with S. aureus aptamer and Fe3O4 modified with S. aureus aptamer. The method is based on the peroxidase-like activity of Cu-MOF NPs catalyzing 3,3\u2032,5,5\u2032-tetramethylbenzidine in the presence of H2O2, producing a yellow color. In the presence of S. aureus, the aptamer-modified Cu-MOF and Fe3O4 NPs specifically bind the surface of S. aureus cells. Following magnetic separation, Cu-MOF NPs bound to bacterial cells would be removed from the supernatant, decreasing the number of Cu-MOF NPs in the supernatant and so fading the yellow color with the increased concentration of S. aureus  that bode well in the efficient binding and detection of bacterial targets. In NP-mediated colorimetric aptasensors, NPs could assist the capturing aptamer (the bioreceptor detects and binds the target) and participate in signal conversion (by transducer or probe) . Chang eg et al.  also devThis review pioneers our understanding of the mechanisms behind the antibacterial therapeutic effects of NPs. We will begin with the mechanistic story and address a series of confusing questions to elaborate on the different mechanisms as delineated in Assuming that Ag NPs or NPs, in general, are similar to therapeutic gunshots, once the shot hits and interacts with the treated bacterial cell membranes, it forms \u201cpits\u201d that damage the membranes, increasing the permeability of bacterial membranes and killing the bacteria . Then, t+ ions [+ ions (as such or released from Ag NPs) are soft acids motivated to interact with soft bases containing sulfur and phosphorous. The interaction of Ag+ ions with sulfur-containing proteins in bacterial cell walls and thiol groups of bacterial enzymes and proteins inactivates them, damaging bacterial membranes. The interaction of Ag+ ions with phosphorus parts of DNA prevents bacterial replication [+ ions also inhibit the bacterial electron transport chain (which is membrane-bound) via facilitating the oxidation of respiratory membrane-bound enzymes (flavoprotein and cytochrome b1), eventually collapsing bacterial respiration [+ ions. Can we attribute the antibacterial mechanisms of Ag NP shots to Ag+ ions? Our previous study has pointed toward the extensive different mechanistic antibacterial actions of Ag NPs and Ag+ ions and concluded that Ag NP shots mainly damage the bacterial membranes, whereas Ag+ ions mainly target bacterial DNA [+ ions. The review extended to shape the formula that not only are the antibacterial mechanisms different, but the bacterial resistance mechanisms against Ag NP shots and Ag+ ions would also be different [The immobilization of Ag NP shots on substrates (silica) allows more contact-mode interactions between Ag shots and cells because it inhibits the sequestration of shots within the bacterial cells . Smaller+ ions . Ag+ ionlication ,165. Ag+piration ,167. Frorial DNA . A more ifferent .E. coli among other shapes of Ag NPs (spheres and rods) and even Ag+ ions. The authors also mentioned the sharing of the {111} lattice planes of the truncated triangular nanocrystals in their best antibacterial properties because of the high-atom-density {111} facets, enabling more reactivity with the bacterial cells. Similar effects of sharp edges have been echoed as damaging of bacterial membranes and killing of S. aureus and E. coli upon direct contact with the extremely sharp edges of the graphene oxide nanowalls. The nanowalls killed more S. aureus than E. coli, possessing other outer membrane protection against the damage [Would there be antibacterial properties related to the shape of NP shots? Van Dong et al.  have hige damage .Streptococcus mutans. Catalytic NPs activated the co-administered hydrogen peroxide (H2O2) rapidly under acidic conditions (pH 4.5 to 5.5), mimicking the pH within biofilms and producing in situ free radicals that concurrently degraded the EPS of biofilms and killed the bacterial cells embedded within their biofilms. Ghaseminezhad et al. [3O4 nanocomposites against S. aureus biofilms in chronic wounds. The most striking result of their investigation is that the nanocomposites were uniformly distributed within the collagen gel matrix containing deeply embedded biofilms, and S. aureus biofilms were eradicated following the administration of the magnetic field, pushing the nanocomposites within the collagen matrix. Meanwhile, Ag NPs could not eradicate S. aureus biofilms, despite releasing more Ag+ ions and producing more ROS than the nanocomposites. They finally suggested that the antibiofilm mechanisms of their nanocomposites remain murky. Qin et al. [Staphylococcus epidermidis (60 days with seven exposure cycles) to the synergetic (Ag NPs and titanium substrate) inhibition of bacterial adhesion via downregulation of the expression of biofilm-associated genes (icaA and icaD). These ica genes are virulence markers and mediate the full slime (EPS) production of S. aureus and S. epidermidis [S. mutans and Streptococcus gordonii on the enamel surface via electrostatic interactions. The cationic amino groups in the nanocomplexes neutralized the anionic bacterial surface charge, decreasing bacterial adhesion to surfaces. The nanocomplexes enhanced the flocculation of particles in the solution, reducing the cell\u2013cell adhesion [S. aureus and E. coli via physical stress and chemical effects. Bacterial sensing properties were facilitated in combination with laser-induced breakdown spectroscopy, quantifying the captured bacteria with a low detection limit. Nanowires offered shear stress and binding sites for bacterial cells and large-sized extracellular organelles . Au@Ag NPs offered other binding sites for small-sized extracellular organelles  or membrane proteins. Au cores improved the antibacterial activity of Ag shell atoms. In the same track of preventing bacterial adhesion and biofilm formation, an adhesive containing Ag NP shots releasing Ag+ ions inhibited the growth of S. mutans biofilms. Ag+ ions downregulated S. mutans glucosyltransferases  gene expressions  [P. aeruginosa biofilms [Finally, what antibiofilm mechanisms might Ag NP shots or NP shots employ in general? Unfortunately, researchers have not studied the interactive mechanisms of NPs with biofilms in much detail. There has also been a controversy between scholars regarding experimental results. Some observers attributed the antibiofilm effects of NPs to the same broad antibacterial mechanisms of NPs . However, this broad concept has been debated by other studies arguing more intricate interactive mechanisms between NPs and biofilms, taking into consideration the formation and architecture of biofilms . Gao et d et al.  investign et al.  have shedermidis . NPs coudermidis . The bacdermidis . Therefodermidis . For insadhesion . Liao etadhesion  have mannd gtfD) . Ag NP sbiofilms . We beliS. aureus is a scourge, commonly colonizing or secondarily infecting the skin of patients with atopic dermatitis [S. aureus for three consecutive days. Ag-containing polymeric or composite electrospun fibers could be a major area of interest within fields requiring the prolonged antibacterial actions of Ag NPs, including implant scaffolds [Electrospinning is an economical, practical, and simple method for the preparation of nanofibers ,182,183.rmatitis  and prodrmatitis . Dermatormatitis . In a strmatitis  used coarmatitis . Physiolrmatitis , whereasrmatitis ,201. Acirmatitis . In anotrmatitis  have elermatitis  have demcaffolds ,206 and caffolds . The moscaffolds ,192,208.caffolds ,209, heacaffolds . Biodegrcaffolds ,209, as The synthesis of star-shaped polymers is an increasingly important area in diagnosis and polymer therapeutics  because of their featured structural  properties, encapsulation capabilities (because of their 3D structure), functionalities , and heightened stimuli-responsiveness . Star poE. coli with high sensitivity. Shen et al. [+. The fluorescence of Ag nanoclusters diminished after 100 min of illumination . The combinations of properties of star polymers provide means for their efficient use for diagnosis in different forms, including fluorescent probes, contrast agents, and in vitro diagnostics . Qiu et n et al.  fabricatS. aureus and E. coli, retaining their antibacterial properties even after 20 water flush treatments. More therapeutic applications of star polymers have also been reported [E. coli (99%) within 2 h of contact. Weng et al. [Streptococcus mutans, which was unchanged after 30 days of aging in water, suggesting its potential application as long-lasting antibacterial cement. Bone repair tissue engineering represents a specific application of biodegradable star polymers due to the ease of tuning the mechanical properties and degradation time of star polymers. For example, the covalent cross-links , hydroxyl radical (OH\u2022), H2O2, and hypochlorous acid (HOCl) [2\u2212 is electrostatically motivated , binds the bacterial solvent-exposed Fe-S cluster. ROS converts them to an unstable oxidized form [2\u2212 and H2O2 inactivate the enzyme family  using the single iron atom as an enzymatic cofactor. Ultimately, a third mechanism might be associated with the indirect damage of DNA, where H2O2 produces OH\u2022, damaging the nitrogen-containing nucleobases and deoxyribose of DNA oxidatively [Photodynamic therapy (PDT) plays an essential role in selective bacterial illumination via selective PS and the efficient treatment of bacterial diseases via the produced ROS . The mead (HOCl) . Three mzed form ,222  with the carboxy group of ampicillin (AMP) via a crosslinker forming amine-functionalized CDs  as a carrier for the immobilization and delivery of AMP cargo. CDs-AMP demonstrated better antibacterial activities than free AMP against E. coli. This enhanced antibacterial activity was demonstrated by a decrease (by 40%) in the MIC of immobilized AMP due to the greater exposure of E. coli cells to larger molecules of the immobilized AMP that retained its activities even after two weeks of storage (at 4 \u00b0C in aqueous solution). CDs-AMP generated ROS (O2\u2022\u2212) under visible light illumination. The generated O2\u2022\u2212 increased with greater exposure time and visible light lamp intensity and enhanced the antibacterial activity of the conjugate, disrupting the integrity of E. coli membranes. Inspired by the exciting properties of electrospun nanofibers and the antibacterial efficiencies of PDT (without administering antibiotics), Contreras et al. [E. coli (as a model organism for this combined system) that increased with the time of light exposure  compared with PDT . Within S. aureus (nanotherapy) by secondary IgG (Immunoglobulin G)-conjugated 40 nm GNPs. A real-time assessment of the nanotherapy was exercised using a photothermal microscope (nanodiagnosis) with higher sensitivity than the transmission technique. Bound S. aureus with conjugated GNPS were irradiated with laser pulses , killing bacterial cells aptly combined with the bubble-formation phenomenon around the clustered GNPs. This apt killing was achieved as increasing the laser energy formed bubbles (life span of 0.1 and 2 ms and size of 1 to 8 \u03bcm) around the hot clustered GDNPs, penetrating bacterial cells causing local cell-wall damage and subsequent complete bacterial disintegration. Huang et al. [3O4)@Au nanoeggs and reported a temperature increase in the nanoegg suspension from 23 to about 55 \u00b0C after NIR irradiation (808 nm) for 3 min. They have further immobilized vancomycin on the surface of nanoeggs. The treated MRSA were entirely covered with the vancomycin-bound nanoeggs and killed (99%) after NIR irradiation . The magnetic properties of nanoeggs aggregated the bacterial cells and contributed to an ace photothermal effect of the vancomycin-bound nanoeggs. Wang and Irudayaraj [3O4-Aurod necklace-like probe. They further functionalized the probe with specific antibodies to E. coli and investigated its simultaneous detection, separation, and photokilling properties to E. coli within a cocktail of pathogens. The authors recorded a strong longitudinal plasmon for the probe at 765 nm, which decreased after 30 min incubation with E. coli. This decrease implied the selective binding of several antibody-bound probes to its targeted much larger E. coli cell (around 1 to 3 \u03bcm), even at a concentration as low as 102 CFU/mL. Following irradiation with NIR light (785 nm) for 15 min, the probe-bound E. coli cells were magnetically separated and cultured, showing no grown colonies and implying probe absorption to adequate energy after excitation in the NIR region killing the targeted E. coli.In PTT studies using GNPs, Zharov et al.  developeg et al.  preparedudayaraj  assemble3O4 MNPs also possess photothermal properties under NIR light illumination, where Tsai-Jung et al. [3O4/alumina core/shell MNPs specifically targeted and inhibited the cell growth of antibiotic-resistant nosocomial bacteria by over 95% within 10 min of illumination. Moreover, the graphene-based PTT was investigated by Wu et al. [S. aureus and E. coli after NIR laser irradiation and in comparison with magnetic reduced graphene oxide (MRGO) and magnetic carbon nanotubes functionalized with GA (MCNGA)  conjugated to methylene blue (PS)-modified aptamer. This combined nanoplatform serves for selective detection and separation, fluorescence imaging, and MRSA destruction within 40 min from binding. Several nanoplatforms are bound to one MRSA cell because of their smaller size (one order of magnitude) than the size of MRSA cells. PTT heat destruction of MRSA cells was facilitated by the induction of plasmonic Au shell by the NIR light (670 nm). The methylene blue developed NIR fluorescence images after magnetic separation (capture efficiency of 96%). Methylene blue simultaneously served as a PS facilitating PDT ROS production after light irradiation and a synergistic agent during PTT, destroying MRSA cells.Similar to GNPs, Feg et al.  have fouu et al. , preparin et al.  went on Pseudomonas aeruginosa in chronic wound biofilms [The depressing concept of \u201ccommunity prescribing\u201d antibiotics promotes the trend of growing antibiotic resistance and remains futile, given that they are often improperly employed to target viral respiratory infections . The conbiofilms  and SCVsbiofilms . Moreovebiofilms . The devbiofilms ,91. Tailbiofilms . In contbiofilms ,70.E. coli and P. aeruginosa against Ag NPs (28 nm) due to the production of adhesive flagellum protein (flagellin), aggregating Ag NPs to reach 480 nm. Strikingly, the emerged resistance-like mechanism did not involve any genetic change. Ag-resistance genes have also been reported in Salmonella plasmid isolated from a hospital burn ward [E. coli chromosomes [2+) ions mediate the conjugative transfer of plasmid-encoded antibiotic resistance genes from E. coli to Pseudomonas putida. Horizontal gene transfer was stimulated by ROS (induced by the CuO NPs and ions), damaging bacterial DNA, activating the SOS response, and encouraging the conjugative gene transfer [To date, there is a paradox in the actual antibacterial mechanisms of the action of NPs. Data from several studies suggest that the ROS produced by active NPs  are the key players of the antibacterial properties. However, a considerable amount of the literature has refuted any link between the antibacterial properties of NPs and bacterial metabolism. Several other attempts have been made to attribute the antibacterial properties of NPs to a sum of those mentioned above three fundamental mechanisms . Therefore, several questions remain to be answered to unravel the antibacterial mechanisms of different NPs in different media conditions using unified standard procedures . If produrn ward  and theiomosomes . Recentltransfer . Speaking on the possible induced toxicities by nanotherapeutics, an ideal agent would facilitate selective characteristics for the diseased tissue and a therapeutic effect and demonstrate safety, biodegradability, and lack of immunogenicity . RegardiAlthough electrospun polymeric nanofibers are considered empowered antibacterial wound dressings, incorporating antibacterial agents (via blending followed by electrospinning or core\u2013shell electrospinning or nozzle-free electrospinning) into the nanofibers and their commercialization remain incompetent ,190. FirThe biostability and biodegradability of star polymers are essential criteria that should coincide with their potential applications. The perfect star polymers are stable in maintaining their functions and then sharply biodegrade into non-toxic small molecules that could be eliminated from the body. The tactics for tailoring the biodegradability of star polymers are (i) synthesizing biodegradable arms via using biodegradable polypeptides, polymers  and PCL), and cleavable linkers; (ii) manufacturing biodegradable cores via biodegradable multi-functional molecules  and cleavable linkers; and (iii) compiling biodegradable arms, cores, and linkers . A potenAs hospital settings\u2019 role as a source of nosocomial HA-MRSA infections has been outlined above, combating MRSA infections could be achieved by limiting unnecessary hospital visits and performing hand hygiene that is shown to be effective in preventing MRSA. Applying measures, such as isolating MRSA infected patients, using protective gear, reducing inappropriate administration of broad-spectrum antibiotics, and screening MRSA and eradicating MRSA in colonized patients and healthcare workers should be adequate measures to curb MRSA infections . We propS. aureus form would improve our ability to control chronic tolerant infections [S. aureus persisters with daptomycin has also shown a five-fold increase in the killing of persisters in one hour. This synergistic glucose\u2013daptomycin effect could be attributed to glucose induction to specific carbohydrate transport proteins, increasing the susceptibility to daptomycin, or to glucose stimulating the release or activity of cell-lytic proteins, enhancing the action of daptomycin [Regarding the biofilm dilemma, understanding the mechanism behind how persisters of fections  instead fections . The acyfections . Adding ptomycin . TherefoS. aureus into such electrospun wound dressings controlling atopic dermatitis, then the successful development of what we call \u201cmultifunctional theranostic nanofibers\u201d would be achieved. We believe that electrospun wound dressings could serve as multi-functional smart dressings, controlling atopic dermatitis. We propose using star polymers with UV-light responsiveness for electrospinning, where we can benefit from UV-light for both phototherapy and controlled unloading of corticosteroids and antibiotics as an effective topical treatment of atopic dermatitis. If researchers incorporated NPs mediating the diagnosis of We are coming now to the critical point of biocompatibility and safety of nanotheranostics, which could be comprehensively reviewed in a separate manuscript. A recent review has highlighted that every distinct form of Ag NP is considered a separate compound with distinctive physicochemical properties and unique antibacterial and resistance mechanisms . We woulS. aureus resistance and biofilm (lifestyle and myths surrounding it) clinical infections associated with implants and wounds. Numerous promising antibacterial nanotheranostic systems have been described in this comprehensive review. Whereas the literature is beginning to scratch the surface of the working mechanisms of antibacterial nanotheranostics, this tutorial review has unraveled the detailed antibacterial and antibiofilm mechanisms of nanotheranostics, allowing efficient therapy and rapid diagnosis to curb S. aureus infections competently. We have sought to provide one of the first attempts to thoroughly criticize the reviewed literature and provide detailed appraisals for combating S. aureus infections. Our \u201cthree action appraisals\u201d are are follows. (i) First, there are preventive actions that would have two wings. The first general wing includes avoiding unnecessary hospital visits, hand hygiene, and legislations against over-the-counter antibiotics, especially in developing countries. Our second wing of recommended prevention actions includes preventing the adverse side effects of the NPs from resistance and toxicity. On the one hand, preventing developed resistance against NPs could be started by establishing standard testing procedures and breakpoints of bacteria\u2019s susceptibility to NPs, simulating the standard breakpoints of antibiotic susceptibilities. On the other hand, the toxicity should be avoided by dealing with every single batch of synthesized NPs as a separate material that should be thoroughly examined for toxicity in vitro and in vivo, following standard toxicity tests for NPs. (ii) Theranostic actions include considering NPs combined with antibiotics, glucose, or antiviral drugs, and \u201cmultifunctional theranostic nanofibers\u201d to diagnose and treat S. aureus infections. We believe in the promising feasible application of these multifunctional theranostic nanofibers in a short time. This belief is based on the fact that the theranostic nanofibers would be applied topically, for example, on wound dressings, against the notorious skin pathogen S. aureus. This topical application would decrease the burden of safety issues for NPs without neglecting the necessary toxicity tests that would remain crucial before applications. (iii) Scientific actions include scientific collaborations between multidisciplinary scientists and the international implementation of these appraisals, especially establishing standard testing procedures to close the open uncertainty loop surrounding NPs and their further application as nanotheranostics. Here, we have focused on deciphering the problematic S. aureus) and anti-coronavirus nanotheranostics to determine the clinical efficacy of such systems. Ultimately, we propose the promising employment of nanotheranostics with their detection and detailed antibacterial and antibiofilm properties to curb S. aureus and their biofilms in different fields where they are implicated. Such employment could span across the medical, environmental, and agricultural sectors.A fruitful area for further work would be the implementation of PDT and PTT systems in photodynamic therapy and radiotherapy directed for cancer treatment. We also want to direct the reader\u2019s attention to the following recent, authoritative, and interesting literature to considerably investigate other antibacterial and anti-biofilm drug delivery or nanotheranostic systems (e.g., liposomes ,252, pol"}
+{"text": "NKAE cells were cultured with irradiated Clone9.mbIL21 cells. Then, cells were transduced with an NKG2D-4-1BB-CD3z-CAR. CAR-NKAE cells exhibited no evidence of genetic abnormalities. Although memory T cells were more stably transduced, CAR-NKAE cells exhibited greater in vitro cytotoxicity against MM cells, while showing minimal activity against healthy cells. In vivo, CAR-NKAE cells mediated highly efficient abrogation of MM growth, and 25% of the treated mice remained disease free. Overall, these results demonstrate that it is feasible to modify autologous NKAE cells from MM patients to safely express a NKG2D-CAR. Additionally, autologous CAR-NKAE cells display enhanced antimyeloma activity demonstrating that they could be an effective strategy against MM supporting the development of NKG2D-CAR-NK-cell therapy for MM.CAR-T-cell therapy against MM currently shows promising results, but usually with serious toxicities. CAR-NK cells may exert less toxicity when redirected against resistant myeloma cells. CARs can be designed through the use of receptors, such as NKG2D, which recognizes a wide range of ligands to provide broad target specificity. Here, we test this approach by analyzing the antitumor activity of activated and expanded NK cells (NKAE) and CD45RA New-generation drugs have improved the quality of life and survival among multiple myeloma (MM) patients , but curSeveral groups have developed methods to modify lymphocytes for improved antitumor efficacy \u20137, and t+ T cells, NKT cells, and some T-cell subsets (CD4+ and \u03b3\u03b4+) [Chimeric antigen receptor (CAR) cell products can further augment immune potential . CAR celand \u03b3\u03b4+) . NKG2D rand \u03b3\u03b4+) \u20136 that aand \u03b3\u03b4+) , 13. Oveand \u03b3\u03b4+) \u201316. Prevand \u03b3\u03b4+) .CAR-T cells are most commonly used effector cell type; however, therapy with CAR-T cells can be associated with life-threatening toxic effects, such as cytokine release syndrome (CRS) and neurotoxicity , 19. AddOur group has delivered large numbers of activated and expanded autologous NK cells (termed NKAE), which showed good clinical results without toxicity , establiInvestigations were performed using fresh peripheral blood (PB) samples from MM patients  was designed and synthesized by Song et al. . Charact6 cells/mL. The following day, transduction was performed with a multiplicity of infection (MOI) of 5, on plates coated with RetroNectin\u00ae . Two days later, cells were harvested for experiments.PB mononuclear cells (PBMC) were isolated by centrifugation over a density gradient. Then PBMCs were activated and expanded for 10 days, achieving NKAE-cell expansion by co-culture with irradiated Clone9.mbIL21 feeder cells in RPMI medium supplemented with 10% human AB serum  plus 100 IU/mL IL-2 , as previously described . NKAE ce+ cells were depleted by labelling of PBMCs with CD45RA microbeads (Miltenyi Biotec) for magnetic cell separation according to the manufacturer\u2019s instructions. Purified CD45RA\u2212 cells were primed at 2\u2009\u00d7\u2009106 cells/mL overnight in X-VIVO-15  supplemented with 250\u2009IU/mL IL-2, 10\u2009ng/mL anti-CD3 (OKT3), and 10\u2009ng/mL anti-CD28 antibody (28.2) . The following day, transduction (MOI\u2009=\u20095) was performed on RetroNectin\u00ae-coated plates. After 10 days, the cells were harvested for experiments.CD45RAFlow cytometry was performed on a BD FacsCanto II\u2122 cytometer . Supplemental Table http://www.sanger.ac.uk/genetics/CGP/Census/).To exclude chromosomal aberrations in CAR-NK cells and NKG2D-CAR-T cells, we performed comparative genome hybridization (CGH) arrays using the KaryoNIM\u00ae STEM CELLS platform . DNA from samples and commercial reference sex-matched DNA (Promega Biotech) were hybridized. Bioinformatic analysis was performed using the genomic construct hg19 and Aberration Detection Method . The minimum number of consecutive alterations was set as 5. Duplications or deletions related to the genomic instability and anomalous proliferation of 407 genes were analyzed according to the Cancer Gene Census list  performed as previously described . U-266, 2). MM cells were suspended in methylcellulose  and seeded in triplicate, in a humidified chamber. Plates were incubated for 14 days , and colonies were counted. Representative images were acquired with a G:BOX Chemi XX6 transilluminator and analysis was performed using GeneSys image acquisition software .Colony-forming assays were performed to evaluate NKAE and CAR-NKAE-cell cytotoxicity against clonogenic MM cells . MM cellCells were prepared as described in the PrkdcscidIl2rgtm1Wjl/SzJ (NSG) male mice  were irradiated (1.5\u2009Gy) and intravenously injected with either 5\u2009\u00d7\u2009106 U-266-GFP-luc cells or PBS (Control). Three days later, the mice were infused with one single injection of 15\u2009\u00d7\u2009106 of untransduced NKAE cells, CD45RA\u2212 T cells, NKG2D-CAR-expressing NKAE cells, or NKG2D-CAR-T cells via intravenous tail injection. Mice were divided into five groups: group 1 received 5\u2009\u00d7\u2009106 MM cells; group 2 received 5\u2009\u00d7\u2009106 MM cells and 15\u2009\u00d7\u2009106 untransduced NKAE cells; group 3 received 5\u2009\u00d7\u2009106 MM cells and 15\u2009\u00d7\u2009106 NKG2D-CAR-NKAE cells; group 4 received 5\u2009\u00d7\u2009106 MM cells and 15\u2009\u00d7\u2009106 CD45RA\u2212 T cells; and group 5 received 5\u2009\u00d7\u2009106 MM cells and 15\u2009\u00d7\u2009106 CD45RA\u2212 CAR-T cells. Tumor progression was evaluated every 2 weeks using the In-Vivo Xtreme Preclinical Optical/X-ray Imaging System , with imaging beginning 5\u2009min after intraperitoneal injection of an aqueous solution of D-luciferin potassium salt (200\u2009mg/kg) . Non-obese diabetic (NOD) Cg-http://sourceforge.net/projects/bbmap/). The resulting reads were analyzed with Nextpresso pipeline as described in the Ribosomal RNA was depleted with the NEBNext rRNA Depletion Kit (E6310L) and RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760S) following manufacturer\u00b4s instructions. Reads were sequenced in paired-end fashion (76\u2009bp\u2009\u00d7\u20092) in a NextSeq 550 sequencer, with a High Output v2 kit. Adapters and remaining ribosomal sequences were removed with bbduk . Flow cytometry data are presented as median and interquartile range (IQR). Normal distribution and homoscedasticity were confirmed. Then, assay data were compared using the Student\u2019s All patients and healthy donors provided written informed consent in accordance with the Declaration of Helsinki, and the study was approved by the Hospital Universitario 12 de Octubre Institutional Review Board.Mice were maintained in pathogen-free conditions and experiments were performed in accordance with the EU, CIEMAT and Instituto de Investigaci\u00f3n Sanitaria Hospital Universitario 12 de Octubre guidelines upon approval of the protocols by the Environment Department in Comunidad de Madrid, Spain (PROEX 191.2/20).We analyzed samples from 9 MM patients and 9 MM cell lines for surface expression of NKG2D ligands . NKG2DL expression widely varied among patients\u2019 samples Fig.  and S4A.Compared to cell lines, MM samples exhibited lower expression of MICA and ULBP-3. Defining positive expression as >5% positive cells for one marker, 44.4% of patients were positive for MICA, 100% for MICA/B, 66.7% for ULBP-1, 88.9% for ULBP-2, and 22.2% for ULBP-3. Patient MM cells widely varied in expressions of MICA/B (93.8\u20135.91%) and ULBP-1 (81.28\u20130.7%)  at 5 days post-transduction. Compared to NKAE cells, memory T cells were more efficiently and stably transduced, and maintained increased NKG2D expression even up to 15 days post-transduction . At 24\u2009h post-transduction, CAR-NKAE cells showed an increased percentage of NKG2D-positive cells and increased median fluorescence intensity (MFI) Fig. . Howeverion Fig. .Fig. 2NK\u2212 T cells and CD45RA\u2212 CAR-T cells .NKAE cells showed robust cytotoxic activity against the U-266 MM cell line, and destroyed 77.7% of MM cells at the maximum E:T ratio tested (32:1). Compared to untransduced NKAE cells, CAR-NKAE cells exhibited improved cytotoxicity, destroying 100% of MM cells at a lower E:T ratio (8:1)  when compared to OPM-2  or L-363  Fig. .2\u2009=\u20090.99989), ULBP-1 (R2\u2009=\u20090.99452), ULBP-2/5/6 (R2\u2009=\u20090.91222), and ULBP-3 (R2\u2009=\u20090.99533)  Fig. .Time-lapse microscopy confirmed CAR-NKAE cells antimyeloma activity and revealed that CAR-NKAE cells had equal migration and adhesion capacity compared to memory CAR-T cells and NKAE , TNF-\u03b1 (p\u2009=\u20090.015), granzyme A (p\u2009=\u20090.009), granzyme B (p\u2009=\u20090.013), perforin (p\u2009=\u20090.0176), granulysin (p\u2009=\u20090.0132), sFas (p\u2009=\u20090.0401), and sFasL (p\u2009=\u20090.022) than untransduced T cells   Fig. .Fig. 6CAMice receiving NKAE cells and CAR-NKAE cells survived twice as long as mice in the untreated control group (MM group). However, mice receiving memory T cells or CAR-T cells survived as long as the untreated group Fig. A and 7C + cells, CD56+ CD16+ NK cells and CD45RO+ memory T cells) were detected in PB 10 days after infusion: NKAE cells (17.3%\u2009\u00b1\u20093.97) and memory T cells (11.31%\u2009\u00b1\u20090.92). CAR-transduced cells were also detected; however, persistence was lower than that of untransduced cells: CAR-NKAE cells (3.51%\u2009\u00b1\u20091.26) and CAR-T cells (1.49%\u2009\u00b1\u20090.49). Although a decrease was observed, NKAE were able to persist until 20 days in PB (0.82%\u2009\u00b1\u20090.1) after infusion as well as CAR-NKAE cells (0.16%\u2009\u00b1\u20090.03), memory T cells (3.55%\u2009\u00b1\u20090.72), and CAR-T cells (0.78%\u2009\u00b1\u20090.2)  was observed for untransduced T cells (46.88%\u2009\u00b1\u20091.85) and CAR-T cells (46.6%\u2009\u00b1\u20093.2).Effector cells (human CD45.2) Fig. . An effe\u2212 T cells were mostly CD4+ (95.65%\u2009\u00b1\u20090.46 and 93.3%\u2009\u00b1\u20090.07) and exhibited a TEM phenotype, 74.45%\u2009\u00b1\u20096.4 and 87.95%\u2009\u00b1\u20091.02 for T and CAR-T cells, respectively.To analyze the migratory potential of the cells, flow cytometry of mice bone marrow was performed. NKAE cells and T cells were detected into the bone marrow 7 days and 14 days after infusion, respectively  and CCD-18Co (colon) cell lines and allogeneic PBMCs, with a basal expression of NKG2D ligands, were exposed to CAR-transduced NKAE cells. CAR-NKAE cells showed low cytotoxicity against lung cells and PBMCs, and higher-than-expected cytotoxicity against colon cells. Untransduced NKAE cells and CAR-NKAE cells exhibited similar toxicity profiles Fig. .Fig. 8ToCAR-T-cell therapy usually produces graft vs. host disease (GvHD) roughly within two months of treatment . HoweverCAR cell products are a promising new weapon against MM, but challenges include finding specific tumor-associated antigens and reducing CAR-related toxicities . SeveralThe advantage of NKG2D-CAR therapy is to achieve high activity against tumor cells regardless of cell type. All analyzed primary MM samples exhibited high expression at least of one NKG2DL, and we previously found that resistant and clonogenic MM tumor cells expressed NKG2DL . Thus, iNK-cell lines can be used to produce CAR-NK cells, representing a renewable source that enables easy attainment of large cell numbers. However, they are derived from NK-cell neoplasia, and require irradiation before infusion, which significantly reduces their persistence in vivo and their clinical efficacy . We prev\u2212 T cells) expressing NKG2D [Memory T cells from MM patients were easily expanded and transduced with NKG2D-CAR, but showed weak cytotoxicity compared to CAR-NKAE-cell products, suggesting that autologous memory CAR-T cells therapy may not be effective in MM. Several methods can be used to produce allogeneic memory CAR-T cells  and different cloning vectors (retrovirus vs. lentivirus). Chang et al. tested the cytotoxic activity against hematological cell lines, but not against MM, and found high cytotoxicity . In a xeXiao et al. employed NKG2D-CAR-expressing NK cells generated by RNA electroporation, containing DAP12 or CD3\u03b6 as the signaling domain . RNA eleMultiple studies describe engineering CAR-NK cells from NK-cell lines expressing NKG2D. NK-92 is most commonly used since it shows reproducible high cytotoxicity . ComparePatient-derived NKG2D-CAR-T cells show efficacy against MM in vitro and in vivo using an NKG2D-CAR comprising the NKG2D receptor extracellular domain fused with CD3\u03b6 , 57. NKGIn summary, this is the first report demonstrating the reproducibility and feasibility of using autologous NKAE cells bearing NKG2D-CAR to treat MM and showing that CAR-NKAE cells are a better strategy against MM than memory CAR-T cells. We also demonstrated that merging ex vivo expansion and activation of primary NK cells and NKG2D-CAR transduction is a feasible approach. NKAE cells were transduced and NKG2D-CAR transduction enhanced the potent antitumor activity both in vitro an in vivo. While memory T cells are also susceptible to CAR transduction, they were not effective against MM in an autologous setting. In contrast, autologous CAR-NKAE cells displayed strong cytotoxic activity with no signs of toxicities, and completely abrogated MM growth in a mouse model. These results support the use of autologous NKG2D-CAR-expressing NKAE cells as a treatment for refractory MM.Supplemental material"}
+{"text": "Dynamic control over protein function is a central challenge in synthetic biology. To address this challenge, we describe the development of an integrated computational and experimental workflow to incorporate a metal-responsive chemical switch into proteins. Pairs of bipyridinylalanine (BpyAla) residues are genetically encoded into two structurally distinct enzymes, a serine protease and firefly luciferase, so that metal coordination biases the conformations of these enzymes, leading to reversible control of activity. Computational analysis and molecular dynamics simulations are used to rationally guide BpyAla placement, significantly reducing experimental workload, and cell-free protein synthesis coupled with high-throughput experimentation enable rapid prototyping of variants. Ultimately, this strategy yields enzymes with a robust 20-fold dynamic range in response to divalent metal salts over 24 on/off switches, demonstrating the potential of this approach. We envision that this strategy of genetically encoding chemical switches into enzymes will complement other protein engineering and synthetic biology efforts, enabling new opportunities for applications where precise regulation of protein function is critical. Dynamic control over protein function is a central challenge in synthetic biology. Here the authors present an integrated computational and experimental workflow for engineering reversible protein switches; metal-chelating unnatural amino acids genetically encoded into two conformationally dynamic enzymes to yield robust switches. Many enzymes also possess regulation and control mechanisms to ensure that they can respond to environmental stimuli2. Leveraging these remarkable properties for chemical synthesis has long appealed to chemists and synthetic biologists4, but current enzyme engineering strategies largely focus on improving catalytic properties or changing substrate specificity5. These engineering strategies often neglect native control capabilities like allosteric regulation, which can be inefficient for non-native substrates6, or lost without selection pressure as has been observed in several directed evolution approaches10. Most engineered enzymes are used in highly optimized single-reaction processes12 where allosteric control is not needed and could even be detrimental. The need for modular, orthogonal methods to control enzyme activity in a stimulus-dependent manner, however, has become increasingly apparent13 for efforts to evolve proteins for in vitro multi-enzyme cascade catalysis3, diagnostic tools16, biosensing18, and construction of novel signaling circuits19.Naturally occurring enzymes have evolved to catalyze chemical reactions, in many cases, with exquisite selectivity, substrate specificity, and high catalytic rates20. Chimeric systems have also been developed to couple a naturally responsive protein to a protein of interest (POI) so that regulation of the former allows for control over the latter21. Optical regulation is particularly notable in this regard given that it allows for precise spatiotemporal control of protein function22. This approach is commonly achieved by fusing a POI to the light-oxygen-voltage (LOV) responsive domain of plant phototropins, which can control protein function through blue-light induced conformational changes 23. Optogenetic dimerization has been successfully implemented in systems that utilize LOV domains25 and those based on Arabidopsis thaliana cryptochrome 2 (CRY2)26. These approaches often require that large  regulatory domains be used28, and achieving efficient regulatory transduction between domains can require extensive protein engineering29. Finally, de novo design has been used to produce switchable proteins31, but switching has only been reported in response to peptides and proteins, and de novo design of switchable enzymes has not been reported.A key challenge to engineering dynamically regulated enzymes is the complex interplay between catalytic activity, substrate specificity, and regulation. For example, while native allosteric proteins have been engineered to respond to new stimuli, this control typically applies to the native protein function, frequently DNA binding32, hydrazines and aldehydes form hydrazones in the presence of anilines33, and bipyridines bind metal ions to form bis- or tris-bipyridine complexes34. We reasoned that amber codon suppression methods35 could be used to genetically encode non-canonical amino acids (ncAAs) that contain the reactive functional groups  found in synthetic switches. Previous studies have established that ncAAs can be integrated into proteins and peptides to reversibly control conformation36. Recently it has also been shown that ncAAs can be used to control protein function38, although most examples rely on irreversible mechanisms like deprotection of caged residues41. Reversible control of protein function has been demonstrated by incorporating light-responsive ncAAs, such as those based on azobenzenes, into an enzyme that is already subject to allosteric regulation42. Key to our approach, however, is the use of LGs to control the conformation of proteins that are not already subject to allosteric control to enable reversible control over enzyme catalysis. LG incorporation would involve minimal disruption of protein structure and would only require that the LGs can be placed in an orientation to disrupt catalysis upon metal binding. The structural simplicity of the LG approach, however, belies the potential difficulty of engineering systems in which two LGs impart suitable switching properties.We envisioned that small molecule switches that undergo reversible formation or cleavage of covalent bonds in the presence of different stimuli could be integrated into enzymes to enable regulation of catalysis. For example, boronic acids and diols form boronic esters at low pH\u03b2-C\u03b2 distance between enzyme conformations. Enzyme variants containing LG pairs at candidate sites were then designed and rapidly prototyped using cell-free protein synthesis (CFPS)43 and high-throughput experimentation (HTE) to select active enzyme variants with metal-dependent activity for analysis. Metal-responsive variants44 of two distinct enzymes not subject to native allosteric control were thus engineered by disrupting catalytically relevant conformational dynamics via LG-metal binding. This approach complements existing methods for tuning enzyme catalysis and providing a means to genetically encode functionally orthogonal control elements to regulate enzyme catalysis.To address this difficulty, here we developed a framework to design, build, test, and analyze enzymes with genetically encoded chemical switches. Initial efforts focused on bipyridine (Bpy) LGs that could induce reversible activation of enzymes in the presence/absence of metal salts Fig.\u00a0. Specifi2. By perturbing the populations of these states via covalent bond formation and cleavage under different conditions, LGs could be used to regulate enzyme activity in a stimulus-responsive manner. We selected prolyl oligopeptidase (POP), from the hyperthermophilic organism Pyrococcus furiosus (Pfu) as a model test case for LG regulation of enzyme activity. POP is a serine protease that hydrolyzes small peptide substrates containing proline residues45, and it is not subject to native allosteric regulation. The POP structure comprises a \u03b2-propeller domain that controls substrate access to the active site and a peptidase domain that contains a Ser-His-Asp catalytic triad. MD simulations revealed that POP undergoes spontaneous domain opening/closing that provides a dynamic port of entry for substrates and orients the catalytic triad His residue into a catalytically competent position46. Suitably placed LGs could therefore provide a means to control POP conformation and peptidase activity.Allosteric modulation of enzyme activity requires an enzyme that can adopt at least two states possessing different activity\u03b2-C\u03b2 distance to prohibit bond formation in a different conformational state , and (iv) are placed on opposite domains of the enzyme 2 complex was analyzed to establish that a distance of approximately 10.5\u2009\u00c5 would allow for formation of a metal bis-BpyAla complex, M(BpyAla)2, at the interface of the \u03b2-propeller and peptidase domains of POP  are close enough in space to enable covalent bond formation between LG pairs in one enzyme conformational state , (ii) are solvent exposed to allow the proper chemistry to take place, (iii) undergo suitable changes in Cyme Fig.\u00a0. BecausePOP Fig.\u00a0. Pairs oons Fig.\u00a0. As a reE. coli-based CFPS platform50 to synthesize proteins containing two BpyAla residues in response to the amber stop codon. BpyAla and aminoacyl-tRNA synthetase (BpyRS)47 concentrations were combinatorially optimized using a sfGFP reporter containing two premature amber stop codons (2TAG-sfGFP) to enable 2TAG-sfGFP expression at yields comparable to wild-type (WT) sfGFP, and BpyAla incorporation was verified by intact protein ESI-MS  at an average yield of 1098\u2009\u00b1\u2009124\u2009\u03bcg/mL within a 15\u2009\u03bcL CFPS reaction, comparable to WT protein  released by enzymatic hydrolysis of Z-Ala-Pro-pNA  at higher concentrations of Ni(II) while maintaining >75% of WT activity in the absence of metal  relative to the apo protein at the highest concentration of metal tested  inhibition in the presence of 0\u20131,000-fold molar excess of Ni(II) relative to enzyme , Co(II), Zn(II), and Fe(II) , Co(II), and Zn(II) in a dose-dependent manner, but only the latter two were inhibited by Fe(II). POP167/513, which was activated by Ni(II), was also activated by Cu(II) and Co(II) but not Zn(II) or Fe(II)  Fig.\u00a0. While W14\u20131018 (Fe < Co < Zn < Ni < Cu), which exceed values for M(Bpy)2 complex formation and thus should enable reversibility by competition52. All POP variants were incubated with 1000-fold excess metal, exposed to 2\u2009mM EDTA, and assayed to measure activity. Nearly all enzymes tested with Ni(II), Cu(II), Co(II), or Zn(II) displayed near-quantitative recovery of activity upon addition of EDTA 2 complex involving Bpy LGs.The reversibility of POP variant inhibition/activation was examined by adding a competitive chelator, ethylenediaminetetraacetic acid (EDTA), to reactions conducted using the workflow outlined above Fig.\u00a0. EDTA foDTA Fig.\u00a0. Recover167/517, POP169/510, POP159/517, POP169/512 and POP167/513, which exhibited the highest degrees of reversible inhibition or activation by metal salts in our HTE workflow, by analyzing initial rates   because saturating substrate concentrations under these conditions were beyond the solubility limit of the substrate. Notably, POP167 and POP517 displayed only 1.1- and 1.4-fold changes in rate, respectively  Fig.\u00a0. kcat anage Fig.\u00a0. A 1:1 m167/517 were evaluated relative to WT POP. The enzymes were preincubated with Ni(II) or EDTA before an aliquot was removed to assess activity, which allowed the same enzyme sample to be switched between metallated and apo forms  or EDTA -mediated activity switching for POPrms Fig.\u00a0. WT POP DTA Fig.\u00a0. The enz2 linkage had thus far been inferred from the effects of added metal salts on POPX/Y variant activity. Addition of Ni(II) to a solution of apo POP167/517 led to a mass spectrum with a low m/z feature consistent with the presence of both one and two Ni(II) ions and a second high m/z feature consistent with the presence of a single Ni(II) ion  by both BpyAla residues. Single metalation was also observed for both POP167 and POP517 in the presence of Ni(II), but only the low m/z feature was observed for these, consistent with metal binding with an open conformation -BpyAla binding, since all evidence suggesting the involvement of the intended M(BpyAla)ion Fig.\u00a0. The hig2 linkage in POP167/517 was obtained from circular dichroism spectroscopy and UV\u2013vis spectroscopy  exhibit minimal absorbance in the UV\u2013vis region54, the corresponding Fe(II)(Bpy)n complexes possess a strong MLCT55 absorption at ~520\u2009nm. This feature was observed upon addition of Fe(II) to solutions of apo POP167, POP517, and POP167/517, and the higher molar extinction coefficient of the latter is consistent with the formation of a Fe(II)(BpyAla)2 linkage  in the POP167/517 scaffold to form the intended Fe(II)(BpyAla)2 linkage. The same high m/z feature was observed by intact protein ESI-MS upon addition of Fe(II) to POP167/517 as was observed in the presence of Ni(II)  opy Fig.\u00a0. While sII) Fig.\u00a0, these dPhotinus pyralis luciferase (Pluc) variants. Pluc is a genetic reporter used in the life sciences58, and the ability to switch its activity in response to metal ions may prove useful for biosensing applications. Structurally, Pluc requires a large conformational change between its N- and C-terminal domains to first adenylate luciferin and then catalyze oxygen-dependent decarboxylation to form oxyluciferin and light59. MD simulations based on Pluc structures in both catalytic conformations were used to design 22 Pluc variants with BpyAla residues situated at sites that would allow reversible trapping in one conformation or the other  and were inhibited in a dose-dependent manner by Ni(II) , but Vmax values for Pluc202/532 and Pluc108/508 decrease by 20-fold and 8.4-fold, respectively (Table\u00a0M for luciferin was reduced by a factor of 10 in the presence of Ni(II) for the Pluc202/532 variant, which was selected based on the initial luciferin-binding form of the enzyme and could therefore reflect trapping of a conformation better suited to bind luciferin. Total catalytic efficiency (Vmax/KM) in the presence and absence of metal is 463 and 1005 RLU/\u03bcM, respectively, for Pluc202/532 and 709 and 19210 RLU/\u03bcM, respectively, for Pluc108/508. Our results show that the Bpy LG can be used to regulate the activity of structurally distinct enzymes that catalyze unrelated chemical reactions in a stimulus-driven manner.Metal-dependent regulation of Pluc activity was then examined by incubating the variants with different Ni(II) concentrations and assaying luciferase activity in a saturating amount of luciferin and ATP. Two variants, PlucII) Fig.\u00a0. Steady-Pfu POP and Pluc, with high yields and only modest impact on the activity of functional variants in the absence of metal, highlighting its functional-orthogonality and potential utility for proteins that may not accommodate large conformationally responsive domains or the introduction of new catalytic sites. The optimal POP variant displays up to a 20-fold dynamic range in response to metal salts and can be switched on/off 24 times with no significant loss in activity, rivaling the best-performing reversible switches reported to date61. A similar dynamic range was observed in Pluc, showing the extensibility of LG regulation.In this study, we established an integrated computational and experimental workflow to incorporate a metal-responsive chemical switch into proteins. The workflow uses MD simulations to help minimize experimental design validation and CFPS to synthesize designed variants in high yields sufficient for direct assay. The latter technique enabled a rapid screening approach using HTE to prepare and monitor designs exhibiting different phenotypes  in 384-well plates. While this workflow is limited to enzymes that have substrates, products, or cofactors compatible with high-throughput measurement such as those with optical, fluorescent, or luminescent properties, it nevertheless facilitates screening of many types of enzymes. For example, the activity of any enzyme that oxidizes or reduces NADH could be measured in real-time using this workflow. This HTE approach enabled us to engineer a switch, comprising a pair of genetically encoded BpyAla residues that are strategically incorporated so that reversible metal coordination would bias enzyme conformational states. The Bpy LG was incorporated into dozens of sites in two structurally distinct enzymes, 2 complex, which alters enzyme conformational landscapes to inhibit catalytic turnover. In this sense, the genetically encoded BpyAla residue allows facile access to the dynamic metal-ligand bonding with tunable bonding strength and specificity found in naturally occurring metalloproteins that have far more complex metal coordination environments and regulation transduction networks62. BpyAla has been used to generate metallocofactors in artificial metalloproteins63 and metalloenzymes64, to stabilize protein motifs like coiled coils65, and to template protein self-assembly66, highlighting its propensity to form stable M(BpyAla)n complexes in a variety of protein contexts. This ability likely underpins the high stability of POP167/517 relative to WT POP during activity switching even at elevated temperatures and high salt concentrations and suggests that M(II)(BpyAla)2 complex formation plays a dual structural/functional role similar to metal binding in many natural67 and some artificial metalloenzymes68. Despite its thermodynamic stability, reversible BpyAla-metal binding at domain interfaces distal to enzyme active sites enables metal-responsive44 allosteric control over catalysis.Kinetic, spectroscopic, and computational evidence indicates that switching by Bpy LG pairs involves reversible formation of the intended M(II)(BpyAla)167/517, several observations suggest that significant improvements to LG switching could be realized. For example, Bpy LG pairs led to the intended metal-dependent inactivation in most POP variants, but some variants were activated . In addition, while the design process outlined in Fig.\u00a02 complexes, several variants displayed modest specificity for other metal ions  synthetase (aaRS):tRNA pairs suitable for LG incorporation70 and improved methods for incorporating two unique ncAAs74.Even given the excellent switching properties exhibited by POP3 for systems that can tolerate added metal salts and chelators. These applications would be facilitated by immobilized chelators or enzymes to minimize accumulation of chelator or both metal and chelator, respectively, since these components could adversely affect particular enzymes. While removal of these components cannot be readily achieved in vivo, it may also be possible to use metal switching for in vivo sensing14, and other applications19 where reversible regulation is not required.Looking forward, we anticipate that genetically encoded chemical switches installed into proteins using the integrated computational/experimental approach described here will enable new strategies for protein engineering and synthetic biology. This capability could expand opportunities for controlling multi-enzyme biocatalysis in vitropNA in DMSO was spotted into each well of a clear, flat-bottom 384-well plate from a source plate using the Echo 550. After incubation on ice, the reaction mixture was split into three 13.5\u2009\u03bcL aliquots and pre-warmed to 30\u2009\u00b0C. Using the Integra Viaflo, 10.8\u2009\u03bcL of the reaction mixture was dispensed into the substrate-containing 384-well plate and mixed thoroughly. The plate was quickly spun down and read on a pre-warmed plate reader at 30\u2009\u00b0C at 410\u2009nm for two hours.CFPS reactions were performed to synthesize all proteins, including WT POP, the entire panel of POP variants, and 2TAG-sfGFP. Only StrepII-tagged enzymes were used for the high-throughput experiments. Blank reactions to dilute reactions to be equimolar were set up in parallel. After reaction completion, CFPS reactions were heat-treated at 75\u2009\u00b0C for 15\u2009minutes as a crude purification. Insoluble components were pelleted at 20,000 x g for 10\u2009minutes at 4\u2009\u00b0C. The supernatant containing POP enzymes was diluted to 1\u2009\u03bcM using blank CFPS reactions as diluent. 4.5\u2009\u03bcL of POP enzymes were then mixed with 22.5\u2009\u03bcL of 2X POP Buffer  4.5\u2009\u03bcL of 0\u20131\u2009mM metal (Nickel(II) Sulfate Hexahydrate, Copper(II) Sulfate Pentahydrate, Cobalt(II) Chloride Hexahydrate, or Zinc(II) Chloride), and 13.5\u2009\u03bcL of water. The mixture was equilibrated on ice for 2\u2009hr. For reversibility screening, 1.8\u2009\u03bcL of 50\u2009mM EDTA pH 8.0 was added and then incubated for an additional hour on ice. During the incubations, 1.2\u2009\u03bcL of 25\u2009mM Z-Ala-Pro-Kinetic curves were analyzed using a custom Python script. Briefly, this script requires two input files: (i) A minimally formatted raw data CSV and (ii) a descriptor CSV that annotates reaction conditions for each well. The script calculates rate by conducting a linear regression over a sliding window of five timepoints and calculates an average and standard deviation between all replicates. Finally, it identifies and plots the maximum slope for each reaction condition. An example of the script is included in the Supplementary Information.2O) was incubated at 55\u2009\u00b0C with shaking (750\u2009rpm) for the entirety of the assay. For the first round, 1\u2009\u00b5L of NiCl2 solution (10\u2009mM) was added to the protein stock and the sample was incubated for 2\u2009min. An aliquot of protein was removed from the stock and added to a quartz cuvette containing buffer. The amount of protein added to the reaction buffer was adjusted throughout the assay based on the changing concentration due to additions of EDTA/NiCl2 (Supplementary Table\u00a0pNA (10\u2009mM in DMSO) and the solution was mixed by pipetting up and down several times. The reaction was monitored by following the formation of pNA with absorbance measurements (at 410\u2009nm) every 6\u2009s for 1\u2009min. Initial rates were determined by converting absorbance values over time to concentrations of time using the molar extinction coefficient  in Excel. Simultaneously, an aliquot of protein (20.1\u2009\u00b5L) was removed from the protein stock solution and added to a cuvette containing buffer and was incubated at 85\u2009\u00b0C for 2\u2009min. This cycle was repeated in the same manner by alternating additions of NiCl2 and EDTA. Final concentrations of components in the reaction were as follows: 30\u2009mM HEPES (pH 7.4), 100\u2009mM NaCl, 20\u2009nM enzyme, 0.2\u201330\u2009mM NiCl2, 0\u201341\u2009mM EDTA, 1.00\u2009mM Z-Ala-Pro-pNA, and 10% (v/v) DMSO. All data were collected in triplicate and averaged. Relative rates were determined by dividing each average initial rate by the maximum average rate collected for that data set so that the highest relative rate was 1. The relative initial rates were plotted versus round to assess the switching of the systems. Error bars represent propagated standard deviations.The switching of activity between \u2018on\u2019 and \u2018off\u2019 states was performed using a modified version of the kinetic assays described in the Supplementary Information. 500\u2009\u00b5L of a 1\u2009\u00b5M stock of protein  9.8.0.200 (Academic), PyMOL 2.5.0, Compass Data Analysis 5.1 Build 201.2.4019 (Bruker) for MS data, and Python 3.7 using custom scripts available at DOI: 10.5281/zenodo.6320869.Further information on research design is available in the\u00a0Supplementary InformationReporting SummaryPeer Review File"}
+{"text": "Leptospira species express leucine-rich repeat (LRR) proteins that are rarely expressed in non-pathogenic Leptospira species. The LRR domain-containing protein family is vital for the virulence of pathogenic Leptospira species. In this study, the biological mechanisms of an essential LRR domain protein from pathogenic Leptospira were examined. The effects of Leptospira and recombinant LRR20 (rLRR20) on the expression levels of factors involved in signal transduction were examined using microarray, quantitative real-time polymerase chain reaction, and western blotting. The secreted biomarkers were measured using an enzyme-linked immunosorbent assay. rLRR20 colocalized with E-cadherin on the cell surface and activated the downstream transcription factor \u03b2-catenin, which subsequently promoted the expression of MMP7, a kidney injury biomarker. Additionally, MMP7 inhibitors were used to demonstrate that the secreted MMP7 degrades surface E-cadherin. This feedback inhibition mechanism downregulated surface E-cadherin expression and inhibited the colonization of Leptospira. The degradation of surface E-cadherin activated the NF-\u03baB signal transduction pathway. Leptospirosis-associated acute kidney injury is associated with the secretion of NGAL, a downstream upregulated biomarker of the NF-\u03baB signal transduction pathway. A working model was proposed to illustrate the crosstalk between E-cadherin/\u03b2-catenin and NF-\u03baB signal transduction pathways during Leptospira infection. Thus, rLRR20 of Leptospira induces kidney injury in host cells and inhibits the adhesion and invasion of Leptospira through the upregulation of MMP7 and NGAL.Approximately 1 million cases of leptospirosis, an emerging infectious zoonotic disease, are reported each year. Pathogenic  In the last few decades, several biomarkers have been reported for acute and chronic kidney diseases ,2. The mLeptospira is reported to interact with various cell surface receptors, including E-cadherin (CDH1), P-cadherin (CDH3), and VE-cadherin (CDH5) [Leptospira was reported to interact with the human E- and VE-cadherins [2+ ions bind, interact with other E-cadherin molecules. The intracellular domain of E-cadherin is connected with several essential signal transduction components, including \u03b1-catenin (CTNNA1), \u03b2-catenin (CTNNB1), and p120 (CTNND1) [Leptospira infection induced a decrease of E-cadherin from the plasma membrane and the relationship between E-cadherin and Leptospira needs further investigation [n (CDH5) . One of adherins . E-cadheadherins . The str(CTNND1) . In anim(CTNND1) . Previoutigation ,23.Leptospira and interacted with the EC1 domain of E-cadherin through charge\u2013charge interactions [56, Glu59, and Glu123) were proposed to interact with the EC1 domain of E-cadherin [Leptospira is a novel human E-cadherin-binding protein that promotes the expression of MMP7 and NGAL. Furthermore, rLRR20 promoted the MMP7-mediated degradation of surface E-cadherin, which led to the activation of the NF-\u03baB pathway and the stimulation of NGAL expression.Previously, we demonstrated that LSS_11580 (rLRR20) was located at the outer membrane in pathogenic ractions . Three ecadherin . In thiscadherin . Thus, rMMP7 and NGAL) were upregulated, indicating that these genes were involved in the rLRR20-mediated effects on kidney cells  for 16 h  and non-pathogenic L. biflexa serovar Patoc (L. biflexa) at a multiplicity of infection (MOI) of 100 were examined using western blotting. Compared with those in the control HK2s and hRPTECs (cultured in EMJH medium), the E-cadherin protein levels were significantly downregulated in the L. santarosai-infected HK2s and hRPTECs but non-significantly downregulated in the L. biflexa-infected HK2s and hRPTECs . The effect of the Neu-\u03b1-E-cad on the E-cadherin protein levels was examined using western blotting. The HK2s and hRPTECs were incubated with Neu-\u03b1-E-cad for 1 h before adding 10 \u03bcM rLRR20 for 8 h. The E-cadherin protein levels in the rLRR20-treated HK2s and hRPTECs were significantly lower than those in the PBS-treated HK2s A,B. Meanfor 16 h . At a cocadherin . Therefoted HK2s C,D. Compted HK2s C,D. The ted HK2s C,D. Thes hRPTECs E,F. Thes37 and Thr41, were examined [To examine the effect of rLRR20 on the downstream signaling of E-cadherin, the expression of \u03b2-catenin, a major E-cadherin intracellular domain-binding component, was examined using western blotting and confocal microscopy . The HK2examined . TreatmeMMP7 -treated HK2s and hRPTECs, the MMP7 mRNA levels were significantly upregulated in the rLRR20-treated HK2s and hRPTECs, respectively , the MMP7 mRNA levels were significantly upregulated in the rLRR20-treated and L. santarosai-treated HK2s and hRPTECs  and hRPTECs (at rLRR20 treatment concentrations of \u22658 \u03bcM), respectively  could induce kidney injury through the outer membrane virulence factor LRR20.To prevent rophores . Additiorophores . In thisrophores . Treatmerophores . The finLeptospira.rLRR20 interacts with E-cadherin and activates downstream \u03b2-catenin, which results in the nuclear translocation of activated \u03b2-catenin and the consequent activation of MMP7 expression. MMP7 is secreted and further degrades E-cadherin on the cell surface. MMP7-mediated downregulation of surface E-cadherin activates NF-\u03baB:p65, which results in the nuclear translocation of NF-\u03baB:p65 and the subsequent activation of NGAL expression. NGAL, which is upregulated in human kidney epithelial cells during bacterial infection and inflammatory conditions, is a biomarker for AKI. This study proposed a novel model  for the The rLRR20 (LSS_11580) protein was purified following the protocols of a previous study with minor modifications . Brieflyw/v) FCS, 2 mM glutamine, 20 mM HEPES (pH 7.0), 0.4 \u03bcg/mL hydrocortisone, 5 \u03bcg/mL insulin, 5 \u03bcg/mL transferrin, and 28.9 \u03bcM sodium selenite. hRPTECs were cultured in DMEM/Ham\u2019s F12 medium supplemented with 5% (w/v) FCS, 4 mM L-glutamine, 10 mM HEPES buffer, 5 pM triiodothyronine, 10 ng/mL recombinant human EGF, 3.5 \u03bcg/mL ascorbic acid, 5 \u03bcg/mL transferrin, 5 \u03bcg/mL insulin, 25 ng/mL prostaglandin E1, 25 ng/mL hydrocortisone, 8.65 ng/mL sodium selenite, and 100 \u03bcg/mL G418. The cells were cultured at 37 \u00b0C in a humidified atmosphere of 5% (v/v) CO2. Serum-starved HK2s and hRPTECs (2 \u00d7 107) for 16 h were incubated with various concentrations of rLRR20 for different durations. Additionally, the rLRR20-treated HK2s and hRPTECs were cultured in the absence or presence of the following inhibitors: ICG-001  [ABI ViiA7 qRT-PCR system . The TaqMan primers used in the qRT-PCR analysis are listed in Human kidney 2 cells  and human renal proximal tubular epithelial cells (hRPTECs)/TERT1 #CRL-4031) were purchased from the American Type Culture Collection . The cells were cultured in a medium described in a previous study 31 were p. In brieNJ, USA) , gallic Leptospira biflexa serovar Patoc  and L. santarosai serovar Shermani str. LT821  were purchased from ATCC. The bacterial cells were cultured at 28 \u00b0C under aerobic conditions in the Ellinghausen\u2013McCullough\u2013Johnson\u2013Harris (EMJH) medium, following the protocols described in a previous study [Leptospira were incubated with HK2s and hRPTECs at a multiplicity of infection (MOI) of 100 for 8 h. The protein levels of E-cadherin, active MMP7, and NGAL in the culture supernatant were analyzed.us study . The denp-value < 0.05 were classified into functional groups.Total RNA was amplified, labeled, and hybridized to the Clariom D Assay chips , following the manufacturer\u2019s instructions. Microarray data were submitted to the National Center for Biotechnology Information Gene Expression database (accession number: GSE155061). Differentially expressed genes with a fold change >2 and The serum-starved HK2s and hRPTECs were treated with different concentrations of rLRR20 or bacterial for different durations. The supernatant was collected to analyze the levels of active MMP7 and NGAL using the human MMP7 (active) ELISA Kit  and human NGAL quantikine ELISA kit , respectively, following the manufacturer\u2019s instructions.HK2s and hRPTECs were incubated with 10 \u03bcM of rLRR20, and the cells were washed, fixed, permeabilized, and incubated with the following primary antibodies: anti-E-cadherin , anti-His-tag , anti-active \u03b2-catenin , and anti-p65  antibodies. Next, the cells were incubated with Alexa488-conjugated and Alexa594-conjugated anti-rabbit or anti-mouse secondary antibodies  and subjected to confocal microscopy. The nuclei were stained using 4\u2032,6-diamidino-2-phenylindole (DAPI), and the cells were imaged using a confocal laser scanning microscope .w/v) milk or 1% (w/v) bovine serum albumin. The primary antibodies used in this study including anti-E-cadherin , anti-beta actin antibody , anti-active \u03b2-catenin , anti-p65 , and anti-TBP antibodies . Immunoreactive signals were visualized using an enhanced chemiluminescent detection reagent .The treated HK2s and hRPTECs were washed thrice with PBS and lysed directly using Mem-PER plus membrane protein extraction kit for membrane protein extraction  supplemented with Halt protease and phosphatase inhibitors . Cytoplasmic and nuclear fractions were prepared using a cytoplasmic and nuclear protein extraction kit , following the manufacturer\u2019s instructions. The concentration of proteins was determined using the Bradford method. The proteins were resolved using SDS-PAGE. The resolved proteins were transferred to a polyvinyl difluoride membrane. The membrane was incubated with the indicated primary antibodies, followed by incubation with horseradish peroxidase-conjugated secondary antibodies in Tris-buffered saline with 5% .At least three independent experiments were performed. The variables are expressed as mean \u00b1 standard error of the mean. The data were analyzed using Student\u2019s"}
+{"text": "After Italy\u2019s first national restriction measures in 2020, a robust approach was needed to monitor the emerging epidemic of coronavirus disease 2019 (COVID-19) at subnational level and provide data to inform the strengthening or easing of epidemic control measures.We adapted the European Centre for Disease Prevention and Control rapid risk assessment tool by including quantitative and qualitative indicators from existing national surveillance systems. We defined COVID-19 risk as a combination of the probability of uncontrolled transmission of severe acute respiratory syndrome coronavirus 2 and of an unsustainable impact of COVID-19 cases on hospital services, adjusted in relation to the health system\u2019s resilience. The monitoring system was implemented with no additional cost in May 2020.The infectious diseases surveillance system in Italy uses consistent data collection methods across the country\u2019s decentralized regions and autonomous provinces.Weekly risk assessments using this approach were sustainable in monitoring the epidemic at regional level from 4\u00a0May\u00a02020 to 24\u00a0September\u00a02021. The tool provided reliable assessments of when and where a rapid increase in demand for health-care services would occur if control or mitigation measures were not increased in the following 3\u00a0weeks.Although the system worked well, framing the risk assessment tool in a legal decree hampered its flexibility, as indicators could not be changed without changing the law. The relative complexity of the tool, the impossibility of real-time validation and its use for the definition of restrictions posed communication challenges. The risk assessments produced for each region and autonomous province were initially used to informally assist regional epidemic responses. Subsequently, in October 2020 the assessments were formally integrated as part of a flexible COVID-19 prevention and control response strategy for the autumn to winter 2020 season.From the beginning of November 2020,,The aim of the risk assessment was to provide a weekly overall categorization of the risk of an uncontrolled and unsustainable SARS-CoV-2 outbreak in each of the 21 Italian regions and autonomous provinces. As per ECDC guidance, we defined risk as a combination of the probability of the health threat and its impact,The three components of the Italian risk assessment tool therefore were: (i)\u00a0probability ; (ii)\u00a0impact ; and (iii)\u00a0resilience . We used three sets of quantitative indicators to assess these components .12 The fWe assessed probability and impact separately using two dedicated algorithms each composed of three trigger questions requiring a yes/no answer. The first two questions in each algorithm were quantitative while the last question was qualitative.Between 4\u00a0May\u00a02020 and 24\u00a0September\u00a02021, the Italian national institute of health performed 71 weekly risk assessments.In its early implementation, during low viral circulation in spring to summer 2020, the risk assessment system was very sensitive to localized clusters with limited cases, especially in smaller regions or autonomous provinces. The risk assessment therefore changed occasionally from low to moderate and then back to low as the clusters were contained. These findings, although consistent with the data, were misinterpreted as false alarms and led to some initial concern and distrust in the method among subject-matter experts. As the indicators could not be changed without changing the law, we solved these initial issues by clarifying concerns with public health officials without modifying the risk assessment tool.Subsequently, the perceived complexity of the tool and the fact that risk assessments always addressed the previous week (too delayed) were criticized.The weekly publication of the risk assessment findingsDuring a protracted outbreak, ensuring that control measures against the spread of disease are proportionate to the risk is important to limit an unwarranted impact on the economy and on the overall well-being of the population. Ensuring accountability and transparency to the general population is also needed. The risk assessment system supported decision-making in Italy by effectively anticipating when the disease outbreak was expected to rapidly worsen, harnessing existing data flows at national and subnational level. The system operated without dedicated funding but, despite requiring a large amount of staff time, was sustainable in the medium term without any disruption in the weekly production of updated risk assessment reports.Continuous communication between the experts at the national institute of health and public health officials across all the regions and autonomous provinces made sure that the assessments reflected what was happening locally each week while supporting the cohesion of the public health network. Also, different data sources and multiple indicators were helpful in maintaining the robustness of the assessment during increased transmission. The main challenge in conducting the risk assessments during the pandemic was related not to the method\u2019s performance but to difficulties in public communication. While we addressed initial misunderstandings among public health officers through technical discussions, the situation changed when the risk assessments started directly impacting restrictions and, consequently, peoples\u2019 daily lives and livelihoods. Criticism of the risk assessment tool (too complex) or of specific parameters (too delayed) stopped being a technical discussion among subject-matter experts and became a contested topic for decision-makers and the general public.A similar approach to capturing the components of probability, impact and resilience could be adopted in different countries by adapting existing data flows and deploying available human resources. However, we learnt that to increase the acceptability of risk assessment tools like the one described, robustness in performance is not enough . CommuniBox\u00a01Decision-making during large-scale disease outbreaks can be supported by robust mixed-method risk assessments informed by public health intelligence and existing surveillance systems without dedicated funding.Continuous communication with health officials across administrative levels ensures that assessments reflect what is happening in the field and supports the cohesion of the public health network during an emergency.Communication issues in applying risk assessment tools should be anticipated during an emergency and approached using dedicated communication tools."}
+{"text": "Advanced ovarian cancer is one of the most lethal gynecological tumor, mainly due to late diagnoses and acquired drug resistance. MicroRNAs (miRNAs) are small-non coding RNA acting as tumor suppressor/oncogenes differentially expressed in normal and epithelial ovarian cancer and has been recognized as a new class of tumor early detection biomarkers as they are released in blood fluids since tumor initiation process. Here, we evaluated by droplet digital PCR (ddPCR) circulating miRNAs in serum samples from healthy (N = 105) and untreated ovarian cancer patients (stages I to IV) (N = 72), grouped into a discovery/training and clinical validation set with the goal to identify the best classifier allowing the discrimination between earlier ovarian tumors from health controls women. The selection of 45 candidate miRNAs to be evaluated in the discovery set was based on miRNAs represented in ovarian cancer explorative commercial panels. We found six miRNAs showing increased levels in the blood of early or late-stage ovarian cancer groups compared to healthy controls. The serum levels of miR-320b and miR-141-3p were considered independent markers of malignancy in a multivariate logistic regression analysis. These markers were used to train diagnostic classifiers comprising miRNAs (miR-320b and miR-141-3p) and miRNAs combined with well-established ovarian cancer protein markers . The miRNA-based classifier was able to accurately discriminate early-stage ovarian cancer patients from health-controls in an independent sample set . In addition, the integration of the serum proteins in the model markedly improved the performance . A cross-study validation was carried out using four data series obtained from Gene Expression Omnibus (GEO), corroborating the performance of the miRNA-based classifier (AUCs ranging from 0.637 to 0.979). The clinical utility of the miRNA model should be validated in a prospective cohort in order to investigate their feasibility as an ovarian cancer early detection tool. Although ovarian cancer (OC) accounts to 2.5% of all women malignances  this tumThe local Ethics Committee (Artemisia S.p.A) has approved the protocol study. All healthy donors provided written informed consent for the use of serum samples for research purposes. All serum samples from ovarian cancer patients were obtained through MTA  signed consent form from the following centers: Discovery Life Sciences , BioIVT , Victorian Cancer Bank , and Wales Cancer Bank . Inclusion criteria for patients were: i) serous epithelial ovarian adenocarcinoma diagnosis; ii) no previous radiotherapy, chemotherapy or endocrine therapy; iii) availability of clinical data (i.e. tumor staging and subtype classification). Exclusion patients\u2019 criteria were: i) incomplete medical history data; ii) other important organ dysfunction and iii) known synchronous neoplasia. The study design and main results found are illustrated in In total, 72 OC patients and 105 Healthy Controls (HC) were enrolled in the study. The cases were stratified in a Training Set, comprising 68 healthy controls and 47 ovarian serous adenocarcinoma and a Validation Set comprising 37 healthy controls and 25 ovarian serous adenocarcinomas . The TraAll serum samples from ovarian serous adenocarcinoma patients which were purchased from several commercial biobanks (as cited above) were shipped frozen in 2mL tubes (dry ice) and were immediately kept at -80\u00b0C upon arrival. Serum samples from healthy-controls women were collected from blood samples in Vacutest tubes (with cloat activator) recruited in Altamedica Center (Rome) between 2018 and 2020. Blood tubes were centrifuged at 3000 rpm/4\u00b0C/10 min. Serum (1 mL) were collected to a new 2 mL tube and re-centrifuged at 16000 g/4\u00b0C/10 min. The supernatant was kept at \u2212 80\u00b0C until miRNAs isolation. For normalization and quality control purposes, we have used cel-miR-238-3p ) AND (MicroRNAs [Mesh]) AND  AND (serum OR blood OR plasma OR circulating OR \u201cliquid biopsy\u201d OR biofluid). The eligible datasets included: (1) datasets with published results; (2) datasets including a minimum of 50 human samples, represented by at least 10 OCs and 10 controls ; (3) sncRNA profiling of cell-free RNA from body fluids . The exclusion criteria were: (1) duplicate data reported in other studies; (2) lack of clinical/ histological information; (3) datasets related to letters, editorials, case reports or case series; (4) liquid biopsy studies using whole-blood RNA extraction. The available processed values (microarray and high-throughput sequencing) were used to apply the miRNA diagnostic model and the AUCs were assessed. This analysis was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) [Publicly available databases were interrogated to test the circulating miRNA-model using GEO datasets ((PRISMA) .P-value <0.05. The performance of the miRNA model and the serum proteins was estimated using sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV).Graphpad Prism , IBM SPSS Statistics for Windows, Version 25.0  and BRB ArrayTools (v. 4.6.1) software were employed in statistical analysis and illustrations. The null hypothesis was rejected when two-tailed From the 45 target miRNAs assayed in the Discovery Set , 11 were frequently undetected in the serum of cancer individuals  and were subsequently removed. The biological groups were statistically compared, unveiling six miRNAs . As shown in The six miRNAs considered as potential ovarian cancer biomarkers were additionally evaluated, using single ddPCR assays to quantify the serum miRNAs and expand the sample set from 51 to 115 (defined as Training set). All six miRNAs and the tested proteins were significantly associated with the risk of ovarian cancer in the univariate logistic regression analysis  and miR-141-3p  were considered independent markers of malignancy and were used to design the diagnostic classifiers. The Compound Covariate Predictor analysis was carried out using the log2-transformed protein and miRNA  quantifications, establishing weights to each marker and a prediction threshold. A miRNA-based classifier was trained in this dataset aiming to discriminate ovarian cancer patients from healthy controls. The application of the classifier , yielded a 72.3% sensitivity and 88.2% specificity in the LOOCV. By combining the miRNAs with proteins , a classification with 75.6% sensitivity and 100% specificity was obtained in the LOOCV . For comIn order to support the performance of the predictive models, the miRNAs (miR-141-3p and miR-320b) and proteins (CA-125 and HE4) were further tested in a new independent sample set , adopting the same mathematical models prior described. In this Validation Set, the miRNA classifier presented a sensitivity and specificity of 68.0% and 70.3%, respectively (AUC = 0.723), while the miRNA/protein classifier presented a sensitivity and specificity of 87.0% and 100%, respectively (AUC = 0.989) . ImportaBy investigating independent available datasets from GEO, eight data series were found and four were included after employing the inclusion/exclusion criteria and curation of the published articles . All fouOvarian cancer is the fifth leading cause of cancer death in women worldwide because it is usually asymptomatic in the earlier stages, and few screening tests are available. CA-125 detection was originally established to monitor patients previously diagnosed with ovarian cancer and not for tumor screening. When used as an individual marker, CA-125 is not sufficiently sensitive to detect all cases of early-stage ovarian cancer . In addiUsing a strategy involving three analysis steps , we identified by ddPCR six significantly upregulated miRNAs in the serum samples of OC patients , where two of them (miR-141-3p and miR-320b) were used to design and validate a novel circulating-miRNA diagnostic model. This miRNA-based model was able to distinguish patients with ovarian cancer from healthy individuals with high accuracy .Although the performance of our method in the Validation set was not high enough to corroborate the use as a single diagnostic clinical test, we showed that it could be used as a complement for the two main routinely used biomarkers (CA-125 and HE4) in the diagnosis of early stage ovarian cancer .In a recent study, Yokoi and colleagues analyzed serum miRNAs of a large cohort of 428 patients with ovarian tumors and 2759 non-cancer controls, obtaining expression profiles of 2588 miRNAs through a miRNA microarray platform . The autIn addition to miR-320b, miR-141-3p also was identified as a relevant miRNA in our diagnosis model with higher levels significantly detected among late stages (II-IV) compared to stages I-II samples , P<0.01.A limitation of our study was the healthy control subgroup. As these women were gynecological disease-free participants coming to our center for a visit routine, the mean age was around 15 years lower compared to the ovarian cancer subgroup . Even wiIn conclusion, we developed a multi-analytical liquid biopsy-based method using serum miRNAs that can discriminate early stages OC from healthy controls with 80.0% sensitivity and 70.3% specificity. The combination of the miRNA panel and widely used protein biomarkers could improve the OC diagnosis during early progression to 88.9% sensitivity and 100% specificity, when the patients still have a 5-year survival rate of 70\u201390%. Nonetheless, these data need to be validated in a large prospective study.S1 Table(XLSX)Click here for additional data file.S2 Table(XLSX)Click here for additional data file.S1 FigA. In this experiment, a 1D plot show two health-controls samples  used to test cDNA and primer dilution for miR-21-5p, the most abundant serum miRNA identified across ovarian cancer and health-controls subgroups. Two primer dilutions and (0.55\u03bcL and 1.1\u03bcL) and three cDNA dilutions  were tested. Better separation of positive (blue) and negative (gray) droplets were obtained with primer at 0.55\u03bcL and cDNA diluted at 1:90 (red squares) for this miRNA assay. B. In this experiment, seven different samples  were used for miR-320b and cel-miR-238-3p targets. On 1D plot (left), samples can be visualized independently, and at 2D plots (right), all samples are visualized together. It is possible to observe the different miRNAs levels and separation of positive (blue) and negative (gray) droplets profiles across the samples and targets under manually defined threshold for each assay (pink lines). Red arrows show unspecific droplets excluded of the analysis using \u201cpencil\u201d tool. NTC: negative template control.(TIF)Click here for additional data file."}
+{"text": "In vitro, we found that dioscin could inhibit the activation of the VEGFA\u2013VEGFR2 signaling pathway and cell proliferation of human retinal microvascular endothelial cells in a high-glucose (HG) environment. A more important dioscin intervention inhibits the expression of pro-angiogenic factors in the retinas of db/db mice. In conclusion, our study indicates that dioscin reduces the vascular damage and the expression of pro-angiogenic factors in the retina of db/db mice and implies an important and potential application of dioscin for treatment of DR in clinics.Diabetic retinopathy (DR) is a complication of diabetes that has a serious impact on the quality of life of patients. VEGFA is necessary in the physiological state to maintain endothelial activity and physical properties of blood vessels. VEGFA plays an important role in the promotion of neovascularization; therefore, inhibition of VEGFA can degrade the structure of blood vessels and reduce neovascularization. In the present study, HERB, a high-throughput experimental and reference-oriented database of herbal medicines, was used for compound mining targeting VEGFA. The compounds most likely to interact with VEGFA were screened by molecular docking. Next, the compounds were used to verify whether it could inhibit the activity of the VEGF signaling pathway  Diabetes mellitus is a rapidly growing global disease that affects approximately 415 million people and is expected to reach 642 million by 2040 . DiabetiVEGF is necessary in the physiological state to maintain endothelial activity and physical properties of blood vessels . Under pAnti-VEGF drugs currently used in clinical practice mainly inhibit neovascularization by inhibiting the binding of VEGF to its receptor. Macugen specifically binds to VEGF165 and inhibits the binding of VEGF to its receptor to reduce vascular permeability and neovascularization . BevacizIn mammals, the VEGF family consists of five secreted proteins, VEGF-A, -B, -C, -D, and placental growth factor, of which the role of VEGF-A in the endothelium has been most intensively studied . VEGF-A http://herb.ac.cn/)  , a high-in vivo studies conformed to the Guide for the Care and Use of Laboratory Animals published by the NIH . We decided the sample size for animal studies based on a survey of data from published research or preliminary studies, and no mice were excluded from the statistical analysis. Animal studies were approved by the Ethics Committee of the Second Clinical Medical College of Jinan University, Shenzhen People\u2019s Hospital (IACUC Issue No: 20200319-45). Male type 2 diabetic  mice and C57BLKS/J wild-type mice at the age of 6\u00a0weeks were purchased from Gempharmatech Co. Ltd. . They were maintained in SPF units of the Animal Center of Shenzhen People\u2019s Hospital  and maintained on a standard rodent diet with free access to water in plastic bottles. The mice were allowed to acclimatize to their housing environment for at least 7\u00a0days before the experiments. Up to five mice were housed in each plastic cage with corncob bedding material. We conducted the treatment in a blinded fashion. The drugs used for treating animals were prepared by researchers who did not undergo treatment. The animals were randomized before receiving treatment. Dioscin was delivered by oral and ocular administration. Doses of oral administration [80\u00a0mg/kg body weight (mpk)] (db/db mice). The mice in the normal group received vehicle as the control. At the end of the experiment, all mice were anesthetized and euthanized in a CO2 chamber, followed by collection of eyeball samples.All animal care and experimental protocols for t (mpk)]  and ocul2 atmosphere. 5\u2009\u00a0mM  or 22\u00a0mM (high glucose) of D-glucose (Gibco) were added to the stimulation medium for 48\u00a0\u2009h.Human retinal microvascular endothelial cells (HRMECs) were obtained from the American Type Culture Collection . The cells were cultured in DMEM+\u200910% fetal bovine serum (FBS)  at 37\u2009\u00b0C in a 5% COhttps://www.rcsb.org) (Discovery Studio (DS) was used for molecular docking of VEGFA and its compounds. DS 2019 version is molecular modeling software for protein structure studies and drug discovery . The strcsb.org) . First, csb.org) . -CDOCKEDuring the treatment, blood was withdrawn from the mouse tail vein after overnight fasting at different time points. Blood glucose levels were determined using a OneTouch glucometer and test strips (LifeScan) according to the manufacturer\u2019s instructions.TM Real-Time PCR system (Applied Biosystems) with specific primers (\u2013\u0394Ct (\u0394Ct = Ct of the target gene\u2014Ct of \u03b2-actin) and normalized using the level detected in the control group as 1.At the end of the experiment, TRIzol reagent (Invitrogen) was used to extract total RNA as described in the classic protocol. Chloroform was mixed well with the homogenate and centrifuged at 13,300\u00a0rpm for 15\u00a0min at 4\u00b0C. The top aqueous phase was collected, mixed with isopropanol, and stored at \u221220\u00b0C. The next day, RNA was centrifuged and washed with 75% ethanol and 100% ethanol in sequence. RNA was dissolved in an appropriate amount of RNase water. cDNA was obtained using a reverse transcription kit purchased from New England Biolabs . qPCR was performed using the ABI StepOnePlus primers . The relAfter treatment, a piece of tissue or cell was lysed or homogenized in lysis buffer , and total protein was obtained according to the classical protocol. 1:1000 diluted fresh primary antibody or anti\u2013\u03b2-actin antibody  in PBS containing 1% fresh dry fat-free milk and 1:5000 diluted fresh HRP-conjugated anti-Rabbit or mouse IgG in PBS containing 1% fresh dry fat-free milk were used. Western blotting experiments were performed using antibodies against VEGFA (Abcam), VEGFR2 , phosphorylation of ERK1/2 , ERK1/2 , Akt , and Akt , as described previously.To determine the interaction of VEGFA and VEGFR2 in HRMEC homogenates, 1 mg whole-cell extracts was incubated with antibodies against VEGFA (Abcam) overnight under stringent conditions, immunopurified using Dynabeads Protein G beads (Life Technologies Corporation), and immunoblotted using VEGFR2 .2 of the retina.Vasculature and quantitation of acellular capillaries retinal vasculature were performed according to a previously described method  with minp < 0.05.All experiments were repeated at least thrice, and representative results are presented. All data are presented as mean \u00b1 standard error and were analyzed by Student\u2019s-test or one-way ANOVA with Bonferroni correction. The differences were considered significant at http://herb.ac.cn/), a high-throughput experimental and reference-oriented database of herbal medicines, was used for compound mining targeting VEGFA  were treated with different doses of dioscin  in the presence of high glucose. Our results showed that dioscin treatment did not influence the protein level of VEGFA when compared with HG treatment alone (control group) . The maiKi67 and PCNA) and HIF1\u03b1 (the main inducer of VEGF) also supported our finding that dioscin treatment could inhibit cell proliferation  every day. To determine this, we initially isolated the retinal network of vessels and conducted PAS staining to assess the effect of dioscin on the retinal vasculature  were also consistent with our findings . Clearly, 55\u00a0mg/kg body weight is much less than 300\u00a0mg/kg body weight. This suggests that the dose of 80\u00a0mg/kg body weight dioscin [the human dose is 8.8\u00a0mg/kg body weight (8.8 = 80/9.1)] may be relatively safe, but more experiments are required to verify this. Importantly, there are no clinical reports on the hepatotoxicity of traditional Chinese medicinal products containing dioscin.Yu et al. investigated the subchronic toxicity of dioscin in rats; when dioscin was administered at 300\u00a0mg/kg body weight for 90\u00a0days, the levels of alanine aminotransferase in both male and female rats increased significantly, which indicated an impairment of liver function; a dose-dependent trend in liver injury was also observed in male rats . In thisdb/db mice and implies an important potential application of dioscin for treatment of DR in clinics.In conclusion, our study indicates that dioscin inhibits the vascular damage in the retina of"}
+{"text": "The purpose of this study was to present a translation and interpreting (T&I) teacher role identity (TITRI) framework for investigating how T&I teachers in China develop their role identities. There is a vast literature on language teacher identity in higher education compared to a paucity of literature on the development of T&I teacher identity. Developing a strong T&I teacher identity in the context of Chinese universities is challenging as teachers combine sub-roles of trainers/educators, researchers, and practitioners, and the context is more supportive of constructing a researcher role than trainer/educator and practitioner roles. A strong teacher identity, on the other hand, is vital since it enhances teachers\u2019 willingness to engage in professional development. This study proposes a framework based on the Dynamic Systems Model of Role Identity (DSMRI) that describes how three sub-roles interact and contribute to overall T&I teacher identity. This work contributes to the scant literature on T&I teacher identity research, shedding light on how different role identities may interact throughout the professional careers of a teacher. Additionally, the framework may also foster an awareness of the impact of higher education on a teacher and, as a result, offer implications for universities in China to encourage the development of teacher identity. Being a translation and interpreting (T&I hereafter) teacher is demanding as the teacher is expected to be good at training/educating, research, and practice at the same time . For oneTranslation and interpreting teachers, in other words, are expected to take on a range of professional roles and devote substantial time to each. They must prioritize their roles and manage their time to meet the expectations of their students, institutions, and jobs. These roles, as well as the significance placed on each role, influence their professional development . A practIt is especially important to examine T&I teachers\u2019 role identity in integration as it is linked to their professional development. There is a dearth of interest in addressing the issue of T&I teacher identity, compared to the strong tradition of published research on language teacher identity , p. 385.However, what distinguishes T&I teachers from other language teachers are different teaching competencies, goals, and profiles. Other than language competence, teaching skills, and disciplinary knowledge that one expects of a language teacher, T&I teachers are expected also to acquire first-hand personal experience of T&I profession and knowledge of market trends , p. 365.This study presents a T&I teacher role identity (TITRI hereafter) framework to illustrate how the main role of a T&I teacher influences three sub-roles and how these sub-roles interact. The TITRI framework is based on prior models of identity formation, particularly the Dynamic Systems Model of Role Identity (DSMRI) , and is Roles may vary from formal  to informal . People in today\u2019s society take on a variety of professional roles, including teachers, doctors, and lawyers, all of which are context-dependent and may change over time. The expression of a teacher\u2019s professional identity is how they carry out their professional roles, and this becomes the core of their teacher identity .Professional role as a concept is defined by In the present study, the professional roles of the T&I teacher can be considered as a main role housing three sub-roles . The reaThe meanings for an integrated framework are twofold. First, such a framework helps to clarify how different sub-roles interact and how they relate to the main role. Even within T&I studies, it was only until recently that attention was paid to empirical research on T&I teachers and their professional development . Kang anSecond, though tensions and conflicts exist between the main role identity and sub-role identities or between sub-role identities, it is believed that individuals seek increased coherence, alignment, and integration within and between roles in the professional development process within a relatively long time . IndividAs an \u201cemerging model\u201d of teacher identity , the DSMThe core structure of the DSMRI consists of four contextual-constructed, reciprocal, and partially overlapping components: (1) ontological and epistemological beliefs relate to the knowledge and conceptions that are held to be true by teachers about the world and the subject domain and beliefs about the certainty, complexity, and the credibility of their ontological knowledge, along with the emotions connected to these beliefs . For insvice versa How do the three sub-roles of a T&I teacher  interact with each other?(2)How do the three sub-roles relate to the main role of a T&I teacher?In a multiple-case narrative study, the primary way to investigate any phenomenon is through the experience of the individual , p. 41. In deciding the case number, Another sampling strategy adopted is the maximum variation in terms of T&I teachers\u2019 individual characteristics to gain commonality across diversity and enhance transferability  sometimes mean there are some untranslatable terms. When you are teaching, you need to explain to your students. It is at this time that I need to look up some research articles to guide me to solve problems. (Gary)These tangible pedagogical effects also included using research as a tool to \u201cbetter define training difficulties\u201d and as \u201ca yardstick to judge the training effects.\u201d Besides tangible pedagogical effects, a central meaning of research seems to fall into the category of \u201creflection\u201d , thinkinFor one thing, research is a guide in your training mentality and methods. What we teach and how we teach should not be purely experiential. It is not just only what you think is good that can be 100% passed on to your students. This is not scientific enough. For introducing a new training mentality and methods, you need to be equipped with research achievements. Furthermore, research can provide a means to better understand your training. (Keven)It is worth noting that when reflection does not merely stop at a thinking level, it can be a means to connect theory and practice, i.e., a means to integrate the two sub-roles of T&I trainers/educators and researchers. It leads to inspiration for new research ideas, new projects, or new courses, thus empowering their T&I trainer/educator and researcher identity.One course I taught was called \u201cConference Interpreting as a Profession,\u201d which included the concept of the market. If you are going to introduce the T&I market, you need to start with the language service sector. The T&I market is just a small yet important part of the sector. This intrigued me to initiate a research topic about the language service sector. But for the course, I would not have initiated such a project. I am very interested in it now. (Carol)vice versa, Paul and Amy went one step further to create a virtuous cycle between the two roles. Paul not only utilized research to address problems in class, but he went on to compile his textbook by incorporating research results and his knowledge of the T&I curriculum. He expanded his research by using his textbook as instructional materials and bringing examples from his study into classes to make theory less abstract and practice more alive for students. In doing so, he created a virtuous cycle between T&I training and research. Similarly, Amy, a doctoral student, though still fighting for her threshold of being a researcher, believed that these two roles \u201chelp each other.\u201dInstead of merely stopping at what training has contributed to research and I really believe these two roles help each other. Before doctoral study, I might have simplified all the problems arising from T&I course. I just copied others\u2019 successful training experience without modifying much [\u2026] Now that I understand there should be a more scientific way of referring others\u2019 classroom practice and more systemic way of organizing my training plan. On the other hand, in my training, I noticed that students\u2019 autonomy in learning is at a relatively low level. For students in my school , they simply don\u2019t want to study and don\u2019t know what to do and how to do it. I want to pay more attention to this and make a research topic out of this. I think it will be very promising in research area. (Amy)Amy referred to research as a syllabus design repertoire for her T&I training. When she initiated the research plan, she tended to bear her students\u2019 learning in mind. Her desire to incorporate both research and training offers the possibility that she will be open to engaging in the process of doctoral training, which is a necessary step for enacting the role of a T&I researcher.vice versa.When asked about the relationship between research and practice, most T&I teachers reported no direct help from research to their practice and I don\u2019t perceive much relationship between research and practice, at least not strongly related. When we are interpreting, it is almost impossible to think about how to use some theories or think of some research results at that very moment. It might not be 100% true to say so as you may already be equipped with the T&I theory deep enough to change your mindset. What I mean is personally speaking, I tend not to consider those theories when I am interpreting. (Keven)[\u2026] Well, this kind of practice convenience (brought about by linguistic perspectives) does not necessarily lead to rich research output. My broad interests and open mind in translation practice without pre-constructed categories often distract me from one research topic to another, consuming too much time and energy and sometimes resulting in zero paper. (Paul)The belief that T&I practice is not much relevant to T&I research confirms what We can observe from the table that distinct, or even opposing, DSMRI components are associated with the T&I practitioner and researcher roles. Practitioners are described as being emotional \u201csuper-high,\u201d but researchers are described as being \u201ccruel.\u201d These opposing phrases for emotions imply that the T&I practitioner experience is joyful and relaxed, whereas the researcher is more irritated and painstaking. Furthermore, the nature of labor as experienced by our participants varied greatly. The work of T&I practitioners was believed to be \u201cfulfilling the task\u201d and \u201cinstant,\u201d while research work was to \u201cfind cases, analyze, and write the thesis\u201d and thus \u201ca long process.\u201dThis yawning gap between T&I practitioner and researcher roles, which causes unwillingness or reluctance for integration action possibilities, is recognized by participants. Dina said that a lack of time may be a big barrier to future integration of action possibilities.I have a wish to collect all the interpreting practice that I can to make it into a corpus, a big one. I really try my best to audio- or video-tape all the conferences. What happens in the end? You have collected more and more corpus, fully loaded in every stockpile. Yet you don\u2019t have the time to sort it out and organize it into one or more research ideas. You simply don\u2019t have time. To do that, you need a period breaking away from other tasks. [\u2026] It (practice experience) just offers an opportunity to collect data, but whether it can be turned into meaningful research actually depends on the time and energy invested. (Dina)Though it is the appeal of existing literature that, ideally, T&I practitioners and researchers should endeavor to develop deeper ties, the opposing and contrasting DSMRI components foreshadow skepticism and unwillingness to cross the divide. Furthermore, there are frequent complaints about a lack of time for T&I practice in the comments, implying that the other two roles take precedence over T&I practice. The secondary place of T&I practice is evident in the following excerpt.I fully stop my T&I practice at the moment. I cannot do so many things at the same time. I need long periods of time to do my research so that I have to give up practice for now. [\u2026] The materials I use for class is from my past experience, like two or even three years ago. You know the T&I market is changing rapidly. I am very dissatisfied with my training materials but I have no other alternative. I need to wait until I get my PhD degree to devote into T&I practice. (Betty)An important theme developed from the relationship between T&I practitioner and trainer/educator roles is that the former helps make sense of the latter in both a direct and indirect way. T&I teachers were committed to using their practice as an important source of training. They were concerned with offering students a good training source, ranging from pre-translation preparation to up-to-date first-handed materials to after-translation reflection and to the cultivation of students\u2019 professional skills and knowledge. They also emphasized the need to integrate simulated T&I tasks into the course.We (T&I teachers) have a well-established tradition of audio recording the conference interpreting scene and use in our training course, which of course can only be done with employers\u2019 permission. Actually, they (the employers) welcome and support this as they know we are training tomorrow\u2019s interpreters. From our perspective, the fact that we as practitioners fulfill the task means we have already processed the whole interpreting task, from pre-task preparation, pre-site preparation, on-site experience, problem-solving during the task, and customer feedback to after-task reflection. This experience, when transmitted to the training process is well-received by our students. (Carol)As T&I practitioners and trainers, they stressed that their training must be scientifically updated so as to meet the \u201clive\u201d needs of T&I tasks besides focusing on professional competence and skills, avoiding merely giving \u201cdidactic recipes.\u201dThis  is definitely one major feature of T&I training. Besides national conference materials, those T&I materials for local economic entities proved to be especially useful. Just think about most of your students will serve local economic entities in the future. They thus perceive these on-site experiences as highly relevant [\u2026] For instance, you can \u2018transport\u2019 what you have encountered as difficulties into a classroom and ask about their response. This will be an interesting discussion about interpreting decision-making process. (Dina)Translation and interpreting trainers/educators paid special attention to the way that they behaved as T&I practitioners, revealing the awareness of the special profession they were training/educating. The alignment among their training goals of integrating on-site T&I experience, epistemological faith in ontological beliefs in authentic training materials, and their action possibilities of engaging in both training and practice reflect a high level of integration of their role identities as trainers/educators and practitioners.Other than perceiving a direct link between T&I training and practice, they also referred to an indirect link concerning the professionalism of future T&I practitioners.Students like to hear your personal stories as interpreters. What\u2019s more, if they become interpreters one day and happen to meet some employers who know your name, they will be greatly inspired. They feel that they come from an outstanding group, in which they themselves are part of it. I think our own practice of excellence will be great incentive for our students. (Dina)From the excerpt, Dina was dedicated to the T&I field. She discussed her professional role identity as an interpreter and pride in the profession, both of which are essential constructs of T&I professionalism . Other tI want my MTI students to know that they are not undergraduates anymore, instead, they are future practitioners in the field. [\u2026] It would be a waste if they are not to be a practitioner in the field. So I tell them \u2018if you don\u2019t comprehend, please do not make it up,\u2019 or else it will be a serious ethical issue. You will lose your job for violating the code of conduct. (Carol)Carol not only instructed her students about professional codes of ethics but also provoked students with a profound understanding of ethical issues in interpreting. As an interpreter working for experts during COVID-19, she further stated that she held herself to be \u201ca role model\u201d using her practice experience during the pandemic, hoping to provide a positive impact by making future interpreters reflect upon their \u201caccountability\u201d to the community and the humanity at large .Now looking back (at being an interpreter during COVID-19 period), I want my students to know that there need to be someone to do something at that very moment. If you, as their teacher, cannot perform the task, how can you expect your students to do so? [\u2026] If my work can at least inspire some students who want to be devoted to T&I practice, I will consider it as rewarding or meaningful. (Carol)From the excerpt, Carol is held responsible for the consequences of her interpreting practice and reflected carefully about her decisions and the impact. Instead of simply prescribing the codes, she would like to incorporate them into the training curriculum to provide her students, trainee interpreters, with a platform to reflect on various issues and situations that they may face in their professional lives in the future, allowing them to examine their own professional values, becoming more conscious of and critically assessing the values. The merging of the T&I practitioner and trainer roles opens up the action possibilities of transforming the training classroom into what However, the interaction between trainer/educator and practitioner is not only mutually beneficial but it also indicates a contradiction in higher education, where a T&I teacher is expected to fulfill the institution\u2019s mission of educating students rather than performing T&I practice. T&I teachers often receive the message of prioritizing their researcher and trainer/educator roles over their practitioner role. For example, while being fully aware of the necessity of T&I practice, Paul persisted on making it the last priority due to limited time and energy.I will put training/educating in the first place. This is what we are required to do and get our monthly salary for, right? After we fulfill the teaching task, we can arrange our other two missions. [\u2026] T&I practice is vast and never-ending, sometimes interrupting your research process. Though I believe the time for practice is important, but it really takes time. (Paul)Likewise, Carol indicated a similar difficulty and ranked the role of the practitioner as the last consideration.I have to deal with three roles, which are all highly demanding. I have no other alternatives but to set priority under limited time and resource. My first priority is training/educating, which needs to be fulfilled before other considerations. And I devote the rest into my research to try to fulfill research demands. Only with these two accomplished, I would be able to consider practitioner role. (Carol)Therefore, it is evident that, that even though T&I teachers displayed great interests in practice, they prioritize their trainer/educator and researcher roles over their practitioner role.Within the context of the higher education system, T&I teachers are identified strongly as college teachers. Compared to other job opportunities, T&I teachers perceived a teaching post in tertiary education as what they are meant to do, referring to the fact that it was their \u201cideal job.\u201d This is also demonstrated that, when asked about their professional future, none of the participants would consider leaving the teaching profession.When I was a college student, I envied my teacher for their flexible working hours. They always seemed to enjoy their free time without following a traditional nine-to-five working routine. Since that time, I have had a firm belief that a college teacher is an ideal job for the future. (Amy)I have had a very firm belief to be a teacher since I was still a student of English about 30 years ago. All through these years, my determination to be a good teacher has always stood steady. I devoted all my life to it, without even considering another career path. (Paul)Nevertheless, T&I teachers experienced tensions among the three roles and responded to them in different ways. When asked about the most difficult part of bringing together the three sub-roles, most participants noted a lack of time and energy due to a heavy workload. The workload ranged from a lot of teaching-related tasks, such as preparation brought by online courses during the COVID-19 period, teaching extra classes, staff meetings, and interviews for MTI potential students, to research-related obligations. Betty, for example, mentioned that it was a complete failure to juggle research, teaching, and practice, calling it a \u201cvicious circle.\u201dDoing research takes up a long period of undivided time and attention. For example, if I can read for 5 or 10 days in a row, I will be very efficient and productive. But it is just an ideal situation. Last week, for example, I was requested to act as an interviewer for prospective MTI students, which takes 2 days. After that, you must rest for a whole day to recover from two exhausting days. Three days have gone with little progress in research. Because of this kind of workload, you can barely afford the time to take up any T&I practice, which will cause a predicament in training as you don\u2019t have the up-to-date materials for your students. (Betty)Dina\u2019s feeling of contradiction was triggered by her attempt to integrate the three roles. Instead of coherence, she felt a disintegration among the roles. This was caused by her research plan which was not in congruence with her training and practice. Instead of mutually beneficial to facilitate professional development, she believed \u201c1 + 1 + 1 < 3.\u201dIt (T&I practice) is super high. If you quit the profession for a long period, you will miss the thrill of translating like an experienced hand. As a result, there is a conflict between competing priorities. On the one hand, you work in a university and must dedicate your time to teaching. On the other hand, if you want to do effective research, you must commit your 100% attention. You should wake up at 6 a.m. and work your way through sorting, analyzing data, writing, and maybe submitting. Only 30 or 40% of attention cannot make a good research, at least for me. And if you put your whole heart into research, you won\u2019t have time or energy to devote to interpreting. For me trying to do three at the same time makes it worse, after all, 1 + 1 + 1 < 3. (Dina)Translation and interpreting teachers repeatedly mentioned that they are aware of the significance of research to their career advancement and the pressure is more likely to come from an institutional level. This institutional level of pressure together with the fear to lose their jobs, which in other words, imposed a sense of insecurity for not accomplishing research tasks.I work in a comprehensive university. At the very beginning, there were no special research requirements for a T&I teacher, a practice-oriented position. But this began to change in 2015. Even an interpreting teacher can not get a higher academic title by not doing research. What\u2019s worse, if you cannot secure a higher academic ranking, you will be forced to leave the position. It is at this time I began seriously thinking and I realized how I love T&I teaching, and how I love to be a T&I trainer/educator. In order to keep my job, I have to do research, and most urgently, I need a doctoral degree. The road to becoming a Ph.D. student is full of twists and turns. Comparatively speaking, I feel much more at ease with my teaching and practice. (Betty)It is worth noting that a number of participants responded to a similar sense of insecurity about their tenure-track contract. Traditionally speaking, the \u201cup or out\u201d rule constitutes an important part of the academic tenure system in US universities, meaning that a permanent position is provided by the institution only to those faculty members who have earned an established record in teaching, research, and service. In mainland China, the \u201cup or out\u201d rule was introduced first in 1994 in Tsinghua University but was implemented in most Tier 1 and Tier 2 universities with varying criteria from 2000 . ParticiIn conclusion, T&I practice and their job satisfaction toward the main role T&I teacher are believed to bring the three roles together while heavy workload, laboring research activity, and job insecurity due to the tenure system are to separate the three roles.In the light of the DSMRI refer to , which vAccording to the findings, participants see both the sub-roles of T&I trainer/educator and researcher as significant duties for T&I teachers and can acquire insights and skills from both in a meaningful and reciprocal manner. Reflection is associated with the enlightenment or empowerment of their T&I trainer/educator and researcher role identities: it allows for the creation of new research ideas, initiatives, or training courses.From a DSMRI perspective, their role as T&I trainers/educators exhibits existing beliefs and goals that form parts of their researcher role identities, and which are in harmony with their goal of fulfilling institutional requirements. For Carol and Paul, even before the research element was included in the training course, their existing self-perceptions and professional goals aligned with the goal of a T&I researcher role identity. The reflection process provides a platform to connect their beliefs and interests in teaching with the T&I researcher identity. The institutional requirements of teaching new courses were incorporated into the training/educating that helped carry out the research plan. What is more, the previous academic training they received as T&I researchers provides the skills and strategies for carrying out the research plan, facilitating them to enact the role of the T&I researcher.Thus, the proposed TITRI framework uses two overlapping ovals to indicate two different yet mutually beneficial role relationships. In the framework, both trainer/educator and researcher roles are visualized as the same size, the interaction represents a large degree of overlapping .The size and intersection of the circles vary based on different roles. The ovals may differ for each role, with some being larger or smaller depending on the prominence or importance of the role. The larger the oval is, the more prominent the role identity is. Between the ovals, there is more or less overlap, indicating the intersection between roles. The greater the overlap, the more integrated the role identities are.Our findings indicate that the majority of teachers perceived the interface between the T&I researcher role and the practitioner role as a \u201cdivide\u201d , p. 40. The interaction between the researcher and practitioner role is not only a divide (not overlapping), but also the former overshadows the latter, outlining a secondary position of T&I practitioner role refer to . AlthougThe secondary position and overshadowing identities can be explained by the effects of the institutional context. From a role identity perspective, both researcher and practitioner roles are commonly enacted by T&I teachers after they enter universities. While a practitioner role may align with the teachers\u2019 interests, bringing positive emotions such as excitement and enjoyment, they are also strictly defined by the institution that the T&I teacher serves. Higher education in China is undergoing an expansion and internalization process during the last two decades. First, China began its fast expansion of higher education in 1999, signaling a shift from an elite-oriented to a public-oriented higher education system, with increasing skepticism following suit about the quality of undergraduate education . As a reBecause of the expansion and internationalization of higher education in China, academic performance has become a primary goal for universities, posing strong washback effects on practice-oriented discipline teachers such as T&I teachers. To evaluate research performance and to strengthen internationalization, teachers are mandatorily required to publish in (S)SCI journals to obtain tenure and promotion. This is not unique in China though, as the tenure was proposed as early as 1940s and has been prevalent in North America . HoweverAs a result, the relationship between the roles of researcher and practitioner, a non-overlapping yet overshadowing one, is demonstrated visually in Rather than a wide divide between the researcher and practitioner roles as described by T&I teachers, they sense both the direct and indirect links between the trainer/educator and practitioner roles as they aim to utilize their practice experience to be a \u201crole model for students.\u201d More specifically, the T&I teachers\u2019 perceptions of combining training classes with authentic translation materials, as well as their desire to help the community during COVID-19, all act as components in their T&I practitioner role identity systems, which are aligned to inform the perception and goals of the T&I trainer/educator role identity system. The connection between the goals of providing a role model for students and the accompanying action possibilities and self-perception of value fulfillment leads to T&I teachers seeing the experience as rewarding and meaningful. This positive emotion reinforced the integration of the two roles.However, the trainer/educator role identity has once again taken precedence over the practitioner one. T&I teachers are required to teach a certain number of courses that are directly relevant to their job obligations as full-time university teachers, but they are not required by institutions to participate in T&I practice. To be more precise, no matter how seasoned a practitioner is or how well-received by their employers, a T&I teacher cannot be promoted to a higher academic title without high-impact publications and satisfying the teaching duties. The teacher/faculty appraisal mechanism and the promotion system thus have given rise to an enhancement of the T&I trainer/educator role but a diminishment of the T&I practitioner role.After analyzing the dynamic interaction between two role identities \u20135, we plAs the data reveal, participants are enthusiastic and satisfied with their major role identity as a T&I teacher, shedding light on how T&I teachers perceive disintegration between three sub-role components in their DSMRI system. First, due to the high loyalty to the main role, teacher in higher education, we can rightly anticipate that the participants would be motivated to make use of all available recourses, promoting themselves to further adapt to the requirements of the main role. Furthermore, since they never want to change jobs, we can expect that T&I teachers\u2019 beliefs within three sub-roles will be linked with professional goals in staying in the position even if they face temporary difficulties and setbacks. Finally, because of their long-standing attachment to the teaching role, they are unlikely to set goals and perceive action possibilities that are not conducive to the development of their main role identity.An overall TITRI framework  thus putTogether, the TITRI framework articulates the interplay of role identities and the consequences of higher education on the role identity formation of T&I teachers. It may be used to frame future research in a particular role, understand T&I teacher agency and autonomy , or gainBased on the DSMRI, the TITRI framework aims to provide a broad overview of how role identities interact with one another and ultimately merge as a T&I teacher. The framework first clearly articulates the interaction between trainer/educator, researcher, and practitioner role identities and how they relate to T&I teacher identity development. Despite the fact that previous research e.g.,  has placThe study is not without its limitations. First and foremost, the study only focuses on T&I teachers\u2019 engagement in training/educating, research, and practice. We acknowledge that T&I teachers may assume additional academic and administrative duties , such asBacui Chen (first author): BC is a doctoral candidate in the Department of Education Studies at Hong Kong Baptist University. She is also a lecturer of translation and interpreting in Lingnan Normal University in Guangdong Province, China. Her research interests include translation and interpreting training, and teacher identity/agency/autonomy. She has published several articles in Chinese journals. She has translated over 10 best-selling books from English to Chinese, including Pacific Rim series.Jing Huang (second and corresponding author): JH obtained his Ph.D. degree in Applied Linguistics from the University of Hong Kong. He has been working as a language teacher educator for more than 20 years in mainland China, Singapore, and Hong Kong. His research is in autonomy/identity/agency in second language education, TESOL teacher education, educational ethnography, and metacognition in language learning. He has published extensively in these areas in reputable journals including System; Language Teaching Research; The Modern Language Journal; TESOL Quarterly; Language, Culture and Curriculum; Asia Pacific Journal of Education; Frontiers in Psychology; Sustainability; SAGE Open; Educational Action Research; Teaching Education; etc. Google Scholar profile: https://scholar.google.com/citations?user=jJrsIUkAAAAJ&hl=en&oi=ao.The original contributions presented in this study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.The studies involving human participants were reviewed and approved by Hong Kong Baptist University Committee on the Use of Human and Animal Subjects in Teaching and Research (HASC). The patients/participants provided their written informed consent to participate in this study.BC led the research project and contributed to the research design, data collection, data analysis, article drafting, and revising. JH analyzed the data, reviewed, and revised the manuscript. Both authors have approved the submission."}
+{"text": "In comparison to cvs. Khalas and Reziz, date palm cv. Sheshi showed less tolerance to drought stress. A total of 1118 drought-responsive expressed sequence tags (ESTs) were sequenced, 345 from Khalas, 391 from Reziz, and 382 from Sheshi and subjected to functional characterization, gene ontology classification, KEGG pathways elucidation, and enzyme codes dissemination. Three date palm cultivars deployed a multivariate approach to ameliorate drought stress by leveraging common and indigenous molecular, cellular, biological, structural, transcriptional and reproductive mechanisms. Approximately 50% of the annotated ESTs were related to photosynthesis regulation, photosynthetic structure, signal transduction, auxin biosynthesis, osmoregulation, stomatal conductance, protein synthesis/turnover, active transport of solutes, and cell structure modulation. Along with the annotated ESTs, ca. 45% of ESTs were novel. Conclusively, the study provides novel clues and opens the myriads of genetic resources to understand the fine-tuned drought amelioration mechanisms in date palm.Date palm is an important staple crop in Saudi Arabia, and about 400 different date palm cultivars grown here, only 50\u201360 of them are used commercially. The most popular and commercially consumed cultivars of these are Khalas, Reziz, and Sheshi, which are also widely cultivated across the country. Date palm is high water-demanding crop in oasis agriculture, with an inherent ability to tolerate drought stress. However, the mechanisms by which it tolerates drought stress, especially at the transcriptomic level, are still elusive. This study appraised the physiological and molecular response of three commercial date palm cultivars Khalas, Reziz, and Sheshi at two different field capacities  levels. At 25% FC (drought stress), leaf relative water content, chlorophyll, photosynthesis, stomatal conductance, and transpiration were significantly reduced. However, leaf intercellular CO Phoenix dactylifera L., family Arecaceae) is a monocot, dioecious, perennial woody fruit tree with a genome size of ca 650 Mbp3. Nonetheless, a recent study reported that the date palm genome is 18% larger and more contiguous than earlier reports3. It is an ancient plant commodity in the Arabian Peninsula and possibly originated from Iraq. Date palm is cultivated in both the Old World  and the New World (American continent), and the cultivation area has been stretched from the East Indus Valley to the West Atlantic Ocean4. Total worldwide dates production is ca. 9.61 million tonnes, and the area under cultivation is 1.25 million hectares5. The Kingdom of Saudi Arabia (KSA) is the epicenter of date palm diversity with approximately 400 cultivated cultivars and ranked fourth in date production with 1.54 million tonnes from ca. 152 hundred thousand ha cultivated area6. Among 400 cultivated cultivars, Khalas, Reziz and Sheshi are among the most popular cultivars based on consumer preference, particularly in the Eastern province of KSA7.Date palm . Date palm cultivars showed an increase in WUE while decreasing gas exchange characteristics under drought stress in vitro conditions20.Drought is becoming one of the most prominent environmental challenges as a result of climate change, limiting plants' physiological characteristics21. At molecular levels, generally, two groups of such genes are known; the first group protects directly from drought and include osmotin, chaperones, water channel proteins, late embryogenesis abundant proteins, osmolyte biosynthesis, mRNA binding proteins, and sugar and proline transporter22. While the second regulates a diverse array of drought-responsive regulatory genes and include transcription factors, phosphatases, signaling molecules , and protein kinases23. Plants regulate a plethora of genes at the molecular level to alleviate the stress. Some recent advances have been made to understand the complex cascade of gene expression during osmotic stress, particularly in abscisic acid (ABA)-dependent and ABA-independent signaling pathways. ABA is an important key stress-signaling hormone in plants. In ABA-dependent pathway, hyper-production of ABA is achieved to mitigate the drought. In turn, the ABA production triggers underlying cascade pathways such as the production of reactive oxygen species (ROS), elevation of cytosolic calcium levels, and activation of ion channels to achieve the stomatal closure. In ABA-dependent pathway, ABA-responsive element (ABRE) and ABRE-binding transcription factors (ABFs) play a pivotal role. Likewise, in ABA-independent pathway, cis-element, dehydration-responsive element/C-repeat (DRE/CRT) and DRE-binding protein 2 (DREB2) play important roles. The detailed role of key transcription factors: DREB1/cis-element binding factors (CBFs), DREB/DRE, AREB/ABFs, DREB2A, and DREB1/CBF3, in transcriptional regulation of ABA-dependent and ABA-independent gene expression have been extensively reviewed25. Besides, many other genes such as late embryogenesis abundant, photosystem, ATP synthesis, monooxygenases and DREB/CBF, are up-regulated to neutralize the adverse effects of stress26.Drought tolerant plants have certain genetic traits that help them withstand for a longer time during drought stress. Plant species can undergo various morphological, physiological, biochemical, metabolical, and molecular changes that enable them to survive under drought stress and re-establish normal cell function after stress cessation30. As the date palm genome is the least studied genome; consequently, minimal information is available regarding its genome annotation and functional characterization.Plants have enormous biological and genetic diversity, so they deploy different transcriptome/proteomic approaches to offset the drought stress. However, expression levels and underlying molecular mechanisms could vary in various plant species. Therefore, it is of prime importance to investigate and unravel the drought-responsive genes in different cultivars of the same plant species to understand their stress adaptation role. Unfortunately, apart from socio-economic values and global cultivation, date palm is among those whose genomes are less studied and characterized. Until now, just a few studies are available where stress-responsive genes in date palm were studied at the molecular level31. The PCR-Select cDNA Subtraction technique is a unique method for selectively amplifying differentially expressed sequences, which overcomes the technical limitations of traditional subtraction methods32.The transcriptomic analysis enables deciphering how a crop's intricate molecular machinery responds to abiotic stress. The suppression subtraction hybridization (SSH) technique has a substantial advantage in investigating the gene regulations in response to particular/induced stress. Additionally, it serves as an alternative to microarray in transcript profiling of novel genesIn the study outlined here, the response of three date palm cvs. Khalas, Reziz and Sheshi, to drought stress at the physiological and molecular level was investigated. The results demonstrated that the leaf physiological characteristics were negatively affected under drought conditions, and the nexus of drought-responsive gene regulation shared several similitudes and dissimilitude in these date palm cultivars. The significance of the findings is discussed in more detail.2 concentration was increased with the increase in water stress  exhibited a comparable level of phenotypes Fig.\u00a0A. At 100https://www.ncbi.nlm.nih.gov/bioproject/).Functional genomics approaches, such as EST, have been used extensively to understand the stress-response mechanism in plants.Three independent subtractive cDNA libraries of date palm cvs. Khalas, Reziz, and Sheshi, were constructed from the middle leaf tissues of drought-exposed date palm plants. A total of 2733 drought-responsive ESTs from three date palm cultivars were isolated, cloned, and sequenced. After trimming the vector sequences, eliminating low quality, duplicated, and short read-length sequences, collectively 1118 high-quality ESTs, 345 from Khalas, 391 from Reziz, and 382 from Sheshi, were subjected to the analysis. A total of 1107 ESTs were submitted to the databank after precluding those ESTs having a length of fewer than 100 nucleotides (due to databank requirements), comprising 344 from Khalas , 387 from Reziz (Bioproject PRJDB11271 accession # HX998531-HX998917), and 376 from Sheshi , and can be accessed online (https://blast.ncbi.nlm.nih.gov/). These findings indicated that ESTs were related to metabolic and cellular processes, biological regulations, biogenesis, binding and catalytic proteins, photosynthesis, integral cell membrane components, oxidative phosphorylation, translation, transcription, and immune systems. Subsequently, all the isolated ESTs were subjected to direct gene annotation (GO) for assigning biological processes (BP), molecular functions (MF), and cellular components (CC) functions. The BP results revealed that the highest number of ESTs (356 [31.85%] of 1118) were found related to metabolic process, followed by cellular process (339 [30.32%] of 1118), biological regulation (95 [8.5%] of 1118), and response to stimulus (87 [7.80%] of 1118) , Quercus suber (13 ESTs), Coffea canephora (13 ESTs), and Phaseolus vulgaris (12 ESTs). However, just a few ESTs (ca. 10 ESTs) showed a top hit with date palm  did not reveal any organism-specific similarity. Nonetheless, the highest numbers of ESTs (ca. 22) were found to be similar to m Figure .ESTs isolated from each cultivar were subjected to functional annotation, and their cellular components (CC), molecular functions (MF), and biological process (BP) were inferred. The CC analysis revealed that the highest number of ESTs related to integral membrane components were expressed in Sheshi (50 ESTs), while both Khalas and Reziz expressed an equal number of ESTs 35)  in Khalas, 10 ESTs in Reziz, and just 4 ESTs in Sheshi Fig.\u00a0. The secThe BP analysis exhibited that the majority of drought-responsive ESTs were related to the oxidation\u2013reduction process; 34 ESTs were expressed in Khalas, 33 in Reziz, and 8 in Sheshi , followed by Reziz (5 ESTs) and Sheshi (2 ESTs) Fig.\u00a0.2 evolving complex. In Reziz, H-ion transport, ATP synthase complex F0 and F1. Similarly, ligase and ubiquinol-cytochrome-reductase were unique ESTs involved in MF in Khalas. Whereas, protein di-sulphide reductase, pyridoxal-phosphate binding, and hydrolase were found in Sheshi, tryptophan synthase, hydrolase, and phosphopantothiene binding were found in Reziz  reaction centre, and PS-II-Oziz Fig.\u00a0. Unique ziz Fig.\u00a0. Apart fprocesses, and the y-axis represents their number of ESTs.Following GO annotation, assigning KO and enzyme code (EC) to the ESTs, the KEGG pathways were elucidated, and the results demonstrated that drought-responsive ESTs were associated with over 50 pathways Table . ApproxiThe KEGG pathway analysis of each cultivar revealed that three cultivars had the highest number of ESTs related to antibiotic synthesis; 29 ESTs encoding 4 enzymes) in Khalas , 22 ESTs encode transferases , 23 ESTs encode hydrolases , 51 ESTs encode lyases , 11 ESTs encode ligases , and 9 ESTs encode translocases, and 4 ESTs encode isomerases Fig.\u00a0.Figure 534, but in the case of date palm plants, the effect of drought is more pronounced on mature leaves . Date palm plant has a solitary shoot ending in a crown of leave  without having an apparent branching system. So, date palm leaves were used in the study to quantify and appraise the drought stress at the transcriptomic level.The study described here is the first to examine and appraise the molecular response to drought stress of three date palm cultivars. The drought-exposed date palm plants exhibited a comparable level of phenotype to each other. However, under natural conditions, the physiological and molecular parameters, as well as expression levels of the date palm genes, can vary due to the constantly changing environmental conditions (temperature and humidity), soil capacity to retain moisture, rainfall patterns, and rate of transpiration. During any stress, young leaves and roots are mainly affected parts of the plantArabidopsis plants overexpressing the date palm gene were previously found to have superior water management under abiotic stress conditions35. Moreover, as the plant triggers adaptation mechanisms to resist water stress, the increase in respiration at lower RWC would correspond to an increase in metabolism36.The findings of this study revealed that different physiological attributes were modulated to varying levels in the date palm cultivars. The cvs. Khalas and Reziz maintained better leaf RWC than cv. Sheshi. It could be because these cultivars were able to maintain better water potential and osmotic potential in their leaves and roots during drought. The overall improved water utilization system of cvs. Khalas and Reziz are linked to the plant's overall genetic makeup, which contributes to its drought-resistant physiology. Transgenic 29. Another study used 2D electrophoresis and mass spectrometry to analyze the proteome repertoire of drought and salinity exposed date palm plants. They deciphered that three common proteins, ATP synthase alpha, beta unit, and Ribulose-1,5-bisphosphate carboxylase (Rubisco), were differentially expressed under both stresses, while nine proteins, including chlorophyll A-B binding protein, superoxide dismutase, light-harvesting complex I protein, phosphoglycerate kinase, transketolase, and phosphoribulokinase, expressed to similar levels in salt stress28.Plants rapidly deploy a plethora of information (gene upregulation) in response to the onset of stress and orchestrate stress-responsive genes via complex regulatory networks. A study mapping the heat and drought-responsive ESTs in date palm reported similar sets of ESTs to ours37 and normal physiological conditions38. Although our results demonstrated that a similar set of ESTs was upregulated, but we may speculate on two things: first, the expression level of these ESTs would be relatively high as we generated ESTs by subtracting them from control plants; and second, the molecular mechanism underlying these regulations may differ substantially. Additionally, increased expression of these ESTs may be a common strategy for coping with a variety of stressors.Our data revealed an upregulation of ESTs involved in metabolic and cellular processes, different kinds of stimuli, protein binding, biological regulations, catalytic activities, structural molecule, and transporter activities. These findings are consistent with earlier reports in date palm, where a similar set of ESTs with comparable MF, CC, and BP profiles was observed under the saline stress39 and maintain their homeostasis by regulating the activity of photosynthesis-related proteins. During drought conditions, CO2 uptake is reduced due to impaired ATP synthesis and metabolism40. Our results demonstrated elevated levels of ATP synthesis-related genes. A mitochondrial terminal oxidase, alternate oxidase, is responsible for the uncoupling of the energy consumption of ATP synthesis in N. tabacum plants. The overexpression of this enzyme improved the photosynthetic performance under drought conditions41. Nonetheless, some findings revealed that photosynthesis was compromised through stomatal apertures not by ATP synthesis42. Nonetheless, our results demonstrated that cvs. Khalas and Reziz used a greater proportion of photosynthetic machinery and associated parameters than cv. Sheshi to cope with drought, which corroborates previous research demonstrating a link between photosynthetic rate and intercellular CO2 concentration in date palm43. Additionally, ATP synthase was upregulated in cv. Reziz, which might be linked to its hyper ability to withstand against drought stress compared to the other two cultivars. The peptide mass fingerprint analysis of drought-exposed muskmelon revealed an upregulation of proteins involved in photosystem, nucleotide biosynthesis, DNA binding, and stress-responsive proteins44. Our findings corroborate to Kim et al. (2007), who demonstrated the upregulation of DNA-binding transcripts and these proteins were involved in post-transcriptional gene expression processes and in the regulation of abiotic stresses45. Conclusively, chloroplast plays a core role in mitigating drought stress by up-regulating the photosynthetic protein repertoire, ATP bindings and signaling pathways.The current results inferred that the upregulation of genes, inclusively and conclusively, involved in photosynthesis, ATP synthesis, maintaining cell and cell membrane integrity, oxidation\u2013reduction pathways, maintaining homeostasis, metal ion binding proteins, and protein synthesis. Under drought conditions, photosynthesis is severely compromised. As photosynthesis sensors, chloroplasts are directly and indirectly affected by light intensity and water and moisture availability. Under drought stress, chloroplast communicates retrogradely with the nuclear genome to mediate the expression of nuclear-encoded plastid proteins to ameliorate the stress46, and its structure, level, and activity are severely compromised under drought stress48, which was linked to an inhibitor of Rubisco activity in tobacco leaves48. In drought susceptible wheat germplasm, the Rubisco level severely dropped in the flag leaves, resulting in early senescence, while it remained steady in the drought-tolerant germplasm49. A study corroborated our findings that analyzed the proteome repertoire of drought- and salt-responsive date palm plants and exhibited significant upregulation in the levels of Rubisco and its components28. So, it is speculated that elevated levels of Rubisco are a common mechanism among date palm cultivars to orchestrate normal cell functions to mitigate drought stress. By triggering the precursors of Rubisco activase and Phosphoglycerokinase, the level of rubisco and carbohydrates synthesis, including 3-phosphoglycerate, can be enhanced50. Subsequently, this leads to glucose and pinitol production, and both function as major osmolytes under drought conditions51.Rubisco is a rate-limiting enzyme in the Calvin cycle52. Disruption or down-regulation of any LHCB members led to a reduction in drought tolerance, responsiveness of stomatal movement to abscisic acid (ABA), and compromised ROS homeostasis53. Water stress decreases up to 55% chlorophyll contents in plants55 and in the present study, a substantial reduction in the chlorophyll contents could be attributed to the sensitivity of this pigment to escalating water stress and impaired photophosphorylation process due to decreasing leaf water potentials58. A peanut gene related to chlorophyll biosynthesis (AhGLK1) was up-regulated during drought stress, and its expression into glk1glk2 mutants Arabidopsis plants induced a green phenotype and recovery from drought stress59. Similarly, Brassica napus Drought 22 kD (BnD22), a chlorophyll-binding protein, protected younger tissues from adverse conditions and sustained sink growth under stress conditions60. Drought sensitivity was found to be linked with impaired LHCBs and chlorophyll contents in wheat61. All the previous studies concur with the findings presented here, signifying that expression of LHCBs or chlorophyll pigments or photosynthetic antenna protein complex is a common mode of action for alleviating drought stress in different plant species.Light-harvesting chlorophyll-binding a/b proteins (LHCB) are the most abundant protein in nature and are part of PS-II. Numerous ESTs encoding PS-I and PS-II components were upregulated in all three date palm cultivars. Several members of the LHCB family (LHCB1-to-LHCB6) are known in plants, where they serve as antenna complexes for light harvesting and photoprotection62, and function in auxin biosynthesis, osmoregulation, metabolism of glucosinolates, stabilizes photosynthetic structure, pathogen defense and abiotic stresses63. The overexpression of two Arabidopsis FMO genes, YUC6 and YUC7, enhanced drought tolerance, auxins biosynthesis, and reduced ROS levels65. The expression of choline MO in tobacco plastids catalyzed the conversion of choline to betaine aldehyde (glycine betaine [GB]), improved photosynthetic rate, and increased tolerance to drought/salt stress66; in addition, it up-regulated GB synthesis in the young tissues of drought-stressed plants67. Similarly, 3-to-5 folds increase in choline MO was observed in Sugar beet and Amaranth plants under drought conditions68. In Arabidopsis and wheat plants, MOs indirectly enhance drought and salinity tolerance by interacting and mediating the constitutive expression of methionine sulfoxide reductase69. The role of MOs towards drought and salinity tolerance is very versatile and accomplished by the interplay of different biochemical mechanisms. The expression of ESTs related to MOs in three date palm cultivars is suggestive of maintaining the water balance, reducing the ROS level, improving the photosynthetic rate and ultimately ameliorating the drought stress.ESTs encoding monooxygenases (MO) were expressed in all three date palm cultivars, with the highest number of MOs were observed in Khalas. Flavin-containing MOs (FMOs) are most abundant in plants; 29 FMO like genes have been identified in Arabidopsis only. FMOs catalyze the transfer of hydroxyl group to small nucleophilic atoms such as iodine, nitrogen, selenium, and sulfur71. An upregulation of different MIBs  in three date palm cultivars was observed. The zinc finger proteins (ZFP) are well-studied ZIB proteins that are abundant in different plant species. About 176 ZFP have been identified in Arabidopsis, 126 in wheat, and 109 in Populus trichocarpa74. ZIBs improve abiotic stress tolerance in plants by scavenging ROS, inducing ABA, enhancing soluble sugars, and reducing water loss by closing the stomatal apertures76. The overexpression of a ZFP, BBX24, enhanced the tolerance of Chrysanthemum morifolium plants to drought and salt77. Additionally, certain ZFPs, AtTZF, AtRZFP, DST, ZAT12, interact with other proteins like Mediator of ABA-regulated Dormancy 1 (MARD1), Fer-Like Iron Deficiency-Induced transcription Factor (FIT), Jasmonate Zim protein 7 (JAZ7) and abscisic acid receptor (PYL5) to ameliorate salt and osmotic stress in various plants79. Under drought conditions, the Oryza sativa metallothionein 1a (OsMT1a) and cotton metallothionein 3a (GhMT3a) genes were upregulated, with the highest levels in the roots81.Metallothioneins  are biological chelators that regulate metal ions homeostasis and buffer the damage caused by different abiotic stresses, including drought82, and maize plants produced the highest levels of chloroplast thylakoid membrane proteins83. Drought stress perturbed the phospholipid composition of wheat plants by affecting the phosphatidylcholine/phosphatidylethanolamine ratio and unsaturation in the fatty acyl chains84. Phospholipids can regulate aquaporins, the constitutive expression of the AQP gene, StPIP1, in potato plants improved drought tolerance, nonstructural carbohydrates level, and WUE85. Our physiological data revealed a small difference in WUE\u00a0between stressed and non-stressed plants, apart from cv. Khalas, which differed substantially from the other cultivars after 90\u00a0days of stress. Our findings coincide with those of Helaly et al.20, who reported an increase in WUE in date palm cvs. Shamia and Amri with the increase in water stress. So, we speculated that upregulation of WUE, ESTs associated with integral membrane components, and thylakoid membranes play a pivotal role in improving drought tolerance in the date palm cultivars. ATP binding proteins (ABPs) play a critical role in adaptation to water scarcity via regulating the stomatal openings, increasing active transport of solutes, and ABA87. ABP is a large family of membrane transporters in plants with over 200 known members in rice, Lotus japonicus, and Arabidopsis plants. The Arabidopsis ABP, AtABCG25/WBC26 transporter, is an ABA efflux carrier, and its overexpression reduced the water loss by facilitating ABA delivery to guard cells88; similarly, expression of AtABCG36 in transgenic Arabidopsis plants contributed to drought stress and salt resistance89. An increased level of ABP and GBP was observed in Arabidopsis and Betula halophila plants under drought stress, and the significant increase in ABP is consistent with the increased activity of ATPase91. Thus, all three date palm cultivars opted for similar molecular mechanisms to mitigate the drought stress by overexpressing the ABP-associated ESTs.Drought poses unique challenges to plants at the cell wall and the membrane levels. Plants try to circumvent water scarcity by restructuring the polysaccharide-rich cell wall and lipid bilayer cell membrane. Our data indicated that approximately 11% ESTs related to integral components of the cell membrane and around 8% ESTs related to chloroplast thylakoid membranes were expressed. Inevitably, more ESTs involved in cell structure modification, mitotic cell cycle, microtubules, and cytoskeleton were upregulated in cvs. Reziz than Khalas. This demonstrated that Reziz deployed more cellular resources to re-structure its cellular integrity than the other two cultivars. Under drought conditions, barley plants extensively rearranged actin filaments of leaf cellsDendrobium wangliangii, an endangered species due to climate change92. In general, the response of the cv. Sheshi to drought was comparable to that of the cv. Reziz, as similar sets of drought-responsive genes were transcribed in both cultivars  numbers distribution is a hierarchical numbering system for enzymes based on the reaction they catalyze. We performed the EC distribution analysis and found different ESTs belonging to all the major classes of enzymes. Similar findings have also been reported earlier in date palm cv. SukaryAlthough we were able to map a decent number of ESTs against the available repositories, representing\u2009~\u200950% of the ESTs collection, nonetheless, a huge number of ESTs were novel and could not be mapped, as gene annotation data is not available. The role of novel ESTs in date palm drought tolerance would be substantially important and could interest future studies. In addition, such genes could provide novel clues and can be used to develop drought (or abiotic stresses) tolerant date palm plants.The present study was conducted during the years 2018\u20132019 at the Date Palm Biotechnology department, Date Palm Research Center of Excellence, King Faisal University, Saudi Arabia . Five-year-old, uniform, mature offshoots of commercial date palm cvs. Khalas, Reziz and Sheshi, raised through tissue-culture were obtained by Balakrishnan Sudhakar from SAPAD Tissue Culture Date Palm Co., Dammam, Saudi Arabia. The formal identification of the date palm cultivars was performed by M. Munir (Plant physiologist). These plants, however, were not deposited in a publicly accessible herbarium because they all were commercial cultivars. Plants were then potted  in a 1:2 mixture of sandy loam soil (Aridisol soil) and sphagnum peat moss compost.105. Sandy loam soil contained 79.94% sand, 8.13% silt, 11.93% clay, 7.42 pH, 3.87 dS m\u22121 EC, 3.57% moisture content, 1.57\u00a0g\u00a0cm\u22123 bulk density, 0.24% organic matter, 17.68\u00a0mg\u00a0kg\u22121 total nitrogen, 11.18\u00a0mg\u00a0kg\u22121 phosphorus, 13.58\u00a0mg\u00a0kg\u22121 potassium, and 20.53\u00a0mg\u00a0kg\u22121 sodium. The sphagnum peat moss had 5.2 pH, 2.3 dS m\u22121 EC, 39.73% moisture content, 0.94\u00a0g\u00a0cm\u22123 bulk density, 92.47% organic matter, 976\u00a0mg\u00a0kg\u22121 total nitrogen, 341\u00a0mg\u00a0kg\u22121 phosphorus, 543\u00a0mg\u00a0kg\u22121 potassium, and 283\u00a0mg\u00a0kg\u22121 sodium. Prior to drought induction, the date palm plants were acclimatized in a sterilized growth room for 3\u00a0months. The mean diurnal temperature of the growth room was 27\u2009\u00b1\u20092\u00a0\u00b0C, relative humidity 60%, and 14\u00a0h day\u22121 photoperiod (800\u00a0\u00b5mol\u00a0m\u22122\u00a0s\u22121 photosynthetic photon flux density\u2014PPFD). Three replicated control plants of each cultivar were watered at 100% field capacity (FC), while a gradual and progressive water deficit plan was followed to induce drought stress at 25% FC in three plants of each cultivar106. The experiment was laid out on a completely randomized design with three replications of each date palm cultivar.The sandy loam soil was collected from the top layer (0\u201320\u00a0cm) of a nearby barren field with no sign of vegetation (Latitude 25\u00b0 16\u2032 27.4224\u2033 N and Longitude 49\u00b0 42\u2032 24.8328\u2033 E). It was air-dried at room temperature, sieved through 2\u00a0mm stainless steel wire mesh, and sterilized in an autoclave at 121\u00a0\u00b0C for 2\u00a0h107 after 90\u00a0days of water stress. Three fully expanded leaves were excised from the second whorl of the plant of each cultivar, and their fresh weight was recorded within 2\u00a0h. Leaf turgid weight was obtained after immersing these leaves for 16\u00a0h in distilled water. After soaking, leaves were carefully dried with tissue paper prior to the determination of turgid weight. Leaf dry weight was obtained after drying the leaves sample for 72\u00a0h at 70\u00a0\u00b0C. Relative water content was calculated from the following equation:The estimation of relative water contents (RWC) of leaves was accomplished in accordance with Cao et al.Pn), stomatal conductance (gs), transpiration (E), and intercellular CO2 concentration (Ci) were estimated at 0, 45, and 90\u00a0days of water stress using the Li-6400XT photosynthesis system  as described previously108. A leaf area of 6 cm2 was inserted in the Infra-Red Gas Analyzer (IRGA) chamber for the estimation of photosynthesis and related parameters. The leaf temperature of the IRGA chamber was adjusted at 25\u00a0\u00b0C. Inside the chamber, the reference and sample CO2 were set at 400\u00a0\u00b5mol m2\u00a0s\u22121 with 500\u00a0\u00b5mol\u00a0s\u22121 airflow. The photosynthetic WUE was calculated by Pn/E after 0, 45, and 90\u00a0days of drought induction.Among physiological parameters, leaf chlorophyll content was calculated after 90\u00a0days of water stress using a chlorophyll meter . The photosynthesis (\u22121) and 1/5 volume of 3\u00a0M sodium acetate were added to the supernatant and inverted gently for 6\u20128 times. Two volumes of chilled isopropanol were added, mixed, and incubated overnight at \u221280\u00a0\u00b0C. The next morning, the total RNA was harvested by centrifuging the contents at 20,000\u00a0rpm for 30\u00a0min at 4\u00a0\u00b0C. The resultant RNA palette was air-dried and then re-suspended in 10\u00a0mM TE buffer. To get rid of any DNA contamination, the extracted total RNA solution was first treated with DNase I (1 U 100\u00a0\u03bcL\u20121) and then phenol:chloroform (1:1) extraction was performed. Finally, the total RNA was precipitated at 20,000\u00a0rpm for 20\u00a0min and the resultant pellet was air-dried for two minutes and dissolved with nuclease-free water. The isolated RNAs' quality and quantity were assessed spectrophotometrically  and electrophoretically. All plasticware and utensils used in RNA extractions were pretreated with 0.8% of the Diethyl Pyrocarbonate (DEPC) solution.Two grams (g) of mature leaf tissues (middle leaflets) were collected at fortnight intervals throughout the year, snap-frozen in liquid nitrogen, pooled, and stored at \u2212 80\u00a0\u00b0C until used. To isolate total RNA from frozen samples, they were ground in a pestle with mortar. A total of 72 samples were subjected to total RNA extraction using a unique and modified protocol. Ten ml of lysis buffer  was added and mixed to the ground tissues, followed by 5\u00a0ml of ice-cold chloroform and 2\u00a0ml of water-saturated phenol and isoamyl alcohol (2:1). After mixing thoroughly, the homogenate was transferred to a sterile 50\u00a0ml polypropylene (PP) tube and incubated in a water bath at 40\u00a0\u00b0C with intermittent mixing. The resultant lysate was spun at 20,000\u00a0rpm at 4\u00a0\u00b0C for 10\u00a0min. The supernatant was carefully aspirated into a nuclease-free 50\u00a0ml centrifuge tube and mixed with an equal volume of phenol:chloroform mixture (1:1). The mixture was incubated in a rocker for 30\u00a0min at 10\u00a0rpm, then centrifuged at 20,000\u00a0rpm. The supernatant was transferred to a nuclease-free PP tube. Muscle glycogen (5\u00a0\u00b5g\u00a0mlMessenger RNA (mRNA) was isolated from their respective purified total RNA using the mRNA purification kit . The synthesis of cDNA, both first and second strands, was carried out using the SMARTer cDNA synthesis kit .\u00ae PCR-Select\u2122 cDNA Subtraction Kit . The cDNA of drought-stressed date palm (tester) plants was hybridized with the cDNA of the control date palm (driver) plants to subtract the cDNA of the driver plants. The remaining unhybridized cDNA, representing differentially expressed genes, were subjected to second-strand synthesis and PCR amplification. The resulting double-stranded (ds) cDNAs were ligated into a TOPO-TA cloning vector , transformed into Escherichia coli (strain DH5\u03b1), and spread on an Ampicillin and IPTG/X-Gal LB agar plates. Colonies with successful insertion were cultured to isolate the recombinant plasmids  and then sequenced to make drought-specific libraries of cvs. Khalas, Reziz and Sheshi. In the end, a unique identifier nomenclature (DPRC2K16C 1-2733) was developed to assign a unique number to each clone.The drought-responsive SSH library of expressed transcripts of each cultivar was generated by two-step subtraction hybridization using Clontechwww.ncbi.nlm.nih.gov). The finally cleaned ESTs were BLASTx searched (www.ncbi.nlm.nih.gov)109 using a non-redundant (nr) database with an acceptable cutoff E-value at\u2009\u2264\u20091.0E-\u221205. If no homology was found in the BLASTx search, then the BLASTn algorithm was used in conjunction with the nucleotide sequence database with an acceptable cutoff E-value at\u2009\u2264\u20091.0E\u221205. Besides, the reference data were used from the European Molecular Biology Laboratory (EMBL) and the DNA Data Bank of Japan (DDBJ).Purified clones were sequenced with M13 (\u201220) forward sequencing primers using the Sanger sequencing platform. The obtained sequences were cleaned by trimming vector and adapter sequences using online sources  tools were used for an additional level of functional annotations and assigning pathways. Furthermore, the results of InterProScan were merged with GO annotation to yield more precise data. Initially, the drought-responsive date palm ESTs were annotated and considered credible according to the BLASTx results against the non-redundant (nr) database with an E-values\u2009\u2264\u20090.05. However, this ends up with just a small number of ESTs with GO analysis. Subsequently, the analyses were carried out at E-value 10 to yield maximum GO data. The unmatched ESTs were further searched through the Pfam database in the OmicsBox. For the ESTs with multiple BLAST hits, only the highest score hit was considered credible and included in the analysis. In addition, enzyme mapping of ESTs was performed using OmicsBox and KEGG pathways were elucidated using KEGG orthologs (KO) using the OmicsBox default parameters.To annotate and map the date palm ESTs, OmicsBox (v1.2.4) was usedp\u2009\u2264\u20090.05), if the ANOVA showed significant differences at a 5% probability level.The recorded data were analyzed using Genstat software, 14th Edition . Duncan\u2019s Multiple Range Test (DMRT) was applied to determine the least significant difference between treatment means  to drought stress at physiological and transcriptome levels. Although drought stress significantly affected leaf RWC, chlorophyll content, photosynthesis system, and WUE, however, date palm cvs. Khalas and Reziz thrive well under the stressed environment (at 25% FC) compared to cv. Sheshi. At the transcriptomic level, each date palm cultivar deployed not only common but also distinct mechanisms for drought stress amelioration, indicating their indigenous potential to ameliorate drought stress. The response of cvs. Khalas and Sheshi to drought amelioration was comparable, while cv. Reziz deployed more pathways associated ESTs, showing its higher potential to withstand against drought conditions. A large number of ESTs were novel and indigenous to date palm, and their functions could not be assigned due to a lack of nucleotide sequence homology with other plant species. However, this could be an area of interest for future studies. To the best of our knowledge, this is the first study in which the response of three elite date palm cultivars at the molecular level was studied and appraised.Supplementary Information."}
+{"text": "The use of rapid molecular tests may anticipate the identification of causative agents and resistance determinants in the blood of critically ill patients with sepsis. From April to December 2021, all intensive care unit patients with sepsis or septic shock who were tested with the T2Bacteria and T2Resistance assays were included in a retrospective, single center study. The primary descriptive endpoints were results of rapid molecular tests and concomitant blood cultures. Overall, 38 combinations of T2Bacteria and T2Resistance tests were performed. One or more causative agent(s) were identified by the T2Bacteria assay in 26% of episodes (10/38), whereas negative and invalid results were obtained in 66% (25/38) and 8% (3/38) of episodes, respectively. The same pathogen detected by the T2Bacteria test grew from blood cultures in 30% of cases (3/10). One or more determinant(s) of resistance were identified by the T2Resistance assay in 11% of episodes (4/38). Changes in therapy based on T2Bacteria and/or T2Resistance results occurred in 21% of episodes (8/38). In conclusion, T2Bacteria/T2Resistance results can influence early treatment decisions in critically ill patients with sepsis or septic shock in real-life practice. Large, controlled studies remain necessary to confirm a favorable impact on patients\u2019 outcomes and antimicrobial stewardship interventions. Bloodstream infections (BSI) caused by multidrug-resistant (MDR) bacteria remain associated with high mortality ,2,3. The\u00ae) technology  [Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, and Escherichia coli) and of different resistance determinants with the T2Resistance assay , within 3\u20135 h after the blood draw [Since blood culture results (identification and susceptibility test) usually become available after 48\u201396 h from the onset of the infection , the useMA, USA) ,14,15,16ood draw ,17,18.In the present single center experience, we describe the use of the T2Bacteria and T2Resistance assays in critically ill patients with sepsis or septic shock, as well as the influence of their results on treatment decisions.The present retrospective study was conducted in intensive care units (ICUs) of San Martino Policlinico Hospital-IRCCS for Oncology and Neurosciences, a 1200-bed teaching hospital in Northern Italy. At the time of the study, the hospital had five ICUs: (i) one for general ICU patients and neurosurgical patients, with 28 beds; (ii) one for coronavirus disease 2019 (COVID-19) and respiratory patients, with 10 beds; (iii) one for cardiovascular surgery patients, with 12 beds; (iv) one for major surgery and solid organ transplant patients, with 10 beds; (v) one in the emergency department, with 8 beds. From 1 April 2021 to 31 December 2021, all ICU patients with sepsis or septic shock who were tested with the T2Bacteria and the T2Resistance assays at the clinical onset of sepsis/septic shock were included in the study. Decisions about which patients to test were made by infectious diseases consultants according to local practice, based on personal judgment and balancing different factors . Patients could be included more than once if they were tested during different sepsis/septic shock episodes. Blood cultures were also performed in all episodes at the onset of sepsis/septic shock, according to standard practice. Sepsis and septic shock were defined according to Sepsis-3 criteria [Enterococcus faecium; Staphylococcus aureus; Klebsiella pneumoniae; Pseudomonas aeruginosa; Acinetobacter baumannii; Escherichia coli. The T2Resistance assay allows detection of the following resistance determinants: blaKPC; blaOXA-48; blaNDM; blaVIM; blaIMP; blaCTX-M-14/15; blaCMY; blaDHA; vanA/B; mecA/C. Blood culturing was performed for 5\u20137 days in accordance with routine laboratory practice using the automated Bactec FX system . Positive blood cultures were subjected to Gram staining microscopy and solid-medium subcultures. The Vitek MS MALDI-TOF system  was routinely used for identifying microorganisms isolated from blood culture, whereas the Vitek 2 AES system was used for susceptibility testing. The results of the susceptibility tests were interpreted according to the criteria of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) . The immunochromatographic rapid diagnostic test RESIST-4 O.K.N.V. RDT  was used to detect different carbapenemases in culture-grown Gram-negative bacteria.For each episode, two whole blood samples for the T2Bacteria Panel and T2Resistance panel assays were collected into 4-mL K2 EDTA Vacutainer blood collection tubes. T2 specimens were processed immediately upon their arrival at the laboratory by a fully automated T2Dx instrument. The T2Bacteria assay allows detection of the following bacteria: No a priori sample size calculation was performed for this preliminary, exploratory study. Descriptive endpoints are reported by number and percentages. Exact confidence intervals for percentages were calculated with the Blaker\u2019s method . DescripDuring the study period, 38 T2Bacteria and T2 Resistance paired tests were performed on whole blood from 33 ICU patients with sepsis or septic shock. Their median age was 62 years (interquartile range 47\u201371) and 55% were males (18/33). The most frequently suspected source of infection was the lower respiratory tract , followed by the abdomen , whereas endocarditis, mediastinitis, and the urinary tract were the suspected primary source of infection in one episode each. The source of infection was unknown/unclear in the remaining 37% of episodes (14/38). Additional details on the demographic and clinical characteristics of patients are available in Candida auris grew from blood cultures in presence of a T2Bacteria test positive for Klebsiella pneumoniae).The results of T2Bacteria and T2Resistance tests, as well as their concordance with blood cultures results, are shown in Klebsiella oxytoca, one for Citrobacter freundii, one for Staphylococcus epidermidis, and two for Candida auris). In one of the three episodes with invalid T2Bacteria results (33%), blood cultures turned out positive for K. pneumoniae, whereas they were negative in the two remaining cases. In one of the four episodes with positive T2Resistance results (25%), results were consistent with those obtained from the standard laboratory workflow (KPC-producing K. pneumoniae), whereas discordant results were observed in the other three episodes with positive T2Resistance results , since no growth was observed from blood cultures.In episodes with negative T2Bacteria results, positive blood cultures were obtained in five cases (one for p = 0.334).As shown in In this preliminary, real-life experience, the results of the T2Bacteria and T2Resistance assays led to early changes in antibiotic therapy in 21% of critically ill patients with sepsis or septic shock admitted to ICUs. Citrobacter spp. or Klebsiella oxytoca, which were detected by blood cultures in some episodes in our study) and resistance determinants  that are not covered by the T2 panels, and thus cannot be detected before blood cultures\u2019 results. From this standpoint, a decision of continuing the initial regimen could still reflect appropriateness  and potential usefulness of the T2 assays. The possibility of negative T2 results in the presence of a non-bacteremic sepsis/septic shock should also be weighed in balance when making early treatment decisions in patients already colonized by MDR bacteria. In our opinion, there is a need for training and expertise in interpretating T2Bacteria and T2Resistance results at the bedside of critically ill patients with sepsis or septic shock. Indeed, it cannot be excluded a priori that a treatment change decision taken without balancing all factors discussed above could be harmful. For this reason, in our real-life experience, T2-guided decisions were always made by infectious diseases specialists. In this context, diagnostic stewardship is necessary to optimize the benefits of syndromic testing and to ensure a correct interpretation of the results in the context of the patient. In our analysis, we compared crude 30-day mortality between episodes in which treatment was changed based on T2Bacteria/T2Resistance results and episodes in which treatment remained unchanged, to confirm that no increase in mortality occurred after changes in treatment based on T2 results.In our opinion, two pragmatic clinical considerations stem from the present study. Firstly, T2Bacteria and T2Resistance assays can influence early treatment decision in real-life practice. The effectiveness of these laboratory tests should be tested in large, controlled studies with respect to their impact on clinically relevant endpoints. With regard to the T2Bacteria assay, Quirino and colleagues , in an uOverall, the global impact of T2Bacteria/T2Resistance on clinical outcomes at population level needs to be assessed in controlled studies. Nonetheless, we believe that our preliminary results can be considered promising regarding the potential for T2-guided early escalation/de-escalation in critically ill patients with sepsis/septic shock, for improving either clinically relevant outcomes or antimicrobial stewardship interventions . This hypothesis is in line with the findings of a recent systematic review and meta-analysis summarizing the favorable impact on resources utilization of T2Candida and T2Bacteria assays .The main limitations of the present study are the small sample size of our study population, the lack of a control group, and the unavailability of the T2Candida assay in our hospital at the time of the study . Chance related to the small sample could also explain our 66% concordance rate between T2Bacteria and blood cultures results, which was lower than in other studies ,18, althT2Bacteria/T2Resistance results can influence early treatment decisions in critically ill patients with sepsis or septic shock in real-life practice. Large, controlled studies are warranted to confirm a favorable impact on clinically relevant patients\u2019 outcomes and antimicrobial stewardship interventions."}
+{"text": "Recently, one of the authors and his family migrated from Nigeria to take up employment in the United States of America and the other from Spain to the United Kingdom. Both journeys have been ones of mixed feelings, as we have both reaped rewards, but have experienced significant hardships. The migration of skilled workers has been ongoing for centuries and seems set to continue. Individuals who embark on such journeys become entangled with a lot of hopes and expectations, some of which may be unfounded. However, there are several benefits and drawbacks to migration from source nations into any of the advanced receiver countries. In this paper, we share our experience as highly-skilled workers and hope that this will help stimulate other individuals who have embarked on this journey or are yet to commence the process. We also hope that this paper will inform policy direction, employers\u00b4 attitudes, and community response to highly-skilled immigrant workers. International migration is defined as the movement of people from one country to another to take up employment, establish residence, or seek refuge from persecution, either temporarily or permanently . It is uHowever, migration is not all from the global south, as some OECD developed countries such as Spain, Italy, Portugal and Greece overproduce highly-skilled graduates themselves and therefore these workers are added to the list of economic migrants to countries such as the United Kingdom in order to maintain skills and have the career to which they have been trained. Migrating to countries such as the USA or the United Kingdom has its potential benefits and hardships. Highly-skilled workers may migrate to enjoy a better lifestyle, secure income, education for their children and more opportunities in general . Some miAll immigrants  are naturally affected by and may suffer different levels of cultural shock on arrival at their new employment site in the host country. To this group of workers, understanding the new work environment, cultural practices, and expectations, and the \u201cwiring\u201d of people\u00b4s minds in the new country would be most helpful - especially in the early stages of their cultural adaptation. Migrant workers are faced daily with a lot of challenges and abuse which affect their health, productivity, and longevity in the workplace. These challenges may range from language difficulty, cultural differences, values and beliefs, racism and lateral oppression. Although, many organizations claim to be equal opportunity systems in line with USA or European labor laws, in practice, this is not the case as there are several forms of inequity and unfairness to migrant workers. These may be system-engineered or policy-medicated. Until now, most OECD developed countries have largely ignored the challenges and abuse within the industry concerning migrant workers, but they may not be able to continue to do so for much longer .Although immigrants may have different levels of skills, this article focuses mainly on highly-skilled legal immigrants who may be so classified because of having a tertiary degree or earning above a prescribed income limit. The recruitment and engagement of highly-skilled migrant workers is usually triggered either by demand or supply factors . In demaThe majority of these international migrant workers work under conditions that increase their risk of illness and injuries . Every mQualifications and certifications issues: to be qualified to be employed as a highly-skilled immigrant, one must either have a tertiary degree or a unique skill set that is needed to solve a particular problem, create a new product, or improve an existing system. This qualification and/or skill may be scarce in the recipient country. But, no matter the qualifications, as a migrant one may be viewed with suspicion. There is also a form of qualification racism as immigrants may suffer from a lack of skills recognition and employment commensurate with qualifications and experience [perience . These uCultural difference issues: highly-skilled individuals who migrate to various OECD developed countries  from developing countries  for work, experienced different levels of cultural shock - this is the mixture of anxiety and feelings of confusion, excitement, and insecurity to which each person feels differently [ferently . These cferently . High peferently . Every hLanguage is another dimension of cultural shock that high-skilled immigrants face regularly. They may be poor or inadequate in the use of local dialect, requiring their attending language classes before officially resuming work. In the United States, although English is the official language, there are several tribal languages that an immigrant working with native Americans (for instance) will have to contend with. Furthermore, although all may speak the same language (English), certain words may have different meanings for different people. This may be more problematic for migrant workers from non-English speaking backgrounds (NESB) . LanguagEthical issues: these vary remarkably across nations of the world, as what is ethically correct and or accepted in one region, state or nation may be unacceptable in others. Most high-skilled immigrants have four main ethical issues in the United States or Northern Europe - privacy, accessibility, property, and accuracy [accuracy . For insaccuracy ?Cost of living issues: highly-skilled immigrant workers spend more in their new location to settle down, equip their homes, buy food, and move around. It is not uncommon to see them live first in hotels, then in a temporary, but expensive accommodation, before qualifying to rent. Buying houses are also impossible initially as they do not have 12 to 24 months\u00b4 rent history, nor a good credit history if this is their first entry into the United States or the United Kingdom. New immigrants may have to hire or rent vehicles for transportation, buy furniture, fitting and equipment; and for those living in small cities, import what they need from distant, larger cities. To obtain their full documentation, driver\u00b4s license, state identity cards, social security number, and work permits, a lot of resources are needed and are spent. So, even when the employing agency decides to support these processes with relocation allowances, this is usually never enough to cover the expenses incurred by highly-skilled immigrant workers in traveling and settling down. One of the authors (RAF) had to work in the unskilled job sector in order to have an income while awaiting validation of degrees and training documents. This experience is not unique and highly-skilled migrants should be prepared to do similar to support themselves because with the COVID-19 pandemic efficiency of government agencies has been slowed to a halt in many countries.Capacity and documentations issues: highly-skilled immigrants are expected to, not only have the required qualifications for the job but to really know their work and assignments. They should both \u201ctalk the talk\u201d and \u201cwalk the talk\u201d. They are not expected to think they know their work, but to really know the work as people will expect the very best from them. The employing organization will also expect the new migrant to go \u201cabove and beyond\u201d in their task, work beyond the normal work hours to deliver outcomes that are second to none, and have extraordinary results to justify employment. However, because highly-skilled migrants often have a different experience from that of native skilled workers, their perspectives on problem-solving and access to non-overlapping knowledge networks will differ from natives [ natives . This di natives . To get Highly-skilled immigrants will be compared naturally with natives who had previously occupied the same office and positions. As staff may wonder why the migrants were employed in the first place, seeking reasons to work for or against them, it is the capacity and documentation skills of the migrant workers that will distinguish them and solidify their position. It is also important to note that proponents of the human capital theory suggest that skill plays a key role in employment prospects for international migrants because of the more skilled the worker, the greater his/her productivity . MoreoveOne of the unique capacities expected of a highly-skilled migrant is the capacity for elaborate documentation of activities, communications, decisions, and action. To mitigate litigation and backlash, a highly-skilled worker should ensure that all the Ts are crossed, and Is are dotted. For instance, to engage new staff, a migrant worker must document every single step taken from vacancy announcement to selection and onboarding. If this is not properly done, the new immigrant may lose in a court of law if they believe that they were not taken because of irregularities, bias, or policy violations. To introduce new concepts and practices, a skilled immigrant must ensure that every step is equally documented, and that required approvals are obtained from superior powers before next steps are taken, even when there are policy provisions. This becomes more important when such policy provisions have never been implemented. Deliberately proactively seeking clear approval will prevent these conflicts.Character and core values issues: a lot is expected of a highly-skilled immigrant worker - far and above the native and locally trained/employed workers. Character and core values are key to a sustainable placement. Both employer and employees are looking for a slight slip especially if the migrant is from a country noted for corruption and other malpractices. People will check the migrant out, weigh them in the balance, and make judgments concerning them. Their character in terms of time management, meeting management, professionalism, personality type, human relationships, and several other character aspects will determine how the migrant fits into the system, and how long they will keep their current position. It is advisable that a single-line narrative be avoided in judging and assessing a highly-skilled migrant worker.Racism, lateral oppression, and gender issues: highly-skilled immigrants working in their native countries enjoy protection against all forms of racism and lateral oppression. However, this is completely lost as one migrates into a receiver nation, such as the USA. This is worst if one is to work in a state or location that has a uniformity of a particular ethnic group, such as Caucasian or native tribes; or states with significant white supremacy, as may be seen in certain parts of the USA.Supervision issues: highly-skilled immigrant workers are also faced with having supervisors with different orientations, values, and work ethics. This is worst when the supervisors are less qualified, may not have tertiary education, and may even suffer from low self-esteem or ego problems, historical trauma, or are currently in need of psychological or mental health support. It is not also uncommon to have these highly-skilled immigrants supervised by multiple individuals with a different understanding of the primary task, assignment, and goals. This may result in abusive supervisory practices in the workplace that have been shown to have important direct consequences in work and work relationships, and also indirect consequences on workers\u00b4 well-being and relationships outside work [ide work . In someide work . These sWays forward: migrant highly-skilled workers must develop a new order of resilience and stable mental health to ensure better quality of life and faster adaptation in their new countries [ountries . Higher ountries . To imprTo achieve this, it is important that countries improve their ability to measure migration patterns by country of origin to determine the training needs and other assistance required and engage employers appropriately . Due to Furthermore, there is the need to see to the full implementation of the codes of practice and bilateral memoranda of understanding established in 1999 which strives to protect the rights of migrant workers, ensure the provision of adequate workplace support for migrant workers and seek to ensure that migration flows do not disrupt health services in source countries ["}
+{"text": "Epilepsy is a multifaceted disorder that can have a variety of etiologic factors, including genetic and structural causes. Neuroimaging is an essential component of its diagnostic workup. Conventional MRI scans can reveal visible structural brain abnormalities that may be the cause of seizures in both common and rare forms of epilepsy. However, in some cases, even when the suspicion of an epileptogenic structural lesion is high, such as in patients being referred for epilepsy surgery, a conventional brain MRI may not reveal any abnormalities. Advanced neuroimaging techniques such as MRI fingerprinting, brain morphometry, functional MRI, and ultra-high field MRI can provide additional diagnostic information and can help identify subtle or cryptic lesions that may not be visible on a conventional brain MRI. This can aid in more accurate clinical assessments of individuals with epilepsy, or those with an unclear etiology. Advanced neuroimaging is a powerful tool to investigate neural networks underlying seizure generation, epilepsy-associated large-scale system reorganization, and substrates of cognitive comorbidities. Most advanced imaging techniques can be applied to study both groups and single subjects, providing working hypotheses that can subsequently be explored in larger studies. Comprehensive views can be further provided by multisite neuroimaging meta-analyses, that explore morphological and functional brain abnormalities shared by subjects with common epilepsies or specific syndromes.The aim of this Research Topic is to give an in-depth overview of the latest advances in epilepsy research that have been made using diverse and innovative neuroimaging techniques. Our focus has been 2-fold: (i) Hypothesis testing and pursuit of mechanisms: how advanced neuroimaging can be employed to verify or explore the pathophysiological processes underlying common epilepsies and (ii) Clinical application: to define the role of advanced neuroimaging techniques in the diagnostic workup of both common and rare epilepsies.via conventional neuroimaging approaches; investigation on the microscopic characteristics of brain lesions identified by conventional imaging; analysis of structural and functional brain abnormalities in specific syndromes or across the epilepsy spectrum; exploration of the functional networks associated with seizures/interictal spikes, epilepsy-related neural system reorganization, and cognitive comorbidities.With this purpose, we called for articles focusing on: identification of subtle morphological brain abnormalities Pizzanelli et al. proposed a functional connectivity study to investigate a group of adults with drug-sensitive temporal lobe epilepsy  by means of 3 Tesla resting-state functional MRI. They showed that reorganization of mesiotemporal functional connectivity can be observed also in seizure-free patients and that lateralization-related differences are remarkable. He et al. analyzed hippocampal malrotation with qualitative and quantitative parameters in adults with focal cortical dysplasia, disclosing no differences between patients and healthy controls. Zhang et al. explored brain morphometry of young patients with juvenile myoclonic epilepsy, showing widespread microscopic structural abnormalities associated with cognitive performances and disease course. Machegger et al. showed that quantitative analysis of diffusion restriction and ADC decrease on MRI is applicable to differentiate acute ischemic stroke from status epilepticus with high sensitivity and specificity. Lastly, Fukuma et al. developed a novel asymmetry method to localize areas of hyperperfusion in poststroke epilepsy using a single postictal single-photon emission computed tomography (SPECT) study. While the gold standard for localizing epileptogenic seizures in epilepsy is subtraction imaging of ictal and interictal perfusion SPECT coregistered to MRI (SISCOM), in many clinical settings, ictal perfusion studies are difficult to obtain, and postictal studies are used instead. Comparing a standardized asymmetry analysis vs. postictal\u2014interictal subtraction of perfusion SPECT images, Fukuma et al. demonstrated that a single scan postictal SPECT asymmetry analysis may offer diagnostic results in certain cases, at the cost of a sensitivity reduced by 20%, which may be still complemented by the subtraction method in unclear cases. In certain clinical settings, such a stepwise procedure could result in reducing the number of scans needed for seizure focus localization, limiting radiation exposure, and scanning costs.Upon our call for papers, five high-quality manuscripts have been submitted and underwent peer-review. Three papers met the standards we deemed adequate for this topic and we gathered two additional articles of particular value. The quality of these selected articles was remarkable and allowed us to provide an overview on different and up-to-date techniques in advanced neuroimaging in epilepsy. One of the most relevant themes of this collection is the breadth of imaging-driven information that can be applied to categorize individuals with epilepsy. The widespread use of non-invasive biomarkers that might assist in predicting seizure outcome and associated comorbidities and to tailor epilepsy surgery would in fact be of utmost importance. We are confident that our community will strongly pursue this quest to improve the life and care of people with epilepsy.All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication."}
+{"text": "The potential impact of music-making on air quality around musicians was inferred at the outset of the SARS-CoV-2 pandemic from measurements on individual musical instruments and from theoretical considerations. However, it is unclear to what extent playing together in an orchestra under optimal ventilation conditions really increases infection risks for individual musicians. In this study, changes in indoor air quality were assessed by measuring common parameters, i.e., temperature, relative humidity, and carbon dioxide, along with particle counting and determining the presence of airborne pharyngeal bacteria under different seating arrangements. The study was conducted in cooperation with a professional orchestra on a stage ventilated by high volume displacement ventilation. Even with a full line-up, the particle load was only slightly influenced by the presence of the musicians on stage. At the same time, however, a clear increase in pharyngeal flora could be measured in front of individual instrument groups, but independent of seat spacing. Simultaneous measurement of various air parameters and, above all, the determination of relevant indicator bacteria in the air, enables site-specific risk assessment and safe music-making even during a pandemic. Early in the COVID-19 pandemic, a number of transmission events could be attributed to music making, particularly singing together in a choir . SubsequThese findings influenced health care authorities\u2019 containment measures of the SARS-CoV-2 pandemic and led to considerable restrictions in the cultural scene, especially at the beginning of the pandemic. Orchestral musicians in particular were almost completely restricted in their professional practice for a long time by the establishment of rules regarding upper limits on the number of people in the room and minimum distances between musicians on stage .Many different studies have focused on individual aspects of music making, especially with wind instruments, in order to assess possible transmission risks. In some cases, slightly different results were obtained for individual instrument groups and instruments. By comparing the release of particles during breathing and speaking with the release during music making ,7, risk 2 concentration in the surrounding area of a mannequin dummy /500 L air volume) of bacteria and only species that can be assigned to the human skin flora could be detected. In addition, a comparative measurement of the bacterial load of the air was performed during the phase when the musicians entered the stage (data not shown). This phase showed an increase in the total number of bacteria with a predominant proportion of species belonging to the skin flora.While playing the piece of music, distinct differences in the relative exposure of the air to skin and pharyngeal flora at different measurement positions in front of different instrument groups were observed . RelativFurthermore, differences were determined depending on the score of the piece of music being played. Almost all instrument groups showed a lower detection rate of bacteria at the beginning of the piece of music  as in the other phases. In the course of the second measurement phase , up to the third measurement phase , an increasing tendency was shown. Especially in the third measurement phase (T12) a clear increase of pharyngeal flora can be observed for the clarinets, bassoons, trumpets and trombones. This observation is compatible with the score of the piece of music, which has a musical highpoint here and is represented by loud dynamics, many tutti passages, as well as a high participation of the wind instruments.2 concentration are compatible with 100% fresh air proportion in the supply air and a high air exchange rate at the same time. The German Technical rules for workplaces issued by the German Federal Institute for Occupational Safety and Health specify a limit of 1000 ppm for CO2 concentration indoors and recommend that a value of 800 ppm be maintained during the SARS-CoV-2 pandemic [2 concentration in the air is associated with an infection prevention effect [The collected measurement data show a very good indoor air quality during all measurement phases, even with narrow seating distances while the orchestra is present on stage. The almost constant values of the COpandemic . During n effect .The median values of the measured particle load are consistently at a very low level, for particle sizes 0.5\u20131.0 \u00b5m comparable to rooms with an ISO 7 classification . FurtherParticle loads described in the literature are not directly comparable with the particle concentrations measured in this study due to the different measurement methods. In addition, the basic particle load of rooms varies between different studies. The locally observed short-term increase in particle concentration, especially for the size group 2.5\u20135.0 \u00b5m , could a3/h for all seating positions. It can therefore be assumed that in the breathing zone of persons present, unpolluted fresh air continuously flows in from the source air outlets. In a study on a mathematical risk assessment model with a comparison of different prevention measures, it was shown that the person-related air flow rate per hour of stay is a favorable indicator for evaluating the preventive effect of ventilation measures in infection prevention [In the area of the examined stage, active ventilation is carried out by the principle of displacement ventilation. With this ventilation technique, supply air is introduced close to the floor with a low flow velocity and a slightly lower temperature compared to the ambient temperature. Due to the heating of the air by the people present the air rises vertically, which enables the efficient removal of polluted air, especially at very high room heights. In low rooms, an excessively high temperature gradient can lead to the formation of a barrier layer and the accumulation of polluted air in the breathing zone of people ,21. A teevention . In addievention . Cultural detection of human bacterial flora with assignment of identified species to typical body regions might be a suitable measurement method to model exposure to potentially infectious particles from the upper respiratory tract. However, no comparable data for the quantitative release of droplets or pharyngeal flora can be found in the literature yet. The detection rate of culturable bacteria in the air provides no evidence of an accumulation of potentially infectious droplets or an adverse effect of reduced seating distances. Even for the peak values of pharyngeal flora, the relative number of detected bacteria was low if the average respiratory minute volume of humans (approximately 8 L/min) is taken into account compared to the very high intake volume for airborne bacteria measurement (100 L/min). It has been demonstrated that musical instruments may be contaminated with typical pharyngeal and environmental flora . Thus, tDue to the need for personal operation of the air sampler during music making, the measurement of the bacterial load in the air must be carried out in smaller distances as the seating distance, which results in a slight overestimation of the bacterial load in the air compared to the load in the breathing zone of musicians. The assignment of the bacterial species measured in front of the instrument groups to their probable site of origin, can support a further classification of instruments into the categories low, normal and high risk. For the clarinets classified as normal or high risk in different literature ,6, the rA very high detection rate of skin bacteria in front of the second violins during the first measurement setup is most likely an environmental contamination  in the vicinity of this measurement position, which dissipated in the course of the measurement day . When classifying the groups, it should be noted that the terminology of high-risk instruments chosen by other working groups must be seen in the overall context. The relative amount of viral particles in the upper airways can vary over a wide range , and notThe following limitations of the present study should be noticed. The release of particles and pharyngeal flora during music making also depends on the playing time (playing times compared to break times) of the respective instruments. The playing proportions of instrument groups in musical pieces vary, such that a locally increased rate of pharyngeal flora and particles can also be caused by a large playing time proportion of certain instruments within the piece. Further studies on the release of pharyngeal flora per instrument group with standardized playing time may therefore be informative in order to evaluate this influence more precisely. It should also be taken into account that during each of the experiments, measurements were taken in front of a group of instruments, so the distance of each musician to the measuring instruments varied to some extent. For some instrument groups, this measurement position may not correspond directly to the main flow direction of the emitted air when playing music. Therefore, the number of particles and germs detected in the air may possibly be underestimated for individual instruments. The aim of the study was to evaluate whether there could be an accumulation effect of particles and pharyngeal flora during music making as an indicator of increased risk of infection for the entirety of the musicians on stage. Viral respiratory infectious agents are usually emitted adherent to larger mucosal particles and not alone . FurtherFinally, it should also be noted that the combined method for evaluating the release of particles and pharyngeal flora was used for the first time in this study. Additional studies should be conducted in the future to better understand the significance of detecting pharyngeal flora during music making. Before a general application of this method, it should be tested in different locations with different ventilation principles.A highly effective ventilation system based on displacement ventilation results in no aerosol accumulation on the stage, regardless of the seating arrangement or the number of musicians playing music, when an orchestra is present. In contrast to the quantitative measurement of particles or aerosols, the detection of bacterial flora from the upper airways might be an important additional aspect for the individual assessment of potential infection risk in large groups of persons. With suitable test concepts to exclude highly positive persons as well as infection prevention concepts to avoid droplet infections, a very high safety level for orchestra members can be reached by optimized ventilation, even with narrow seating."}
+{"text": "Colonoscopy remains the gold standard investigation for colorectalcancer screening as it offers the opportunity to both detect andresect pre-cancerous polyps. Computer-aided polyp characterisation candetermine which polyps need polypectomy and recent deep learning-basedapproaches have shown promising results as clinical decision supporttools. Yet polyp appearance during a procedure can vary, makingautomatic predictions unstable. In this paper, we investigate the useof spatio-temporal information to improve the performance of lesionsclassification as adenoma or non-adenoma. Two methods are implementedshowing an increase in performance and robustness during extensiveexperiments both on internal and openly available benchmarkdatasets. During  sigmoid , which h sigmoid . Direct  sigmoid . However sigmoid \u20139.Computer-aided diagnostic (CADx) systems can be used to augment opticaldiagnosis and differentiate between adenomatous, hyperplastic or sessileserrated polyps in the colon. Polyp classification methods have beenwidely investigated, focusing on classifying hyperplastic againstadenomatous polyps \u201313 or onTechnically, most recent CADx approaches are based on deep learning with arange of architectures being reported  includinMachine learning techniques rely on data, hence public polyp histopathologydatasets have started becoming available \u201327. PolyIn practice, endoscopists use both spatial and temporal information whendetecting and diagnosing polyps, where observing the polyp overconsecutive frames in a video aids the task. The use of spatio-temporalinformation has been shown to improve other interventional applications,such as surgical phase recognition , polyp sThe proposed solutions were extensively evaluated, both on internal datausing cross-validation and external data to evaluate generalisability. Anin-depth evaluation of performance was carried out, reporting standardmetrics as well as polyp accuracy in order to evaluate the consistency ofpredictions. Polyp classification needs to be carried out per lesion. Toovercome the fact that several polyps can be in view simultaneously in avideo frame, the classification is applied only to the region of the imagecontaining the polyp. The spatio-temporal methods were tested recreating aclinical environment workflow using them in combination with a polypdetection model. This highlighted the benefits temporal methods bring inthis setup. Finally, the polyp diagnosis methods were quantified in termsof the quality of the polyp location to evaluate the classificationrobustness.2.Two spatio-temporal methods were implemented for adenoma/non-adenoma videoclip classification, namely a Long-Term Recurrent Convolutional Network(LRCN)  and ConvThe models were trained for a maximum of 20 epochs, SGD as the optimizerwith a learning rate of 0.0001. Cross-entropy loss was used using balancedclass weights to assign each class weights inversely proportional to theirrespective frequencies. The overall balance of adenoma/non-adenoma boxeswas 76%/24%, but it differed on each fold. Batch sizes were selected basedon available GPU memory. The code was implemented on Pytorch 1.6 on Ubuntu18.04.4 LTS with a GeForce RTX 2080 GPU.Both methods were developed with a shared backbone, a Resnet50 ConvNet, in orde2.1A dataset of colonoscopic videos was used for our experiments. Thevideos were collected at University College Hospital in London between2018 and 2021 (project ID 236056). All adenomatous polyps  and serrated polypswere included. All other polyps were excluded. Videos were collectedusing Olympus 260 and Olympus 290 endoscopes (Olympus Lucera) andannotated by expert endoscopists to include a bounding box aroundvisible polyps. Polyp-related image quality labels were also added,deeming the image as high-quality if the polyp(s) was discernible.Histology results were adopted for adenoma and non-adenomaground-truth labels. Additionally, the Piccolo Dataset was used as an external testing set.It is a publicly available dataset that comprises 3433 manuallyannotated images (2131 white-light images 1302 narrow-band images),originated from 76 lesions from 40 patients using Olympus endoscopes(CF-H190L and CF-HQ190L). Low quality and uninformative frames wereremoved, and the videos were sampled every 25 frames. Each lesion hasan associated histology as adenoma, hyperplasia or adenocarcinoma aswell as a binary mask with the location of the polyp . We cons2.2A LRCN architecture was used to classify video clips as adenoma ornon-adenoma. This architecture was selected because of its success ontime-series tasks, and due to its ability to learn disentangledspatial and temporal representations. Other 3D models such as C3Dextract spatio-temporal features, which can be useful for tasks suchas action recognition where the objects movement is part of theaction. However, in the case of polyp diagnosis where the video isegocentric, the motion of the camera does not determine the type ofpolyp. The LRCN architecture combined a deep visual feature extraction(such as a ConvNet) with a Long-Short Term Memory (LSTM) module tocollate temporal dynamics for sequential data tasks .In the current implementation, a Resnet50 backbone  was usedThe backbone was pretrained on the available frames and its weightsfrozen when training the LRCN, as this setup showed a smallexperimental improvement when compared to end-to-end training. Thelearning rate was reduced on plateau by a factor of 0.1 with apatience of four epochs. The overall inference speed was 72.21frames/second on our GPU.2.3The second spatio-temporal method utilised consisted on aggregating theConvNet outputs. In this 2-step method, each visual inputA second step was used to incorporate temporal information. Severalmethods were explored for this phase, namely soft averaging, pluralityvote and extreme vote. In soft averaging, softmax outputs obtainedfrom all frames in a clip of lengthd in Eq.\u00a0. (1)z=The plurality vote was obtained by thresholding predictions from eachof the n in Eq.\u00a0. (2)z=In the case of soft averaging and extreme voting, the final predictiony(Eq.\u00a0). The ov2.4A clip was defined as a set of The LRCN model was trained with each clip as an input sample, whereasthe ConvNet was trained with all the frames included within the LRCNclips, ensuring the same frames were utilised for both methods,although less samples were used for LRCN. After excluding white lightsequences, low-quality clips and lesions with less than k frames, thebaseline model was trained with a total of 27,087 frames from 197polyps from 89 colonoscopy procedures, forRandom sampling of 5000 frames was performed on each epoch, re-samplingeach time, to minimise overfitting . Data auAll models were trained with 5-fold patient cross-validation. For allexperiments, the same folds were respected, to ensure a faircomparison between models. For each fold, each patient\u2019s video wasused for either training or testing following an 80-20% split,avoiding any data contamination. The patient splits were generatedoptimizing the distribution balance between the training and testingsets in terms of the number of NBI polyp frames, the number ofdifferent lesions, the polyp size (in pixels), the polyp types and thequality of the images.2.5In a clinical setup, the locations of the polyps in each colonoscopyframe would not be provided by experts, but by a computer-assisteddetection (CAD) model. It was paramount to implement such a pipelineconsisting of a polyp detection model followed by a polypclassification model, in order to assess the full polyp classificationworkflow.A polyp segmentation model, an FCN-Resnet101, was trained on ourinternal dataset using the same 5-fold cross-validation splits usedfor the previous experiments. A new set of predicted bounding boxeswas obtained on frames from each of the 5-fold testing sets using thepolyp detection network results as follows: (i) frames containingmultiple polyps were discarded; (ii) if only one region was predictedas a polyp, the detected region was circumscribed by a rectangularbounding box; (iii) if multiple regions were detected , they were enclosed as a single prediction in thesame bounding box; (iv) if no polyp was detected, the frame wasdiscarded as no box could be used to crop the image.3.3.1Traditional metrics were used for the evaluation of the methods, namelyaccuracy, sensitivity and specificity  as well as area under the curve (AUC). These metrics werecomputed using all boxes from all evaluated frames. When testing oninternal data, the results from all folds were aggregated together andthe metrics were computed on the entire dataset. Additionally, weintroduced polyp accuracy. It quantifies the percentage of correctlypredicted frames in a polyp, averaged across all polyps. In3.2A Resnet50 was trained as our baseline ConvNet. Other architectureswere explored for polyp classification, but Resnet architecturesshowed the best results empirically. Different model sizes wereexplored, however Resnet50 gave a good balance between performance,training time and generalisability. In order to allow for comparisonwith other methods, the frames used for the baseline were the sameframes used for the temporal experiments, containing images from a 15frames clip extraction using 5-fold cross-validation, as detailed inSection As it can be observed in 3.3The weights from the Resnet50 ConvNet were used to initialise the LRCNbackbone. Additionally, the ConvNet baseline predictions were combinedfor each 15-frame clip in the test set to obtain per-clip results. Itis important to note that, even though all methods were tested on thesame frames, the baseline was evaluated per frame, whereas thetemporal methods were evaluated on a per-clip basis. As it can beobserved in The per-polyp accuracy also increased for all temporal methods, with ahigher improvement on the LRCN, showing that most polyps benefit fromthe temporal information, rather than just a few longer polypsequences. Additionally, 3.4In order to gain some understanding of the benefits of the differenttemporal methods, further analysis was performed. The temporal methodswere evaluated in terms of the amount of temporal information presentin the clips. The similarity of the frames within a clip wasquantified by the means of normalised cross-correlation (Eq.\u00a0). The noTo further assess if the LRCN benefits from increased temporalinformation, the model was trained and evaluated with different cliplengths ranging from 3 to 15-frame clips. It is important to note thatincreasing the clip size considerably reduced the number of availableclips. Visualization 1. Example clips are shown in 3.5The proposed methods for polyp type classification use the polyp regionin the image, defined by a bounding box, as an input to the models with respect to the original box. Eachpolyp in each frame was evaluated 9 times using boxes randomlygenerated presenting IoUs going from 5% to 95% with a 5% jump, so thatall the IoU range was evaluated for each case. The image in the bottomright of The graphs in 3.6The performance was measured on the publicly available dataset  describeBoth temporal methods improved the per-frame performance, showing ahigher AUC. Particularly, both temporal methods show a 100%specificity in this dataset. LRCN showed an overall higher polypaccuracy, approximately 4% above the baseline, showing highergeneralisability than the averaging method for the set threshold of0.5.4.In this paper, two approaches to exploit spatio-temporal features for polypdiagnosis were investigated. CADx systems for polyp diagnosis have shownpromising results in previous literature. However, one of the limitationsof these models is the inconsistency of predictions on the same polyp. Totackle this problem, we implemented two methods to incorporate temporalinformation in the predictions and improve the performance and the overallpolyp accuracy.First, we showed that implementing a simple temporal averaging overconsecutive frames increased the performance of a CADx system andconsiderably improved robustness when applied to video data. Similarly, amore complex temporal model, LRCN, also yielded an improvement inperformance and robustness. Although both methods were found to havecomparable performance, our results indicated that the LRCN approach maybenefit from larger temporal variations within the window, whichpotentially indicates a favorable performance of this method on longervideos.Both of the proposed methods were evaluated on internal data and on anopenly available external testing set. Cross-validation was used on ourinternal dataset, to ensure more representative evaluation results. Themethods were additionally compared to a spatial baseline, providingablation studies for fair comparison. The performance on the open datasetwas found to be comparable to the results on our internal data, supportingthe fact that temporal information brings an increase in polyp diagnosisperformance. Furthermore, the fact that the external dataset did notcontain consecutive frames from each polyps confirmed the generalisationcapabilities of the temporal implementations. It is important to point outthat large-scale colonoscopy polyp diagnosis datasets are lacking for bothtraining and evaluation, but the problem is gaining traction, for instancein the GIANA Endovis challenge .Such a CADx model would be used in combination with a polyp detectionmodel, where the workflow would be to first detect a polyp in the image,and then use the detected polyp region to obtain a polyp classificationbetween adenoma and non-adenoma. As this study aims to solve problems thatarise from clinical use of such a device, it is imperative to test thefull setup to provide realistic results. A polyp detection model wastherefore implemented and run on the test videos. The obtained boxes wereused for the different polyp diagnosis methods. The results showed thatthe effect of using non-expert boxes was minimised when using temporaldiagnosis methods. An additional experiment evaluated the performance ofeach of the classification techniques based on the quality of the polypboxes. This analysis demonstrated that the diagnosis capabilities wereenhanced when the quality of the boxes improved, providing a practicalclue for its use in a clinical environment, where clinicians could discarddiagnosis predictions if the boxes are visually unsatisfactory. Theresults also show there might be scope to improve the classificationperformance on low-quality boxes through the use of more extreme dataaugmentation techniques. It is unclear where the turning point is wherethe position of a box becomes inaccurate enough that it hides importantfeatures needed for polyp classification.Future work includes the use of other spatio-temporal techniques, as wellas the inclusion of spatio-temporal data augmentation to decreaseoverfitting with small datasets. It was observed that the informationpresent in a clip could affect the performance of a spatio-temporal model.This leads to think that there could be room to optimize the frames to usein a clip in a way that the information present is maximised. In thissense, the inclusion of sampling techniques should be explored as futurework."
\ No newline at end of file