diff --git "a/deduped/dedup_0381.jsonl" "b/deduped/dedup_0381.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0381.jsonl"
@@ -0,0 +1,37 @@
+{"text": "The estimation of the difference between two evolutionary distances within a triplet of homologs is a common operation that is used for example to determine which of two sequences is closer to a third one. The most accurate method is currently maximum likelihood over the entire triplet. However, this approach is relatively time consuming.We show that an alternative estimator, based on pairwise estimates and therefore much faster to compute, has almost the same statistical power as the maximum likelihood estimator. We also provide a numerical approximation for its variance, which could otherwise only be estimated through an expensive re-sampling approach such as bootstrapping. An extensive simulation demonstrates that the approximation delivers precise confidence intervals. To illustrate the possible applications of these results, we show how they improve the detection of asymmetric evolution, and the identification of the closest relative to a given sequence in a group of homologs.The results presented in this paper constitute a basis for large-scale protein cross-comparisons of pairwise evolutionary distances. The estimation of evolutionary distances between biological sequences is at the basis of many bioinformatics problems: it plays a particularly important role in phylogenetic tree inference ,2 and inThe present article investigates this fundamental problem of estimating the difference between two distances in a triplet of homologs Fig. . We compThe evolutionary distance between two biological sequences is generally based on the assumption of a first-order Markovian process of amino acid evolution. This implies two biological assumptions, common to all standard models of evolution: no memory and position-independence. The substitutional processes are described in the form of substitution matrices, defining mutation probabilities from each character to every other character for a given evolutionary distance. These matrices are either parametrical models of sequence evolution or empirically based substitution matrices. Parametrical models are often employed for nucleotide substitution (e.g. Jukes-Cantor  or HasegM(d0) through the equation M(d0)x = M(xd0), which is a special form of the Chapman-Kolmogorov equation for Markov chains. It is common and computationally more efficient to formulate this process in terms of a rate matrix Q from which the probability matrices for distance d are derived as M(d) = edQ. We normally measure d in PAM units ).Y and Z)and an out-group (X). Several methods have been developed to test the significance of the unequal lengths of the branches leading from the common ancestor to the two duplicated sequences. Tests on simulated and real data from Arabidopsis thaliana for two of such methods have suggested very low statistical power to detect asymmetric evolution of duplicates )dOY and dOZAlternatively, we can estimate \u0394 by subtracting estimates of the distances triplet = OY - OZOY and OZ can be obtained by maximum likelihood over the multiple sequence alignment of X, Y, Z [L of a multiple sequence alignment (MSA) is the product, over all positions of the MSA, of the probability of observing characters x, y, z at distance dOX, dOY, dOZ of the origin, where such a probability is obtained by marginalizing over every character o at the origin:The estimates  X, Y, Z , in a maC is the set of characters \u2013 the 20 amino-acids in the present case, and f(o) the background frequency of the character o. Consequently, the log-likelihood function l iswhere The log-likelihood is maximum where its gradient disappears:There again, the problem can be solved efficiently by Newton's iteration2l)-1 is the inverse of the Hessian . The inverse of the Hessian also yields the variance-covariance matrix of the estimates OX, OY, OZ when multiplied by -1. A final use of the Hessian is to check that its complement is positive definite, a condition necessary to ensure that the solution found is indeed a maximum and not a minimum or a saddle point. Therefore, we obtain the variance of triplet from the variance-covariance matrix:where  = 1/100.) and that all transitions are equally likely, and only depend on the PAM distance. Under this model, the log-likelihood can be expressed in terms of the counts of matches/mismatches of the triplet , i.e. Nxxx is the number of positions where all the characters are identical, Nxxz is the number of positions where X and Y coincide but Z differs, etc.so that px is the probability of mutating from the origin to X and similarly for py and pz. Taking partial derivatives of the likelihood with respect to px, py and pz gives a system of 3 rational polynomial equations  in 3 unknowns and 6 parameters. Such a system of equations has a solution that will be an algebraic function of the parameters . Despite its simple appearance, this system of equations is beyond the capabilities of current computer algebra systems to resolve. And this is not a complete surprise, as the algebraic numbers/functions involved are at least of degree 23. The special case where two of the branches have the same length, has been solved exactly in [where actly in , they fiNxxx = 10, Nxxz = 5, Nxyx = 4, Nxyy = 3, Nxyz = 2, k = 3 using Maple and the value of px is a root of the irreducible polynomialWe have computed the exact solution for concrete values of the parameters, in particular z - 2438333515038720 z2 + ...-6582435840000 + 189590785228800 z21 - 1635488137841976 z22 + 99990709180560 z23... + 10304020514917800 This means that the general solution will be an algebraic function of degree 23 or higher, it cannot be lower. If an instantiation of the polynomial with values gives this irreducible polynomial, then the general polynomial must be irreducible of degree 23 or higher (some terms could have simplified in the instantiation). This makes the usefulness of an exact solution inexistent. it is more difficult to solve the polynomial and select the right root than to maximize the likelihood and/or solve the system of equations by numerical methods."}
+{"text": "To improve the public health system's ability to prevent and control chronic diseases, we must first understand current practice and develop appropriate strategies for measuring performance. The objectives of this study were to measure capacity and performance of local health departments in diabetes prevention and control and to investigate characteristics associated with performance.In 2005, we conducted a cross-sectional mailed survey of all 85 North Carolina local health departments to assess capacity and performance in diabetes prevention and control based on the 10 Essential Public Health Services and adapted from the Local Public Health System Performance Assessment Instrument. We linked survey responses to county-level data, including data from a national survey of local health departments.Local health departments reported a median of 0.05 full-time equivalent employees in diabetes prevention and 0.1 in control. Performance varied across the 10 Essential Services; activities most commonly reported included providing information to the public and to policy makers (76%), providing diabetes education (58%), and screening (74%). The mean score on a 10-point performance index was 3.5. Characteristics associated with performance were population size, health department size and accreditation status, and diabetes-specific external funding. Performance was not better in localities where the prevalence of diabetes was high or availability of primary care was low.Most North Carolina local health departments had limited capacity to conduct diabetes prevention or control programs in their communities. Diabetes is a major cause of illness and death, yet it is neglected in public health practice. These findings suggest opportunities to enhance local public health practice, particularly through targeted funding and technical assistance. As noted in reports by the Institute of Medicine and others -3, as weLess visible public health challenges are the epidemics in chronic diseases, such as obesity and diabetes . ChronicTo improve the public health system's ability to prevent and control chronic diseases, it is necessary first\u00a0to understand current practice and then to develop appropriate and valid strategies for measuring performance. Among the chronic diseases, diabetes is an optimal choice for studying the performance of governmental public health agencies in chronic disease prevention and control. The nation is facing an epidemic in type 2 diabetes and its related risk factor, obesity , and diaThe objectives of our study were to measure capacity and performance in diabetes prevention and control in local health departments (LHDs) and to understand the characteristics of the LHD and the community that are associated with performance. The study was a collaboration among investigators at the University of North Carolina at Chapel Hill (UNC-Chapel Hill), the North Carolina Division of Public Health, Diabetes Prevention and Control Program (NC DPCP), and the North Carolina Association of Local Health Directors. North Carolina has a decentralized local public health system: the LHDs are overseen by local government and local boards of health and are independent of the state health department. A state health department grant program, Diabetes Today, provides funding to some LHDs, but otherwise LHDs receive no specific funding for public health activities related to diabetes.In 2005, a cross-sectional mailed survey of all 85 LHDs  in North Carolina was conducted to assess capacity and performance in diabetes prevention and control. The targeted respondent was the health director or his or her designated staff person working in diabetes. The mailed survey was preceded by an e-mail version of the survey cover letter and was followed by a reminder postcard and telephone call, a second mailing of the survey and second reminder postcard, and follow-up phone calls. Collaborators in the NC DPCP and the NC Association of Local Health Directors signed the initial cover letter and made several contacts with LHD directors to increase the response rate. As an incentive, each responding LHD was entered into a lottery for a scholarship for 1 person to attend a 5-day training in diabetes offered by a North Carolina university, worth approximately $850. The institutional review boards of the NC Division of Public Health and UNC-Chapel Hill approved the protocol.The key variables of interest in the study were capacity and performance. We defined capacity as the number of full-time equivalent personnel (FTEs) in diabetes prevention or control, and performance was defined as the self-reported provision of a diabetes-specific service or program. Questions were based on the 10 Essential Public Health Services  and adapted from the Local Public Health System Performance Assessment Instrument developed by the National Public Health Performance Standards Program at CDC . This inWe linked survey responses to secondary data to assess the characteristics of the health departments and the jurisdictions that were associated with high performance. The characteristics of interest were based on a model of public health system performance  and a ret tests and Spearman correlation coefficients), using a cutoff for significance of P < .05, and multiple linear regression were conducted to investigate which independent variables were associated with the outcome of the performance index. Because the sample size was small, the effect of confounding was assessed 1 variable at a time.To report capacity and performance in diabetes prevention and control, we present simple univariate descriptions of item responses. The study had a secondary objective of exploring the characteristics of the health departments and jurisdictions that were associated with high diabetes-related performance. To do this efficiently, we created a summary performance score, which was a simple index of performance based on the 10 essential services. A total of 33 yes/no questions assessing key programs or services were used to assign a score (between 0 and 1) for each essential service. The score represented the average of 1 to 5 questions per essential service; in the event of a missing response to a question , the remaining responses were averaged for that essential service. Subsequently, the scores for each of the 10 essential services were summed to create an index of total performance, with a range of 0 to 10. Bivariate analyses , presence of a stated diabetes or chronic disease-related mission statement, and estimates of need for diabetes-related programs . The relationship of general structural capacity measures  to performance was investigated, but in the modeling they were considered potential confounders. We investigated as other confounders the demographic characteristics of the jurisdiction, such as poverty rate and urban or rural status.The response rate was 100%. Forty-six LHDs received a second mailing of the survey, and 8 LHDs requested a third copy of the survey on follow-up telephone calls. Survey responses were obtained over the telephone at the request of the LHD in 3 instances. On average, 2.2 people were involved in completing each survey on behalf of the LHD. The most common respondents were nurses, followed by health educators, health directors, and nutritionists. Health directors directly participated in 25% of the responses.The median number of FTEs per LHD was 80, and the median yearly expenditures were $4.81 million . SlightlHealth departments reported limited capacity in diabetes: the median number of FTEs was 0.05 in prevention , 0.1 in control (IQR 0-0.5), and 0.3 in prevention or control (IQR 0-1.0) (data not shown). Forty percent reported no FTEs devoted to diabetes prevention or control. In terms of specific provider types, only 16% reported having a certified diabetes educator on staff. The most common provider types reported by LHDs were nurses, followed by nutritionists, health educators, nurse practitioners or physician assistants, and physicians. Only 12% reported any physician FTEs devoted to diabetes prevention or control.Self-reported performance varied widely across the essential services . Most LHOther programs and services were reported less commonly. Only half had a coalition or committee that focuses on diabetes. Less than half reported assessing the extent to which primary care or diabetes education was available in their community, and only 11% reported conducting a recent diabetes-related public and personal workforce assessment. Other activities less commonly reported involved public policy; training for health care providers; modification of laws, regulations, or ordinances; research; and evaluation.P = .03). LHDs with a history of funding through Project IDEAL had a mean index of 6.7 compared with 3.4 for those without (P = .002). Measures of need  were not associated with performance, nor were having \"diabetes\" or \"chronic disease\" in the mission statement. Population size of the jurisdiction and LHD size (measured by FTEs or expenditures) were also associated with performance. Health departments that had received accreditation were also more likely to have a high total performance score.The mean score for all LHDs on the 10-point index of performance was 3.5 (SD = 1.9). Of the main characteristics of interest, only the history of diabetes-specific external funding (Diabetes Today or Project IDEAL) was associated with performance . LHDs wiMultiple linear regression was used to investigate whether the observed association between Diabetes Today funding and the performance index was confounded by other factors. . Complete data on FTEs and expenditures were not available . A history of diabetes-specific external funding was associated with LHD performance even when controlling for potential confounders such as LHD size.This is the first study known to the authors to measure performance of LHDs in a chronic disease. Previous studies of LHDs have focused on measuring global performance ,21,23, pThis study and the survey itself do, however, provide an important example of how a state program (the NC DPCP) can measure LHD performance for evaluation and program improvement and measure the effect of its grants to LHDs. A similar instrument, developed by the Diabetes Council of the National Association of Chronic Disease Directors , exists The findings that LHD size or population size and LHD funding affect performance are consistent with those of other studies ,20,21. UThis study represents a snapshot of all possible types of diabetes-related programs and services, not necessarily those that are most important to local public health practice. The index itself is weighted to represent each essential service equally, which may also not be appropriate. Key informants and stakeholders should be interviewed to refine the instrument by identifying which items are the priorities for LHDs.This study has several limitations. Because the data are self-reported, performance may be overreported. Almost all studies of LHD performance rely on self-reported data. In addition, variation in numbers and types of staff responding to the survey may have introduced some measurement error. Limitations of individual survey items included that the survey did not assess amount, reach, or quality of programs, only the presence or absence of programs. In addition, the amount or duration of diabetes-specific external funding was not available. The most important limitation, however, is that the performance index has not been formally validated. Replication of this work in other states and studies to validate the instrument are needed. With respect to the associations between LHD characteristics and performance, this is a cross-sectional study, and no determinations of causation can be made. The sample size was limited, and results from North Carolina may not be generalizable to other states, especially those that are outside the Southeast or that do not have a decentralized LHD structure.The survey also did not measure characteristics of LHDs that are likely predictors of diabetes-related capacity and performance, for example, the extent or quality of partnerships of the LHD; the nature of leadership within the LHD; and organizational climate, especially as it pertains to adoption of evidence-based recommendations or guidelines. A follow-up study, which consists of case studies of high-performing LHDs, will allow investigation of these hypotheses. Finally, although not necessarily a limitation of the study, the outcome measured in this study, as in most studies of public health performance, was the performance of the LHD alone and not the local public health system. Local health department performance, here measured as the presence of certain programs or services, may vary on the basis of what is otherwise available in the service area.This study documents the low level of capacity and performance in diabetes prevention and control among NC LHDs. Despite the well-described threats of the diabetes and obesity epidemics to the nation's health, LHDs may not be well positioned to conduct or coordinate effective diabetes prevention or control in most communities. This study, although cross-sectional in design, also suggests that external funding is critical for building programs to address chronic disease and the need of a community may not necessarily determine the programs or services that are offered. Targeted funding offers the opportunity to develop a local public health system that can address the less visible but urgent chronic disease challenges of our time."}
+{"text": "Metabolic pathway analysis, one of the most important fields in biochemistry, is pivotal to understanding the maintenance and modulation of the functions of an organism. Good comprehension of metabolic pathways is critical to understanding the mechanisms of some fundamental biological processes. Given a small molecule or an enzyme, how may one identify the metabolic pathways in which it may participate? Answering such a question is a first important step in understanding a metabolic pathway system. By utilizing the information provided by chemical-chemical interactions, chemical-protein interactions, and protein-protein interactions, a novel method was proposed by which to allocate small molecules and enzymes to 11 major classes of metabolic pathways. A benchmark dataset consisting of 3,348 small molecules and 654 enzymes of yeast was constructed to test the method. It was observed that the first order prediction accuracy evaluated by the jackknife test was 79.56% in identifying the small molecules and enzymes in a benchmark dataset. Our method may become a useful vehicle in predicting the metabolic pathways of small molecules and enzymes, providing a basis for some further analysis of the pathway systems. Metabolism defines a series of chemical reactions that occur in a cell, maintaining the lives of living organisms by supplying the necessary molecules and energy During the past decade, large amounts of information concerning different organisms have been gathered on both the genetic and metabolic levels. Some databases pertaining to chemicals and proteins, such as KEGG (Kyoto Encyclopedia of Genes and Genomes) A large body of data concerning protein-protein interactions and chemical-chemical interactions has been applied extensively to predicting the attributes of proteins and compounds ftp://ftp.genome.jp/pub/kegg , from which we extracted 17,641 small molecules. After excluding small molecules that do not participate in any metabolic pathway, 4,487 small molecules were retained. The dataset of enzymes of yeast were also acquired from the FTP site of the public database KEGG ftp://ftp.genome.jp/pub/kegg . Likewise, those enzymes that do not participate in any metabolic pathway were excluded. Thus, we retained 655 enzymes of yeast, whose data on participation in metabolic pathways is available.The dataset of small molecules to be studied was downloaded from the FTP site of the public database KEGG Sce. However, not all samples can be used in our method due to the lack of interaction information. Those not having any interactions with other compounds or proteins in Sce were excluded. Finally, we obtained 4,002 samples including 3,348 small molecules and 654 enzymes, formulated by S\u200a=\u200aSc\u222aSe, where S denotes the benchmark dataset consisting of 4,002 samples, Sc the dataset consisting of 3,348 small molecules, and Se the dataset set consisting of 654 enzymes.As described above, 4,487 small molecules and 655 enzymes of yeast have recoverable information concerning their participation in metabolic pathways. These samples were used to comprise a dataset http://www.genome.jp/kegg/pathway.html), there exist more than 150 metabolic pathways, classified into 11 major metabolic pathway classes  i.e., the likelihood that an interaction may occur. For any two small molecules c1 and c2, their interaction confidence score, i.e., the weight of the edge with c1 and c2 as endpoints, was denoted by Qcc. Specifically, if the interaction between c1 and c2 does not exist in STITCH, their interaction confidence score was set to 0, i.e., Qcc\u200a=\u200a0. Likewise, the weight of the edge with one small molecule c and one enzyme e as endpoints was denoted by Qcp. In particular, the confidence score was set to be 0 if the interaction between c and p does not exist in STITCH. The data concerning protein-protein interactions was retrieved from STRING (http://string.embl.de/) p1 and p2 as endpoints was labeled with a score, denoted by Qpp, to quantify the interaction confidence, i.e., the likelihood that an interaction may occur. In particular, if p1 and p2 are non-interactive proteins according to the data in STRING, their interaction confidence score was set to 0, i.e., Qpp\u200a=\u200a0.The constructed network takes small molecules and enzymes as its nodes, and an edge is drawn between two nodes if and only if the corresponding small molecule and enzyme can interact with one another. Different combinations of the participants lead to three kinds of interactions: chemical-chemical interactions, chemical-protein interactions, and protein-protein interactions. The data concerning chemical-chemical interactions and chemical-protein interactions was acquired from STITCH  denote a node set consisting of the neighbors of s. The likelihood that s belongs to jM was calculated by.s belongs to jM. If j, it implies that there are no interactive compounds or proteins of the query sample s in the training set that belong to pathway class jM. In this case, it is thought that the probability of s belonging to jM is zero. For a query sample s, if the results obtained from Eq. 3 ares belongs to is M3, followed by M6, and so forth. Also, M3 is called the 1-st order predicted pathway class of s, and M6 the 2-nd order predicted pathway class of s, and so forth.In statistical prediction, the jackknife test j-th order predicted pathway class, its prediction accuracy jCM denotes the number of samples that are predicted correctly according its j-th order predicted pathway class, and N denotes the total number of samples in the dataset. For these 11 prediction accuracies, high j and low j indicate that the method arranges the candidate pathway classes well. The first order prediction accuracy is more important than others, because it has the smallest index of j.For any query sample , the prediction method described in Section \u201cPrediction method\u201d will provide a series of candidate pathway classes. For the Eq. 6 cannot evaluate the prediction method on the whole, another measurement is needed to calculate the probability of all pathway classes that are correctly predicted according to the first m predicted candidate pathways classes as follows i,mS denotes the number of the correctly predicted pathway classes of the i-th sample among its first m predicted candidate pathway classes, and iN denotes the number of pathway classes that the i-th sample belongs to. Usually, we calculate Eq. 7 by taking m as the smallest integer equal to or greater than the average number of samples\u2019 pathway classes in the dataset, which is calculated bySince the 11 prediction accuracies calculated by mL always implies a good performance for mapping small molecules or enzymes into correct metabolic pathway class.Sc. The pathway classes of these molecules were predicted by the prediction method described in Section \u201cPrediction method\u201d by the jackknife test based on all samples in benchmark dataset. Here, an example is given to demonstrate how we made the prediction. \u201cC07277\u201d, belonging to M9, is a sample in Sc. Its interactive compounds and proteins were shown from row 1 to 6 in Eq. 3, the likelihood that \u201cC07277\u201d belongs to each of 11 pathway classes was calculated and shown in M1 with the highest likelihood, followed by M9, M10 and M4. The 1-st order predicted pathway class was not its true pathway class, while its 2-nd order predicted pathway class was its true pathway class. After the pathway classes of each sample in Sc were predicted, 11 ordered prediction accuracies were obtained by Eq. 6 and listed in column 2 of Eq. 8, i.e., M\u200a=\u200a1.15. Thus we consider the first 2 predicted pathway classes for each small molecule. After collecting these pathway classes calculated according to Eq. 7, it was observed that the probability that all true pathway classes were covered by them was 83.81%. Our results are comparable to that in In the training dataset, 3,348 small molecules comprised the dataset Se. Our prediction method was also applied to predict their metabolic pathway classes, evaluated by the jackknife test. Likewise, \u201cYLL058W\u201d, a sample in Se, was selected to demonstrate how its predicted pathway classes were obtained. \u201cYLL058W\u201d belongs to two pathway classes: M2 and M5. Its interactive compounds and proteins were shown from row 7 to 17 in M5 is most likely, followed by M2, M6 and M1. The first two predicted pathway classes were its true pathway classes. After processing by Eq. 6, 11 ordered prediction accuracies were obtained. These accuracies were listed in column 3 of Eq. 8, i.e., M\u200a=\u200a1.37, meaning that the average success rate by a random guess would be 12.46% (1.37/11), which is much lower than that by our method. Like the 11 ordered prediction accuracies for small molecules, those for enzymes also generally followed a descending trend when increasing the order number  according to Eq. 8, i.e., M\u200a=\u200a1.18, meaning that the average success rate by a random guess would be 10.73% (1.18/11), much lower than that obtained by our method. Meanwhile, it is observed from column 4 of S was 1.18, the first two predicted pathway classes for each sample were considered. After collecting these pathway classes calculated by Eq. 7 by taking m\u200a=\u200a2, 83.74% true pathway classes were covered by the first 2 predicted pathway classes.The predicted results for all samples in the benchmark dataset As illustrated by the above sections, our method is very effective in predicting the metabolic pathway classes of small molecules and enzymes, indicating that interactive small molecules or enzymes are very likely to appear in a common metabolic pathway. In this section, we analyze the confidence score and illustrate the value in utilizing such scores.k in the interval , the following rate was calculated for each kind of interaction.kI is the number of interactions with confidence score to be at least k, and kIM is the number of interactions with their confidence score to be at least k and their corresponding small molecules or enzymes belonging to at least one common pathway class. The superscript of Eq. 9 was to differentiate three different kinds of interactions \u2013 Eq. 9 quantifies the contribution of the interactions with confidence score at least k for predicting the pathway classes of small molecules and enzymes in our method. For each kind of interaction, we can plot a curve with k as its X-axis. For clarity, the curve for chemical-chemical interactions is named the chemical-chemical curve, the curve for chemical-protein interactions is the chemical-protein curve, and that for protein-protein interactions is the protein-protein curve. Shown in k < \u223c900, and when k > \u223c900, the rate starts to increase quickly. These data indicate that the proportions of the interactions contributing to the prediction in the method become higher and higher with the increasing of confidence score, meaning that the confidence scores of interactions are related to the prediction of enzymes and compounds in a metabolic pathway. It is, therefore, foreseeable that as the interactions become more evidenced in STRING and STITCH, predictions requiring confidence scores will also be improved accordingly. Finally, it is important to note that when taking all interactive enzymes or compounds into consideration, more than half of the interactions would provide contributions to the prediction, indicating that using interaction information of proteins and chemicals to predict their metabolic pathways is reasonable. It is also the basis upon which our method performs well.The network constructed contains 4,002 samples and 100,754 interactions, including 66,942 chemical-chemical interactions, 19,695 chemical-protein interactions, and 14,117 protein-protein interactions. As described in Section \u201cConstruction of hybrid network\u201d, each interaction was labeled with a confidence score ranging from 1 to 999, quantifying the likelihood that an interaction occurs. For each integer M5, while its 1-st order predicted pathway class was M8. Shown in M5 and M8, and the last row of M5 and M8. Two difficult situations were observed from Eq. 3), it is highly possible that a query sample satisfying one of the above situations would be predicted incorrectly. Among 818 misclassified samples, 556  samples fit the first situation; while 604  samples fit the second situation. Furthermore, 762  samples fit at least one of the two situations. As a result, these samples were all misclassified. On the other hand, the incompleteness of the interaction information may be another important reason. When interactions, especially those with high confidence scores, for the true class are missing in the calculation, the prediction is likely to be incorrect.Although our method performs well, where the 1-st order prediction accuracy for all samples achieved 79.56%, 818 samples  achieved incorrect 1-st order predictions. The distribution of these misclassified samples in the 11 pathway classes is shown in By integrating the data for chemical-chemical interactions, chemical-protein interactions, and protein-protein interactions, a multi-label prediction model was developed to identify the metabolic pathway classes of small molecules and enzymes. Since interactive chemicals and proteins are more likely to involve a common pathway, the first order prediction accuracy achieved by our method was 79.56%, much higher than the average success rate by a random guess. Our analysis shows that interactive chemicals or proteins with higher confidence scores would be more likely to participate in the same metabolic pathway. We hope that this method may facilitate the understanding of metabolic pathway systems. It is also anticipated that prediction accuracy will increase as more and more interaction information concerning chemicals and proteins becomes available.Online Supporting Information S1List of the 4,002 samples, including 3,348 small molecules and 654 enzymes of yeast, classified into 11 metabolic pathway classes.(PDF)Click here for additional data file."}
+{"text": "Saccharomyces cerevisiae is a multi-step developmental path on which dormant spores re-enter the mitotic cell cycle and resume vegetative growth. Upon addition of a fermentable carbon source and nutrients, the outer layers of the protective spore wall are locally degraded, the tightly packed spore gains volume and an elongated shape, and eventually the germinating spore re-enters the cell cycle. The regulatory pathways driving this process are still largely unknown. Here we characterize the global gene expression profiles of germinating spores and identify potential transcriptional regulators of this process with the aim to increase our understanding of the mechanisms that control the transition from cellular dormancy to proliferation.Spore germination of the yeast Employing detailed gene expression time course data we have analysed the reprogramming of dormant spores during the transition to proliferation stimulated by a rich growth medium or pure glucose. Exit from dormancy results in rapid and global changes consisting of different sequential gene expression subprograms. The regulated genes reflect the transition towards glucose metabolism, the resumption of growth and the release of stress, similar to cells exiting a stationary growth phase. High resolution time course analysis during the onset of germination allowed us to identify a transient up-regulation of genes involved in protein folding and transport. We also identified a network of transcription factors that may be regulating the global response. While the expression outputs following stimulation by rich glucose medium or by glucose alone are qualitatively similar, the response to rich medium is stronger. Moreover, spores sense and react to amino acid starvation within the first 30 min after germination initiation, and this response can be linked to specific transcription factors.Resumption of growth in germinating spores is characterized by a highly synchronized temporal organisation of up- and down-regulated genes which reflects the metabolic reshaping of the quickening spores. A greater understanding of the control mechanisms that establish, maintain and end quiescence is important for basal, medical and biotechnological research.Cellular adaptation to environmental changes ensures fitness and survival of cells and organisms. Adaptation programs may strengthen cell walls in response to stress, switch the metabolic machinery upon starvation or trigger morphological differentiation during multicellular development and sexual reproduction. Entering and exiting GSaccharomyces cerevisiae responds to carbon and nutrient limitation either by entering stationary phase (haploids), or sporulation (diploids) [a and \u03b1, enclosed in an ascus sack (reviewed in [Budding yeast iploids) ,2. Sporuiewed in ). The spiewed in -7. Upon iewed in ,9. Duriniewed in ,11. If tiewed in . The matiewed in -15. The In this study, we analysed the transcriptional reprogramming of germinating spores and show that exit from dormancy results in rapid and global changes consisting of sequential gene expression subprograms. We identified a complex candidate network of transcription factors (TFs) regulating this response, thereby extending our understanding of the global regulatory program during germination . By compWe performed a time course microarray analysis to investigate the global response during germination Figure A. The anWe further aimed at identifying regulators of the global transcriptional germination program and its subprograms. The on-line-tool T-profiler  was usedThe main trigger for spores to exit dormancy is a fermentable carbon source, which suffices to induce early germination events such as spore wall degradation and swelling ,11. To i-214; chi-square test). We conclude that the vast majority of genes changed expression in the same direction, even though expression change for some genes passed the two-fold criterion in YPD but not glucose treatment. There is one noteworthy exception; 45 genes showed a two-fold or more up-regulation in glucose but not in YPD . The coD Figure D. AlmostD Figure E. This sThe similarity in gene expression pattern between germination in YPD and glucose is reflected in similar TF activity profiles. T-profiler analysis of the global germination program in glucose predicted eight additional TFs and the combined TF set of germination in YPD and glucose encompass thirty three TFs Figure . The majTo relate the temporal organisation to the candidate TF network structure, we extracted the TF sub-network corresponding to the thirty three TFs identified above from a global TF network . Figure We proceeded to compare our results to a previous transcriptome analysis of germination of SK1 spores . Two dimSeveral lines of evidence suggest that a large portion of the germination program reflects the metabolic evolution of the quickening spores rather than germination specific functions. To pursue this connection in more detail, we compared the germination program to the transcriptional changes during stationary phase exit . We starFurther, a T-profiler analysis of stationary phase exit and comparison with YPD-induced germination revealed that the rapid and transient upregulation of many genes seen during germination was also prominent during stationary phase exit Figure B, C. WheThe ability to exit and re-enter the cell division cycle in response to altered nutrient conditions is of paramount importance for cellular viability and cooperation. When starved, diploid yeast cells enter the sexual cycle by sporulation, while haploid cells arrest in a stationary phase. Cells in these two quiescent stages share many properties; they do not proliferate, their metabolic, transcriptional and translational rates are low, and they are surrounded by a thickened cell wall that provides resistance to harsh environments . ConsistFurther, we identified a common early and transient peak of transcription, including genes encoding transporters and transcriptional regulators that presumably are required for setting up proliferation after spore dormancy . We alsoThere are also discrepancies between dormancy exit of spores and stationary cells. In our hands, germination is associated with down-regulation of Gcr1/Gcr2-regulated glycolytic mRNAs, which does not occur during quickening from stationary phase. This is counterintuitive as resumption of growth in glucose containing medium requires glycolysis. We can only speculate about the possible purpose of this. To germinate quickly is crucial in the competition with other micro-organisms for nutrients and colonization of the micro environment; perhaps the spores contain high levels of these glycolytic mRNAs for translation immediately upon germination signals as mRNAs already present in the dormant spores most likely is the first choice for translation upon germination initiation . It is aWe further characterise the spore quickening by examining the effect of re-entry of media on the gene expression program. Rich growth medium with glucose has proved to be a more powerful germinant than glucose alone when it comes to acquisition of zymolyase sensitivity and trehalose breakdown ,28. ThisFinally, we resolve the gene expression profile in temporally distinct subprograms that are orchestrated by interconnected TFs. The data set we present here has a higher initial time resolution than previous studies, more stringent evaluation criteria, less noise and hence more coherent clusters, and benefit from the increased resolution gained by two-dimensional clustering. This allows us to analyse the temporal and compositional organisation of the germination gene expression program. As shown in Figure In conclusion, we have determined the gene expression response of dormant spores to YPD and pure glucose, identified distinct expression subprograms, and linked them to distinct TFs. We found strong similarities between quickening of spores on YPD and glucose, and to quickening from stationary phase. Resumption of active metabolism coincides with a transcriptional response with clearly distinct subprograms that reflect each nutritional condition. Interestingly, the program does not encompass any clear germination specific genes, and the process can be explained by a combination of metabolic programs including trehalose mobilisation, glucose repression, amino acid and protein biosynthesis, and mating. Future challenges in the field of yeast germination include deciphering the translational and metabolic responses of germinating spores, and to identify proteins and pathways essential for the process of exiting dormancy.HO gal3 MALI SUCI) strain background [Diploid cells of Y55  and labelled in a reverse transcription reaction with Cy3-dUTP or Cy5-dUTP (Amersham Pharmacia Biotech) in a total volume of 30 \u03bcl, following standard protocols (http://.cmgm.stanford.edu/pbrown) [http://microarrays.ca) was prehybridized with 1% BSA in DIGeasy hybridization buffer at 42\u00b0C for 1 h. Hybridization was performed at 42\u00b0C for 12\u201318 h. The slides were scanned on a GenePix 4000B scanner and quantized using the software GenePix Pro 4.0 resulting in data for 13056 spots, two spots represented one gene. RNA from dormant spores was used as reference RNA for all microarrays.Samples for RNA isolation were taken in three biological replicates at nine different time points  after addition of YPD or glucose 2%. For RNA extractions, 10 ml sample volumes were taken at each time point and transferred to 40 ml ice-cold 0,5% TritonX-100 in 50 ml falcon tubes, left on ice for a few minutes and then centrifuged briefly to collect the cells . The pellet was immediately frozen in dry-ice. Total RNA was extracted as described previously [/pbrown) . LabelleFor microarray data analysis, normalization was performed by a correction for dye-bias and intensity dependent trends. The normalization method was chosen by fitting a robust line (loess line) on the M-values and then corrected each value according to the value of the line. Statistical data analysis was carried out to obtain significantly different gene expression by using a moderated t-test analysis in R and Limma package . EmpiricTranscription profiles of germination and stationary phase comparative datasets were collected from databases NCBIs Gene Expression Omnibus (Series accession number GSE7393), and The ArrayExpress Archive (Experiment E-UMCU-12), respectively. Normalized log2 values were subjected to transformation so that all genes were 0 at 0 min time points.http://www.ncbi.nlm.nih.gov/geo/) with the accession number GSE29960.MIAME-compliant microarray data has been deposited in the microarray database GEO (http://.rana.lbl.gov/EisenSoftware.htm) [http://www.yeastgenome.org).The gene expression profiles were filtered to select genes with a reliable expression change by applying the criterion of a two-fold change (in the same direction) in expression level in two or more consecutive time points. K-means and hierarchical clustering was performed and visualized using Cluster and TreeView (are.htm) . Two dimare.htm) . Brieflyhttp://www.t-profiler.org) compares the mean expression ratios of groups of genes, and all genes within each group contribute to the evaluation of statistical significance, not just those genes that are judged to be differentially expressed. Two statistical parameters are utilized; (i) a t-value measuring the up-regulation (t\u2009>\u20090) or down-regulation (t\u2009<\u20090) in units of the standard error of the difference and (ii) a Student t test derived E-value that reflects the degree of difference in the mean log2-transformed expression ratio of a pre-defined group of genes and the mean for the rest of the genome. An E-value of <0.05 is considered as a statistically significant difference in gene expression. Only TFs and motifs with T-values \u22653.5 or\u2009\u2264\u2009\u22123.5 (in one or more time points) in one or both conditions compared are included in the analyses. Most but not all of these TFs have statistically significant E-values. Where several T-values for a transcription factor are identified, the highest absolute T-value at each time point is used. For TF identification in k-means clusters, the time point with the largest change compared to previous time point for each cluster is analysed. Only those TFs identified also for the whole microarray dataset are listed , without consideration of statistical significance. For cluster 7 and 8 in Figure T-profiler  was usedFor calculations of the differences in TF T-values between two different conditions (X-Y), the following rules were set up: If the T-values of the TF has the same sign in both conditions, then purple (positive numbers) indicates a higher absolute value in YPD germination compared to glucose germination/stationary phase exit, and green vice versa (negative numbers). If the TF T-values are of different signs, the highest absolute value of the two conditions dictates the direction of the comparison.For Cytoscape visualization, the data on transcription factor promoter binding was collected elsewhere , and theThe authors declare that they have no competing interests.CG participated in the design of the study, analyzed and interpreted the data, made figures, participated in discussions of the work and has been highly involved in drafting the manuscript. IP designed and carried out the microarray analysis and performed initial data analysis. WV and AE performed the statistical analysis and processing of data and helped with initial data analysis and interpretation. JN participated in design and coordination of the study. MK assisted and advised CG on analysis and interpretation of the data and has been highly involved in drafting the manuscript. SH conceived of the study, and participated in its design and coordination and has been involved in drafting the manuscript. All authors read and approved the final manuscript.K-means clustering of the complete gene expression dataset of YPD induced germination is largely consistent with clusters in Figure1. Genes were subjected to K-means clustering and grouped in eight clusters. The graph displays the average expression profiles of the eight clusters, named and coloured according to the clusters in Figure Click here for fileT-profiler analysis of the global K-means clusters identified in Additional file. TFs identified both in the global analysis in Figure Click here for fileTwo-dimensional visualisation highlights the correlation between the transcriptional responses of spores to rich growth medium and pure glucose. Two dimensional hierarchical clustering of the expression response to YPD and glucose. The x-axis represents the YPD cluster trees whereas the y-axis holds the glucose cluster trees. Three plots are separated by a grey line; genes whose expression changed two-fold in both data sets to the upper left, genes whose expression changed two-fold after glucose addition but not after YPD addition to the upper right, genes whose expression changed two-fold after YPD addition but not after glucose addition to the lower left. Each cluster is subdivided into groups of genes with correlation factor >0.75 by thin lines. The colour panels along each axis indicate diminished (blue) or stimulated gene expression (red) over time, compared to dormant spores. Each gene occurs once on each axis and the intersection is marked with \u201c\u25a0\u201d.Click here for fileTwo-dimensional comparison of the YPD data set with previous study on yeast germination. Two dimensional hierarchical clustering of the transcriptional response of spores to YPD, comparing the datasets from this study and a previous study (Joseph-Strauss) [Strauss) . The x-aClick here for file"}
+{"text": "Previous estimates of prevalence and incidence of systemic lupus erythematosus (SLE) in the United States have varied widely due to factors such as heterogeneous source populations, limitations with case ascertainment, and differing case definitions. The California Lupus Surveillance Project (CLSP) is part of a national effort funded by the Centers for Disease Control and Prevention to determine more credible estimates of incidence and prevalence of SLE, with a special focus on Hispanics and Asians.The CLSP is a population-based registry designed to determine the incidence and prevalence of SLE in San Francisco County, CA, USA. Sources of cases included hospitals, rheumatologists, nephrologists, commercial laboratories, and state population databases. These sources were queried for the International Classification of Diseases, Ninth Revision (ICD-9-CM) codes of 710.0 (SLE), 695.4 (discoid lupus), 710.8 (other specified connective tissue disease), and 710.9 (unspecified connective tissue disease). Laboratories were queried for serologic tests including ANA, anti-dsDNA, anti-Smith, antiphospholipid antibodies, and low complement levels. Pathology laboratories were queried for renal and cutaneous biopsies consistent with lupus. Over 15,000 potential SLE patients were identified after the initial queries, and trained abstractors performed detailed medical chart reviews on the >5,500 patients who met the catchment criteria of residence in San Francisco County within the years 2007 to 2009. Cases were defined as patients with documentation of \u22654/11 of the ACR Classification Criteria for SLE. Using SAS 9.3, we calculated prevalence and incidence rates and associated 95% confidence intervals (CIs). Denominators for all rates were obtained from the US Census data  for San Francisco County.The preliminary overall crude prevalence and incidence of SLE in San Francisco County was 90.4/100,000 and 5.1/100,000 respectively. The highest prevalence of disease was observed in Black women , followed by Hispanic and Asian , and White  women (Table The CLSP uses more complete case finding methods to provide current estimates of prevalence and incidence in a racially and ethnically diverse population. Racial and ethnic disparities in SLE were confirmed with the highest burden of disease in Black women, followed by Hispanic and Asians, and, finally, White women."}
+{"text": "In contrast to other materials, UiO-66(Zr)-2COOH demonstrated a superior adsorption performance to verapamil due to their strong acid-base and/or hydrogen-bond interactions, and the adsorption process fitted well with the pseudo-second-order kinetic model. As verapamil-adsorbed materials were used for desorption experiments, ZrO2 demonstrated the most favorable desorption performance, whereas UiO-66(Zr)-2COOH yielded the poorest desorption capability. These Zr-based materials had also been coated at the surface with filter papers for the analysis of various drugs and proteins in the process of paper spray mass spectrometry. The results demonstrated that among the studied materials, ZrO2-coated paper gave the most favorable desorption performance as a pure drug solution, whereas the paper from UiO-66(Zr) demonstrated the optimal capability in the analyses of therapeutic drugs in a complex matrix  and a protein . The dynamic pore systems and high surface areas of flexible metal\u2013organic framework materials make them excellent candidates to be used in different kinds of adsorption processes. However, the adsorption and desorption behaviors of therapeutic drugs on metal\u2013organic frameworks in solution are not fully developed. Here, we systematically investigated the adsorption and desorption behaviors of a typical therapeutic drug, verapamil, over several Zr-based metal\u2013organic frameworks [e.g., Zr-FUM, UiO-66(Zr), UiO-66(Zr)-NH Metal\u2013organic frameworks (MOFs) ,2 have r2  as well as ZrO2 have been systematically investigated using paper spray mass spectrometry. The results demonstrated that in contrast to other materials, UiO-66(Zr)-2COOH presented a superior adsorption ability to the studied therapeutic drug verapamil due to their strong acid-base or hydrogen-bond interactions. As those materials were used for desorption experiments, ZrO2 showed the most favorable performance. In addition, we coated the investigated Zr-based materials onto the surface of filter paper and studied the elution or desorption behaviors of different drugs and proteins from the coated papers. ZrO2-coated paper was found to display the most favorable elution behaviors to studied drugs prepared in pure solvent, whereas UiO-66(Zr)-coated paper demonstrated special tolerance to a sample matrix, with the optimal performance to drugs in a complex matrix such as blood and protein analysis. The present study not only paves the way to explore the adsorption and desorption performances of various Zr-based materials with paper spray mass spectrometry, but also provides a deep insight into the application of metal\u2013organic frameworks in analyses of different samples. In summary, the adsorption and desorption performances of various Zr-based materials [e.g., Zr-FUM, UiO-66(Zr), UiO-66(Zr)-NH"}
+{"text": "An attempt is made to study and understand the behavior of quantization of geometric phase of a quantum Ising chain with long range interaction. We show the existence of integer and fractional topological characterization for this model Hamiltonian with different quantization condition and also the different quantized value of geometric phase. The quantum critical lines behave differently from the perspective of topological characterization. The results of duality and its relation to the topological quantization is presented here. The symmetry study for this model Hamiltonian is also presented. Our results indicate that the Zak phase is not the proper physical parameter to describe the topological characterization of system with long range interaction. We also present quite a few exact solutions with physical explanation. Finally we present the relation between duality, symmetry and topological characterization. Our work provides a new perspective on topological quantization. The concept of geometric phase was put first by Pancharatnam23 in 1956, in the context of interference of polarized light. However the generalization of Berry\u2019s concept has been carried out by Wilczek and Zee24 and also by Aharonov and Anandan25 independently. The motivation of this research presented here is derived from the seminal work of Berry. Berry has found this phase along with the dynamical phase of the system for the cyclic evolution of a wave function and, at the same time, this phase is gauge invariant. Here, we mention very briefly the basic aspect of geometric phase to emphasis the importance of the present study of quantization of geometric phase from the perspective of integer and fractionally topological characterization. One finds the time evolution of the Hamiltonian through the time dependent Schr\u00f6dinger equationThe physics of Berry Phase (geometric phase) has been playing an important role in understanding pivotal findings of quantum condensed-matter systemsR(t) which changes with time adiabatically. One can also write this equation in a basis |\u03d5(x(t)) > corresponding to the energies En as, H(R(t))|\u03d5(R(t)) > = En(R(t))|\u03d5(R(t)) >.The Hamiltonian of the system depends on the parameter \u03b1n = \u03b8n + \u03b3n. \u03b3n are the dynamical and geometric phases respectively. Finally, Berry obtained the geometric phase asBerry assumes that the properties of the Hamiltonian is such that there is no degeneracy and no level crossing in the system during the evolution. During the adiabatic time evolution of the system, the state vector acquires an extra phase over the dynamical phase, \u03b8 around z-axis. The time dependent external magnetic field can be written as, Bx(t) = B0 sin \u03b8 cos (\u03c9t), By(t) = B0 sin \u03b8 sin (\u03c9t), Bz(t) = B0 cos \u03b8, where \u03c9 is the angular frequency of the rotation and B0 = |t)|. The Berry phase can be evaluated very easily as\u03c8\u00b1 > are the eigenstates with energies E\u00b1 = \u00b1\u03bcB0. The curve C in the parameter space is a sphere due to the existence of three component of an external magnetic field, B0 = constant, \u03b8 = constant, \u03b5\u2009\u2208\u2009. One can write the above equation as half of the solid angle enclosed by the path C,Here, we mention very briefly the famous example of geometric phase of spin-1/2 particle, which is moving in an external magnetic field \u03b3\u00b1(C) for the physical arguments of topological nature of geometric phase in the following sections of this work.We will use this result of C), i.e., the geometric phase will change if the path changes. However, there are some situations when the Berry phase remains the same, that is when the path (C) is subjected to smooth transformation, for this situation the geometric phase is topological in nature. The most fundamental example to illustrate this concept is Aharonov-Bohm effect (\u03b3n(C) is the geometric phase. It is independent of n and C, here the parametric space is 1). The topological phase is non-local in the sense that it cannot be defined at a point in space, but only as a closed integral enclosing the magnetic flux or what is observed in the Aharonov-Bohm effect26. In the latter phase, Aharonov finds another effect  which goes by the name \u201cAharonov-Casher\u201d effect27. The problem which we solve here is topological in nature with many new and interesting features and has not been explored explicitly in the literature of this model Hamiltonian and its variant system.The Berry phase is geometric in nature through the dependence of local geometry of the path . However, topological invariants are ill-defined at topological phase transition points, as they are usually defined for each quantum state protected by non-zero energy gaps.While the conventional quantum phases are described by continuous order parameters31. Furthermore, these systems are test-beds for applying new ideas and methods to quantum phase transition. Topological properties of quantum matter and interacting light matter systems are also in the state of art to understand many basic and fundamental aspects of topological states of matter41.Quantum spin models have got considerable attraction in the condensed matter physics community for the following reasons. Firstly, the quantum spin model can be simulated in an artificial quantum system with tunable parameters. Secondly, quantum simulations of the spin chain systems can be realized through different physical systems42. This comment of the legendary theoretical physicist motivates us to study the quantization of geometrical phase, duality and symmetry of this model Hamiltonian system. The detailed motivation of this research paper is presented below.C. N. Yang, in his concluding talk of the TH 2002 conference in Paris characterized the twentieth century theoretical physics by three \u201cMelodies\u201d. \u201cSymmetry, quantization and phase factorIn this study, the quantum Ising model with long range interaction is considered. The change in the topological characterization due to the introduction of the next-nearest-neighbor interaction in the model Hamiltonian is attempted to be elucidated. For this situation, three quantum critical lines are obtained .A pertinent question arises: Are the all quantum critical lines the same in nature from the perspective of topological characterization? This problem is studied explicitly for this model Hamiltonian.63. This is the bulk boundary correspondence. The common notion is that bulk boundary remains unchanged for the Hermitian system. The system with non-Hermiticity shows the physics beyond the bulk boundary correspondence.A one-dimensional topological system is characterized by the topological invariant number (winding number). The system is in the non-topological state for the zero winding number with the absence of zero mode Majorana alike excitation at the edge of the system. For the system with the integer winding number is in the topological state with the integer numbers of zero energy Majorana edge mode at both the edges of the system65, have shown explicitly that the bulk boundary correspondence can be modified in the presence of non-Hermiticity. They have shown that for a non-Hermitian Hamiltonian that encircles an exceptional point in the momentum space, the winding number has a fractional value 1/2. In this study, model Hamiltonian is Hermitian. However, any possibility to find the physics beyond the bulk boundary correspondence is explored. The possibility to find the fractional values of winding numbers for this study even though the model Hamiltonian has no exceptional point in the momentum space has been explored in this study.The authors of refsWe search what is the relation between the duality transformation and the topological quantization. Apart from that, quite a few exact solutions for the quantization of geometric phase with a physical explanation are presented.We also do the study for the symmetry operations for this model Hamiltonian explicitly to ascertain any difference of symmetries for the integer and the fractional topological characterization of the system.The other most important part of this study is how the topology of the auxiliary space changes for the integer and fractional topological characterization, along with the physical interpretation of integer and fractional topological characterization.22.Based on our results on quantization of Zak phase, we would like to raise the question whether the Zak phase is at all meaningful for the topological characterization of the system with long range interaction. There are quite a few studies in the literature of quantum condensed matter physics for studying the topological state and the properties of system through the Zak phase. However, the behavior of Zak phase under the integer and fractional topological characterization is absent in the literature70.The quantum phase transition properties have already been studied in quantum Ising model. At the same time, Ising models with long range interaction have been found to exhibit topological characterization, but the study of quantization of geometric phase with integer and fractional topological characterization for this quantum Ising model with long range interaction is absent in the literatureThis work provides a new perspective on topological quantization.68 of the present study isThe model Hamiltonian\u03bb1 and \u03bb2 are the nearest-neighbor (NN) and next-nearest-neighbor (NNN) interactions respectively and \u03bc is the strength of the transverse coupling. Here we consider it as a chemical potential.It is clear from the above Hamiltonian that the transverse field Ising model is modified by the presence of next-nearest-neighbor spins interaction. This Hamiltonian transfer to the spinless fermion Hamiltonian through the Jordan-Wigner transformation, After the Jordan-Wigner transformation, the Hamiltonian is reduced to,Finally, after the Fourier transform, the Hamiltonian become,k). The geometric phase in the momentum space is defined asun,k > is the Bloch states which are the eigenstates of the nth band of the Hamiltonian. The model Hamiltonian of the present problem is Z type topological invariant and the system has an anti-unitary particle hole symmetry (please see the \u201cSymmetry\u201d section for the detailed symmetry operations). For this system, the analytical expressions of the Zak phase19 isNow we are interested to derive the analytical expression of geometric (Zak) phase. Basic definition of Zak phase is the following. The Berry\u2019s phase picked up by a particle moving across the Brillouin zone. Here, the Brillouin zone is in the one dimension as treated by the Zak, and, therefore, the natural choice for the cyclic parameter is the crystal momentum .The BdG equation for this Hamiltonian is71. One can write BdG Hamiltonian in the pseudo spin as,\u03c4\u2019s are the Pauli matrices which act in the Nambau basis of HBdG. Finally, we succeeded in presenting the model Hamiltonian as a pseudo spin in a magnetic field in a two-dimensional plane (YZ plane). The parameter space of the Hamiltonian is  presents the number of times The winding number  for this model Hamiltonian is19 have shown explicitly from the symmetry arguments of the model Hamiltonian that the Zak phase is related with the winding number (W) by the Eq.\u00a019. We calculate winding number by using Eq.\u00a071). Finally we obtain the general expression for geometric phase (Zak phase). This is the justification for the derivation of the geometric phase (Zak Phase).Justification of the derivation of above equation is the following: The authors of refs\u03bb2 = 0 and \u03bb1 \u2260 0, (2) \u03bb1 = 0 and \u03bb2 \u2260 0, (3) \u03bb2 = \u2212\u03bc. (4) \u03bb2 = \u03bc + \u03bb1, (5) \u03bb2 = \u03bc \u2212 \u03bb1, The last three lines are the quantum critical lines.Here, we study the quantization of geometric phase in the different regime of the parameter space of the system, which are, (1) In this section, we discuss the results regarding Zak phase and their physical consequences with integer topological characterization, i.e., winding number takes the integer values.\u03c0 because it is measured in modulo of 2\u03c0. Therefore, when the winding number is even integer multiple, then the geometric phase is zero because it is measured in the modulo of 2\u03c0. However in the figure, we present the geometric phase, \u03b3 as 0,\u03c0 and 2\u03c0, to state the different topological state of the system in spite of the geometric phase remaining the same with \u03b3 = 0 and \u03b3 = \u03c0 for even and odd integer multiple of winding number respectively.Before we present the results, we would like to state a few generic information about the presentation. The Zak phase takes only two quantized values 0 and \u03bb1 \u2260 0, \u03bb2 = 0, (2) \u03bb2 \u2260 0, \u03bb1 = 0, (3) \u03bb2 = \u2212\u03bc. The analytical expressions for the geometric phase for these regime of the parameter space are the following\u03bb1 \u2260 0 but \u03bb2 = 0.\u03bb2 \u2260 0 but \u03bb1 = 0.\u03bb2 =\u2212\u03bc. The analytical expressions for Zak phase are ill define at the topological quantum phase transition points because the winding number is ill define at that points due to the change of topological state at that point.In our study, we observe a region of parameter space, where the system shows the integer topological characterization. This parameter space is stated as: (1) \u03bb1 \u2260 0 and \u03bb2 = 0; \u03bb2 \u2260 0 and \u03bb1 = 0; \u03bb2 =\u2212\u03bc respectively. Our study reveals that the \u03b3(1) is non-zero when \u03bb1 > \u03bc, otherwise it is zero, i.e., the transition occurs at the \u03bb1 = \u03bc. The variation of \u03b3(1) with \u03bb1 reveals that the transition of \u03b3(1) from zero to \u03c0 occurs at \u03bb1 = \u03bc, i.e., from the topologically trivial state to the topological state. We observe only a single transition which is related to the topological state of the system with a change of winding number unity, i.e., the system is in the state with integer topological characterization. Therefore, in this regime of parameter space the topological characterization of the state is the same both for Zak phase and winding number study. Only at the topological quantum phase transition point the jump of the winding number is sharp and it is ill define otherwise winding number is definite for the topological state. One can also explain this situation physically: The topological invariant quantity depends on the topology of the configuration space, for a particular topological configuration space winding number is a definite value, and change of winding number leads the system to the different topological configuration. This change of configuration space never become continuous because it is topological quantum phase transition, and not the continuous phase transition with order parameter. This is the physical explanation of sharp change of winding number at the topological quantum phase transition point.Figure\u00a073, they have done only for the short range interaction.The results and physical analysis of our study are consistent with the previous studies63 have also found the transition of geometric phase from 0 to \u03c0 for the topological orbital ladders. We observe in the middle row, the geometric phase that shows transition from 0 to 2\u03c0 for \u03bb2 > \u03bc. For this transition, the winding number of the system changes from 0 to 2 whereas the geometric phase remains 0, but we present in the figure as 2\u03c0 to illustrate the distinction between the two different topological states of the system and this is also in the integer topological characterization. The third row is always in the topological state with \u03b3(3) = \u03c0 and remains constant, i.e., the system is in the topological state with winding number unity, and there is no transition of \u03b3(3). Here, the system also shows the integer topological characterization, this description is only valid when the system is in gapped phase otherwise the situation is different. In Fig.\u00a0The authors of ref.\u03c0, like to the Kitaev\u2019s model, where the system is either in the non-topological state  or the topological state with . However, the system with long range interaction, the Zak phase will not depict the right physical picture because, for the same value of Zak phase, the number Majorana alike zero mode excitations are different at the edge of the system. Therefore, the results of topological invariant number is more fundamental than the results of Zak phase for the characterization of topological state of matter76. For that reason, we present our results of Zak phase from the perspective of winding number.We observe that the geometric phase (Zak phase) only describes the topological characterization correctly if it takes only two values 0 and \u03c7(k) = (\u03c7x(k), \u03c7y(k), \u03c7z(k)) = . The parametric equations for the system areThe parametric equation of the Hamiltonian in the pseudo spin space is the following form: \u03bb1 \u2260 0 and \u03bb2 = 0; \u03bb2 \u2260 0 and \u03bb1 = 0; and \u03bb2 = \u2212\u03bc respectively. The parameter space of these three rows are the same with the parameter space of Fig.\u00a0We have already discussed the topological origin of the geometric phase for this model Hamiltonian. In Fig.\u00a0mentclass2pt{minim\u03bb1 > \u03bc and \u03bb2 = 0, the origin of the parametric space is inside the circle otherwise not. The same observation is for when \u03bb2 > \u03bc and \u03bb1 = 0. These loop only touch the origin at the topological quantum phase transition point. There is no gapless excitation for these two lines except at the topological quantum phase transition point. But the situation is different for the third row (\u03bb2 = \u2212\u03bc). The system is in the integer topological characterization, when it is in the gapped phase (\u03bb1 > |2\u03bb2|). At the gapless phase (\u03bb1 < |2\u03bb2|) situation is different, as we observe in the last panel of third row, where the system shows the behaviour of fractional topological characterization. As the chemical potential increases the origin of the auxiliary space shifts from the centre to the edge and finally loop touches the origin of the auxialiary space. We present detail study of fractional topological characterization in the next section. The other consistent picture of this figure which reflect in the first column that for \u03bc = 0 the behaviour of all three lines are the same as it should be because at this value of chemical potential, the system is in the topological state for all quantum critical lines.We observe in the auxiliary space that when \u03bb1 \u2260 0 and \u03bb2 = 0; \u03bb2 \u2260 0 and \u03bb1 = 0; and \u03bb2 = \u2212\u03bc respectively. We have already emphasized that the variation of k plays an important role for the determination of geometric phase of the system. The parameter space of these three rows are the same with the parameter space of the three rows of Fig.\u00a0\u03bc = 0, there is no variation of \u03b3 = \u03c0, whereas the \u03bcs for a fixed value of \u03bb1. The result reveals from the second row \u03bc = 0 that there is no variation of k. It presents the topological state with \u03b3 = 2\u03c0(\u22610), and \u03bcs for a fixed value of \u03bb2. The most beautiful feature of this study reveals that k for this parameter space. In the lower row, \u03bc, and as a consequence of it is \u03b3(3) = \u03c0.Figure\u00a0\u03bb2 = \u03bc + \u03bb1 and \u03bb2 = \u03bc \u2212 \u03bb1. The analytical expression for the geometric phase for these two fractionally topological characterization of the system are \u03b3(4)(\u03bb2 = \u03bc + \u03bb1) and \u03b3(5)(\u03bb2 = \u03bc \u2212 \u03bb1).In this section, we present the quantization of geometric phase for the fractionally topological characterization parametric regime of the system, where the winding number takes only the fractional values. We study the quantization of geometric phase for the lines \u03b3(4) with \u03bc and \u03bb1. In the lower panel, where we consider the variation of \u03b3(5) for different values of \u03bb1 and \u03bc, we observe that there is a transition from \u03c0 and the analytical relation between \u03bb1 and \u03bc are different from the integer topological characterization . The detail derivation for this parametric relation is relegated to the \u201cMethod\u201d section. The difference of geometric phase between the two fractionally topological characterization is \u03c0, which is same with the difference between the trivial and topological state for the integer topological characterization.The study of upper panel of Fig.\u00a029. Therefore, it is very clear from our study that the topological properties of three quantum critical lines are different. Only one of them shows the integer topological characterization for a certain regime of the parameter space. In the \u201cMethod\u201d section, we have shown explicitly that for the other two quantum critical lines, the system is always in a gapless phase, apart from the parametric condition of gapless phase. Therefore, due to the presence of gapless state, the system never achieve the gapped topological state. This is main difference between the integer and fractional topological characterization.Now, we discuss two possible physical picture of the fractional topological characterization. The first physical explanation is the following: The fractionally quantized winding number for the above mentioned two quantum critical lines is not physically realizable; the explanation is the following: For this situation there is no topological excitations in the system. Here one can continuously deform the topological patch to a single point . We show explicitly in the \u201cMethod\u201d section that for these two quantum critical lines, the system has bulk gapless excitation (at k = 0 for \u03bb2 = \u03bc \u2212 \u03bb1 and k = \u03c0 for \u03bb2 = \u03bc + \u03bb1), as a consequence of it the loop always touch the origin of the auxiliary space. Thus the system is in the bulk gapless non-topological state for these two quantum critical lines. There is no gapless excitation for integer topological characterization except at the topological quantum phase transition point, we observe that the loop only touch the origin for that situation.It is very interesting to observe that for fractionally quantized topological characterization, the loop always touch the origin of the auxialary space  is also a fractional value of \u03c0. For the right panel of this figure, we observe two constant lines of \u03bc = 0,0.3. These two constant lines correspond to two different fractional values of winding number. The behavior of k for the left panel and right panel of the figures are different for non-zero values of \u03bc. The variation of k, but this symmetric behavior of fractional topological characterization is different from the integer topological characterization.In Fig.\u00a0\u03b3  and \u03b3(2) are in the following form77\u03bb1 \u2260 0 and \u03bb2 = 0:Exact solutions for \u03b3(1) = \u03c0 for \u03bc = 0 for all the values of \u03bb1. We also observe that this transition occurs at \u03bb1 = \u03bc  jumps from 0 to \u03c0. Now we look to find a result from the exact analytical expression for arbitrary \u03bb1 and \u03bc. At first, we present the results for \u03bb1 \u2260 0 and \u03bb2 = 0. For this regime of parameter space is  = 2\u03c0 that for \u03bc = 0 for the all values of \u03bb2. Topological quantum phase transition occurs at \u03bb2 = \u03bc  = \u03c0 for \u03bc = \u03bb1. We also observe that there is no transition of \u03b33 at \u03bb1 = \u03bc, The exact solution for the quantum critical line \u03bb2 = \u03bc + \u03bb1):The exact solution for the quantum critical line  introduce a kink in the system, which is a topological excitation.Duality and the topological state of the system have a relation. The non-zero values of duality operator \u03b2 operators are the following:Here, we introduce the order and disorder operator following the study of duality of the model Hamiltonian explicitly. These operators are defining the sites of the dual lattice, i.e., we define the operator between the nearest-neighbor site and of the original lattice. The analytical relation between the Pauli operators and Now we write the Hamiltonian in terms of the dual operators. The present Hamiltonian Equation\u00a0 consistsAfter using all the relations between the order and disorder operators, finally, we obtain the duality transform Hamiltonian as,\u03bc and \u03bb1. Now, we do the duality transformation for the total Hamiltonian \u03bb2 = \u2212\u03bc,For the quantum critical line (B)\u03bb2 = \u03bc + \u03bb1,For the quantum critical line (C)\u03bb2 = \u03bc \u2212 \u03bb1,For the quantum critical line (D)\u03bb2 \u2260 0,\u03bb1 = 0,For the NNN interaction only, Now we see how the duality transform the Hamiltonian at the quantum critical lines.H1, HA)( and HC), CT symmetry, PT symmetry and CPT symmetries of the model Hamiltonian. We do this study of symmetries for three reasons82: In the first point, we have already discussed \u03b3 is related W, when the model Hamiltonian of the system obeys the anti-unitary particle-hole symmetry, it triggers us to study the other different symmetries of the model Hamiltonian. The second point is that whether the symmetries of the model Hamiltonian manifests in different way for the integer and fractional topological characterization. The third point is that the non-Hermitian Hamiltonian which shows the anomalous edge modes with fractional value of winding number possess the chiral symmetry and PT symmetry. Therefore, it also motivates us to study the symmetry properties of this model Hamiltonian system and how it responses for the fractional and integer topological characterization.In this section, we present the result of Time-reversal symmetry (\u03c7y(k) and \u03c7z(k) during the derivation of these results.Here, we only present the basic aspects of symmetry and the results of symmetry study. The detailed calculations are relegated to the \u201cMethod\u201d section. The BdG Hamiltonian of the present problem is for spinless fermion, and, therefore, we use the spinless format of the symmetry operators. We use the properties of Now we present the results of symmetry studies of this model Hamiltonian. The detail derivations are relegated to the \u201cMethod\u201d section.Time reversal symmetry operation:Thus, the model Hamiltonian is invariant under time reversal symmetry.Charge-conjugation symmetry:Charge-conjugation symmetry operator is Thus, the model Hamiltonian is invariant under charge-conjugation symmetry.Chiral symmetry:Chiral symmetry operator is given by, Thus, the model Hamiltonian is invariant under chiral symmetry.Parity symmetryPHBdG(k)P\u22121 = \u03c3zHBdG(k)\u03c3z = HBdG(\u2212k)Thus, the Hamiltonian obeys parity symmetry.CP symmetryCPHBdG(k)(CP)\u22121 = \u03c3xK\u03c3zHBdG(k)\u03c3zK\u22121\u03c3x = \u2212HBdG(\u2212k).Thus, the Hamiltonian obeys CP symmetry.PT symmetry:Thus, the Hamiltonian does not obeys PT symmetry.CT symmetry:Thus, the Hamiltonian obeys CT symmetry.CPT symmetry:Thus, the Hamiltonian does not obey CPT symmetry.Now we compare the relations between the duality and symmetry: For the NN coupling the duality is invariant and the results obtained from the Zak phase study is also physically consistent. In the presence of NNN or further long range interaction duality breaks down for this model Hamiltonian but the behaviour of the symmetry, whether it is preserved  or breakdown (PT and CPT), is the same for NN, NNN and any long range interaction. Therefore, the duality and symmetry behaves differently depending on the range of interaction.Here, we have studied the interaction up to NNN interactions. One can generalize these results for further long range interaction. Suppose one consider the third NN interaction, the integer winding number will be 0, 1, 2, 3 and the fractional winding number will be 5/2, 3/2, 1/2. Similarly, one can generalize it for further long range interaction with maintain the sequence of NN and NNN interactions. The only thing is that the properties of duality and symmetry will be the same as we obtain from the study of NNN interactions, i.e., the NNN interaction is sufficient to characterize the complete nature of duality and symmetry for this model Hamiltonian system.We have presented the quantization of geometric phase for both integer and fractionalize topological characterization for this system along with the physical explanations. We have shown that all the quantum critical lines are not topologically equivalent. We have also presented the exact solutions based results for the quantization of geometric phase. The model Hamiltonian possesses different symmetries and the symmetry properties are the same for all quantum critical lines. One of, the most important conclusion is that Zak phase is not the proper physical quantity for the characterization of topological state in the presence of long range interactions. One can generalize this result for further long range interaction. We have shown explicitly relation between the duality, symmetry and topological characterization. Our work provides a new perspective of topological quantization.H2 . The analytical expressions for \u03c7z(k) and \u03c7y(k) are given in Equations\u00a0E| = 0.Now, we derive the analytical expressions for quantum critical lines based on the energy dispersion of k = 0 case.First, we consider for E| = 0, from this condition, we find the analytical expression for quantum critical line is \u03bb2 = \u03bc \u2212 \u03bb1.|k = \u03c0 case.Second, we consider for E| = 0, from this condition, we find the analytical expression for quantum critical line is \u03bb2 = \u03bc + \u03bb1.|Third, we consider for \u03bb2 = \u2212\u03bc.From this condition, we find the analytical expression for quantum critical line is A detailed analysis to search the parametric relations at the topological quantum phase transition pointThe analytical expression for winding angle is,At first we discuss the parametric relations for the quantum critical lines\u03bb2 = \u03bc + \u03bb1 and (2). \u03bb2 = \u03bc \u2212 \u03bb1.\u03bb2 = \u03bc + \u03bb1 becomeks where \u03c7y(k) = 0 = \u03c7z(k) and we find the parametric relations at the topological quantum phase transition point. From the analysis of \u03c7y(k), we get that \u03c7y(k) = 0 for the two values of k, that are respectively k1 = 0 and \u03c7z are \u22124\u03bb1 and 2(\u03bb1 + 2\u03bc) respectively. Here \u03bb1 and \u03bc both are positive, therefore it is clear that there is no situation for this quantum critical line with a parametric relation that satisfy The parametric relations for the quantum critical line k3 = \u03c0, which gives \u03c7y = \u03c7z = 0. So there is a gap closing point at k3 = \u03c0 for this quantum critical line and the system is always in gapless excitation and does not satisfy the gapped topological excitation state, although we get the fractional values of winding number. This excitation is the bulk gapless excitation, there is no edge excitations, which occurs in the integer topological characterization. We only obtain the fractional topological characterization with edge excitations, If we redefine the ill define point for this quantum critical line.Now we discuss the third point, i.e., \u03bb2 = \u03bc \u2212 \u03bb1. From the analysis of \u03c7y(k), we get that \u03c7y(k) = 0 for the two values of k, that are respectively k1 = 0 and k1 = 0, \u03c7y(k1) = 0 \u03c7z(k1) = 0, and for k2, \u03c7z(k2) = 2(\u03bb1 \u2212 2\u03bc). So for k = 0, we get this condition Analysis for the other quantum critical line k2 this quantum critical line satisfy the condition \u03bc = \u03bb1/2. This is the parametric relation where the another gapless phase occurs. This excitation is the bulk excitation which differ from the edge excitation of integer topological characterization. We only obtain the fractional topological characterization with edge excitations, If we redefine the ill define point for this quantum critical line.It is clear from the analysis for \u03bb2 = \u03bc + \u03bb1 and two for \u03bb2 = \u03bc \u2212 \u03bb1.The numbers of bulk gapless edge modes are different for these two quantum critical lines. It is one for Now we discuss the situation of parametric relation for integer topological characterization:\u03bb1 \u2260 0, \u03bb2 = 0, the gap vanishes only at k = 0. Therefore it is clear from the above analysis for k this quantum critical line satisfy the condition \u03c7z(k) = 2(\u03bb1 \u2212 \u03bc), i.e., the condition satisfy when \u03bb1 = \u03bc. For this situation, the system has gapless edge mode except when \u03bb1 = \u03bc.\u03bb1 = 0, \u03bb2 \u2260 0, the gap vanishes only at k = 0. Therefore, it is clear from the above analysis for k this quantum critical line satisfy the condition \u03c7z(k) = 2(\u03bb2 \u2212 \u03bc), i.e., the condition satisfy when \u03bb2 = \u03bc. We also observe this transition in Fig.\u00a0\u03bb2 = \u03bc.\u03bb2 = \u2212\u03bc, here we have not found any parametric relation to show the topological quantum phase transition. For this situation, the system is in the integer topological characterization for the gapped phase (\u03bb1 > 2\u03bb2) and in the fractional topological characterization for gapless phase (\u03bb1 < 2\u03bb2). This result has shown explicitly in Fig.\u00a0The other quantum critical line is the (1). 76 for this model Hamiltonian.At first we introduce the basic concept of the different symmetries very briefly and then the detail derivation of the symmetry operationst \u2192 \u2212t. The condition for the time-reversal invariant is,This symmetry operation can be represented by an operator \u03b7c. C\u03a8p)( = \u03b7c\u03a8p)(CP)\u22121 = \u2212H(\u2212k), where CP symmetry operator can be given by CP = \u03c3xK\u03c3z.This symmetry is the combination of charge conjugation and parity symmetry. CP symmetry is a transformation of particles into antiparticles with the inversion of spatial coordinates. From the definitions of the charge conjugation and parity symmetries, one can write, PT:  \u2192 . For a Hamiltonian which is invariant under PT symmetry we can write,This symmetry is a combination of parity and time-reversal symmetries. PT symmetry is transformation of space coordinates along with time. In other words, the reflection of space and time coordinates, i.e., PT = \u03c3zK.Since time reversal flips the sign of the spin, we have PT symmetry operator for spinless systems as CTH(p)(CT)\u22121 = \u2212H(p); {CT,H} = 0. One can write the CT operator for spinless systems as CT = \u03c3xKK = \u03c3x.This symmetry is a combination of charge conjugation and time-reversal symmetry. It is a transformation of particles into antiparticles with inversion of time. For a Hamiltonian which is invariant under CT symmetry must obey this relation, \u03b1. Hamiltonian which is invariant under CPT symmetry must obey the relation, \u03b1H(k)\u03b1\u22121 = \u2212H(k); {\u03b1, H} = 0, where the CPT operator is given by \u03b1 = \u2212iCPT. For spinless systems, one can compute the operator as This symmetry is combination of charge conjugation, parity and time-reversal symmetry. It is a transformation of particles into antiparticle with inversion of all space and time coordinates. We denote CPT symmetry operator as Time-reversal symmetryTime-reversal symmetry operation is \u03c7z(k) = \u03c7z(\u2212k) and \u03c7y(k) = \u2212\u03c7y(\u2212k).It is clear from the above expression that the model Hamiltonian obeys time reversal symmetry. During this derivation, we use the properties of Charge-conjugation symmetryThis symmetry operator is Thus, the Hamiltonian obeys charge-conjugation symmetry.Chiral symmetryThis symmetry operator is given by, Parity symmetryThus, the Hamiltonian obeys parity symmetry.CP symmetryThus, the Hamiltonian obeys CP symmetry.PT symmetryThus the Hamiltonian does not obeys PT symmetry.CT symmetryThus, the Hamiltonian obey the CT symmetry.CPT symmetryThus, the Hamiltonian does not obey the CPT symmetry."}
+{"text": "Neisseria meningitidis and other Gram-negative pathogens. Recent studies have demonstrated that LbpB plays a role in protecting the bacteria from cationic antimicrobial peptides due to large regions rich in anionic residues in the C-terminal lobe. Relative to its homolog, transferrin-binding protein B (TbpB), there currently is little evidence for its role in iron acquisition and relatively little structural and biophysical information on its interaction with Lf. In this study, a combination of crosslinking and deuterium exchange coupled to mass spectrometry, information-driven computational docking, bio-layer interferometry, and site-directed mutagenesis was used to probe LbpB:hLf complexes. The formation of a 1:1 complex of iron-loaded Lf and LbpB involves an interaction between the Lf C-lobe and LbpB N-lobe, comparable to TbpB, consistent with a potential role in iron acquisition. The Lf N-lobe is also capable of binding to negatively charged regions of the LbpB C-lobe and possibly other sites such that a variety of higher order complexes are formed. Our results are consistent with LbpB serving dual roles focused primarily on iron acquisition when exposed to limited levels of iron-loaded Lf on the mucosal surface and effectively binding apo Lf when exposed to high levels at sites of inflammation.Lactoferrin binding protein B (LbpB) is a bi-lobed outer membrane-bound lipoprotein that comprises part of the lactoferrin (Lf) receptor complex in  Bacteria responsible for important infections in humans and food production animals survive and proliferate within their host by \u2018hijacking\u2019 iron from the host iron-binding proteins, transferrin and lactoferrin. The iron-hijacking process is mediated by a set of surface receptors that are specific for transferrin and lactoferrin from the host. In this study we focused on the receptors from important human pathogens responsible for meningitis and gonorrhea that are being targeted for development of vaccines, thus a detailed understanding of the structure and function of these proteins is needed to aid in vaccine design. Although there is detailed information available for the transferrin receptor proteins, currently information is lacking for the lactoferrin receptor proteins. This study focuses on a specific constituent of the lactoferrin receptor, lactoferrin binding protein B, that also serves to protect the bacteria against host defense mechanisms mediated by small peptides that kill microbes, including ones derived from host lactoferrin. We demonstrated that lactoferrin binding protein B has two different sites for binding lactoferrin, one associated with obtaining iron, the other related to protection against the antimicrobial peptides. This information enabled us to understand how this protein can effectively serve both roles and adapt to the local conditions. Neisseria meningitidis is a diplococcal, Gram-negative bacteria that lives commensally in the nasopharyngeal tract of approximately 10\u201320% of humans [N. meningitidis is an opportunistic pathogen that can cause serious invasive infections including meningitis and sepsis. This pathogen acquires iron\u2013an essential cofactor required for redox reactions in biological processes\u2013from the iron-loaded host glycoproteins, human transferrin (hTf) and human lactoferrin (hLf) using a set of specialized receptors with specific affinity for these host glycoproteins[N. meningitidis are both comprised of an integral outer-membrane \u2018A\u2019 protein  and a bi-lobed, lipidated \u2018B\u2019 protein associated with the outer membrane . hTf is present in serum, within interstitial fluids and on mucosal surfaces, whereas hLf is localized to the mucosal surface, secretions, and sites of inflammation\u2013possibly providing different niches for the functionality of these receptors [eceptors .N. meningitidis have all been determined [The molecular mechanism by which the transferrin receptor hijacks iron from hTf has been well studied from a structural and biophysical perspective. Crystal structures of TbpB, TbpB:hTf, and TbpA:hTf from termined , 5, provN. meningitidis and Moraxella bovis have been determined [N. meningitidis have failed [N. meningitidis LbpB N-lobe predicted a binding interaction with the hLf N-lobe that contrasts the binding interface seen in the TbpB:hTf interaction. In contrast, Noinaj and Cornelisson et al. [LbpA is required for acquiring iron from hLf  and bindtermined , 10, attn et al.  proposedin vivo\u2013or this may now be its primary or sole function. This function would not be compromised by the release of LbpB by NalP-mediated cleavage of the anchor peptide [N. meningitidis pathogenicity. In this study, we employ the use of several biophysical and biochemical strategies in order to characterize the interaction between LbpB and lactoferrin. We provide a more comprehensive picture of the binding mechanisms of LbpB to hLf and novel insights as to how the interactions may serve different roles under iron-limited and inflammatory conditions N. meningitidis would experience within the host.Recent work \u201314 has a peptide  but NalPIn TbpB, the N-lobe and C-lobe are in a tight association with the two lobes in a perpendicular orientation , 15 thatN. meningitidis strains MC58 and B16B6, respectively, with a homobifunctional N-hydroxysuccinimide ester crosslinker , and analyzed the trypsin-digested products via LC-MS/MS. LbpB crosslinks were mapped onto an in silico homology based model of LbpB using Swiss-Model that was modelled against N. meningitidis TbpB [N. meningitidis strain B16B6 [A crosslinking reagent was used that adds an 11.4\u00c5 spacer group between accessible primary amine groups situated on lysine residues which are located up to 30\u00c5 from one another. We treated full-length LbpB and TbpB from in B16B6  as a conThe structural models with mapped crosslinks are illustrated in TbpB has been shown to bind to both domains of the iron-loaded form of human Tf C-lobe, effectively trapping it in the closed conformation . Thus, tThe demonstrated preference of LbpB for the iron-loaded form of Lf, implicates a similarity to TbpB that binds the iron-loaded C-lobe of Tf with its N-terminal lobe . SimilarD that was eliminated by removal of the anionic loops is consistent with the expectation that these loops mediated binding to the cationic region of the hLf N-lobe. Absence or differences in binding hLf cannot be attributed to problems with binding the LbpB derivatives as they were all observed to bind the streptavidin BLI sensors during the loading step  and holo-hLf (PDB entry 2BJJ). To dock these two proteins, we used the HADDOCK 2.2 web interface and included the inter-protein constraints relevant to the LbpB-N:hLf-C interaction noted in In order to gain a better sense of how the experimental data could be reconciled and the interaction visualized, we performed data-directed docking experiments with the LbpB-N lobe crystal structure from A selected set of lysine residues involved in crosslinking and their respective crosslinked partner are denoted with dashed yellow linker lines . NotablyThe data-directed model for the LbpB:hLf complex is strikingly similar to the TbpB:hTf complex  and is pIn the experiments with LbpB and hLf, incubation with DSS followed by SDS-PAGE also resulted in the identification of a higher molecular weight species that was most consistent with a 2:1 hLf:LbpB complex . The 260In the various experiments we performed evaluating the formation of complexes between LbpB and hLf we commonly observed the formation of precipitates that were not observed in the control preparations with hLf or LbpB alone, particularly over longer incubation periods and with higher concentrations of the proteins. Although XL-MS and HX-MS were useful in characterizing the 1:1 complex between iron-loaded hLf and LbpB that could reflect the situation on the mucosal surface, their utility decreased substantially when dealing with higher order complexes that might occur at sites of inflammation where higher concentrations of apo hLf are present.The ability to utilize host iron-binding glycoproteins as a source of iron for growth has been observed in Gram-negative bacteria that reside in the upper respiratory or genitourinary tracts of a variety of vertebrate hosts ranging from birds to humans , 28. TheNeisseria LbpB has been shown to protect against cationic peptides derived from the Lf N-terminal region [The bipartite Lf receptors were likely derived from ancestral Tf receptors after establishment of the mammalian lineage and have also been shown to be important for growth and survival on the mucosal surface . Howeverl region , 13 and l region , raisingl region , highligl region  and LbpBl region  or to thl region . Since bIn this study the combined results from the biolayer interferometry binding studies , crossliN. meningitidis against the killing activity of cationic antimicrobial peptides derived from hLf [LbpB has been shown to be important for protecting from hLf , and thafrom hLf . The resfrom hLf , its expThis study has demonstrated the duality and complexity of the LbpB:Lf interaction that reflects the dual roles that LbpB plays in iron acquisition and protection from cationic peptides. A schematic for the proposed pathways can be seen in tbpB and lbpB genes from Neisseria meningitidis strain MC58 or B16B6 were PCR amplified and cloned into a custom expression vector encoding a N-terminal polyhistidine tagged maltose binding protein followed by a TEV cleavage site [N. meningitidis (N.m.) strain M982 TbpB protein used in affinity-capture or BLI experiments excluded amino acids 1\u201340. N.m. MC58 LbpB protein excluded amino acids 1\u201315, and LbpB N-lobe protein excluded amino acids 1\u201335.Regions of the age site . The ampEscherichia coli strain ER2556 and after 1 hour incubation in LB broth containing 100 \u03bcM ampicillin, 1 mL was directly inoculated into a 20 mL starter culture of LB with ampicillin. After growth at 37\u00b0C for 18 hours the cells were re-inoculated into a 1 L culture of ZY auto-induction media containing ampicillin and allowed to grow for 24 hours. Cells were pelleted by centrifugation at 11,200 \u00d7 RCF, the broth supernatant was decanted and cell pellets were re-suspended in 50 mM sodium phosphate, 300 mM NaCl, 5 mM imidazole, pH 7.4 buffer (resuspension buffer) and lysed using an Avestin Emulsiflex-C3 homogenizer. Lysates were centrifuged at 48,200 \u00d7 RCF for 1 hour and the supernatant was filtered through a 0.45\u03bcm syringe filter. The filtered sample was loaded onto a 5 mL HisTrap FF column  using an Amersham peristaltic pump at a flow rate of 2 mL/min. The column was then loaded onto an AKTA purifier, washed in resuspension buffer followed by wash buffer  until UV signal baselined. The target protein was eluted with elution buffer  and selected fractions were pooled and dialyzed into interaction buffer  and stored at 4\u00b0C.The recombinant plasmids were used to transform LbpB fused with MBP was released by TEV protease cleavage  overnight. MBP and LbpB were separated by ion exchange on a Q HP column  and the samples were eluted on a salt gradient . The LbpB containing fractions were dialyzed into interaction buffer and stored at 4\u00b0C.2O2).3 \u03bcl of receptor protein preparations (recombinant MBP fusions) at concentrations of 1 mg/mL were applied to a nitrocellulose membrane  and allowed to dry. The membrane was then blocked with a 1% skim milk (W/V) in SPB buffer  for 1 hour. A 1:1000 dilution of HRP-conjugated ligand at an approximate concentration of 1 mg/mL was added to the blocking solution, and incubated overnight, shaking at 4\u00b0C. The blocking solution was removed, and the membrane was washed three times for 5 min with SPB Buffer. A development stock solution was created from 300 mg of HRP Color Development Reagent (BioRad) in 100mL methanol, then stored at -20\u00b0C. A diluted form of the development reagent stock was used on the membrane . Iron-free (apo) resins were generated by washing iron-loaded resin in a low pH buffer . 100 \u03bcL of 50% slurry was washed three times with binding buffer  by centrifuging the resin at 6,000 \u00d7 RCF for 1 min, decanting the supernatant, and resuspending the resin in binding buffer. Approximately 100 \u03bcg of free LbpB or TbpB protein was incubated with the resin for 2 hours at RT. Samples were centrifuged at 6,000 \u00d7 RCF for 1 min, and supernatant was decanted. Resins were then washed three times in binding buffer with salt adjusted to 120 mM (hLf resin) or 1 M (hTf resin) for 20 min. 85 \u03bcL of 2 x SDS-loading buffer  was added to the resin, and boiled for 5 min to release bound protein.E. coli ER2566 cells were transformed with plasmids encoding the various recombinant protein constructs including a BirA biotin acceptor peptide (BAP) [D value for the TbpB:hTf interactions (~50 nM) by approximately tenfold in each direction. Concentration values were calculated on a logarithmic scale incrementing by 0.33 to obtain the values 10 nM, 21 nM, 46 nM, 100 nM, 213 nM, 467 nM, 600 nM and 800 nM. After an initial baseline in 1 X kinetics buffer  and sensor loading, assay steps followed a repeat pattern of: baseline, association, dissociation, and regeneration. Regeneration was carried out in a 100 mM sodium citrate, 50 mM EDTA, pH 4.5 buffer. Association and dissociation steps were carried out in kinetics buffer. Steady state values were obtained by averaging the response values obtained in the last 5 seconds of the association step were plotted against concentration to generate saturation binding curves, and the data was fitted using Prism (Graphpad). The \u201cOne site\u2013Total binding\u201d saturation curve was used for Intact, N-lobe and Intact-lgsm, whereas the \u201cOne site\u2013specific binding with Hill slope\u201d was used for C-lobe binding.BLI experiments were carried as outlined in  on a Forde (BAP) , and plaMutants were generated using splicing by overlap extension (SOE) PCR . PrimersN.m. MC58 LbpB and hLf (Agennix) were incubated together in interaction buffer at equimolar concentrations in a total volume of 50 \u03bcL, shaking gently for 4 hours at RT. A stock solution of disuccinimidyl suberate  at 25 mM in DMSO was prepared and added to the complexed LbpB:hLf mixture to a final concentration of 1 mM. This mixture was gently mixed and incubated a further 30 min at room temperature. The DSS was then quenched using a 1 M NH4HCO3 solution added to a final concentration of 50 mM. Samples were loaded on a handcast 6% SDS-polyacrylamide gel until the 190kDa and 260kDa bands were completely separated from all other protein bands. The gel was stained with Coomassie blue, and the band of interest was excised with a clean scalpel blade for processing by conventional tryptic in-gel digestion methods [2 resolution at 7500. Up to ten of the most abundant ions were selected for fragmentation using higher energy collisional dissociation (HCD), rejecting charge states 1 and 2, and using a normalized collision energy of 40%. Data analysis was performed using the crosslinking plugin within Mass Spec Studio 2.0, using default settings [ methods , followesettings  with higab initio docking. This is approach is justified, as crosslinking data derived from DSS-based experiments typically generate a modest number of restraints, with poorly defined distances between linked residues. For docking we allowed crosslinks to vary between 5-25\u00c5 [it0, 200 in it1 and 200 during refinement in explicit solvent). Results were clustered according to fraction of common contacts (FCC), and the top-ranked cluster according to HADDOCK score was selected. Within the best cluster, the best-scoring model was chosen to represent the hLf:LbpB interaction.HADDOCK (High Ambiguity Driven protein-protein DOCKing) , 41 was en 5-25\u00c5 , and gen2O, in 10 mM Tris-HCl) at 4\u00b0C to a final D2O level of 45%. Labelling was performed for 1, 10, and 100 min for individual protein and the complex solutions. At the end of the labelling period, the samples were incubated in 100 mM TCEP under quenching conditions  for 1 minute, followed by digestion at 10\u00b0C with 6 \u03bcL of recombinant NepII  for 2 min [Stock solutions of hLf (20 \u03bcM) and LbpB (10 \u03bcM) were diluted to 5 \u03bcM in 10 mM Tris-HCl (pH 7.4) buffer prior to the HX-MS experiment. Similarly, the hLf:LbpB complex solution was prepared from the stock solutions in a 10 mM Tris-HCl (pH 7.4) buffer at a 1:1 ratio of hLf and LbpB with final concentration of 5 \u03bcM for each component protein. The complex solution was incubated for 1 hour prior to performing HX-MS analysis. HX was initiated by adding 2 \u03bcL diluted protein solutions to the labelling solution  A two-sided view of LbpB and the intra-protein crosslinks between spherized lysine residues obtained using DSS. Groups of crosslinks within close proximity are grouped and labelled a unique colour (specified in Tables (PDF)Click here for additional data file.S2 Fig(A) SDS-PAGE gel of the MBP-LbpB-C-lgsm in presence and absence of DSS (crosslinker). Arrows point to the band of interest in each case, and band-broadening upon addition of crosslinker can be seen, indicating successful crosslinking. (B) BLI sensor loading steps for each recombinant MBP-LbpB used in this study. Empty streptavidin sensors were placed in 1x kinetics buffer for 60 seconds before being placed in a crude preparation of biotinylated recombinant LbpBs. An increase in response (y-axis) with time (x-axis) indicates an increase in thickness of the biological layer on the sensor and thus protein binding.(PDF)Click here for additional data file.S3 FigA model of LbpB-C-lgsm was generated using the sequence of LbpB-C with the anionic loops removed and modelled against TbpB, as no high-resolution structure is available for this protein. Intra-protein crosslinks were mapped onto the protein and localized regions of crosslinks were coloured with a unique colour.(PDF)Click here for additional data file.S4 FigTEV-cleaved LbpB and hLf were purified and loaded in lanes 1 and 2, respectively. An incubation of these two proteins in equal molar concentrations was then crosslinked with 2mM DSS. Crosslinked protein was concentrated and loaded in duplicate beside the marker (lane 3) in lanes 4 and 5. Appearance of a ~160kDa 1:1 complex, and ~245 kDa 2:1 complex are indicated.(PDF)Click here for additional data file.S5 FigDifference in deuteration between (a) hLf-LbpB complex and free hLf and (b) hLf-LbpB complex and LbpB, plotted as a function of protein sequence. A reduction in deuteration, resulting from stabilization upon binding is shown in blue. Destabilization is shown in red. Peptides for which no significant change in deuteration was observed are shown in grey (p < 0.05). Dashed grey lines indicate the 2x SD deviation cut-off based on the error in all non-significant measured deuteration values.(PDF)Click here for additional data file.S6 FigNeisseria meningitidis M982 (PDB entry 3VE1). (C) Alignment of docked model from (A) with crystal structure from (B). (D) Solid phase binding assay of WT and mutant LbpBs binding hLf at pH 5.9 and 7.4.(A) Docked model of LbpB-N  against diferric hLf (PDB entry 2BJJ) using XL-MS constraints. Binding interface is noted with a translucent gray rectangle. (B) Crystal structure of the TbpB-N:hTf-C interaction from (PDF)Click here for additional data file.S1 Table* Inter-lobe crosslink.**Low\u2013medium confidence crosslink.(PDF)Click here for additional data file.S2 Table* Inter-lobe crosslink.(PDF)Click here for additional data file.S3 Table(PDF)Click here for additional data file."}
+{"text": "This study examined how intracranial large artery stenosis (ILAS), symptomatic and asymptomatic ILAS, and risk factors affect unfavorable outcome events after medical treatment in routine clinical practice.This was a 24-month prospective observational study of consecutively recruited stroke patients. All participants underwent magnetic resonance angiography, and their clinical characteristics were assessed. Outcome events were vascular outcome, recurrent stroke, and death. Cox regression analyses were performed to identify potential factors associated with an unfavorable outcome, which included demographic and clinical characteristics, the risk factors, and stenosis status.p\u2009<\u2009.05), hypertension (p\u2009=\u2009.01), and old infarction (p\u2009=\u2009.047) were factors relating to vascular outcomes. Hypertension was the only factor for recurrent stroke (p\u2009=\u2009.035). Poor glomerular filtration rate (<\u200930\u2009mL/min/1.73\u2009m2) (p\u2009=\u2009.011) and baseline National Institutes of Health Stroke Scale scores (p\u2009<\u2009.001) were significant predictors of death.The analysis included 686 patients; among them, 371 were assessed as ILAS negative, 231 as symptomatic ILAS, and 84 as asymptomatic ILAS. Body mass index (This study extended previous results from clinical trials to a community-based cohort study by concurrently looking at the presence/absence of stenosis and a symptomatic/asymptomatic stenotic artery. Substantiated risk factors rather than the stenosis status were predominant determinants of adverse outcome. Although the degree of stenosis is often an indicator for treatment, we suggest risk factors, such as hypertension and renal dysfunction, should be monitored and intensively treated. Intracranial large artery stenosis (ILAS) is a leading cause of ischemic stroke, especially for Asians and Africans , 2. SeveThese aforementioned studies were limited by patient selection bias , no comparable control groups (no recruitment of patients without stenosis), and only consideration of stenosis without inclusion of possible risk factors . Only onThe primary aim of this study was to examine how the status of ILAS and risk factors in patients with ischemic stroke affect unfavorable outcomes after medical treatment in routine clinical practice. ILAS status was categorized as patients with ILAS vs without ILAS. Patients with ILAS were further divided into the subgroups of patients with asymptomatic vs symptomatic ILAS.This was a 24-month prospective observational single hospital-based study that consecutively recruited ischemic stroke patients. The study enrolled patients who met all of the following eligibility criteria: (1) patients with acute ischemic stroke or transient ischemic attack; (2) patients without intracerebral hemorrhage; (3) patients who had received magnetic resonance (MR) imaging (MRI)/MR angiography (MRA) screening in the acute hospitalization; and (4) patients who provided written informed consent. The institutional review board of the Chang Gung Memorial Hospital at Kaohsiung Medical Center approved the study protocols .2 was categorized as indicating obesity and 24 to 27\u2009kg/m2 as overweight. ICA stenosis was classified as >\u200950% and\u2009\u2264\u200950%. ICA was evaluated by carotid duplex imaging during the acute hospitalization, with stenosis >\u200950% defined as a peak systolic velocity\u2009\u2265\u2009140\u2009cm/s or as a ratio of the ICA peak systolic velocity to the common carotid artery peak systolic velocity of >\u20092 [2 was assessed as abnormal, and results were further categorized into two groups with above or below 30\u2009mL/min/1.73\u2009m2. A serum uric acid level of >\u20098.3\u2009mg/dL was assessed as abnormal.Demographic and clinical characteristics were assessed. The risk factors included body mass index (BMI), internal carotid artery (ICA) stenosis, glomerular filtration rate (GFR), serum uric acid level, baseline neurologic deficits, and history of ischemic stroke, hypertension, diabetes mellitus (DM), hyperlipidemia, heart disease , atrial fibrillation, and smoking . Clearery of >\u20092 . A neuroBaseline neurologic deficits at admission were assessed with National Institutes of Health Stroke Scale (NIHSS), with a scale from 0 to 38 . In addition, the stroke etiology (the subtype of recurrent stroke) might have a large effect on the outcome of recurrent stroke; thus, the subtype of recurrent stroke was further classified into small vessels occlusive, cardioembolism, and atherosclerosis.All participants underwent MRA on a 1.5-T MR scanner (the Philips Gyroscan Intera or the GE Signa). Although MRA 3\u2009T is available and outperformed MRA 1.5\u2009T in various outcomes, such as improved signal-to-noise ratio and higher resolution, its use is usually limited to the research setting. However, MRA 1.5\u2009T is routinely used in clinics and is easily accessible to scan a large number of patients. Three-dimension time of flight was used. The image was usually reconstructed from 80 images insonated centered at the sella and 19 images from the sagittal plane. Brain MRA was used to assess 13 segments of intracranial large arteries: bilateral intracranial ICA, first and second part of the middle cerebral arteries, anterior cerebral arteries, posterior cerebral arteries, vertebral arteries, and basilar artery. Because the criteria used for stenosis evaluation on a cerebral angiogram are not easily adapted for MRA, a modified method to clarify ILAS was explored . In thisFor descriptive purpose, we categorized patients as patients without ILAS (ILAS\u2013), including the mild group, and patients with ILAS (ILAS+), including moderate, severe, and occlusion groups. ILAS+ was further categorized into two groups: symptomatic ILAS+ (ILAS+S), defined as ILAS with corresponding acute infarct detected by an MRI diffusion-weighted image or clinical symptoms, regardless the presence or absence of asymptomatic ILAS+ (ILAS+AS), and ILAS+AS as ILAS coexisting with no corresponding infarction. The number of ILAS+ was classified as single if only one stenotic segment was recognized and as multiple if more than one stenotic segment was found.The ILAS in this study was documented by board-certified neuroradiologists unaware of the patients\u2019 recruitment status. After recruitment was completed, one neurologist blinded to the outcomes of patients confirmed the stenosis ratings. If no focal stenosis was identified, although smaller in caliber compared with the other side, the vessel would be assessed as no ILAS , 21. If Because of the universal health insurance program in the study area with a single payer and limited copayment, MRI use was not confounded by socioeconomic status , 22. AppThe outcome events were (1) vascular outcome events, defined as cerebrovascular with recurrent stroke; cardiovascular event as any cardiovascular diseases requiring revascularization or admission; renovascular event as serum creatinine level increased by two times during follow-up, newly initiated hemodialysis, or diagnosis of nephropathy; or other vascular disease with vascular entity-related diagnosis at any new admission or emergency department visits, at the discretion of the investigators; (2) recurrent stroke, defined as an ischemic or hemorrhagic stroke after the first index stroke during the follow-up period; and (3) death. Outcome events were verified by hospital records and ascertained by one neurologist.2 test was used to determine significant differences in attributes studied in relation to ILAS. Cox regression was used to assess how ILAS+ symptomatic/asymptomatic and risk factors affected unfavorable outcome events. The variables included in the Cox regression analysis were sex, BMI, ICA stenosis, GFR, serum uric acid level, baseline neurologic deficits, and history of ischemic stroke, hypertension, DM, hyperlipidemia, heart disease, atrial fibrillation, smoking, multiple stenosis, and stenosis status. In the Cox regression, variables of interest were backward selected in the models. We further performed univariate analysis using the etiologic classification as the potential predictor of recurrent stroke and also multivariate Cox regression analysis involving the other variables together with the variable of stroke etiology as the potential predictors. All significant tests were two-tailed, and differences were considered to be statistically significant at a p\u2009<\u2009.05 level.SPSS 16.0 software  was used for data analyses. The \u03c7The study recruited 686 patients Fig.\u00a0; among tThe baseline characteristics of the participants in the ILAS+S, ILAS+AS, and ILAS\u2212 groups are summarized in Table\u00a02  and\u2009>\u200927\u2009kg/m2 , hypertension , and old infarction  were factors relating to the vascular outcome [Table\u00a0p\u2009=\u2009.035) accounting for the recurrent stroke. For death, the univariate analysis showed sex, GFR, uric acid, DM, heart disease, atrial fibrillation, and baseline neurologic deficits were significant factors, and the multivariate analysis showed poor GFR  and poor baseline NIHSS scores  were significant.Tables\u00a0To date, the optimal treatment of ILAS has not been confirmed . The cur2) and obese (BMI \u2265\u200927\u2009kg/m2) patients have a lower incidence of vascular outcome events than patients with a BMI of <\u200924\u2009kg/m2. Orpana et al. [2) has a significant protective effect for all-cause mortality compared with being underweight . A scrutiny of our data showed that half of our obese patients had a BMI of 27 to 30\u2009kg/m2. The protective nature associated with a low incidence of undesirable outcomes may have merit in the overweight and obese patients in this study.The results of this study indicate that risk factors were associated with worsening disease activity. Consistent with previous studies , 24\u201328, a et al.  suggesteGFR, uric acid, and baseline neurologic deficits (NIHSS admission score) were factors relating to death outcomes in our study. Chronic kidney disease may trigger vascular damage and endothelial dysfunction , and preConcurrently considering other relevant characteristics relating to the outcome events, neither ILAS+ and ILAS\u2013 nor ILAS+S and ILAS+AS were significant predictors for unfavorable outcome events. Thus, the presence or absence of stenosis and the presence of asymptomatic or symptomatic stenosis were not prominent factors for the outcome events. Although our finding is counterintuitive with the long-standing assumption that stenosis severity is an indicator for treatment decisions to reduce adverse outcome, it reinforces observations from the recent clinical trial that the degree of stenosis does not predict an adverse outcome after treatment with intracranial stents . Our resHowever, our finding is inconsistent with the previous cohort study  that occThat the participants in this study did not come from clinical trials is noteworthy. They were not population-based but from a metropolitan medical center. However, the incidence of carotid artery stenosis identified by duplex as >\u200950% was 3 to 14% and higher in patients with ILAS (ILAS+S and ILAS+AS), which was compatible with the incidence reported in the previous study using population-based data , indicatThe incidence of patients with ILAS+S and ILAS+AS in this study was similar to the previous study , which mOur study has limitations. First, our study was subject to bias because participants were recruited in one medical center. However, the study hospital is the main referral hospital for all types of stroke in the Kaohsiung metropolitan area of Taiwan. The incidence of carotid artery stenosis in the present study was compatible with the incidence reported in the previous study using population-based data, suggesting the data are representative of the population scenario.Second, owing to limited research manpower, detailed information on concomitant medication or modification of risk factor control is lacking, which might have introduced errors in the analysis of the incidence of outcome events. However, we attempted to reduce such bias in terms of reporting that patients had high rates of being monitored in the study hospital and of being treated for risk factors.Third, there is no universally accepted standard to diagnose ILAS. In this study, we used MRA and explored a modified method to clarify the stenosis of ILAS based on the study by Chimowitz et al. , which sFourth, there are several imaging modalities, such as MRA, computed tomographic angiography (CTA), and digital subtraction angiography (DSA), can be used to assess intracranial stenosis, we used MRA to identify ILAS instead of DSA and CTA, which are more sensitive. DSA is considered the gold standard for diagnosing intracranial vascular diseases, and CTA may provide higher diagnostic accuracy of the intracranial atherosclerosis than MRA . DSA, hoFifth, some factors that might influence the incidence of outcomes, such as lesion stability, were not included. We recommend that future studies consider these factors.This study extended previous results from clinical trials to a community-based cohort study concurrently investigating the presence/absence of stenosis, symptomatic/asymptomatic stenotic artery, and substantial risk factors. Hypertension, BMI, and renal dysfunction status are among the substantial risk factors that are predominant determinants of an adverse outcome rather than the stenosis. We suggest that although the degree of stenosis is often an indicator for treatment, risk factors should be monitored and intensively treated. Future research might consider other classification systems, such as perfusion symptoms or features of the plaque, instead of the type of stenosis, as potential factors of predicting adverse outcome."}
+{"text": "Wuchereria bancrofti infection is necessary in communities where mass drug administration (MDA) for the elimination of lymphatic filariasis (LF) as a public health problem has been stopped. During the post-MDA period, transmission assessment surveys (TAS) are recommended by the World Health Organization to monitor the presence of the parasite in humans. Molecular xenomonitoring (MX), a method by which parasite infection in the mosquito population is monitored, has also been proposed as a sensitive method to determine whether the parasite is still present in the human population. The aim of this study was to conduct an MX evaluation in two areas of Bangladesh, one previously endemic district that had stopped MDA (Panchagarh), and part of a non-endemic district (Gaibandha) that borders the district where transmission was most recently recorded.Careful monitoring for recrudescence of W. bancrofti using real-time PCR. A total of 23,436 intact mosquitoes, representing 31 species, were collected from the two districts, of which 10,344 (41%) were Culex quinquefasciatus, the vector of W. bancrofti in Bangladesh. All of the 594 pools of Cx. quinquefasciatus tested by real-time PCR were negative for the presence of W. bancrofti DNA.Mosquitoes were systematically collected from 180 trap sites per district and mosquito pools were tested for W. bancrofti in these districts. MX could be a sensitive tool to confirm interruption of LF transmission in areas considered at higher risk of recrudescence, particularly in countries like Bangladesh where entomological and laboratory capacity to perform MX is available.This study suggested the absence of  Wuchereria bancrofti microfilaria, antigen or antibody in human blood samples, molecular xenomonitoring can identify parasite DNA in vector mosquitoes. We collected the main vector of lymphatic filariasis in Bangladesh, Culex quinquefasciatus mosquitoes, in two districts in Bangladesh to see if W. bancrofti could be detected. One of the districts never had evidence of widespread transmission but borders another district where transmission was most recently detected. The other district had previously had W. bancrofti transmission, but after 12 rounds of mass drug administration, had been deemed to have little to no ongoing transmission. In each district, traps were set at 180 sites to collect mosquitoes. Over ten thousand Cx. quinquefasciatus mosquitoes were collected, but none of them tested positive for presence of W. bancrofti. The practice of trapping mosquitoes was feasible for the national program to execute, and the absence of infected mosquitoes suggests that parasite rates are nearing zero.To ensure elimination of lymphatic filariasis, efficient surveillance methods are needed. While some available methods rely on the detection of  Wuchereria bancrofti, Brugia malayi and Brugia timori. The Global Programme to Eliminate Lymphatic Filariasis was established in 2000 by the World Health Organization (WHO) and has two objectives: (i) the interruption of LF transmission through mass drug administration (MDA) using the combination of albendazole plus diethylcarbamazine or ivermectin, or all three drugs together in specific contexts as recommended recently by WHO [Lymphatic filariasis (LF), an important cause of acute and chronic morbidity worldwide, is caused by infection with the thread-like nematodes y by WHO  and (ii)y by WHO .After MDA is ceased, programs must conduct surveillance to identify and respond to the possibility of re-emergence of transmission. Current WHO recommendations for post-MDA surveillance include repeating TAS twice at 2\u20133 year intervals after stopping MDA, and ongoing surveillance \u20136 to ideWuchereria bancrofti is the only species of human filarial worm currently known to be present in Bangladesh and the main vector is Culex quinquefasciatus [W. bancrofti transmission trends through the assessment of microfilaremia (Mf), antibodies, and antigenemia among adults in these two districts. Molecular xenomonitoring [W. bancrofti in the two districts was less than the cut-off point of 0.25%, a threshold that has been suggested for areas where Culex mosquitoes are the vector [In Bangladesh, 70 million individuals were at risk of LF before the Ministry of Health and Family Welfare (MoHFW) started its LF elimination program in 2000 . Wuchereasciatus . Based onitoring  was implnitoring . We souge vector .2 [Mosquitoes were collected in two evaluation units, one in Panchagarh district and one in Gaibandha district . Panchag2 . It is b2 .2 [2) bordering the Rangpur district. These three sub-districts were selected due to (i) the risk of LF introduction due to the proximity with the Rangpur district and; (ii) the size of Gaibandha, which was considered too large for the implementation of MX throughout the entire district.Gaibandha district is also part of the Rangpur division with a population of 2.4 million and a total area of 2115 km2 . It is bCx. quinquefasciatus were collected prior to the third night.This study used a two-stage cluster sampling design. Probability proportional to estimated size (PPES) was used for the selection of villages based on the 2011 Bangladesh Census Data . Thirty Culex quinquefasciatus sample size was based on a positivity threshold of <0.25%, a threshold previously suggested for areas where Culex mosquitoes are the vector [Culex mosquitoes was required . To account for community level clustering, this sample size was multiplied by a design effect of two . This sample size was slightly decreased to 13,500 mosquitoes per evaluation unit  so that it was evenly divisible by the cluster and pool size. We expected to collect at least 75 female Cx. quinquefasciatus mosquitoes over three nights at each household to be able to create three pools of 25 mosquito per trap site, which would result in a total of 540 pools of 25 mosquitoes per evaluation unit. No more than four pools were tested per site.The e vector . When siFour teams of three entomologists from the MoHFW were tasked with trap deployment and mosquito identification. Each team was generally able to complete trapping in two villages per three-day collection period, resulting in collections occurring in eight villages per three-day period for the four teams.Cx. quinquefasciatus [Cx. quinquefasciatus in Bangladesh requires observation of features from the head, thorax, and abdomen, and 2) association of partial mosquitoes might result in mismatches which could then lead to an overestimation of infection rates if a single positive mosquito was split between two pools. After the three days of collection unfed, fed, semigravid, and gravid female Cx. quinquefasciatus from a single trap site were pooled (aiming for 25 mosquitoes per pool) and desiccated in 1.5ml Eppendorf tubes with silica gel. Unfed mosquitoes are defined as nulliparous mosquitoes, which have never fed on humans so cannot be infected, as well as parous mosquitoes, which have laid their eggs, but have not taken a next blood meal. For each trap collection site, district, sub-district, house numbers, GPS coordinates, and trap barcode numbers were entered into a data collection application developed on an Android smart phones and using the LINKS System  [Mosquitoes were collected using CDC gravid traps , which are commonly used for sampling asciatus . The traasciatus ,15. The asciatus . Only inGeorgia) . Data onW. bancrofti DNA at the molecular laboratory of the Institute of Epidemiology, Disease Control & Research  in Dhaka, Bangladesh. Positive and negative controls were also tested. DNA was extracted from pools using DNeasy Blood and Tissue kits  following the manufacturer\u2019s instructions. DNA quality was confirmed prior to PCR using a NanoDrop . The real-time PCR protocol described by Rao et al. [W. bancrofti DNA in the pools. All reactions were carried out in an ABI 7500 Fast Dx real-time PCR system  using Taqman Universal PCR Master Mix , and all pools were run in duplicate.Pooled mosquitoes were tested for presence of o et al.  was usedW. bancrofti infection prevalence in mosquitoes [Data analysis was conducted using Stata 14  for descriptive statistics. The PoolScreen software (version 2.0.3) was used to determine the maximum likelihood estimate and 95% confidence intervals of squitoes . The mapThis protocol was approved as a program evaluation by the U.S. Centers for Disease Control and Prevention (#2015\u2013180). The protocol was also approved by the Bangladesh MoHFW. Written consent to place a gravid trap in the courtyard was obtained from household members.Cx. quinquefasciatus (47%). For one trap location, only two nights were necessary to collect the number of mosquitoes needed. Of these, 10,021 (97%) mosquitoes were sorted into 594 pools, 267 collected in Gaibandha and 327 collected in Panchagarh  were intact. Most mosquitoes identified to species were female (95%) and the most commonly collected species was tus (47%). A totalnchagarh . The ranCx. quinquefasciatus and Cx. hutchinsoni were the only species that were predominantly collected in the gravid stage. Of the intact female Cx. quinquefasciatus collected, 88% were gravid, 10% were unfed, 1% were semigravid, and 1% were fed (As shown in were fed . All mosW. bancrofti DNA by PCR. Using the Clopper-Pearson method [None of the 594 pools tested positive for the presence of n method  in PoolSW. bancrofti. The results showed that none of the mosquito pools tested were positive for W. bancrofti DNA. This finding correlates with results from TAS surveys carried out in the previously endemic district (Panchagarh), in 2013 and 2015 among children 6\u22127 years old, which did not identify any children with positive antigenemia. In the same district, the ongoing surveillance system among adults \u2265 18 years in five health facilities identified a circulating filarial antigen prevalence of less than 1% among the participants. TAS was not conducted in the non-endemic district (Gaibandha), but the routine surveillance system among adults in seven health facilities found a circulating filarial antigen prevalence of less than 1%. The sum of our MX data and recent district-level data is consistent with the absence of W. bancrofti transmission in the two districts where the MX evaluations took place.This study describes the first MX evaluation carried out in Bangladesh during the post-MDA period to evaluate the presence of mosquitoes infected with 2) and the three sub-districts of Gaibandha (785km2) were similar in size to that of Galle district in Sri Lanka (1652km2). The fact that in Bangladesh we were unable to obtain the target sample size in each district is a key limitation of our study. However, if the mosquito infection rate were truly close to zero in all of the selected villages, the design effect would have been close to one. In that case, the sample size needed was half the one calculated initially , closer to the 10,021 tested in this study.The practical application of xenomonitoring activities is worthy of discussion. A key issue is to ensure that an adequate sample size can be attained. The main limitation encountered during the MX evaluation in Bangladesh was the difficulty in collecting sufficient mosquitoes to reach the targeted sample size of 13,500 female mosquitoes per district. Our sample size estimate was based on a on a positivity threshold of <0.25% and a design effect of two. Several sample sizes to detect culicine vector infection thresholds  have been proposed, and range from 0.25% to 0.65%. , 20. MX The large variation in size amongst clusters/villages also posed logistical challenges. Villages within the two study areas had sizes that ranged from two to 2875 HH according to the 2014 census. If we had calculated the sampling interval by dividing the total number of HH in the evaluation unit by the number of trap sites , some of the randomly selected villages would have received 0 traps and others 26. Instead, we calculated the sampling interval by dividing the total number of HH per evaluation unit by 30 . In each of the 30 villages selected per evaluation unit, six trap-sites were systematically selected, regardless of the size of the village. By using this method, the number of traps allocated to each team and the number of villages visited daily could remain constant throughout the study.The interpretation of zero positive pools represented a challenge in this study. LF is a focal disease, and cross-sectional cluster surveys like MX or TAS have an inherent risk of missing residual foci of transmission . MX provCx. quinquefasciatus densities were present. However, baseline data from the study areas regarding seasonal densities of Cx. quinquefasciatus were not available, and there are differing accounts of Cx. quinquefasciatus seasonality in Bangladesh in the published literature. Begum et al. [Cx. quinquefasciatus in December in Dhaka using human landing collections. Ameen & Moizuddin [Cx. quinquefasciatus in Dhaka in the months of March and November. These data made it difficult to identify the best time of year to collect Culex quinquefasciatus in Gaibandha and Panchagarh. Because of budget and time constraints, we were unable to extend the collection times to ensure that three pools of 25 mosquitoes were obtained at each site. The MoHFW entomologists conducting the field work were responsible for other entomological activities in the country, ranging from sampling of malaria vectors to surveillance of Aedes aegypti. As such, we had to define a discrete period of collection in order for the program to adequately balance available human and budgetary resources.In most cases, three nights were not enough to collect three pools of 25 mosquitoes per site. We wanted to undertake these collections at the time of year when the highest m et al.  found thoizuddin  found peoizuddin  found peCx. quinquefasciatus in Tanzania [Cx. quinquefasciatus to standardize this aspect of xenomonitoring, while realizing that the attractiveness of these infusions may be variable from site to site. A highly attractive infusion could optimize collection efficiency and reduce the number of days of trapping needed to reach the desired sample size.The composition and maturity of the grass infusion used to bait the traps may have impacted trap yields. While grass infusion has been shown to be an effective attractant for Tanzania  as well Tanzania . HoweverTanzania  used an Cx. quinquefasciatus, 30 other mosquito species were collected, all of which had been previously recorded from Bangladesh [W. bancrofti, vectors of other diseases were collected as well. Al-Amin et al. [Anopheles species collected in this study . An. annularis [An. philippinensis [Cx. gelidus, Cx. pseudovishnui, Cx. vishnui, and Cx. tritaeniorhynchus). As resting collections near oviposition sites enhance the likelihood of collecting JEV vectors [Aedeomyia catastica, Armigeres kesseli, Uranotaenia rampae, Ur. campestris, Cx. infula, and Mansonia annulata are especialy noteworthy as records of these species in Bangladesh are relatively rare [In addition to ngladesh . Non-vecngladesh , 29. Addnnularis  and An. pinensis , have al vectors , gravid ely rare .Although this was the first MX evaluation carried out in Bangladesh, MX evaluations have been used in other countries to evaluate the impact of MDA on human infection prevalence , 34, 35.S1 Table(XLSX)Click here for additional data file."}
+{"text": "Fos-dependent activity tagging, which captures populations of activated cells and allows them to be reactivated to test their physiological role. External warming tagged two principal groups of neurons in the median preoptic (MnPO)/medial preoptic (MPO) hypothalamic area. GABA neurons located mainly in MPO produced non-rapid eye movement (NREM) sleep but no body temperature decrease. Nitrergic-glutamatergic neurons in MnPO-MPO induced both body cooling and NREM sleep. This circuitry explains how skin warming induces sleep and why the maximal rate of core body cooling positively correlates with sleep onset. Thus, the pathways that promote NREM sleep, reduced energy expenditure, and body cooling are inextricably linked, commanded by the same neurons. This implies that one function of NREM sleep is to lower brain temperature and/or conserve energy.Mammals, including humans, prepare for sleep by nesting and/or curling up, creating microclimates of skin warmth. To address whether external warmth induces sleep through defined circuitry, we used c-  \u2022Nitrergic-glutamatergic neurons in the preoptic area are excited by external warmth\u2022Reactivation of these neurons induced a drop in body temperature and NREM sleep\u2022This circuitry binds a warm stimulus, NREM sleep, and body cooling Harding et\u00a0al. identify nitrergic/glutamatergic neurons in the MnPO-MPO hypothalamus, which after activity tagging by a warm external stimulus induce both sleep and hypothermia when reactivated. This suggests sleep and body cooling are inextricably linked. Reactivating GABAergic neurons, however, induces only sleep. Specific animal behaviors prior to natural sleep are well-recognized components of sleep initiation. Humans curl up in bed, and rodents and birds go to nests. While central circuits governing the timing of, and switching between, sleep states are being increasingly revealed , 2, 3, wBoth sleep and temperature regulation converge in the preoptic (PO) hypothalamus , 18, 19.As well as inducing NREM sleep, sustained external warmth to\u00a0the skin induces a homeostatic response to cool the body , 22. An In this paper, we use the genetic technique of \u201cactivity tagging\u201d to identify MPO-MnPO hypothalamic neurons that respond to a warm stimulus but which, when reactivated, simultaneously induce both sleep and a reduction in body temperature, thus showing that sleep induction and body cooling are inextricably linked.Laboratory mice are usually housed at temperatures (20\u00b0C\u201324\u00b0C) significantly below the temperature at which their metabolic expenditure is at a minimum, the so-called \u201cthermo-neutral zone\u201d. In mice, the thermo-neutral zone can range from 26\u00b0C to 34\u00b0C . Given tc-fos gene [c-fos-based activity tagging [fos-promoter-dependent pulse of hM3Dq-mCherry receptor expression in the MnPO-MPO area during exposure of the mice to an increase in ambient temperature. This method allowed us to test the hypothesis that a warm stimulus elicits NREM sleep via the MnPO-MPO hypothalamus.Mice showed a clear preference for exhibiting behaviors that involve preparing to sleep at a temperature close to their thermo-neutral zone . Neuronsfos gene , 31  was tightly regulated by doxycycline  into the MnPO and MPO hypothalamic area of C57BL/6 mice to generate Pan-MnPO/MPO-ActivityTag-hM3Dq mice   B. The hMtwo days C, and thtwo days C or at ttwo days D. Howevetwo days D. Under two days D, right c-fos-dependent hM3Dq-mCherry transgene expression following exposure of the mice to warm or ambient stimuli. Compared with hM3Dq-mCherry expression after ambient temperatures (hM3Dq-mCherry transgene expression throughout the MnPO and MPO area (c-fos-dependent hM3Dq-mCherry transgene induction was restricted to the MnPO-MPO area (Pan-MnPO/MPO-ActivityTag-hM3Dq mice were placed back on doxycycline (200\u00a0mg/kg) to repress the PTRE-tight-hM3Dq-mCherry transgene  induced a state of almost constant NREM-like sleep in the warm-exposed l waking B. Some sl waking C, consis warming C and 3E. warming F and 3G, warming C. Thus, q-mCherry protein. We double stained the MnPO-MPO area in activity-tagged mice with mCherry antisera and a panel of antibodies for neurochemical markers: choline acetyl transferase (ChAT), somatostatin (SOM), calretinin (CR), parvalbumin (PV), neuronal nitric oxide synthase (NOS1), vesicular glutamate transporter 2 (VGLUT2), and glutamic acid decarboxylase 67 (GAD67)  . The tag, and PV A but did, and PV B, VGLUT2, and PV C, and GA, and PV D. There , and PV D. Howeve, and PV C, suggesNos1-expressing and GABAergic neuronal populations in responding to external warmth and producing the hypothermia and NREM sleep. The pan activity-tagging method does not differentiate between subtypes of neurons. To address this, we restricted the activity tagging to genetically specified cell types   D and susDq mice) E\u20135H. By othermia D but a sExcept in the extreme case of fever , currentAlthough we have discussed our results in the context of external warmth, we cannot separate the effects due to the small increase in body temperature from those caused by the larger increase in skin temperature. Nonetheless, we suggest that external warming elicits sleep and body cooling primarily via skin warming. When the mice are exposed to the ambient warm stimulus of 32\u00b0C, the temperatures on the surfaces of the head and tail increase by approximately 4.5\u00b0C and 12.5\u00b0C, respectively. These increases are probably due to both passive heating as well as heating due to vasodilation, because the skin temperature exceeds that of the external warm stimulus. In contrast, the rise in core body temperature, although it cannot be ignored, is much smaller (\u223c0.4\u00b0C above controls). Even so, more work is required, for example by blocking pathways from peripheral thermosensors, to definitively show that skin warming is driving the circuitry that we have identified.A methodological point concerns the drop in body temperature that is produced by CNO reactivating the MnPO-MPO nitrergic/glutamatergic neurons. This decrease was considerably larger than that during natural NREM sleep. This over-activation of hypothalamic circuitry with pharmaco- or optogenetics to produce hypothermia (or hyperthermia) was similarly observed in other studies , 25, 28.Although our data are for mice and might not be reliably extended to humans, our findings on circuitry linking NREM sleep induction and body temperature decreases could explain the classical data, known for many years, that NREM sleep is\u00a0associated with lower core body and brain temperatures , 39. ThiFor humans, temperature is an important determinant of sleep duration and timing . During The synaptic pathway for how skin warmth initiates sleep would start with sensory TRPM2 ion channels in the skin that are stimulated by mild (non-painful) external warming . From thand temperature. Our proposed circuit in A receptor antagonist picrotoxin into the MPO area of rats triggers wakefulness and body warming [The glutamate neurons in the MnPO-MPO area are likely to form a key node that links energy expenditure and sleep. Given the small brain volume occupied by the MnPO, we suggest that the glutamate neurons studied by others that regulate body temperature in MnPO are the same nitrergic/glutamatergic cells studied by us that regulate sleep  warming . Dominan warming , 45. Dep warming , 47. CirGABAergic neurons in the MnPO-MPO area are usually thought to be the \u201cprime movers\u201d that induce NREM sleep , 18, 37.In summary, we have discovered nitrergic/glutamatergic neurons in the MnPO hypothalamus that respond to skin warming and control both NREM sleep induction and body cooling. It has been hypothesized before that cooling the brain is part of the function of NREM sleep  and alson.franks@imperial.ac.uk)Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Nicholas P. Franks (Vgat-ires-Cre: Slc32a1tm2(cre)Lowl/J (JAX labs stock 016962), kindly donated by Bradford B. Lowell [Nos1-ires-Cretm1(cre)Mgmj/J (JAX labs stock 017526) kindly donated by Martin G Myers [C57BL/6J (supplied by Charles River UK). All mice used in the experiments were male and congenic on the C57BL/6J background. Mice were maintained on a reversed 12\u00a0hr:12\u00a0hr light:dark cycle at constant temperature and humidity with ad libitum food and water.Experiments were performed under the Home Office Animal Procedures Act (1986), UK and were approved by local ethics committee. Mice were 10-12\u00a0weeks old at the time of the first surgery. The following types of mice were used: . Lowell ; Nos1-ir G Myers , and C57pAAV-ITR-PcFos-tTA-WPRE-pA-ITR  and pAAV-ITR-PTRE-tight-hM3Dq-mCherry-WPRE-pA-ITR  transgenes packaged into AAV [hM3Dq-mCherry reading frame was inverted between heterologous pairs of lox sites (FLEX switch) downstream of the PTRE-tight promoter . To make this plasmid, the promoter PTRE-tight fragment was cut out and isolated from pAAV-PTRE-tight-hM3Dq-mCherry plasmid, using MluI and SalI restriction enzymes. The plasmid pAAV-hSyn-flex-hM3Dq-mCherry  [hSynapsin promoter. The PTRE-tight promoter was ligated into the backbone between MluI and SalI sites to give pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA .We described previously the construction of the AAV-pan-neuronal activity-tagging system, comprising into AAV . For the #44361)  was doubAll AAV transgenes were packaged into AAV capsids  as described previously .AAV-Pcfos-tTA and AAV-PTRE-tight-hM3Dq-mCherry (or AAV-PTRE-tight-flex-hM3Dq-mCherry), were mixed in a 1:1 ratio. Viral infusions, using either a steel injector (10\u00a0\u03bcl-Hamilton #701) or a silica micro-capillary made in house, were performed with an electronic pump and optimized for the target with up to two injections of 0.15\u00a0\u03bcL at 0.1\u00a0\u03bcL min-1. The injection coordinates relative to Bregma were AP\u00a0+0.34\u00a0mm, ML 0\u00a0mm, DV \u22124.8 & 5.2. Mice were given three weeks for recovery before the activity-tagging, still keeping the doxycyline diet until the activity-tagging (see below). The week after the first surgery, the temperature loggers were often implanted.The mice needed three types of surgery: stereotaxic injections of AAV viruses, ECoG electrode placement (see \u201cEEG and EMG recordings and scoring of vigilance states\u201d below) and temperature logger placement into the abdomen (see \u201cCore Temperature recordings\u201d below). Two of these surgeries, electrode placement and AAV injections, were often performed together. One day before\u00a0surgery and AAV injection, mice were place on a 200\u00a0mg/kg doxycycline (Harlan TD.09265) diet. For surgery, mice were anesthetized with 2% isoflurane. The two viruses required for activity-tagging, 10 of 2.0 and 1.9, respectively. This was quantified by measuring the average RMS amplitude as a function of temperature during NREM epochs  temperature logger  recording on a pre-defined program sampled every two minutes for CNO injections. Skin temperature was measured using a Testo 845 infrared thermometer (head) and a 40-gauge, T-type thermocouple (tail), sampled at 1Hz.ad libitum access to food and water. At the end of this habituation period, and two hours before the end of the \u201cLights off\u201d period, the cage was then placed on temperature-controlled warming plates, adjusted such that one end of the cage was at 32\u00a0\u00b1 1\u00b0C, while the other end of the cage was at the ambient room temperature (22\u00a0\u00b1 1\u00b0C). The mouse nest was removed and scrunched into a ball and then returned to the middle of the cage. At the end of this two-hour period with the lights off, the lights came on and the position of the mouse recorded for two hours after the light change. At the end of the experiment the position of the mouse and the two largest pieces of bedding were marked. For each trial, the orientation of the plate and cage was randomized. The position of the mouse was recorded using ANY-maze video-recording software .Mice were habituated to a new cage for at least seven days and allowed to complete a nest using pulped cotten fiber nesting material . The mice had -1 doxycycline (Harlan TD.09265). For activity-tagging, 48\u00a0hr prior to the warm or ambient stimuli, the doxycycline was replaced with a doxycycline-free diet. The activity-tagging stimulus was started at ZT 21, and consisted of 2\u00a0hr in a warm-box  containing food and water. For the control stimulus, the box was at ambient temperature. Following the activity-tagging stimuli, the diet was immediately substituted for 1\u00a0g kg-1 doxycycline (HIGH) (Harlan TD.09295) for 24\u00a0hr followed by 200\u00a0mg kg-1 doxycycline indefinitely. 72\u00a0hr after the heat or ambient stimulation, mice were given i.p. injections of CNO  or saline under a randomized protocol and the EEG and core body temperature recorded (see above). The injections took place at approximately ZT 20 .Mice were maintained on 200\u00a0mg kghM3Dq-mCherry receptor, and that CNO\u2019s metabolite clozapine is also a potent ligand at this receptor [CNO has recently been characterized as a low affinity but high efficacy ligand at the receptor . Becausereceptor , it is ireceptor  who showq-mCherry expression, mice were killed and perfused 4\u00a0days after the activity-tagging stimulus. Mice were given pentobarbital anesthesia , and transcardially perfused with 4% paraformaldehyde in phosphate-buffered saline (PBS), pH 7.4. Brains were removed and 35-\u03bcm-thick coronal sections cut using a Leica SM 2010R microtome. Free-floating sections were washed in PBS three times for 10\u00a0minutes, permeabilized in PBS plus 0.4% Triton X-100 for 30\u00a0min, blocked by incubation in PBS plus 10% normal goat serum (NGS), 0.2% Triton X-100 for 1\u00a0h  and subsequently incubated with either a c-FOS polyclonal antiserum , an mCherry monoclonal antibody , rabbit polyclonal calretinin , rabbit polyclonal parvalbumin , rat monoclonal somatostatin , goat polyclonanl choline acetyl transferase , mouse monoclonal NOS1  and/or mouse monoclonal antibody Nos1 , and/or VGLUT2 antisera  or a GAD67  monoclonal antibody. Primary antisera or monoclonal antibodies were diluted in PBS plus 5% NGS  overnight or for 48 hours at 4\u00b0C. The next day, incubated slices were washed three times (each lasting 10\u00a0minutes), in PBS and then incubated for 2\u00a0h at room temperature in PBS plus 5% NGS with a 1/1000 dilution of a Alexa Fluor\u00ae 488 goat anti-rabbit IgG (H+L)  or Alexa Fluor\u00ae 594 goat anti-mouse IgG (H+L)  or\u00a0Alexa Fluor\u00ae 488 goat anti-guinea pig IgG (H+L)  or Alexa Fluor\u00ae donkey anti-goat IgG (H+L)  and subsequently washed there times in PBS for 10\u00a0min at room temperature. GAD67 and NOS1 were amplified using a tyramide amplification kit .For endogenous c-FOS staining following peripheral heating, mice were killed and perfused 30\u00a0mins after stimulus. For detecting activity-tagged hM3DFor the data shown in Nos1 these data were taken from 7 sections from 3 mice, and for GAD67 these data were taken from 4 sections from 2 mice (Bregma 0.0 to\u00a0+0.56).For \u2217p\u00a0< 0.05, \u2217\u2217p\u00a0< 0.01, \u2217\u2217\u2217p\u00a0< 0.001, \u2217\u2217\u2217\u2217p\u00a0< 0.0001). When multiple comparisons were made, the Bonferroni-Holm post hoc test was applied. Mice were excluded from the analysis if the histology did not confirm significant AAV transgene expression in the MnPO-MPO preoptic hypothalamus, or if the transgene expression had spread beyond the target region. Investigators were not blinded to treatments.Origin v8.6 was used for statistical analyses. Data collection and processing were randomized or performed in a counter-balanced manner. Data are represented as the mean\u00a0\u00b1 SEM unless otherwise stated in the figure legends. For the behavioral experiments, two-way ANOVA (vigilance state and treatment factors or genotype), or t tests were performed. p values are shown when they are less than 0.05 ("}
+{"text": "On-chip blood plasma separators using microfluidic channels are typically developed as disposable devices for short-term use only because blood cells tend to clog the microchannels, limiting their application in real-time and continuous systems. In this study, we propose an anti-clogging method. We applied dielectrophoresis to prevent microchannel clogging in a plasma separator that can be used over long periods for real-time and continuous monitoring. Prior to applying the anti-clogging method, the blood plasma separator stopped working after 4\u2009h. In contrast, by manipulating the separator with the new anti-clogging method at a voltage of 20\u2009V, it continued working in a long-term experiment for 12\u2009h without performance deterioration or an increase in cell loss. Two critical performance parameters of the manipulated separator, the purity efficiency and the plasma yield, were 97.23\u2009\u00b1\u20095.43% and 38.95\u2009\u00b1\u20099.34%, respectively, at 20\u2009V after 15\u2009min. Interestingly, the two performance parameters did not decrease during the long-term experiment. Hence, the blood plasma separator with the anti-clogging method is an interesting device for use in real-time and continuous blood plasma separation systems because of its consistent performance and improved lifespan. It also serves as the medium for exchange of vital minerals such as sodium and potassium and helps maintain a proper pH balance in the body2. Plasma can be rich with indicators of various diseases, which is why separating plasma from blood is of clinical importance3.Human blood performs many critical function for the body by supporting processes like nourishing tissues, regulating organ activities, and defending against harmful agents. Plasma, which is the liquid component of blood that suspends blood cells and many substances, constitutes more than 50% of the blood volume. Plasma serves in a variety of functions from maintaining the blood pressure and volume to transporting critical proteins involved in blood clotting and immunity15. The approach offers many advantages, such as the use of very small quantities of samples and reagents, a high resolution and sensitivity in separation and detection methods, low cost, short analysis times, and a small footprint for the analytical devices. Numerous microfluidic-based on-chip devices and techniques have been proposed for blood plasma separation, such as capillary force4, geometrical obstacles6, sedimentation8, acoustic forces9, inertial forces11, micro-filtration13, magnetophoresis14, and electroosmotic flow15. Some of the on-chip blood plasma separation methods are efficient. However, clogging is an issue for applications with long separation time in continuous systems18. In miniaturized plasma extraction systems, blood cells and plasma are typically separated by microfluidic channels. Within a microfluidic channel, blood cells tend to move along the axis of the microchannel, thereby increasing the cell concentration along the centre of the microchannel. When a microfluidic channel splits into more than two branches for blood plasma separation, the fluid velocity increases because of the shrinking of the cross-sectional areas in the microchannel. Therefore, blood cells located near the centre of the microchannel are accelerated by the fluid velocity and approach the microchannel wall because of their inertia20. This process is accelerated because of the high cell content in blood19.Conventional methods for plasma separation use centrifugation, which specifically supports processing of large volumes of blood. Although the conventional methods are very efficient and most commonly used in research and clinical laboratories, they have many limitations including the need for highly skilled personnel to operate the high-cost equipment and analyse the results. To circumvent this limitation, the lab-on-a-chip (LOC) approach by miniaturization and integration of the blood plasma separation procedure has gained an increasing interest in the past few years23. However, these reports did not mention how long and how often the device can be used, and whether it can be only operated using specifically designed microchannel. Moreover, some groups used blood with very low haematocrit23. For anti-clogging of the microchannel, most research groups have used surfactant or surface treatment24. However, using a surfactant, which is a chemical method, pollutes the medium. The surface treatment method is not suitable for a device that is operated for a long time due to the problem of durability.The phenomenon of blood cell adherence to the microchannel wall is termed a cell loss in this paper. It causes performance and reliability deterioration and unexpected structural changes or system pressure drops. Hence, microchannels are very prone to clogging during blood processing because of the extremely high number of cells and the strong adhesive force caused by a large surface-to-volume ratio. Once blood cells adhere to the microchannel wall, it is difficult to detach them. Some research groups already described \u2018clogging-free\u2019 blood plasma separation methodsHence, the objective of this study was to develop a microfluidic channel device with a long lifespan for continuous, real-time blood plasma separation using an anti-clogging method. In this study, we applied dielectrophoresis (DEP) to a hydrodynamic blood plasma separation device as anti-clogging technique that does not damage microfluidic devices. In addition, this technique can be applied to most microchannel devices without any restriction regarding the channel design. To verify the effect of the anti-clogging technique and the prevention of cell loss, interdigitated (IDT) electrode pairs were integrated into the device at the bottom of the branch channel for plasma extraction. Moreover, we tested if the technique improves the purity efficiency and the plasma yield.11. As shown in Fig.\u00a0Typically, on-chip blood plasma separation devices have a microfluidic network consisting of two or more split and branched microchannels that promote the blood plasma separation because of hydrodynamic forces26. The interactions are a combination of attraction by van der Waals forces and repulsion by electrostatic double layer forces, which are acting on relatively long-range27. After the initial contact, the cells attach to the surface more strongly through specific cell membrane factors that selectively bind the cell to the surface27.The adhesive force between a single cell and a solid surface is critical for the mechanism of microchannel clogging. Typically, when a blood cell is in close proximity to a planar surface, it is pulled to an adhesive contact with the planar surface by physical and chemical surface forces at the interfaceIn this study, we aimed to prevent the initial cell attachment to the internal microchannel surface. We hypothesized that the long-range adhesive forces which are critical for disturbing initial cell attachment.Fadh on the single cell is composed of the van der Waals force Fv and the electrostatic double layer force FEDL20.The adhesive force h between the cell and the surface and on the surface properties. The two forces are described as follows.The surface of the microchannel wall can be considered flat and the two forces are normal on the surface. The strength of these forces depends on the distance A is the Hammaker constant (5 zJ)20, d is the particle diameter, \u03b5m is the permittivity of the medium (78 \u03b50)28, \u03ba is the Debye parameter (0.159\u2009nm\u22121)29, kB is the Boltzmann constant (1.38\u2009\u00d7\u200910\u221223\u2009J/K), T is the absolute temperature (296.15\u2009K), and e is the fundamental electronic charge (1.602\u2009\u00d7\u200910\u221219\u2009C). The terms \u03b3p and \u03b3w are defined as \u03b3p/w\u2009=\u2009tanh[(ze\u03b6p/w)/(4kBT), respectively19, where \u03b6p/w is the surface zeta potential (RBCs: \u221210.8\u2009mV and PDMS: \u221213.825\u2009mV) and z the valency of the symmetric electrolyte30.h\u2009<\u20090.5\u2009nm), as shown in Fig.\u00a0The adhesive force on a cell increases sharply close to the microchannel wall surface  is the real part of the Clausius-Mossotti factor, and Erms is the root mean square value of the electric field. The Clausius-Mossotti factor fCM, determined by the complex permittivity of the particle \u03b5*p and the medium \u03b5*m, is a function of the frequency of the electric field.The The complex permittivity can be written as follows.\u03c9 is the frequency of the electric field, and \u03c3 is the electric conductivity.The fCM), ranges from \u22120.5 to 1.0 and determines the direction of the DEP force exerted on particles32. When Re(fCM) is positive, it is called positive DEP (pDEP); and particles move toward high electric field density. Conversely, when Re(fCM) is negative, it is called negative DEP (nDEP); and particles move toward low electric field density28. In this study, nDEP was used as repulsive force to prevent cell loss and clogging in the microchannels. The real part of the Clausius-Mossotti factor is related to the permittivity and conductivity of the particles along with those of the medium and the frequency of the electric field. However, because biological cells, like RBCs and WBCs, are not homogeneous spheres, the high contrast of conductivity between cytoplasm and the isolating membrane makes it necessary to consider a core-shell model. To obtain the effective complex permittivity of cells, a mixing equation was developed28.The real part of the Clausius-Mossotti factor, Re(router is the radius of the entire particle (shell\u2009+\u2009core) and the rinner is the radius of the core; \u03b5*outer and \u03b5*inner are the complex permittivities of the shell and core, respectively.The 32. The real part of the Clausius-Mossotti factor for blood cells in plasma as a function of the frequency was calculated using equations  ,,3), resph\u2009<\u20090.5\u2009nm. However, at h\u2009>\u20090.5\u2009nm, the adhesive force is smaller than the repulsive DEP force for anti-clogging. In addition, when the electric potential for generating the DEP force is further increased, the cross point between adhesive and DEP force, i.e., the minimum distance of the anti-clogging technique, shifted to a shorter distance, improving the efficacy of the anti-clogging technique. As a result, the DEP force can disturb migration of the blood cells toward the surface of the microchannel wall at h\u2009>\u20090.5\u2009nm, which prevents cell adhesion.In addition, the relationship between the adhesive and DEP force expressed as the distance from the cell to the surface is important for the application of the anti-clogging technique. As shown in Fig.\u00a033. Thus, in a microfluidic channel, cells are drawn into the microchannel with a higher flow rate because they are subjected to a higher pressure and a torque which is produced by the asymmetric distribution of shear forces34. In conclusion, when the blood cells migrate through the microchannel, the cell-free region is formed near the channel wall and the blood plasma can be separated using the bifurcation law, without the cells moving to the branch channel. However, some cells migrate to the branch channel unwantedly; these attaches to the narrow branch channel and promote clogging.In a microfluidic channel, blood cells tend to migrate in the axial direction of the microchannel. Therefore, the cell concentration along the centre of the microchannel increases, and the cell-free region, which is a marginal zone devoid of cells along the microchannel walls, is formed concurrently, as shown in Fig.\u00a011, is also possible because of the DEP force.In this study, plasma separation was accomplished by designing a simple microfluidic network based on the bifurcation law and DEP force for the anti-clogging. Because of the DEP force which disturbed cell migration to the branch channel for extracting the blood plasma, we can use relatively wide branch channels as compared with previous hydrodynamic blood plasma separation devices. That ensures a higher plasma yield. Moreover, separation of pure blood plasma (without PLTs and WBCs) from PLTs and WBCs contained blood, which was mostly not mentioned in reports about hydrodynamic blood plasma separation devices\u03b7L was defined asCi, Co, and Cp is the original concentration of the blood cells at the inlet, the processed concentration at the blood outlet, and the concentration at the plasma product outlet, respectively. If the cell loss was high, adhesion of the blood cells to the microchannel wall was high. Therefore, when the cell loss was closed to zero, the anti-clogging method was working properly. Figure\u00a0To estimate the anti-clogging method, cell loss We monitored the concentration of blood cells in the processed plasma at 15\u2009min after the beginning of the experiment. Figure\u00a0Ep and plasma yield \u03b7 are defined as36:Hi, Ho and Hp are the haematocrit levels at the inlet, at the blood outlet (concentrated samples), and at the plasma outlet (processed samples), respectively. To determine the haematocrit levels, centrifugation was used. Figure\u00a0To evaluate the performance of the experimental device, purity efficiency and plasma yield, which are the conventional evaluation indexes, were used. The purity efficiency Figure\u00a0All the results of the cell loss, the purity efficiency, and the plasma yield did not change significantly in relation to the flow rate change. However, when the applied voltage was 20\u2009V and the flow rate was 1\u2009\u00b5l/min, the experimental device had the best results in the cell loss, the purity efficiency, and the plasma yield. Therefore, we set the values for applied voltage and flow rate were 20\u2009V and 1\u2009\u00b5l/min, respectively, in the time-dependent experiment for testing the long-term use.To expand the lifespan of the device, an anti-clogging method was applied. The range of the applied voltage without cell lysis was 0 to 20\u2009V. Additionally, at 1\u2009\u00b5l/min flow rate, the device had a maximum value of purity efficiency and plasma yield. Therefore, we set the applied voltage to 20\u2009V and the flow rate to 1\u2009\u00b5l/min for anti-clogging.Figure\u00a0The time-dependent experiment showed that using the applied voltage at 20\u2009V was crucial for extending the lifespan of the experimental blood plasma separation device to at least 12\u2009h without any cell clogging within the microchannel network. In addition, the performance of the experimental device, the purity efficiency, and the plasma yield were maintained over time. When the anti-clogging method was not applied, however, the microchannel was quickly clogged by the blood cells and the device stopped working at the 4-h time point , as shown in Fig.\u00a0et al.37 achieved a purity efficiency of 80%, but the plasma yield was only 3% with whole blood. Lee et al.38 achieved a plasma yield of 62.2%, but the purity efficiency was only 60% with whole blood. In contrast, the proposed device obtained both relatively high purity efficiency and plasma yield in real-time and continuous blood plasma separation with whole blood.Blood plasma separation is an important method because plasma is widely used to assess the health status of people. In step with the general progress in further developing the LOC technology, various on-chip plasma separators have been described. However, unwanted clogging by blood cell adhesion to the microchannel walls has been blocking any progress in this field. Clogging remains a major source of performance deterioration and, as a result, most plasma separators are disposable and not for long-term use or real-time monitoring, which is a limitation for expanding the on-chip technology. In this study, we applied an anti-clogging method for blood plasma separation to prevent unwanted cell adhesion to the microchannel wall and deterioration of device performance. When the anti-clogging method was applied, the purity efficiency, and plasma yield of the experimental device were 97.23\u2009\u00b1\u20095.43% and 38.95\u2009\u00b1\u20099.34% with diluted blood and 87.96\u2009\u00b1\u20097.59% and 38.18\u2009\u00b1\u20090.09% with whole blood, respectively, at 15\u2009min after test initiation. In previous studies, when the high purity efficiency was achieved, the plasma yield was low and vice versa. For example, Tripathi Over time and without the anti-clogging method, cell loss increased dramatically, eventually clogging the device, which did no longer work after 4\u2009h. In contrast, when a voltage of 20\u2009V was applied as an anti-clogging method, the experimental separation device was still working after 12\u2009h without general performance deterioration, although a reduction in purity efficiency and plasma yield was observed. According to these results, we demonstrated that our anti-clogging method ensured the long-term use of an experimental on-chip device for plasma separation. We expect that the anti-clogging method can be applied for other blood plasma separators composed of a main channel and narrow branch channels. The experimental device with anti-clogging function is a promising candidate for usage in real-time and continuous blood plasma separation systems, because of its extended lifespan.The following sections provides a brief description of design of proposed device, fabrication techniques, and the experimental procedure. All the blood samples in this study were obtained with informed consent from all subjects. All the experiments in this study were performed in accordance with the guidelines and regulations which were approved by the bio-safety committee, Yonsei University, Korea.The proposed blood plasma separation was accomplished using a microfluidic channel device specifically designed for blood processing. The details of proposed blood plasma separator are shown in Supplementary Fig.\u00a02 layer was deposited using PECVD at a thickness of 100\u2009nm. To complete the proposed blood plasma separation device, both the PDMS replica and the IDT electrodes on a glass substrate were aligned (Karl Suss MJB3 Mask Aligner) and bonded after oxygen plasma treatment.To test the anti-clogging method and blood plasma separation technique, the interdigitated (IDT) electrodes and the microchannel device were fabricated  solution. The haematocrit of the diluted blood was measured adjusted by centrifugation at 25%. The haematocrit of whole blood was 45%.For the anti-clogging method, we used sinusoidal voltages ranging from 0 to 20\u2009V generated with a function generator  to create the DEP forces acting on blood cells. We used a syringe pump  to control the flow rate of the solution through the microchannel device. Before the experiment, the microchannel was rinsed by PBS. The microchannel during the experiments was monitored with a microscope and images were captured by a CCD camera . To determine the performance of the proposed device, a haemocytometer  was used to count cells at the inlet and outlets. All the experimental setup is shown in Supplementary Fig.\u00a0Supplementary Information"}
+{"text": "Job stressors in organizational studies are commonly known as role stressors. These include role overload (RO), role conflict (RC), role ambiguity (RA) and job insecurity (JI). We explored the predicting role of these stressors on the overall level of job stress (JS) and job satisfaction (JSF). Moreover, we tested the role of JS as a mediator between the relationship of role stressors and JSF in a multinational corporation (MNC) in a non-western collectivist context (Pakistan). We obtained data through field surveys from 173 engineering employees from the electrical, mechanical, safety and chemical divisions. Role stressors significantly predicted overall level of JS and JSF. JS was also found to partially mediate the relationship between role stressors and JSF. The study findings suggest that foreign ownership needs to focus not only on the economic value, but also the organizational and job design to mitigate the detrimental role of selected stressors. The results of this study have important implications for MNCs in general, and in developing countries in particular. Theoretical and managerial implications are discussed with recommendations. Human resource management, planning, development and retention of employees are the core issues of an organizational success. In pursuit of organizational success, a stress free working environment is essential for the smooth running of the business. Stress is the pressure, force or tension that an incumbent experiences in the workplace and tries to resist in order to keep the working environment normal . StudiesThe role incumbent in an organization meets the expectations of the role sender by investing his/her physical/mental resources and starts to perform his/her duty to become a part of the system through this role. People gain stress when their expectation is not met by the organizational resources due to excessive work compared to their physical/mental resources to tackle that assigned work . ResearcLike other developing nations, the economy of Pakistan is presently in a transition process affected by multiple factors , growing population and unemployment rates), where traditional employment patterns (long term) and job security are changed by more piece rate and temporary contracts . We chosPast research has explored that labor markets and work organizations are affected by globalization and exacerbates job characteristics such as job demands, JI, low job control, long work hours, psychosocial stressors . These fIn view of these challenging patterns of MNCs, the purpose of this study is to empirically examine the relationship between role stressors, JS and JSF in a MNC operating in Pakistan. This study is further motivated by: (a) the need to broaden the context of stress theory in non-western MNCs. (b) the need to examine the underlying process through which role stressors influence JSF by focusing on JS. (c) The desire for a more comprehensive understanding of JS as a mediator in relation to role stressors and JSF. (d) The opportunity to explore JI in non-western settings with an increased portfolio of role stressors in a desired MNC.It is a known reality that much of the employees\u2019 potential is being wasted due to JS in almost every organization. Stress is not confined in any geographic location, industry or profession, therefore the need is to assess its impact on different job related scenarios. Extensive work has been done to explore the relationship between role stressors, JS and its influence on employees attitude in the western individualist cultural context, whereas a little attention has been given to Asian collectivist countries ,20. LikeCollectivist attitude among the organizational settings in developing countries suggest more complex dynamics mediated by one emotion towards the collectivity . SpectorFirst hypothesis, measure role stressors, JS and JSF relationship in MNCs. Role stressors  have been a major concern at the workplace and considered a main source for job dissatisfaction . Past stBased on arguments above, stress cause losses that occurs due to stressors creating circumstances when individuals come under exceeding demand resulting psychological discomfort . MoreoveRO has significant positive influence on JS [The first factor in the model ce on JS  resultince on JS . Empiricce on JS . A meta-ce on JS . The secce on JS . In a RCce on JS . Kahn etce on JS  observedce on JS . In Asiace on JS ,27,36. TThe third factor RA situation is created at the work place \u2018when individual has less information necessary to carry out his job properly\u2019 . MoreoveThe second main hypothesis (H2) examines role stressors and JSF relationship. There is an ample evidence in the literature that JSF results from employees\u2019 positive reaction about their specific role which occurs by comparing the actual results with the expected output, such as desired, wanted, needed, or perceived to be just and rational . IncreasH1:\u00a0Role stressors will be positively related to JS such that:(H1a), RO will be positively related with JS, (H1b), RC will be positively related with JS (H1c), RA will be positively related with JS (H1d), JI will be positively related with JS.H2:\u00a0Role stressors will be negatively related with JSF such that:(H2a), RO will be negatively related with JSF (H2b), RC will be negatively related with JSF (H2c), RA will be negatively related with JSF (H2d), JI will be negatively related with JSF.Job strain model  guides uWe offer that stressors differentially affect the employees overall level of JS which further negatively results individual JSF. JS was also observed as a partial mediator between workplace discrimination and JSF . MoreoveH3:\u00a0JS and JSF are negatively related.H4:\u00a0JS will mediate the relationship of:(H4a), RO and JSF (H4b): RC and JSF (H4c), RA and JSF (H4d), JI and JSFIn the light of above discussion and hypotheses, we propose following model  to be tePrimary data were collected through a structured questionnaire from 173 employees of the organization with 97% response rate. The sample size 180 was determined based on statistical formula , from a The demographic information revealed that all the participants in the study consists of male because the engineering profession traditionally being a male dominant field specifically in Pakistan. The manpower included most of the engineers, sub engineers, and helpers. The average age of the respondents was 35 years. Maximum employees have less than five years of experience. Profession wise the sample consist of 32 engineers from Electrical department, 66 from Civil, 41 from Mechanical and rest of them from safety, chemical, and other Divisions.The questionnaire survey was used as an instrument for data collection comprising two parts. Part A dealt with the demographics while Part B dealt with the research variables. We measured RO by using 11 item scale . RC and Correlations and descriptive statistics are provided in the following sections.The mean, SD, reliability estimates and zero order correlations were used . Resultsp <0.01, \u0394R2 = 0.92, p < 0.01). Similarly, significant values were found for H1b, RC and job stress , H1c, RA and job stress , and H1d, job insecurity and job stress . The obtained values for overall model were also significant. So, hypothesis 1, followed by sub hypothesis H1a to H1d was fully supported and fulfills the first criteria for mediation outlined by Baron and Kenny [The first step in a conceptual model, nd Kenny . p < 0.01, \u0394R2 = 0.26, p < 0.05). Similarly, H2b, RC and JSF , H2c, RA and JSF  and finally, H2d, JI also negatively predicted JSF . The obtained values for overall model were also significant. So, hypothesis 2 followed by Sub-hypothesis H2a to H2d was fully supported and fulfills the second criteria for mediation outlined by Baron and Kenny [The second step  exhibitsnd Kenny . Hypothesis 3 by entering JS in the equation. Results confirmed that JS negatively predicted JSF . The overall model was also found significant F = 60.33, p \u02c2 0.001). So, hypothesis 3 was also accepted.The third step  exhibit The above main hypotheses followed by sub-sets proved that all the predictors i.e., role stressors are significantly related to JS (Mediator) and with JSF (criterion variable) as illustrated in ab) is given by Sobel, [a and Sb are the standard errors of a and b path respectively.Barron and Kenny  protocoly Sobel,  as follohypotheses 4 and its sub-set (H4a-d). The following  presentsp < 0.01, \u0394R2 = 0.33, p < 0.01). Although, the results remain significant but the effects of RO on JSF reduced from \u03b2 = \u22120.64 to \u03b2 = \u22120.41 as difference shown in For testing of sub-hypothesis H4a, we expected that JS would mediate the relationship between RO and JSF. The RO was controlled in the first block of hierarchical regression in p < 0.001 of the test was acquired. Therefore, partial mediation effect for RO and JSF was found. Sub-hypothesis H4a was therefore, partially supported.Moreover, Judd and Kenny  differen4bH we expected that JS mediates RC and JSF relationship. After controlling RC in the first block of hierarchical regression in p < 0.01, depicted in p < 0.01 as the same method mentioned in the result of sub-hypothesis H4a above. Therefore, sub-hypothesis H4b was partially supported.In sub-Hypothesis Sub-Hypothesis H4c posited that JS mediates RA and JSF relationship. The first and second condition of protocol was met in p < 0.01 given in Sub-Hypothesis H4d posited that JS mediates JI and JSF relationship. After controlling the effect of JI in the first block of hierarchical regression equation in This study examines the relationship between role stressors, JS and JSF with the main objective of establishing whether JS can play the role as a mediator between the selected stressors and JSF. We explored the cross cultural applicability of stress models in non-western culture like Pakistan. This research further demonstrated the relationship of role stressors with JS and JSF with increased portfolio in role stressor model by adding JI in a framework. We argue that JI causes relatively stress among the developing countries\u2019 employees alike in developed nations. Our findings confirmed that role stressors significantly influence JS and JSF both directly and indirectly. Secondly the relationship of each role stressor with JS is significantly positive. This is in the line with previous studies where two role stressors i.e., RA and RC were positively associated to work stress ,57. The mean value for JI in this research is slightly less than the neutral meaning that employee in this MNO feel less JI. These results are contrary to the western views, where results indicated that \u2018collectivist values were more likely to be affected by JI than individualist counterparts\u2019 . Hence, This study proved that role stressors have significant and direct negative relationship with JSF. This is in conformity with those of the previous studies and showed that employees while facing these stressors become dissatisfied from their jobs ,58,59. MThis study has also some potential limitations. One of the potential weakness of this research is the use of a cross sectional design, so we were unable to determine causality of the dependent and independent variables. Therefore, we could not analyze whether role stressors cause a feelings of job dissatisfaction, nor could we test whether role stressors and JS negatively impact on JSF. Hence, a longitudinal research design could have been useful to determine causality. Another potential limitation needs proper attention from the researchers, for example, the relative closeness of predictors (role stressors) and the mediator (JS). This might be sometime creates the issue of multicollinearity because role stressors measures may include items that capture strain due to stressors impact on criterion variables. Hence, it is recommended to check whether some measures unfortunately capture stressors and strain at a time in order to avoid common method bias and ensure the scale reliability. So, researchers in the future should pay more attention to the validity issues specifically in stressors and JS relationship, however, literature shows that role stressors effect JS with variance values . Moreover, the collected data were based on self-reported assessments and the observed relationships may be inflated due to common-method bias. Thus, future studies should examine whether the relationship remains constant by using longitudinal or experimental research design and could address the problem of common method bias. Another limitation is the characteristics of the sample. The study was conducted in a single MNC which restricts its generalizability. Previous literature affirmed the direct relationship of role stressors and JSF in a meta-analysis see for example . So, morHence, it would be more interesting to design a comparative study presented the cross cultural perspective about the mediating role of JS. We have selected JI to enhance the portfolio of role stressors to improve the model generalizability. Therefore, researchers might take benefits in the same domain to compare the model between western  and non-western (collectivist) MNCs context. In recent past researchers and practitioners are getting immense interest in this connection to explore the antecedents of JI across the cultures ,63.Our results showed that JS partially mediated between all the predictive variables and outcome variable. The findings validate the viability of social exchange theory  and COR RO is another complex form of RC , the relThe partial mediating role of JS suggests that in addition to direct effects of role stressors, MNCs should focus on JS in reducing the overall effect of role stressors on JSF to ensure a stress free environment and better work life quality to enjoy organizational effectiveness. We propose particularly in collective contexts that MNCs should promote open and direct communication with employees through training sessions  to understand their psychological and emotional problems. In addition, try to resolve the issues when they arise as it may cause mental health issues  if problIn sum, this study provides better alternative measures of reducing role stressors to examine employees\u2019 work related environment in improving JSF. Our study contributes in extending JS models in collectivist context, and further, explores directly and indirectly important work behavior (JSF) affected by role stressors. By exploring COR and social exchange theories in non-western collectivist context, this study highlights the importance of cultural differences in organizational behavior in general and MNCs in particular."}
+{"text": "This study aimed to explain the dynamics of prostate-specific antigen (PSA) levels in patients with prostate cancer who were treated with carbon ion radiotherapy (CIRT) and neoadjuvant androgen-deprivation therapy (ADT).Eighty-five patients with intermediate-risk prostate cancer who received CIRT and neoadjuvant ADT from December 2015 to December 2017 were analyzed in the present study. The total dose of CIRT was set at 51.6 Gy  delivered in 12 fractions over 3 weeks. The PSA bounce was defined as a \u22650.4 ng/ml increase of PSA levels from the nadir, followed by any decrease. PSA failure was defined using the Phoenix criteria.The median patient age was 68  years. The median follow-up duration was 33  months. The clinical T stage was T1c, T2a, and T2b in 27, 44, and 14 patients, respectively. The Gleason score was 6 in 3 patients and 7 in 82 patients. The median pretreatment PSA level was 7.37  ng/ml. All patients received neoadjuvant ADT for a median of 6  months. PSA bounces were observed in 39 patients (45.9%), occurring a median of 12  months after CIRT. PSA failure was observed in eight patients (9.4%), occurring a median of 21  months after CIRT. The 3-year PSA failure-free survival rate was 88.5%. No clinical recurrence was observed during the follow-up period. Younger age and lower T stage were significant predictors of PSA bounce. Younger age was a significant predictor of PSA failure.In this study, we identified the significant predictors of the occurrence of PSA bounce and failure. Further follow-up is needed to reveal the clinical significance of PSA dynamics. Among cancers, prostate cancer ranks second globally in morbidity and fifth in mortality . RadiothThe first carbon ion radiotherapy (CIRT) clinical trial for prostate cancer was initiated in 1995 at the National Institute of Radiological Sciences  . CIRT ofSerum prostate-specific antigen (PSA) is a sensitive marker of treatment outcomes for prostate cancer . FluctuaPSA bounces have been observed after various radiotherapy modalities for prostate cancer, such as low-dose-rate brachytherapy (LDR-BT), high-dose-rate brachytherapy (HDR-BT), IMRT, and stereotactic radiotherapy (SRT). However, only one study has reported PSA dynamics after CIRT . In thatThe study was approved by the institutional review board of Kanagawa Cancer Center . Written informed consent was obtained from all patients. Clinical data obtained between December 2015 and December 2019 was accessed in this study. The source of medical records used in this work was Kanagawa Cancer Center.In total, the cases of 85 consecutive patients with intermediate-risk prostate cancer who received CIRT at i-ROCK between December 2015 and December 2017 were analyzed in the present study. The patients were classified using the D\u2019Amico risk group classification . The cliAll patients were treated at i-ROCK in Japan. The first clinical treatment for prostate cancer at the i-ROCK was performed in 2015 .Patients were placed in the supine position on a vacuum mattress  and immobilized using thermoplastic shells . Enema was used before CT for CIRT planning. The rectum was emptied as much as possible using a laxative and an antiflatulent before each session, and enema was performed if the patient did not defecate within 24 h of treatment. The patients urinated and drank water 60 min before CT. A set of CT images with 2-mm-thick slices was taken for treatment planning.Contouring of the target volumes and normal tissues was performed using MIM maestro software version 5.6 . Dose calculation and optimization were performed using the Monaco version 5.20 system (Elekta AB).The prostate volume was measured via CT imaging. The gross tumor volume was not defined. The clinical target volume (CTV) included the entire prostate and proximal seminal vesicles. Planning target volume (PTV) 1 was created by adding anterior and lateral margins of 10 mm and a posterior margin of 5 mm to the CTV. Boost therapy was performed using PTV2, in which the posterior edge was set in front of the anterior wall of the rectum to reduce the rectal dose in the ninth course of treatment , 24. TheThe total dose was set at 51.6 Gy (RBE). After the first eight fractions were delivered using PTV1, boost therapy was performed using PTV2 in the latter four fractions. The PTV was covered by \u226595% of the prescribed dose, and the maximum PTV dose was limited to <105% of the prescribed dose. The dose constraint for the rectum aimed at V80% < 10 ml.CIRT was administered once daily for 4 days a week for 3 weeks. All patients were treated using the spot scanning method. CIRT was performed from both the right and left sides of the patient. One port was used for each treatment session. Verification of the patient position was performed using in-room CT during the first, fifth, and ninth treatment sessions. In each treatment session, a computer-aided online positioning system was employed to verify the positioning accuracy to less than 1 mm.Urologists administered ADT. Neoadjuvant ADT was administered for 4\u20138 months through the end of CIRT . ADT wasA urologist and a radiation oncologist conducted patient follow-up at 3-month intervals for the first 3 years after CIRT and at 6-month intervals thereafter. PSA was measured at each follow-up visit. In the present study, the PSA bounce was defined as a PSA increase of at least 0.4 ng/ml from the nadir PSA level, followed by any decrease , 26. PSAp value was calculated as <0.10, were evaluated using the multivariate stepwise Cox regression model Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0No**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Dear authors, thank you for submitting this manuscript, which I read with great interest. Please find my comments below, which I hope will be a positive contribution.Summary:This manuscript reviews the retrospective analysis of PSA failure and bounce for the patients with intermediate-risk prostate cancer treated with CIRT combined with neoadjuvant hormonal therapy at a single institution. There is limited information about PSA kinetics about CIRT combined with hormonal therapy.This reviewer has some significant concerns that need to be addressed by the authors:Comments:AbstractionLine 53, 54:It would be helpful to have a more specific conclusion based on the findings of the data reported in the paper. Statements with \"investigated\" are not conclusions.BackgroundLine 74-77:The facility's description is considered to be not directly relevant in the background. I recommend that you consider moving it to the methods paragraph.Materials and MethodsLine 134-135: Describe the details of dose constraints other than the rectum.Line 156: Statistical Analysis Paragraph\"The correlation of clinical variables with PSA dynamics was assessed via logistic regression.\" In Table 2 and 4, was logistic regression analysis performed for both univariate and multivariate analyses? If not, please add a different test method used for univariate analysis.PSA failure and PSA bounce are both time series data and it is not appropriate to use logistic regression in the test methodIn the multivariable analysis, the number of independent variables greatly exceeds the number of occurrence events, which lead to inappropriate results. Describe the process of selecting explanatory variables.Clarify the detail about the statistical methods for differences between groups in the PSA time series used in Figures 1b and 1c.ResultsTables:Remove unnecessary gray lines in each table.Table1: The sum of pretreatment PSA is not 85. Correct the number of patient numbers in each category.Table2: The results of PSA nadir is not correctly displayed.Reviewer #2:\u00a0Given the fact that the clinical significance of PSA bounce is unclear and its definition is various, I think such a prospective observational study is valuable. This manuscript is very important as the first report of PSA dynamics after CIRT with neoadjuvant ADT.I have one question that there were 8 patients with PSA failure, 7 were followed up, and only 1 was treated immediately. What is the reason for this difference?Reviewer #3:\u00a0General commentsCarbon ion radiotherapy requires advanced technique and the patient number is limited compared with those who receive photon radiotherapy. The current study analyzed intermediate risk prostate cancer patients who received CIRT and ADT to illustrate the dynamics of PSA after treatment.It is essential to further describe the intention to investigate PSA dynamics for prostate cancer after CIRT and ADT and potential clinical impact to emphasize the value of this study.Specific commentsMaterials and methods section1. How many patients were in the favorable intermediate risk group among the 85 patients? If any, please describe the indication of neoadjuvant ADT use.2. Please describe the ADT regimen (drug name and dosage) specifically and clarify the last dose of ADT and its active duration.3. Please explain why patients received neoadjuvant ADT of various duration (4 to 8 months) in this study. Did the authors investigate whether the duration of ADT administration was associated with the time interval of subsequent incidents of PSA bounce/PSA failure?Statistical analysis section4. Please describe the starting date to calculate the follow-up time.5. The current study investigated the correlation between different continuous variables and PSA bounce/PSA failure. ROC curve analysis should be adopted to survey the potential cutoff value of these continuous variables.6. Cox regression should be considered in multivariate analysis to investigate the effect of these variables on the time it takes for PSA bounce or PSA failure to happen.Results section7. The median follow-up time was 33.1  months, which is relatively short for intermediate risk group prostate cancer patients.8. Compared with conventional fractionated RT for prostate (about 7 to 8 weeks), the treatment course of 3 weeks using CIRT was relatively short. Usually, the decline of PSA after RT is gradual and it usually take several months to reach the PSA nadir. Most patients in the current study reached nadir rapidly within 3 to 4 months after CIRT. How can the authors confirm that the nadir is due to the effect of CIRT (unique RBE?) rather than effect of ADT?9. Only eight patients developed biochemical failure during follow-up of this cohort. The small number could reduce the power of statistical analysis.10. Seven of eight patients developed PSA failure and five of them had PSA level decrease spontaneously. Please explain the findings.11. Only one out of eight patients with PSA failure received salvage ADT. What about the other patients? Did those patients receive any other salvage therapy? Otherwise, the authors should provide the subsequent management and clinical course of those patients.Discussion section12. The authors could try to review the published literature to compare the PSA dynamics of intermediate risk prostate cancer patients receiving CIRT, CIRT with ADT, IMRT, and IMRT with ADT.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 10 Aug 2020Reviewer #1: Thank you for your review and precise suggestions. We have revised our manuscript according to your suggestions as follows: \u201cDear authors, thank you for submitting this manuscript, which I read with great interest. Please find my comments below, which I hope will be a positive contribution.Summary:This manuscript reviews the retrospective analysis of PSA failure and bounce for the patients with intermediate-risk prostate cancer treated with CIRT combined with neoadjuvant hormonal therapy at a single institution. There is limited information about PSA kinetics about CIRT combined with hormonal therapy.This reviewer has some significant concerns that need to be addressed by the authors:\u201dComments:Abstraction\u201cLine 53, 54:It would be helpful to have a more specific conclusion based on the findings of the data reported in the paper. Statements with \"investigated\" are not conclusions.\u201d We have revised the Conclusion of the Abstract. A new sentence has been added to explain our study in the Conclusion. . \u201cThis study revealed the significant predictors of PSA bounce and PSA failure.\u201d\u201cBackgroundLine 74-77:The facility's description is considered to be not directly relevant in the background. I recommend that you consider moving it to the methods paragraph.\u201d The sentence describing our facility has been moved to the Materials and Methods section. . \u201cMaterials and MethodsLine 134-135: Describe the details of dose constraints other than the rectum.\u201d V80% < 10ml for the rectum was the only dose constraint in this study. Other DVH parameters for the rectum were not used for dose constraints. We did not use dose constraints for other normal tissues, such as bladder, urethra, penile bulb, and femoral head. \u201cLine 156: Statistical Analysis Paragraph\"The correlation of clinical variables with PSA dynamics was assessed via logistic regression.\" In Table 2 and 4, was logistic regression analysis performed for both univariate and multivariate analyses? If not, please add a different test method used for univariate analysis.PSA failure and PSA bounce are both time series data and it is not appropriate to use logistic regression in the test methodIn the multivariable analysis, the number of independent variables greatly exceeds the number of occurrence events, which lead to inappropriate results. Describe the process of selecting explanatory variables.\u201dWe have revised the statistical analysis according to the comments. The Cox regression model was newly adopted for both univariate and multivariate analyses. Another reviewer suggested that we analyze the ROC curve. We have revised the manuscript to explain the statistical methods in the Materials and Methods section. . \u201cThe correlation of clinical variables with PSA dynamics was assessed via Cox regression model. Prognostic factors of which p value was calculated as < 0.10 were evaluated by multivariate stepwise Cox regression model [28]. Comparative analyses for continuous variables such as PSA level and age of the two groups were examined using the Mann\u2013Whitney U test. Receiver operating characteristic (ROC) curves were generated and used to determine the optimal cut-off value.\u201dThe results were modified using the Cox regression model. We have revised Tables 2 and 4 to reflect these changes and have revised the text to explain the new results. .\u201cIn the univariate analysis, younger age, lower T stage and higher PSA nadir were statistically significantly associated with the occurrence of a PSA bounce .\u201d\u201cThe median PSA nadir of patients with and without PSA bounces were 0.014  and 0  ng/ml, respectively (p = 0.002). In the multivariate analysis, younger age and lower T stage were significantly associated with the occurrence of a PSA bounce .\u201d\u201cIn the univariate analysis, younger age, higher pre-CIRT PSA levels, and higher PSA nadir were significantly associated with the occurrence of PSA failure .\u201d\u201cThe median PSA nadir of patients with and without PSA bounces were 0.014  and 0  ng/ml, respectively (p = 0.002).\u201dThe Cox regression model revealed that T stage was also correlated with PSA bounces, so we have added explanations of these results to the Results section.  We have also added a discussion about the relationship between T stage and PSA bounces to the Discussion section. .\u201cIn the multivariate analysis, younger age and lower T stage were significantly associated with the occurrence of a PSA bounce .\u201d\u201cIn the present study, lower T stage was significantly correlated with PSA bounce. In a study of the PSA bounce after LDR-BT, lower T stage was one of the predictive factors for PSA bounce [38]. Sengoz et al. reported that PSA bounce was more frequent in patients with T1-2 stage after external body radiation therapy [39]. The mechanism which lower T stage tended to correlate with PSA bounces was unclear. On the other hand, there were several studies suggested that T stage had no correlation with PSA bounces . Further investigation is warranted to reveal the correlation between T stage and PSA bounces.\u201dWe have added a new figure to show the ROC curves .\u201cClarify the detail about the statistical methods for differences between groups in the PSA time series used in Figures 1b and 1c.\u201dWe have revised the manuscript to clarify the statistical methods for PSA in each of the two groups. . \u201cComparative analyses for continuous variables such as PSA level and age of the two groups were examined using the Mann\u2013Whitney U test.\u201d\u201cResultsTables:Remove unnecessary gray lines in each table.\u201dThe gray lines are not shown in the PDF file. We have attached the PDF file for the tables.\u201cTable1: The sum of pretreatment PSA is not 85. Correct the number of patient numbers in each category.Table2: The results of PSA nadir is not correctly displayed.\u201dWe have revised Tables 1 and 2 accordingly.\u2003Reviewer #2: Thank you for your review and precise suggestions. We have revised our manuscript according to your suggestions as follows: \u201cGiven the fact that the clinical significance of PSA bounce is unclear and its definition is various, I think such a prospective observational study is valuable. This manuscript is very important as the first report of PSA dynamics after CIRT with neoadjuvant ADT.I have one question that there were 8 patients with PSA failure, 7 were followed up, and only 1 was treated immediately. What is the reason for this difference?\u201d We had not decided the treatment protocol after PSA failure, and each urologist determined the treatment policy for each case. We have to consider the treatment policy for the patient with PSA failure. As the results of the present study showed that PSA level decreased without treatment in many PSA failure cases, we believe that careful follow-up is important.\u2003Reviewer #3: Thank you for your review and precise suggestions. We have revised our manuscript according to your suggestions. \u201cGeneral commentsCarbon ion radiotherapy requires advanced technique and the patient number is limited compared with those who receive photon radiotherapy. The current study analyzed intermediate risk prostate cancer patients who received CIRT and ADT to illustrate the dynamics of PSA after treatment.\u201d\u201cIt is essential to further describe the intention to investigate PSA dynamics for prostate cancer after CIRT and ADT and potential clinical impact to emphasize the value of this study.\u201dSpecific commentsMaterials and methods section\u201c1. How many patients were in the favorable intermediate risk group among the 85 patients? If any, please describe the indication of neoadjuvant ADT use.\u201dThirty patients were found to be in the favorable intermediate risk group after NCCN classification. Because we used the D\u2019Amico classification in this study, intermediate risk was not divided into favorable and unfavorable groups. It is still unclear whether ADT is necessary for patients with favorable intermediate risk of prostate cancer treated by CIRT. This is a subject for future analysis.\u201c2. Please describe the ADT regimen (drug name and dosage) specifically and clarify the last dose of ADT and its active duration.\u201dWe have explained the ADT regimen in the Materials and Methods section. . \u201cWe performed a representative ADT using a combination of bicaltamide and leuprorelin acetate.\u201d\u201c3. Please explain why patients received neoadjuvant ADT of various duration (4 to 8 months) in this study. Did the authors investigate whether the duration of ADT administration was associated with the time interval of subsequent incidents of PSA bounce/PSA failure?\u201dThe ADT duration was determined by the results of previous research. We have added a reference to clarify the previous research. .The ADT duration was not associated with either PSA bounce or PSA failure (Tables 2 and 4).Statistical analysis section\u201c4. Please describe the starting date to calculate the follow-up time.\u201dWe have modified the Materials and Methods section to clarify the starting date in order to calculate the follow-up time. .\u201c5. The current study investigated the correlation between different continuous variables and PSA bounce/PSA failure. ROC curve analysis should be adopted to survey the potential cutoff value of these continuous variables.\u201dWe performed a ROC curve analysis. We have added new sentences to the Materials and Methods section to explain the statistical analysis. . \u201cReceiver operating characteristic (ROC) curves were generated and used to determine the optimal cut-off value.\u201dWe have added new figures  and sentences to explain the results of the ROC analyses. .\u201cThe ROC curve analysis calculated the area under the ROC curve (AUC) as 0.705 and determined a cut-off value of 68 years, at which the sensitivity and specificity were measured to be 76.1 and 61.5 %, respectively. )\u201d \u201cThe ROC curve analysis calculated the area under the ROC curve (AUC) as 0.844 and determined a cut-off value of 65 years, at which the sensitivity and specificity were calculated as 77.9 and 87.5 %, respectively. )\u201d\u201c6. Cox regression should be considered in multivariate analysis to investigate the effect of these variables on the time it takes for PSA bounce or PSA failure to happen.\u201dWe have revised the statistical analysis section. Cox regression model was newly adopted for both univariate and multivariate analyses. We have revised the Materials and Methods section to explain the statistical methods. .  \u201cThe correlation of clinical variables with PSA dynamics was assessed via the Cox regression analyses. Prognostic factors, for which p value was calculated as <0.10, were evaluated using the multivariate stepwise Cox regression model [28]. Comparative analyses for continuous variables, such as PSA level and age of the two groups, were examined using the Mann\u2013Whitney U test. Receiver operating characteristic (ROC) curves were generated and used to determine the optimal cut-off values.\u201dThe results were changed by the Cox regression model. We have revised Tables 2 and 4 and have added sentences to explain these results. .\u201cIn the univariate analysis, younger age, lower T stage and higher PSA nadir were statistically significantly associated with the occurrence of a PSA bounce .\u201d\u201cThe median PSA nadir of patients with and without PSA bounces were 0.014  and 0  ng/ml, respectively (p = 0.002). In the multivariate analysis, younger age and lower T stage were significantly associated with the occurrence of a PSA bounce .\u201d\u201cIn the univariate analysis, younger age, higher pre-CIRT PSA levels, and higher PSA nadir were significantly associated with the occurrence of PSA failure .\u201d\u201cThe median PSA nadir of patients with and without PSA bounces were 0.014  and 0  ng/ml, respectively (p = 0.002).\u201dThe Cox regression model revealed that T stage was also correlated with PSA bounces, so we have added sentences to explain these results in Results section.  and have added a discussion regarding the relationship between T stage and PSA bounces in the Discussion section. .\u201cIn the multivariate analysis, younger age and lower T stage were significantly associated with the occurrence of a PSA bounce .\u201d\u201cIn the present study, lower T stage was significantly correlated with PSA bounce. In a study of the PSA bounce after LDR-BT, lower T stage was one of the predictive factor for PSA bounce [38]. Sengoz et al. reported that PSA bounce was more frequent in patients with T1-2 stage after external body radiation therapy [39]. The mechanism which lower T stage tended to correlate with PSA bounces was unclear. On the other hand, there were several studies suggested that T stage had no correlation with PSA bounces . Further investigation is warranted to reveal the correlation between T stage and PSA bounces.\u201dResults section\u201c7. The median follow-up time was 33.1  months, which is relatively short for intermediate risk group prostate cancer patients.\u201dWe also believe that the short follow-up duration is a limitation in this study. A longer follow-up is warranted to reveal the clinical significance of PSA dynamics.\u201c8. Compared with conventional fractionated RT for prostate (about 7 to 8 weeks), the treatment course of 3 weeks using CIRT was relatively short. Usually, the decline of PSA after RT is gradual and it usually take several months to reach the PSA nadir. Most patients in the current study reached nadir rapidly within 3 to 4 months after CIRT. How can the authors confirm that the nadir is due to the effect of CIRT (unique RBE?) rather than effect of ADT?\u201dDarivis et al. reported the relationship between ADT and CIRT alone (ref 20). They did not mention the duration for PSA nadir, but a figure in that study demonstrated that it takes several months or more to reach PSA nadir by CIRT alone. Therefore, it is suggested that the short time to PSA nadir in the present study may be affected ADT.9. Only eight patients developed biochemical failure during follow-up of this cohort. The small number could reduce the power of statistical analysis.We also believe that the small number of patients with PSA failure is a limitation of the present study. Further investigation is warranted in the future.10. Seven of eight patients developed PSA failure and five of them had PSA level decrease spontaneously. Please explain the findings.Because clinical recurrence was not observed in any of the seven patients, careful surveillance of PSA was selected and PSA level was decreased without any salvage treatment. Several cases that met the PSA failure criteria among patients with PSA bounce have been reported in previous studies . A similar clinical course was observed in these seven patients in this study.11. Only one out of eight patients with PSA failure received salvage ADT. What about the other patients? Did those patients receive any other salvage therapy? Otherwise, the authors should provide the subsequent management and clinical course of those patients.The seven patients with PSA failure did not receive any salvage therapy. We have added the following sentence to clarify this point: \u201cNo salvage treatments were performed in these seven patients in the follow-up period.\u201d .Discussion section12. The authors could try to review the published literature to compare the PSA dynamics of intermediate risk prostate cancer patients receiving CIRT, CIRT with ADT, IMRT, and IMRT with ADT.We could not find any previous literature that investigated PSA dynamics limited to intermediate risk groups. Especially for CIRT, there has been only one study into PSA dynamics  (20). Therefore, we believe that the present study has novelty and may provide important information for both patients and physicians to understand PSA dynamics after CIRT.AttachmentResponce to Reviewers.docxSubmitted filename: Click here for additional data file. 26 Aug 2020PONE-D-20-18791R1Prostate-Specific Antigen Dynamics After Carbon Ion Radiotherapy for Prostate CancerPLOS ONEDear Dr. Takakusagi,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Oct 10 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Stephen ChunAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressedReviewer #3:\u00a0(No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Partly**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The revised version is well re-written replying the comments of the reviewers. I feel that the revised manuscript is suitable for publication.Reviewer #2:\u00a0Given the fact that the clinical significance of PSA bounce is unclear and its definition is various, I think such a prospective observational study is valuable. This manuscript is very important as the first report of PSA dynamics after CIRT with neoadjuvant ADT. I think this paper is worthy for publication.Reviewer #3:\u00a0Thank the authors for revising the manuscript; however, some problems remain in the revised manuscript.1. The topic of the manuscript is \u201cProstate-Specific Antigen Dynamics After Carbon Ion Radiotherapy for Prostate Cancer.\u201d If the authors were not able to confirm whether the PSA dynamics was due to the effect of CIRT, ADT or both, the issue of this investigation should be \u201cProstate-Specific Antigen Dynamics After Neoadjuvant ADT and CIRT for Prostate Cancer.\u201d Precisely, the study demonstrated the prostate-specific antigen dynamics after neoadjuvant androgen-deprivation therapy combined with carbon ion radiotherapy for intermediate risk prostate cancer patients.2. Table 1 demonstrated that the duration of ADT were enormously diverse with median of 6.2 months (ranging from 2.3 to 116.9 months). Essentially, this arises the concern of its potential effects on the time period for PSA bounce or PSA failure. This issue stayed unexplained in the revised manuscript.3. Only eight patients developed biochemical failure during follow-up of this cohort. The small number could reduce the power of statistical analysis, which should be estimated in the manuscript.4. Importantly, the statistical analyses have some fundamental problems even after revision. The results of the univariate analysis and Cox regression model of multivariate analysis provided in Table 2 and Table 3 were insufficient to demonstrate how those parameters were correlated with the time period for PSA bounce or PSA failure to happen. For example, if younger age and lower T stage were not clearly defined in the investigation, how did authors conclude that younger age and lower T stage were associated with the time period for PSA bounce or PSA failure to occur after CIRT?Because CIRT requires advanced techniques and the patient number is limited compared with those who receive photon radiotherapy, this requires careful statistical analysis to investigate PSA dynamics to confirm its clinical impact.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 9 Sep 2020Reviewer #1: The revised version is well re-written replying the comments of the reviewers. I feel that the revised manuscript is suitable for publication. We thank the reviewer for evaluating our manuscript and for their encouraging comments.Reviewer #2: Given the fact that the clinical significance of PSA bounce is unclear and its definition is various, I think such a prospective observational study is valuable. This manuscript is very important as the first report of PSA dynamics after CIRT with neoadjuvant ADT. I think this paper is worthy for publication. We appreciate the reviewer\u2019s feedback and are elated to hear this news.Reviewer #3: Thank the authors for revising the manuscript; however, some problems remain in the revised manuscript.We thank the reviewer for evaluating our manuscript. According to the suggestions, we have revised the manuscript as follows.1. The topic of the manuscript is \u201cProstate-Specific Antigen Dynamics After Carbon Ion Radiotherapy for Prostate Cancer.\u201d If the authors were not able to confirm whether the PSA dynamics was due to the effect of CIRT, ADT or both, the issue of this investigation should be \u201cProstate-Specific Antigen Dynamics After Neoadjuvant ADT and CIRT for Prostate Cancer.\u201d Precisely, the study demonstrated the prostate-specific antigen dynamics after neoadjuvant androgen-deprivation therapy combined with carbon ion radiotherapy for intermediate risk prostate cancer patients.We have revised the title to \u201cProstate-Specific Antigen Dynamics After Neoadjuvant Androgen-Deprivation Therapy and Carbon Ion Radiotherapy for Prostate Cancer,\u201d as per their insight .2. Table 1 demonstrated that the duration of ADT were enormously diverse with median of 6.2 months (ranging from 2.3 to 116.9 months). Essentially, this arises the concern of its potential effects on the time period for PSA bounce or PSA failure. This issue stayed unexplained in the revised manuscript.Tables 2 and 3 demonstrate that the ADT duration was not associated with the occurrence of PSA bounce and failure. This has been delineated in the Results section as follows: ADT duration was not correlated with the occurrence of PSA bounce (p = 0.731) .ADT duration was not correlated with the occurrence of PSA failure (p = 0.614) .3. Only eight patients developed biochemical failure during follow-up of this cohort. The small number could reduce the power of statistical analysis, which should be estimated in the manuscript.We agree with the reviewer\u2019s comment that this small number of patients has contributed to a reduction of statistical power. We have acknowledged this as a limitation of our study, which is as follows:In particular, the small number of PSA failure cases could reduce the power of the statistical analysis . 4. Importantly, the statistical analyses have some fundamental problems even after revision. The results of the univariate analysis and Cox regression model of multivariate analysis provided in Table 2 and Table 3 were insufficient to demonstrate how those parameters were correlated with the time period for PSA bounce or PSA failure to happen. For example, if younger age and lower T stage were not clearly defined in the investigation, how did authors conclude that younger age and lower T stage were associated with the time period for PSA bounce or PSA failure to occur after CIRT?Because CIRT requires advanced techniques and the patient number is limited compared with those who receive photon radiotherapy, this requires careful statistical analysis to investigate PSA dynamics to confirm its clinical impact.In the present study, we solely aimed to determine the occurrence of PSA bounce, PSA failure, and related clinical factors; elucidation of the time period for PSA bounce or failure to occur was beyond the scope of this study. This has been stated in the manuscript as follows: In this study, we identified the significant predictors of the occurrence of PSA bounce and failure. .The occurrence of PSA bounce and failure was correlated with younger age. .AttachmentResponce to reviwers.docxSubmitted filename: Click here for additional data file. 12 Oct 2020PONE-D-20-18791R2Prostate-Specific Antigen Dynamics After\u00a0Neoadjuvant Androgen-Deprivation Therapy and\u00a0Carbon\u00a0Ion Radiotherapy for Prostate CancerPLOS ONEDear Dr. Takakusagi,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Nov 26 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Stephen ChunAcademic EditorPLOS ONEAdditional Editor Comments (if provided):After additional statistical review, with minor revisions as suggested by Reviewer #4 to clarify methodology, this manuscript will be acceptable for publication.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #4:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #4:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #4:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #4:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #4:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #4:\u00a0In the statistical analysis section, authors should give details on how the ROC curves were used to generate the optimal cutoffs (was it from univariable model? Or multivariable model?) or list any appropriate reference articles.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 16 Oct 2020Reviewer #4: We thank the reviewer for evaluating our manuscript. According to the suggestions, we have revised the manuscript as follows.\u201cIn the statistical analysis section, authors should give details on how the ROC curves were used to generate the optimal cutoffs (was it from univariable model? Or multivariable model?) or list any appropriate reference articles.\u201dWe used Youden index to determine the optimal cut-off value. We have revised the statistical analysis section to clarify how the cut off value was generated  and a new reference have been added (ref number 29)\u201cNon-parametric receiver operating characteristic (ROC) curves were generated and Youden index (J = max [sensitivity + specificity \u2013 1]) was used to determine the optimal cut-off values [29].\u201d\u201c29) Conroy AL, Liles WC, Molyneux ME, Rogerson SJ, Kain KC. Performance characteristics of combinations of host biomarkers to identify women with occult placental malaria: a case-control study from Malawi. PLoS One. 2011;6(12)\u201dAttachmentResponce to reviwer.docxSubmitted filename: Click here for additional data file. 19 Oct 2020Prostate-Specific Antigen Dynamics After\u00a0Neoadjuvant Androgen-Deprivation Therapy and\u00a0Carbon\u00a0Ion Radiotherapy for Prostate CancerPONE-D-20-18791R3Dear Dr. Takakusagi,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Stephen ChunAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 28 Oct 2020PONE-D-20-18791R3 Prostate-Specific Antigen Dynamics After\u00a0Neoadjuvant Androgen-Deprivation Therapy and\u00a0Carbon\u00a0Ion Radiotherapy for Prostate Cancer Dear Dr. Takakusagi:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Stephen Chun Academic EditorPLOS ONE"}
+{"text": "The automatic formal verification of multiplier designs has been pursued since the introduction of BDDs. We present a new rewriter-based method for efficient and automatic verification of signed and unsigned integer multiplier designs. We have proved the soundness of this method using the ACL2 theorem prover, and we can verify integer multiplier designs with various architectures automatically, including Wallace, Dadda, and 4-to-2 compressor trees, designed with Booth encoding and various types of final stage adders. Our experiments have shown that our approach scales well in terms of time and memory. With our method, we can confirm the correctness of  Arithmetic circuit designs may contain bugs that may not be detected through random testing. Since the Pentium FDIV bug\u00a0, formal There have been numerous efforts to find a scalable and automated method to formally verify integer multipliers. Early methods that were based on attempts to represent hardware and its specification in various canonical forms - BDDs\u00a0 and deriThere are several approaches for the verification of hardware multipliers used in the industry. One is based on writing a simple RTL multiplier design without optimizations and comparing it to the candidate multiplier design through equivalence checking\u00a0, 35. ThiIn recent years, the search for more automatic procedures resulted in methods based on symbolic computational algebra\u00a0, 23, 40 widely applicable,provably correct, andscalableWe have developed an automatic rewriter-based method for verification of hardware integer multipliers that isWe implemented and verified our method with the ACL2 theorem proving system, which is a subset of the LISP programming language. Our method is not ACL2 specific and can be adapted to other platforms with suitable adjustments. In this paper, we also provide proof of its termination. Even though we have not proved the completeness of this method, our tool can verify various multiplier designs. We test our method on designs implemented with (System)\u00a0Verilog where design hierarchy is maintained. We can verify various types of multipliers in a favorable time; for example, we tested our method with 8 different types of The paper is structured as follows. In Sect.\u00a0In this section, we describe the concepts and tools required to understand the method proposed in this paper. We review the ACL2 theorem prover and term rewriting, how Verilog designs are translated and used in proofs, and various integer multiplier architectures.ACL2 is a LISP-based interactive theorem prover that can be used to model computer systems and prove properties about such models using both its internal procedures as well as appealing to external tools such as SAT and SMT solvers. ACL2 is used by the industry for both software and hardware verification\u00a0. Our metrewrite rules, and later use them when attempting to confirm other conjectures. ACL2 terms are prefix expressions and rewriting is attempted on terms such as. Left-hand side of a rewrite rule is unified with terms; in case of a successful unification, the matched term is replaced by a properly instantiated right-hand side if all hypotheses are satisfied. Example\u00a0event, ACL2 attempts to confirm the conjecture by rewriting it in an inside-out manner. For the conjecture given in, the rewriter replaces (+\u00a0x\u00a0(-\u00a0x)) and (+\u00a0y\u00a0(-\u00a0y)) with 0 using a-a as a lemma. Then the resulting term (+\u00a00\u00a00) is replaced with 0 using the executable counterpart of the function +.ACL2 can store proved lemmas as , and a theoremproved subsequently usingas a lemma. A simple rewrite ruleThe rewriting mechanism in ACL2 is much more complex and intricate than we indicate here\u00a0. ThroughSVL netlists in ACL2 and use SVL functions for semantics and simulation of circuit designs\u00a0[SV\u00a0[VL\u00a0[We convert (System) Verilog designs to designs\u00a0. SVL netns\u00a0[SV\u00a0 and VL\u00a0SV\u00a0[VL\u00a0 tools thSV\u00a0[VL\u00a0. In thisAn SVL netlist is an association list where each key is a module name, and its corresponding value is the definition of the module. An SVL module is composed of input and output signals, and a list of occurrences. An occurrence can be an assignment or an instantiation of another module. Example\u00a0SVL netlist for half and full-adder. An . This function traverses occurrences of a module and simulates them in order by evaluating the assignments and making a recursive call for the submodules. After each occurrence, the values of wires/signals are stored in an association list, and when finished,retrieves and returns the values of output signals from this association list. These values can be concrete (svl-run is executed), or symbolic , which can create ACL2 expressions representing the functionality of the design for each output. For example, we can generate expressions for the outputs of the full-adder (\"fa\") in Example\u00a0and. Alternatively, since the design retains hierarchy, submodules can be replaced by their specification. For example, assume that we have specification functionsandfor each output of the half-adder (\"ha\"), and we proved a rewrite rule to replace calls of svl-run of \"ha\" with these functions. If we rewrite the instantiations of \"ha\" with this rule while expanding the definition of \"fa\", we can instead getandfor each output of \"fa\".The semantics of an SVL netlist is given by a recursively defined ACL2 function,generation algorithms, such as Booth encoding, and partial-product summation algorithms, such as Wallace-tree. Even though the applicability of our verification method is not confined to a specific set of algorithms, reviewing them is beneficial for understanding the verification problem.In this section, we discuss the most commonly used algorithms to implement integer multipliers. We summarize partial-product We can divide multiplier designs into two main components: partial product generation and summation. Figure\u00a0Baugh-Wooley\u00a0 and BootA rudimentary way to sum partial products is by using a shift-and-add algorithm. One may use an accumulator and a vector adder such as a ripple-carry adder to shift and add partial products. An array multiplier is a variation of this algorithm and it is implemented using a very similar principle with some additional optimizations. Due to their regular structure, verifying the correctness of these multipliers has not been a challenging problem\u00a0. HoweverA family of partial product summation algorithms, which are often called Wallace-tree like multipliers\u00a0, use parWe aim to prove the functional correctness of signed and unsigned multiplier designs. We do that by proving an ACL2 theorem demonstrating the equivalence of semantics of a multiplier circuit design to the built-in ACL2 multiplication function (*) with appropriate sign extensions and truncations.m-bit and n-bit numbers, then the first and 3-bit vector, respectively. Then, a correct multiplier would return the 7-bit vector, which represents -12.We work with integer multiplier circuits that are designed to multiply two numbers (signed or unsigned) stored in bit-vectors and cut (truncate) the resulting number to return it as a bit-vector. If we are multiplying a and b are variables and a and b, simulating an m-by-n signed multiplier circuit returns a value that is equivalent to multiplication of sign-extended a and b, truncated at is an ACL2 constant that contains the multiplier design in SVL format which is translated from (System) Verilog, andis the function to simulate this module with inputs a and b. On the right-hand side, * is the built-in integer multiplication function,returns first returns a number that represents the sign-extended value of a bit-vector. Multiplier designs are implemented with fixed values of m and n; therefore, we prove such theorems for constants m and n and variables a and b. The ACL2 theorem for unsigned multiplication has the same form but in the place of, we use thefunction, which performs zero-extension. The actual statement of the theorem contains more components than shown, including function calls to extract outputs and parameters for state-holding elements; we only give the essentials for brevity.Listing\u00a01.1 shows the final ACL2 theorem we prove for signed integer multipliers, where The correctness theorem given in Listing\u00a01.1 is proved by rewriting both sides of the equality to two syntactically equivalent terms. In this section, we describe our methodology to rewrite both sides to a specific form through an automated rewriting mechanism.a and b are the inputs/operands of multiplication with a certain size , we define a measure calculated on the term and show that it decreases every time we rewrite with one of our lemmas. We first define the measure for simplifying adder modules Lemmas\u00a0\u20133. Sinces, c, and The first part of our multiplier verification algorithm is simplifying the logic in adder components and rewriting them in terms of the mentclass2pt{minim. Function . Function For example, computing We define a measure The pairs produced by mentclass2pt{minimRewriting for summation tree and partial product generation algorithms are performed together with a rewriting algorithm derived with Lemmas\u00a0. Function For example, computing . Function c, the second occurrence of For example, computing We define measure The value of x is unified with a term that contains a negative minterm, then the value of s, rewriting with both lemmas decreases Rewriting with Lemmas\u00a0d, c, Rewriting with Lemmas\u00a0x can only be unified with a positive minterm. Therefore, rewriting with these lemmas does not change x is unified with a negative minterm, then Rewriting with Lemmas\u00a0mentclasspt{minimaIn short, rewriting with Lemmas\u00a0http://mtemel.com/mult.html.In this section, we present our experimental results and compare them to the other state-of-the-art tools for the automated verification of multiplier designs. We have gathered a large set of multipliers from 3 different generators, and run all the experiments for other verification tools and ours on the same computer (A 2014 model iMac Intel(R) Core(TM) i7-4790K CPU @ 4.00 GHz with 32 GB system memory) for comparison. The instructions and a ready-to-run VM image to run our tool and reproduce these experimental results can be found online at SCA-genmul\u00a0[For benchmarking, we used 3 different generators. The tool from Homma et al.\u00a0 generate-genmul\u00a0 to gener-genmul\u00a0 that canWe have measured the complete proof time for each benchmark, when available, and compared our results to the work of D. Kaufmann et al.\u00a0 and A. MWhen we run our tool on these benchmarks, we only need to identify the names of the adder modules, their I/O size; multiplier I/O size, and whether they perform signed or unsigned multiplication in order to determine their specification. The proofs finish automatically, and users can see the specification explicitly to validate what is proved. The other tools are not interactive and use some heuristics to decide on the specification internally based on the design.D. Kaufmann et al.\u00a0 and A. Mtem\u00a0[sca\u00a0[hom\u00a0[sp (simple unsigned/signed or Baugh-Wooley-based), and bp (unsigned and signed Booth radix-4 encoded). Summation tree algorithms are dt (Dadda tree), wt , cwt , ar (array), os (overturned-stairs tree), bdt , and 4:2 (4-to-2 compressor tree). Finally, the final stage adders are bk (Brent-Kung), lf (Ladner-Fischer), rc (Ripple-carry), ks (Kogge Stone), csk (Carry-skip), hc (Han-Carlson), and cla (Carry-lookahead). The selection of benchmarks was arbitrary but we have concentrated on Wallace-tree-like multipliers with complex final stage adders as they have a more widespread industrial application. For experiments with 64 Table\u00a0tem\u00a0, sca\u00a0[2m\u00a0[sca\u00a0, and homa\u00a0[hom\u00a0. PartialFor all the benchmarks we have tested, our tool out-performed the other tools in all cases. Our method is shown to verify benchmarks the others cannot and produce a more homogeneous timing performance across different designs. A. Mahzoon et al.\u00a0 work onlAdditionally, since integer multipliers are used to implement floating-point operations, we tested our method in a correctness proof for an implementation of a floating-point multiply-add instruction for Centaur Technology, and we got similar results.Having described our method, we now compare it with the related work. Well-known methods to verify multipliers include generic reasoning methods such as BDDs and SAT solvers. However, these tools do not scale well with large multipliers. For the last few years, efforts to verify large integer multipliers have explored the symbolic computer algebra approach based on Gr\u00f6bner basis\u00a0, 28, 37.When a proof fails for a multiplier design, our tool does not output a user-friendly message. We will work to improve our tool to process the resulting terms from failed verification attempts and generate counterexamples for incorrect designs.In this paper, we have presented an efficient method with a proven tool to verify large and complex integer multipliers. With maintained circuit hierarchy, we can automatically verify very irregular multiplier designs; for example, various"}
+{"text": "CH) with copper sulfate (4CuSO) on growth, carcass characteristics, tibia traits and mineral concentration in broilers fed a conventional wheat-soybean meal\u2013based diet. Day-old Ross 308 male chicks (n\u00a0=\u00a0864) were randomly assigned into 8 dietary treatments with 6 replicates of 18 chicks per treatment. The dietary treatments included a basal diet containing no supplemental copper (Cu) serving as the negative control (NC); basal diet supplemented with 15 or 200\u00a0mg/kg Cu as CuSO4; basal diet supplemented with either 15, 50, 100, 150, or 200\u00a0mg/kg Cu from CH. Diets were fed over the starter (day 1\u201314) and grower (day 14\u201335) phases. Birds in the NC group gained the same body weight and had similar feed conversion ratio (FCR) to birds receiving 15\u00a0mg/kg Cu as CuSO4, but birds receiving 15\u00a0mg/kg Cu as CH had a lower FCR than the NC birds . Birds fed 200\u00a0mg/kg Cu as CH gained more weight (77\u00a0g/bird) and had a lower FCR (3.2 point) compared with those fed 200\u00a0mg/kg Cu as CuSO4 (P\u00a0<\u00a00.01). Based on broken-line regression models, the optimum inclusion level of Cu as CH in the diet for optimal body weight gain and FCR were estimated to be 109.5 and 72.3\u00a0mg/kg, respectively (P\u00a0<\u00a00.001). Carcass characteristics were not affected by dietary Cu sources or levels (P\u00a0>\u00a00.05). The highest and lowest tibia ash content were observed in birds fed diet with 150\u00a0mg/kg Cu as CH and 200\u00a0mg/kg Cu as CuSO4, respectively (P\u00a0<\u00a00.05). Supplementation with 200\u00a0mg/kg Cu as CH resulted in higher duodenal mucosa Cu content compared with the diet containing 200\u00a0mg/kg Cu as CuSO4 (P\u00a0<\u00a00.001). In conclusion, supplementation of Cu from CH was more efficacious than CuSO4 in promoting growth performance, both at nutritional and pharmacological levels.This study was designed to compare the effects of nutritional and growth-promoting levels of copper hydroxychloride ( AGP) in poultry production. However, the risk of bacteria becoming resistant to certain antibiotics has led the poultry industry to look for alternatives to AGP possessing antimicrobial properties which can maintain intestinal health and improve growth performance (Cu) has been reported to have antimicrobial properties when used at doses higher than the required nutritional levels (BGW) and feed efficiency in broiler chickens.Antibiotics have long been used at subtherapeutic levels as antibiotic growth promoters . Sulfate molecules are highly reactive in the presence of moisture and can easily break down both in the feed and the upper gastrointestinal tract, releasing reactive free Cu ions which can bind other dietary nutrients such as vitamins, fats, and enzymes, consequently hindering the bioavailability of both Cu and such nutrients  is an inorganic source of Cu, which is less soluble in water but is soluble in acidic solutions when compared with Cu sulfate , 50, 100, 150, or 200\u00a0mg/kg (as growth-promoting doses) Cu as CH . The broiler chicks received the wheat-soybean meal\u2013based experimental diets in 2 phases from day 1 to 14 (starter) and day 14 to 35 (grower). All pens were checked for mortality twice daily and feed intake (FI) was corrected for mortality for each period.The birds were randomly assigned into 8 dietary treatments, each replicated 6 times, with 18 chicks per replicate. The dietary treatments met the nutrient specifications of the strain, as recommended by the Ross 308 guidelines . The 8 dFCR), and livability rate were measured for the starter (1\u201314\u00a0d), grower (14\u201335\u00a0d), and the entire experimental period (1\u201335\u00a0d).Performance parameters including FI, BGW, feed conversion ratio . Blood samples were centrifuged at 3,000\u00a0\u00d7\u00a0On day 35, 3 randomly selected birds were slaughtered to collect the right tibia and to measure carcass traits. The tibiae were collected after the procedure applied on day 14, and all tibiae were used to measure breaking strength and to determine ash content and mineral concentration. Carcass parts including the breast meat, thigh, fat pad, liver, gizzard, pancreas, bursa, and spleen were removed and weighed, and weights were expressed as g/100\u00a0g live body weight. In addition, the same birds were used to evaluate footpad dermatitis and hock burns (lesions) on both feet. Any signs of footpad dermatitis were scored from 0 to 9 for footpads  and 0 toICP-OES) .The mineral content in the diets and premixes, tibia, and duodenal mucosa was determined using an inductively coupled plasma\u2013optical emission spectrometer  were collected and ground into fine particles (0.5\u00a0mm) for analysis of Cu concentration in duplicate. Then 0.5\u00a0g of each diet sample was weighed into white Teflon tubes  and then digested in 1\u00a0mL distilled water and 4\u00a0mL concentrated HCl (70%) in an Ultrawave Microwave Digestion system . The digested samples were diluted with distilled water to a volume of 25\u00a0mL in a 30\u00a0mL volumetric flask for analysis of mineral concentration by ICP-OES instrument.The tibiae were subjected to breaking strength using an Instron instrument  set up with a 300\u00a0kN load cell and 3 point fixture bed, at a test speed of 10 points of data per second and run using Blue Hill 3 software. The tibia bones were then dried at 105\u00b0C for 24\u00a0h in a drying oven  to determine dry mass, and ashed in a chamber furnace  at 600\u00b0C for 6\u00a0h. Then 0.1\u00a0g of each ash sample was weighed for analysis of mineral concentration by ICP-OES technique (as described above). The tibia mineral content was calculated as a proportion of the crude ash.Duodenal mucosal samples were freeze-dried at \u221250\u00b0C for 1\u00a0wk in a freeze-drying system  and passed through a 0.5\u00a0mm screen. Then 0.5\u00a0g of dried mucosa sample was weighed for analysis of Cu concentration by the ICP-OES technique.Serum Cu concentration was determined colorimetrically using a commercial kit , in accordance with the manufacturer's protocol, followed by running the plate reader in a spectrophotometer .n\u00a0=\u00a048). Tukey's HSD test was used to make pairwise comparisons between means, when a significant effect of treatment was detected. Significant values are based on P\u00a0\u2264\u00a00.05, with a trend suggested at P\u00a0>\u00a00.05 but <0.10. Orthogonal contrasts were made to detect statistical significances between treatment means of the 200\u00a0mg/kg CuSO4\u2013supplemented group vs. CH\u2013supplemented groups, and the NC group vs. 15\u00a0mg/kg CuSO4\u2013 and 15\u00a0mg/kg CH\u2013supplemented groups. The optimum Cu levels from CH for the optimal weight gain and feed efficiency was determined using linear broken-lines regression analysis following the method of All data were checked for normal distribution before conducting statistical analysis using the UNIVARIATE procedure of SAS 9.3 . Data weNC) was 9.1\u00a0mg/kg for the starter phase and 7.6\u00a0mg/kg for the grower phase . The greatest BWG and lowest FCR were observed in birds fed the 200\u00a0mg/kg CH treatment, followed by the 100\u00a0mg/kg CH group (P\u00a0<\u00a00.01). Birds receiving 200\u00a0mg/kg CH had statistically higher weight gain (77\u00a0g) and lower FCR (3.2 points) compared with the birds receiving CuSO4 at 200\u00a0mg/kg (P\u00a0<\u00a00.01), as revealed by orthogonal contrast comparisons. No significant differences in FI were detected in either the starter or grower periods (P\u00a0>\u00a00.05). Orthogonal contrast analysis did not reveal any statistical differences between birds receiving NC with 15\u00a0mg/kg Cu as CuSO4 or 15\u00a0mg/kg as CH for any parameters measured during the starter or grower periods (P\u00a0>\u00a00.05). However, over the entire production period, birds in the 15\u00a0mg/kg CH group had lower FCR than the NC group (P\u00a0=\u00a00.013). Dietary inclusion of 15\u00a0mg/kg CH vs. 15\u00a0mg/kg CuSO4 resulted in higher final BWG and lower FCR (P\u00a0<\u00a00.05). Supplementation of 100 or 150\u00a0mg/kg CH compared with 200\u00a0mg/kg CuSO4 did not affect BWG but significantly improved FCR during the grower and entire production periods (P\u00a0<\u00a00.001).P\u00a0<\u00a00.001), respectively.Based on fitted broken-line models for performance parameters , the preP\u00a0>\u00a00.05).In accordance with the results presented in P\u00a0=\u00a00.059) to influence tibia-breaking strength on day 35 of age, with birds in NC and 200\u00a0mg/kg CH\u2013supplemented diets recording the lowest and the highest breaking strength values, respectively. A significant effect (P\u00a0<\u00a00.05) of the treatments on tibia bone ash was detected only on day 14, where birds in the 150\u00a0mg/kg CH group recorded the highest ash percentage (P\u00a0<\u00a00.05). Diet supplementation with CH at 200\u00a0mg/kg resulted in a significant increase (P\u00a0<\u00a00.05) in tibia bone Cu content compared with the NC diet on day 14. Birds fed the low Cu diets, including the negative control and diets with CH and CuSO4 at 15\u00a0mg/kg, deposited less Mn (\u03bcg/g) in the tibia on day 35 (P\u00a0<\u00a00.01). The concentration of other minerals in the tibia, including Zn, Ca, and P, were not significantly affected by the dietary treatments (P\u00a0>\u00a00.05).Data on tibia-breaking strength and mineral composition determined on day 14 and 35 are presented in P\u00a0<\u00a00.01; 4 at a level of 200\u00a0mg/kg compared with those with 50 and 100\u00a0mg/kg Cu from CH (P\u00a0<\u00a00.001). The duodenal content of Zn, Mn, Fe, Ca, P, Mg, and Na was not different among the treatments (P\u00a0>\u00a00.05). No significant differences were observed in serum Cu concentration (P\u00a0>\u00a00.05).Corresponding to the dietary Cu levels, duodenal mucosa Cu content increased with increasing supplemental Cu  recommended for broilers by the th CuSO4 . Hooge e4 at 200\u00a0mg/kg. This result is in agreement with the findings of 4. Moreover, the growth-stimulation effects of Cu could be attributed to the changes in the gastrointestinal microbiota, thereby reducing the susceptibility of birds to disease, reducing intestinal lymphocyte recruitment and infiltration, and subsequently increasing nutrient absorption . 4 (15\u00a0mg/kg) and Zn sulfate (20 or 80\u00a0mg/kg). This may be related to the antimicrobial effects of Cu against pathogenic bacteria, which leads to an increase in nutrient absorption and thus higher protein accretion  and pharmacological levels (up to 200\u00a0mg/kg), through enhancing growth rate and feed efficiency. The optimum Cu inclusion from CH in the diet for optimal BGW and FCR was estimated to be 109.5 and 72.3\u00a0mg/kg feed, respectively. The mineral profile of the tibia and duodenal mucosa suggest that the inclusion of high dietary copper either from CH or copper sulfate up to 200\u00a0mg/kg does not compromise the bioavailability and absorption of other minerals. A diet with no supplemental copper may not adversely affect footpad lesions and carcass yield; however, it may compromise tibia-breaking strength particularly in older birds."}
+{"text": "Streptococcus canis is a common colonizing bacterium of the urogenital tract of cats and dogs that can also cause invasive disease in these animal populations and in humans. Although the virulence mechanisms of S. canis are not well-characterized, an M-like protein, SCM, has recently identified been as a potential virulence factor. SCM is a surface-associated protein that binds to host plasminogen and IgGs suggesting its possible importance in host-pathogen interactions. In this study, we developed in vitro and ex vivo blood component models and murine models of S. canis vaginal colonization, systemic infection, and dermal infection to compare the virulence potential of the zoonotic S. canis vaginal isolate G361 and its isogenic SCM-deficient mutant (G361\u2206scm). We found that while S. canis establishes vaginal colonization and causes invasive disease in vivo, the contribution of the SCM protein to virulence phenotypes in these models is modest. We conclude that SCM is dispensable for invasive disease in murine models and for resistance to human blood components ex vivo, but may contribute to mucosal persistence, highlighting a potential contribution to the recently appreciated genetic diversity of SCM across strains and hosts. Streptococcus canis is a Gram-positive beta-hemolytic group G Streptococcus that colonizes the epithelial, respiratory, gastrointestinal, and urogenital surfaces of cats and dogs [S. canis is well-recognized in veterinary medicine for causing a variety of invasive diseases across domestic animal species including sepsis, necrotizing fasciitis, urinary tract infection, ulcerative keratitis, and mastitis [S. canis colonization and disease manifestations have been reported in wild animal populations [S. canis-mediated endocarditis, septicemia, cellulitis, and periprosthetic joint infection have been reported [S. canis as the causative agent in ~1% of human streptococcal infections, however, given the reliance of Lancefield classification for group G Streptococcus identification without further speciation, coupled with close interactions between humans and companion animals, it is likely that S. canis human infections are underestimated [and dogs ,2,3. Offmastitis ,6,7,8,9.ulations ,11,12. Sulations , human creported ,19,20,21stimated ,23.S. canis is being actively explored. There are currently more than 50 multi-locus sequence types (MLST) and 20 genomes for S. canis [S. canis is not well-described, yet the pyogenic nature of many S. canis soft tissue infections suggest neutrophils and macrophages may be involved. To date, knowledge of S. canis virulence factors remains limited, and is largely extrapolated from genetic similarities to the widely-studied group A Streptococcus (S. pyogenes) [S. pyogenes, S. canis possesses an arginine deiminase system [S. canis virulence factors [The genetic diversity and molecular pathogenesis of S. canis ,24. The yogenes) . Similare system , a strepe system , lysogene system , and an e system , which i factors .S. pyogenes, the M protein, which is genetically diverse with more than 200 emm types, serves multiple roles in pathogenesis and immune evasion [S. canis SCM displays genetic heterogeneity. There are currently 15 SCM types divided into group I and II alleles [S. canis colonization and virulence remains undefined.In  evasion . Likewis alleles . SCM is  alleles  which bi alleles  and the  alleles . We rece alleles . HoweverS. canis vaginal colonization, systemic infection, and dermal infection to broadly characterize the virulence potential of the zoonotic S. canis vaginal isolate G361, originally isolated from a 40-year-old female, and its isogenic SCM-deficient mutant (G361\u2206scm).In this study, we incorporated in vitro and ex vivo human blood component models, together with murine models of Streptococcus canis human vaginal wildtype (WT) isolate G361 [scm-targeted insertional mutant G361\u2206scm [Streptococcus pyogenes human invasive isolate 5448 M1 and isogenic \u0394emm1 [Streptococcus agalactiae human meningeal isolate COH1 (ATCC BAA-1176). All bacterial strains were grown to stationary phase in Todd-Hewitt broth , or THB agar plates, at 37 \u00b0C without shaking. Erythromycin (5 \u00b5g/mL) was added to G361\u2206scm to retain the plasmid insertion. Cultures were diluted in fresh THB and incubated at 37 \u00b0C until mid-logarithmic phase (defined as OD600 = 0.4). For growth curves, stationary cultures were diluted to OD600 = 0.1 in either fresh THB or RPMI-1640 (Gibco) and incubated at 37 \u00b0C for 3 h with optical density measured every 30 min. To assess hemolytic activity, WT G361 and G361\u2206scm were grown overnight and 10 \u00b5L was spotted onto blood agar plates  and incubated for 24 h at 37 \u00b0C with 5% CO2. For minimum inhibitory concentrations (MIC), mid-log phase S. canis was diluted 1:100 in THB and 100 \u00b5L was added to 96-well microtiter plates. Hydrogen peroxide or hypochlorite  was diluted in THB and 100 \u00b5L was added to the bacterial plates . The plates were then incubated at 37 \u00b0C for 18 h and OD600 was measured to determine MIC values .Bacterial strains used in this study include ate G361  and isogG361\u2206scm , Streptoic \u0394emm1 , and StrS. canis and S. pyogenes biofilms were assessed using methods adapted from previous work [600 = 0.1, and 200 \u00b5L added to tissue culture-treated 96-well plates. Biofilms were allowed to form for 48 h at 37 \u00b0C without shaking. After washing 3X with PBS, biofilms were stained with 1\u03bcM SYTO 13 nucleic acid stain (Invitrogen) for 30 min in the dark. Biofilms were then washed 3X with PBS and quantified by measuring fluorescence at OD485/OD520 on an Infinite 200 Pro (Tecan) plate reader. Fluorescent images of biofilms were also collected using an Echo Revolve microscope at 100X magnification.ous work . Briefly2. Adherent cells were split every 3\u20134 days at ~80% confluency, and 0.25% trypsin/2.21mM EDTA (Corning) were used to detach DH82 and VK2 cells for passaging. HEK-Blue IL-1\u03b2 indicator cells were detached with calcium- and magnesium-free sterile PBS.Canine macrophage-like cells (DH82), immortalized human vaginal epithelial cells (VK2/E6E7), and human monocyte cell line (THP-1) were acquired from the American Type Culture Collection . HEK-Blue IL-1\u03b2 cells (Cat# hkb-il1b) were purchased from InvivoGen. DH82 cells were cultured in Eagle\u2019s Minimum Essential Medium (EMEM) (Gibco) + 15% FBS (heat inactivated). VK2 cells were cultured in keratinocyte serum-free medium (KSFM) (Gibco) with 0.5 ng/mL human recombinant epidermal growth factor and 0.05 mg/mL bovine pituitary extract. THP-1 cells were grown in suspension in the following media: RPMI-1640 (Gibco) + 10% FBS (heat inactivated) + 10 mM HEPES + 1 mM sodium pyruvate + 4500 mg/L glucose + 1500 \u03bcg/mL sodium bicarbonate + 0.05 mM 2-mercaptoethanol. When macrophage differentiation was necessary, the cells were treated for 24 h with 25 nM phorbol myristate acetate (PMA) to produce an adherent culture. HEK-Blue IL-1\u03b2 cells were grown in adherent culture in Dulbecco\u2019s Modified Eagle Medium (DMEM) with L-glutamine (Gibco) + 10% FBS (heat inactivated) + 200 \u03bcg/mL HygromycinB (InvivoGen) + 100 \u03bcg/mL Zeocin (Invitrogen). All cells were cultured in a 37 \u00b0C incubator with 5% COUnder approval from UC San Diego and Cedars-Sinai Medical Center Institutional Review Boards (Protocol # 131002), venous blood was obtained after informed consent from healthy adult volunteers, with heparin as an anticoagulant for whole blood and neutrophil studies. Neutrophils were isolated as described previously  using Po4 cells per well. THP-1 cells were differentiated to macrophages, as described above. The following day S. canis was diluted in PBS and added to the macrophages at multiplicity of infection (MOI) = 1. The culture plates were centrifuged for 5 min at 300\u00d7 g to facilitate bacterial contact, and then plates were incubated at 30 min at 37 \u00b0C in 5% CO2. At the end of incubation, the supernatant was removed, and the macrophages were rinsed once with PBS before being lysed with water, serially diluted, and plated on THB agar. For human neutrophil killing assays, neutrophils were diluted to 2 \u00d7 106 cells/mL in RPMI-1640 and seeded at 2 \u00d7 105 cells/well in 96-well tissue culture plates. S. canis was diluted in RPMI-1640 was added to neutrophils at MOI = 1. Plates were centrifuged at 300\u00d7 g for 5 min to facilitate bacterial contact with neutrophils, and then incubated at 37 \u00b0C in 5% CO2 for 30 min or 60 min. Samples were lysed with water, serially diluted, and then plated on THB agar. For human and murine whole-blood killing assays, 90 \u00b5L of whole blood  and 10 \u00b5L containing 1 \u00d7 105 colony-forming units (CFU) of S. canis were incubated at 37 \u00b0C with rotation for 30 min or 60 min, and plated on THB agar. In all assays, S. canis survival was calculated as a percentage of the inoculum.Bacterial killing assays were modified from previous work ,36,37. FS. canis at MOI = 10 suspended in HBSS with calcium and magnesium. Plates were incubated at 37 \u00b0C with 5% CO2 for 120 min, and every 20 min, fluorescence intensity (485 nm excitation/530 nm emission) was measured using an EnSpire Multimode Plate Reader (PerkinElmer). Samples were normalized to fold change of fluorescence signal of time = 0.Induction of reactive oxygen species release from DH82 cells was adapted from previous work . Briefly2 with 50 \u03bcL of supernatants from THP-1 macrophages previously infected with S. canis or S. pyogenes at MOI = 1 for 30 min. After 18 h, supernatants from the HEK-Blue cells were analyzed for secreted alkaline phosphatase activity by the addition of 50 \u03bcL of HEK-Blue supernatants onto 150 \u03bcL of Quanti-Blue reagent (Invivogen) and monitoring the optical density at 620 nm via an EnSpire Multimode Plate Reader. Four independent replicate experiments were performed, and data compiled and expressed as relative units normalized to the mean optical density for the GAS group across all four experiments.Detection of THP-1 cell IL-1\u03b2 release was measured as adapted from prior work . HEK-BluS. canis or S. agalactiae at MOI = 1 (assuming 1 \u00d7 106 VK2 cells per well). Bacteria was brought into contact with the VK2 cells by centrifugation for 1 min at 300\u00d7 g. Cells were incubated at 37 \u00b0C in 5% CO2 for 30 min, supernatant was removed, and cells washed 6X with sterile PBS. Cell layers were incubated for 5 min with 100 \u03bcL 0.25% trypsin/2.21mM EDTA after which 400 \u03bcL of 0.025% Triton-X in PBS was added. Wells were mixed vigorously 30X to ensure detachment and lysis, and bacterial recovery was determined by plating on THB agar. Data was expressed as a percentage of adherent CFU compared to original inoculum.Vaginal epithelial adherence assays were performed as adapted from prior methods ,39. VK2 For detection of human titers against SCM, a purified truncated form of SCM (KO173225)  which doad libitum.The UCSD Institutional Animal Care and Use Committee (Protocol #S00227M) approved all animal protocols and procedures. Wildtype (WT) CD-1 male and female mice aged 8-10 weeks were purchased from Charles River Laboratories (strain code 022). Groups were assigned randomly and housed at 5 animals per cage in separate cages. Mice were allowed to eat and drink 8 CFU WT S. canis strain G361 or \u0394scm mutant. Sides receiving WT or \u0394scm (left and right) were alternated at random across groups of mice. Lesions were imaged daily for three days and surface area calculated using ImageJ software.For intradermal infection models adapted from prior work , CD1 mal7 CFU wildtype GAS strain 5448, WT S. canis strain G361 or \u0394scm mutant. Mice were monitored three times daily for mortality. Analgesics were not administered during systemic infection due to potential effects on the study outcome.The UCSD Institutional Animal Care and Use Committee (Protocol #S00227M) approved the anticipated mortality and study design. For in vivo survival studies, CD-1 male and female mice (n = 10/group) were intraperitoneally (i.p.) injected with 100 \u00b5L of PBS containing 5 \u00d7 107 CFU WT GBS COH1, WT S. canis strain G361 or \u0394scm mutant suspended in 10 \u00b5L of PBS. For WT S. canis strain G361 and \u0394scm competition experiments, mice were vaginally inoculated with 1 \u00d7 107 CFU each of G361 and \u0394scm suspended in 10 \u00b5L of PBS. Colonization was monitored daily by collecting vaginal swabs . Bacterial load was determined by serial dilution plating on CHROMagar\u2122 StrepB base  and where necessary, WT G361 and \u0394scm distinguished by plating on CHROMagar containing erythromycin (5 \u00b5g/mL).For vaginal colonization models, CD1 females  were treated i.p. with 0.5 mg \u03b2-estradiol in 100 \u03bcL sesame oil (5 mg/mL) to synchronize estrus as described previously . After 2g for 5 min. Cells were blocked with 1:200 mouse BD Fc-block (BD Biosciences) for 15\u2009min on ice in 50 \u00b5L of PBS containing 1\u2009mM EDTA, 1% FBS, and 0.1% sodium azide. Cells were stained for surface markers using the following antibodies at 5\u2009\u03bcg/mL for 30\u2009min on ice: anti-CD11b-fluorescein isothiocyanate (FITC) , anti-c-kit-phycoerythrin (PE) , anti-CD8-PerCP-Cy5.5 (where PerCp is peridinin chlorophyll protein) , anti-F4/80-PE-Cy7 , anti-Ly6G-allophycocyanin (APC) , anti-MHC-II-APC-Fire750 , anti-Fc\u03b5RI-Pacific Blue , and anti-CD45-BV510 . Samples were washed 3X in PBS containing 1\u2009mM EDTA, 1% FBS, and 0.1% sodium azide. Samples were run on a BD FACSCanto II (BD Biosciences), were gated on unstained cells, and positive signals were determined using single-stain controls. Data were analyzed with FlowJo, version 10.2, software (FlowJo LLC).Vaginal swab samples obtained during swabbing for bacterial colonization were subjected to flow cytometry as adapted from previous work ,41. VagiWhole reproductive tract tissues were collected at day 3 post-inoculation, fixed in 10% neutral buffered formalin for 24 h, and dehydrated by an ethanol gradient and embedded in paraffin. Tissue sectioning and hematoxylin and eosin (H&E) staining was performed by the UC San Diego Comparative Phenotyping Core. H&E-stained slides were examined for presence and character of inflammation by an ACVP board-certified veterinary anatomic pathologist. Representative images were captured using a Leica brightfield microscope and color CCD camera.p values < 0.05 were considered statistically significant.In vitro and ex vivo experiments were repeated at least three times independently with at least three technical replicates with the exception of human serological studies which were performed in technical duplicate and analyzed twice independently. Mean values from independent experiments were used to represent biological replicates for statistical analyses. In vivo experiments were conducted at least twice independently which each mouse serving as a biological replicate. Experimental data was combined prior to statistical analyses. Data sets were subjected to D\u2019Agostino & Pearson normality test to determine Gaussian distribution before selecting the appropriate parametric or non-parametric analyses. In instances where experimental numbers (n) were too small to determine normality A\u2013C,E datS. pyogenes, and the orthologous nature of the SCM protein suggests a potential for a similar role in S. canis pathogenesis. To investigate the role of SCM in S. canis virulence, we utilized a SCM insertional mutant made from the S. canis G361 clinical isolate strain that no longer produces the SCM protein and exhibits reduced aggregate formation in culture [S. canis compared to wildtype S. canis in bacteriologic media  and included a strain of the common vaginal colonizing bacterial species group B Streptococcus (GBS) as a comparison. Although no differences in vaginal cell adherence was observed between WT G361 and \u0394scm, both S. canis isolates adhered significantly better than GBS  or GBS (p = 0.003) on day 1 post-inoculation, but no significant differences were seen in subsequent time points , F4/80, Ly6G, Fc\u03b5RI, and c-kit. CD45+ cells were analyzed for the presence of additional surface markers and total cell counts of each sub-category were reported. CD8+ T cells (CD45+ CD8+), mast cells (CD45+ c-kit+ Fc\u03b5RI+), macrophages (CD45+ CD11b+ F4/80+), neutrophils (CD11b+ Ly6G+), and antigen presenting cells (CD11b+/- MHC-II+) were all observed, but numbers did not significantly differ across groups  and bacterial burdens quantified over 3 days via vaginal swab. WT G361 and \u0394scm were differentiated by plating on agar with and without erythromycin. In competition, \u0394scm showed significantly lower burdens than WT G361 on days 2 and 3 post-inoculation. To confirm that the \u0394scm mutant was not losing the plasmid insertion in vivo over time, we assessed the stability of erythromycin resistance in CD1 mice singly challenged with \u0394scm by plating on both selective and non-selective agar plates. No differences were observed in bacterial counts using either erythromycin selection or no selection (To assess whether SCM contributes to nization , female e points B. To dets groups C. Additielection .S. canis is a well-known pathogen of dogs, cats, and other mammals, and an opportunistic zoonotic disease of humans [S. canis pathogenesis and colonization. Overall, we observed minimal contributions of SCM to S. canis interactions with the host in either commensal or pathogen contexts using the S. canis strain G361 which possesses a SCM type 2, group 1 allele [S. canis interactions with its host. Prevalence of SCM in veterinary S. canis isolates is quite high: both colonizing and invasive isolates are 70.6-90.0% SCM positive by PCR [S. canis colonization and/or invasive disease.f humans ,50,51,52f humans ,31,53; h1 allele . Importae by PCR  suggestiS. canis, similar to reports for other streptococcal M-like proteins [S. pyogenes, M1 over-expression enhances biofilm formation and M1-deficient strains demonstrated reduced biofilm formation in bacteriologic media [S. canis in bacteriologic media, however, this finding was not observed in conditions reflective of the host environment (RPMI, S. pyogenes, M protein contributes to the hydrophobicity of the bacterial surface, leading to greater biofilm formation [S. canis possibly reduces surface proteins with greater hydrophobicity, leading to the observed decrease in biofilm formation. Alternatively, because SCM activity is associated with S. canis aggregation microcolony formation in vitro [scm strain may alter the morphology of S. canis biofilms [scm biofilms in RPMI-1640, the morphology of the biofilms was visibly different. While WT G361 biofilms grown in RPMI-1640 formed microcolonies comparable to WT G361 grown in THB, \u0394scm grown in RPMI-1640 formed diffuse biofilms with fewer microcolonies (S. canis interactions within different host tissues is a topic of future study.In terms of bacterial characteristics, SCM is non-essential for growth, either in nutrient-rich bacteriologic media or nutrient-poor tissue culture media. SCM also does not contribute to hemolysis in proteins . In S. pic media . Similarnt RPMI, C. In S. ormation . Thus, lin vitro , loss ofbiofilms ,57. In fcolonies D. The imS. pyogenes M proteins confer resistance against phagocytosis by inhibiting the alternate complement pathway [S. canis, this self-aggregation is lost in the absence of SCM [S. canis (scm bacteria were effectively controlled by macrophage cell lines or human and mouse whole blood, with ~100% or more of inoculum recovered at the experimental end point. This contrasts our findings with isolated human neutrophils, which efficiently reduced S. canis viability by more than 90% over the assay (S. canis neutrophil resistance. This observation is in line with a previous study which did not observe any differences in neutrophil control of SCM-positive or SCM-negative S. canis except for when exogenous SCM and/or plasminogen was present [Streptococcal M proteins play key roles in virulence and host immune evasion.  pathway ,59, or a pathway ,60 or as pathway ,62. Simie of SCM . HoweverS. canis . In facthe assay F, yet wi present .S. pyogenes. S. pyogenes M1 neutralizes cathelicidin [S. canis (S. canis with levels similar to that of M protein-deficient S. pyogenes. This failure to elicit an immune response could benefit S. canis as it avoids the production of inflammatory cytokines and pyroptosis that have been shown to be critical for the control of some bacterial pathogens [S. canis invasive infection, we did not distinguish distinctive contributions of SCM. No differences in skin lesion sizes were observed between SCM-deficient and WT S. canis, and in general, we observed smaller lesion sizes than that reported for a similar model in S. pyogenes [S. canis compared to S. pyogenes in a murine model of systemic infection at a dose of 5 \u00d7 107 CFU, similar to a previous study, which demonstrated an LD90 of 3 \u00d7 107 CFU in mice [Another notable activity of M-like proteins is resistance to host immune defense molecules and activation of innate inflammatory responses, best characterized in elicidin ,34, stimelicidin , and actelicidin . In our S. canis . Overallathogens . Howeverpyogenes . Time po in mice .S. pyogenes M proteins is well-recognized [S. canis, antisera against SCM has been detected in diseased cats [S. canis infections or exposure were not included in this study.Additionally, the antigenic nature of cognized ,66, and cognized ,68. Regased cats . No compS. canis persisted in the mouse vaginal tract at similar levels to GBS highlighting the utility of this murine model in studying S. canis factors contributing to urogenital colonization. We detected no changes to immune cell profiles or epithelial appearance suggesting that S. canis does not stimulate a robust vaginal immune response soon after introduction. This contrasts with other human pathogen vaginal colonization models which do invoke immune responses [S. canis in mammals such as cats and dogs. Although we observed minimal contribution of SCM in S. canis colonization in a single bacterial challenge model, when both WT S. canis and \u0394scm were introduced in competition, WT S. canis demonstrated a competitive advantage (Along with relevance to pathogenesis, streptococcal M proteins play prominent roles in host colonization. This phenomenon may be in part due to mediating adherence , althougesponses ,73,74 andvantage E. The uncanis infection and colonization and interrogated the role of SCM in these models using a targeted knockout mutant. We observed minimal impact of SCM deficiency in invasive disease models, but found an SCM-associated advantage in vaginal colonization. These results suggest that the role of SCM is distinct from the repertoire of virulence mechanisms ascribed to other streptococcal M proteins. Further studies are necessary to determine the mechanisms underlying decreased colonization fitness of SCM-deficient S. canis and to extend our findings to other SCM variants. Identification of these mechanisms will provide insight into the viability of SCM as a vaccine target for the zoonotic pathogen S. canis.In summary, we have deployed several new in vitro and mouse models of S."}
+{"text": "Helicobacter pylori chronically infects the stomach of approximately half of the world\u2019s population. Manifestation of clinical diseases associated with H. pylori infection, including cancer, is driven by strain properties and host responses; and as chronic infection persists, both are subject to change. Previous studies have documented frequent and extensive within-host bacterial genetic variation. To define how within-host diversity contributes to phenotypes related to H. pylori pathogenesis, this project leverages a collection of 39 clinical isolates acquired prospectively from a single subject at two time points and from multiple gastric sites. During the six years separating collection of these isolates, this individual, initially harboring a duodenal ulcer, progressed to gastric atrophy and concomitant loss of acid secretion. Whole genome sequence analysis identified 1,767 unique single nucleotide polymorphisms (SNPs) across isolates and a nucleotide substitution rate of 1.3x10-4 substitutions/site/year. Gene ontology analysis identified cell envelope genes among the genes with excess accumulation of nonsynonymous SNPs (nSNPs). A maximum likelihood tree based on genetic similarity clusters isolates from each time point separately. Within time points, there is segregation of subgroups with phenotypic differences in bacterial morphology, ability to induce inflammatory cytokines, and mouse colonization. Higher inflammatory cytokine induction in recent isolates maps to shared polymorphisms in the Cag PAI protein, CagY, while rod morphology in a subgroup of recent isolates mapped to eight mutations in three distinct helical cell shape determining (csd) genes. The presence of subgroups with unique genetic and phenotypic properties suggest complex selective forces and multiple niches within the stomach during chronic infection. Helicobacter pylori, one of the most common bacterial pathogens colonizing humans, is the main agent responsible for stomach ulcers and cancer. Certain strain types are associated with increased risk of disease, however many factors contributing to disease outcome remain unknown. Prior work has documented genetic diversity among bacterial populations within single individuals, but the impact of this diversity for continued bacterial infection or disease progression remains understudied. In our analysis we examined both genetic and functional features of many stomach isolates from a single individual infected over six years. During these six years the subject shifted from having excess acid production and a duodenal ulcer to lower acid production from gastric atrophy. The 39 isolates form sub-populations based on gene sequence changes that accumulated in the different isolates. In addition to having distinguishing genetic features, these sub-populations also have differences in several bacterial properties, including cell shape, ability to activate immune responses, and colonization in a mouse model of infection. This apparent functional specialization suggests that the bacterial sub-populations may have adapted to distinct niches within the stomach during chronic infection. Helicobacter pylori is a bacterial pathogen that colonizes the human gastric mucosa of approximately half of the world\u2019s population , 49H. pyH. pylori populations both within each time point and between time points, we performed whole genome sequencing using Illumina MiSeq. Short reads were aligned using the published sequence of J99 as the reference (AE001439). Our J99 isolate differed from the reference J99 (AE001439) at 755 polymorphic sites ; of these 553 polymorphisms were common to all isolates in the collection  compared to the ancestral isolates (\u03c0 = 3.6 x 10\u22125), demonstrating accumulation of genetic diversity during chronic infection  for unique pairwise comparisons of isolates from the same time point (within time point) to isolates from different time points (between time point). For between time point comparisons, only antral isolates (n = 24) were used to reduce potential confounding effects introduced from comparing isolates from different anatomical locations. The average genetic distances  of within time point pairs was 6.75 x 10ite/year . Overallnfection .To identify regions of the genome that accumulate within host variation, we examined enrichment of nonsynonymous SNPs (nSNPs) in specific genes and functional classes assigned by the microbial genome database (MGDB) . Out of The MGDB does not specifically analyze antibiotic resistance genes. While this subject had no known history of antibiotic treatment, the presence of antibiotic resistance to metronizidole, ampicillin, clarithromycin, was previously tested. Four isolates, three antral and one duodenal, were resistant to clarithromycin due to a mutation in the 23S rRNA gene, but all the other isolates were sensitive to all three . To valibabA, sabA, sabB, and hopQ) that play roles in adhesion and exhibit variation between and within hosts . Se. SecagY immunity . Due to ion Figs  and S5C.ion Figs  and S5A.isolates . The SC4SC4 Figs  and S5C.SC4 Figs . In ordevariants . Co-cultfrom J99 .H. pylori  A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Steven R. BlankeAssociate EditorPLOS PathogensAlan HauserSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064***********************Overall, the referees agreed that the strengths of the manuscript include the biomedical importance of understanding \"within infection\" factors that contribute to Hp genomic changes that drive Hp-dependent emergence of gastric disease in humans. The premise of the study is well founded, and takes advantage of an important resource  collected from different gastric sites of an individual at two different time points separated by approximately 6 years. There is also documented medical information that documents profound changes in the health status of the individual from whom the strains were collected.However, an array of serious concerns were expressed by two of the three referees. Referee 2 highlighted several major weaknesses included the inability to identify whether the observed phenotypes reported were due to new, clade- or isolate-specific mutations, as well as the inability to differentiate whether the phenotypes could be ascribed to de novo mutation or recombination. There were also queries as to whether repeated phenotypes were examples of genetic parallelism? Both reviewers 2 and 3 were uneasy about the methods of comparative genome analysis. In addition, major concerns were raised about the reference J99 sequence, which contained many changes in the genome relative to the Genbank sequence of J99, many of which were clustered to changes documented in the clinical isolates reported in this study. Concern was expressed that these changes could substantially inflate the number of unique SNPs observed within the clinical isolates, and thereby potentially confound the author\u2019s interpretations. In addition to these major shortcomings, a variety of additional major and minor items were identified, and are highlighted in the referee comments, that reduced overall enthusiasm for the manuscript.Overall, although there was enthusiasm expressed by all three referees for the premise and potential importance of the studies reported in this manuscript, there were serious shortcomings that the referees highlighted, that would ultimately require highly extensive additional work to suitably address major concerns.Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1:\u00a0Long-term infections with the bacterial type-I carcinogen Helicobacter (Hp) have been associated with a broad range of gastric disorders, including gastritis, ulceration, gastric cancer or MALT lymphoma. The manifestation of clinical diseases associated with Hp infection is driven by strain properties and host susceptibility. Previous studies have documented frequent and extensive within-host bacterial genetic variation. To define how within host diversity contributes to phenotypes related to Hp pathogenesis, the authors collected 39 clinical isolates, acquired prospectively from a single subject at two time points and from multiple gastric sites. During the six years separating collection of these isolates, this individual, initially harbouring a duodenal ulcer, progressed to gastric atrophy and concomitant loss of acid secretion. The authors performed whole genome sequence analysis and identified 2,232 unique single nucleotide polymorphisms (SNPs) across isolates and a nucleotide substitution rate of 1.3x10 -4 substitutions/site/year. They also analysed phenotypic differences in bacterial morphology, ability to induce inflammatory cytokines, and mouse colonization. For example, higher inflammatory cytokine induction were correlated with polymorphisms in the Cag PAI protein CagY, while rod morphology in a subgroup of recent isolates mapped to eight mutations in three distinct helical cell shape determining (csd) genes. The presence of subgroups with unique genetic and phenotypic properties suggest complex selective forces and multiple sub-niches within the stomach during chronic infection. Together, this is an interesting paper, which will raise considerable attention in the community.Reviewer #2:\u00a0This study takes advantage of a remarkable collection of H pylori isolates from a chronic infection lasting six years. Given what\u2019s generally known about the standing diversity, mutation rates, and evolutionary rates of H. pylori, the fact that the authors observe population divergence following WGS is not surprising, but it's certainly worth documenting carefully. The discovery that late isolates tend to stimulate higher IL-8 secretion and have altered morphologies that may be adaptive is interesting and sets the stage for further study about the mechanisms of host adaptation, ideally with isolates differentiated by fewer genetic differences.There are two significant limiters to this study. The first is that all conclusions are drawn from two sampling periods with no intermediates, and the manuscript relies upon, and often overstates, correlations drawn from only these two periods. This must be acknowledged and reconciled. The second is that many conclusions are drawn on the basis of the amount of pairwise genetic differences between strains, and this requires both greater rigor and appropriate phylogenetic context. I make recommendations about improving the rigor of variant calling follow; however, regardless if these methods don\u2019t change the among-isolate variance much, the entire study must be grounded in phylogeny rather than sets of pairwise differences that largely reflect time and effects of a few outliers (eg strain/clade A2). That is, it\u2019s fine to say that variation among isolates increases over time, and interesting that this variation does not correlate with point of isolation, but this variation likely evolved from a single clone and hence most mutations differentiating strains are non-independent due to shared ancestry.The key question that\u2019s not clearly resolved is what are the new, clade- or isolate-specific mutations that might account for the interesting phenotypes you observe? Further, are these caused by de novo mutation or recombination? Are these repeated phenotypes also potentially examples of genetic parallelism? Suggestions are offered but are not as convincing as they could be with more rigorous phylogenomic inference of driver mutations.Reviewer #3:\u00a0This paper by the group of Nina Salama describes the genome-wide characterization of sequence variation in a collection of H. pylori isolates taken from one individual at two different time points. The collection of strains is unique due to the extensive sampling at two time points with a six year interval. It is also of particular interest, because one of the strains isolated from this patient at the first time point is H. pylori strain J99, one of the best characterized H. pylori strains. Subgenomic (e.g. microarray) analyses of a selection of these isolates were published before . To apply whole genome sequencing to these isolates is straightforward and the authors are to be commended for taking on the endeavor of reanalyzing this important set of strains, using Illumina MiSeq technology. The results of the genome comparisons were used as a basis for designing additional experiments which a focus on phenotypical traits successfully studied in the Salama laboratory, such as bacterial cell shape, IL-8 induction, and virulence in a mouse model.**********Part II \u2013 Major Issues: Key Experiments Required for Acceptanceabsolutely required to validate study conclusions.Please use this section to detail the key new experiments or modifications of existing experiments that should be Generally, there should be no more than 3 such required experiments or major modifications for a \"Major Revision\" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend \"Reject\".Reviewer #1:\u00a0noReviewer #2:\u00a0MajorOverall the introduction describes an array of mechanisms of H pylori variation but not a sense of what is known about the typical diversity within or among infections. Please provide this background and relate your results to what\u2019s been shown.* Methods and rigor of sequencing  and variant calling require clarification.While breseq is a standard-bearer, the key question is how many sites are informative \u2013 since some are prone to variation regardless of variant calling method even for extremely well studied reference genomes -- and how many of those remaining can be used to rigorously differentiate isolates. Sampling bias is a problem for some analyses because the 1B clade is n=1. The IL-8 phenotype and cell shape phenotypes is interesting but complicated.Method for distinguishing between ancestral and recent diversity (Table 1) is not described and needs at the minimum a phylogenomic analysis if not ancestral reconstruction. Recent diversity could actually have existed earlier without detection, right?- Repeated, different  mutations in the same gene (Table 2) could result from diversifying selection in that trait but also could result from poor assembly or read-mapping. Recombination in these regions could also confound inference. Please comment on these possibilities.Fig 2 \u2013 how are SVs accounted in your estimate of pairwise nucleotide variation? Looks like difference is driven by enrichment of a more divergent set of isolates from the first sampling point.Fig 5: panel C is disingenuous. There\u2019s no relationship between numbers of SNPs and IL8 induction, this is very clearly a false correlation where time and likely a few mutations are the causative variable.Reviewer #3:\u00a0Unfortunately, the comparative genome analysis is not (yet) State of the Art and so the study currently fails to deliver on its promise and potential. The most important concerns are:1.) L269//506-509: The authors chose to use an \u201cagnostic\u201d (their word) approach, i.e. not to distinguish between mutation and polymorphisms introduced by recombination. In my view, this is a very bad choice, since it makes the results (e.g. the frequency of polymorphisms) impossible to compare with other studies, and likewise very hard to interpret. A quick analysis of the sequences shows ample evidence of recombination in the later set of strains. Methods for accurate phylogenetic inference of recombination in bacterial genomes, such as Gubbins or ClonalFrameML, are now available and widely used. Why choose a dendrogram over a phylogenetic tree that would have provided a more accurate representation of the evolutionary relationships between the isolates? Moreover, a brief inspection the VCF file provided on the Github repository indicates that many SNPs present in the recent group of isolates are tightly clustered together, suggesting that a majority of the diversity could actually come from recombination. In any case, more technical information should be provided concerning the construction of the dendrogram .2.) L189/Table 1/Table S1A. It appears that strain J99 was resequenced along with the other isolates. Suprisingly, the new J99 sequence displays hundreds of differences compared to the Genbank sequence of J99. These differences must either be sequencing errors in the reference sequence or in the Illumina data, or the sequences do not come from the same strain. Furthermore, and of even more concern, most the SNPs observed between the \u201cold\u201d and \u201cnew\u201d versions of J99 also appear in all the isolates in this study. This raises substantial doubts about all quantitative statements regarding sequence changes during the six years of infection. There are several possible explanations for this, one possibility is that the clone sequenced by Richard Alm and colleagues was substantially different from the current J99. Since the patient apparently did have a mixed infection (since there is so much recombination), this is possible. Alternatively, the old sequence may contain many errors, but then the point of reference for all isolates should be the \u201cnew\u201d J99 sequence, not the old one. This issue appears to inflate the number of unique SNPs observed by around 20%, which is very significant. It would probably be best to complete the new genome sequence of J99 (e.g. by adding PacBio or Oxford Nanopore long reads) and to use this as a reference for the analysis. This is a major issue affecting the validity of all comparisons and must be addressed.3.) L191: Both mutation and recombination are considered here, thus using \u201cpolymorphism\u201d instead of \u201cmutation\u201d would be more accurate.4.) L227-228: How different is the pool of within-host variable OMPs between the old and recent group of isolates?5.) L258-259: Are these four isolates all from the recent group? The 23S rRNA is typically fairly conserved. How do you explain that polymorphisms related to antibiotic resistance appeared at a significant frequency in the population with no known history of antibiotic treatment?6.) Figure 4/5/6/7: The unit used on the x-axis may not be correct. On the NextStrain platform, the scale indicates \u201cDivergence\u201d, which seems to correspond to the accumulation of changes since the common ancestor and not a rate like \u201csubstitution per site per year\u201d seems to indicate.7.) Figure 4/5/6/7: Isolates from the duodenum, corpus and antrum regions appear in both subgroups 2A and 2B. This should be discussed.8.) Figure 4/5/6/7: The common ancestor of the recent group of isolates appears to only date back to a few months before the sampling date . How is it explained if the population has been evolving from the population of 6 years ago without a major bottleneck?**********Part III \u2013 Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1:\u00a0Minor points for improvement:1.) Table 2: How many SNPs were seen per individual Hp gene?2.) Just one SNP per Hp strain and gene or multiple SNPs in any particular gene, e.g. hopQ?3.) If multiple SNPs, could they be the result of intrachromosomal recombination?4.) In Fig. 5 you mention a > 20% increase, but in Fig. 9 you refer to >20% decrease. Please clarify.5.) How do you compare the mutation rates to that in previously published papers from isolates of chronically infected patients?Reviewer #2:\u00a0Minor66 \u201csub niches\u201d awkward and not a standard term.77 please provide specific details about what\u2019s known about the extent of diversification of H pylori during a typical infection. Important for setting baseline81-83 same comment about cagAY allelic variation \u2013 how much?129 what\u2019s the quality of J1 genome? How was it produced? You\u2019ve now resequenced it effectively \u2013 how many calls are shared, derived and thus actually in the J1 isolate?176 92% ANI is beyond the level of species distinction, even genus \u2013 this seems inconceivable. Sequencing and mapping details need to be provided up front to justify this claim184-188 writing is awkward223: \u201cfunctional classes assigned by the microbial genome database (MGDB) add reference.\u201d What do you mean? Definitely add the reference!230 you state others have found variation in OMPs but don\u2019t provide references. Be more specific about the kind and consequences of this variation.Fig 3 statistical enrichment of functional categories should be conservative because of numerous potential biases; omit those at p=0.03.263 \u201cbut no mutations indicative of additional antibiotic resistance were discovered.\u201d Vague. Describe methods esp in light of the broad challenge to identify AMR determinants from genomes.Reviewer #3:\u00a0L676: It iss not quite clear how experimental variation was assessed. Were multiple tests performed for every individual isolate? What are \u201cpooled replicates from two independent experiments\u201d?Fig. 1: The information contained in Fig. 1 is also contained in the text, consider deleting it to conserve space.The reference section needs careful checking for completeness and formatting of citations.**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: Reproducibility:http://journals.plos.org/plospathogens/s/submission-guidelines#loc-materials-and-methodsTo enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see  15 Sep 2020Attachment2020_09_15_Response_Letter.docxSubmitted filename: Click here for additional data file. 22 Oct 2020Dear Nina,We are pleased to inform you that your manuscript 'Helicobacter pylori diversification during chronic infection within a single host generates sub-populations with distinct phenotypes' has been provisionally accepted for publication in PLOS Pathogens. The referees were highly impressed with the manner in which you addressed the comments and concerns expressed in regard to\u00a0the initial submission,\u00a0and believed that the findings reported in the\u00a0revised manuscript\u00a0represents an important advance in the field of Helicobacter pylori infection biology.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Steven R. BlankeAssociate EditorPLOS PathogensAlan HauserSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064***********************************************************Reviewer Comments :Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1:\u00a0acceptedReviewer #2:\u00a0I was impressed by the unique dataset, detailed genomic study, and careful follow up analyses of genetic variation evolving during prolonged H pylori infection. With this highly responsive revision that tackles each comment from our reviews, I'm now even more so. I think this will be an important contribution to our understanding of bacterial evolution during chronic infections in general, as well as the unique dynamics of H pylori infections.Reviewer #3:\u00a0The authors have fully addressed all points raised in my review.**********Part II \u2013 Major Issues: Key Experiments Required for Acceptanceabsolutely required to validate study conclusions.Please use this section to detail the key new experiments or modifications of existing experiments that should be Generally, there should be no more than 3 such required experiments or major modifications for a \"Major Revision\" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend \"Reject\".Reviewer #1:\u00a0acceptedReviewer #2:\u00a0(No Response)Reviewer #3:\u00a0(No Response)**********Part III \u2013 Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1:\u00a0acceptedReviewer #2:\u00a0unnecessary comma in line 362.Reviewer #3:\u00a0(No Response)**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064"}
+{"text": "Aim: The purpose of this experimental study was to evaluate the existence of adrenergic receptors in ketamine-induced corneal blood vessels in rat pups. Methods: The study of corneal neovascularization motricity was performed on 45-day-old Wistar rats in which, starting from the 15th day of life, corneal blood vessels were obtained by injecting intraperitoneal ketamine at a dose of 150 mg/ kg body weight, a total of 5 successive doses. The examination of the neovascularization was done with the help of a Nikon stereomicroscope connected to a video camera and a computer, the total magnification being 400X. The reactivity of the new corneal blood vessels to the administration in conjunctival instillations of a 1.5 mmol/L adrenaline solution was tested. The parameters followed were represented by variations in the caliber of corneal blood vessels. The data were analyzed using Microsoft Office Excel.Results: Administration of distilled water did not produce statistically significant changes in corneal blood vessels, while adrenaline produced a statistically significant constriction of vascular diameter .Conclusions: The results showed that adrenaline produces vasoconstriction in the new corneal blood vessels, which allows us to assume that they contain \u03b1-adrenergic receptors. However, we cannot say that corneal pathological vessels do not contain \u03b22-type adrenergic receptors, because the effect of adrenaline may be an algebraic sum between vasoconstriction produced by stimulating \u03b1-adrenergic receptors and vasodilation produced by stimulating \u03b22-adrenergic receptors, but in which the vasodilating effect may be masked by the vasoconstrictor effect given by a higher density of \u03b1-adrenergic receptors.Abbreviations: A= adrenaline, DNM = non-measurable diameter, NA= noradrenaline, Std.Er.= Standard error Subsequently, the sub-types \u03b11 with postsynaptic localization and \u03b12 located predominantly presynaptic, but also postsynaptic and extrasynaptic were highlighted for \u03b1-adrenergic receptors [2-4]. \u03b1-adrenergic receptors were also divided into several sub-types \u03b21, \u03b22, \u03b23, and \u03b24 [5-7]. In 1959, Furchgott discovered other types of adrenergic receptors, gamma, and delta [8], responsible for the actions of catecholamines in smooth muscles. Currently, most authors admitted the existence of \u03b11-, \u03b12-, \u03b21- and \u03b22-adrenergic receptors. \u03b11-adrenergic receptors are found mainly in the vascular smooth muscles, and their stimulation causes vasoconstriction. \u03b12-adrenergic receptors are located mainly presynaptically, and their stimulation inhibits presynaptic release of norepinephrine leading to relaxation of vascular and intestinal smooth muscles. There are also postsynaptic \u03b12-receptors that cause vasoconstriction [9]. Stimulation of \u03b22-adrenergic receptors causes vasodilation by relaxing the vascular smooth muscles (arteriolar and venous).The adrenergic system comprises all the structures that use the catecholamines adrenaline and noradrenaline as chemical mediators. First described by Ahlquist in 1948 [10], as well as \u03b11-adrenergic receptors that regulate inositol-phosphate turnover [11]. Stimulation of corneal \u03b2-adrenergic receptors causes protein kinase A activation and an increase in intracellular cAMP concentration, and stimulation of \u03b12-adrenergic receptors inhibits protein kinase A (PKA) activity by inhibiting adenylate cyclase. Modulation of the corneal cAMP-PKA pathway can play important roles in homeostasis and corneal wound healing [12].The corneal epithelium expresses \u03b1- and \u03b2-type adrenergic receptors. \u03b2-adrenergic receptors are found at the cell surface, and through adenylate cyclase, leading to the formation of AMP-cyclic, with stimulation of Cl- permeability at the epithelial membrane [9]. Adrenaline has an affinity for both types of receptors, thus determining biphasic actions, the final response depending on the types of receptors it binds to and their density at the cell surface. Thus, in the cutaneous, mucosal, and splanchnic territories, where there is a higher density of \u03b11-adrenergic receptors, adrenaline leads to vasoconstriction, while in the brain, in striated muscles, kidneys, or coronary adrenaline causes vasodilation due to an increased density of \u03b22-adrenergic receptors. Table 1 shows a distribution of adrenergic receptors in the ocular tissues (in humans), and Table 2 shows a classification of adrenoceptors with agonists (endogenous and exogenous) and antagonists.The effects of adrenaline and noradrenaline depend on their selectivity to the types of adrenergic receptors, as well as the density of the types of adrenergic receptors in the tissues. Noradrenaline has a high affinity for \u03b1-adrenoreceptors, causing a pressor-type response. Noradrenaline causes vasoconstriction in all vascular territories and increased volume by contraction of the spleen capsule .The model of corneal neovascularization is the result of research done to investigate sodium selenite-induced cataract in 15-day-old rat pups in which, for microscopic study of lens opacities, general anesthesia was performed with ketamine at a dose of 150 mg/ kg body weight and in which in vivo study of lens transparency changes was no longer possible due to the occurrence of changes in corneal transparency . In two of the eyes examined, the vasoconstriction was so intense that the measurement of the vascular diameter was no longer possible. The administration of distilled water did not produce statistically significant changes in vascular diameter. These allowed us to assume that there are \u03b1-adrenergic receptors at the level of the corneal blood vessels, whose stimulation classically produces vasoconstriction.Following these results, we cannot exclude the existence of \u03b2-adrenergic receptors whose stimulation produces vasodilation. The vasoconstriction found above may be an algebraic sum between the vasoconstrictor effect produced by stimulating \u03b1-adrenergic receptors and the vasodilatory effect produced by stimulating \u03b2-adrenergic receptors if the vasodilatory effect is less intense than the vasoconstrictor effect.1. Administered in conjunctival instillations, adrenaline produces vasoconstriction in the corneal blood vessels.2. In our experimental conditions, there were \u03b1-adrenergic receptors in the corneal blood vessels.3. It is possible that there are also \u03b2-adrenergic receptors in the corneal blood vessels, but whose stimulation produces lower intensity vasodilation, masked by the vasoconstrictor effect produced by the stimulation of \u03b1-adrenergic receptors.Conflict of InterestAuthors state no conflict of interest.AcknowledgementsNone.Sources of FundingNone.DisclosuresNone."}
+{"text": "Osteoarthritis (OA) is characterized by joint pain and joint function limitation. Hsa_circ_0045714 (circ_0045714) is a novel OA-related circular RNA. However, its repertoire remains to be further clarified in joint chondrocytes.RNA and protein expression levels and inflammatory factor levels were detected by real-time quantitative polymerase chain reaction, western blotting and enzyme-linked immunosorbent assay. Cell proliferation and apoptosis were determined by colony formation assay, cell counting kit-8 assay and apoptosis assay. Direct interaction was predicted by bioinformatics method and confirmed by dual-luciferase reporter assay.Expression of circ_0045714 and phosphoinositide-3-kinase (PI3K) regulatory subunit 3 (PIK3R3) was declined, and microRNA (miR)-331-3p was promoted in knee articular cartilages and cells from OA patients, as well as interleukin (IL)-1\u03b2-challenged human articular chondrocytes (HAC) cell line. In stimulation of IL-1\u03b2, HAC cells showed a loss of colony formation ability, cell viability and expression of Bcl-2 and Collagen II, allied with an increase in apoptosis rate and levels of IL-6, IL-8 and tumor necrosis factor-\u03b1, Bcl-2-associated X protein, cleaved caspase-3, and ADAM with thrombospondin motif-5. Noticeably, overexpressing circ_0045714 and inhibiting miR-331-3p could suppress IL-1\u03b2-evoked these effects, and both were through up-regulating PIK3R3, a key gene in PI3K/AKT signaling pathway. Mechanically, circ_0045714 functioned as competing endogenous RNA (ceRNA) for miR-331-3p and further regulated expression of the downstream target gene PIK3R3.There was a novel circ_0045714/miR-331-3p/PIK3R3 ceRNA axis in HAC, and its inhibition might be one mechanism of HAC injury in OA. Osteoarthritis (OA) is a complex multifactorial disease, and its pathology has been advanced in genetics, genomics and epigenetics . Joint pOne of the major endpoints of OA is the loss of articular cartilage, and chondrocyte is the only cell type in the cartilage . ChondroPhosphoinositide 3-kinase (PI3K) regulatory subunit 3 (PIK3R3) is an inhibitor of PI3K  in PI3K/In this study, we attempted to investigate the expression and role of circ_0045714, miR-331-3p and PIK3R3 in OA patients and IL-1\u03b2-insulted human articular chondrocytes (HAC), and to further confirm the underlying relationship among them.OA knee articular cartilage samples and healthy cartilage samples were collected from 20 OA patients with total knee replacement and 20 trauma patients with amputation, respectively. Cartilage specimens were stored at \u2212\u200980\u00a0\u00b0C. OA patients were in accordance with clinical and radiological diagnostic criteria for OA, and experienced constant pain during the last three months. Trauma patients were without any arthritis. All patients were recruited from Wuhan General Hospital of People\u2019s Liberation Army, and each participator signed informed content. This study was ratified by the Ethics committee of this hospital.Cartilages were minced into very small pieces and soaked into DMEM/F-12 medium  containing 0.1% trypsin  and 0.2% Collagenase II  at 37\u00a0\u00b0C for 8\u00a0h. Afterward, undigested tissues were removed using 40\u00a0mm filter, and cells were harvested by centrifugation. Isolated cells were cultured in DMEM/F-12 medium (R&D systems) supplemented with 10% fetal bovine serum  and 1% penicillin\u2013streptomycin . Complete medium was changed every three days and cells in 2 passage were harvested for use.The immortalized HAC cell line  was cultured in DMEM  containing 0.1\u00a0mg/ml G418 disulfate salt  and 10% FBS (R&D systems). HAC cells were used to transiently transfect with exogenous nucleotides or vectors using Lipofectamine 3000  for 36\u00a0h. The oligonucleotides were circ_0045714-siRNA (si-circ_0045714), PIK3R3-siRNA (si-PIK3R3), negative control (NC)-siRNA (si-NC), miR-331-3p mimic, miR-NC mimic, miR-331-3p inhibitor (anti-miR-331-3p), and miR-NC inhibitor (anti-miR-NC). The vectors were empty pCD5-ciR vector , recombinant pCD5-ciR-circ_0045714 vector, pmiR-Reporter vector  expressing circ_0045714 containing the wild type (WT) or mutant type (MUT) of miR-331-3p response elements, and pmiR-Reporter vector  expressing PIK3R3 3\u2019UTR containing WT or MUT of miR-331-3p response elements. Single and co-transfection models were performed per the instructions, and transfected cells at 36\u00a0h were harvested for further assays.Transfected and un-transfected HAC cells in 80% confluence were starved in serum-free medium for 4\u00a0h and then replaced with complete medium added with 10\u00a0ng/mL IL-1\u03b2  for 24\u00a0h. HAC cells without transfection or IL-1\u03b2 treatment were served as control.\u2212\u0394\u0394CT method was used to evaluate RNA expression level, and internal parameters glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were used to correct RNA expression. Primers for circ_0045714, unk zinc finger (UNK), miR-331-3p and PIK3R3 are shown in Table RNA was isolated with TRIzol reagent  and reversely transcribed into cDNA with SuperScript II first-strand synthesis system (Invitrogen) for RT-qPCR. SYBR Green Mix  and StepOne\u2122 Real-Time PCR System  were adopted for the PCR amplification and melting curve analysis. 2Actinomycin D and RNase R assays were implemented to measure the characterization of circ_0045714, comparing to its host gene UNK. Actinomycin D  was added in HAC cells for 0, 4, 8, 12 and 24\u00a0h, and RNA in each timing was isolated. RNA from HAC cells was treated with 3 U/\u03bcg RNase R (GENESEED) for 30\u00a0min, and mock cells were without RNase R treatment. Expression of circ_0045714 and UNK was detected in Actinomycin D, RNase R and mock groups using RT-qPCR.A sum of 150 cells were seeded in 12-well plate and cultured for 15\u00a0days. Eventually, single cell was cloned into a colony, and cloned colonies were dyed with crystal violet method. Number of colonies (>\u200930 cells/colony) was manually determined under an inverted microscope. Cell Counting Kit-8  was employed to monitor cell viabilities of IL-1\u03b2-treated HAC and control cells during 3\u00a0days by measuring the optical density (OD) values at 450\u00a0nm.5 cells were co-incubated with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) according to the instructions of Annexin V-FITC/PI apoptosis detection kit . Using flow cytometry (FCM), stained cells and unstained cells were analyzed: live cells were Annexin V-/PI-, early apoptotic cells were Annexin V\u2009+\u2009/PI-, and late apoptotic cells and necrotic cells were Annexin V\u2009+\u2009/PI\u2009+\u2009.About 5\u2009\u00d7\u200910The products of IL-6, IL-8 and TNF-\u03b1 in the cell culture supernatants were examined by the human IL-6 ELISA kit , IL-8 ELISA kit  and TNF-\u03b1 ELISA kit , respectively. Four paralleled wells were for each group. Following the assay protocols, OD absorbance was read with a microplate reader at 450\u00a0nm, and measured concentrations were determined using linear regression of OD value against the standard curve.Cellular protein was isolated from tissues and cells using RIPA lysis buffer , and culture medium protein was also isolated and concentrated via ultrafiltration membrane. Protein concentration was determined depending on BCA protein assay kit (Beyotime), and western blotting was performed in the following order: electrophoresis with polyacrylamide gel, membrane transferring via electrophoresis, antibody incubation using special primary antibodies Table  and horsHAC cells in exponential growth were co-transfected with the recombinant pmiR-Reporter vectors expressing WT/MUT-circ_0045714 or WT/MUT-PIK3R3 3\u2019UTR and mimic of miR-NC or miR-331-3p for 36\u00a0h. Cells were lysed and subjected to dual-luciferase reporter gene assay Kit (Beyotime). Luminescence was detected by luminometer. Relative light unit of Firefly luciferase was corrected by that of Renilla luciferase.P value\u2009<\u20090.05 was chosen to indicate a statistical significance.Data were presented in the form of mean\u2009\u00b1\u2009standard deviation. Each experiment was carried out in triplicate. One-way or two-way analysis of variance test followed by Tukey\u2019s post hoc test was used to determine the differences among groups on GraphPad Prism 7 . Circ_0045714 was derived from UNK via back-splicing event  between circ_0045714 and miR-331-3p levels in these 20 OA cartilages was \u2212\u20090.8030  between miR-331-3p and PIK3R3 mRNA levels in 20 OA cartilages was \u2212\u20090.8077 . However, the potential target relationship between miR-331-3p and PIK3R2 or PIK3R5 was not further confirmed. By the way, PI3K/AKT pathway was the downstream of miR-155/PIK3R1 axis in dictating the cell fate of chondrocytes under IL-1\u03b2 condition [Except for PIK3R3, we also noticed that PIK3R2 and PIK3R5 were predicted to have miR-331-3p response elements according to starBase software (ondition , and autondition , 36; howIn conclusion, circ_0045714 and PIK3R3 were down-regulated and miR-311-3p was up-regulated in OA patients, and restoring circ_0045714 could prevent HAC against IL-1\u03b2-elicited cell apoptosis, inflammatory response and ECM degradation by regulating miR-331-3p and PIK3R3 via a ceRNA axis. Moreover, circ_0045714/miR-331-3p axis might mediate inhibition of PI3K/AKT signaling pathway via targeting PIK3R3."}
+{"text": "Telemonitoring enables care providers to remotely support outpatients in self-managing chronic heart failure (CHF), but little is known about the usability and patients\u2019 willingness to engage with this technology.This study aims to evaluate feedback from patients with CHF following participation in the Innovative Telemonitoring Enhanced Care program for CHF (ITEC-CHF) study.The telemonitoring intervention consisted of three components: remote weight monitoring, structured telephone support, andnurse-led collaborative care. Participants were provided with electronic weighing scales , and a computer tablet . They were asked to weigh themselves on the provided scales daily. Telemonitoring was integrated with a personal assistance call service and a nurse care service according to their workflows in usual care. Feedback on the usability of ITEC-CHF was collected via survey from study participants following 6 months of receiving telemonitoring care for their body weight. Survey responses were provided on a 5-point Likert scale and through open-ended questions to determine participants\u2019 perceived benefits and barriers to using ITEC-CHF.A total of 67 participants , with a mean age of 69.8 (SD 12.4) years completed the survey. The majority of participants agreed or strongly agreed that the ITEC-CHF program was easy to use , easy to navigate , useful , and made them feel more confident in managing their weight . Themes related to participants\u2019 perceptions of telemonitoring included increased support for early intervention of clinical deterioration, improved compliance to daily weighing, a sense of reassurance, and improved self-care and accountability, among others.ITEC-CHF was rated highly on usability and was well accepted by users as part of their routine self-management activities. Participants were willing to use telemonitoring because they perceived a broad spectrum of benefits for CHF management.Australian New Zealand Clinical Trial Registry ID ACTRN 12614000916640; https://www.anzctr.org.au/Trial/Registration/TrialReview.aspx?id=366691. Chronic heart failure (CHF) is a complex disease that is expensive to manage and affects approximately 2%-3% of the adult population , with a The mixed results from telemonitoring studies may, in part, reflect the willingness or readiness of patients with CHF to engage with telemonitoring technology and to adhere to its use -12. BecaAlthough several recent studies have investigated the perceptions of telemonitoring in other clinical cohorts, such as patients with chronic kidney disease, chronic obstructive pulmonary disease, or hypertension ,11,14,15The Innovative Telemonitoring Enhanced Care program for CHF (ITEC-CHF) was the first such program to incorporate telemonitoring supported by a 24-hour call center and first-line nurse-led CHF intervention in community care settings in Australia ,22. To mA detailed description of the protocol for the ITEC-CHF study has been previously published . ParticiEligible participants for the survey were required to have completed the ITEC-CHF intervention. The detailed protocol for this study has been published , but it Guidelines for the Prevention, Detection, and Management of Chronic Heart [Participants were provided with electronic weighing scales , and a computer tablet . They were asked to weigh themselves on the provided scales daily. The measured weight entry was recorded in the weighing scale and then automatically transmitted to the tablet via a wireless Bluetooth function embedded in the scales. The tablet was preloaded with an Android application  that received the weight entry and uploaded it to a proprietary software package, ManageMyHealth . A web application in MMH automatically monitored the uploaded weight entries in real time to generate alerts and triage those alerts to project nurses and the call center. The alerts were designed in accordance with the National Heart Foundation of Australia\u2019s ic Heart .The telemonitoring intervention consisted of three components: remote weight monitoring, structured telephone support, and nurse-led collaborative care. Telemonitoring was integrated with a personal assistance call service (MePACS) and a nurse care service according to their workflows in usual care.Operators at the call center responded to the alerts in real time . In cases where the participant required clinical support, such as advice for assessing CHF symptoms or managing fluid and salt restriction, the call operator arranged a nurse follow-up.The project nurses provided structured interventions according to three types of alerts: rapid weight fluctuation (\u00b12\u2009kg in 2 days), slow weight fluctuation (\u00b15\u2009kg in 28 days), and low-risk weight fluctuation (\u00b11\u2009kg over 24\u2009hours). If a participant\u2019s body weight fluctuation exceeded \u00b11\u2009kg (but less than \u00b12\u2009kg) over 24\u2009hours, a questionnaire was automatically triggered and sent to the participant\u2019s computer tablet. If the participant reported any of the clinical conditions in the questionnaire or did not respond to the questionnaire, the project nurses contacted the participant for a clinical assessment. However, if the response to the questionnaire determined the participant was asymptomatic, the alert was cancelled automatically to minimize unnecessary alerts to the project nurses.The study\u2019s inclusion criteria were as follows: patients (1) with CHF diagnosed by a clinician with an ejection fraction \u226440%, (2) who were able to weigh oneself safely, (3) who were at least 18 years of age, (4) who have a regular personal general practitioner (GP) or agree to use a designated GP, (5) who have a permanent residential address, and (6) without significant cognitive impairment. The exclusion criteria were as follows: (1) patients with expected survival <12 months, (2) patients with end-stage renal failure on dialysis, (3) long-term nursing home residents, or (4) patients participating in any other clinical trial. All participants provided written informed consent.Statistical analyses were performed using SPSS software . Descriptive statistics  were used to characterize the study population and described participants\u2019 perceptions of usability of ITEC-CHF.Open-ended questions were transcribed and imported into NVivo version 12  to facilitate the coding and to maximize the effectiveness and efficiency in sorting and merging the data according to themes reflecting common views and experiences. These were collated and supported by deidentified quotes from participants. Thematic analysis was performed to identify themes related to participants\u2019 perceptions of the perceived benefits and perceived barriers, as well as their suggestions about improving the system, thus capturing participants\u2019 understandings and allowing an in-depth analysis of the data . Data weThe ethics application for the trial site in Victoria has been approved by Peninsula Health Human Research Ethics Committee (HREC Reference: HREC/14/PH/27), and the ethics applications for trial sites in Western Australia have been approved by Royal Perth Hospital Human Research Ethics Committee (Reference: 15-081) and the Curtin University Human Research Ethics Committee (Reference: HR 181/2014). This study complies with the Declaration of Helsinki. The trial has been registered in the Australian New Zealand Clinical Trials Registry, Trial ID: ACTRN12614000916640.The survey response rate was 77%  of participants \u201cagreed\u201d or \u201cstrongly agreed\u201d that the telemonitoring system was easy to use, 85% (57/67) \u201cagreed\u201d or \u201cstrongly agreed\u201d that the technology improved their confidence in managing their CHF condition, 78% (51/65) \u201cagreed\u201d or \u201cstrongly agreed\u201d that the technology was easy to navigate, and 91% (59/65) \u201cagreed\u201d or \u201cstrongly agreed\u201d that the telemonitoring was useful. A few participants indicated that they \u201cdisagreed\u201d or \u201cstrongly disagreed that the telemonitoring system was easy to use (3%), that the technology improved their confidence in managing their CHF condition (2%), that the technology was easy to navigate (2%), and that the telemonitoring was useful (2%).For the broad concepts of Participants provided feedback, including a range of benefits and barriers to using telemonitoring. Eight key themes related to the ITEC-CHF program emerged from responses to the open-ended questions. Quotes from participants are provided to support each theme.Clinicians were able to view patient health data easily and quickly, which enabled early detection of clinical deterioration. This meant that problems were detected quickly, and participants were able to receive an early intervention.Weight fluctuation detected early and see GP same day.The telemonitoring system helped participants get into a routine and inform them when a change occurred in their weight that was outside the predetermined limits.Information exchange. Motivation to try and be healthy.Learning about weight changes and fluid balance.Participants indicated they felt reassured that a clinician was behind the scenes reviewing their data.Staff are competent.Safety net that someone is watching.Participants felt accountable for their self-management because they were being monitored and would receive a reminder if they missed weighing themselves. This was reported as having had a positive effect on compliance to their self-management regime.Weight measurement helped me with trying to maintain my health status.Made me personally more accountable of fluid management.Encouraging to weigh regularly. Help keep an eye on my diet.The ITEC-CHF environment helped participants feel supported in self-managing their condition while reflecting on the telemonitoring system in self-care.Weighing reminders from MEPACS.Don't feel alone. Familiar with nurses.Reassuring that help is on hand.Some concerns expressed by participants were related to the technology, mainly due to Bluetooth connectivity issues in the early stages of the trial.When machine doesn't register .Computer tablet not registering weight measured from scales.Some participants suggested they would have liked greater flexibility to be able to weigh themselves later than 10 AM to suit their lifestyle. This feedback was provided by participants who are employed, including those who work a night shift, to have the flexibility of the cutoff time to weigh in extended.Sunday mornings when woken by MEPACS.Extend time to midday.Extend time limit.Participants who had lifestyles involving frequent traveling found the continuous telemonitoring unsuitable. In addition, some participants reported difficulty in answering the questions on the computer tablet in a timely manner.Not suitable when going away on holiday.Not enough time to answer symptoms questions.In this evaluation of the perceptions of telemonitoring among patients with CHF, the majority of participants \u201cagreed\u201d or \u201cstrongly agreed\u201d that the intervention was feasible and helpful in their care. This included being easy to use (91% agreement) and helpful in improving their confidence in self-management (85% agreement). These findings are consistent with those reported from studies in other cohorts of people with chronic diseases that have evaluated perceptions of telemonitoring ,11,14,15Feedback from participants in this study highlights the importance of minimal user burden and ensuring user-friendly technology for telemonitoring to be acceptable to patients. High rates of satisfaction were observed with all the aspects of usability surveyed. Participants reported that the ITEC-CHF program was easy to use, easy to navigate, useful, and increased their confidence in managing their weight. Similarly, patients with chronic kidney disease were found to be highly accepting of using telemonitoring because they perceived it as being interactive and applicable in managing their condition . In patiCompliance with care provider instructions and being self-disciplined in health management activities and self-care were two themes that were expressed by a high proportion of participants using the ITEC-CHF system. Compliance with self-care activities, such as diet, exercise, and medication adherence, are important factors in managing chronic conditions such as CHF given that successful disease management is, in part, dependent on patients\u2019 ability and willingness to carry out self-care activities . MoreoveHowever, the acceptance of telemonitoring was not ubiquitous for participants in the current study. For example, the technology in its current form may not suit patients who travel frequently. Several participants also indicated that greater flexibility in the telemonitoring system would reduce disruption to their lives, especially during holidays and on weekends. It was suggested by some participants that having the ability to alter the time before an alert was sent  would reduce the psychological burden of the alert system during these periods. This is an important consideration because previous studies have found that insufficient flexibility in telemonitoring models may hinder the ongoing use of the system -36.Participant feedback also highlighted the importance of engaging consumers with a lived experience of CHF in the co-design of telemonitoring to ensure that it is simple and easy to engage with by the end user. Participants stressed the importance of a system that is robust, with easily accessible technical support\u2014a finding consistent with observations in other clinical groups ,38. ThisThere are several limitations to the study that warrant highlighting. First, the results from the usability of the ITEC-CHF program were based on a relatively small sample size, so larger studies are required to confirm these findings. Second, there was no baseline data of participants\u2019 perceptions of the usability of the system to provide a comparison for user satisfaction measured at the end of the study. However, this design would have its own limitations because participants would lack the experiential insight derived from being involved in the trial to answer some of the questions at baseline. Third, the findings are based on the experiences of participants who completed the trial and who are, therefore, likely to have a more favorable view of the telemonitoring system than those who dropped out. Finally, the single-group ITEC-CHF usability design precluded the assessment of the feasibility of randomization procedures, attrition, outcome measures, and acceptability in a control arm.In this study evaluating the usability of a telemonitoring program in patients with CHF, a high overall usability rating was achieved, and the telemonitoring system was generally well accepted by users as an adjunct to their routine self-management activities. Participants in the study expressed that they were confident in using the ITEC-CHF system and reported many perceived benefits, including quick identification of early signs of clinical deterioration, which allows for faster response to manage the symptoms of CHF. Future trials that are powered to assess whether telemonitoring effects rehospitalization and mortality rates are required to determine whether these characteristics of telemonitoring translate to an improvement in clinical outcomes for patients with CHF."}
+{"text": "Parameniscal cysts are associate with horizontal meniscal tears. Arthroscopic meniscal repair and the excision of the cyst by mini-open approach represent a valid treatment. However, the recurrence of cyst is still a current issue. Therefore, biological factors may be considered to promote the biological repair and avoid recurrence. The aim of the present study was to report the clinical results and the rate of recurrence of the cyst after minimum 2-year of follow up in a cohort of patients treated by meniscal repair and autologous platelet-rich fibrin matrix augment.Patients with lateral parameniscal cyst undergoing arthroscopic meniscal repair and autologous platelet-rich fibrin matrix augment between 2016 and 2019 were retrospectively reviewed in March 2021. Inclusion criteria were absence of prior surgery on the affected knee with minimum 2-year of follow-up. Exclusion criteria were concomitant ligament lesions, rheumatic diseases and knee osteoarthritis. After reviewing the database, each selected patient was contacted and asked to participate in the study; at the follow-up evaluation all patient signed an informed consent. Tegner-Lysholm knee score, IKDC and NRS were collected before surgery and at follow-up.This study included 15 patients  with mean age of 32.8\u2009years old. No recurrence of the cysts was observed. The Tegner-Lysholm knee score and IKDC subjective scores increased respectively from 41.3\u2009\u00b1\u20095.4 and 37.6\u2009\u00b1\u20095.1 at baseline to 92.3\u2009\u00b1\u20094.6 and 89.4\u2009\u00b1\u20092.6 at the final follow up. Concerning pain relief, the Numeric Pain Rating Scale (NRS) displayed a significant improvement reaching at the follow up a score of 1,3\u2009\u00b1\u20091.1 in comparison to 6.8\u2009\u00b1\u20090.9 at the baseline.Surgical management of symptomatic lateral parameniscal cyst with cyst excision, autologous PRP membrane application and meniscus repair demonstrated excellent subjective clinical outcome with any cyst reoccurrence.III, retrospective cohort study. Parameniscal cysts are defined as internal disorder of the knee joint located on the medial or on the lateral side that might be asymptomatic or cause knee pain, joint swelling and soft tissue masses . Over thIt has been well established that cyst dimension, failure to disrupt the check-valve mechanism and multilobulated structure are associated with a cyst recurrence rate that could reach 15% of cases .Due to the deep extend of the cyst in the red-red zone of the meniscus, biological factors may be considered to promote the biological repair. Common methods to enhance the vascularity and healing of the meniscus include trephination, synovial abrasion, application of a fibrin clot and platelet-rich plasma (PRP). PRP is characterized by a concentration of platelets above the baseline values . It is tThe purpose of this study was to evaluate the clinical results and the rate of recurrence of the parameniscal cyst in a cohort of patients treated by meniscal repair and autologous platelet-rich fibrin matrix augment. We hypothesized that the biological augmentation in meniscal healing could avoid cyst recurrence with satisfying clinical results.The collected data of patients who underwent implantation of autologous platelet-rich fibrin matrix for parameniscal cysts between 2016 and 2019 were retrospectively reviewed in March 2021. Inclusion and exclusion criteria were summarized in Table\u00a0As per institutional policy, each patient undergoing this procedure was screened and documented by recording history and demographic data at the time of surgery. All patients underwent to knee X-Ray and Magnetic Resonance Imaging (MRI) as standard protocol before surgery. Moreover, the following clinical scores were evaluated: IKDC subjective, Numeric Pain Rating Scale (NRS) and Tegner-Lysholm knee score for the pre-injury level and pre-operative physical activity. After reviewing the database, each selected patient was contacted and asked to participate in the study; at the follow-up evaluation all patient signed an informed consent and underwent to physical examination. The same scores applied for the basal evaluation were used and recorded at follow-up.Each patient that accepted to participate at the study, made up a new knee MRI at follow up, the images were collected. All procedures were conducted in accordance with good clinical practice and the Declaration of Helsinki 1964. The present study was approved by the Ethics Committee of Verona and Rovigo \u2013 Italy .General knee arthroscopic examination is routinely carried out via anterolateral and anteromedial portals. A diagnostic arthroscopy is conducted to ensure that there is no additional intra-articular pathology. Meniscal tears were treated by all-inside or outside-in suture Fig.\u00a0.Fig. 1a The autologous platelet-rich fibrin matrix  is a thin layer of autologous fibrine very rich in platelets. It is obtained from a blood sample of the patient following manufacturers\u2019 instruction Fig.\u00a0.Fig. 2ThA small horizontal or oblique skin incision is made over the joint line in correspondence of the cyst, and the subcutaneous tissue of the knee is dissected. Transillumination of the lateral compartment could determine the proper level for incision placement, especially when one is trying to make a smaller incision. Z-shaped incision is made at ileotibial band to improve exposure of underlying layers and closure. A horizontal-oblique incision of the capsule is performed over the joint line in correspondence of the cyst. The cyst is evacuated. The autologous platelet-rich fibrin matrix membrane is located in the outer layer of the lateral meniscus and then sutured side-to-side to the adjacent capsule by adsorbable suture  Fig.\u00a03)3).Fig. 3Postoperatively, all patients start range of motion exercises immediately after the surgery. Physical therapy emphasizes early quadriceps muscle activation and knee flexion from 0\u00b0 to 90\u00b0 restricted for the first 4\u2009weeks and progressed thereafter. Weight-bearing was allowed after 4\u2009weeks.p value <\u20090.05. For data analysis, a dedicated statistical software was used .Continuous variables were assessed using the paired-sample Student\u2019s t-test. Statistical significance was set at Figure\u00a0Fourteen patients underwent to meniscal suture through all inside system . One patient with meniscal tear located at anterior horn of lateral meniscus underwent to meniscal suture by outside-in technique. No cases of cyst recurrence were reported by clinical examination and follow-up MRI images Fig.\u00a0. MoreoveNo complications as infection or adverse effect of autologous membrane implantation have been reported during follow up period.p\u00a0<\u00a00.01). Likewise, IKDC subjective scores increased from 37.6\u2009\u00b1\u20095.1 at the baseline to 89.4\u2009\u00b1\u20092.6 at the follow-up (p\u00a0<\u00a00.01). Concerning pain relief, the Numeric Pain Rating Scale (NRS) displayed a significant improvement reaching at the follow up a score of 1,3\u2009\u00b1\u20091.1 in comparison to 6.8\u2009\u00b1\u20090.9 at the baseline (p\u00a0<\u00a00.01) (Fig.\u00a0At a mean follow up of 42,6\u2009months patients show a significant and clinical improvement in terms of pain relief and functional outcomes. The Tegner-Lysholm knee score increased from 41.3\u2009\u00b1\u20095.4 at the baseline to 92.3\u2009\u00b1\u20094.6 at the final follow up (The most important finding of the present study was that the application of autologous PRP membrane for the treatment of parameniscal cyst represent a safe and efficacy method for augmentation of meniscal healing. No cases of infection or adverse effect of membrane implantation were reported during follow up period. Moreover, despite the considerable size of the cysts of our series, no cases of recurrence have been observed. Even though, previous studies reported that overall recurrence of parameniscal cyst ranged from 9.4 to 15% after arthroscopic decompression \u201318. EachIt is known that various cytokines from platelets have a myriad effect on cellular processes involved in tissue healing as cell proliferation, angiogenesis, cell chemotaxis, and matrix synthesis \u201321. The The membrane is easily suturable and it has been successfully used for the therapy of vascular ulcers and promising results have been reported in the treatment of rotator cuff tears , 26. In The limitations of our study included the small cohort, its retrospective and nonrandomized design, the short follow-up and lack of control group which may have led to bias. On the other hand, the post-operative MRI images could accurately assess the meniscal healing and recurrence.The surgical management of symptomatic lateral parameniscal cyst with meniscus repair, cyst excision and autologous PRP membrane application demonstrated excellent subjective clinical outcome with any cyst reoccurrence at minimum 2\u2009year of follow up."}
+{"text": "At the molecular scale, bone is mainly constituted of type-I collagen, hydroxyapatite, and water. Different fractions of these constituents compose different composite materials that exhibit different mechanical properties at the nanoscale, where the bone is characterized as a fiber, i.e., a bundle of mineralized collagen fibrils surrounded by water and hydroxyapatite in the extra-fibrillar volume. The literature presents only models that resemble mineralized collagen fibrils, including hydroxyapatite in the intra-fibrillar volume only, and lacks a detailed prescription on how to devise such models. Here, we present all-atom bone molecular models at the nanoscale, which, differently from previous bone models, include hydroxyapatite both in the intra-fibrillar volume and in the extra-fibrillar volume, resembling fibers in bones. Our main goal is to provide a detailed prescription on how to devise such models with different fractions of the constituents, and for that reason, we have made step-by-step scripts and files for reproducing these models available. To validate the models, we assessed their elastic properties by performing molecular dynamics simulations that resemble tensile tests, and compared the computed values against the literature . Our results corroborate previous findings, as Young\u2019s Modulus values increase with higher fractions of hydroxyapatite, revealing all-atom bone models that include hydroxyapatite in both the intra-fibrillar volume and in the extra-fibrillar volume as a path towards realistic bone modeling at the nanoscale. If current preventive diagnosis techniques remain unimproved, aging-related bone diseases, such as osteoporosis and their subsequent bone fractures are expected to overload health care systems worldwide . UnderstBones are patient-specific and exhibit a multiscale structure ,3,4. ThiSeveral works performing molecular dynamics (MD) simulations of the bone structure have tried to comply with these two points, as shown by recent reviews ,3,5. EspUnderstanding the mechanical properties of bones and the molecular aspects that underlie their behavior at small non-continuous length scales constitutes an open field of research and requires substantial further endeavors. This work aims to contribute to the field by: (1) detailing the process of modeling all-atom bone collagen fibrils  and, foThis paper covers a multidisciplinary topic, which may attract the attention of researchers from different fields, including biology, medicine, physics, chemistry, and engineering. Thus, inspired by Ref. , four exDefinition:\u00a0Non-mathematical definitions that may be differently understood by specialists from different fields;Highlight:\u00a0A statement that plays a major role in the interpretations and discussions of the results;Open Issue:\u00a0Issues and problems not clearly defined or not yet completely solved within the surveyed literature;Remark:\u00a0Relevant notes.The appendices contain detailed information about the modeling process. Readers seeking to reproduce the models are advised to read the main text along with the appendices.10(PO4)6(OH)2, and water (H2O) [At the molecular scale, bone is a unique and complex composite material mainly composed of type I collagen (CLG), hydroxyapatite (HA) Caer (H2O) ,26,27,28er (H2O) ,29.Reference values for their volume fractions are: 33\u201343% mineral material (mainly HA), 32\u201344% organic material (mainly CLG), and 15\u201325% H2O ,30.Reference values for their mass fractions are: 60\u201365% mineral material (mainly HA), 25\u201330% organic material (mainly CLG), and 10% H2O ,30,31,32side chain. A peptide bond is the CO\u2013NH chemical covalent bond formed between two molecules when the C of the carboxyl group of one molecule reacts with the N of the amino group of the other molecule, releasing a molecule of HA single CLG molecule, i.e., a tropocollagen, is a helical structure consisting of three  left-handed polypeptide chains coiled around each other to form a right-handed superhelix; see GLY-X-Y. This means that one in three amino acids is a glycine. The most common amino acids present in the X and Y positions are proline (PRO) and hydroxyproline (HYP), respectively. Prolines at the third position of the tripeptide repeating unit GLY-X-Y tend to be hydroxylated, turning into hydroxyproline.The amino and carboxyl groups are standard parts of amino acids. The R group can vary among amino acids. Thus, it is the R group that defines the type of amino acid. Type I CLG displays polypeptide chains that consist mostly of At the sub-nanoscale, a collection of axially connected CLG molecules arranged side by side forms a collagen fibril (CLGf); see Remark\u00a01 .The multiple length scales of bone are not equally structured and represented in the literature. The structure presented by Ref. , Figure In brief, from the molecular scale up to the nanoscale, bone is composed of a large number of interacting molecules. Each molecule comprises several atoms participating in interatomic bonds. Assuming that modeling each atom as a solid particle and each bond as an elastic spring is accurate enough, the molecular/nanoscale domain is defined as a gathering of discrete particles, i.e., a non-continuum, which is mostly studied through MD simulations.Here, a step-by-step description is given of how models that resemble fibers in bones can be devised.First, starting from the sequence of amino acids and an available fibrillar structure, the CLG Fibril model was devised through homology modeling. Then, a structure of the CLG fibril that requires Periodic Boundary Conditions (PBCs) only along the z direction was extracted and labeled CLG NanoFiber. When the latter is replicated along the x and y directions, surrounded by an EFV, and subjected to PBCs in the x, y, and z directions, the newly devised model is labeled CLG Fiber. Finally, adding physiological conditions into fibrils and, consequently, fibers, which confer CLG-based tissues with their remarkable macroscale mechanical properties, such as high tensile strength. Thus, it is crucial to reproduce the fibrillar and fiber structure in MD simulations when studying the CLG mechanical properties.\u00a0\u00a0\u00a0\u00a0 Different from most proteins, CLG is not found isolated and fully solvated in bones, and it does not completely fold to perform a specific function. It is the association of CLGs under Definition\u00a01In biochemistry, reactions are usually studied under physiological conditions, that is, an electrically neutral aqueous solution at 1 atm pressure, ~37 \u00b0C temperature, 0.16 mol/L salt concentration . To date, only the amino acid sequence, i.e., the primary protein structure, of human type I CLG has been fully determined. This can be found at the Universal Protein Resource (UniProt) website  under thDefinition\u00a02Low-resolution structures usually contain only the position of the alpha carbons (CA). All other atomic positions, e.g., side-chain atoms, must be inferred. High-resolution structures usually contain the position of every non-hydrogen atom.(High-Resolution and Low-Resolution Protein Structures). homology modeling.Unfortunately, there is no experimentally determined molecular structure of the quaternary protein structure of the human type I CLG available in the PDB. An alternative for modeling the human type I CLG structure is Definition\u00a03Also labeled comparative modeling of protein 3D structures, homology modeling is a procedure that produces a previously unknown 3D protein structure by associating an amino acid sequence (labeled the target) with a known experimentally determined 3D atomic-resolution structure (labeled the template) of a homologous sequence. Two amino acid sequences are considered homologous when they are very similar, e.g., they display a high sequence identity value, meaning that they share a common evolutionary ancestry. Homologous sequences display similar structures and, frequently, similar functions .(Homology Modeling). The PDB structure 3HR2 , an expeWhen aligned, the type I CLG amino acid sequences of the human\u2014Uniprot P02452 and P08123\u2014and rat\u2014PDB 3HR2\u2014exhibit sequence identity above 90%, indicating that they are highly homologous. Hence, they are appropriate for comparative structural modeling. If the 3HR2 structure were a high-resolution structure, it could be directly used for the MD simulations proposed here. However, since it contains only the positions of the CA atoms of the amino acids, the position of the non-CA atoms must be inferred. Homology modeling allows the inference of the positions of the non-CA atoms.MODELLER 9.25 [LER 9.25  was useda = 39.970 \u00c5; b = 26.950 \u00c5; c = 677.900 \u00c5; http://www.ks.uiuc.edu/Research/vmd/, accessed on 30 January 2022). The H atoms can be kept or not. The models built here did not keep the H atoms, since they can be added later using the VMD software when generating a PSF file, as described in Importing the homology model, built as described in pbc set {39.970 26.950 677.900 89.24 94.59 105.58}\u201d command of the VMD PBCTools Plugin in the VMD TkConsole;Setting triclinic UC dimensions using the \u201cWrapping all atoms into the defined UC using the \u201dpbc wrap\u201d command of the VMD PBC Tools Plugin in the VMD TkConsole.When compressed in the crystal-like triclinic UC determined by Ref.  . Remark\u00a02The CLG Fibril, which is derived from the 3HR2 PDB from Ref. , exhibit(D-period). \u00a0\u00a0\u00a0\u00a0 As previously mentioned, the deposition of HA in the IFV yields the mCLGf. However, as shown in Refs. ,20,22,23(a)The 3HR2 structure  does not directly allow the deposition of HA in the EFV, but only within the fibril. That is because the UC defined by  possesse(b)Including HA in the EFV means devising a very large system (much larger than the UC of the 3HR2 structure), which implies computationally more expensive simulations.To the best of our knowledge, there are, as of yet, no available studies reporting MD simulations of the bone structure while taking into consideration the HA content in the EFV. There are probably two main reasons for this:Refs. ,14,15, fOpen Issue 1 (Coarse-Grained Models).An alternative to simulate the CLG fiber structure without requiring a prohibitively large number of atoms is to use coarse-grained models where an entire group  is treated as a single interacting entity ,8,43,44.The first step to create a model that resembles the structure of the fibers present in bone is to extract from the CLG Fibril a structure that requires no PBCs along the x and y direction, labeled here as CLG NanoFiber, as shown in \u00a0\u00a0\u00a0\u00a0 When Remark\u00a03A bundle of axially aligned CLGfs and mCLGfs surrounded by (CLG Fiber vs. Bone Fiber models). The mechanical properties of bones at the nanoscale are affected by the relative fractions of their constituents. All models presented here consider bone to be constituted of CLG, HA, and HOpen Issue 2 .The presented models consider bone to be constituted of CLG, HA, and s (NCPs) ,46. Boths (NCPs)  reportedPackmol, a package distributed as free software for building initial configurations for MD simulations , was useIn all devised models, the total number of HA molecules was added to the simulation box such that 80% belong to the EFV, and only 20% to the IFV, as Refs. ,22,23 poThe devised IFV displays the x, y, and z dimensions Note that 20% of the HA molecules were added into the IFV box, and the remaining 80% were outside the IFV, but inside the simulation box. The EFV is defined as the volume of the simulation box subtracted from the volume of the IFV box.Open Issue 3 (EFV vs. IFV).By visually identifying the volume mostly occupied by the CLG fibrils, two different boxes were created that define the IFV and EFV. However, there may be more accurate ways to define the IFV and EFV for MD simulations. This paper presents a realistic model of a bone fiber (not fibril), i.e., the first model to reproduce fibrils and to insert HA molecules both in the IFV and in the EFV. However, modeling both the IFV and EFV can be considered an open issue.All the devised models display a salt concentration of 0.16 mol/L. This was assured by adding a total of 132 chloride ions and 0 sodium ions to the models  can significantly affect MD simulation results. It is thus paramount to select FFs that are appropriate for the specific goal of the simulation .top_all36_prot.rtf, par_all36m_prot.prm for proteins;toppar_all36_prot_modify_res.rtf for modified residues, i.e., HYP;toppar_water_ions.prm for water and ions;were used for the simulations described in this article, and included in the MODELLER 9.25 library during the homology modeling process, as described previously in CHARMM36m ,53,54,55par_all36_lipid.prm, par_all36_carb.prm, par_all36_It is important to mention that the files na.prm, par_all36_cgenff.prm, and par_HA.prm, though not containing parameters for the atoms of the presented models, were also loaded in the NAMD configuration files, since CHARMM files contain NBFIX, and CHARMM commands specifically written for the CHARMM program, not for NAMD. Reading all these files avoids errors in NAMD.a = 9.417 \u00c5; b = 9.417 \u00c5; c = 6.875 \u00c5; For the HA species, parameters from the IFF , which oOnce devised, the Bone Fiber structure went through minimization steps and equilibration runs in NAMD before starting the production run; see Definition\u00a04.Definition\u00a04There is a subtle difference between equilibration or thermalization and production runs. Both basically consist in running MD simulations (solving Newton\u2019s Second Law for each atom in the system). However, data is only collected in the production run, since the computed properties should correspond to a system in thermodynamic equilibrium.(Production Run). a atoms interacting with up to n neighbor atoms:MD simulations consist in solving Newton\u2019s 2nd Law of Motion at a material molecular scale whose spatial domain contains Details of the minimization and equilibration performed in NAMD and their parameters are shown in Structural convergence was ensured by analysis of the root mean squared deviation (RMSD), a numerical measure of the difference between two structures, of the CA atoms. The slope of the RMSD with respect to time approached zero short before 100 ns of equilibration. Remark\u00a04During equilibration, a volume contraction varying from 30 to 50% with respect to the devised models was noticed. The volume contraction reflects a structural relaxation that is made possible by simulating in the NPT ensemble, which keeps the number of particles, pressure, and temperature constant, allowing the volume to adapt. Moreover, differently from other works that fully solvated the CLG molecule in water, here, a pre-defined number of water molecules was set to guarantee the relative composition of the nanomaterial, as shown in (Volume Contraction). charmm2lammps.pl from LAMMPS tool. The LAMMPS equilibration consisted of: 1 ns equilibration with time step 1 fs and neighbor skin 1.0, followed by an additional 5 ns equilibration with a time step of 2 fs, as indicated in LAMMPS, an open-source code with a focus on materials modeling and science ,61,62,63PBCs were applied in all directions and during all steps.\u00a0\u00a0\u00a0\u00a0 Assessing elastic properties using MD simulations is sometimes difficult ,65, espefix deform command deforms the box by extending the box length \u00a0\u00a0\u00a0\u00a0 A uniaxial deformation along the z-axis was imposed by gradually increasing the z-length value of the simulation box, i.e., of the domain. Taking advantage of the continuum mechanics and strength of materials, the engineering strain along the z direction can be defined as: LAMMPS allows the user to decide whether to input the strain rate PBCs were applied in all directions and during all steps of the production run. While the box was deformed along the z direction, an NPT ensemble was used for the x and y ones. E through the following stress-strain relationship:Assuming bone as a Cauchy-Linear-Elastic (CLE) material  complyincompute pressure command computes the elements of the symmetric pressure tensor at the molecular scale by adding components of the kinetic energy tensor and of the virial tensor:i-th component of the resultant force applied on the k-th atom. Here, pressure can be interpreted as stress; i.e., The LAMMPS default fix deform command and the respective linear fitting of the elastic region.During the MD tensile tests simulations, stress and strain were frequently outputted and later plotted to strain-stress curves. scipy.optimize.curve_fit [A simple linear regression based on least squares using urve_fit  was usedHere, bone was considered a CLE material complying with Hooke\u2019s Law. No plastic, viscoelastic, or non-linear behavior was considered. The Young\u2019s Modulus values shown in Ref.  comparesRef.  performere, Ref.  displaysre, Ref.  also disRefs. ,69 devisAs shown above and also discussed by ref. ,71, therAs discussed in Nevertheless, the presented approach allows the modeling of larger, and even more realistic bone nanoscale fiber model. Unfortunately, the almost prohibitive computational cost of these models precludes its large use, since this would require millions, and even billions, of atoms.Although earlier experiments showed that fibers in bone exhibit most of their HA in the EFV ,20, no mWe performed simple tensile tests using LAMMPS in order to assess the Young\u2019s Modulus values of the devised models. Our results are in good agreement with the literature, although the data reported by different groups for bone-like nanostructures fall over a broad range of values. Future computational and experimental studies could provide additional validation.By including HA in the EFV, the present Bone Fiber models take into account an important element of the biology and chemistry of fibers in bones, and can be easily modified to model larger and even more human-like bone fibers. The models unfold a new alternative to study the nanoscale mechanics of bones, and together with the information provided in this work, can be used as the foundation of future studies regarding the modeling and mechanical properties of bone at the nanoscale."}
+{"text": "In data analysis, the maximum value and arithmetic mean of the sensor data for each test period are not effective value. The characteristics of the dynamic data are: (1) Each DAW completes one test for one parameter, there is a unique effective value; (2) In test state, the fluctuation of the sensor value gradually decreases when approaching to the end of the test. An effective value calculation model was designed using the method of dimensionality reduction of dynamic data. The model was based on the distribution characteristics of the process data, and consists of 4 key steps: (1) Identify the Data Analysis Window (DAW) and build DAW dataset; (2) Calculate the value of optimal DAW dataset segmentation and build DAW subdataset; (3) Calculate the arithmetic mean (Mc) and count the amount of data in each subdataset (Fc), and build the optimal segmentation statistical set; (4) Effective value calculation and error evaluation. Calculation result with 50 sets of monitor data conformed that the EVC model for dynamic data of gas online monitoring meets the requirements of experimental accuracy requirements and test error. This method can be independently calculated without relying on the feedback information of the monitoring device, and it has positive significance for using the algorithm to reduce the hardware design complexity.The development of \u201cCC30A CH Gas composition online analysis technology has gradually diversified with the improvement of the accuracy of gas sensors Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The paper is well written and interesting. I recommend accepting it after a minor revision.1. Please note the standardization of writing. For example, there should be no colon after \"results and discussion\".2. Literature review is insufficient. I suggest that the author read the following papers and add them to the literature review:(1) Lu, H., Iseley, T., Matthews, J., Liao, W., & Azimi, M. (2021). An ensemble model based on relevance vector machine and multi-objective salp swarm algorithm for predicting burst pressure of corroded pipelines. Journal of Petroleum Science and Engineering, 203, 108585.(2) Xu, Z. D., Yang, Y., & Miao, A. N. (2021). Dynamic Analysis and Parameter Optimization of Pipelines with Multidimensional Vibration Isolation and Mitigation Device. Journal of Pipeline Systems Engineering and Practice, 12(1), 04020058.(3) Lu, H., Iseley, T., Behbahani, S., & Fu, L. (2020). Leakage detection techniques for oil and gas pipelines: State-of-the-art. Tunnelling and Underground Space Technology, 98, 103249.Reviewer #2:\u00a0This study attempts to explain design of effective value calculation model for dynamic data-flow of infrared gas online monitoring. The study develops an effective value calculation model using the method of dimensionality reduction of dynamic data. The model was based on the distribution characteristics of the process data, and consisted of four steps. This research aids in improving knowledge on gas monitoring and should be considered for publication after addressing the following suggestions / comments:1. The introduction section of the study should include the background of the study and the concept of dynamic data flow analysis for clarity on the subject. This is necessary to offer an understanding of the topic and scope of the study.2. The results and discussion section should be enhanced further. In fact, it primarily offers a summary and repetition of information already appearing in both introduction and methods section. Therefore, this section needs to be revised to offer a discussion of the study results.3. The study lacks conclusion section. This is an integral part of any research and need to be added.4. Additionally, the following style and grammatical errors should be addressed:i. Check the in-text references and make sure they are according to the author guideline. Avoid any mixing two different referencing styles. For example, in line 71 there is a superscript 9. Is this for the foot notes or a typo?ii. Ensure that you use correct symbols all through the paper. Example, check line 103iii. Follow the provided author guidelines while numbering and formatting your equationsiv. Kindly proof read your document before submission to ensure that all sentences are well structured.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0AttachmentPONE-D-20-38017 review comments.docxSubmitted filename: Click here for additional data file. 13 Sep 2021REVIEWER #1: The paper is well written and interesting. I recommend accepting it after a minor revision.Q1. Please note the standardization of writing. For example, there should be no colon after \"results and discussion\".Answer\uff1awither another reviewer's suggestion, a \u201cconclusion\u201d chapter was added after \"results and discussion\".The chapter 6\u201c6. Declarations\u201d has been modified as \u201cagreements\u201d according to the PLOS ONE specification.Q2. Literature review is insufficient. I suggest that the author read the following papers and add them to the literature review:(1) Lu, H., Iseley, T., Matthews, J., Liao, W., & Azimi, M. (2021). An ensemble model based on relevance vector machine and multi-objective salp swarm algorithm for predicting burst pressure of corroded pipelines. Journal of Petroleum Science and Engineering, 203, 108585.(2) Xu, Z. D., Yang, Y., & Miao, A. N. (2021). Dynamic Analysis and Parameter Optimization of Pipelines with Multidimensional Vibration Isolation and Mitigation Device. Journal of Pipeline Systems Engineering and Practice, 12(1), 04020058.(3) Lu, H., Iseley, T., Behbahani, S., & Fu, L. (2020). Leakage detection techniques for oil and gas pipelines: State-of-the-art. Tunnelling and Underground Space Technology, 98, 103249.Answer: These three articles are very interesting and meaningful. They have been added in references.REVIEWER #2: This study attempts to explain design of effective value calculation model for dynamic data-flow of infrared gas online monitoring. The study develops an effective value calculation model using the method of dimensionality reduction of dynamic data. The model was based on the distribution characteristics of the process data, and consisted of four steps. This research aids in improving knowledge on gas monitoring and should be considered for publication after addressing the following suggestions / comments:1. The introduction section of the study should include the background of the study and the concept of dynamic data flow analysis for clarity on the subject. This is necessary to offer an understanding of the topic and scope of the study.Answer: the introduction section has been rewritten, and add background of this study (as follows). The definition of dynamic data flow has been added in \u201cDefinition\u201d and \u201cIntroduction\u201d section.CH4 and CO2 are the key products in the anaerobic fermentation of coal or biomass, and the trend analysis of gas componsition changes is the key factor for the control of anaerobic digestion. Gas composition online analysis technology has gradually diversified with the improvement of the accuracy of gas sensors[1]. For example, using infrared CH4-CO2 gas sensor instead of gas chromatography (GC) to achieve low-cost online gas components detection and analysis. At the same time, the optimization of data analysis methods  and the improvement of computing capabilities of single-chip microcomputer, has further improved the reliability and accuracy of online monitoring. When the sensor is working, it analyzes the target gas concentration in its gas chamber in real time, and continuously send the value to microcomputer, forming a data flow which is named dynamic data flow. However, taking the CC30A CH4-CO2 combined analyzer  as an example, in order to avoid the mutual interference of the gas samples from each channel and ensure the test accuracy, the analyzer will flush gas chamber with N2 after complete each test. Meanwhile, the response time of sensor further enhanced the delay effect of test result. For sensors with quick response time , the raw sensor data is correlated with the measured parameter and identified effective data, when the data collection period is longer than the sensor response period. And for the sensor with slow response time , the effective data will be mixed with process data when the data collection frequency is much shorter than the sensor response period is. Infrared CH4-CO2 sensor is a typical case. These two factors cause the gas composition to be in dynamic changes all the time in sensor gas chamber, and effective data and process data mixes in dynamic data flow. More than 80 % of the sensor data is process data, which is invalid data, when data collection frequency is set to 1 data/S.Q2. The results and discussion section should be enhanced further. In fact, it primarily offers a summary and repetition of information already appearing in both introduction and methods section. Therefore, this section needs to be revised to offer a discussion of the study results.Answer\uff1athe result and discussion have been rewritten, and add a new figure  has been added.This model was designed for the key algorithm in CC30A CH4-CO2 combined analyzer system development. In the CC30A system, infrared CH4-CO2 sensors were used as the core analysis unit. The system needs to be physical seperated between calculation unit and analysis unit, including power ground and signal transmission. To solve this problem, only one optical coupler was used in system design to establish one signal isolation path for the two units. This simplified design improved the anti-interference ability of the system, but created a problem which was how to make the computing unit fast and complete the result analysis with low calculate resource utilization. This algorithm design was based on the analysis steps and sensor characteristics of CC30A CH4-CO2 combined analyzer, and clarifies the reason and law of the fluctuation of the infrared gas component sensor data. It was to allow the computing unit to automatically lock the data analysis window and complete the effective value calculation according to data changes in dynamic data flow. The model uses the data dimensionality reduction method to extract the data distribution characteristics. The dimensionality reduction calculation instead of curve slope change analysis or curve fitting, and completes the calculation of the effective value by the conditional judgment and mean calculation within 8 data. This algorithm calculation is mainly divided into three steps  . The calculation of the DAW subdataset and the OSS subset completed the dimensionality reduction calculation of the original data. It is the core algorithm of the EVC model. The model was verified based on 50 sets of CH4 and CO2 data. Error analysis confirmed that the EVC model for dynamic data of gas online monitoring meets the requirements of experimental accuracy requirements and test error. Figure 5 hereFigure 5 effective value calculation (EVC) model calculation flow chart.Q3. The study lacks conclusion section. This is an integral part of any research and need to be added.Answer\uff1aThis suggestion is very important, the \u201cConclusion\u201d section has been added.6. ConclusionReal-time and accurate acquisition the concentration of CH4 and CO2 in anaerobic fermentation is key indicators for monitoring the fermentation system. The design goal of the CC30A CH4-CO2 combined analyzer is to realize low-cost, automated, real-time online analysis of key gas components. Limited by the computing power of the ARM7 processor, the effective value calculation (EVC) model has been designed. The advantage of this algorithm is that only a few simple judgments and statistics are needed to replace complex algorithms to extract the target data from the data flow. According to the principle of model operation, the model can be well utilized to dynamic data flow operations with the following characteristics. (1) the effective value is related to the data distribution characteristics, and is not the maximum or average value in dataset; (2) the calculation is independent and complete according to the fluctuation of the data, and does not rely on any peripheral devices signals. The design of the EVC model enables the calculations independently, and it has positive significance for using the algorithm to reduce the hardware design complexity.Q4. Additionally, the following style and grammatical errors should be addressed:i. Check the in-text references and make sure they are according to the author guideline. Avoid any mixing two different referencing styles. For example, in line 71 there is a superscript 9. Is this for the foot notes or a typo?Answer: mistakes of referencing styles have been revised.ii. Ensure that you use correct symbols all through the paper. Example, check line 103Answer: symbols mistakes have been revised in paper.iii. Follow the provided author guidelines while numbering and formatting your equationsAnswer: all the equations and numbering have been re-edit.iv. Kindly proof read your document before submission to ensure that all sentences are well structured.Answer\uff1aThe grammar and presentation of the thesis have been modified by native English students.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 14 Oct 2021Design of Effective Value Calculation Model for Dynamic Dataflow of Infrared Gas Online MonitoringPONE-D-20-38017R1Dear Dr. Xiao,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Pasquale Avino, Ph.D.Academic EditorPLOS ONE 19 Oct 2021PONE-D-20-38017R1 Design of Effective Value Calculation Model for Dynamic Dataflow of Infrared Gas Online Monitoring Dear Dr. Xiao:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProfessor Pasquale Avino Academic EditorPLOS ONE"}
+{"text": "Biomechanical forces aggravate brain tumor progression. In this study, magnetic resonance elastography (MRE) is employed to extract tissue biomechanical properties from five glioblastoma patients and a healthy subject, and data are incorporated in a mathematical model that simulates tumor growth. Mathematical modeling enables further understanding of glioblastoma development and allows patient-specific predictions for tumor vascularity and delivery of drugs. Incorporating MRE data results in a more realistic intratumoral distribution of mechanical stress and anisotropic tumor growth and a better description of subsequent events that are closely related to the development of stresses, including heterogeneity of the tumor vasculature and intrapatient variations in tumor perfusion and delivery of drugs.The purpose of this study is to develop a methodology that incorporates a more accurate assessment of tissue mechanical properties compared to current mathematical modeling by use of biomechanical data from magnetic resonance elastography. The elastography data were derived from five glioblastoma patients and a healthy subject and used in a model that simulates tumor growth, vascular changes due to mechanical stresses and delivery of therapeutic agents. The model investigates the effect of tumor-specific biomechanical properties on tumor anisotropic growth, vascular density heterogeneity and chemotherapy delivery. The results showed that including elastography data provides a more realistic distribution of the mechanical stresses in the tumor and induces anisotropic tumor growth. Solid stress distribution differs among patients, which, in turn, induces a distinct functional vascular density distribution\u2014owing to the compression of tumor vessels\u2014and intratumoral drug distribution for each patient. In conclusion, incorporating elastography data results in a more accurate calculation of intratumoral mechanical stresses and enables a better mathematical description of subsequent events, such as the heterogeneous development of the tumor vasculature and intrapatient variations in tumor perfusion and delivery of drugs. Glioblastoma multiforme (GBM) is one of the most common primary brain tumors ,2. DespiMathematical models can be divided into two categories based on the scale at which the tumor is represented. The models can be discrete/stochastic, with an emphasis on the microscopic scale and the interactions at the cellular level, or continuum models, which focus on events taking place at the macroscopic scale ,7. HybriThe realization that not only biological and brain physiological factors but also biomechanical forces drive brain tumor progression has led to the development of mathematical models that account for tissue biomechanical properties ,24. The For a better understanding of the biomechanical tumor microenvironment, a detailed quantification of the mechanical properties of the normal and tumor brain is required. Magnetic resonance elastography (MRE) is a promising imaging technique, which allows for noninvasive quantification of the mechanical properties of tissues by applying external vibrations . BiomechTo this end, we present a mathematical model that incorporates not only conventional anatomical and DTI MRI data but also considers MRE data for a more realistic representation of the biomechanical properties and mechanical stresses in healthy and malignant brain tissues. The model combines the elastography data of a healthy subject\u2019s brain with those of five patients with GBM. Our model simulates tumor progression by assuming that the non-uniform distribution of mechanical stresses promotes proliferation towards low-stress regions ,56,57,583 to 110 cm3 (median 60 cm3). Imaging was performed before any treatment. For a healthy subject (a 34-year-old woman), the MRE imaging was extended to cover the entire brain.MR imaging was performed on a 3T clinical MRI scanner  using a 32-channel head coil. Anatomical T1-weighted, T2-weighted and fluid attenuated inversion recovery (FLAIR) images, as well as DTI MRIs and MRE data, were acquired for five patients, using imaging parameters as in , also shStorage and loss modulus values were derived from the MRE data using a localized divergence-free finite element reconstruction ,62. The A brain geometry employed in a previous study  was usedA mesh was generated in COMSOL Muliphysics . A finer mesh was used inside and around the tumor domain compared to the rest of the brain in order to improve accuracy and reduce computational cost. The mesh included two types of elements: 1008 prisms that form boundary layers at the tumor boundary and 34,468 tetrahedra for the rest of the geometry.The storage and loss modulus and diffusion tensors derived from the healthy subject were interpolated in the brain domain. This was done by using a Matlab\u2019s built-in interpolation function  to interpolate the data existing in the Matlab matrixes to the nodes of the finite elements in COMSOL Multiphysics. The same interpolation was used for the patient\u2019s data to the initial tumor seed. This required a deformation of the patient\u2019s data prior to the interpolation, as shown in For each patient dataset, a rectangular parallelepiped containing the tumor data was extracted. For each patient\u2019s data, the rectangular parallelepiped had the smallest possible dimensions that fitted inside the tumor domain. The parallelepiped was deformed into a cube and then interpolated to the initial tumor seed. For each simulation performed, the tumor seed was subjected to each patient\u2019s elastography data and to the same surrounding elastography data of the normal tissue . This was done to examine the effect of different tumor elastography properties on the tumor growth.The complex shear modulus  modulus . In the Tumor growth is based on principles of continuum mechanics. The deformation gradient tensor, mponents ,65.(3)FThe elastic component of the deformation gradient tensor is calculated as,lated as ,66,(6)1isotropy . When A r growth . For A\u00a0>agnitude ,56,57,58,The growth term, ty, Tcel ,(10)rg=According to the biphasic theory for soft tissues , the totThe Cauchy stress tensor, essed as ,(12)\u03c3s=e tissue .(13)W=G, was normalized by division with a reference initial value of Cancer cell density, ells/cm3 . Thus, t DTI MRI ,16,72. Ith is the hydraulic conductivity of the interstitial space [Normal and tumor tissues have properties similar to those of a porous medium. According to Darcy\u2019s law, the interstitial fluid velocity is given byal space . The masal space ,75,(18)The first term of the right-hand side of Equation (18) describes the fluid flux entering from the blood vessels and the second term the flux exiting through the lymphatic system.  vessels .The rate of change of oxygen concentration in the tissue was modeled with a convection diffusion equation that includes a source and a sink term ,78. The Cancer cell infiltration was studied in our previews work . Thus, ipression , and by The functional vascular density can be expressed as ,(22)Sv=ribed in . The comThe therapeutic agent can exist in three states: it can travel freely through the interstitial space (ates are .(23)\u2202cfThe free drug that travels in the tumor interstitial space, Starling\u2019s approximation was employed for the transport of drugs across the vessel wallsthe drug ,80:(28)LAt all internal boundaries/interfaces of the computational domains, COMSOL automatically assigned continuity. For the calculation of the displacement fields and stresses, the external surfaces of the brain were considered to have a fixed boundary  and, thus, the distribution of the drug taken up by cancer cells. The non-uniform spatial distribution of the vasculature can be observed in Incorporation of anisotropic growth  allows for the development of more realistic, non-spherical tumor shapes and growth towards the region of lower stresses. Interestingly, an increase in the anisotropic parameter, A, does not have a large effect on the shape of the tumor. The overlap of the tumor shapes is displayed in Subsequently, we repeated the simulations using the MRE data of the other four patients , with eaVessel compression owing to mechanical stresses causes a reduction in the vessel diameter that limits the area of the lumen available for blood flow. This can have a detrimental effect on tumor perfusion and the functionality of the vessels as the higher the magnitude of stresses the more compressed the vessels become. Abnormal development of vessels during tumor-induced angiogenesis results in vessel hyper-permeability and openings in the tumor vessels wall that can be hundreds of nanometers large . For larFor larger pores, the lack of pressure gradients eliminates drug transport through convection inside the tumor, and, thus, diffusion becomes the dominant transport mechanism (Equation (26)). Thus, the drug accumulates at the tumor periphery, where both convection and diffusion are prominent, and is washed out from the tumor to the host tissue .In Importantly, incorporation of MRE data can affect model predictions of drug distribution independently of the size of the vessel walls . This isNext, we repeated the simulations for the delivery of drugs of different sizes: 2 nm, 70 nm and 150 nm, accounting for small molecules and for nanoparticles .For the constant elastic properties scenario, the drug distribution is symmetric in the radial direction. This is not the case when the MRE data are included, in which regions of lower functional vascular density exhibit reduced drug delivery. The reduced drug delivery in the MRE cases can be further observed by the decrease in the standard deviation when comparing them with the corresponding constant elasticity values . MoreoveFinally, we employed the elastography data of all the patients to investigate the different patterns of drug delivery within patients .The results show that the incorporation of patient-specific elastography data can affect the delivery and intratumoral distribution of the drugs. Regions of lower functional vascular density vary among patients, and this results in a distinct drug distribution for each patient. To compare these five cases, we evaluated the fraction of the tumor that receives a drug concentration greater than a specific value . This frThe important role of mechanical forces in tumor progression and therapy is well established ,31,32,41The incorporation of elastography data resulted in a non-uniform distribution of mechanical stresses. The incorporation of anisotropic growth allowed the development of a more realistic non-spherical tumor shape and growth towards the regions of lower stresses. The non-uniform mechanical stresses induced a non-uniform distribution of vascular density due to vessel compression. This resulted in a non-symmetric distribution of drugs where regions of lower functional vascular density exhibited reduced drug delivery. Stress distribution, vascular density distribution and drug delivery are unique for each patient\u2019s MRE data, and, thus, the inclusion of MRE data allows patient-specific predictions.Smaller pores of the vessel wall induced a smoother distribution of interstitial fluid pressure. The incorporation of MRE data did not change the magnitude and elevation of interstitial fluid pressure. Smoother pressure gradients caused a more uniform distribution of drug inside the tumor. In addition, our results suggest that smaller drugs can be transferred faster through the pores of the vessels and delivered in larger amounts to the cells compared to larger drugs. Overall, our findings can be used to improve treatment response assessment and evaluation of pharmacological strategies as MRE is a noninvasive imaging technique that can be added to patients\u2019 MR examination. MRE is an emerging imaging technique that has been used in several studies of patients with brain tumors . CurrentSeveral simplifying assumptions were made in this study. For the host tissue, elastography data of a healthy subject were used because the clinical patient scans did not cover the entire brain, only 4.65 cm, covering the tumor. Because the patients differ from healthy subjects in terms of MRE values , more acThe presented methodology and results led to the conclusion that incorporating the tissue elastic properties assessed by MRE and anisotropic growth into mathematical models can result in more accurate predictions of the distribution of mechanical stresses in tumors. This produces an improved mathematical description of subsequent events that are closely related to the development of mechanical stresses, including the heterogeneity in the functional vasculature of the tumor and intrapatient variations in tumor perfusion and delivery of drugs."}
+{"text": "We extract expert features of all measurements and find significant changes in multiple modalities. Ultimately we train and evaluate machine learning algorithms using single and multimodal inputs to distinguish cognitive load levels. We carefully evaluate model behavior and study feature importance. In summary, we introduce a novel cognitive load test, create a cognitive load database, validate changes using statistical tests, introduce novel classification and regression tasks for machine learning and train and evaluate machine learning models.Driver monitoring systems play an important role in lower to mid-level autonomous vehicles. Our work focuses on the detection of cognitive load as a component of driver-state estimation to improve traffic safety. By inducing single and dual-task workloads of increasing intensity on 51 subjects, while continuously measuring signals from multiple modalities, based on  The rapid development of novel sensor technology, powerful computing capabilities and methods using artificial intelligence has moved the prospect of autonomously driving vehicles into a potential candidate to transform the way people experience mobility. This development is a promising direction for traffic safety. Surveys ,2,3 repoThese states are of special interest, since engaging in dual- or multitask settings, a driver\u2019s attention is a finite resource and cognitive limitations are soon met . The resSubjective measurements can capture Perceived Mental Workload (PMWL) as shown in early studies, that used a mental-effort rating scale with 9-grades as symmetrical categories from very, very low mental effort (1) to very, very high mental effort (9) [Performance measurements are strongly related to the task imposed on the subject. Several metrics have been used in the past, such as the number of mistakes made during a complex learning task [n-back [Behavioral Measurements such as linguistic [Physiological Measurements, include other properties of the eye, such as pupil diameter or pupil change responses [One can study the concept of CL empirically, through meaningful measurements from four categories ,13. Subjfort (9) , while rfort (9) ,16,17. Efort (9) , (b) theing task  or more  [n-back . Others  [n-back . In the nguistic , speech nguistic ,23,24, dnguistic ,26 or conguistic  are commnguistic ,29. Anotnguistic ,31, thatesponses . Other pesponses . Both phesponses .Our attempt to measure cognitive load using multimodal data is influenced by other areas of research, that try to detect psychological states, especially contributions in the area of affective computing. Lisetti et al. have summarized early work in a review article, highlighting several contributions that show statistically significant changes in different elicited emotions . Wang etn-back task based on datasets, that have been introduced in\u00a0[In addition to the study of emotions and stress, other researchers already studied the concept of cognitive load while driving using multidimensional measurements. Haapalainen et al. studied the effect of various elementary cognitive tasks while recording the psycho-physiological activity using wearables . Hussainduced in\u00a0,54.Some datasets are not publicly available to the research community. We release recordings of 30 subjects.physiological and behavioral measurements, subjective questionnaires and performance metrics.Related work collected combinations of input modalities from subsets of relevant measures, while our work combines a diverse set of modalities form In recent years, researchers introduced and studied various tasks, however, we as a research community failed to provide a database where the same subject participated in different tasks with different intensities of cognitive load in one recording session. Our setup fills this gap and therefore enables the analysis of distribution shifts and the evaluation of the robustness of predictors with representations that generalize across tasks and test the effects of subject-wise shifts during analysis.Missing information about metadata of the sample population like age, sex and personality traits, as well as the potential inclusion of subjects with undetected medical conditions or medication treatments, that might interfere with some measurements.Aside from the research gaps, described below and answered throughout this study, the analysis of related datasets makes it apparent, that issues with current data acquisitions setups and datasets remain:We implemented a simulation environment for autonomous driving software to induce different levels of cognitive load and a fully synchronous network of recording devices for multimodal measurements.We create a dataset that provides a wide range of physiological modalities, subjective ratings, performance metrics, behavioral data and biomarkers with precisely annotated phases of multiple levels of cognitive load.We conduct a robust statistical evaluation, and present various statistical and expert features with significant changes for multiple modalities.We identify several meaningful combinations of modalities to measure cognitive load using multimodal fusion techniques.We propose a novel continuous cognitive load value, combining subjective and performance measurements as a target for training.Autonomous Driving Cognitive Load Assessment Database (ADABase), containing 30 subjects to the public to enable the development of novel algorithms for multimodal machine learning.We release In this work, we focus on the estimation of cognitive load, collecting measurements of all four groups: physiological measurements, performance measurements, subjective measures and behavioral measures. For our subjective measurements, we employ the multidimensional NASA-TLX test. For performance measurements, we measure based on correct and incorrect hits recall and precision for our tests, as well as the reaction time. Our physiological measurements include Electrocardiography (ECG), Electrodermal Activity (EDA), Electromyography (EMG) Photoplethysmogram (PPG), respiration and eye tracker data. For behavioral measurements, we use action units extracted from video recordings. We enrich these data records through a detailed analysis of our study cohort design. To explore the potential use of cortisol as a biomarker for CL, prominently used in stress studies, we collect salivary samples. Furthermore, our statistical analysis of various extracted statistical and medical-motivated expert features provides explainable measures of cognitive load. We train various machine learning models to predict CL of subjects while participating and observing a close-to real-world driving simulation of an autonomously driving car. This leads to our key major contributions:n-back test for easier alignment with related work.In addition, research gaps in related works are clarified by providing a detailed analysis of 51 subjects with multimodal data recordings including modalities that are only briefly studied, such as action units and cortisol measurements at different levels of cognitive load. Furthermore, we combine multiple modalities that are until now, studied in subsets in related work, to a superset of modalities for cognitive load estimations, including remote measures such as eye tracking data and facial videos. We have created a new simulation with a close-to-real-world autonomous driving scenario, while also recording the extensively studied n-back test introduced in n-back), commonly used in cognitive neuroscience to measure the working memory and its capacity, the results may generalize well to similar\u00a0scenarios.To study the concept of cognitive load and develop machine learning algorithms, that utilize multimodal data for the detection of different cognitive load levels, this study focuses on the implementation of a fully integrated driving simulator. Our simulator includes the ability to record a wide range of physiological signals, face videos and eye tracker data, performance data, task-specific subjective feedback self-evaluations, personality traits and stress-related questionnaires while ensuring that all data points are synchronized across multiple acquisition platforms and modalities. In this study, we induce CL in two different ways. The first test is motivated by recent advances in the development of autonomously driving vehicles. We developed a test with subject/test-system interactions, that are similar to driver/vehicle interactions in lower-to-mid-level-autonomous vehicles. This test is introduced in One of the many development contributions in this dataset is the usage of high-precision multimodal recordings and coordinated cognitive load simulation. The simulator for both tests is introduced in The demographic data of all participants was acquired through self-reporting. Reported parameters were age, sex, weight, height, the highest obtained educational degree, state of employment, first language, state of driving license, as well as the duration of driving experience and handedness. Subjects with medical conditions or subjects under medications, that are known to have an impact on behavior, cognition, physiology or the HPA axis analyzed in this experiment, have been excluded upfront.The acquired dataset consists of 51  subjects with an average age of ribed in , we idenonnaires . To analonnaires  as an asn-back Test: A established and commonly used continuous assessment of the wm, described in k-drive Test: An application task with multiple levels of cognitive load with a primary and secondary task, while observing an autonomously driving vehicle, described in During the complete experiment, the subjects were located in the center, sitting in an upright position in a simulator car seat . The user inputs were entered using the button controls of a steering wheel . The different tasks were visualized using a multi-monitor setup (four 4K 55inch monitors) to enable an immersive experience and a simulation environment that is motivated by real-world car cockpits. All commands, instructions and custom tests were shown on the top monitor, while the three monitors below were used to show the driving simulation. The tablet was located on the side of the dominant hand. The test system was running depending on the active study phase, several custom applications, which were written in PsychoPy [The experimentation schedule consists of two main test phases, separated by a questionnaire phase to acquire self-reported subjective measures, targeting mental-well being, chronic stress and all demographic information reported in PsychoPy , exectueThe experimentation software is developed using PsychoPy version 2021.1.0. All experiments and user instructions are described in German language within the software. To mitigate any effects that can arise from personal interactions between the examiner and the subject only a few interactions are required during the experimentation phase. At the beginning/end of the experiment, the subject is connected/disconnected to the Biopac system. During the questionnaire phase or before the driving test starts, the tablet is positioned by the examiner to ensure ergonomic accessibility. In addition to these interactions, the salivary samples are collected given the described schedule in  button to indicate that the autonomously driving car is passing another car (overtaking). In level 2, the subject is additionally asked to indicate that the car is being overtaken, which can be detected by pushing the  button. For the last level (3), events of high acceleration and deceleration need to be detected by pushing the  button. All driving sessions were simulated using the playback of a pre-recorded Assetto Corsa  KUNOS Simulazioni s.r.l., Via Degli Olmetti 39/B, 00060 Formello (RM), Italy) screen capture and were presented on the three lower monitors shown on the left side of https://www.assettocorsa.it/tracks/ (accessed on 25 November 2022)), with twelve other cars that followed the road. The selected racetracks contained curvy and straight street segments without two-way traffic to simulate one-way highways. For easier reference, we are using the notation: k-drive, where k indicates the number of actions the user needs to react to and set  /  /  / ).We are simulating a semi-autonomous driving experiment, where only little interaction of the subject with the vehicle is required and increasing levels of single- and dual-task load is put onto the subject. The steering, gas and brake control as well as gear shifting is autonomously controlled by the simulator. The subject\u2019s interaction is limited to three buttons, located on the steering wheel to detect three different maneuvers as a primary task. During level 1, the subject can use the n-back test  is used to familiarize the subject with the music application, presented on the IPad. We run these baselines to ensure an ergonomic and familiar setting and record baselines for task-specific shifts, such as moving your eyes from the on-road screen to the iPad music application. We record positive (action was detected correctly) and negative hits  as well as reaction time for our primary task. Additionally, we count the number of added songs that were added to the playlist for levels 2 and 3 for our dual-task experiment.Similar to our dual-task test see , the subn-back test [n-back test run, the subject had different baseline phases. The schedule for the complete test run and the baseline phases is visualized in  and for an auditive event the , respectively.In addition to our driving simulation, we conducted an ack test  that is ack test . In our We recorded both, positive hits (when the reaction to a stimulus was correct) and negative hits . For positive hits, we recorded the reaction time from the beginning of the stimuli until the button was pressed. The evaluation protocol for positive/negative hits and reaction time is described in The appendix of this publication provides an overview of the experimentation sequence in k-drive and n-back levels. Woody et al. have bisected the cognitive component and social evaluative component of stress and found that social evaluative thread in absence of cognitive load led to greater cortisol values while increased cognitive load had no main or additive effect [The measurement of glucocorticoids has proven to be a significant auxiliary value to detecting acute social stress responses using salivary samples ,61. Earle effect  on cortie effect  have idee effect ,65, we mn-back tests and drive scenarios, we ask the subject to self-evaluate and report the effort required to complete the given task. These subjective measures often vary. However, to a certain degree the self-reported ratings can reliably determine the CL put on a certain task [n-back test, three ratings for our dual workload n-back test and three ratings for our driving experiments. In addition, we evaluate perceived stress over the last month and therefore set a baseline for our evaluations. We utilized the Perceived Stress Scale (PSS) by Cohen et al. [n-back test. Utilizing a 5-scale Positive and Negative Affect Schedule (PANAS) introduced in work by Watson et al.\u00a0[After every phase of the aforementioned ain task ,17,66. Iain task . We keptain task . We colln et al.  to enabln et al.  the 5-scn et al.\u00a0 with 10 n-back test, and our k-drive test, the maximal time between the beginning of an event and the time when the user could react to this event was set to 3 s. Similar to the nomenclature used in classification tasks we compute and report recall, precision and Performance is commonly used to measure cognitive load as introduced in n-back task. For the secondary tasks during levels 2 and 3 of k-drive we only collect the correctly added songs to the playlist  and report only our recall-motivated performance metric.The same metrics are also computed for the secondary auditive Ag-AgCl electrodes . The skin was prepared with an isopropyl solution. The surface EMG was recorded to capture the activation of the trapezius muscle using three electrodes. The reference electrode is placed on the seventh cervical vertebra (C7), and the other two electrodes for measuring the activation are placed at the right lateral trapezius muscle. The EDA electrodes were placed on the palmar side of the index and middle fingers (digitus manus 2 and 3) at the medial phalanges. To compensate for changes in conductance at the beginning of the recording, the placement of the electrodes was done at least 10 min before the recording started. For skin preparation, only warm water was used. The PPG signal was measured on the tip of the middle finger (digitus manus 3). Skin Temperature (SKT) was measured using a sensor placed on the tip of the index finger (digitus manus 2). All, EDA, PPG and SKT were measured on the non-dominant hand, which was placed on the leg and could rest without movement as no interaction was required. Respiration cycles were recorded using the BIOPAC MP3X respiratory effort transducer, measuring the change in thoracic circumference. During the early stages of our experimentation development, we recorded electroencephalographic recordings using a Mobita ConfiCab with 32 channels. We stopped the acquisition of these recordings during this experiment, as some subjects, reported headaches after the long duration of wearing the electrode cap.For data acquisition, we used a Biopac MP160 system and specialized Biopac modules ECG100C, EGG100C, EMG100C, EDA100C, PPG100C, RSP100C and SKT100C for the corresponding modalities. We used a sampling frequency of 2000 Hz for all modalities, as storage was not an issue in this simulator setting and the analog synchronization across multiple devices, modalities and time stamps is ensured to be consistent. For ECG recordings, we use the Einthoven, Lead I and Lead II with a limp sensor placed below the shoulder and lower torso using W.We opted to extract features based on statistical signal properties and medical expert features for all biosignal modalities. Features extracted from electrocardiography recordings, reflecting the electrical activity of the human heart, are, except the heart rate itself, based on the concept of Heart Rate Variability (HRV). The HRV is impacted by modulations of biochemical processes, that correspond to the activation of the parasympathetic and sympathetic nervous systems. In addition to recordings of the electrical activity of the heart, we measure the mechanical activity using PPG sensors. Studies have extracted features based on the variability of the pulse waves, so call Pulse Rate Variability (PRV) features. In this publication, we are not interested in the estimation and computation of PRV features, because they have a strong correlation with HRV features, but are more sensitive to movement artifacts in our acquisition setup . RecordiMany studies have shown the relevance of eye-related characteristics for the prediction of a person\u2019s cognitive state . For eyeW we extract the number and duration of fixations, saccades, and blinks as well as the mean saccade amplitude, thus the mean distance for a saccadic movement. As pupil-related features, we select the mean pupil size and two other features that take pupil change into account. To calculate the index of pupillary activity (IPA) we follow [In accordance with the literature, we extract multiple features based on fixations, saccades, blinks, and pupil dilation. An overview can be found in e follow ,94.One of many indices in this study is the analysis of facial cues. These facial cues are sometimes closely related to messages, that express emotion, such as anger, fear, disgust, happiness, sadness or surprise. As we are highly interested in such behavioral expressions and their relationship to cognitive load, we record the subject\u2019s face during the complete experiment. A BASLER acA1920 155 \u03bcm  camera was used to record a video stream with a resolution of 1920 \u00d7 1080 at 25 frames per second, which was triggered using the BIOPAC analog output, to ensure a fully synchronized recording. Depending on the position of the subject, we extracted 1024 \u00d7 1024 pixels as a region of interest and resampled it to a 512 \u00d7 512 frame. For action unit extraction we used the SVM model developed by Cheong et al. , using Dk-drive and n-back test, including baselines, training and testing phases. For statistical evaluation and machine learning, we used the window that was in the center of the respective phase described in The recording of biosignals is prone to various artifacts, while we designed our recording environment with great care, in some situations it is not evitable that artifacts degrade signal quality. Due to the complex nature of our environment, we were not able to prevent 50 Hz power line noise and removed this frequency component, if applicable, and all higher harmonics from the recorded signals using a notch filter. For our ECG feature extraction pipeline it is crucial to detect the R-peaks with high sensitivity and specificity. To ensure only sequences with sufficient quality are used during evaluation, we have computed Signal Quality Index (SQI)\u2019s based on work by Zaho and Zhang of both leads and selected the lead with better SQI\u2019s or if both leads are corrupted, we exclude those intervals from the evaluation . For vidn-back and k-drive and normalize the extracted trials using subject-wise z-score normalization. We used the MAD-rule to remove outliers of our features. When working with combinations of multiple features, we drop the complete instance (feature vector) that contains a missing value from our dataset and therefore out machine learning experiments. We do not employ any imputation technique, for missing data, but remove the entire sample that contains a missing feature value. We report the percentages of available records after these steps in To summarize our feature-extraction and preprocessing protocol, for all records used in our statistical evaluation and machine learning pipeline, we start by rejecting artifacts as described above in this section and exclude corrupted parts of the signal. If the examiner reported recording issues during acquisition , we removed the corrupted parts from the sequence. Given the recorded, fully synchronized trigger signals, we define the windows of the baselines and levels. Following that, we computed all features for each modality using a rolling window over the complete experiments of p-values using Holm\u2013Bonferroni correction for our experiments (k-drive and n-back) separately. For features that changed significantly according to our repeated measures ANOVA, we conducted post hoc-tests. If the post hoc-test results show a p-value below our level of significance To analyze the effect of different experimentation levels (factors), on our extracted expert features  we conduct a one-way Analysis of Variance (ANOVA) for repeated measurements, observing if there are significant changes. We determine if the data is distributed normally, using a Shapiro\u2013Wilk test. If the criterion of normality for ANOVA is not met, we conduct a non-parametric Friedman test as omnibus test instead. The assumption of sphericity was controlled by a Mauchly\u2019s test. Whenever necessary, we employ a Greenhouse-Geisser correction. As we conduct multiple comparisons we adjust our Autonomous Driving Cognitive Load Assessment Database (ADABase) was recorded to study subjects under different levels of cognitive load while observing an autonomously driving vehicle, using multi-modal representations of physiological-, behavioral-, subjective- and performance-based measurements. We create various downstream tasks for classification and regression. As a first task, we separate our recording into two levels of cognitive\u00a0load:Low Load Class, without any task or undemanding tasks imposed on the subject.A High Load Class with tasks of high demand introducing high cognitive load.A Using this setup we evaluate three different experiments: For the visual-only n-back task we select the observation-only-baseline and the 1-back level as low load class and the 2-back and 3-back levels as high load class. The same phases are used for audiovisual classification. For complete n-back classification we used both baselines (resting and no-task observation), 1-back visual-only, 1-back audiovisual testing phase as low load class and 2-back and 3-back visual-only and audiovisual for high load. Using this classification scheme has several advantages of having a balanced class distribution, being able to evaluate single-only and dual-only vs. single-and-dual task loads, and capturing different levels of the load imposed by the given tasks. We propose to use this labeling scheme for k-drive, too. For our low load class, we use the baseline with an observation-only driving example as low load class and 1-drive as high load class. For our dual-task-load classification of k-drive, we use the baseline with observation-only driving and the baseline with secondary-task observation only as low load and 2 and 3-drive dual task as high load. We also train a classifier on the combination of n-back and k-drive schemes, leading to a single-task, dual-task and a combination of both binary classifications. It is important to note that these classification groups have been carefully selected to include similar tasks  to mitigate the effects of distribution shifts, like not looking to the monitor or infotainment system and light patterns that influence the pupil dilation.n-back and k-drive. For k-drive, we use the observing-only-baseline and 1-drive for low load, 2-drive for medium load and 3-drive for high load. For n-back we use the observation-only baseline and visual-only 1-back as low load, 2-back visual only and 1-back dual task for medium workload and 3-back visual-only and 2-back and 3-back audiovisual for high load. It is noteworthy that the records collected during the specific phases, using these splits are not equally distributed.In addition to this very coarse-grained experiment of low vs. high load , we creaWe propose several targets for our regression tasks. The first task is to use performance metrics only, averaging a score based on the recall of the primary task  and 1 is the worst of the complete study population) and the reaction time of the primary task . As a second target, we use the NASA-RTLX score, scaled between 0 and 1, where 1 is the highest task load reported by the specific subject and 0 is the lowest reported task load of that subject. We drop all baselines from this dataset. For our third task, we compute the average of both targets and therefore use performance and subjective rating as a continuous target between 0 and 1 for our regression algorithms.n-back, dual-n-back, single-k-drive, dual-k-drive the combinations of both, single and dual-task load, and both experiments, n-back and k-drive. Using this experimentation schedule we can as an extension to our statistical evaluation in For evaluation, we conduct several experiments. We group our features modality-wise and train a classifier using the binary-task-classification to train and evaluate classifiers for all sub-tasks: single-Past studies in the affective sensing multimodal human sensing community have shown promising results using eXtreme Gradient Boosting (XGBoost) as a machine learning technique for classification . We follner fold  and optin-back and k-drive in We structure our results similar to the sections in n-back as the first experiment and 26 subjects with k-drive as the first experiment. Due to the malfunction of the eye-tracking hardware, for six subjects the eye-tracker data is missing. A defect in the camera trigger line led to synchronization issues of video data with the rest of the test system and some subjects refused the recording of video signals with privacy concerns. We excluded the video data for 17 subjects, leading to missing action units for these subjects. For two subjects the skin temperature data saturated at maximum, caused by defective sensors connectors. For some subjects Eindhoven lead II of the ECG was noisy or the electrode fell off. As an alternative, we used the other lead for R-peak detection and feature computation. If temporary errors occurred during the recording , we drop only these specific intervals using our artifact correction mechanisms described in Each subject participated in both experiments described in n-back baseline 1, and k-drive baseline 1 were resting phases of at least 5 min, where the subject was instructed to rest without any interference or additional tasks. During the second n-back baseline phase the subject observed an n-back sequence without any task imposed on the subject. In the second k-drive baseline an autonomous driving simulation was presented without any task imposed on the subject. The third k-drive baseline was introduced to the iPad infotainment application, used for dual-task load scenarios of k-drive. As introduced in ADABase to learn representations of cognitive load on different timescales. Starting with a continuous prediction, only limited by physiological processes in the test subject, followed by more medium-grained task-specific phases, that combine training and testing, to coarse-grained phases that differentiate between single and dual task loads tasks.k-drive. All Holm-adjusted p-values were with After every testing phase, we asked the subject to answer a NASA-TLX questionnaire. We conducted t-tests of raw NASA-TLX values between 1-back and 2-back, 2-back and 3-back and 1-back and 3-back and the same for all levels of n-back tests and all our k-drive tests, we conducted t-tests for both recall and precision of the visual performance between the first level and the second level, the second level and the third level, as well the first and the third level. All Holm-adjusted p-values are smaller than 0.001. We report primary and secondary task performance and reaction time for all tests in For every level in our single and dual task n-back  and k-drive (Post-00) could not be rejected with a sufficient level of significance. This result is in line with other studies analyzing cortisol after phases of high cognitive load [n-back and k-drive tests, we report the cortisol values over the absolute daytime, showing the circadian variation of cortisol of the sample population.We report the relative median values and quantiles of the raw non-normalized cortisol measurements in ive load . In addin-back (n-back: n-back tests with single- and dual-task load. Comparing the features during the observation only baseline and the medium level 2-back and high level 3-back cognitive load task as post hoc experiment and evaluation of an increasing or decreasing mean for significant changes shows an increased heart rate, a decreased heart rate variability, a decreasing skin temperature, decreasing mean respiration rate and an increasing IPA. For the EDA activity we could not reject the null hypothesis for all repeated measures. We selected the baseline tutorial phase for our post hoc test because no cognitive load was introduced during this phase, while the subject was still observing an n-back sequence with similar lighting and pose conditions. All results are reported in For statistical evaluation of features measured during  n-back:  levels, k-drive following our statistical evaluation protocol desribed in n-back experiment an increasing heart rate, a decreasing heart rate variability, a decreasing skin temperature and an increasing IPA. All results are reported in We evaluate our measurements of features during all levels of n-back and k-drive, we extract action units from facial videos as described in n-back test in n-back and k-drive for our omnibus test. Our n-back tests change the number of activations of brow lowerer (k-drive tests showed a significant change in inner brow raiser (For both experiments r as correlation coefficient and r.When characterizing stress responses using multimodal physiological data, personality traits play an important role . Figure n-back baselines, k-drive baselines, 1-back single task and level 1 drive task and red indicate phases with high cognitive load: 2/3-back single task, Using our extracted biosignal features, we have computed t-SNE representations with two components of different feature subsets. Representations are computed for all participating subjects. The colors indicate the coarse-grained binary classes, where blue contains the ground-truth labels XGBoost as model. Our first experiment determines the effect of using features from different and multiple modalities as input for binary task classification. The results are reported in tabular form in n-back tests, single- and/or dual-task load k-drive tests and combinations of both. The AUC of models trained on the combination of all biosignal features is n-back and k-drive tests. Models using only PPG as input achieve a AUC of n-back and k-drive tests. Another noteworthy finding is that eye tracker features perform equally well for all conducted tasks with a AUC of n-back test and a AUC of k-drive test, while other modalities such as EDA perform well for k-drive with n-back tests with a AUC of The automatic detection of cognitive load using computerized programs is a key ingredient for deployment in semi-autonomously driving cars. We conduct several experiments described in XGBoost for classification and can therefore express the feature contribution to the final classification as gain metric, that implies the relative contribution of the corresponding features to the final prediction of the model. XGBoost model and both heart rate and heart rate variability based features extracted from the electrical activity of the heart. In To further study the impact of all acquired features on classification performance for our binary classification task, we analyze the models that used all tasks, levels and features from all modalities for training. As described in k-drive using all features, high-load is often confused with medium-load and only detects 69 percent correctly. This holds for different subsets of features and tasks. We can observe that the identification of multiple levels, degrades performance, leading to an k-drive test.In addition to our low vs. high cognitive load task, we introduced a classification task for multiple intensities of cognitive load in XGBoost models performed best for the detection of drivers\u2019 distraction from physiological and visual signals [Previous literature found that  signals . We confXGBoost regressor. The regression targets are described in In addition to our classification tasks, we train a regression model using a The presented results compiled in the previous chapter of this study provide a valuable addition to the research community assessing the effect of cognitive load using multimodal measurements.n-back test with visual-only stimuli and audiovisual stimuli inducing cognitive load. As an application-motivated test, we developed the k-drive test, which is inspired by the observations of semi-autonomously driving cars with only a few driver-car interactions required. This test imposes cognitive load by an increasing number of events the subject needs to respond to. In addition, a secondary task of interacting with a car infotainment system needs to be executed for dual-task load tests.With a carefully designed study population and a detailed cohort description, we conducted two experiments with various levels of cognitive load. As a reference experiment, that is comparable to experiments on cognitive load in related work, we asked the subjects to participate in a single- and dual-task load physiological measurements include biosignals such as ECG, PPG, EDA, EMG, skin temperature and respiration recordings as well as eye tracker data. We found significant changes in established expert and statistical features during both, n-back and k-drive, which revealed an increasing heart rate, decreasing heart rate variability, an increasing number of peaks in the electrodermal activity, a decreasing mean skin temperature, a decreasing respiration rate and an increasing eye tracker IPA during cognitive load compared to non-load baselines, to name only a few. Our findings of a positive correlation between IPA and cognitive load align with previous research that has reported promising results using IPA in cognitive load measurement [behavioral measurements based on facial videos. Using simple features based on the number of activated action units within a certain time frame, we found several action units that changed significantly for increasing levels of task demand of n-back and k-drive levels. These observations are supported by the findings of Yuce et al. who analyzed the link between action units and cognitive load while driving [performance metrics for all conducted n-back and k-drive tests and levels for both secondary and primary task loads, including precision and recall. In combination with the subjective feedback, acquired through NASA-TLX questionnaires following every test, we found properties of human responses, that are statistically significant across all analyzed dimensions: physiological, behavioral, performance and subjective measurements. Comparing our collected dataset with work analyzed by a recent review of related data collections by Seitz et al., confirms the validity of our multimodal approach for the computerized detection of cognitive load, differentiating our setup with a combination of multiple modalities, that all have been used in subsets, but not as a combination during the same protocol [Our study compiled a recording setup for multiple modalities. Our surement ,110,111.surement ,113,114  driving . We measprotocol . The revprotocol .XGBoost classifier, showing important contributions of features like heart rate, heart rate variability, change of skin conductance within a given time interval, IPA, fixations and saccades of our eye tracker data as features with strong predictive power in our binary low-vs-high cognitive load classification task. During n-back we were able to control the lighting conditions to be more stable, compared to the application-motivated k-drive test. This could be a reason, why IPA is the most important feature for the detection of cognitive load for one task while losing importance for the other task. Nonetheless, we found eye-tracking-based features to have a high contribution (see Starting with a unimodal input we train several machine learning models and present the predictive power of each biosignal modality, eye tracker data and facial action units separating low and high levels of cognitive load. By combining features of various modalities, we present the predictive power of all biosignals, biosignals and eye tracker data and the combination of eye tracker data, biosignal and action units, leading to an overall AUC, using the complete dataset consisting of collected single- and dual-task load  results ,117,118.tion see  for the performance metrics, subjective ratings and the linear combination of both measures as targets, resulting in a k-drive, a novel and close-to-real-world autonomous driving task to study cognitive load.The introduction of physiological, behavioral, subjective and performance measurement from 51 subjects while participating in levels of increasing task difficulty with single and dual workload scenarios.The collection of The extraction and evaluation of features from ECG, PPG, EMG, EDA, respiration belt, skin temperature, eye tracker data, facial video recordings using a detailed statistical evaluation protocol.The validation of the collected data using statistical methods before training and testing of machine learning models.The training and evaluation of machine learning models using unimodal and multimodal inputs for cognitive load estimation.The analysis of feature importance for models trained with multiple inputs.The introduction of novel machine learning tasks and training of baseline models as reference for future contributions by the affective sensing and machine learning community.Accompanying this publication we release a subset of 30 subjects, containing the recorded and unprocessed sensor data, questionnaires, performance metrics and NASA-TLX scores, enabling the research community to develop and evaluate novel algorithms for cognitive load estimation. We encourage the research community to build novel algorithms and machine-learning methods using the released data.In addition to our classification tasks, that separate the different levels of CL imposed onto the subject based on the task difficulty of each level, we introduced a regression task, that used Our future work will include the analysis of distribution shifts of machine learning models that are trained on one task and evaluated on another task. An important next step before deploying these algorithms in the wild is the analysis of the robustness and stability of fusion techniques for multimodal machine learning when one or more modalities are corrupted or perturbed. In direct line with this work will be the study of models trained in an end-to-end manner such as deep neural networks using the raw input signals for CL prediction. Another important factor is the inclusion of the reported personality traits as input to machine learning models to improve model performances using personalized information. In this publication, we have selected a constant window length of two minutes for all features and all inputs, based on results from literature introduced in"}
+{"text": "Deep learning enables bypassing the tradeoffs between imaging speed, field of view, and spatial resolution in autofluorescence-harmonic microscopy. Two-photon autofluorescence (2PA) of flavin adenine dinucleotide (FAD) and three-photon autofluorescence (3PA) of nicotinamide adenine dinucleotide (NADH) permit noninvasive monitoring of metabolic activities2. Second-harmonic generation (SHG) microscopy provides morphological and functional characterization of anisotropic biological structures, such as collagen3, muscle4, and microtubules5. Third harmonic generation (THG) microscopy enables elucidating on cellular and tissue organizations by probing intra- and extracellular membranes, and extracellular matrix structures6. Recent advances in simultaneous label-free autofluorescence- multiharmonic (SLAM) microscopy further expands the nonlinear optical microscopy\u2019s utility in intravital imaging7 and slide-free, stain-free histopathology9.Label-free nonlinear optical microscopy is an emerging technique for probing biological structures and functions without exogenous labels or dyes. Thus, it provides an attractive solution to gain biological insights without perturbing the native states of biological samples and processes. For example, vibrational spectroscopic imaging techniques10, a novel deep learning augmented microscopy framework is developed to overcome the physical tradeoffs. The proposed \u201cdeep learning autofluorescence-harmonic microscopy\u201d (DLAM) is demonstrated on human pathological tissues for multimodal imaging, including 2PA of FAD, SHG and 3PA of NADH, with enhanced spatial resolution and much reduced acquisition time. This advancement may find broad utilities in the studies of biology and neuroscience.Despite these advances, the implementations of all nonlinear optical microscopy techniques rely on laser scanning. This makes it challenging to simultaneously achieve a wide field of view (FOV), high spatial resolution, and fast imaging speed with sufficient signal-to-noise ratio (SNR) in the measurement. In this work by Shen et al.11, which overcome different aspects of physical limitations by combining novel instrumentation and deep learning. For example, strategies have been developed to first acquire low-SNR images at high speed and low light exposure and later enhance the SNR by deep learning to alleviate photo-damages in fluorescence microscopy12 and SRS microscopy13. Deep learning-based super-resolution reconstruction has been demonstrated to bypass the limitation of FOV14. Data-efficient acquisition schemes by deep learning have been developed for multi-shot quantitative imaging techniques, such as Fourier ptychographic microscopy15, single molecule localization microscopy16, and structured illumination microscopy17. We envision this deep learning augmented approach may fundamentally push the imaging limits and ultimately revolutionize the field of microscopy.Broadly speaking, DLAM adds to the rapid-growing list of deep learning augmented microscopy techniques"}
+{"text": "Premature ovarian failure (POF) is a common female reproductive disorder and characterized by menopause, increased gonadotropin levels and estrogen deficiency before the age of 40 years old. The etiologies and pathogenesis of POF are not fully clear. At present, hormone replacement therapy (HRT) is the main treatment options for POF. It helps to ameliorate perimenopausal symptoms and related health risks, but can\u2019t restore ovarian function and fertility fundamentally. With the development of regenerative medicine, bone marrow mesenchymal stem cells (BMSCs) have shown great potential for the recovery of ovarian function and fertility based on the advantages of abundant sources, high capacity for self-renewal and differentiation, low immunogenicity and less ethical considerations. This systematic review aims to summarize the possible therapeutic mechanisms of BMSCs for POF. A detailed search strategy of preclinical studies and clinical trials on BMSCs and POF was performed on PubMed, MEDLINE, Web of Science and Embase database. A total of 21 studies were included in this review. Although the standardization of BMSCs need more explorations, there is no doubt that BMSCs transplantation may represent a prospective therapy for POF. It is hope to provide a theoretical basis for further research and treatment for POF. Premature ovarian failure (POF) refers to the decline of the ovarian function that occurs before the age of 40 in female. It is a clinical syndrome defined by oligomenorrhea or amenorrhea, increased gonadotropin levels, and decreased estradiol levels, and it is often accompanied by a variety of perimenopausal symptoms such as hot flashes, night sweats, alopecia, dry skin and mucous membranes, decreased libido, sleep disorders, irritability , 2. The Women with POF have an increased risk of psychological disorders, cardiovascular diseases, osteoporosis, autoimmune diseases, cognitive dysfunction, urinary and reproductive system infections and other diseases compared with normal people. In addition, low fertility and even infertility are also major problems for POF patients , 6. StatCurrently, there is no effective treatment for POF. HRT is the main therapeutic schemes for POF, which can effectively improve the menopause symptoms and reduce the risk of osteoporosis and cardiovascular diseases, as well as improve the quality of life of patients. However, HRT can\u2019t fully restore ovarian function, such as hormone secretion, follicular growth or ovulation . MoreoveStem cell therapy has made great strides in regenerative medicine over the past two decades. \u201cStem cells\u201d refer to the specific cell types that are insufficiently differentiated and immature, capable of self-renewal, which can proliferate and differentiate into various tissues and organs. Based on the therapeutic potential of stem cells in multiple systems, exploring the potential role of stem cells in treating female reproductive system diseases has become the focus of cutting-edge research. Recent years, a number of studies have also confirmed that many stem cells are effective in treating POF, including mesenchymal stem cells (MSCs), ovarian germ stem cells (OGSCs), embryonic stem cells (ESCs). Among them, BMSCs have shown great potential in repairing ovarian damage and restoring ovarian function in POF animal models or patients , 14. DueThe study was carried out following the PRISMA guidelines . KeywordA total of 1202 articles were retrieved after the initial search. 154 duplicate records were removed after importing into endnote software. After screening the title and abstract, 1014 articles were excluded mainly because they were not relevance with the current analysis, or they were reviews or meta-analysis, or other sources of MSCs but not bone marrow, or duplicate reports. Among the 34 potentially relevant studies, 14 were further excluded after reviewing full texts due to 5 studies were unrelated to the treatment of POF, 4 studies were unrelated bone marrow derived MSCs, 3 studies were related to bone marrow derived acellular therapy and one paper was meeting abstract Figure\u00a01MSCs are a kind of pluripotent stem cells originating from the early mesoderm, which can be isolated from bone marrow, adipose, dental pulp, placenta, umbilical cord, amniotic membrane, amniotic fluid and other tissues . Among tin vitro will adhere to the substrate; second, the cells are characterized by expressing CD105, CD90, CD73, CD44 and Sca1 surface antigens, while lack of CD34, CD45, CD14 or CD19, CD79\u03b1, CD11b and HLA-DR; Meanwhile, these cells must have the ability of differentiating towards osteoblasts, chondroblasts and adipocytes in vitro , hepatocyte growth factor (HGF), monocyte chemotactic protein (MCP)3, platelet-derived growth factor are released in injured tissues, while these factors stimulate high expression of specific receptors (CXC chemokine receptor 4 (CXCR4), cMET, CC chemokine receptor 1, platelet-derived growth factor receptor, respectively) on the surface of BMSCs, thereby promoting the homing of BMSCs , 75. CheHGF is a growth factor consisting of \u03b1 and \u03b2 chains, which contains four cyclic domains and one serine protease-like domain, respectively. Evidences demonstrate that HGF plays an important role in growth stimulation, tissue regeneration, migration, angiogenesis, morphogenesis, tumorigenesis, and tumor invasion . In addiin vitro and in vivo though histone demethylase KDM6B mediated inhibition of methylation marker H3K27me3  . Therefovia inducing primordial follicle development , HGF, bFGF , 55. Theelopment . Althougelopment , 123.in vivo or in vitro. These results indicate that the secretion of these factors plays an important role in BMSCs improving ovarian function -induced POF mice . BMSCs tturation . Transplturation . In addituration , 62. Endturation , 140. Hoturation . Hence, turation Figure\u00a06via changing the expression of HO-1/HO-2 and enhancing catalase and SOD1 gene expression  is a pulse emission with low intensity and low thermal effect. Studies have found that LIPUS exposure can activate MAPK/ERK and PI3K/Akt signal pathways by up-regulating CyclinD1 and C-MYC genes, thus promoting the proliferation of MSCs , 169. Liin vivo after intravenous injection, which substantially sustained BMSCs survival and enhanced overall immunomodulatory capacity of BMSCs in a model of allogeneic transplantation .Figures were created with BioRender software (The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "This study presents the routine prosection findings of a 73-year-old male cadaver, with the cause of death reported to be hypertension and respiratory failure. Deep thorax and abdomen dissection exposed profound external and internal anatomical abnormalities. Externally, the body exhibited the following: pectus excavatum; short-limbed dwarfism; and abnormalities of the head, face, and external genitalia. Most of these findings suggest that the donor had Robinow syndrome, a rare genetic disorder involving developmental delay and skeletal abnormalities akin to those found in this cadaver. The internal gross anatomical findings included the following: megacolon; hiatal hernia; bilateral inguinal hernias; laterally displaced right kidney with a fibrous adhesion extending from the inferior pole of the kidney to the inguinal canal; atypical branching of the abdominal aorta; superiorly displaced diaphragm; pulmonary hypoplasia; heart right of midline; and curved esophagus. Although determining the exact etiology of megacolon is difficult in a cadaveric specimen, it is important to investigate the physiological changes associated with it. Therefore, the aim of this study was to investigate the space-occupying pathology of megacolon and to discuss a potential connection between megacolon and Robinow syndrome. Whereas some of the findings in this article were previously presented both as a poster and a podium presentation at the Michigan Osteopathic Association 123rd Annual Spring Scientific Convention , the details herein further explore in depth, the pathophysiology and histopathology underlying the megacolon and other gross pathoanatomical findings in the cadaver presented. Megacolon is defined as acute, toxic, or chronic distension of the large intestine in the absence of mechanical obstruction [The cadaver presented in this article exhibited gross anatomical features of Robinow syndrome and megacolon. This is a unique situation since the database is devoid of any description of the association between the two conditions. Robinow syndrome is a genetic disorder that affects bone development and often manifests as genital deformity or craniofacial abnormalities such as cleft lip/palate ,4. It woPathoanatomical findingsDuring routine dissection of a 73-year-old male cadaver, multiple anatomical variations and abnormalities were discovered. The main observations included the following: megacolon Figure ; bilaterThe colon was dilated, particularly the descending segment, which featured a maximal dilation measuring approximately 23 cm. Comparatively, the enlargements of the cecum, ascending and transverse colon were not as remarkable. The hepatic and splenic flexures were markedly narrowed Figure . In contThe gross anatomic sequelae of megacolon were easy to notice in this cadaver. For example, it was evident that abdominal and thoracic organs had all been shifted to some degree by mass displacements. The diaphragm, heart, and lungs had all been shifted superiorly Figure . PortionThis plethora of internal variations and abnormalities prompted to note external features as well, with the following being most prominent: short stature of approximately 5\u20191\u201d with relatively short limbs; pectus deformity; webbed penis; wide-set eyes; enlarged tongue; and anteverted nares.Histopathological findingsBecause of the numerous adhesions in the cadaver, the authors wondered if there might have been some involvement of an underlying connective tissue disorder. Sections from various organs stained with H&E and Congo Red were negative for amyloidosis which could have contributed to the organ abnormalities and fibrous pathology. Of note, sections from the left ventricle showed evidence of chronic myocardial fibrosis and muscle atrophy Figure . HistoloThe extensive anatomical variations and abnormalities on this cadaver could not be explained by the limited medical history provided upon body donation, which included hypertension, hyperlipidemia, type 2 diabetes, GERD, seizures, and repeated falls. Further investigation into the medical history and communication with the family confirmed a history of developmental delay since birth. Interestingly, the family also reported episodes of severe constipation for approximately 20 years before death. However, no specific syndromic diagnosis is listed that would explain the thoraco-abdominal and external findings.It is clear that this individual suffered severe megacolon. It is reasonable to believe that the condition was long-standing because of the chronic force required to displace viscera of the abdomen and thorax in such a profound manner as was discovered during prosection. Another indication that this case of megacolon is chronic rather than acute or toxic is supported by the 20-year history of constipation prior to death.Chronic megacolon can be congenital, acquired, or idiopathic . The strModern-day surgical treatments for congenital Hirschsprung disease include low anterior rectal resection and terminal ileostomy, pull-out anterior rectal resection and terminal ileostomy, and low anterior resection. Post-operative course in these cases is most often uncomplicated. After resection, patients either undergo fecal diversion such as colostomy or intestinal continuity restoration such as subtotal colectomy. Possible complications include those typical of any surgery manipulating the bowel, including hypoproteinemia, anemia, obstruction, abdominal effusion, and infection of the surgical incision .Diagnostic capabilities in cadaveric study are extremely limited; a full history and physical examination are impossible to obtain and neither laboratory nor genetic testing is feasible. As such, all attempts of diagnosis using the cadaver are based on anatomic changes that are appreciable post-mortem as well as limited medical history, augmented by information reported by the family.Therefore, the authors relied on anatomical cues for genetic pathology to support the hypothesis that the megacolon was indeed congenital. These included the fetal facial features, short stature, accessory renal arteries, genital deformity, heart defects, and the ligamentous structure extending from the liver, showing embryologic features.\u00a0With these clues supporting genetic and/or embryologic pathology, Robinow syndrome becomes the most likely diagnosis given the close alignment of symptoms resulting from that disease process and the gross and microscopic findings discovered on this cadaver, namely, short stature, fetal facial features, genital deformity grossly, and left ventricular myocardial fibrosis. There is also a history of developmental delay, which is typically present in cases of Robinow syndrome. Robinow syndrome can result from a variety of gene mutations, and can be autosomal recessive, from a loss of function mutation in the ROR2 gene, or autosomal dominant, from a mutation either to WNT5A or to DVL1 .During routine prosection of a 73-year-old male cadaver, the authors discovered a number of anatomical anomalies that could not be explained by the reported medical history, most notable of which being extensive distension of the descending colon. The anatomical nature of the megacolon and the report from the family indicating constipation 20 years prior to death pointed to a chronic rather than an acute process. The additional internal anatomical variations of accessory renal arteries and atypical fibrous adhesions suggested an underlying congenital cause for these developmental anomalies. These unique external findings narrow that congenital cause to the diagnosis of Robinow syndrome. The nature of cadaveric dissection limits diagnostics, so laboratory and genetic testing were not possible to confirm the diagnosis. Regardless, this case of megacolon in a cadaver illustrates the profound space-occupying effects of megacolon, in that almost every abdominal and thoracic organ was affected in some way due to the sheer size of the defect and consequential mass effect. This highlights the importance of early detection and treatment of megacolon. As for its relation to Robinow syndrome, which is suspected in this cadaver, more genetic research and data would be required to properly correlate megacolon as a feature of Robinow syndrome."}
+{"text": "Dental calculus has long been considered as a vital contributing factor of periodontal diseases. Our review focuses on the role of dental calculus as a repository and discusses the bioinformation recently reported to be concealed in dental calculus from three perspectives: time-varying oral condition, systemic diseases, and anthropology at various times. Molecular information representing an individual\u2019s contemporary oral health status could be detected in dental calculus. Additionally, pathogenic factors of systemic diseases were found in dental calculus, including bacteria, viruses and toxic heavy metals. Thus, dental calculus has been proposed to play a role as biological data storage for detection of molecular markers of latent health concerns. Through the study of environmental debris in dental calculus, an overview of an individual\u2019s historical dietary habits and information about the environment, individual behaviors and social culture changes can be unveiled. This review summarizes a new role of dental calculus as a repository of bioinformation, with potential use in the prediction of oral diseases, systemic diseases, and even anthropology. Dental calculus is the plaque and sediment that has calcified or is calcifying on the tooth surface or prosthodontic body. It can be divided into supragingival calculus and subgingival calculus according to the location of deposition above or below the boundary of the gingival margin . CalculuBioinformatics, as related to genetics and genomics, is a scientific subdiscipline that involves using computer technology to collect, store, analyze and disseminate biological data and information, such as DNA and amino acid sequences or annotations about those sequences. By using databases that organize and index such biological information, scientists and clinicians can better understand health and disease. Dental calculus has long been considered as one of the contributing factors of periodontal diseases, while plant phytoliths in dental calculus found by Armitage in 1975 indicated its potential as a biological information database . And witOur review is the first to conclude both the modern and the ancient dental calculus, aiming to summarize the potential role of dental calculus as a \u201cstorage library\u201d in the past few years, hoping to provide a new insight to depict the long process of development of diseases and human evolution.Streptococcus mutans associated with dental caries and \u201cRed Complex\u201d involving Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia linked with periodontitis in ancient dental calculus which could date back to c. 950-1200 CE , the presence of certain human papillomaviruses (HPVs) capable of promoting malignant progression, a verified risk factor for OSCC, was confirmed . LikewisMoreover, some studies found novel chemical components in dental calculus connected with systemic diseases. Toxic heavy metals were one of them. Exposure to heavy metals has become a serious health concern in recent decades due to the ubiquity of heavy metals in our daily environment, which may induce a higher risk of cancer in multiple organs. Heavy metals own long biological half-life and can accumulate in dental calculus during calcification . Toxic hPrevious studies have supported the idea that there is bioinformation related to some systemic diseases that may be detected in calculus, which inspires us to use another way to find hints about chronic diseases, such as cardiovascular diseases, diabetes, and cancers. Thus, dental calculus may be a potential biological data storage reservoir for detection of molecular markers of latent pathogens, including bacteria, viruses and some protein factors, or other pathogenic factors, such as toxic heavy metals, in patients with systemic diseases Figure\u00a01Dental calculus is in fact a \u201cdepositional environment \u201c as materials can enter the mouth from a range of sources . In termMicroparticle analysis and stable isotope analysis used to be the most common approaches to study environmental debris in dental calculus. Also, with the development of bioinformatics and advanced sequencing technology in recent decades, more archaeological studies on calculus elucidating hominin dietary habits, behavior and culture have been implemented.By shotgun sequencing of ancient DNA from Neanderthal dental calculus, Weyrich et\u00a0al. described the differences in diet matching with the characterization of regional differences in Neanderthal ecology. The Spy Neanderthal diet was primarily meat-based, including woolly rhinoceros and wild sheep (mouflon), which is consistent with the characteristics of a steppe environment . In contStreptococcus, are much more abundant in Homo. The underlying mechanism can be attributed to the notable ability of Mitis, Sanguinis, and Salivarius groups expressing amylase-binding proteins to capture salivary alpha-amylase, which they use for their own nutrient acquisition and dental adhesion. Alpha-amylase is the most abundant enzyme in modern human saliva, and modern human express it at a higher level than any other hominid. The increase in alpha-amyla has been argued to be associated with dietary shifts during human evolution, specifically an increased reliance on starch-rich foods (Analogously, a recent study on hominins\u2019 dental calculus in the Eastern Alpine region of Italy compares the late paleolithic and mesolithic diet. It provides a more balanced picture of three foragers\u2019 diet, underlining a possible contribution of plant species as food at that time. In particular, starch granules belonging to grass grains, which is of dietary importance, were recovered in the analyzed dental calculus, hence providing the direct evidence that local foragers consumed vegetal resources during their life. Thus, these prehistoric hunter gatherers, as well, were well adapted to the environment in which they lived through exploiting many natural resources . Starch ch foods . Lipid, ch foods .More abundantly, a variety of debris was detected in the dental calculus sample, including animal micro remains and molecules, hairs, starch granules and other plant micro debris such as fibers and phytochemicals . Such anVia scanning electron microscopy with energy-dispersive x-ray spectroscopy and micro-Raman spectra, Radini et\u00a0al. reported the discovery of lapis lazuli pigment preserved in the dental calculus of a religious woman in Germany radiocarbon dated to the 11th or early 12th century, suggesting medieval women\u2019s early involvement in manuscript production (By analyzing historical dental calculus samples, some historical events in the distant past may be reconstructed. To reconstruct the notorious Great Famine of 1845 to 1852, a study used microparticle and proteomic analysis of human dental calculus samples from victims of the famine to elucidate the variability of diet in mid-19th-century Ireland. This study reveals the monotonous potato diet of the poor compared to egg protein of the better-off social classes . Via scaoduction .Bleasdale\u2019s research utilizing plant microparticles from dental calculus as well as isotope analysis of human and animal remains and charred food remains in Central Africa, spanning the early Iron age to recent history, visually presented new dietary evidence that revealed the long-period variation in the adoption of cereals and the longevity of mosaic subsistence strategies in the region . And MilDental calculus could record the agelong information and allow us to outline the subsistence pattern of ancient hominins and reconstruct the significant historical event just as happened yesterday with the help of omics and imaging techniques. In view of this opinion, our further study focused on the historical dietary information recorded in the calculus of patients with type II diabetes. In the management and prevention of type II diabetes, dietary factors are of paramount importance . InteresDental calculus is the calcified plaque or sediment on the tooth surface or prosthodontic body and has long been regarded as the most important local contributing factor of periodontal diseases. Therefore, in clinical treatment, removing this visible risk factor by ultrasonic supragingival scaling and root planning is a key part of initial periodontal therapy .in vitro experiments and cultures are necessary.In the past few years, dental calculus has become a research hotspot in both archaeological and modern etiological research. By analyzing calculus, a new material in archaeology, archaeologists have provided persuasive inferences about the eating habits, lifestyles and migration changes of people at different times. These findings suggest that calculus can act as a relatively stable repository of bioinformation because the dental calculus used in archaeology usually has a history of hundreds or even thousands of years. Thus, in modern etiological research, dental calculus appears to be reliable for detection. On the one hand, dental calculus can be a code for a state of health or illness, especially for an individual\u2019s oral condition. Using contemporary advanced inspection and analysis technology such as metagenomics, metaproteomics and metabolomics, a comprehensive microbial composition may be achieved and therefore imply that the oral state is healthy. In addition to being a hint for the condition of the oral cavity, dental calculus is also connected with some diseases occurring away from the mouth by means of detecting unique components within it, including viruses, proteins and chemical material. The function as a repository of biological information is illustrated in Conceptualization/Methodology, QL, KL, YL, XP, BR, and JL; Writing-Original Draft. Preparation, QL, KL, ZS, FH, YW, FZ; Writing-Review and Editing, QL, KL, ZS, FH, YW, FZ, YL, and XP; Supervision, BR and JL; Project Administration, BR and JL. All authors contributed to the article and approved the submitted version."}
+{"text": "The association between Moyamoya syndrome (MMS) and sickle cell disease (SCD) has been well-established in pediatric populations; however, limited literature exists documenting the characteristics and management of MMS in adult SCD patients. Studies have indicated the role of endovascular management in secondary stroke prevention for pediatric populations, with no current guidelines available for adult populations. Here, we describe a unique case of MMS in a 30-year-old patient with SCD and incidental protein S deficiency. Our unique case highlights a patient at high risk for neurosurgical intervention due to her hypercoagulable state who has benefitted from medical management. We also discuss current literature for the prevention of secondary cerebral vascular events and the role of further studies involving adult populations with MMS and SCD.\u00a0 Sickle cell disease (SCD) is caused by a mutation in the beta globin chain of hemoglobin (HbS). It results in inadequate hemoglobin folding during periods of physiological stress, such as hypoxia, hyperosmolar states, infection, and acidosis. Inappropriate hemoglobin polymerization facilitates a sickled morphology, which causes vaso-occlusion, hemolytic anemia, ischemia-reperfusion injury, hyper-coagulability, and widespread inflammation\u00a0. The degA 30-year-old female with a past medical history of homozygous SCD and prior pulmonary embolism presented to the sickle cell clinic to establish care. Her SCD (HbSS) is well-controlled, and she reports having rare pain crises and had one prior blood transfusion during her pregnancy a year before the presentation. Her hemoglobin baseline is between 8 and 9 g/dL. She experienced pulmonary embolism during her pregnancy one year before presentation, at 26 weeks of gestation. At that time, she was managed with six months of daily treatment doses of enoxaparin therapy. She has an etonogestrel implant for pregnancy prevention. She was offered hydroxyurea by her prior physician but declined.\u00a0One month before the presentation, she experienced sudden onset neurological symptoms, where she had new onset slurring of speech and word-finding difficulty, lasting a few hours. MRI brain was performed in an outside facility, for which the patient brought in the report, demonstrating gliotic changes in the left frontoparietal white matter, acute to subacute ischemic changes in the left parietooccipital lobe, and subacute vs. chronic hemorrhagic infarcts in the left parietal lobe; suggesting an extension of prior stroke. Since her symptom onset one month ago, she has been experiencing constant left-sided throbbing headaches unrelieved by codeine. The speech slurring and word-finding difficulty had subsided. She had no vision changes, weakness, numbness, or tingling. The physical exam was unremarkable. Given her concerning symptoms and abnormal MRI report from Guyana, the patient was referred to neurology for further evaluation of stroke in the setting of SCD.The patient was seen in the general neurology clinic, with concern for her neurologic presentation secondary to ischemic stroke with possible hemorrhagic conversion. Given her history of SCD, there also was a concern for arterial embolic stroke or cortical vein thrombosis. As such, the neurology team recommended a complete stroke workup. The brain MRI demonstrated small strokes in the left frontoparietal deep border zone with areas of hemorrosidden deposition, suggesting old hemorrhagic conversion. Magnetic resonance venography (MRV) showed no signs of dural sinus thrombosis. MRA was notable for left ICA terminus stenosis extending into the proximal left anterior cerebral artery (ACA) and middle cerebral arteries (MCAs) Figures\u00a0-2, consiTrans-thoracic echo was notable for pulmonary artery systolic pressure of 29, with normal ejection fraction and no structural wall or valvular abnormalities. Given the history of pulmonary embolism, a thrombophilia workup demonstrated low protein S activity of 44% , normal protein C activity, normal antithrombin C activity, negative cardiolipin antibodies, and negative beta-2 glycoprotein. The coagulation workup was done while the patient was off anticoagulation for a year. She was diagnosed with protein S deficiency and advised to remove the etonogestrel implant to minimize the risk of thrombosis. In addition, she was started on statin and clopidogrel for secondary stroke prevention.The patient was subsequently lost to follow-up for 14 months. She presented again 14 months later to the emergency department with chest pain, at which time she was also 19 weeks pregnant. She was admitted for suspicion of new-onset pulmonary embolism. CT angiography was negative for pulmonary emboli. Chest pain was determined to be of musculoskeletal etiology. She was subsequently discharged with 1.5 mg/kg enoxaparin daily to prevent venous thrombotic events, given concern for combined hyperestrogenic state and protein S deficiency in pregnancy. She was also started on prophylactic transfusion therapy to maintain hematocrit above 30%, to reduce the risk of fetal loss and hypoxia, and for secondary stroke prevention during pregnancy. She successfully delivered via C-section at 37 weeks gestation with no complications.\u00a0She has been followed for three years since her initial diagnosis of MMS and protein S deficiency. She is currently following up with the sickle cell and neurology clinic with an observational approach to managing her MMS and protein S deficiency. She has not had any further neurological symptoms or signs of thrombotic events. The current medication regimen includes aspirin 81 mg and enoxaparin 1 mg/kg.Cerebrovascular accidents are a common complication in patients with SCD, with the pathogenesis of silent infarcts appearing early in life. Current literature suggests that attachment of sickled cells to vascular endothelium leads to a cascade of endothelial activation and vascular damage, as implicated in vaso-occlusion, intimal hyperplasia, fibrosis, and thrombosis\u00a0. MMS in Similarly, a recent meta-analysis by Agulair-Salinas et al., which pooled 53 patients from seven studies who underwent revascularization procedures, found that the rate of ischemic stroke-free survival was 94.3% (95% CI 83.3-98.1) and the incidence rate of ischemic stroke was 1.42 events/100 patient-years (95% CI 0.46-4.4). Likewise, a larger systematic analysis by Terell et al. reviewed the data from 13 studies of pediatric populations. Early detection and surgical intervention significantly improved stroke recurrence and neurocognitive outcomes\u00a0[Chronic transfusion therapy remains the gold standard for managing secondary stroke prevention for MMS-SCD patients. Transfusions can be performed every 3-6 weeks to maintain HbS levels <30%, with overall hemoglobin levels between 9 and 12.5 g/dL. The SWITCH trial, a phase 3 multicenter trial, evaluated the role of transitioning from chronic transfusion therapy to hydroxyurea and noted that transitioning to hydroxyurea was associated with increased stroke risk in pediatric patients\u00a0. CurrentOnly a handful of cases are documented in the literature describing MMS in adult SCD patients\u00a0-15, withHere, we present a case of MMS in a patient with SCD patient with concomitant protein S deficiency. Our unique case highlights a patient at high risk for neurosurgical intervention due to a concomitant hypercoagulable state. Thus far, our patient has benefitted from medical management for secondary stroke prevention and yearly monitoring for MMS progression. Future studies should consider a retrospective analysis of patients diagnosed with MMS in adulthood to determine outcomes of medical vs. revascularization and consider the surgical risks associated with neurosurgical intervention in adult populations. Overall, we outline a unique case of MMS-SCD in an adult patient with protein S deficiency and consider the role of conservative/medical management of MMS in adult patients."}
+{"text": "Over the years, with developments in technology and radiobiology, radiation therapy has evolved into a primary treatment method for many cancer patients with certain disease sites. However, in current radiotherapy (RT) practices, we are still treating each patient within a specific tumor type and stage with a common dose, ignoring the wide per-patient and per-tumor-sub-volume dose-response variations and missing the opportunity to dynamically modify the dose distribution based on tumor response . RadiatiAmong a number of proposals submitted, 19 of which were accepted for publication in the special issue. The accepted papers can be grouped in to the following three main directions: (1) importance of personalized radiation therapy; (2) image based treatment response prediction; (3) exploration of personalized treatment.Iezzi et\u00a0al. presented a study on evaluating the dosimetric importance of on-line adaptive for breast IMRT treatment. A strategy is also proposed to make automatic prediction based on daily CBCT if on-line adaptive is necessary for that specific fraction. Also targeting on breast cancer, Wang et\u00a0al. introduced their study on the incidental irradiation to internal mammary node (IMN) for patients underwent different type of surgery, radical mastectomy vs. breast-conserving surgery, and different radiotherapy regimens. Their study came to the conclusion that surgery type was the influencing factor of dose to IMN with conventional radiotherapy strategy. This opens up a question: is it possible to achieve more optimal dose to IMN regardless of the surgery type patients received with personalized RT? Zhang et\u00a0al. used a \u201cSphere-mask\u201d optical positioning system (S-M_OPS) retrospectively analyzed the setup errors for a large group of patients with different disease sites. In addition to introducing the efficiency and setup accuracy of S-M_OPS, the study also highlighted the residual setup errors with different mainstream setup tools, which can be further accounted for by on-line personalized RT.Luo et\u00a0al. introduced their model that is based on CT radiomics, clinical and dosimetric parameters to predict 1-year local control for lung cancer patients treated with SBRT. On the platform of low field MRgRT, Chiloiro et\u00a0al. performed a study evaluating a \u201cdelta radiomics\u201d approach to predict 2-year disease-free-survival (2yDFS) for rectal cancer patient undergoing neoadjuvant chemoradiotherapy (nCRT). For the same type of patients, Shi et\u00a0al. investigated the usage of combined information of pretreatment blood biomarkers and MRI based morphological information to predict nCRT treatment response. Besides anatomical information, different medical imaging modalities can also provide functional information. Currently, anatomical change is still the main clinical criteria for treatment response evaluation. However, functional change, such as metabolism, cellular density, and vasculature, usually happens earlier than morphological changes  and Dynamic Contrast-Enhanced (DCE) MRI, finding significant correlations. This study highlighted the possibility of using IVIM as a non-contrast alternative perfusion MRI for longitudinal acquisition to achieve early treatment response prediction. For a cohort of head and neck patients, Chen et\u00a0al. performed pre-treatment and weekly mid-treatment FDG-PET/CT acquisition during standard chemoradiotherapy. Tumor voxel dose-response matrix (DRM) constructed based on the serial FDG-PET/CT was proven to be a predictive tool for treatment response. Also with FDG-PET, Ji et\u00a0al. developed a convolutional neural network (CNN) taking pre-treatment FDG-PET and spatial dose distribution as input to predict RT treatment outcome as a synthetic post-treatment FDG-PET, which can be used for adaptive RT decision making or on-line planning. changes \u201311 This Hooshangnejad et al. introduced a novel patient-specific duodenal pacer simulator algorithm, which can serve as a decision support system to provide optimal spacer location for placement guidance. Ku et\u00a0al. introduced a novel fiducial marker (FM) implantation procedure by adding a patient specific pre-implant planning and simulation step. For patients with invisible lung tumors treated on CyberKnife, this retrospective study proved that the additional step reduces the patient radiation exposure and increases the number of FMs inserted around tumors. Zhang et\u00a0al. explored an augmented reality (AR) \u2013 assisted RT positioning system using HoloLens 2. This is an interesting and novel patient specific positioning study and concluded that the proposed AR-assisted RT positioning method is highly feasible with several advantages. Using image guidance to personalize RT during treatment planning or treatment fractions is gaining a lot of research interests in the past several years. Zhu et\u00a0al. used multiparametric MRI including 3D ASL to differentiate high and low blood perfusion areas within GTV for a group of adult non-enhancing low-grade gliomas (NE-LGGs). This generated information can be used to guide personalized RT boost for treatment efficacy improvements. Also for tumor segmentation purpose, Lau et\u00a0al. explored a gradient-based method using 18F-PSMA-1007 PET/CT for prostate cancer lesion contouring and quantification. Nie and Li proposed predictive strategy to project tumor volume onto 2D MR cine from 4D MRI libraries for personalized MRgRT. By accurately predict respiratory motion during 2D cine imaging and projecting tumor volume contour on 2D cine, real-time assessment of beam-to-tumor conformality was proven to be feasible and promising for personalized MRgRT. Last but not the least, biology-guided radiation therapy (BgRT), represented by RefleXion X1\u2122, the first FDA cleared BgRT system, is another novel and promising technology that can potentially bring meaningful personalized RT into routine clinical practice. Seyedin et\u00a0al. described a planning comparison study on RefleXion X1\u2122 and proved its potential as a powerful tool to reduce the radiation dose to nearby structures by using real-time positron emission imaging.Personalized treatment is a broad definition, and the personalized portion can happen at different steps of the entire RT workflow. We have presented here some snapshots of different research activities in our field related personalized radiotherapy. We are hoping this can serve as a handy reference resource for students and researchers who are interested in this area and inspire more and more studies to further advance personalized RT with the ultimate goal of maximizing RT efficacy for every patient."}
+{"text": "Background: Sepsis is a medical and surgical emergency that describes the body\u2019s systemic immunological response to an infectious process that can lead to end-stage organ dysfunction and death. Various clinical and biochemical parameters serve as indicators of organ dysfunction in patients with sepsis. Most familiar among them are the Sequential Organ Failure Assessment (SOFA) score, Acute Physiology and Chronic Health Evaluation (APACHE) II score, Mortality Prediction Score (MPM), and Simplified Acute Physiology Score (SAPS).Methodology: A comparative study of APACHE II and SOFA scores was done at the time of admission in a total of 72 patients with sepsis and compared with the mean SOFA score. In our study, the SOFA score was measured serially and the mean SOFA score was calculated. All patients were selected according to the definition of sepsis (Sepsis-3). The ROC curve, the sensitivity, and the specificity were calculated to analyze the diagnostic value of SOFA, APACHE II, and the mean SOFA score. For all statistical tests, a \u201cp-value\u201d less than 0.05 was taken to indicate a significant difference.1\u00a0(day 1 of admission) APACHE II & SOFA scores in predicting mortality in surgical patients with sepsis.Results: Our study showed that the mean SOFA score had a sensitivity of 93.65 and a specificity of 100, and on comparing the AUC of mean SOFA with APACHE II (Day\u00a01) and SOFA (Day\u00a01) - we got the P-value 0.0066 and 0.0008, which shows a statistically significant difference. So, we can say that the mean SOFA score is better than DConclusions: APACHE II and SOFA scores are equally effective in assessing mortality in surgical patients with sepsis at the time of admission. However, if we take serial measurements of SOFA scores and calculate the mean SOFA score it becomes a very useful tool for predicting mortality. APACHE II is the sum of three units: an Acute Physiology Score, a chronic health evaluation, and a score based on the patient\u2019s age . It inclIn our study, the SOFA score was measured serially and the mean SOFA score was calculated. All patients were selected according to the new definition of sepsis (Sepsis-3). The ROC curve, the sensitivity, and the specificity were calculated to analyze the diagnostic value of SOFA, APACHE II, and the mean SOFA score. For all statistical tests, a \u201cp-value\u201d less than 0.05 was taken to indicate a significant difference.\u00a0Statistical testing was conducted with the statistical package for the social science system version SPSS 25.0. Continuous variables were presented as mean\u00b1SD or median (IQR) for non-normally distributed data. Categorical variables were expressed as frequencies and percentages. The comparison of normally distributed continuous variables between the groups was performed using Student\u2019s t-test. Nominal categorical data between the groups (survived and died) were compared using the Chi-squared test or Fisher\u2019s exact test as appropriate. Non-normal distribution continuous variables were compared using the Mann-Whitney U test. A receiver operating characteristics (ROC) analysis was calculated to determine the optimal cut-off value of SOFA, APACHE II for predicting mortality. The area under the curve, the sensitivity, and the specificity was also calculated to analyze the diagnostic value of SOFA, APACHE II. For all statistical tests, a p-value less than 0.05 was taken to indicate a significant difference.The study was done on a total of 72 surgical patients with sepsis. The majority of patients belonged to the age group of 21 to 30 with an age distribution of 27.78% followed by the age group of 51-60 years with an age distribution of 26.39%.\u00a0Out of 72 patients, 23 were female and 49 were male. There was male preponderance in our study group with a male distribution of 68.06%.Among our study group, 30 cases were of acute abdomen, 19 of necrotizing soft tissue infection, three gas gangrene, two meleneys' gangrene, two wet gangrene, three cholangitis, three Fournier\u2019s gangrene, one ruptured hydatid cyst, two road traffic accidents, one gangrenous ileostomy, two cellulitis lower limb, and three ruptured liver abscess. All patients were selected according to the new definition of sepsis (Sepsis-3).In our study group, 23 patients had comorbidities - diabetes mellitus (DM), hypertension\u00a0(HTN), chronic kidney disease\u00a0(CKD), chronic obstructive pulmonary disease\u00a0(COPD), chronic liver disease (CLD), hepatitis B, hepatitis C, HIV, hepatocellular carcinoma (HCC), coronary heart disease, and hemolytic uremic syndrome (HUS). Most of the patients were on ionotropic support.Out of 72 patients, there was a mortality of 63 patients (87.50%). Mean survival time of 3.68 \u00b1 2.88 SD days, a median of three days, and IQR (Inter-quartile range) between one and six days. The survival time in days ranged between one and 10 days.Out of the total study group of 72 patients, 63 patients had mortality and the mean APACHE II score for the patient who died is 20.76 \u00b1 9.4SD and the median score is 21. The mean value for the APACHE II score on day 1 is 0.004 which is significant  0.97, standard error of 0.019, 95% confidence interval of 0.900 to 0.996, cut-off >4.6667 and P-value <0.0001, which was statistically significant  of 100 and negative predictive value (NPV) of 22.5. Day 1 SOFA score had sensitivity of 68.25, specificity of 77.78, positive predictive value of 95.6 and negative predictive value of 25.9. The mean SOFA score had\u00a0sensitivity of\u00a093.65,\u00a0specificity of 100, and had highest negative predictive value of 69.2; however positive predictive value is 100 which is similar to that of day 1 APACHE II score  for predicting hospital mortality in surgical patients with sepsis. However, when we compare mean SOFA score with day 1 SOFA score and day 1 APACHE II score the value came out to be 0.0008 and 0.0066, which was statistically significant . We calculated the APACHE II and SOFA scores for the patients on the first day of admission. We calculated scores using the worst value of each parameter in a period of 24 hours.Sepsis can affect any age group and in the present study of 72 patients the age group ranged between 14 and 88 years with most of the patients falling under the age group of 21 to 30 years with a mean age of 41.28 years. There was male preponderance in our study with a male distribution of 68.06% and the female distribution of 31.94%. Other similar studies conducted by Todi et al.  and AbhiIn the present study out of the total 72 patients, there was a mortality of 87.50% of the patients, which was quite high compared to other studies by Ganar et al.  and\u00a0Gris\u00a0So our present study suggests that both SOFA score and APACHE II score have similar discriminative powers when evaluated at the time of admission (Day 1) for predicting hospital mortality in surgical patients with sepsis as there is no statistically significant difference between the two scores on day 1 with a P-value of 0.3312. However, the sensitivity of the APACHE II score in predicting mortality on day 1 is (50.79) which is less than that of the SOFA score on day 1 (68.25) but the specificity is higher (100) than the SOFA score on day 1 (77.78).In our present study, we also took the serial measurement of the SOFA score in the study group for a period of 10 days. There was a statistically significant difference between the AUC of SOFA and the mean SOFA score  with a P-value of 0.0008, and the AUC of Day 1 APACHE II and mean SOFA score has a P-value of 0.0066 which was also statistically significant and the mean SOFA score had sensitivity 93.65 and specificity 100, depicting that mean SOFA is a better predictor of mortality than D1 APACHE II and D1 SOFA scores. Hence, the SOFA scoring system has higher predictive value when measured serially as the mean and highest scores reflect the patient\u2019s clinical status more accurately.\u00a0A previous study conducted by Ganar et al. [So, from our study, we have been able to reveal that SOFA scoring is as efficient as the APACHE II scoring system at the time of admission in the assessment of mortality in surgical patients with sepsis. However, if serial measurements of the SOFA score are done during the patient\u2019s hospital admission, and the mean SOFA score is taken, it becomes a very useful tool in predicting mortality.Sepsis is a major healthcare problem and one of the leading causes of mortality and morbidity among surgical patients. The results from our study show that both APACHE II and SOFA scores are equally effective in assessing mortality in surgical patients with sepsis at the time of admission; however, if serial evaluation of the SOFA score is done and the mean of SOFA score calculated to assess outcome it gives better results, with the trend of SOFA score declining in survivors while nonsurvivors had a stable higher score."}
+{"text": "The utility of the Sequential Organ Failure Assessment (SOFA) score in predicting mortality in the intensive care unit (ICU) has been demonstrated before, but serial testing in various settings is required to validate and improve the score. This study examined the utility of the SOFA score in predicting mortality in Jordanian ICU patients and aimed to find a modified score that required fewer laboratory tests.  A prospective observational study was conducted at Jordan University Hospital (JUH). All adult patients admitted to JUH ICUs between June and December 2020 were included in the study. SOFA scores were measured daily during the whole ICU stay. A modified SOFA score (mSOFA) was constructed from the available laboratory, clinical, and demographic data. The performance of the SOFA, mSOFA, qSOFA, and SIRS in predicting ICU mortality was assessed using the area under the receiver operating characteristic curve (AUROC).  194 patients were followed up. SOFA score (mean\u2009\u00b1\u2009SD) at admission was significantly higher in non-survivors (7.5\u2009\u00b1\u20093.9) compared to survivors (2.4\u2009\u00b1\u20092.2) and performed the best in predicting ICU mortality  compared to qSOFA  and SIRS . The constructed mSOFA included points for the hepatic and CNS SOFA scores, in addition to one point each for the presence of chronic kidney disease or the use of breathing support; it performed as well as the SOFA score in this cohort or better than the SOFA score in a subgroup of patients with heart disease.  SOFA score was a good predictor of mortality in a Jordanian ICU population and better than qSOFA, while SIRS could not predict mortality. Furthermore, the proposed mSOFA score which employed fewer laboratory tests could be used after validation from larger studies. Clinical scoring systems provide a helpful tool for predicting the outcome of patients in critical care and usually derive a severity score from a variety of measurable clinical and laboratory variables . In addi2 of <32\u2009mm\u2009Hg; and (4) a leukocyte count of >12000 or <4000/microliter or over 10% immature forms or bands [The SOFA scoring scheme assigns 1 to 4 points for each organ system  depending on the level of dysfunction, where a score of 0 is given for normal function while 4 is given for severe dysfunction . Althougor bands .Several factors can affect the discriminative ability of scoring systems such as the setting  and the population under investigation. When considering in-hospital mortality, for example, the discriminative ability of the SOFA score was greater than qSOFA or SIRS in a large study in Australian and New Zealand ICUs , but sucTherefore, this study aimed to assess the use of the SOFA score in predicting mortality in Jordanian ICU patients, for which no previous data were found. The study also compared the predictive ability of the SOFA score to qSOFA and SIRS scores. Those scores were chosen for comparison because they require no additional clinical or lab variables than those routinely collected for all ICU patients, they are commonly used in the ICU , and theThis was a single-center prospective cohort study conducted at the adult ICUs of Jordan University Hospital (JUH), Amman, which is the largest teaching tertiary hospital in the capital and serves thousands of patients from various regions of the country. We followed up 194 admissions to JUH ICUs over a period of 6\u2009months . The characteristics of the study cohort were described previously in a study that investigated the characteristics of adult sepsis patients in the ICU [The Institutional Review Board (IRB) approved the study protocol at JUH (Ref. No. 189/2020). In addition, the work was conducted according to the principles of Good Clinical Practice (GCP) that have their origin in the Declaration of Helsinki . All collected data were treated with confidentiality.Participation in the study was voluntary. After fully explaining the study objectives, written and signed informed consent was obtained from all conscious patients who agreed to participate. Assessing the level of consciousness involved checking orientation: participants who were able to promptly and spontaneously state their name, location, and date or time were said to be conscious. For patients who were unconscious or unable to consent at the time of admission, consent was obtained from first-degree relatives. However, consent was sought from those who survived once they regained consciousness or improved clinically to a stage where they can consent.The recorded data were categorized into demographic, clinical, and laboratory variables for each admission. Demographic variables included age, sex, height, weight, comorbidities, date of admission to the hospital and ICU, and date of discharge from the hospital and ICU.Clinical variables included the ICU section , source of ICU admission, reasons for admission, origin of infection for patients with sepsis, vital signs on admission, and medical interventions .2), fractional inspired oxygen (FiO2), total protein, random blood sugar (RBS), and electrolytes  as well as microbiological findings such as culture results and type of samples used for culture.Laboratory variables included hemoglobin, packed cell volume (PCV), total WBC count, neutrophils, lymphocytes, platelet count, creatinine, bilirubin, arterial oxygen partial pressure  was calculated as (the date of ICU discharge\u2013the date of ICU admission). Hospital LOS was calculated as the discharge date\u2013the hospital admission date. The diagnosis of sepsis was based on the diagnostic guidelines of Sepsis-3 that were set in 2016 by the ic Shock . Sepsis mean SOFA was the average of daily SOFA scores of any individual during their ICU stay; maximum SOFA was the highest SOFA score of any individual during their ICU stay; and delta SOFA was the SOFA score after 48\u2009hours of admission\u2013SOFA score at admission. In the mSOFA score, chronic kidney disease was defined as structural or functional abnormalities of the kidneys for \u22653\u2009months, and dialysis patients were included only if they fulfilled the aforementioned definition [The finition . Breathit-test for continuous variables, while the Wilcoxon rank-sum test was used when normality was violated. Normality was tested using histograms and the Shapiro\u2013Wilk test. For categorical variables, the chi-square test and Fisher's exact test were used.Data generated were organized in Microsoft Excel and statistical analysis was done using R statistical language, version 4.1.3 . Descriptive statistics were presented as counts/percentages for categorical variables and as means\u2009\u00b1\u2009standard deviation/medians for continuous variables. The association between survival status and different scores was assessed using Student's p value of less than 0.05 was considered statistically significant.The association of the SOFA score and SOFA organ-specific subcomponents to SIRS was assessed visually by producing scatter plots and quantitatively using Spearman's correlation coefficient. Odds ratios (ORs) were calculated using univariate and multivariate logistic regression models. Backward logistic regression was used to reach the minimum number of significant variables for the predictive model. The area under the receiver operating characteristic curve (AUROC) was used to assess the discriminative power of SOFA, qSOFA, SIRS, and the modified SOFA models. An AUROC of 0.5 indicates that the model has no discriminative power and an AUROC of 1.0 indicates perfect discriminative power . De LongDemographic and clinical data of the 194 patients admitted to the adult ICUs at JUH during the study period were described in a previous epidemiological study about sepsis in the ICU . In briep < 0.001). Organ-specific subcomponents of the SOFA scores  which reflect the dysfunction in each organ system separately were significantly higher in non-survivors ; maximum SOFA ; and delta SOFA (SOFA score after 48\u2009hours of admission\u2013SOFA score at admission), showed significantly higher scores in non-survivors than in survivors (Examination of the following SOFA score derivatives: the urvivors .p < 0.001).The serial measurement of the SOFA score across the ICU stay allowed for visualization of the change in scores for survivors and non-survivors over the first 7\u2009days . Scores rs) was used to investigate a correlation between each organ system SOFA and SIRS criteria (scored 0\u20134). SOFA and organ-specific SOFA scores were not correlated with SIRS   and atrial fibrillation, while lab tests included creatinine and potassium  of 4 or more was sufficient to remove the variable [Afterward, significant variables with a variable . Lab resp value <0.001). All patients with an mSOFA score above 4 at admission died in the ICU.Subsequently, a backward logistic regression analysis of all variables considered for multivariate analysis was performed to end up with the most reduced predictive model, and a modified SOFA (mSOFA) score was constructed . HepaticTo assess the performance of different scores in predicting ICU mortality, an AUROC analysis was performed.The analysis revealed that both SOFA and mSOFA scores had the best predictive ability  and , respectively, with qSOFA behind , and SIRS performed the worst  .Specificity and sensitivity as well as cutoff values for each score are found in the supplementary material , followed by average SOFA , while delta SOFA performed worse than SOFA at admission  , kidney disease (n\u2009=\u200939), hypertension (n\u2009=\u2009104), and diabetes mellitus (n\u2009=\u200990)  .p=0.033), while SOFA performed significantly better than qSOFA and SIRS in patients with kidney injury, hypertension, and diabetes  than the initial SOFA. It should be noted that delta SOFA can have more than one definition; many studies define it as the  [The SOFA score was previously shown to be a good predictor of ICU mortality in several recent studies \u201323, most reports , 26, whion SOFA) , 28. Ouron SOFA) .The dependence of qSOFA on clinical characteristics rather than laboratory tests makes it favorable in emergency department (ED) settings  and in rThe use of SIRS positivity on admission to predict mortality has had varying results. A Brazilian study of ICU patients concluded that although SIRS development was associated with mortality, it was a worse predictor of mortality compared to SAPS-3 . A recenUsing the cohort in this study, a modified SOFA score was generated depending on the most predictive variables of mortality. The mSOFA score used hepatic SOFA, CNS SOFA, CKD, and breathing support with a total of 10 points. ICU non-survivors had a significantly higher mSOFA at admission than survivors and all patients with a score above 4 at admission died in the ICU. Additionally, the mSOFA had equivalent ICU mortality prediction to regular SOFA, although it utilized fewer laboratory tests. The respiratory SOFA was replaced by only one point for using any type of breathing support, and renal SOFA was replaced by having documented chronic kidney disease, while the coagulation SOFA was disregarded. This meant that laboratory tests for arterial oxygen, creatinine, and platelet count were not needed. This could be useful for the serial measurement of SOFA, especially in situations such as pandemics where ICUs may be overwhelmed and resources are scarce. Several studies looked at modifications in the SOFA score for better mortality prediction using fewer variables; one study indicated that a modified SOFA that replaced hepatic SOFA with scleral icterus or jaundice and disregarded coagulation SOFA predicted mortality as well as the standard SOFA  . The samThe predictive ability of the SOFA score was measured in various groups of participants, and the presence of comorbidities led to different prediction values with an AUROC of 0.752 in patients with heart diseases to 0.877 in patients with kidney diseases. A study with a large cohort of patients admitted to the ICU following cardiac surgery revealed that day 1 SOFA was able to predict mortality with a comparable AUROC of 0.809 to this study but concluded that in that specific group of ICU patients, traditional scores such as APACHE-IV and SAPS-II were better . PatientThis study had some limitations that should be considered. Firstly, it was performed on ICU patients in a single hospital, and while JUH is the largest tertiary hospital in the capital and receives patients from various regions of the country, it would be difficult to generalize the utility of the SOFA score to other ICUs in Jordan which vary greatly in their capabilities. Another limitation is related to the validation of the mSOFA score, which was only done internally in various subgroups of patients and would require larger multicenter cohorts' validation before clinical use. Finally, although mSOFA here might provide a suitable alternative to the standard SOFA, it is only useful in post-admission settings. Since mSOFA in this study uses breathing support as one of the criteria, it cannot be used in the pre-admission triage of patients.In conclusion, SOFA score utility and superiority to qSOFA and SIRS scores in predicting mortality in the ICU were confirmed in a Jordanian population, adding to the scarce data from developing countries. Furthermore, it indicated the possibility of using a modified score for ICU patients that uses fewer laboratory tests and instead depends on clinical characteristics."}
+{"text": "Opium smoking is commonly practiced via traditional and novel routes in Iran. Both smoking methods are practiced in a non-ergonomic position. According to previous studies and our hypothesis, it can be potentially harmful to the cervical spine. Thus, the present study aimed to investigate the relationship between opium smoking and neck range of motion and neck muscle strength.In this cross-sectional and correlational study, the range of motion and strength of the neck muscles of 120 men with drug use disorder were measured by a CROM goniometer and a hand-held dynamometer. Other data gathering was performed using a demographic questionnaire, the Maudsley Addiction Profile, and the Persian version of Leeds Dependence Questionnaire. The obtained data were analyzed by Shapiro\u2013Wilks test, Pearson\u2019s correlation coefficient and stepwise linear regression.There was no significant correlation between the age of drug use onset and range of motion and muscle strength of the neck; however, the daily duration of opium smoking and the number of years of opium smoking were inversely and significantly correlated with the range of motion and muscle strength of the neck in some directions. Daily opium smoking time for decreasing in neck range of motion and total duration of opium smoking for reduction of neck muscles strength are stronger predictor variables.Opium smoking by traditional routes causes non-ergonomic positions and has a moderate significant correlation with reduced range of motion and neck muscle strength, in Iran.\u2013 The harm of drug use disorder is not only AIDS and hepatitis, and harm reduction programs should go beyond the prevention of AIDS and hepatitis. According to more than 90% of smoking use of drug compared to other methods  musculoskeletal disorders caused by the smoking use of drugs, have a greater cost burden in reducing the quality of life and the need for rehabilitation.\u2013 Drug abuse treatment and harm reduction programs should focus more seriously on replacing smoking use of drugs with oral medications assisted treatment.\u2013 Although in Iran and some countries in the region, a large number of people smoke opium for many years and sometimes all their lives, daily in a completely non-ergonomic position, but studying the deformation of the posture and musculoskeletal disorders related to the body position in them, is not a scientific concern and neither physical therapy researchers have paid attention to it nor addiction researchers.\u2013 Neck muscles strength and range of motion in opium addicts are correlated to the number of years of opium smoking and daily minutes of opium smoking, but not to its oral use.\u2013 There is no significant correlation between the onset age of continues and permanent opium smoking and substance dependence severity with neck range of motion and muscles strength.\u2013 People with drug use disorder  as a large group of vulnerable people, should be the target population of musculoskeletal disorders researchers and addiction harm reduction researchers, and more experimental, comparative, cohort, etc. researches should be designed and implemented for them. The physical posture of individuals is generated by their movement habits. Moreover, it is formed on a morphological and functional basis and is a manifestation of the individual\u2019s physical and mental conditions . TherefoAs long as corrective action is not taken to improve posture, its adverse effects on the body will continue and postural pressure will be imposed on the person. Accordingly, the odds of musculoskeletal disorders related to work or non-ergonomic position remains high . PerformThis cross-sectional and correlation study was conducted in 2021 in Tehran City, Iran. By snowball sampling method, we selected 120 men from four main branches according to the inclusion and exclusion criteria of the study among the referrals to four outpatient and residential substance abuse treatment centers.2 . Also, the exclusion criteria were a history of neuromuscular or skeletal disease, a history of surgery in spine and shoulder girdle areas, a history of championship or practicing sports regularly, any impairments in balance control caused by a specific disease, any obvious postural deformities and anatomical disorders, and using smartphones and tablets for more than 30\u2009min a day  criteria , abilityin a day .Data collection was performed using demographic questionnaire, Maudsley Addiction Profile (MAP)  and PersTo confirm the reliability of the measurement method, 10 subjects participated in an extra four testing sessions of neck muscle strength and ROM test in 2\u2009weeks.Statistical analysis was done by SPSS software version 23 through Shapiro\u2013Wilk test, correlation coefficient tests (ANOVA and Pearson) and stepwise linear regression.The study has been approved by the Ethics Committee of the University of Social Welfare and Rehabilitation Sciences with the code of IR.USWR.REC.1398.120. This article is extracted from doctoral thesis of the first author.2. 53 people were workers, 58 people were employees, and the rest were unemployed. Also, 37 people had primary education, 68 people had high school education, seven people had university education, and the rest were illiterate. The substance use profile of the study participants is available in The mean\u2009\u00b1\u2009SD age of the study participants was 39.30\u2009\u00b1\u20095.05\u2009years and their mean BMI score was 24.29\u2009\u00b1\u20092.12\u2009kg/mThe results of inter-rater and intra-rater reliability tests suggested that the measurement methods were reliable. For inter-rater reliability, the Intraclass Correlation Coefficients (ICCs) ranged from 0.6 (CI: 0.18\u20130.86) for measuring the range of left lateral flexion to 0.88 (CI: 0.64\u20130.95) for forward flexion; regarding muscle strength, ICCs ranged from 0.64 (CI: 0.22\u20130.91) for extension to 0.92 (CI: 0.66\u20130.97) for forward flexion. For intra-rater reliability, the ICCs ranged from 0.68 (CI: 0.20\u20130.90) for right lateral flexion to 0.94 (CI: 0.86\u20130.98) for extension; and in muscle strength ICCs, they ranged from 0.68 (CI: 0.20\u20130.89) for left lateral flexion to 0.9 (CI: 0.65\u20130.93) for extension.There was no significant relationship between the onset age of permanent opium smoking and the ROM of the neck. However, a significant correlation was recorded between the opium smoking duration (months/lifetime) and daily opium smoking time (minutes/day), and the ROM of the neck in most directions .Furthermore, as per In order to determine the most effective independent variable in decreasing the range of motion and muscles strength of neck, stepwise regression analysis was used. For this purpose, the average of the total range of motion of the neck in all six directions was calculated for each participant and considered as a unique index of the range of motion of the neck. Also, average muscle strength in four directions was used as an index of neck muscle strength in regression analysis. As shown in Perhaps in recent decades, the most serious complication and the riskiest consequence of substance use disorder is the transmission of Human Immunodeficiency Virus (HIV) and hepatitis viruses to substance users, through injection drug use. However, it is certainly not the most frequent issue, especially if we consider the harms associated with substance use disorder regionally and the most common route of substance use in that region . For exaMany people, depending on their habit or work needs, foster an inappropriate body position, which causes postural pains in the long term. Each individual, depending on the type of practiced physical or sports activities, is prone to certain types of mild postural abnormalities or deviations, i.e., suitable for that activity at that given time , 25. HowPosture deformities, i.e., mostly acquired and caused by non-ergonomic positions, are related to the ROM of the neck , 33. As Furthermore, previous studies indicated a correlation between psychosocial characteristics and mental health confounders as well as the incidence of musculoskeletal disorders; the results of this study are in line with these prior investigations. This is because substance use disorder is among the main psychosocial health disorders in today\u2019s societies , 40.The main limitation of this study was the lack of previous similar studies and the literature review was not very helpful. I hope this study will draw the attention of researchers and policymakers to the allocation of funds and efforts for this issue, and will make them document more convincing results with more extensive studies and with more accurate scientific and experimental methods. Another limitation of this study was that the samples were only male. Although we did not intend to do so from the beginning, we had to use only men.The traditional and novel methods of opium smoking, which are used in the Persian Gulf countries, the Middle East, Central Asia, and even the countries of East Asia, and require sitting in non-ergonomic positions for long hours, have a significant correlation with neck problems and it seems to be effective in reducing muscle strength and range of motion of neck.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Ethics Committee of the University of Social Welfare and Rehabilitation Sciences with the code of IR.USWR.REC.1398.120. This article is extracted from doctoral thesis of the OM in PhD by Research of Addiction Studies. The patients/participants provided their written informed consent to participate in this study.Data gathering and data analysis were done by OM. OM, AA, AF, MN, and FH contributed to design, drafting, and writing and editing of the article. All authors contributed to the article and approved the submitted version..The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interestAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Parkinson\u2019s disease (PD) is the second most common neurodegenerative disease and is characterized by the loss of midbrain dopaminergic neurons. Endocrine disrupting chemicals (EDCs) are active substances that interfere with hormonal signaling. Among EDCs, bisphenols (BPs) and perfluoroalkyls (PFs) are chemicals leached from plastics and other household products, and humans are unavoidably exposed to these xenobiotics. Data from animal studies suggest that EDCs exposure may play a role in PD, but data about the effect of BPs and PFs on human models of the nervous system are lacking. Previous studies demonstrated that machine learning (ML) applied to microscopy data can classify different cell phenotypes based on image features. In this study, the effect of BPs and PFs at different concentrations within the real-life exposure range  on the phenotypic profile of human stem cell-derived midbrain dopaminergic neurons (mDANs) was analyzed. Cells exposed for 72\u00a0h to the xenobiotics were stained with neuronal markers and evaluated using high content microscopy yielding 126 different phenotypic features. Three different ML models  were trained to classify EDC-treated versus control mDANs. EDC treated mDANs were identified with high accuracies (0.88\u20130.96). Assessment of the phenotypic feature contribution to the classification showed that EDCs induced a significant increase of alpha-synuclein (\u03b1Syn) and tyrosine hydroxylase (TH) staining intensity within the neurons. Moreover, microtubule-associated protein 2 (MAP2) neurite length and branching were significantly diminished in treated neurons. Our study shows that human mDANs are adversely impacted by exposure to EDCs, causing their phenotype to shift and exhibit more characteristics of PD. Importantly, ML-supported high-content imaging can identify concrete but subtle subcellular phenotypic changes that can be easily overlooked by visual inspection alone and that define EDCs effects in mDANs, thus enabling further pathological characterization in the future. The pathogenesis of PD involves a combination of environmental and genetic risk factors, which collectively contribute to the development and progression of the disease. The main cellular and molecular hallmarks of PD are represented by the loss of midbrain dopaminergic neurons (mDANs) in the substantia nigra pars compacta, and intracellular aggregation of alpha-synuclein (\u03b1Syn), respectively2. Importantly, \u03b1Syn aggregates can disrupt normal cellular processes and contribute to the repression of tyrosine hydroxylase (TH), the rate-limiting enzyme in brain catecholamine biosynthesis, decreasing dopamine production3. These features lead to the onset of the characteristic motor  and non-motor  symptoms of PD4.Parkinson\u2019s disease (PD) is the second most common neurodegenerative disease, affecting about 3% of the population above 65\u00a0years5. EDCs include bisphenols (BPs), such as bisphenol A (BPA) and S (BPS), and perfluoroalkyls (PFs), such as perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA). These chemicals are widely diffuse, since BPs are used to produce polymers and resins for the production of polycarbonate plastics, food packaging, food cans, and thermal receipts6. Similarly, PFs are found in different items of common use as cookware and paper food packaging7. As a consequence, humans are constantly and unavoidably exposed to these xenobiotics that may threaten human health via different routes such as dermal absorption, inhalation and dietary ingestion8. EDCs have been detected in human serum, urine, placental tissue, umbilical cord blood and breast milk11. These findings underscore the ability of EDCs to enter and persist within the human body, raising serious concerns about their detrimental effects on human health. Although the molecular mechanism has not been completely clarified, it is generally accepted that BPs act as xenoestrogen, binding and activating the estrogen receptors (ER) \u03b1 and \u03b2, while PFs can interfere with the ER, the androgen and thyroid hormone receptors13. Numerous studies have associated exposure to these EDCs with a range of health concerns, including reproductive disorders, developmental abnormalities, metabolic dysfunction, and an increased risk of several cancers15.Endocrine disrupting chemicals (EDCs) are hormonally active substances present in the environment, including household and industrial products, and can have adverse effects on human health18. Exposure to these chemicals may deteriorate the dopaminergic system, suggesting a role in PD development19. Numerous research works have contributed to explaining this association. For instance, studies conducted in zebrafish and in Drosophila melanogaster have demonstrated that BPs significantly alter the dopaminergic system19. Similarly, BPA-exposed monkey fetuses display reduced levels of dopamine in midbrain dopaminergic neurons20 and a recent investigation showed that EDCs exacerbated phenotypes in a murine PD model21. Likewise, when mice were chronically exposed to a mixture of different PFs, a significant decrease in brain dopamine production was reported22. Also, shorter exposure to PFs  exerted a detrimental effect on the dopaminergic system of Caenorhabditis elegans23.Emerging data indicate that BPs and PFs also negatively affect the nervous system24, it is currently unclear which aspects of human mDAN cellular biology can be modified by BPs and PFs, leaving a critical gap in the understanding of the mechanisms underpinning EDC-induced neurotoxicity. In addition, in vitro toxicological studies are often performed using high concentrations of EDCs in the range of hundreds of \u00b5M to several mM, that do not mimic a realistic exposure26. In recent studies, machine learning (ML) classification approaches have been successfully used for cell line stratification and identification of chemical-treated human mDANs and could be exploited for neurotoxicity studies in vitro29.Although these studies suggest that BPs and PFs have the capacity to alter the dopaminergic system thus contributing to the development and progression of PD, current scientific literature lacks information about the involvement of these xenobiotics on human mDAN pathology. Although epidemiological studies show a relationship between EDC exposure and neurodegenerative diseases32. This was achieved by using high-content fluorescence microscopy to analyze the morphological characteristics affected by these EDCs. Our hypothesis was that EDCs can induce specific morphological modifications in the phenotypic profile of mDANs similar to the ones observed in PD patients. For this purpose, human mDANs were treated with increasing low-dose concentrations  of BPA, BPS, PFOS, and PFOA for 72\u00a0h and stained using immunofluorescence. We then quantified 126 phenotypic features from the high-content imaging dataset and three different ML models  were trained to classify EDC-treated versus control mDANs. By means of this image data-based ML classification approach we measured at which concentrations EDCs induce overall phenotypic changes and which neuronal phenotypic features are most impacted.The primary objective of this study was to examine the pathological impact of exposure to BPs and PFs on human stem cell-derived mDANs, a cell type widely used for disease modelling2) and an average pixel intensity lower than 1500. Smaller and brighter nuclei were assumed to show signs of DNA compaction and were considered as apoptotic. No modifications in cell viability were observed when mDANs were treated with BPA, BPS, PFOS or PFOA  and Pairwise Controlled Manifold Approximation (PaCMAP) were usedDue to the high dimensionality of phenotypic profiles and the large number of changed features, it is not trivial to identify feature patterns that correlate with an experimental condition. Supervised ML classification algorithms are designed to learn rules from large and complex datasets and compute the probability of a new data point falling into predefined classes, such as EDC treated or untreated conditions. We exploited three \u201copen\u201d ML classifiers that allowed us to deduce which data features are most explanatory for the observed differences between classes and to identify generalizable rules related to the cell biological effects of EDC exposure.LDA, XGBoost and LightGBM are popular ML classification algorithms. LDA is used for finding a linear combination of features that best separates classes, while XGBoost and LightGBM are used for creating a series of models that learn from the errors of the previous models to improve prediction accuracy. The main difference between XGBoost and LightGBM is how they build decision trees. XGBoost builds trees one level at a time, while LightGBM focuses on the leaves, or endpoints, of the tree. All three models allow the extraction of features weights. These weights can provide insights into which features are most important in the classification result, helping to interpret the model. Briefly, all the image datasets for each condition were divided into a train set (90% of the dataset) and a test set (10% of the dataset). LDA, LightGBM and XGBoost classifiers were then trained to distinguish treated from untreated phenotypic profiles using the training set. All EDC concentrations ranging from 0.01 to 2\u00a0\u03bcM were assigned to the treated class. The trained model was applied to the previously unseen test set phenotypic profile data to cross validate the classification performance Fig.\u00a0A.Figure . Confusion matrices were plotted for all three classifiers to check for by-class errors and to calculate the accuracy exclusively to the test set. The test set contained data from 15 control and 11 chemicals treated wells across all concentrations and EDCs. LDA classification resulted in the lowest accuracy (0.88) among the three methods used . Regarding the two best performing classifiers, LightGBM model performance relied on a larger range of features with only a single feature contributing more than 5%, compared to XGBoost model, where 6 features contributed between 5 and 15% to performance. Interestingly, for both classification algorithms, the intensity of TH signal around the cytoplasmic membrane, the MAP2 cell surface per nucleus, and the cellular intensity of \u03b1Syn were among the most contributing features to distinguish control and EDCs treated samples  are two crucial proteins in mDANs. A significant fluorescence intensity increase for TH, the enzyme critical for dopamine biosynthesis, was detected inside the neurons: the signal marked the entire cell body, but an increase around the cellular membrane was also observed. Statistical analysis showed that BPA and BPS increased cytoplasmic TH levels at 0.1 and 2\u00a0\u00b5M. Both PFOS and PFOA lead to increased TH signal intensity in the cytoplasm at 1 and 2\u00a0\u00b5M, and PFOA also increased this feature at 0.1\u00a0\u00b5M.Both LightGBM and XGBoost classification algorithms showed that EDC-treated and untreated mDANs differ also in the membrane-associated TH and \u03b1Syn signal mean intensities Fig.\u00a0G,J. TH aAlso, BPA significantly increased TH intensity around the membrane at 0.1 and 2\u00a0\u00b5M. Similarly, BPS increased the TH signal intensity around the membrane at 0.1, 1, and 2\u00a0\u00b5M. PFOS increased TH intensity around the membrane only at 1 and 2\u00a0\u00b5M, while PFOA induced this increase at all concentrations compared to control  BPs and PFs lead to a net increase of \u03b1Syn protein level, a characteristic hallmark of PD; ii) EDC treatment dramatically impaired the neuron network, decreasing neurite length and the branching points per cell; iii) ML successfully classified cells treated with the selected compounds compared to methanol only controls allowing to extract phenotypic features and feature combinations that can be easily overlooked when inspecting cells visually.BPs and PFs belong to the EDC class due to their ability to interfere with the endocrine system. Recent studies suggest that these compounds can have detrimental effects on the nervous system and that they can worsen PD symptoms in different PD model systems37, in our setting BPs and PFs did not significantly impact cell viability. High content imaging analysis showed that 72-h exposure to BPA, BPS, or PFOA resulted in an increase of \u03b1Syn levels in human mDANs. This effect was particularly evident at the highest tested concentration (2\u00a0\u00b5M)  Figs.\u00a0B. In lin41. The elevation of \u03b1Syn levels within the cytoplasm suggests altered protein aggregation dynamics or impaired protein degradation mechanisms. These findings are in line with the growing evidence linking environmental exposure to biologically active compounds to \u03b1Syn pathology and neurodegenerative processes42.Effects of BPs and PFs on \u03b1Syn levels have not been reported; however, a single oral dose of either PFOS or PFOA increased the levels of tau protein in the cerebral cortex and hippocampus of mice, indicating a role in the dysregulation of normal neural homeostasis. The marked increase in \u03b1Syn fluorescence intensity within the mDANs cytoplasm following BPA and BPS exposure is noteworthy, as \u03b1Syn plays a central role in the pathogenesis of PD and other synucleinopathies43 and the TH level increase in both cytoplasm and the neuronal membrane could account for an increased synthesis or for a decreased degradation the enzyme. While the increased signal at the membrane could also suggest an intracellular redistribution from the cytoplasm to the membrane, the overall increased of TH signal after BP treatment seems to rule out this hypothesis, supporting a potential BP effect on TH metabolism . This finding is consistent with previous studies demonstrating that BPA and BPS may affect dopaminergic pathways and neurotransmitter function44. Similarly, PFAS-exposed mice, showed a decrease of TH transcription22 while PFOS exposure upregulated TH and dopamine transporter in zebrafish embryos45, suggesting that PFs could lead to a changed regulation of neuron-related proteins, related to the doses, treatment time and the used model. It is known that cellular TH levels decrease during PD, affecting dopamine synthesis46. In our setting, the increased levels of TH could reflect an initial compensatory mechanism exerted by mDANs in response to EDC exposure. However, the hypothesis that TH signal increase might reflect a higher concentration due to the observed reduced cellular area cannot be excluded. We also noted that the overall cellular surface labelled by both TH and \u03b1Syn antibodies (TH/\u03b1Syn double positive cellular surface intensity) increased following BPA and BPS, but not PFOA or PFOS exposure. These results confirm the neurotoxic effects of BP exposure on human mDANs thus corroborating current literature supporting the role of this EDC class in the development of neurodegenerative diseases  and high concentration (2\u00a0\u00b5M), but not at medium ones (1\u00a0\u00b5M). Interestingly, these findings recapitulate the non-monotonic effect of different EDCs previously shown in vitro, in animal models, and humans14. For example, acute low-dose BPS administration exerted a detrimental action in mouse oocytes, while higher concentrations did not show such an effect52. Also, a non-monotonic, inverted U-shape dose\u2013response relationship was demonstrated for PFOS and global cognition in humans53.Closer analysis of neurite-related features demonstrated that exposure to BPA, BPS, PFOS, and PFOA negatively impacts neurite length and the number of branching points in mDANs. These findings suggest that these EDCs may disrupt the structural development of neuronal processes, which are critical for proper connectivity and communication within neuronal networksogy Fig.\u00a0B. The BP56.Moreover, the importance of our findings is corroborated by the fact we treated mDANs with a range of concentration that include the levels found in different human body fluids Taking not only single but all phenotypic features into account, Cosine distance-based clustering and data embedding using UMAP and PaCMAP showed that at 2\u00a0\u00b5M BPA and BPS phenotypic profiles are similar to each other but differ from PFOA and PFOS profiles which are also similar to each other Fig.\u00a0B,C. This27. ML can help to identify subtle phenotypic patterns that may be easily overlooked but that may be relevant representing the initial signs of cellular distress. This approach appears to be particularly important in the context of the studies on environmental chemicals\u2019 effects on human health. Humans are chronically in contact with these biologically active substances and the consequences on the neurotransmitter systems might become evident only after a protracted exposure, making their risk assessment very challenging. By analyzing large datasets, ML algorithms can detect complex relationships and patterns that may not be immediately apparent to human observers. In this study, by means of the ML approach, EDC treated and untreated mDANs were differently classified based on relevant biological features related to PD, such as increased \u03b1Syn expression and diminished neurite network length. These data are particularly important, as we exposed human mDANs to BPs and PFs doses that resemble the real-life exposure range.One of the notable findings of this study is the ability of ML to accurately discriminate and classify the phenotypic profiles of mDANs treated with EDCs. Specifically, when the XGBoost algorithm was applied to our image-derived dataset, it correctly classified mDANs treated with EDCs and control cells with a high accuracy of 0.96. FI. We preWe anticipate that additional applications of ML classifiers on high-content imaging data in toxicological studies in different model systems are necessary to gain further insights into their predictive power. In the future our approach might also represent a non-animal method for pre-clinical studies, supporting the goal to decrease animal use in toxicology and drug discovery.Our results provide important information regarding the effect of BPA, BPS, PFOS and PFOA on human mDANs, showing that they drive mDANs toward PD-like phenotypes, at different concentrations within the real-life exposure range. Importantly, our ML-supported image analysis approach can identify phenotypic changes that define detrimental EDCs effects, thus representing a useful tool for further mechanistic neurotoxicity studies.On Day 1, Complete Maintenance Media and plates for neuron seeding were prepared. All reagents are listed in Table 2 for 72\u00a0h.Commercially available cryopreserved 35\u00a0days old human induced pluripotent stem cell (hiPSC) derived mDANs were used for this study Table . On Day Neurons were fixed in 4% PFA for 30\u00a0min and then permeabilized and blocked in a 1X blocking solution Table  for 1\u00a0h 2) wide window inside of the cell edges. Based on the segmentations, in total 126 quantitative image features were calculated and averaged per well  were generated. The used dataset contains 126 columns with continuous phenotypic feature data derived from the image segmentation workflow described above. Additional columns include categorical data that detail the experimental conditions used, such as the position on the plate or the chemical treatment applied. Each row in the dataset represents the mean values per well of a 384-well plate, derived from 16 images. To be suitable for ML, all data was scaled per phenotypic feature using the RobustScaler method in the Python package scikit-learn. RobustScaler scales the data according to the interquartile range (IQR). The IQR is the range between the 1st quartile (25th quantile) and the 3rd quartile (75th quantile). Continuous data was graphically reported by dose\u2013response graphs showing the technical replicate data points, the mean and the 95% confidence interval (CI). Since the data were normally distributed, analysis of variance (ANOVA) was used to determine statistically significant differences between the different concentration of each ED on mDAN phenotypical features. When statistical differences were found, a Tukey post-hoc test was employed and adjusted p-values were considered to check where difference occurred. Results were considered significant when p\u2009<\u20090.05. We provide a Python-based Jupyter notebook to reproduce all data standardization and plotting steps Table .In brief, a pipeline was created for preprocessing and classification using the LDA, LightGBM and XGBoost classifiers. The data was split into training and testing sets, with 10% of the data being used for testing. Grid search cross-validation with 5 folds was used to find the best hyperparameters for each classifier. The pipeline was then trained on the full training set using the best hyperparameters found. Features importance was calculated and plotted to show the most important features used by the models. Predictions were made on the test set, and the probabilities of each sample belonging to the \u201ccontrol\u201d class were calculated. The accuracy of the classifier on the test set was evaluated, and a confusion matrix was computed and plotted as a heatmap. Tenfold cross-validation scores were also calculated and plotted across the whole dataset. We provide a Python-based Jupyter notebook to reproduce all data pre-processing, ML, and visualization steps Table .Supplementary Table 1.Supplementary Table 2.Supplementary Table 3."}
+{"text": "Fcna-/-, and Fcnb-/- mice were selected to construct the BLM-induced lung injury model. Lung epithelial cells were utilized to construct the BLM-induced cell model. Exosomes that were secreted from alveolar macrophages (AMs) were applied for intervention by transporting Fcn B. Clinical data suggested M-ficolin (homologous of Fcn B) was raised in plasma of interstitial lung disease (ILD) patients. In the mouse model, macrophage-derived Fcn B aggravated BLM-induced lung injury and fibrosis. Fcn B further promoted the development of autophagy and ferroptosis. Remarkably, cell experiment results revealed that Fcn B transported by BLM-induced AMs exosomes accelerated autophagy and ferroptosis in lung epithelial cells through the activation of the cGAS-STING pathway. In contrast, the application of 3-Methyladenine (3-MA) reversed the promotion effect of Fcn B from BLM-induced AMs exosomes on lung epithelial cell damage by inhibiting autophagy-dependent ferroptosis. Meanwhile, in the BLM-induced mice model, the intervention of Fcn B secreted from BLM-induced AMs exosomes facilitated lung injury and fibrosis via ferroptosis. In summary, this study demonstrated that Fcn B transported by exosomes from AMs exacerbated BLM-induced lung injury by promoting lung epithelial cells ferroptosis through the cGAS-STING signaling pathway.Pathogenesis exploration and timely intervention of lung injury is quite necessary as it has harmed human health worldwide for years. Ficolin B (Fcn B) is a recognition molecule that can recognize a variety of ligands and play an important role in mediating the cell cycle, immune response, and tissue homeostasis in the lung. However, the role of Fcn B in bleomycin (BLM)-induced lung injury is obscure. This study aims to investigate the sources of Fcn B and its mechanism in BLM-induced lung injury. WT,  The lung is an important part of the respiratory system and is susceptible to damage from the organism and external stimuli . Lung in2+ levels and lipid peroxidation [Ferroptosis, a kind of programmed cell death that is different from necrotic apoptosis, depends on iron and reactive oxygen species (ROS) . The relxidation . Beclin1xidation . As a kixidation . TherefoFicolins, novel pattern recognition molecules of the innate immune system, play an important role in lung diseases due to their sustained high expression in the lungs, recognition of a variety of ligands, and other characteristics . RodentsResearch has shown that the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway is the cause of various inflammatory and autoimmune diseases . RecentlFcna-/- and Fcnb-/- mice to construct BLM-induced lung injury models, and mouse lung epithelial cells to construct a BLM-induced cell model to explore the sources of Fcn B and its mechanism in lung injury, which enriched insights into the pathogenesis of lung injury.Here, we applied WT, Fcna-/-, and Fcnb-/- mice (6\u201310 weeks) were used in this study as described before [Fcna-/-, Fcnb-/-, WT+BLM, Fcna-/-+BLM, Fcnb-/-+BLM, 10 mice in each group. Mice were anesthetized by intraperitoneal injection of 3% sodium pentobarbital and fixed on the operating plate. Mice in WT+BLM, Fcna-/-+BLM, and Fcnb-/-+BLM groups were injected intratracheally with BLM   using a syringe. Mice in WT, Fcna-/-, and Fcnb-/- groups were injected with the same volume of normal saline into the trachea. After injection, the mice were rotated upright for 2\u2009min so that BLM or normal saline was evenly distributed in both lungs. The wound was sutured, and the mice were routinely fed after they recovered naturally.Female WT, d before . After 1d before . Mice inFcnb-/-, WT+BLM, WT+BLM+ExoNC, WT+BLM+Exooe-FcnB, Fcnb-/-+BLM, Fcn-/-+BLM+ExoNC, Fcnb-/-+BLM+Exooe-Fcnb, 10 mice in each group. BLM-induced lung injury models were constructed as in experiment 1. Mice in WT+BLM+ExoNC and Fcnb-/-+BLM+ExoNC groups were simultaneously injected with exosomes  derived from oe-NC plasmids-transfected and BLM-treated MH-S through the tail vein. Mice in WT+BLM+Exooe-Fcnb and Fcnb-/-+BLM+Exooe-Fcnb groups were simultaneously injected with exosomes  derived from oe-Fcnb plasmids-transfected and BLM-treated MH-S through the tail vein. Mice in WT, Fcnb-/-, and WT+BLM groups were simultaneously injected with the same amount of normal saline through the tail vein. The intervention was performed weekly for 3 weeks. Whole blood samples of mice were obtained by eyeball blood collection after anesthesia. Alveolar lavage fluid was collected after the mice were sacrificed for cervical dislocation. Lung tissue samples were obtained from mice dissected under sterile conditions. Mitochondria damage and the number of autophagosomes of lung tissues in the above groups were observed by transmission electron microscopy . All procedures were approved by the Biomedical Research Ethics Committee of the University of South China (NHFE2022010601).Mice in experiment 2 were divided into the following groups: WT, 2 at 37\u2009\u00b0C. When the cell confluence reached 70\u201380%, trypsin digestion, passage, and transfection experiments were carried out.Mouse lung epithelial cells  were cultured in DMEM/F-12  containing 10% fetal bovine serum  and 1% Penicillin/Streptomycin . Mouse alveolar macrophages MH-S  were cultured in 1640  containing 10% FBS and 1% Penicillin/Streptomycin. Cells were placed in a humidified incubator containing 5% CO4 cells. BLM can be added to the upper chamber and the lower chamber, respectively, to induce the cells. In the intervention experiment, GW4869 was added to the upper chamber to inhibit the release of exosomes by AMs. The Transwell chamber system was then placed in a humidified incubator containing 5% CO2 at 37\u2009\u00b0C for 24\u2009h. Finally, MLE-12 cells in the lower chamber were isolated for subsequent analysisIn our study, we used the Transwell chamber system for co-culture experiments. The Transwell chamber system consisted of an upper and a lower chamber separated by a porous membrane that allowed the passage of exosomes while preventing direct cell-to-cell contact. AMs were inoculated in the upper chamber and MLE-12 cells in the lower chamber at a density of 1\u2009\u00d7\u200910Cells in Experiment 1 were divided into the following groups: Control, BLM, BLM+co-AMs, BLM+co-BLM-AMs, and BLM+co-BLM-AMs+GW4869. In the Control group, MLE-12 was cultured normally. In the BLM group, MLE-12 was treated with 40\u2009\u03bcg/mL BLM for 24\u2009h. In the BLM+co-AMs group, MLE-12 was treated with 40\u2009\u03bcg/mL BLM for 24\u2009h and co-cultured with MH-S for another 24\u2009h. In the BLM+co-BLM-AMs group, MLE-12 and MH-S were both treated with 40\u2009\u03bcg/mL BLM for 24\u2009h, and two kinds of cells were co-cultured for 24\u2009h. In the BLM+co-BLM-AMs+GW4869 group, MLE-12 and MH-S were both treated with 40\u2009\u03bcg/mL BLM for 24\u2009h and then co-cultured for 24\u2009h after the addition of 10\u2009\u03bcM GW4869  .si-NC, BLMsi-Fcnb, BLMsi-Fcnb+Exooe-NC, and BLMsi-Fcnb+Exooe-Fcnb. In the Control group, MLE-12 was cultured normally. In the BLM group, MLE-12 was treated with 40\u2009\u03bcg/mL BLM for 24\u2009h. In the BLM+BLM-Exo group, MLE-12 were treated with 40\u2009\u03bcg/mL BLM for 24\u2009h and then co-cultured with exosomes derived from MH-S that were treated with 40\u2009\u03bcg/mL BLM for another 24\u2009h. In BLMsi-NC and BLMsi-Fcnb groups, MLE-12 were transfected with si-NC or si-Fcnb plasmids and then treated with 40\u2009\u03bcg/mL BLM for 24\u2009h. In BLMsi-Fcnb+Exooe-NC and BLMsi-Fcnb+Exooe-Fcnb groups, MLE-12 were transfected with si-Fcnb plasmids and treated with 40\u2009\u03bcg/mL BLM for 24\u2009h, and then treated with exosomes derived from oe-NC or oe-Fcnb plasmids-transfected and BLM-treated MH-S for 24\u2009h.Cells in Experiment 2 were divided into the following groups: Control, BLM, BLM+BLM-Exo, BLMsi-NC, BLMsi-cGAS, BLMsi-cGAS+Exooe-NC, and BLMsi-cGAS+Exooe-Fcnb. In the Control group, MLE-12 was cultured normally. In BLMsi-NC and BLMsi-Fcnb groups, MLE-12 were transfected with si-NC or si-Fcnb plasmids and then treated with 40\u2009\u03bcg/mL BLM for 24\u2009h. In BLMsi-cGAS+Exooe-NC and BLMsi-cGAS+Exooe-Fcnb groups, MLE-12 were transfected with si-cGAS plasmids and treated with 40\u2009\u03bcg/mL BLM for 24\u2009h, and then treated with exosomes derived from oe-NC or oe-Fcnb plasmids-transfected and BLM-treated MH-S for another 24\u2009h.Cells in Experiment 3 were divided into the following groups: Control, BLMsi-NC, BLMsi-cGAS, BLMsi-cGAS+Exooe-NC, BLMsi-cGAS+Exooe-Fcnb, 3-MA, and BLMsi-cGAS+Exooe-Fcnb+3-MA. In BLMsi-NC and BLMsi-cGAS groups, MLE-12 were transfected with si-NC or si-cGAS plasmids and then treated with 40\u2009\u03bcg/mL BLM for 24\u2009h. In BLMsi-cGAS+Exooe-NC and BLMsi-cGAS+Exooe-Fcnb groups, MLE-12 were transfected with si-cGAS plasmids, treated with 40\u2009\u03bcg/mL BLM for 24\u2009h, and then treated with exosomes derived from oe-NC or oe-Fcnb plasmids-transfected and BLM-treated MH-S. In the 3-MA group, MLE-12 were treated with 5\u2009mM 3-Methyladenine (3-MA) for 24\u2009h. In the BLMsi-cGAS+Exooe-Fcnb+3-MA group, MLE-12 were transfected with si-cGAS plasmids, treated with 40\u2009\u03bcg/mL BLM for 24\u2009h, followed by 5\u2009mM 3-MA for 24\u2009h, and then treated with exosomes derived from oe-Fcnb plasmids-transfected and BLM-treated MH-S. Mitochondria damage and the number of autophagosomes in the above groups were observed by TEM.Cells in Experiment 4 were divided into the following groups: BLMAccording to the instructions of the exosome extraction kit , exosomes were extracted from the supernatant of AMs culture. The extracted exosomes were suspended with PBS for subsequent identification experiments. TEM was employed to characterize the morphology of exosomes. Nanoparticle tracking analysis  was performed to characterize the particle size of exosomes. Western blot was used to detect the expressions of biomarkers CD9, CD63, and CD81 in exosomes. Exosomes were labeled with PKH67 and co-cultured with MLE-12 to observe the uptake of exosomes by MLE-12.HE staining was utilized to detect the lung histopathological changes of mice in each group. After the lung tissues were washed with normal saline, they were fixed with a 4% paraformaldehyde solution and then sectioned for use after paraffin embedding. First, the slices were dewaxed by placing them in xylene for 20\u2009min. Then dehydration was carried out with gradient ethanol (75\u2013100%), 5\u2009min for each level. The slices were stained with hematoxylin  for 1\u2009min, rinsed with distilled water, and then returned to blue in PBS. Next, the slices were stained with eosin  for 1\u2009min and rinsed with distilled water. Dehydration was carried out with gradient alcohol (95\u2013100%), 5\u2009min for each level. The slices were cleared in xylene for 10\u2009min and then sealed with neutral gum  for observation by microscope.Masson staining  was used to detect pulmonary interstitial fibrosis of mice in each group. First, the lung slices were dewaxed to water. Hematoxylin stain solution was added to cover the slices and then stained for 1\u2009min. The slices were washed with tap water and distilled water in turn. Then, the slices were soaked in PBS (pH 7.2\u20137.6) or ammonia for 10\u2009min to make the nucleus return blue. Acid fuchsin stain solution was added and stained for 5\u2009min. After that, the slices were reacted with a phosphomolybdic acid differentiation solution for about 30\u2009s. The tissue was covered by a drop of aniline blue counterstain, stained for 1\u2009min, and rinsed with absolute ethanol. The slices were blow-dried, cleared in xylene, and then sealed with neutral gum for observation by microscope.2+ , L-ficolin , and M-ficolin  were measured according to the instructions of kits. The death rate of lung epithelial cells was detected by a lactate dehydrogenase (LDH) assay kit .The concentrations of total protein in bronchoalveolar lavage fluid (BALF) , hydroxyproline , malondialdehyde (MDA) , glutathione (GSH) , FeWestern blot was applied to detect the expressions of alpha-smooth muscle actin (\u03b1-SMA), microtubule-associated protein 1 light chain 3-II (LC3II), LC3I, Beclin1, p62, autophagy-related gene 7 (ATG7), glutathione peroxidase 4 (GPX4), solute carrier family 7 member 11 (SLC7A11), ferritin heavy chain 1 (FTH1), ferritin light chain 1 (FTL1), NCOA4 in MLE-12 or lung tissues, as well as CD9, CD81, CD63 in AMs-derived exosomes. First, different groups of samples were treated with RIPA lysate  to extract total proteins. The protein was separated by SDS-PAGE and transferred to a nitrocellulose (NC) membrane. Next, the NC membrane was soaked in 5% skimmed milk and blocked at room temperature for 1.5\u2009h. The NC membrane was then incubated with the primary antibody at 4\u2009\u00b0C overnight. Primary antibodies used in the experiment were as follows: \u03b1-SMA , LC3 , Beclin1 , p62 , ATG7 , GPX4 , SLC7A11 , FTH1 , FTL1 , NCOA4 , CD9 , CD63 , CD81 , cGAS , STING , p-STING , and \u03b2-actin . The NC membrane was incubated with HRP-goat anti-mouse IgG  or HRP-goat anti-rabbit IgG  at room temperature for 1.5\u2009h. Finally, the NC membrane was incubated with ECL reagent  for 1\u2009min and placed in the imaging system for analysis. \u03b2-actin was used as an internal reference protein, and the expression levels of each protein were analyzed using Quantity One 4.6.6 .\u2212\u25b3\u25b3Ct method.The mRNA expression of Fcnb in MLE-12 was detected by RT-qPCR. First, total RNA was extracted using the Trizol total RNA extraction kit , followed by the determination of concentration and purity. Then, an mRNA reverse transcription kit  was used to reverse the transcription of mRNA into cDNA, and RT-qPCR was performed. Primers used in the experiment were as follows: Fcnb: F: GCTGGTGACTCTCTGACACC, R: GCTGGAAGTACTGCCGTCAT; \u03b2-actin: F: ACATCCGTAAAGACCTCTATGCC, R: TACTCCTGCTTGCTGATCCAC. Using \u03b2-actin as an internal reference gene, the relative mRNA expression of Fcnb was calculated by the 2The expression level of Fcnb and the number of neutrophils and macrophages were detected by flow cytometry . Lung tiData were analyzed using GraphPad Prism 8.0. All experimental data were expressed as mean\u2009\u00b1\u2009standard deviation (SD). One-way analysis of variance (ANOVA) was used for comparison between groups.Fcna-/-, and Fcnb-/- mice were stimulated with BLM. Before BLM induction, the survival rates of WT, Fcna-/-, and Fcnb-/- mice were all 100%. However, the survival rate of BLM-induced WT mice was significantly reduced, while that of BLM-induced Fcnb-/- (rather than Fcna-/-) mice reduced slightly  in the plasma of interstitial lung disease (ILD) patients compared with healthy people, while that of M-ficolin (homologous of Fcn B) increased markedly Fig. . To expltly Fig. . HE staiion Fig. . Masson oup Fig. . Similaroup Fig. . In addioup Fig. . After Bice Fig. . The numFcna-/-+BLM and Fcnb-/-+BLM groups displayed reduced expressions of LC3II/LC3I, Beclin1, ATG7, and increased expression of p62  to induce collagen fiber deposition [Fcnb-/- mice, verifying that Fcn B could aggravate BLM-induced pulmonary fibrosis. Studies have shown that macrophages and neutrophils are the main sources of Fcn A and Fcn B, and Fcn B are also partially expressed in lung epithelial cells [Fcna-/- mice, especially in lung macrophages. Besides, the number of lung macrophages was significantly decreased in the Fcnb-/-+BLM group. These results indicated that in this model, secretory Fcn B is mainly derived from lung macrophage and affects the number of macrophages in return.Lung injury, due to its complex pathogenesis, and lack of effective treatment, is a major problem in pulmonary diseases that needs to be solved urgently. Our previous results displayed an obvious role of Fcn A in acute lung injury , 27. Howposition . Total pposition . Hydroxyposition . The abnposition . Therefoal cells , 50. ConFcnb-/-+BLM group were downregulated, while p62 expression was upregulated, indicating that Fcn B could promote BLM-induced autophagy. Studies have shown that ferritinophagy is a process that degrades ferritin, such as FTL1 and FTH1, with NCOA4 as cargo receptor protein, and then releases free iron [2+ produces ROS through the Fenton reaction, which directly combines with polyunsaturated fatty acids to lead to the large accumulation of lipid peroxides (LPO) and induce ferroptosis [2+, and NCOA4 expressions in the Fcnb-/-+BLM group decreased, while GSH, GPX4, SLC7A11, FTH1, and FTL1 increased. These results indicated that in the BLM-induced lung injury model, Fcn B promoted ferroptosis mediated by two pathways.Ferroptosis is a type of programmed cell death that depends on iron and ROS. Many studies have confirmed that ferroptosis is closely related to the occurrence of lung injury and autophagy , 51, 52.ree iron . When inroptosis . LPO is roptosis . Depletiroptosis . In addiroptosis . Here, cvia tail vein to verify the role of Fcn B in vivo. The results showed more severe lung injury, increased inflammatory infiltration, and increased levels of autophagy and ferroptosis, suggesting that AMs-derived exosomes facilitated lung injury, fibrosis, and ferroptosis by transporting Fcn B in vivo.Damaged lung epithelial cells and activation of AMs are thought to be the initiating factor of lung injury . Our stuIn summary, this is the first report investigating the role of Fcn B in BLM-induced lung injury, which showed that Fcn B transported by exosomes from AMs could exacerbate BLM-induced lung injury by promoting lung epithelial cells ferroptosis through the cGAS-STING pathway Fig. .Fig. 9FcAlthough this study has provided important findings on the role of Fcn B in promoting ferroptosis in BLM-induced lung injury, there are several limitations to consider. One limitation of this study is that it only focuses on the involvement of autophagy and ferroptosis in BLM-induced lung injury, with limited attention to other forms of cell death. In BLM-induced lung injury, other forms of cell death, such as apoptosis and pyroptosis, also play important roles. BLM can promote cell apoptosis and pyroptosis in lung cells through multiple pathways and processes \u201380. TherTo conclude, our findings suggested that Fcn B exacerbated BLM-induced lung injury through the cGAS-STING pathway. This study will enrich the understanding of the role of Fcn B in lung injury, provide clues to the molecular mechanism of the occurrence and development of BLM-induced lung injury and provide new targets for its clinical treatment.Supplementary informationOriginal Data FileReproducibility checklist"
\ No newline at end of file