{"text": "Pseudomonas aeruginosa (PA) is the most important bacterial pathogen in patients with cystic fibrosis (CF) patients. Currently, routine bacteriological culture on selective/non- selective culture media is the cornerstone of microbiological detection. The aim of this study was to compare isolation rates of PA by conventional culture and molecular (PCR) detection directly from sputum.Pseudomonas isolation agar, Blood agar & McConkey agar). In addition, from the same specimen, genomic bacterial DNA was extracted (1 ml) and was amplified employing two sequence-specific targets, namely (i) the outer membrane protein (oprL) gene locus and (ii) the exotoxin A (ETA) gene locus.Adult patients (n = 57) attending the regional adult CF centre in Northern Ireland, provided fresh sputum following airways clearance exercise. Following processing of the specimen with sputasol (1:1 vol), the specimen was examined for the presence of PA by plating onto a combination of culture media , we followed these patients and recorded that 5 of these patients converted to being culture-positive at times ranging from 4\u201317 months later, with a mean lag time of 4.5 months.By sputum culture, there were 30 patients positive for PA, whereas by molecular techniques, there were 35 positive patients. In 39 patients (22 PA +ve & 17 PA -ve), there was complete agreement between molecular and conventional detection and with both PCR gene loci. The oprL gene target, is a useful technique in the early detection of PA, gaining on average 4.5 months over conventional culture. It now remains to be established whether aggressive antibiotic intervention at this earlier stage, based on PCR detection, has any significant benefits on clinical outcome.This study indicates that molecular detection of PA in sputum employing the  Pseudomonas aeruginosa, Burkholderia cepacia and Stenotrophomonas maltophilia. However, with modern antibiotic management with improved antimicrobial agents, such as the aminoglycosides and carbapenems, CF patients have an improved survival, resulting in more adults in employment.Cystic fibrosis [CF] is the most commonly inherited fatal disease in persons originating from a white and European background, currently affecting approximately 30,000 adults and children in the US . The defPseudomonas aeruginosa in CF patients.[P. aeruginosa,[P. aeruginosa in CF patients [P. aeruginosa directly from the sputum of CF patients in the UK and Ireland is uncommon. Most clinical microbiology laboratories in the UK and Ireland, which support a CF centre, have developed standard operating procedures (SOPs) for the isolation of this organism from patients' sputum. Hence, it was the aim of this study to compare the conventional and molecular detection of P. aeruginosa from the sputum of adult patients attending the adult centre in Northern Ireland, as well as to estimate the lag time of conventional culture to detection, compared with molecular (PCR) detection.Previous studies have described alternative laboratory markers to conventional bacteriological culture for the detection of patients.,5 These ruginosa, as well Pseudomonas aeruginosa. Processed sputa (10 \u03bc l) were inoculated and incubated, onto several selective media for the isolation of Pseudomonas aeruginosa, including:- Columbia Blood Agar (Oxoid CM0331) supplemented with 5% (v/v) defribinated horse blood, MacConkey Agar (Oxoid CM0007) and Pseudomonas Isolation Agar (PIA) (Oxoid CM0559 + SR0102). All media were incubated aerobically at 37\u00b0C for 48 h, unless otherwise stated. The PIA plates were incubated at room temperature for a further three days following initial 48 hrs incubation. In addition, all different phenotypes from the sputum of each patient were identified phenotypically employing a combination of conventional identification methods (e.g. oxidase), as well as the API Identification schemes  .Duplicate sputa (1 ml minimum) specimens were collected from 57 adult patients with a well characterized history of CF in sterile (100 ml) plastic disposable containers. Sputum was collected immediately after a standardized session of physiotherapy and was stored at ambient temperature and was processed within 4 h from collection. Fresh sputum (1 ml min) was mixed with an equal mass (1:1) of Sputasol  and was incubated in a water bath at 37\u00b0C for 15 min, before further qualitative processing for the detection of et al[Pseudomonas aeruginosa  ATCC 27853, by employment of the Roche High Purity PCR Template Preparation Kit , in accordance with the manufacturer's instructions. Extracted DNA was stored at -80\u00b0C prior to PCR amplification. For each batch of extractions, a negative extraction control containing all reagents minus sputum, was performed, as well as an extraction positive control with P. aeruginosa.All DNA isolation procedures were carried out in a Class II Biological Safety Cabinet  in a room physically separated from that used to set up nucleic acid amplification reaction mixes and also from the \"post-PCR\" room in accordance with the Good Molecular Diagnostic Procedures (GMDP) guidelines of Millar et al, in orde2, 200 \u03bcM (each) dATP, dCTP, dGTP and dTTP; 1.25 U of Taq DNA polymerase , 0.1 \u03bcM (each) of the each set of primers (exoA &oprL) (Table P. aeruginosa ATCC 27853 DNA) and multiple negative (water) amplification controls were included in every set of PCR reactions. In addition, a broad-range/universal PCR was employed with each sputum to demonstrate successful extraction of bacterial DNA from the specimen, as well as lack of PCR inhibition, by employing the highly conserved 16S rDNA primers, PSL/PSR  were set up as follows:-10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl00 \u03bcl werexoA or oprL loci, the specimen was considered positive for P. aeruginosa.Following amplification, aliquots (10 \u03bcl) were removed from each reaction mixture and examined by electrophoresis  in gels composed of 2% (w/v) agarose  in TAE buffer , stained with ethidium bromide (5 \u03bcg/100 ml). Gels were visualised under UV illumination using a gel image analysis system  and all images archived as digital graphic files (*.bmp). Where a band was visualized at the correct expected size for either P. aeruginosa in patients' sputum by conventional and molecular techniques is shown , there was complete agreement between molecular and conventional detection techniques. The oprL locus was more sensitive than the ETA locus, as the former was positive in 10 more patients and there were no patients where the ETA was positive and the oprL target negative, However, there were five patients who were culture positive but PCR -ve by both gene targets. Given that the universal 16S rDNA PCR was positive for these sputum specimens and that the appropriate molecular controls were working optimally, this may accounted for by potential phenotypic misidentification of P. aeruginosa, which has been recently described.[P. aeruginosa colonization with a false-negative culture result due to sample overgrowth by other bacteria or to the presence of non-cultivable organisms or auxotrophic mutations in the organism. Where a PCR +ve/culture -ve result was recorded (10 patients), we followed these patients and recorded that five of these patients converted to being culture-positive at times ranging from 4\u201317 months later, with a mean lag time of 4.5 months, whereas the remaining five patients remained negative for P. aeruginosa.A comparison of the occurrence of wn Table . By cultP. aeruginosa directly from the sputum of patients with CF. Two gene loci were targeted, as specific markers of P. aeruginosa, namely the exotoxin A (ETA) gene and the outer membrane lipoprotein (oprL) gene. ETA is produced by the majority of P. aeruginosa strains and can inhibit eucaryotic protein biosynthesis at the level of polypeptide chain elongation factor 2, similarly to diphtheria toxin.[In this study, two PCR assays were performed individually for the molecular detection of ia toxin. OprL is ia toxin.Pseudomonas aeruginosa is the most important bacterial pathogen in patients with CF [Pseudomonas colonisation of the major airways leading to delibating exacerbations of pulmonary infection, is the major cause of morbidity and mortality in patients with CF, hence it is important to be able to reliably detect P. aeruginosa from patients' sputum. Emerson et al. [P. aeruginosa was a major predictor of morbidity and mortality, whereby the 8-year risk of death parameter was 2.6 times higher in patients who had positive sputum cultures for this organism, as well as having a significantly lower percent predicted forced expiratory volume (FEV1). These workers suggested that early interventions may help decrease associated morbidity and mortality of young patients with CF. with CF , as demon et al.  recentlyet al. [P. aeruginosa infection in CF. These workers suggested that chronic lower airway infection with P. aeruginosa is associated with significant morbidity and mortality among CF patients [P. aeruginosa does not appear to cause an immediate and rapid decline in lung function, as early isolates are generally non-mucoid, antibiotic-sensitive and present at low densities, suggesting a possible \"window of opportunity\" for early intervention, as they describe [More recently, Rosenfeld et al.  describepatients . Howeverdescribe . This stdescribe Pseudomonas colonization as early as possible, so that (i) aggressive antibiotic regimes may be considered,(ii). the patient is managed optimally, in an attempt to avoid early biofilm formation and chronic colonization with Pseudomonas and (iii) appropriate infection control precautions are considered. More recently, West et al. showed by a combination of serum IgG, IgA and IgM anti P. aeruginosa antibodies, in conjunction with these authors' Wisconsis Cystic Fibrosis Radiograph score, that P. aeruginosa infections occurred approximately 6\u201312 months before the organism was recovered from respiratory secretions.[P. aeruginosa acquisition.It is therefore important that primary diagnostic bacteriology laboratories have the ability to detect transient and early cretions. In additPseudomonas aeruginosa, either from culture plates or patients' sputum, small numbers of Pseudomonas colonies (n = 1\u20132) may therefore be missed when present in the early stages of colonization preceding infection of the patient's airways, particularly where such single colonies are mixed alongside other phenotypically similar genera on the primary culture plate.[Pseudomonas colonization. Although such assays are not generally available in most clinical diagnostic laboratories, these laboratories generally do have access to such technology at regional specialist microbiology centres and it may therefore be prudent to establish routine analysis of children's sputum, particularly from patients with no or an intermittent history by culture of Pseudomonas colonization, at annual review. Furthermore, it is very important to follow up any such patients, which demonstrate a PCR +ve/culture -ve finding from their sputum, in order to establish whether there is transient infection in patients, which never result in established colonization leading to chronic infection. Additionally, it is important to monitor such PCR +ve/culture -ve patients in terms of optimal antibiotic management and infection control.Given that not all laboratories employ molecular detection methods for re plate. PragmatiP. aeruginosa were able to detect P. aeruginosa at an early stage, on average 4.5 months sooner than culture detection. However, it remains unclear what this \"window of opportunity\" potentially offers in terms of a decrease in P. aeruginosa-associated morbidity and mortality.Overall, our study demonstrated that molecular assays for the detection of JEM, PGM and JSE jointly conceived the study and designed the experiments. JX executed and analyzed all practical aspects of the study, as well as analyzing the data. JEM executed certain molecular components of experimentation, analyzed the data and prepared the manuscript. BCM helped guide the molecular aspects of experimentation and was involved in drafting of the manuscript. PGM provided expert microbiological analysis and interpretation of data. JSE provided clinical expertise, interacted with the CF patients and was involved in interpretation of data, as well as critically reviewing the final manuscript. All authors read and approved the final manuscript."}
{"text": "Many studies associated nosocomial infections with increased hospital costs due to extra days in hospital, staff time, extra investigations and drug treatment. The cost of antibiotic treatment for these infections represents a significant part of hospital expenditure. This prospective observational study was designed to determine the daily antibiotic cost of nosocomial infections per infected adult patient in Akdeniz University Hospital.All adult patients admitted to the ICUs between January 1, 2000, and June 30, 2003 who had only one nosocomial infection during their stay were included in the study. Infection sites and pathogens, antimicrobial treatment of patient and it's cost were recorded. Daily antibiotic costs were calculated per infected patient.Pseudomonas aeruginosa infections was the most expensive infection treated. Piperacillin-tazobactam and amikacin were the most prescribed antibiotics, and meropenem was the most expensive drug for treatment of the nosocomial infections in the ICU.Among the 8460 study patients, 817 (16.6%) developed 1407 episodes of nosocomial infection. Two hundred thirty three (2.7%) presented with only one nosocomial infection. Mean daily antibiotic cost was $89.64. Daily antibiotic cost was $99.02 for pneumonia, $94.32 for bloodstream infection, $94.31 for surgical site infection, $52.37 for urinary tract infection, and $162.35 for the other infections per patient. The treatment of Daily antibiotic cost of nosocomial infections is an important part of extra costs that should be reduced providing rational antibiotic usage in hospitals. Nosocomial infections are frequent complications of hospitalization and also an important public health problem in developing countries, as well as in developed ones. The socioeconomic impact, ie, prolongation of hospitalization, mortality, and cost of these infections adversely effects patients and nations' economic well-being . The cosThe aim of our study was to determine daily antibiotic cost of nosocomial infection per infected patient in a university hospital.Akdeniz University Hospital is a 600-bed tertiary referral centre in Antalya, Turkey, treating 27 000 patients per year. The study was conducted in six adult medical and surgical intensive care units (ICUs) with a total of 51 ICU beds. Neonatal ICU was not included in the study. Since 1993, the institutional policies of hospital infection control have been implemented by infection control team.In our hospital, routine prospective, active surveillance of nosocomial infections in all ICUs is performed by one infection control nurse, supervised by an infection control physician. Nosocomial infections are defined using the Centers for Disease Control and Prevention criteria ,6. We doBetween January 1, 2000 and June 30, 2003, all inpatients hospitalized in one of the adult ICUs were included in this study. Data on antimicrobial treatment were recorded for patients aged 15 or above presenting with only one nosocomial infection. For all patients included in the study, the following were recorded: age, sex, infection site, microbiologic data, antimicrobial therapy and antibiotic cost.In our ICUs, all antimicrobial prescriptions are recommended by an infectious disease consultant. Antimicrobial agents prescribed only for therapeutic indications were recorded. The daily antibiotic cost was calculated in US dollars based on June 2003 prices of antimicrobial agents provided by the hospital pharmacy. The daily antibiotic cost per infected patient was calculated by the multiplication of box price and number of daily doses that was used for that infection. Two costs were calculated for each antimicrobial; the minimal cost (min) was based on the lowest recommended parenteral daily dose and the maximal cost (max) was based on the highest recommended parenteral daily dose.Between January 1, 2000, and June 30, 2003, a total of 8460 patients were admitted to the adult ICUs. Overall, 817 patients developed 1407 episodes of nosocomial infections, accounting for an infection rate of 16,6%. Among them, 233 patients  had only one nosocomial infection. Mean daily antibiotic cost was found $89,64 per infected patient .Among the sites of nosocomial infections, urinary tract infections had the lowest daily antibiotic cost per infected patient Table . The meaPseudomonas aeruginosa was the most prevalent bacteria followed by Klebsiella spp. and Acinetobacter spp.. P. aeruginosa infections had the highest overall daily antibiotic cost per infected patient than other pathogens. Among 21 Staphylococcus aureus strains 15 (72%) were resistant to methicillin. The overall daily antibiotic cost of methicillin resistant S. aureus (MRSA) infections was two to three times higher than infections with susceptible strains. However, median daily cost per infected patient for MRSA infections were lower than susceptible strain infections.Out of 233 patients, 206 patients had microbiologically documented infections, 177 patients were infected by a single pathogen while 29 patients were diagnosed as having polymicrobial infections  declare that they have no competing interests.DI collated and analyzed the data, participated in the study design and was principal writer of manuscript. ANY conceived the study. GO carried out the laboratory studies. RS, FG, OT and LM participated in the patient management. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Pseudomonas aeruginosa frequently colonizes and is responsible for severe ventilator-associated pneumonia in intubated patients. A quorum-sensing (QS) circuit, depending on the production of the two QS-signaling molecules  3-oxo-C12-HSL and C4-HSL, regulates the production by P. aeruginosa of several virulence factors and is required for biofilm formation. Therefore QS-inhibition has been suggested as a new target for preventive and/or therapeutic strategies. However the precise role of QS during colonization and subsequent infections of intubated patients remains unclear.P. aeruginosa isolates growing inside the biofilm covering the intubation devices and those resident in the lungs of colonized patients differ in their QS-dependent phenotypes. We collected the intubation devices of eight patients colonized by P. aeruginosa. We detected 3-oxo-C12-HSL on eight, and C4-HSL on six of these devices. In three of these patients we also obtained P. aeruginosa isolates from tracheal aspirates at the time of extubation (n = 18), as well as isolates from the intubation devices (n = 25). We genotyped these isolates, quantified their AIs production, and determined three QS-dependent phenotypes . The production of 3-oxo-C12-HSL was consistently increased for isolates from the intubation devices, whereas the production of C4-HSL was significantly higher for isolates from tracheal aspirates. Isolates from tracheal aspirates produced significantly higher amounts of elastase but less biofilm, and had a marginally reduced adhesion capacity than isolates from the intubation devices. Levels of 3-oxo-C12-HSL and elastase production correlated statistically for tracheal intubation isolates, whereas levels of 3-oxo-C12-HSL production and adhesion ability, as well as biofilm production, correlated weakly amongst intubation device isolates.We wondered whether QS is active during colonization of intubated patients, and whether P. aeruginosa. The microenvironment, in which P. aeruginosa grows, may select for bacteria with different capacities to produce autoinducers and certain QS-dependent phenotypes. QS-inhibition might therefore affect differently isolates growing inside the biofilm covering intubation devices and those resident in the lungs.Our findings demonstrate that autoinducers are produced during the colonization of intubated patients by  Pseudomonas aeruginosa is an opportunistic pathogen implicated in a wide variety of infections, particularly in burn victims, cancer patients and cystic fibrosis (CF) patients. In addition P. aeruginosa is a major cause of severe pneumonia in mechanically ventilated patients . factors ,6 but ha factors -10.P. aeruginosa has been clearly established in vivo in animal models [P. aeruginosa infections.The importance of a functional QS-circuit for the virulence of l models . As a coP. aeruginosa isolates from CF patients produce AIs in vitro [P. aeruginosa produces the same signals ex vivo [in situ in CF lung tissue [12-HSL and C4-HSL have also been detected in biofilms, both in vivo and in situ [However the precise role during human infections remains speculative. Most studies so far have focused on the capacity of clinical isolates to produce the two autoinducers and on the detection of the two AIs directly in clinical samples. in vitro , and spu ex vivo . AIs havg tissue , in the g tissue ,16, and g tissue . Recentlg tissue . Both 3- in situ ,16,19; m in situ .P.aeruginosa. Because of the multitude of phenotypes depending on QS we then wondered whether P. aeruginosa isolates growing in different microenvironments might vary in their capacity to produce AIs and differ in their expression of QS-dependent phenotypes. We therefore collected P. aeruginosa isolates from the surface of intubation devices and from tracheal aspirates obtained from the same patients on the day of extubation. For each patient, we grouped strains according to their genotype, and characterized them in terms of production of autoinducers, and capacity to adhere to PVC, and produce elastase and biofilm. Our results suggest that the relative production of autoinducers, and the QS-dependent phenotypes of P. aeruginosa vary according to their site of isolation.Because much remains to be understood about the role of QS during human infections, and the potential of QS-inhibition in their prevention and/or treatment, we examined the behavior of QS during the colonization of intubated patients. To determine whether QS is active during the colonization of intubated patients, we first extracted and quantified AIs directly from the intubation devices of patients colonized with P. aeruginosa isolates were collected both from the intubation device and from a tracheal aspirate on the day of extubation:Patients' clinical characteristics are presented in Table P. aeruginosa was cultured for the first time from his tracheal aspirates 7 days after his intubation. Therapeutic retreat was decided after 15 days of mechanical ventilation and he died without having received any antibiotics. The presence of P. aeruginosa in his tracheal aspirates was considered as colonization. The tracheal aspirate used in the present study was collected shortly before his death and extubation.Patient 8 was a 27-year-old male who suffered a severe polytrauma including cerebral contusion and hemorrhage. P. aeruginosa was first cultured in bronchoalveolar lavage fluid four days after her intubation. P. aeruginosa pneumonia was diagnosed two days later and she was treated with an imipenem \u2013 tobramycin combination therapy. The clinical response was satisfying and she was extubated 3 days later still on antimicrobial therapy. A tracheal aspirate was obtained on the day of extubation.Patient 12 was a 21-year-old female who suffered a severe polytrauma including a cranio-cerebral trauma with diffuse axonal lesions and multiple rib fractures. P. aeruginosa was first cultured from a tracheal aspirate three days after her intubation. P. aeruginosa pneumonia was treated with cefepime during 10 days starting 6 days after intubation. She remained colonized by P. aeruginosa and was extubated after 17 days of mechanical ventilation.Patient 13 suffered severe congestive heart failure with a cardiac arrest. Materials and Methods. 3-oxo-C12-HSL was detected on all cuffs, the amounts varying between 0.4 and more than 10 nmoles per cuff (Table 4-HSL was detected on six of the eight devices tested and its amount varied between 17 and 300 nmoles per cuff (Table in situ isolation of autoinducers from biofilms of the majority of the intubation devices suggests that QS might play a role during colonization by P. aeruginosa of such devices. The fact that we detected C4-HSL only from 6 devices could result from the lower sensitivity of our C4-HSL bioassay (2 nmoles/cuff) compared to the one used to quantify 3-oxo-C12-HSL (0.01 nmoles/cuff).The cuff of each endotracheal intubation device was removed and autoinducers were extracted from the biofilm as described in P. aeruginosa isolates directly from the cuff of the intubation device (ID) as described in Material and Methods. The complete collection consisted of 18 TA isolates and 25 ID isolates partitioned as shown in Table For the three patients in whom we obtained tracheal aspirates (TA) at the time of extubation we also collected in vitro, though levels varied according to the site of isolation , compared to the TA group  without reaching statistical significance, possibly due to the small sample size. In contrast the TA isolates of all patients produced higher amounts of C4-HSL than the ID isolates  than for the ID isolates group . Interestingly all isolates (including genotypes C and P), whatever their site of collection, produced higher levels of C4-HSL than of 3-oxo-C12-HSL. The mean of the C4-HSL/3-oxo-C12-HSL ratios was 38.5 for the TA group compared to 5.1 for the ID group  as for determination of AIs production. For each patient the isolates obtained from the TA displayed higher elastolytic activities than those obtained from the ID . For each individual patient P. aeruginosa isolates recovered from the surface of the ID adhered more efficiently than their counterparts collected from the TA . This positive correlation became statistically significant when genotypes C and P were included . Furthermore, C4-HSL production was not correlated with elastase activity, whatever the isolate group studied . These results suggest that the level of 3-oxo-C12-HSL is positively correlated to elastase production for isolates from tracheal aspirates of colonized patients, but not for P. aeruginosa isolates from biofilms covering the intubation devices.-systems ,9. In spnscripts . Other iisolates . We wond12-HSL production and adhesion capacity for isolates from the ID group   and TA isolates .We then examined correlations between autoinducer production and adhesion capacity. There was a weak, statistically not significant, correlation between 3-oxo-C14) Fig. . No such12-HSL and biofilm production for isolates of the ID group , and TA isolates , despite the inclusion of genotypes C and P . Together these observations suggest that the production of 3-oxo-C12-HSL but not of C4-HSL, might be associated with in vitro adherence and biofilm formation capacities among isolates recovered from the biofilm on intubation devices.Similarly we observed a weak, statistically not significant, correlation between 3-oxo-CP. aeruginosa is initiated by the colonization of the intubation device by bacteria either originating from the digestive flora of the patient (endogenous acquisition) or transmitted via handling of the device by health care workers (exogenous acquisition) [P. aeruginosa then reach the respiratory tract either by leakage around the cuff of the intubation device, by shearing of secretions containing embedded bacteria from the device during the inspiratory air flow, or by contamination and direct inoculation of the respiratory tract by suction tubes introduced through the intubation device by health care workers [Respiratory tract colonization of intubated patients by isition) . This coisition) . P. aeru workers -25.in vitro studies and animal models have suggested that QS plays a major role in the virulence of P. aeruginosa [in situ and in patient data concerning the potential role of QS during colonization and infection by P. aeruginosa in humans remain scarce. QS-activity has been linked to the detection of P. aeruginosa AIs in the lungs of cystic fibrosis patients [Both ruginosa . Howeverpatients -16, as wpatients . So far patients ,22.P. aeruginosa autoinducers, 3-oxo-C12-HSL and C4-HSL, can be detected in situ in biofilms covering intubation devices retrieved from patients colonized by P. aeruginosa. Moreover all P. aeruginosa isolates collected either from these biofilms or from tracheal aspirates produced these AIs in vitro. Whereas 3-oxo-C12-HSL has been previously shown to play a role in the differentiation of P. aeruginosa biofilms [4-HSL seems to be important during the maturation stage of biofilm development [4-HSL than 3-oxo-C12-HSL in vitro. Previous observations have suggested that C4-HSL is produced in higher quantities than 3-oxo-C12-HSL in P. aeruginosa biofilms in the lungs of CF patients [4-HSL as compared to 3-oxo-C12-HSL was observed when isolates were grown in liquid cultures, suggesting that this ratio is not useful as a biomarker for biofilm growth for these isolates. None of the isolates collected from our patients had a mucoid phenotype. This discrepancy could therefore be explained by inherent differences in biofilm development patterns between mucoid and non-mucoid strains. So far there is no evidence that non-mucoid P. aeruginosa colonizing the lung of intubated patients grows in biofilms. Such a hypothesis deserves further investigations.In the present study we show that the two biofilms ,26, C4-Helopment , for theelopment , and forelopment . In our patients ,14. Singpatients . In contAutoinducers have been previously recovered from biofilms formed on urinary tract catheters  and our in vitro production of both AIs varied with the site of collection. Isolates from tracheal aspirates produced higher levels of C4-HSL but lower levels of 3-oxo-C12-HSL than their genotypically identical counter-parts isolated from intubation devices, even after several in vitro passages. This observation suggests that different microenvironments select P. aeruginosa isolates with various AI production capacities. Moreover the production of elastase, and the capacity to adhere to an inert surface and to produce a biofilm also varied with the site of isolation. Tracheal aspirate isolates produced higher levels of elastase, but were less able to adhere and produce biofilm than their counter-parts recovered from intubation devices. LasB elastase is one of the major virulence factors controlled by the P. aeruginosa QS-circuit [In vitro its production is regulated by the QS-circuit and depends mainly on the production of 3-oxo-C12-HSL [P. aeruginosa to invade surrounding tissues by its broad range enzymatic activity and to facilitate blood stream invasion by degradation of elastin fibers in the lamina propria of blood vessels [Intriguingly, the -C12-HSL ,10. LasB12-HSL production correlated positively with the capacity to produce elastase. In contrast for isolates originating from the intubation device, 3-oxo-C12-HSL levels did not correlate with elastase production, but correlated weakly with the capacity to adhere and to form biofilms on inert surfaces. These observations suggest that the previously described control of LasR on elastase production might not apply to all isolates depending on the site they were collected from. It seems that the microenvironment on the intubation devices selects for phenotypes that produce high levels of 3-oxo-C12-HSL but without concomitant increased elastase production. In contrast the lower lung environment seems to select for isolates that produce less 3-oxo-C12-HSL but with a positive control of this AI on elastase production. Two of our patients (12 and 13) received antimicrobial therapies during their mechanical ventilation. We can therefore not exclude that different concentrations of these drugs at the two sites might have selected different phenotypes. However this seems unlikely as isolates of patient 8 presented the same differences in phenotype in the absence of any exposure to antimicrobial therapies.The observed differences in phenotypes between isolates obtained from tracheal aspirates, compared to those from the intubation devices, make sense. Isolates growing in the biofilm on intubation devices might not invest energy in producing elastase, but might be primed to adhere and form biofilms, whereas isolates growing in the lungs might find an advantage in producing elastase. For tracheal aspirate isolates, levels of 3-oxo-C4-HSL production and elastase activity, adhesion or biofilm formation. Strikingly, these phenotypes remained stable for each isolate independently of its origin even after several in vitro passages. This suggests that mutations in specific regulators, that affect the production of AIs and the expression of QS-dependent phenotypes might be selected in particular microenvironments. Indeed lasR and rhlR mutants of P. aeruginosa strains isolated from intubated patients have been previously described [lasR and rhR in 6 TA and 6 ID isolates . A total of 25 ID isolates were collected from patients 8, 12 and 13, and stored at -70\u00b0C  either on the day before, or on the day of extubation. The tracheal aspirates (TA) were plated on selective agar plates (Cetrimide 0.03%) in order to identify isolates . SimilarFor further assays both ID and TA isolates were taken from the frozen stocks and grown in liquid cultures.Cultures for extraction of cell-to-cell signaling molecules and production of elastase were grown in Luria-Bertani (LB) broth. M63 medium  was used12-HSL and C4-HSL determined using the reporter strains E. coli MG\u03bb1,4 (pPCS1) [P.aeruginosa PAO-JP2 (pECP61.5) [Previous studies have suggested that secretions colonized by bacteria accumulate above the cuff of intubation devices and form biofilms -36. Leak (pPCS1)  and P.aeECP61.5)  respectiBacterial strains were genotyped by Random Amplified Polymorphic DNA (RAPD) analysis as previously described using the Ready-to-Go Kit (Amersham)  using prTotal extracellular protease  and rhamin vitro was determined in a static model as previously described [660 of 0.5 and incubated for a further 6 hours at 37\u00b0C with shaking until cells had entered early stationary phase. Sterile calibrated coupons of PVC tracheal tubing were immersed in the suspension and incubated statically at 37\u00b0C for 1 h, then the PVC coupons were transferred to 6-well cell culture plates and incubated statically at 37\u00b0C for 72 h in AP medium. The extent of biofilm formation was measured using crystal violet staining [Adhesion capacity was measured for both ID and TA isolates as the ability of bacteria to adhere to the wells of 96-well microtiter plates. The assay was performed as previously described . Resultsescribed . Brieflystaining . ResultsWe used the Student's t test to compare mean production of AIs and virulence factors by isolates from tracheal aspirates (TA) and the cuff of the intubation device (ID). Correlations between AIs production and QS-dependent phenotypes were calculated using a robust estimator of the Pearson's correlation coefficient. To account for the correlation among multiple observations in the same patient, standard errors and p values were computed using a first-order Taylor-series linearization method. All analyses were conducted using Stata 6.0 statistical software . p < 0.05 was considered statistically significant.SFB carried out the experiments and drafted the manuscript. CE conducted the statistical analysis. TK participated in the design of the study and participated in the analysis of the results. JAR organized the sample collection. CVD conceived the study, supervised the experiments and their analysis, and wrote the final manuscript. All authors read and approved the final manuscript."}
{"text": "Pseudomonas aeruginosa isolates from clinical specimens to those of environmental isolates encountered in the same units of a medical center. Antibiotic susceptibility testing, RAPD analysis and detection of enzymatic activities of extracellular virulence factors, were done on these isolates.We correlated genotypes, virulence factors and antimicrobial susceptibility patterns of nosocomially identified Data showed that most of the clinical and environmental isolates were susceptible to tested antimicrobial agents. RAPD analysis determined the presence of 31 genotypes, with genotype 1 detected in 42% of the clinical isolates and 43% of the environmental isolates. Enzymatic activity testing showed that genotype 1 produced all virulence factors tested for.P. aeruginosa genotype, circulating in a number of units of the medical center and emphasize the need to reinforce infection control measures.In conclusion, our data demonstrated the predominant prevalence of a potentially virulent  Pseudomonas aeruginosa continues to be a major nosocomial pathogen particularly in patients who suffer from immunosuppression [P. aeruginosa is a ubiquitous pathogen prevalent in the hospital environments, and can cause severe nosocomial infections [P. aeruginosa infection in hospitals have been identified; such as tap water, medical equipment, hospital personnel and other patients [P. aeruginosa accounts for 10% of all hospital acquired infections, a site specific prevalence which may vary from one unit to another and from study to study [P. aeruginosa appears to be the major cause of ventilator-associated pneumonia with a high rate of attributable mortality [P. aeruginosa nosocomial infections in our medical center was 18%. Such a high rate prompted us to study the P. aeruginosa genotypes circulating in the various units to reveal the clonal relationship between clinical and environmental isolates and to allow elucidating the source and mode of transmission of this important bacterium at this medical center.Despite the advances in hospital care and the introduction of a wide variety of antimicrobial agents, pression . P. aerufections . The latfections . Variouspatients ,4. P. aeto study . Among dortality . Moreoveortality ,8. DurinP. aeruginosa infection in our patients with 55% due to mechanical ventilation and the remaining 45% due to polysite catheters, Foley catheters and different types of surgery.Our data have shown that several mechanical devices were associated with RAPD analysis have shown 31 genotypes present among the clinical and the environmental isolates figure . Table 1P. aeruginosa spread and infection especially after identification of a potentially virulent clone (genotype 1) of this organism that had been propagated in various units over a period of 9 months. This could indicate that the patients were continuously infected with a strain originating from an exogenous source. The importance of cross colonization of P. aeruginosa in nosocomial infections was previously reported, by Bergmans et al who studied 100 patients admitted to an ICU ward; cross colonization accounted for 50% of all cases of acquired P. aeruginosa colonization, the other 50% of patients were probably colonized from endogenous sources [The strain distribution based on RAPD analysis showed that clinical and environmental isolates distributed in one or more than one unit, included genotypes 1\u20138 and 9, with predominance of genotype 1 in all investigated units. This may indicate that cross contamination among patients lead to the spread of this genotype among the various units, possibly through transient hand carriage by health care personnel due to contact with contaminated surfaces or by patient contact with contaminated surfaces or medical equipment . Our fin sources .P. aeruginosa from endogenous sources occurs mainly in the respiratory and gastrointestinal tracts [The remaining genotypes were isolated exclusively from the clinical specimens of patients and were not detected among environmental isolates. Most of these genotypes did not harbor all the virulence factors tested for. Not being encountered in environmental sources may indicate that these strains may have been endogenously acquired. High rate of colonization with l tracts . Hospital tracts ,15,16.Prevalence of strains with resistance to all antimicrobial agents will constitute a major risk for hospitalized patients. In our study, though, the most prevalent strain of genotype 1 was susceptible to all antimicrobial agents and does not constitute a problem in treatment. However, its potential of producing all virulence factors and being spread by various means in the hospital, unlike other genotypes that harbor all virulence factors, may render genotype 1 a high risk pathogen specially in the immunosuppressed and debilitated patients. The fact that genotype 1 remained susceptible to all antibiotics lead to the conclusion that patients could be continuously infected with a strain originating from an exogenous source.In addition to mechanical spread by personnel, this genotype may carry a number of adhesins that enhance its colonization in the hospital environment and render it more accessible to patients. Studies are underway in our laboratory to detect by PCR, genes encoding a number of adhesins and determine their transcription levels in genotype 1, in comparison to other encountered genotypes. This will shed light on the possible role of adhesins on the prevalence of this genotype in the hospital environment. The extracellular enzymes or toxins produced, on the other hand, will contribute to the breaking down physical barriers and help the organism to penetrate, impair host defenses, and render its new milieu more conducive to its physical, nutritional and reproductive requirements .P. aeruginosa genotype 1 in clinical and environmental specimens, circulating in the various hospital units. From a practical point of view, the results of our study emphasize the need to reinforce implementation of infection control measures, and to limit the transmission of P. aeruginosa among patients and from environmental sources to patients. Screening for P. aeruginosa carriage in all patients with nosocomial colonization or infection should also be done in research settings using both rectal and respiratory tract specimens to determine the source of colonization/infection and hence get informed on whether it was acquired endogenously or exogenously.In summary, our data have shown the predominant prevalence of a potentially virulent P. aeruginosa genotype 1 in clinical and environmental specimens, circulating in the various medical center units.In conclusion, our data have shown the predominant prevalence of a potentially virulent P. aeruginosa (90) isolates were recovered from different patients specimens (one per patient) submitted for bacteriological investigations at the Clinical Microbiology Laboratory at the American University of Beirut Medical Center (AUBMC), between September 2003 and May 2004. Patients acquiring a nosocomial infection due to P. aeruginosa as determined by clinical and laboratory testing and indicated in their medical records, were only considered in this study. Fever, and recovery of P. aeruginosa from the site of infection during stay at the medical center, constituted the most important criteria that defined patient's infection with this organism. Patients' data collected from the medical records, included age (2 to 91 years), sex , admission date, admission diagnosis, invasive procedures used on the patients, symptoms, and the date of the first positive culture for P. aeruginosa. The drugs used in the treatment of these patients, mainly included: amikacin, azactam, gentamicin, tobramycin, and tazocin. Patients were distributed within ten different units in the medical center, mainly the Respiratory Care Unit (RCU), Intensive Care Unit (ICU), Coronary Care Unit (CCU), the Surgery Unit, as well as other units. Twenty three isolates were also collected from different environmental sources, such as, respirators, respirators' filters, water irrigation, tap water, basins, trays, bed side tables, side rails, and sink sides. Statistical analysis determined the sample size required to estimate the true proportion (percentage of P. aeruginosa infections during a given period of time) to within 0.10, with 95% confidence was calculated. Calculations estimated the minimum number of samples required to be 54 [Consecutive ruginosa 0 isolateP. aeruginosa on culture based on colonial morphology, Gram stain microscopy, and oxidase test was further confirmed by the API NE Kits and growth at 42\u00b0C. Susceptibility of all isolates to a panel of antimicrobial agents  was determined according to the guidelines of the National Committee for Clinical Laboratory Standards (NCCLS) [P. aeruginosa ATCC 25321 strain was used as positive control in all tests.The presumptive identification of  (NCCLS) . P. aeruP. aeruginosa ATCC strain and from all isolates of P. aeruginosa by the GFX\u2122 Genomic Blood DNA Purification Kit  according to the manufacturers' specifications. Random amplified polymorphic DNA (RAPD) analysis of the clinical and environmental isolates using two in-house oligonucleotide primers, Pa1 (5'AGGGGTCTTG 3') and Pa2 (5' CTTCTTCAGCTCGACGCGACG 3') was done. RAPD was carried out according to Matar et al [2), 1 \u03bcl of primer 1 (0.5 \u03bcM), 1 \u03bcl of primer 2 (0.3 \u03bcg/ \u03bcl), 2.5 U of Taq DNA polymerase and 61.5 \u03bcl of nanopure sterile water. The amplification program, included the following steps: denaturation at 94\u00b0C for 3s, annealing at 53\u00b0C for 1 min and extension at 72\u00b0C for 1 min, for 44 cycles. The cycles were followed by a final extension step at 72\u00b0C for 10 min. Amplicons were subjected to electrophoresis on 2% agarose gels at 107 volts for 2 hours. Patterns that had the same number of bands and similar fragments size were considered identical.DNA was extracted from ar et al  using thP. aeruginosa were evaluated by spot inoculation containing 106 CFU/ml of the organisms in various media [The enzymatic activities of the isolates of us media . Media uGM supervised the study and wrote the manuscript. MC did the bench work and helped in writing the manuscript. GA provided bacterial isolates. ZS provided help on wards. GJ provided clinical support. UH provided clinical support. All authors read and approved the final manuscript."}
{"text": "Pseudomonas aeruginosa nosocomial infections are increasingly recognized worldwide. In this study, we focused on the virulence of multi-drug resistant clinical strains P. aeruginosa against the intestinal epithelial barrier, since P. aeruginosa can cause lethal sepsis from within the intestinal tract of critically ill and immuno-compromised patients via mechanisms involving disruption of epithelial barrier function.Multi-drug resistant P. aeruginosa clinical strains for their ability to disrupt the integrity of human cultured intestinal epithelial cells (Caco-2) and correlated these finding to related virulence phenotypes such as adhesiveness, motility, biofilm formation, and cytotoxicity.We screened consecutively isolated multi-drug resistant P. aeruginosa clinical strains were attenuated in their ability to disrupt the barrier function of cultured intestinal epithelial cells. Three distinct genotypes were found that displayed an extreme epithelial barrier-disrupting phenotype. These strains were characterized and found to harbor the exoU gene and to display high swimming motility and adhesiveness.Results demonstrated that the majority of the multi-drug resistant P. aeruginosa against the intestinal epithelium has the potential to identify strains most likely to place patients at risk for lethal gut-derived sepsis. Surveillance of colonizing strains of P. aeruginosa in critically ill patients beyond antibiotic sensitivity is warranted.These data suggest that detailed phenotypic analysis of the behavior of multi-drug resistant  Pseudomonas aeruginosa, is a major cause of infectious-related mortality among the critically ill patients, and carriers the highest case fatality rate of all gram-negative infections [P. aeruginosa infection among critically ill patients, a significant number of these infections arise as a result of direct contamination of the airways by the gastrointestinal flora or by hematogenous dissemination from the intestine to the lung parenchyma [P. aeruginosa within the intestinal tract alone can be a major source of systemic sepsis and death among immuno-compromised patients [P. aeruginosa in the critically ill patients have identified the intestinal tract to be the single most important reservoir for this pathogen in cases of severe life-threatening sepsis [P. aeruginosa lies in its ability to adhere to and disrupt the intestinal epithelial barrier [The human opportunistic pathogen, fections . Althougrenchyma ,3. Yet epatients ,5. Exteng sepsis ,7. Work  barrier .P. aeruginosa with up to 30% of these strains being antibiotic resistant [P. aeruginosa alone has been associated with a 3-fold increase in mortality in critically ill patients [P. aeruginosa as a cause of mortality in critically ill patients was recently demonstrated by a randomized prospective study in which selective antibiotic decontamination of the digestive tract (SDD) in critically ill patients with oral non-absorbable antibiotics decreased mortality associated with a decrease in fecal P. aeruginosa [Within as little as 3 days in an intensive care unit, the feces of more than 50% of patients will culture positive for esistant . In suchpatients . In factruginosa .P. aeruginosa clinical isolates behave against the human intestinal epithelium is unknown. Therefore the purpose of this study was to determine the ability of MDR P. aeruginosa to disrupt epithelial integrity of Caco-2 monolayers and to correlate these findings to other relevant virulence features of P. aeruginosa including adhesiveness, motility, ability to form biofilm, and the presence of specific type III secretion related genes exoU and exoS.How multi-drug resistant (MDR) P. aeruginosa were consecutively obtained from the clinical microbiology laboratory from those selectively screened for gentamicin (Gm) resistance. We initially screened consecutive P. aeruginosa isolates that were resistant to Gm since Gm resistance has been shown to be the most common feature of MDR P. aeruginosa [P. aeruginosa on subsequent culture. Therefore 31 clinical strains were available for phenotype and genotype analysis. Most isolates identified as P. aeruginosa were oxidase positive, hydrolyzed acetamide and arginine, oxidized glucose, and grew on cetrimide agar. Remaining isolates were identified by the Vitek 2 system . Additionally, isolates were verified by amplification of 16S DNA using primers forward 5'-GGACGGGTGAGTAATGCCTA-3' and reverse 5'-CGTAAGGGCCATGATGACTT-3', and genome DNAs of clinical isolates as templates. Susceptibility testing was performed by testing on the Vitek 2 or by disk diffusion. Susceptibility results were interpreted using Clinical Laboratory Standards Institute (CLSI) guidelines. Single colonies were picked up from Columbia SB agarized plates , grown in Pseudomonas broth containing Gm, 50 \u03bcg.ml-1 and kept at -80\u00b0C as frozen stocks containing 8% glycerol. The isolates were routinely subcultured from frozen stocks on Pseudomonas isolation agar (PIA) containing Gm, 50 \u03bcg.ml-1. P. aeruginosa strains PAOI, ATCC 27853, PA103, and the environmental isolates PA190 and PA180 [Under IRB protocol #11646B, University of Chicago, 35 strains of ruginosa . Among tnd PA180  were useP. aeruginosa isolates was determined using the random amplified polymorphic DNA (RAPD) PCR fingerprinting, described previously [-1) and visualized using UV radiation. Fingerprints were considered distinct if they differed by at least three bands.The clonality of eviously -16. Prim2 transwells (Costar) in HEPES buffered (15 mM) DMEM media containing 10% FBS for 20 days, and electrophysiological measurements were done using agar bridges and Ag-AgCl-calomel electrodes and a voltage clamp  as previously described [P. aeruginosa strains against Caco-2 monolayers, overnight culture was added to the apical well (volume = 200 \u03bcl) to achieve a final bacterial concentration of ~107 CFU/ml. Media from the apical wells was then quantitatively cultured on PIA plates to determine the final bacterial count. Caco-2 monolayers were co-incubated with bacteria for up to 8 hours at 37\u00b0C, 5% CO2, and TER was measured each hour. All experiments were performed in triplicate.The Caco-2bbe (brush border-expressing) cell line was used in bacterial-cell culture experiments. Caco-2 cells were grown in 0.3 cmescribed . Fixed cSwimming assay was performed as previously described by Rashid and Kornberg . BrieflyTwitching motility was determined by the method of Rashid and Kornberg . Fresh pP. aeruginosa strains were grown in 96-well plates in M63 supplemented with 0.5% casamino acids and 0.2% glucose. Plates were incubated at 37\u00b0C under mild shaking at 50 rpm  for 8 hrs. The wells were then rinsed thoroughly with water and the attached material was stained with 0.1% crystal violet, washed with water, and solubilized in ethanol. Solubilized fractions were collected and absorbance measured at 550 nm with a Plate Reader. All experiments were performed in triplicate.Biofilm formation was assayed as described with modifications . BrieflyP. aeruginosa were added to the apical side of Caco-2 cells to a final concentration of 107 CFU/ml and co-incubated for 1 hour at 37\u00b0C, 5% CO2. Following the one hour incubation, the media was removed and ten-fold dilutions were plated on PIA plates to quantify non-adherent bacteria. Wells were then washed with a continuous flow of 35 ml of PBS. A final single washing with 200 \u03bcl was diluted and plated on PIA to quantify the final amount of remaining non-adherent bacteria. Caco-2 cells were then trypsinized with 200 \u03bcl Trypsin-EDTA (Gibco), incubated for 20 min at 37\u00b0C, 5% CO2, and lysed with 400 \u03bcl of a lysis mixture  [Caco-2 cells were grown to confluence in 24-well plates using HEPES-buffered DMEM media containing 10% fetal bovine serum. Overnight cultures of P. aeruginosa clinical isolate #1 was diluted as 1:100 in fresh M63 media supplemented with 0.5% casamino acids and 0.2% glucose and grown for 2 hours. After that, culture was spitted for control (no Gm) and Gm-variant that was added by Gm to a desirable concentration. 300 \u03bcl aliquots (in triplicates) were loaded in 96-well plate, and absorbance at OD550 nm was measured dynamically during growth at 37\u00b0C, 200 rpm. All experiments were performed in triplicate.Overnight culture of exoU and exoS genes were performed using intact P. aeruginosa grown on PIA as a source of template chromosomal DNA as described [exoU: exoU2998, 5'-GCTAAGGCTTGGCGGAATA-3' and exoU3182, 5'-AGATCACACCCAGCGGTAAC-3'; for exoS: exoS 1106, 5'-ATGTCAGCGGGATATCGAAC-3', and exoS 1335, 5'-CAGGCGTACATCCTGTTCCT-3'.PCR assays for detection of the escribed . AmplifiP. aeruginosa to the final concentration of 107 CFU/ml. Cells were incubated at 37\u00b0C, 5% CO2, for 8 hours, and released lactate dehydrogenase was determined by CytoTox 96 assay (Promega). All experiments were performed in triplicate.Caco-2 cells were grown to confluence in 96-well plates, and inoculated apically by Statistical analysis of the data was performed using Student t-test. Regression analysis was performed using Sigmaplot software.P. aeruginosa strains were consecutively collected based on their resistance to gentamicin (Gm), however most clinical isolates displayed multiple antibiotic resistances to various antibiotics clinical used against P. aeruginosa. Most strains were obtained from sputum and tracheal aspirates while few were from tissues and urine. Significant variation was noted in colony morphology among the various strains. Environmental strains PA190 and PA180 were also tested for antibiotic resistance. Results indicated that PA190 was sensitive to all of the antibiotics routinely used for P. aeruginosa infection, whereas PA180 was resistant to Gm.Morphological and demographic data are displayed in Table P. aeruginosa clinical isolates were typed by RAPD analysis with primers 208 . There was no correlation however between TER changes and twitching motility (r = 0.44)  Fig. , or biof44) Fig. . High sw-1) of growth , whereas strain #1 grown in the presence of Gm showed a dose-dependent stimulation  and displayed cytotoxicity against Caco-2 monolayers. Clinical isolates harboring the exoS gene were not cytotoxic to Caco-2 cells.The cytotoxic effect of the various clinical isolates following 8 hours of bacterial exposure is shown in Figure P. aeruginosa on the intestinal epithelial barrier since intestinal P. aeruginosa has been shown to be a major cause of morbidity and mortality among immuno-compromised patients [Numerous reports have documented that the rise in multi-drug resistant nosocomial pathogens continues to threaten hospitalized patients despite various countermeasures including isolation techniques and antibiotic de-escalation therapy ,23. In tpatients ,24,25.P. aeruginosa to subvert and erode an already compromised epithelial defense system exists [Caco-2 cells are an ideal cell model for these studies since they express several markers that are characteristic of normal intestinal epithelial cells including the presence of a brush border and the ability to maintain a highly resistant barrier to bacterial pathogens ,26. As pm exists ,32.P. aeruginosa [P. aeruginosa against the intestinal epithelium is unknown, its high prevalence in the intestinal tract of critically ill and immuno-compromised patients begs a better understanding of the degree to which certain strains can disrupt the intestinal epithelial barrier. For example the apical side of the intestinal epithelium is highly resistant to various toxic and cytolytic exoproducts of P. aeruginosa including exotoxin A and elastase [P. aeruginosa infection and pathogenesis cannot be directly extrapolated to the intestinal model. Interestingly, data from the present study establish that among the MDR P. aeruginosa isolates tested in the Caco-2 model, most display a minor to minimal ability to disrupt the intestinal epithelium in both motile and non-motile strains.Whether MDR ruginosa -36 straielastase ,11,37, wWe identified 8 MDR clinical isolates with 3 distinct RAPD fingerprints that display a disruptive phenotype against the intestinal epithelial barrier. The presence of such strains within the intestinal tract of critically ill patients has the potential to induce a state of gut-derived sepsis with a high mortality rate as their presence in this site is often difficult to detect and eradicate.exoU gene. ExoU, an effector protein of the type III secretion machinery, has been previously shown to play a major role in mediating a cytotoxic phenotype of P. aeruginosa [P. aeruginosa strains harboring the exoU-genotype may be associated with poor outcome in patients colonized by such strains. Although the presence of ExoS has been previously reported to play a role in the virulence of P. aeruginosa in a lung model [Common features of these highly disruptive strains include high swimming motility, increased adhesiveness to intestinal epithelium, and the presence of the ruginosa ,39 againruginosa . That Exng model , we founng model , motilitP. aeruginosa that pose a significant threat to the patient. The ability of multi-drug resistant strains to persist for prolonged periods in such patients may allow for the development of extremely virulent phenotypes [As we and others have suggested, bacteria are fully capable of changing their virulence phenotype in direct response to host illness ,44. The enotypes .exoU gene could provide a significant prognostic input to identify multi-drug resistant P. aeruginosa strains most likely to place patients at risk for lethal gut-derived sepsis. Further characterization of strains 1, 13 and those of G20 RAPD genotype will be necessary to better understand the precise mechanism by which these strains disrupt the intestinal epithelium to a degree not previously reported for any intestinal pathogen.In conclusion, heterogeneity among critically ill humans, variability in immune response, and antibiotic use could explain the extremely polar phenotypes identified in the series of multi-drug resistant isolates collected in the present study: from phenotypes that are essentially inert with respect to the intestinal epithelium to highly motile, adhesive, and destructive phenotypes. Phenotypic assays such as motility and adhesiveness, and genotyping for the Pseudomonas isolation agar, PIA.Multi-drug resistance, MDR; transepithelial resistance, TER; random amplified polymorphic DNA PCR fingerprinting, RAPD; phosphate buffered saline, PBS; lactate dehydrogenase, LDH; The author(s) declare that they have no competing interests.OZ performed experimental design, most experimental work, and drafting/revising the manuscript. JEK had developed and carried out the adhesiveness assay. YW was responsible for cultivation of Caco-2 cells and growing them on transwells. CB isolated and identified clinical isolates. OS participated in adherence and RAPD analyses. LW participated in adherence analyses. JRT was involved in the experimental design and discussion of experiments and manuscript revision. JCA performed experimental design, experimental data discussion, drafting/revising the manuscript, and is the PI of the NIH funding mechanism of the study. All authors read and approved the final manuscript."}
{"text": "P. aeruginosa. We have investigated the expression level of efflux systems among clinical isolates of P. aeruginosa, regardless of their antimicrobial susceptibility profile.Multi-drug efflux pumps have been increasingly recognized as a major component of resistance in P. aeruginosa isolates studied (64.4% susceptibility), whereas susceptibility rates of imipenem and meropenem were both 47.5%. The MexXY-OprM and MexAB-OprM efflux systems were overexpressed in 50.8% and 27.1% of isolates studied, respectively. Overexpression of the MexEF-OprN and MexCD-OprJ systems was not observed. AmpC \u03b2-lactamase was overexpressed in 11.9% of P. aeruginosa isolates. In addition, decreased oprD expression was also observed in 69.5% of the whole collection, and in 87.1% of the imipenem non-susceptible P. aeruginosa clinical isolates. The MBL-encoding genes blaSPM-1 and blaIMP-1 were detected in 23.7% and 1.7% P. aeruginosa isolates, respectively. The blaGES-1 was detected in 5.1% of the isolates, while blaGES-5 and blaCTX-M-2 were observed in 1.7% of the isolates evaluated. In the present study, we have observed that efflux systems represent an adjuvant mechanism for antimicrobial resistance.Aztreonam exhibited the highest in vitro activity against the P. aeruginosa clinical isolates.Efflux systems in association of distinct mechanisms such as the porin down-regulation, AmpC overproduction and secondary \u03b2-lactamases play also an important role in the multi-drug resistance phenotype among  Pseudomonas aeruginosa is an aerobic gram-negative pathogen and a common etiologic agent of nosocomial infections, especially pneumonia, in seriously ill patients [patients ,2. This patients .Bacterial efflux systems capable of ejecting antimicrobials are mostly encoded by chromosomal genes and generally fall into five classes, the major facilitator superfamily (MFS), the ATP-binding cassette (ABC) family, the small multi-drug resistance (SMR) family, the multi-drug and toxic compound extrusion (MATE) family and the resistance-nodulation-division (RND) family . The RNDP. aeruginosa genome revealed the presence of several RND efflux systems. Of those, MexAB-OprM, MexCD-OprJ, MexEF-OprN and MexXY-OprM are able to pump out multiple antipseudomonal compounds [P. aeruginosa. However, when overexpressed, these efflux systems confer reduced susceptibility to different classes of antimicrobial agents [P. aeruginosa, their overexpression may also contribute to the acquired multi-drug resistance phenotype in mutant isolates [Sequencing of ompounds ,4,6. Stuompounds . The Mexompounds . MexAB-Ol agents ,8. Althoisolates .P. aeruginosa clinical isolates [P. aeruginosa clinical isolates.Overexpression of efflux systems generally confers modest levels of antimicrobial resistance ,10. Howeisolates . The assisolates . For thiP. aeruginosa isolates were collected from bloodstream infections between June and December 2005. The majority of isolates was collected from patients hospitalized in intensive care units (64.4%), followed by the emergency room ward (28.8%) and pediatric oncology unit (6.8%). Aztreonam showed the highest susceptibility rate against the isolates studied (64.4%), followed by cefepime (49.2%), meropenem (47.2%), imipenem (47.2%), ceftazidime (44.1%), amikacin (40.7%), ciprofloxacin (35.6%) and gentamicin  were susceptible to all tested antimicrobial.Fifty-nine non-repetitive idime 44.%, amikacP. aeruginosa clinical isolates studied. Five P. aeruginosa isolates could not be typed by PFGE using SpeI. Although 38 isolates were clustered in six PFGE patterns, 16 isolates showed distinct PFGE patterns.A total of 23 distinct PFGE patterns were detected among the 59 P. aeruginosa, representing 25.4% of the whole collection and 48.4% of the imipenem-resistant isolates. These isolates had their carbapenemase activity inhibited by EDTA, and the presence of the MBL-encoding genes blaSPM-1 and blaIMP-like was confirmed by multiplex PCR, in 14 and 1 isolates, respectively. Among the SPM-producing P. aeruginosa studied, 13 showed the same PFGE pattern, whereas one isolate could not be typed using Spe I. ESBL-encoding genes were present in five isolates: blaGES-1 (n = 3), blaGES-5 (n = 1) and blaCTX-M-2 (n = 1). GES-type producers belonged to the same genotype, whereas CTX-M-2-producer showed a unique PFGE profile.Carbapenem hydrolysis was detected in 15 P. aeruginosa isolates that were non-susceptible to antimicrobials and demonstrated overexpression of efflux genes and ampC, coupled with oprD down-regulation is shown in Table The percentage of n = 30) and 27.1% (n = 16) of P. aeruginosa clinical isolates demonstrated increased mexY (from 2.2- to 41.0-fold) and mexB (from 2.1- to 10.0-fold) transcription mRNA levels, respectively, compared to those of PAO1. In addition, 11 P. aeruginosa isolates (18.6%) showed overexpression of both mexB and mexY efflux genes. Overexpression of MexCD-OprJ and MexEF-OprN were not observed among the clinical isolates of P. aeruginosa evaluated in this study. Overall, 69.5% and 11.9% of P. aeruginosa clinical isolates studied showed decreased oprD expression (from 0.1- to 0.7-fold compared to PAO1), and overexpression of ampC (from 14- to 402-fold compared to PAO1), respectively. None of the investigated resistance determinants was identified in 11.8% of clinical isolates . Among the cefepime non-susceptible isolates that did not show mexY overexpression, 33.3% produced SPM-1, 33.3% overexpressed ampC, 16.7% produced the ESBL CTX-M-2, and 16.7% produced GES-5, an ESBL with carbapenemase activity.Among the isolates overexpressing the mexB (from 2.1- to 5.5-fold higher than PAO1). Of those, 90.0% showed decreased oprD expression, 40.0% were MBL producers, 20.0% overexpressed ampC and 10.0% were GES-5 producers (data not shown). As expected, all meropenem-susceptible isolates that overexpressed mexB, presented normal expression of both ampC and oprD when compared to that of PAO1. Higher percentage of mexB overexpression was observed among isolates that were also not susceptible to cefepime, amikacin, gentamicin and ciprofloxacin. Of note, 85.7% and 28.6% of SPM-producing P. aeruginosa showed increased transcriptional levels of mexY and mexB, respectively.Meropenem non-susceptibility was observed among 62.5% of isolates overexpressing P. aeruginosa usually confers modest increase in the MICs of antimicrobial agents that are ejected by these systems.It is worth to mention that MexAB-OprM and/or MexXY-OprM overexpression was observed among isolates that were susceptible to most antimicrobials tested. This finding was expected since efflux pump overexpression in P. aeruginosa is the fifth most frequent pathogen of bloodstream infections and the first one causing pneumonia in Latin America according to the SENTRY Antimicrobial Surveillance Program [P. aeruginosa has been observed worldwide. Some of antimicrobial agents have become less effective against these organisms reducing the available therapeutic options for treatment of these infections. Program . In the P. aeruginosa isolates studied were resistant to carbapenems. Our findings are in accordance of previous studies that showed high rates of antimicrobial resistance, including carbapenems, among P. aeruginosa clinical isolates collected from Brazilian institutions [P. aeruginosa isolates studied indicates that spread of clones and emergency of distinct genotypes have occurred in our hospital. The high rate of carbapenem resistance can be partially explained by the spread of an endemic SPM-producing clone. It also justifies the susceptibility rate to aztreonam since MBL producers are not able to hydrolyze this antimicrobial agent. This finding corroborates with those previously reported that described a single SPM producer clone spread out in the Brazilian territory [In this study 52.5% of the itutions . The generritory .P. aeruginosa infections since they are capable of pumping out many classes of antimicrobial agents used for treatment of these infections [The overexpression of efflux systems may impact on clinical outcome of fections . Howeverfections .ampC and oprD among 59 P. aeruginosa clinical isolates. This collection represents the total number of patients with bloodstream infection due to P. aeruginosa in a six-month period in Hospital S\u00e3o Paulo, Brazil. We also aimed to evaluate the frequency of isolates presenting different mechanisms of \u03b2-lactam resistance and their association.In the present study, we have evaluated the transcriptional levels of four efflux-encoding genes as well as P. aeruginosa isolates. Since MexAB-OprM and MexXY-OprM are constitutively expressed in wild type P. aeruginosa isolates, the antimicrobial policy in use in each individual institution may interfere with the selection of the most overexpressed efflux system. Aminoglycosides are important substrates of MexXY-OprM and might have exerted a role in selecting P. aeruginosa that overexpressed this system [P. aeruginosa infections. These facts could in part justify why MexXY-OprM was the most frequent overexpressed efflux system, since mexXY expression may be induced by these antimicrobial class [The overexpression of the MexAB-OprM and MexXY-OprM efflux systems were more frequent among antimicrobial resistant s system . The exps system . In our al class . InteresWe did not notice a strict correlation between antimicrobial resistance and efflux genes overexpression. However, efflux overexpressing isolates often presented higher antimicrobial MICs than did PAO1 and those isolates in which no antimicrobial resistance determinant was found.Our findings clearly demonstrate that \u03b2-lactamase production increase antimicrobial MICs more efficiently than do efflux overexpression or porin down-regulation alone. However, these chromosomal resistance mechanisms were frequently present among acquired \u03b2-lactamase producers. These findings suggest that efflux overexpression and porin down-regulation may favor the bacterial survival under selective pressure, increasing its chance to acquire further resistance determinants.P. aeruginosa, but represents an adjuvant mechanism for antimicrobial resistance. The association of distinct mechanisms such as the porin down-regulation and AmpC overproduction play also an important role in the multi-drug resistance phenotype among P. aeruginosa clinical isolates studied. In addition, our findings indicate that spread of clones and emergency of distinct genotypes have occurred in our institution and implementation of control measures is extremely necessary to modify this scenario.In the present study we have observed that efflux pump overexpression do not appear to be the main mechanism of drug resistance among the studied clinical isolates of P. aeruginosa were evaluated, regardless of their antimicrobial susceptibility profile. These isolates were consecutively collected between June and December 2005 from blood culture of patients hospitalized at Hospital S\u00e3o Paulo, a tertiary teaching hospital located in S\u00e3o Paulo, Brazil. Only a single bacterial isolate per patient was evaluated. MICs for ceftazidime, cefepime, aztreonam, imipenem, meropenem, gentamicin, amikacin and ciprofloxacin were determined by agar dilution and interpreted according to Clinical Laboratory Standards Institute [P. aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 strains were used as quality control strains.With the approval of the local Ethics in Research committee , a total of 59 clinical isolates of nstitute . P. aeruGenomic DNA of isolates was prepared in agarose blocks and digested with the restriction enzyme SpeI . Electrophoresis was performed on CHEF-DR III , with the following conditions: 0.5 \u00d7 TBE, 1% agarose, 13\u00b0C, 200 V, for 24 h with switch time ramped from 5 to 90 s. The band patterns were interpreted as previously recommended .P. aeruginosa 48-1997A [blaTEM, blaSHV, blaCTX-M, blaGES, blaVEB and blaPER was investigated by PCR, as previously reported [Investigation of carbapenemase activity in crude extracts was performed by UV spectrophotometric assays. Briefly, a full 10 \u03bcl loop of the test organism was inoculated into 500 \u03bcl of phosphate buffer 100 mM (pH 7.0) and disrupted by sonication. The cells were removed by centrifugation and the supernatants were used for further experiments. Protein quantification in the crude extracts was performed using the Bradford stain. Hydrolytic activity of crude extracts was determined against 100 \u03bcM imipenem and 100 \u03bcM meropenem in 100 mM phosphate buffer (pH 7.0). Measurements were carried out at a 297 nm wavelength. Positive control included SPM-1-producing 48-1997A . Carbape48-1997A . The prereported ,25.mexB, mexD, mexF, mexY, ampC and oprD were determined with Mastercycler Realplex2 . In brief, total RNA was extracted using the RNase Mini Kit, following the manufacturer recommendations . Five micrograms of total RNA was submitted to cDNA synthesis using High Capacity cDNA Archive Kit . Quantitative RT-PCR was performed with Platinum SYBR Green Supermix , using specific primers for mexB, mexD, mexF, mexY, ampC and oprD as previously described [http://bibiserv.techfak.uni-bielefeld.de/genefisher/old.html , by Coordena\u00e7\u00e3o de Aperfei\u00e7oamento de Pessoal de N\u00edvel Superior (CAPES) that conceded a grant to DEX and Conselho Nacional de Desenvolvimento Cient\u00edfico e Tecnol\u00f3gico (CNPq) that provides a researcher grant to ACG. (307714/2006-3)."}
{"text": "Pseudomonas aeruginosa.Cystic fibrosis (CF) is an inherited multi-system disorder characterised by chronic airway infection with pathogens such as P. aeruginosa by patients with CF is usually from the environment, but recent studies have demonstrated patient to patient transmission of certain epidemic strains, possibly via an airborne route. This study was designed to examine the survival of P. aeruginosa within artificially generated aerosols.Acquisition of P. aeruginosa were able to survive within the aerosols, but strains expressing a mucoid phenotype had a survival advantage.Survival was effected by the solution used for aerosol generation. Within the aerosols it was adversely affected by an increase in air temperature. Both epidemic and non-epidemic strains of P. aeruginosa from those with chronic P. aeruginosa infection who are more likely to be infected with mucoid strains may help reduce the risk of cross-infection. Environmental factors also appear to influence bacterial survival. Warming and drying the air within clinical areas and avoidance of humidification devices may also be beneficial in reducing the risk of cross-infection.This would suggest that segregating individuals free of  Pseudomonas aeruginosa.Cystic fibrosis (CF) is an inherited multi-system disorder characterised by chronic airway infection, pancreatic insufficiency, elevated sweat chloride concentration, impaired fertility and hepatobiliary disease. The condition is due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR). Lack of CFTR function results in reduced fluid secretion and excessive fluid absorption, with a net effect of producing a thickening of the mucous component of the airway surface liquid. This causes plugging of the sub-mucosal glands and impairment of mucociliary clearance leading to infection, inflammation, and tissue damage resulting in bronchiectasis and a predisposition to infection with pathogens such as P. aeruginosa is the most common and clinically important pathogen in patients with CF. The organism is a Gram-negative, non-fermentative, aerobic bacillus belonging to the family Pseudomonadaceae. Although classified as an aerobic organism P. aeruginosa is a facultative anaerobe which may allow it to survive within the relatively hypoxic lungs of patients with CF. It is ubiquitous within the environment and is particularly isolated from moist areas such as soil and water. The bacterium is frequently found in environmental reservoirs, such as the drains of hospital ward wash basins [P. aeruginosa can be detected when opening taps [P. aeruginosa from tap water follows contamination of the taps rather than the mains water supply [h basins  and aeroing taps ,3. The ir supply .P. aeruginosa infection in patients with CF can occur at any age. During early stages of P. aeruginosa infection in patients with CF the bacteria are not usually mucoid and can be cleared with aggressive antibiotic treatment [P. aeruginosa infection and increased mortality [P. aeruginosa infection by patients with CF is usually from the environment, but recent studies have demonstrated patient to patient transmission of certain strains of P. aeruginosa [P. aeruginosa remains unclear, there is evidence that airborne transmission may be important [P. aeruginosa within artificially generated aerosols; and 2) identify differences in airborne survival of epidemic and non-epidemic strains under controlled environmental conditions.Acquisition of reatment . Once threatment . A numbeortality -9. Acquiruginosa -13. Moreruginosa ,15. Whilmportant ,17 and tP. aeruginosa (NCIMB 10848) was obtained from the National Collection of Industrial and Marine Bacteria. Isolates of both epidemic and non-epidemic strains of P. aeruginosa were obtained from stored strains at the Department of Microbiology, Leeds General Infirmary and the Centre for Infectious Diseases, University of Edinburgh  glycerol solution. The concentrated bacterial suspensions were stored at -20\u00b0C until required.Bacteria of each strain examined were harvested from 200 ml of overnight, stationary liquid broth culture, washed, and stored in 5 \u00d7 1 mL Eppendorf tubes with 40%  through an Andersen 6-stage impactor [During each sampling event 56.6 L of air was drawn (i.e. at a rate of 28.3 L minimpactor  (Anderseimpactor . The con-1) foetal bovine serum (FBS) containing 105 CFU mL-1 of P. aeruginosa (NCIMB 10848) inoculated from the same frozen sample.In order to assess the impact of variations in the nebuliser suspension fluid, aerosols were generated into the laminar flow apparatus using variously 100 mL of distilled water, 1/8 \u00d7 Ringers, 1/4 \u00d7 Ringers, 1/2 \u00d7 Ringers, 1 \u00d7 Ringers and 2 \u00d7 Ringers solutions, and 10% (v v5 CFU mL-1 of P. aeruginosa (NCIMB 10848).In order to assess the impact of variations in temperature on microbial survival, the temperature of the air within the laminar flow model was maintained at either 22 \u00b1 2\u00b0C or 27 \u00b1 2\u00b0C, and 45% Relative Humidity (RH) by adjustment of the air conditioning controls of the class II aerobiological chamber. Aerosols were generated into the laminar flow model using 100 mL of 1/4 \u00d7 Ringers containing 105 CFU mL-1 of P. aeruginosa (NCIMB 10848).In order to assess the impact of variations in air humidity on microbial survival, the relative humidity of the air within the laminar flow model was maintained at either 45% RH or 67% RH, and 22 \u00b1 2\u00b0C by adjustment of the air conditioning controls of the class II aerobiological chamber. Aerosols were generated into the laminar flow model using 100 mL of 1/4 \u00d7 Ringers containing 10P. aeruginosa in the laminar flow model aerosols were generated into the laminar flow model using 100 mL of 1/4 \u00d7 Ringers containing 105 CFU mL-1 of each strain of P. aeruginosa.In order to examine the survival of strains of All data was expressed as a mean and standard error of mean (SEM) The t-Test and one-way ANOVA was used for analysis of different groups . A p-value of < 0.05 was taken to be significant.P. aeruginosa (NCIMB 10848) when generated using distilled water, 1/8 \u00d7 Ringers, 1/4 \u00d7 Ringers, 1/2 \u00d7 Ringers, 1 \u00d7 Ringers and 2 \u00d7 Ringers solutions, and 10% FBS predominantly produce aerosols containing particles of less than 2.0 \u03bcm in diameter  in the aerosols generated using 1/4 \u00d7 Ringers and 1/2 \u00d7 Ringers (p = 0.0705), or 1 \u00d7 Ringers (p = 0.5198), or 2 \u00d7 Ringers (p = 0.055). Generation of aerosols using hypotonic solutions resulted in a significant reduction in the concentration of viable P. aeruginosa (NCIMB 10848) isolated from the aerosols compared to the use of isotonic Ringer's solution . The concentration of viable P. aeruginosa (NCIMB 10848) was significantly increased when the aerosols generated using 10% FBS compared to 1/4 \u00d7 Ringers (p = 0.0040) , compared with conditions of high temperature  and high humidity (22\u00b0C. 67%RH). Under all three environmental conditions the aerosols generated predominately contained particles less than 2.0 \u03bcm diameter . The concentration of viable P. aeruginosa was greater under conditions of high humidity, but this did not reach statistical significance (p = 0.1340)  (See Figure The mucoid strains of P. aeruginosa can only survive in droplets and not in droplet nuclei, the implication being that respiratory droplet nuclei are not implicated in the transmission of this pathogen [P. aeruginosa can survive within droplet nuclei in artificially generated aerosols, with mucoid strains in particular surviving well in an aerosolised state. In so doing, we have demonstrated that aerial dissemination may be a plausible route of transmission for P. aeruginosa infection.The laminar flow apparatus used in this study enabled comparison of recovered concentrations of viable bacteria, during steady state nebulisation, under controlled environmental conditions. In addition to concentration data, the study produced data regarding the size distribution of the aerosol particles containing viable bacteria in the apparatus. Liquid particles suspended in an aerosol are categorized as being either droplets or droplet nuclei. Droplets are generally considered to be greater than 10 \u03bcm in diameter , whereaspathogen . The resP. aeruginosa from bioaerosols using an Andersen 6-stage impactor, it is important to remember that the concentration cultured using the sampler may not be a true representation of the actual concentration of bacteria within the air. It has been estimated that the quantity of bacteria cultured from an air sample represents only approximately 10% of the actual bacterial burden, with the remaining 90% in a viable but non-culturable state [The Andersen 6-stage sampler is a standard piece of equipment and is probably the most widely used aerobiological sampler . While ole state . Gram-neOur experiments demonstrated that the solution used for nebulisation is critical for the survival of the bacteria within aerosols. The use of hypotonic solutions produced a significant reduction in the ability of the bacteria to survive within the aerosol. Inoculation of bacteria into a hypotonic solution will result in an osmotic shock. However, in our experiments we found that this was not sufficient to kill the bacteria, as the control counts from the nebuliser remained stable pre- and post-nebulisation; it may however be that the osmotic shock is enough to leave the bacteria in a weakened state so that subsequent survival in an aerosol is significantly reduced. The reduction in survival may also have been due to the increase in the boiling temperature that occurs with the addition of a solute to a solution. An increase in the boiling temperature will result in a reduced rate of evaporation and hence protect the bacteria from the lethal effects of desiccation. The solution which allowed for the greatest survival of bacteria was 10% FBS. This solution will not only protect the bacteria from osmotic shock and desiccation, but also contains nutrients that will allow the bacteria to continue metabolising whilst suspended in the aerosol. In many respects this represents the case for bioaerosols produced by patients with CF, who will tend to liberate microorganisms in aerosols containing salts and proteinaceous material.P. aeruginosa is adversely effected by a small increase in temperature. However, increased humidity did not statistically improve the survival of P. aeruginosa within the aerosol. Both of these effects may have potential clinical implications as it would suggest patients with CF should avoid cool and damp air conditions in an effort to minimise infection with P. aeruginosa. Consideration should be made to the environmental air conditions when CF units are been designed. Potentially the use of warm and dry air may reduce the risk of cross-infection by P. aeruginosa between patients with CF. It would also seem reasonable to advise patients with CF to avoid the use of devices such as humidifiers as they may promote the survival of P. aeruginosa within aerosols.The environmental conditions of the aerosol are important for survival of bacteria within droplet nuclei. Bacteria are more rapidly desiccated in conditions of high temperature or low relative humidity. The data presented here confirms that the survival of P. aeruginosa with an aerosol. Isolates of the Liverpool, Leeds Paediatric and Unique CF strains expressing both a mucoid and non-mucoid phenotype were studied in the laminar flow apparatus. For all the strains the presence of a mucoid phenotype resulted in significantly increased concentrations in the aerosols. The mucoid strains over-produce the exopolysaccaride alginate which has been implicated in the persistence and pathogenesis of chronic P. aeruginosa infection in patients with CF [P. aeruginosa in aerosols by providing a protective barrier which reduces the lethal effects of desiccation upon the bacteria.The presence of a mucoid phenotype seems to be particularly important for the survival of  with CF . The algP. aeruginosa between patients with CF. There have been two studies that have demonstrated that patients with CF can produce aerosols containing viable P. aeruginosa [Burkholderia cepacia complex can be disseminated from patients with CF during physiotherapy [P. aeruginosa could be cultured from the air 3 hours after a patient had left the area. To survive this length of time suspended within an aerosol the bacteria must be in a droplet nuclei, because larger droplets would have fallen to the floor due the effect of gravity.The data presented from this study provides support for the hypothesis that airborne dissemination may be important for the cross-infection of ruginosa ,17 as weotherapy . A furthotherapy . The samP. aeruginosa used in the present study were lower than those commonly found in sputum samples from patients with CF which can contain approximately 107 CFU g-1 [P. aeruginosa required to cause pulmonary infection in patients with CF is not knownAlthough this study is limited in that the aerosol residency time for the laminar flow apparatus was relatively short at only just over 1 minute, this was however long enough for the bacteria to travel 4 m \u2013 conclusively demonstrating that the bacteria were transported in droplet nuclei and not in droplet form. The concentrations of  CFU g-1 . AlthougP. aeruginosa expressing a non-mucoid phenotype. However the expression of the mucoid phenotype does seem important for survival within droplet nuclei. This suggests that particular emphasis should be made on segregating individuals free from P. aeruginosa from those with chronic infection who are more likely to be infected with mucoid strains of P. aeruginosa.There appears to be little difference in airborne survival between the epidemic and non-epidemic strains of P. aeruginosa between patients could include warming and drying the air within clinical areas and avoidance of humidification devices.Finally, our study suggests that environment appears to influence bacterial survival and optimal conditions for reducing airborne transmission of CF: Cystic fibrosis; CFTR: Cystic fibrosis transmembrane conductance regulator; FBS: Foetal bovine serum; NCIMB: National Collection of Industrial and Marine Bacteria; RH: Relative humidity.IJC undertook the studies, performed the statistical analysis and drafted the manuscript. LAF participated in the design of the study and assisted in undertaking the studies, CBB, MD, and DGP participated in the design and coordination of the study. All authors read and approved the manuscript."}
{"text": "Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR) assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs).Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification).P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%.Thirty-three strains of This reliable technique may offer a rapid (<1.5 h) tool that would help clinicians to initiate an appropriate treatment earlier. Further investigations are needed to assess the clinical benefit of this novel strategy as compared to phenotypic methods. Pseudomonas aeruginosa is a major human opportunistic pathogen responsible for numerous nosocomial infections, especially within intensive care units [P. aeruginosa is the seventh (i.e. 4.3%) most frequently isolated pathogen from the bloodstream, with a crude mortality exceeding 25% [P. aeruginosa represents 6.8% of bacteremia caused by gram-negative rods [P. aeruginosa bacteremia is clinically indistinguishable from other gram-negative bacterial bloodstream infections, it has been demonstrated that an inappropriate initial antimicrobial therapy was associated with severe adverse outcomes [re units . In US hh i.e. 4.% most frP. aeruginosa, especially in respiratory samples from cystic fibrosis patients. Different molecular targets have been employed such as 16 S rRNA, algD, oprI, oprL, toxA, gyrB, and ecfX genes [oprI genes) as well as false-negative results  have been reported, the ecfX gene is a suitable target for species-specific identification of P. aeruginosa isolates [Because standard phenotypic methods are time consuming and most have inherent limitations, molecular techniques have shown to be a rapid and reliable approach for the identification of bacterial pathogens . TherefofX genes -13. Sincisolates ,13.P. aeruginosa from a positive blood culture (BC) takes at least 24 h using conventional techniques, molecular identification directly from positive BCs could be an interesting alternative leading to a rapid and accurate species-level identification with subsequent adequate empirical treatment. However, PCR detection of P. aeruginosa from positive BCs has been poorly investigated [oprI and oprL as target genes, described previously as non-100% specific [While identification of stigated ,15, and specific ,11.ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive BCsIn this study, we have developed a novel quantitative PCR (qPCR) assay, using P. aeruginosa. Positive bottles were inoculated aerobically and anaerobically at 37\u00b0C for 24-48 h onto trypticase-soy agar, Drigalski agar, 5% horse blood agar and chocolate agar plates, and the concentration of bacteria was determined by quantitative culture . Strains were identified by colony morphology, oxidase reaction, and results of the API 20 E system (bioM\u00e9rieux).From August 2008 to June 2009, a total of 100 positive BCs from 100 inpatients were included. For each patient, a pair of aerobic (BacT/ALERT FA) and anaerobic (BacT/ALERT FN) bottles was taken, then incubated in the BacT/ALERT automated continuous monitoring system . The distribution of positive BCs by bottle type was as follows: 87 aerobic (87%) and 13 (13%) anaerobic. All these BCs showed gram-negative rods at the direct examination, and most of them presented a Gram-staining and/or a motility compatible with those of the species From a 0.5-ml aliquot of blood, template DNA was prepared by using a simple and rapid boiling procedure, taking less than 20 min ,17. BrieecfX gene . Oligonucleotide primers and fluorescent-labeled hybridization probes were designed for amplification and sequence-specific detection of a 152-bp fragment within the P. aeruginosa ATCC 27853 into the commercial plasmid vector, pCR2.1-TOPO plasmid vector from the TOPO TA Cloning Kit  following the manufacturer's recommendations to produce plasmid pRT-ecfX. This plasmid was transformed into competent TOP10 Escherichia coli cells (Invitrogen), and transformants were selected on media containing 30 \u03bcg/mL kanamycin. Plasmid DNA was extracted and purified from one transformant using the HiSpeed Midi Kit  according to the manufacturer's instructions, resuspended in elution buffer (Qiagen) and sequenced to determine the presence of the ecfX insert and its orientation. Plasmid DNA concentration was determined by using the NanoDrop ND-1000 spectrophotometer , and the plasmid DNA reference material was then serially diluted to obtain 10 to 1010 plasmid genome equivalents for standard curve analysis. Quantitative analysis was carried out with the LightCycler software version 3.5 (Roche). The ratio of signals measured at 705 nm/signals measured at 530 nm was used to calculate the crossing point values.A plasmid standard curve was constructed by ligating the 152-bp PCR product from P. aeruginosa (including 2 recovered in anaerobic bottles), 53 strains of Enterobacteriaceae (including 22 Escherchia coli), 9 strains of Stenotrophomonas maltophilia, 2 other gram-negative species, and 3 BCs were polymicrobial of which one mixture of Klebsiella pneumoniae and P. aeruginosa  as compared with that of K. pneumoniae (108 CFU/ml). Limit of detection was estimated at 102 CFU/ml  tool with high sensitivity and specificity for the identification of The authors declare that they have no competing interests.Each author acknowledges that he has contributed in a substantial way to the work described in the manuscript and its preparation. All authors have read and approved the final manuscript."}
{"text": "Pseudomonas aeruginosa is the major respiratory pathogen causing severe lung infections among CF patients, leading to high morbidity and mortality. Once infection is established, early antibiotic treatment is able to postpone the transition to chronic lung infection. In order to optimize the early detection, we compared the sensitivity of microbiological culture and quantitative PCR (qPCR) for the detection of P. aeruginosa in respiratory samples of not chronically infected CF patients.P. aeruginosa negative by both culture and qPCR, whereas 89 samples (10%) were positive by both culture and qPCR.In this national study, we followed CF patients during periods between 1 to 15 months. For a total of 852 samples, 729 (86%) remained P. aeruginosa positive both by culture and qPCR.Twenty-six samples were negative by culture but positive by qPCR, and 10 samples were positive by culture but remained negative by qPCR. Five of the 26 patients with a culture negative, qPCR positive sample became later P. aeruginosa infection for only a limited number of patients.Based on the results of this study, it can be concluded that qPCR may have a predictive value for impending  Pseudomonas aeruginosa and Staphylococcus aureus are the most important. Chronic lung infection with P. aeruginosa is a major cause of morbidity and mortality among the CF patients [P. aeruginosa is successful in postponing chronic infection. Hence, it is important to detect new infection with P. aeruginosa as early as possible so that eradication treatment can be started as soon as possible [P. aeruginosa in respiratory samples is done by conventional methods such as culture and biochemical characteristics. Misidentification can occur due to the variable phenotypic characteristics of this species [P. aeruginosa from CF patients [Cystic fibrosis (CF) is one of the most common genetic disorders, caused by mutations in the CFTR gene, coding for the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein . Mutatiopatients . It is npossible -7. Curre species . Moreovepatients .P. aeruginosa in the respiratory samples from CF patients, not chronically infected by P. aeruginosa.In this national study, we followed CF patients during periods between 1 to 15 months and we compared the sensitivity of conventional culture techniques with qPCR for the detection of P. aeruginosa free and not chronically infected according to the criteria used by the different Belgian CF centers, i.e., the European Consensus criteria [et al. [P. aeruginosa positive culture were treated according to the standard antibacterial treatment protocols of each center, patients with only a PCR positive result were not treated.From January 2008 until May 2009, sputum, nasopharyngeal or throat swab samples were routinely collected from 397 CF patients attending all but one of Belgian CF-centres, i.e. Ghent University Hospital , Universitair Ziekenhuis Brussel , St Luc University Hospital , Queen Fabiola Children's University Hospital and Erasme University Hospital , Antwerp University Hospital , CF Center Liege . Patients were seen every three months and sputum or nasopharyngeal aspirate/throat swab samples were cultured at every visit. Nasopharyngeal aspirates/throat swab samples were collected in case the patients could not expectorate. All 397 included patients, , were considered as criteria  or those [et al. . For theAfter arrival at the Laboratory Bacteriology Research (LBR), sputum and nasopharyngeal samples were liquefied with Sputasol  . Throat swabs  were vortexed in the liquid transport medium present in the Eswab tube. For microbiological culture, samples were immediately processed after arrival. For qPCR, at least 200 \u03bcl of each sample was stored at -80\u00b0C prior to DNA-extraction.Fifty \u03bcl of the samples were inoculated onto MacConkey Agar plates  and 100 \u03bcl into 4 ml Cetrimide Broth  and incubated for at least 24 h at 37\u00b0C at ambient atmosphere before examination. Cetrimide Broth was subcultured by inoculating 50 \u03bcl onto a Sheep Blood Agar plate (Becton Dickinson), which was also incubated for at least 24 h at 37\u00b0C before examination.After a maximum of 5 days incubation, lactose negative colonies on MacConkey Agar were picked, subcultured onto a 5% Sheep Blood Agar plate (Becton Dickinson) and identified using tDNA-PCR .Before DNA-extraction, respiratory samples were pre-incubated with proteinase K, i.e. incubation of 200 \u03bcl of each sample during 1 h at 55\u00b0C in 200 \u03bcl proteinase K buffer  with vortexing every 15 min. DNA was extracted using the protocol Generic 2.0.1 on the bioM\u00e9rieux easyMAG Nuclisens extractor . Final elution volume was 110 \u03bcl. This DNA-extraction protocol had been shown previously to be the most sensitive of five different methods .oprL gene (NP_249664), was performed using primers PAO1 A (5' CAGGTCGGAGCTGTCGTACTC 3') and PAO1 S (5' ACCCGAACGCAGGCTATG 3') and hydrolysis probe oprL TM (5' FAM-AGAAGGTGGTGATCGCACGCAGA-BBQ 3'), manufactured by TIB Molbiol , as described previously [Quantitative PCR (qPCR), targeting the eviously . The reaP. aeruginosa in the respiratory sample is determined as the cycle number whereby the fluorescence signal intensity crosses the detection threshold. This value is expressed as the quantification cycle (Cq). The number of cycles is inversely correlated to the concentration of P. aeruginosa in the sample, e.g. a high cycle number indicates a low the initial concentration of P. aeruginosa in the sputum.Using qPCR, the concentration of et al. [5 Jelly Fish oligonucleotides (105 bp) (IAC-oligo), 0.4 \u03bcM forward primer (IAC fw) and 0.4 \u03bcM reversed primer (IAC rev) primers were added to the reaction mix, and a separate qPCR experiment, using the SybrGreen kit, was carried out with primers hybridizing to the target DNA. When compared to a set of control samples, i.e. culture and qPCR P. aeruginosa positive samples to which the same amount of IAC had been added, the PCR was considered as inhibited by (the DNA extract of) the sample, when an increase of 3 Cqs could be observed.To exclude PCR inhibition as an explanation for the PCR negative, culture positive samples, the PCR mix, containing the DNA extract of the sample, was spiked with an internal amplification control (IAC), as described by Khot et al. . BrieflyoprL gene of the P. aeruginosa isolates for culture positive, PCR negative samples, oprL PCR was carried out on DNA extracted from the P. aeruginosa isolates, cultured from the same samples.To exclude that PCR negativity was due to primer mismatch with the The study was approved by the ethics committee from Ghent University Hospital (project nr. 2007/503). Written informed consent was obtained from the patients > 18 years, or from the parents for the children.q values were examined using the Mann-Whitney U test and p values of < 0.05 were considered as significant.Differences in CP. aeruginosa negative by culture and by P. aeruginosa specific qPCR and 89 samples (10%) from 64 CF patients were both P. aeruginosa culture and qPCR positive  from 307 patients remained  samples 0% from 6 samples 0% from 6Twenty-six samples (3%), obtained from 26 CF patients, were culture negative but qPCR positive . The follow-up samples of these three patients were culture and qPCR negative. The average qPCR Cq value (31.7) for these 26 samples was significantly higher, compared with the Cq value of culture and qPCR positive samples (26.4)  was/were culture and qPCR negative, whereas for two patients the follow-up sample(s) was/were culture and qPCR positive.Ten samples, obtained from 9 patients, were When taking culture as the gold standard, the PCR had a sensitivity of 90%, a specificity of 85%, a positive predictive value of 77% and a negative predictive value of 99%.For the samples with a dissimilar culture and qPCR result, there was no relation with the presence of other bacterial species isolated from the respiratory samples (data not presented) and there was no linkage with the sample type (data not presented).Pseudomonas aeruginosa in respiratory samples of CF patients has become of utmost importance, taking into account that it is now possible to postpone chronic infection with the use of early aggressive antibiotic treatment [P. aeruginosa. However, other detection methods that might be more sensitive than microbiological culture still need evaluation and validation [Early detection of reatment -7. In molidation .P. aeruginosa antibodies has been proposed as an alternative to culture for the early establishment of new infection episodes. Several groups reported that anti-P. aeruginosa antibodies can be detected prior to P. aeruginosa detection by culture and prior to the onset of chronic infection [Serological testing for nfection -18. Howenfection  found moP. aeruginosa in respiratory samples from CF patients, not yet chronically infected with this organism.In this prospective study, we evaluated whether qPCR can improve early detection of P. aeruginosa have been developed [P. aeruginosa from respiratory samples of CF patients [oprL gene [P. aeruginosa in sputum from CF patients. In our hands, using a dilution series of P. aeruginosa in sputum, the three culture methods were equally sensitive to each other but also to the combination of the most sensitive DNA extraction method and the most sensitive amplification assay, i.e. probe based qPCR.During the last decade, several PCR formats and other molecular methods for the detection of eveloped ,20-30. Spatients ,19, whilpatients  or a lowpatients . In thisprL gene ,21, prevprL gene , we compP. aeruginosa detection by culture and by qPCR is compared in a long term study [P. aeruginosa on average 4.5 months prior to culture. In our opinion, this conclusion should be interpreted with caution, because also in their study only 5 of the 10 culture negative, PCR positive patients became P. aeruginosa culture positive during the follow-up period. It can also be argued whether the cultured strain was identical as the one causing PCR positivity 4-17 months prior to culture positivity, given the long follow-up period and the fact that the average conversion rate to culture positivity among CF patients can be considered as relatively high. Finally, the authors also found 5 culture positive, PCR negative samples, for which PCR might have become positive later on, however no follow-up data were reported. In our study, we found that out of the 26 qPCR positive, culture negative samples, only 5 follow-up samples became also P. aeruginosa culture positive, of which one became double positive only in the third follow-up episode after initial PCR positivity. The significantly higher Cq values of these 26 samples, compared to the Cq values of double positive samples, suggest a low P. aeruginosa inoculum in the respiratory sample and may explain why the presence of P. aeruginosa was missed by culture. Thus, PCR positivity may have had a predictive value for impending infection in only 5 of the 26 patients, whereas in 21 patients a positive PCR signal became negative again and did not predict a positive culture at the next follow-up sample. For three of the 26 qPCR positive, culture negative patients, the previous sample was P. aeruginosa culture and qPCR positive but the follow-up samples were culture and qPCR negative. This may indicate that qPCR still detected DNA of already killed bacteria. Another 10 samples (1%) were P. aeruginosa qPCR negative but culture positive. False negativity of the qPCR was not the reason for the negative qPCR result, because qPCR inhibition and primer mismatch could be excluded. Interestingly, for 5 of these 10 patients, there was discordance between both culture techniques, suggestive for borderline detection by culture and thus a low inoculum of the pathogen. Such discordance between culture results was observed in only 11 out of 89 qPCR positive samples.Surprisingly, there is at present only one published study in which rm study . These aP. aeruginosa isolate might differentially influence the ease with which P. aeruginosa can be detected by culture versus qPCR. Further research is warranted on a larger set of samples with discordant qPCR - bacterial culture results to determine the influence of some of these factors.For many samples with discordant qPCR and culture results, a low bacterial inoculum may be the explanation. Based on our results in this study and a previous study , both apP. aeruginosa in respiratory samples of CF patients, not chronically infected with P. aeruginosa. Looking at it from a different angle, qPCR was both sensitive and specific compared with a gold standard of culture.The present study indicates that the currently used routine culture techniques perform equally well as DNA amplification techniques for detection of These data, gathered on clinical samples, confirm the results of our previous laboratory study in which culture methods were equally sensitive to the combination of the most sensitive DNA extraction method and the most sensitive amplification assay, i.e. probe based qPCR .P. aeruginosa may have a predictive value for impending P. aeruginosa infection in only a limited number of cases.Therefore, we may conclude that for this study, based on a large amount of patients and samples, qPCR for MV, FDB, SVD, PS and PD conceived the study and designed the experiments. MV, FDB, PD, PS, SVD wrote the manuscript. PD, LVS, GLdSS performed the experiments. Authors from other universities provided patient samples and helped with the manuscript discussion. All authors have read and approved the final manuscript.Table S1: Overview of the culture positive and qPCR positive samples. Table S2: Overview of the culture negative and qPCR positive samples. Table S3: Overview of the culture positive and qPCR negative samples. Overview of all samples with at least a P. aeruginosa positive qPCR or a P. aeruginosa positive culture result.Click here for file"}
{"text": "Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF) and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa  has been found to be widespread in CF patients in eastern Australia.Chronic lung infection with the bacterium P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE), 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources.Suppression subtractive hybridization (SSH) was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples.We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strain AES-I. We have also shown that Whatman FTA\u00ae Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum.We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the  P. aeruginosa in cystic fibrosis (CF) clinics in Australia, the UK, Europe and Canada has been reported [P. aeruginosa was first detected following the death of five unrelated children attending the CF Clinic at the Royal Children's Hospital, Melbourne [P. aeruginosa had an identical or closely related strain to that of the five young children [The emergence of \"epidemic\" strains of reported -8. In Auelbourne ,10. Ensuchildren . We alsochildren . This stchildren . To avoiTwo hospital environmental studies in 1995 and 1999 failed to identify a common source for AES-I, suggesting person-to-person transmission or cross-infection . To haltAES-I strains isolated from CF patient sputa are currently identified via pulsed field gel electrophoresis (PFGE). PFGE is an expensive, time consuming technique requiring highly skilled personnel and thus cannot be used as a means of routine surveillance for the presence of the AES-I strain in patients attending CF clinics. There is an urgent need for the development of a simple, rapid diagnostic method that will enable routine surveillance for AES-I in Australian CF clinics so that appropriate segregation measures can be instituted in an expeditious manner.P. aeruginosa strains [The development of diagnostic PCR-based assays have proven to be effective tools for the rapid detection of pathogens in infectious diseases, including other known clonal  strains ,15-20. OPseudomonas aeruginosa strains used in this study are listed in Table Eschericia coli strain DH5\u03b1 was used for transformation of the suppression subtractive hybridization (SSH) library.\u00ae Elute cards. Miniprep DNA of SSH clones was prepared using the QIAprep Spin Miniprep Kit (Qiagen Sciences).Chromosomal DNA for SSH was isolated using the Masterpure DNA Purification Kit (Epicentre Technologies). Chromosomal DNA used for PCR was isolated using Masterpure DNA Purification Kit, DNeasy Tissue Purification Kit (Qiagen Sciences) or Whatman FTARsaI fragments according to manufacturer's instructions but with a hybridization temperature of 73\u00b0C. The library of SSH PCR amplicons was cloned in pGEM-T Easy (Promega). Individual clones were miniprepped and sequenced. Nucleotide sequences were determined by use of a PRISM Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) according to the manufacturer's instructions and separated by capillary electrophoresis on an Applied Biosystems 3730S Genetic Analyser at the Monash University Micromon sequencing facility. Sequence data was analysed using MacVector (Accelrys). To determine the presence or absence of the SSH clone sequence in the PAO1 genome, sequences were used in BLASTN searches at the Pseudomonas genome project web-site [http://www.ncbi.nlm.nih.gov.The AES-I isolate (strain 973) was used as the tester strain for SSH. This strain was chosen from a collection obtained from the Royal Children's Hospital, Melbourne and had been previously identified as the clonal strain AES-I . The driweb-site . AES-I sweb-site  of the NoprL gene have been described previously [Oligonucleotides (Sigma Proligo) and annealing temperatures used in the PCR assays are listed in Additional File eviously . AmplifiSpeI and DraI was performed as previously described [P. aeruginosa strain 973 [Molecular typing by PFGE following digestion with escribed . An isolrain 973 .\u00ae Elute cards and allowed to air dry. DNA from a 2 mm diameter disc from each card was eluted into 50 \u03bcL of water as per the manufacturer's instructions and added to PCR tubes containing reaction mixtures for the PCR amplification of either oprL or the SSH-identified AES-1 genomic locus HW2. P. aeruginosa strains were also isolated from the sputum samples and typed by PFGE to validate the PCR diagnosis.Samples of sputum were swabbed onto Whatman FTA\u00ae MGB probes (Applied Biosystems) were designed from regions of the sequences of the HW2 locus and the oprL gene using the Primer Express\u00ae Software v1.0 program (Applied Biosystems). Probe RTHW2-P  of template DNA. To monitor PCR inhibition the TaqMan\u00ae Exogenous Internal Positive Control (IPC) (Applied Biosystems) was multiplexed in the HW2 assay. The oprL assay was performed as a singleplex reaction. Amplification and detection were performed with the Eppendorf Realplex Mastercycler using the following program: 1 cycle of 95\u00b0C for 15 min and 40 cycles of 95\u00b0C for 15 sec and 60\u00b0C for 1 min. Negative controls were included in each assay. PCR products were also visualized by agarose gel electrophoresis to verify product amplification of the expected size. Cycle thresholds (Ct) from experiments to determine method sensitivity were reported as the average and standard deviation of three biological repeats. Correlation coefficients between Ct and DNA template concentration for each TaqMan assay were calculated by regression analysis and amplification efficiency was calculated using the formula: efficiency = -1 + 10^(-1/slope). Primers and probes for quantitative real-time PCR for AES-I are available as a kit through Cardinal Bioresearch http://www.cardinalbioresearch.com.au.Primers and TaqManP. aeruginosa. We sequenced 20 clones from the SSH clone library and identified 14 that contained AES-I sequences not present in PAO1  of DNA from AES-I isolate 973 against PAO1, the sequenced reference strain of  cluster  and thus cluster . Other hWe designed PCR primer pairs to amplify each of the 9 different AES-I genetic sequences that were not found in PAO1 and that did not localise to the O6 antigen gene cluster. We first performed PCRs with each primer set using the AES-I SSH driver strain (isolate 973) and PAO1 genomic DNA to confirm that the PCR reaction worked and was specific to AES-I. One of the primers sets (HW1/11/20) amplified a non-specific product in PAO1 and was not used in further assays.oprL gene that is present in all P. aeruginosa strains [We next performed an initial PCR profiling with the remaining 8 AES-I PCR primer sets on a collection of 9 AES-I strains (including driver strain), 9 non-AES-I CF isolates, 7 non-CF clinical isolates, 6 environmental isolates and the common laboratory strains PAO1, PA103, PAK and ATCC 27853  or non-AES-I (20) [P. aeruginosa strains tested whereas HW3 was found to be present in all but 4 AES-I strains and none of the other P. aeruginosa strains  , 9 repre0 , 9 repS-I (20)  as well P. aeruginosa by standard techniques [P. aeruginosa isolates of which 8 were identified to be AES-I. PCR with the oprL, HW2 and HW3 primer sets was performed on DNA purified from the same set of P. aeruginosa isolates , has been shown to be an efficient method to store, transport and isolate DNA from sputum samples suspected to harbor Mycobacterium tuberculosis [\u00ae Elute technology has further simplified the elution of DNA for PCR and is readily adaptable for routine pathology testing. We used PCR assays for the oprL and HW2 loci to determine if we could detect the presence of P. aeruginosa and AES-I directly from sputum samples stored on Whatman FTA\u00ae Elute cards. Sputum samples from Monash Medical Centre CF clinic patients that were positive or negative for the AES-I strain as determined by PFGE, were swabbed onto Whatman FTA\u00ae Elute cards, DNA eluted and used in the oprL PCR assay to determine the presence of P. aeruginosa in the sputum sample and in a 2nd PCR assay with the HW2 AES-I primers to determine if the P. aeruginosa present in the sputum was AES-I .To improve the diagnostic utility of the HW2 PCR we then developed real-time PCR TaqMan assays for rL Table . Based oP. aeruginosa PAO1, P. putida and P. fluorescens. The HW2 TaqMan assay was negative for these samples while oprL was positive for both P. aeruginosa and P. putida. DNA was then extracted from Whatman FTA\u00ae Elute cards spiked with AES-I positive and unique strains of P. aeruginosa. As predicted, all extracts were oprL positive and only extracts from P. aeruginosa AES-I strains were HW2 and oprL positive. The same pattern of results was obtained with DNA extracted from the AES-I positive and negative sputum samples stored on Whatman FTA\u00ae Elute cards used in the conventional PCR assay  indicating that this locus is present in a region of some variability between AES-I isolates. The HW2 locus was found to be present in all 35 strains determined by PFGE to be AES-I and absent in all 153 non AES-I P. aeruginosa strains tested. These results indicate that PCR for the HW2 locus is 100% specific and 100% sensitive for detection of the AES-I epidemic P. aeruginosa strain.AES-I is a highly transmissible virulent strain of troduced ,10. We htroduced . There iThe collection of strains used in this study included isolates from CF individuals that were identified in our initial 1999 clinic surveillance to harbour the AES-I strain  as well oprL PCR assay in our study was to act as a positive control for DNA quality to avoid false negative results in our PCR screens. Since we commenced our clinical surveillance study in 2005, it has been shown that the ecfX locus is more specific than oprL to identify P. aeruginosa from various environmental and clinical extracts [ecfX locus could be substituted for the oprL assay to provide greater specificity for the presence of P. aeruginosa in sputum samples if desired.The main purpose of the extracts . AccordioprL and HW2 loci can be used for the direct detection of P. aeruginosa and AES-I in CF sputum swabbed onto Whatman FTA\u00ae Elute cards. We are now further assessing the potential for these assays for use as routine surveillance tools for P. aeruginosa and AES-I in CF sputum. The use of Whatman FTA\u00ae Elute cards for sputum storage, transport and DNA template purification for PCR is simple and relatively inexpensive and could be easily adapted for detection of other bacterial pathogens from a broad range of respiratory and other infections.Compared with PFGE which can take 6 to 8 days to obtain a diagnosis from time of receipt of patient sputum, PCR-based assays have many benefits as potential diagnostic tools as they are simple, relatively inexpensive, do not require highly skilled personnel, reduce handling and detection errors and can significantly reduce the time required to identify patients harbouring the AES-I strain. We have shown that PCR amplification of the Monash University has a patent application pending for the AES-I sequences identified in this study. CBW will receive a percentage of royalties arising from commercialisation of the AES-I diagnostic kit according to Monash University policy. The other authors of this manuscript declare no personal, professional or financial relationships that cause a conflict of interest that could bias this work.HLW carried out the subtractive hybridization study, designed the PCR screen and performed the initial screening of lab and clinical isolates. LT participated in the design of the study, carried out screening of the clinical isolates, analysed the data and helped to draft the manuscript. SJT screened additional clinical isolates and carried out the real-time PCR conversion of the assay and screened clinical isolates. AM co-ordinated collection of samples from patients and helped with data analysis and interpretation. TS participated in design and co-ordination of the real-time PCR assay conversion and helped draft the manuscript. DSA participated in the concept and design of the study and data interpretation. CBW conceived, designed and co-ordinated the study and drafted the manuscript. All authors have read and approved the final manuscript.PCR Primer sequences used in this study.Click here for fileHomologies of AES-I genomic sequences identified by suppression subtractive hybridization (SSH).Click here for file"}
{"text": "In acute lung injury, repair of the damaged alveolar-capillary barrier is an essential part of recovery. Endostatin is a 20 to 28 kDa proteolytic fragment of the basement membrane collagen XVIII, which has been shown to inhibit angiogenesis via action on endothelial cells. We hypothesised that endostatin may have a role in inhibiting lung repair in patients with lung injury. The aims of the study were to determine if endostatin is elevated in the plasma/bronchoalveolar lavage fluid of patients with acute lung injury and ascertain whether the levels reflect the severity of injury and alveolar inflammation, and to assess if endostatin changes occur early after the injurious lung stimuli of one lung ventilation and lipopolysaccharide (LPS) challenge.Endostatin was measured by ELISA and western blotting.Endostatin is elevated within the plasma and bronchoalveolar lavage fluid of patients with acute lung injury. Lavage endostatin reflected the degree of alveolar neutrophilia and the extent of the loss of protein selectivity of the alveolar-capillary barrier. Plasma levels of endostatin correlated with the severity of physiological derangement. Western blotting confirmed elevated type XVIII collagen precursor levels in the plasma and lavage and multiple endostatin-like fragments in the lavage of patients. One lung ventilation and LPS challenge rapidly induce increases in lung endostatin levels.Endostatin may adversely affect both alveolar barrier endothelial and epithelial cells, so its presence within both the circulation and the lung may have a pathophysiological role in acute lung injury that warrants further evaluation. Acute lung injury (ALI) is characterised by neutrophilic inflammation of the alveolar-capillary barrier. ALI has multiple aetiologies, but appears to follow a uniform pattern of injury at a cellular level. Extensive damage to the alveolar-capillary barrier leads to the influx of a protein-rich oedema fluid and accompanying inflammatory cells into the alveoli. A complex cascade of both inflammatory and anti-inflammatory cytokines is triggered and inflammatory cells, including neutrophils and monocytes, are recruited to the alveoli. Studying these processes early in the course of the disease can be challenging because most insults causing lung injury are not predictably timed.Two human models of lung injury allow assessment of the early phases of ALI. One lung ventilation (OLV) during oesophagectomy is associated with a significant post-operative risk of ALI with proposed causative mechanisms including the ischaemic/reperfusion insult experienced by the collapsed lung, oxidative stress injury and barotrauma to the ventilated lung . SystemiThe neutrophilic inflammation of the alveolar capillary barrier in ALI and the models of OLV or LPS challenge result in the release of proteases including collagenases . The balin vitro [There are at least 27 different species of collagen. Types I and III predominate within both healthy and fibrotic lung . Perivasin vitro ,18.Resolution of ALI is dependent on the successful repair of a confluent barrier of alveolar epithelial and endothelial cells . This prAll patients enrolled in the study gave written informed consent themselves at the time of enrollment, or it was given by the consultant in charge of the intensive care unit (ICU) (not part of the research team) as their legal guardian if they were unable to give consent because of sedation and ventilation. In addition, in all cases, patients' next of kin gave informed signed assent to inclusion. In the UK. patients' relatives cannot consent for incapacitated relatives. In addition, those patients who recovered mental competency during their inpatient stay retrospectively provided signed consent for their inclusion in the study. This study was fully approved by the local National Health Service trusts and ethical review committee.Patients were studied within 48 hours of admission to the ICU of Birmingham Heartlands and University Hospital, Birmingham, UK, between 2006 and 2008. 38 patients  16 years, 12 with direct and 21 with remote lung injury) were identified as having ALI according to the American-European consensus statement [2): fraction of inspired oxygen (FiO2) ratio was recorded on the day of bronchoscopy. A summary of patient physiological severity is shown in Table Patient demographic characteristics were recorded at baseline. The acute physiology and chronic health evaluation II (APACHE II) and simplified acute physiology score II (SAPS II) were recorded as global markers of disease severity. The Murray lung injury score, partial pressure of arterial oxgen  1 94% predicted, mean 25 pack-year smoking history) undergoing elective oesophagectomy for oesophageal carcinoma underwent BAL of the collapsed lung at the end of the operation, which as such potentially suffers from ischaemia-reperfusion injury. Ventilation was performed with pressure control for eight patients and two patients with volume control. Mean peak airway pressures were 25.8 cm, standard error of the mean (SEM) 0.88 cm, and a mean tidal volume of 430 ml was achieved. Mean duration of OLV was 189 minutes, SEM 22.29 minutes. The preoperative PaOWe include data from a human LPS challenge study assessing the anti-inflammatory effects of simvastatin versus placebo in healthy volunteers. Data are presented from 10 patients treated with placebo  who underwent bronchoscopy six hours post-inhalation of LPS. Full details of the patient characteristics and lavage fluid abnormalities are available in another paper .Bronchoscopy was performed by instilling three 50 ml aliquots into the right middle lobe . Bronchoalveolar lavage fluid (BALF) was processed as described previously . Into liEscherichia coli serotype O26:B6; Sigma Chemicals, Poole, Dorset, UK) was dissolved in endotoxin-free sterile 0.9% saline and inhaled via an automatic inhalation\u2013synchronised dosimeter nebuliser , which delivers particles of a mass median aerodynamic diameter of 10 mm, as described previously. The dosimeter produces a calibrated aerosol of 8 \u03bcl at each slow inhalation starting from functional residual capacity to total lung capacity. Each subject performed five successive inhalations of the LPS solution (1.25 mg/ml) through the mouthpiece with a nose clip in place. The total dose of inhaled LPS was 50 \u03bcg. BAL was performed six hours after LPS inhalation according to standard guidelines by a single researcher (DM).LPS . The epithelial lining fluid (ELF) levels of endostatin were estimated using the following formula: ELF endostatin = BAL urea (mmol/L) \u00d7 BAL endostatin/plasma urea concentration (mmol/L), as described previously . BALF prEndostatin and IL-8 were measured by using an ELISA kit  according to manufacturer's instructions. CV for intra-assay variability in BALF of endostatin is 3.6% and inter-assay variability was 8%. Spiking ALI BALF with recombinant endostatin standard (2.5 ng/ml) has a 96% recovery rate.Immunoprecipitation and western blotting of plasma and BALF was performed using methods described previously ,28. The A 25 \u03bcl sample of BALF was loaded onto polyacrylamide gel and the proteins were separated on a 7 to 12% SDS-PAGE under reducing conditions, electrotransferred to a nitrocellulose membrane  and probed with rabbit polyclonal antibodies against endostatin (HES.6)  and humaCollagen XVIII was immunoprecipitated from human plasma using a monoclonal anti-ALL type XVIII antibody, DB144-N2 bound to anti-mouse IgG-coated magnetic beads , as described elsewhere . The bouP < 0.05.The Ryan-Joiner normality test was used to test the distribution of the data. Non-parametric Mann-Whitney U tests were used for data that was not normally distributed (ELISA endostatin ALI plasma data and BALF data) and are quoted as medians (interquartile ranges (IQR)). Normally distributed data  are quoted as mean (SEM) and compared using analysis of variance (ANOVA). Statistical significance assumed at P = 0.008) and patients at risk from ALI . On day four, plasma levels in ALI patients remained elevated  compared with normal controls  and SAPS II  but not with lung injury score  (data not shown). Plasma endostatin levels at the onset of ALI or at day four did not predict whether patients subsequently survived or died.There were significant linear associations between plasma endostatin at the onset of ALI and the global severity of illness markers APACHE II  and day 4  than healthy individuals (0.08 ng/ml). ALI day 0 endostatin levels (2.6 ng/ml) were higher than those at risk of ALI . There was no difference between BALF levels at day 0 or day 4 between patients who died or survived, or those with direct or remote lung injury. BALF endostatin did not correlate with APACHE II, SAPS II or lung injury score at day 0 or day 4.Endostatin levels in ALI BALF fell from day 0 to day 4 . In addition, day 0 BALF endostatin levels correlated with the degree of BAL neutrophilia  but not with total cell count or BALF IL-8. At day 4 endostatin also correlated strongly with protein permeability index  and total neutrophil counts  (data not shown).There was also a significant relationship between day 0 BALF endostatin levels and protein permeability index . When ELF levels were lower than plasma levels there was a significant correlation  between plasma and ELF endostatin at the onset of ALI (data not shown). However, in some patients, calculated ELF levels were actually higher than plasma suggesting intra-alveolar generation of endostatin. Interestingly, at day 4 ELF endostatin correlated with lung injury score  but not in ALI patients at day 0.Plasma levels of endostatin were significantly higher than calculated ELF levels in the lung  diff = 18 to 169; P = 0.013 vs normal; PPI in LPS: median = 0.0025, IQR = 0.0013 to 0.003, P = 0.011 versus normal; normal PPI = 0.0014, IQR = 0.0008 to 0.0024). Percentage of neutrophils in BAL rose from 1.1% (IQR = 0.0 to 2.65) in normal BALF to median 11% (IQR = 2 to 60.5) in OLV (P = 0.011), and 41% (IQR = 24 to 57) in LPS challenge as described previously [OLV and LPS challenge induced a BAL neutrophilia and an increase in protein permeability index (PPI) compared with normal controls  in LPS-challenged patients. OLV increased BAL endostatin  but not in OLV patients. In contrast, plasma levels of endostatin were not altered by LPS challenge or OLV (data not shown).Inhalation challenge with LPS increased BALF endostatin from a median of 0.08 ng/ml in normal individuals to 0.385 ng/ml   = 198, SE 38) compared with normal plasma  in normal controls  (data not shown). The main bands of 55 kDa, also detectable with anti-LONG antibody, and 72 kDa were interpreted to represent proteolytic N-terminal fragments from the middle form and the short form of collagen XVIII, respectively  in ALI compared with 41.21 (SE 4.8)  end of type XVIII collagen revealed increased levels of C-terminal endostatin-containing fragments of collagen XVIII are present within the BALF of ALI patients with a fragmentation pattern that was different to normal controls.P = 0.02) . Whole lane densitometric analysis showed that significantly elevated amounts of type XVII carboxy terminal endostatin-like fragments were present in ALI samples  compared with normal BALF , which have been implicated in the pathogenesis of ALI ,34,35. WWhat are the implications of our findings for alveolar capillary repair in ALI? Previous studies using the animal corneal micropocket assay have demonstrated that BALF has a strong angiogenic potential that is related to elevated CXC chemokine levels . In contin vitro wound repair responses of both distal small airway epithelial cells, and primary human type II epithelial cells [In addition to effects on endothelial cells, we have recently reported that endostatin inhibits the proliferation and al cells . Thus elThis study has several limitations. Firstly, despite several attempts, we were unable to detect plasma endostatin fragments by immunoprecipitation and western blotting with the HES.6 antibody, which appears unsuitable for plasma endostatin estimation.Secondly, there were a number of drop outs in our sequential assessments, for clinical reasons . We do not believe the results have been biased by this because there were no baseline differences in endostatin between those re-studied at day 4 and those not. Thirdly, it would be interesting to observe the effect of neutralising endostatin bioactivity in BALF on endothelial cell viability. Unfortunately, no effective specific inhibitor for the bioactivity of endostatin is currently available as endostatin has a wide variety of effects on endothelial cells influencing nearly 12% of the genome via a variety of mechanisms . ClearlyTo our knowledge, this is the first report of the presence of endostatin in plasma and BALF of humans with ALI. It is clear that ALI patients have persistently elevated alveolar endostatin levels during the early course of the disease. Our models of the early onset of lung injury suggest these changes occur very early in the injurious process. As endostatin may adversely affect both alveolar-barrier endothelial and epithelial cells, its presence within both the circulation and the lung may have a pathophysiological role in ALI that warrants further evaluation.\u2022 Endostatin is elevated within the plasma and BALF of patients with ALI.\u2022 Endostatin levels in ALI BALF reflected the degree of neutrophilia and the extent of the loss of protein selectivity of the alveolar-capillary barrier.\u2022 Plasma levels of endostatin at the onset of ALI were associated with the severity of physiological derangement.\u2022 Western blotting confirmed elevated type XVIII collagen precursor levels and multiple amino- and carboxy-terminal fragments in plasma and BALF.\u2022 Increases in endostatin occur early after OLV and LPS challenge in human volunteers but this is compartmentalised to the lung.2: fraction of inspired oxygen; ICU: intensive care unit; Ig: immunoglobulin; IL: interleukin; IQR: interquartile range; LPS: lipopolysaccharide; MAPK: mitogen activated protein kinase; MMP: matrix metalloproteinases; OD: optical density; OLV: one lung ventilation; PaO2: partial pressureof arterial oxygen; PBS: phosphate-buffered saline; SAPS II: simplified acute physiology score II; SD: standard deviation; SEM: standard error of the mean; TNF: tumour necrosis factor; VEGF: vascular endothelial growth factor.ANOVA: analysis of variance; ALI: acute lung injury; APACHE II: acute physiology and chronic health evaluation II; BAL: bronchoalveolar lavage; BALF: bronchoalveolar lavage fluid; ELF: epithelial lining fluid; ELISA: enzyme-linked immunosorbent assay; FEV: forced expiratory volume; FiOThe authors declare that they have no competing interests.GDP, NN, SS, DM, AR, WT, MM and DRT recruited patients and performed bronchoscopy. GDP, NN and AR performed ELISA measurements. RH performed the western blot analyses. All authors contributed to writing the paper. GDP NN and DRT performed the statistical analyses. NN and GDP contributed equally to the paper."}
{"text": "Pseudomonas aeruginosa, a non-fermentative, gram-negative rod, is responsible for a wide variety of clinical syndromes in NICU patients, including sepsis, pneumonia, meningitis, diarrhea, conjunctivitis and skin infections. An increased number of infections and colonisations by P. aeruginosa has been observed in the neonatal intensive care unit (NICU) of our university hospital between 2005 and 2007.Hand disinfection compliance before and after an educational programme on hand hygiene was evaluated. Identification of microrganisms was performed using conventional methods. Antibiotic susceptibility was evaluated by MIC microdilution. Genotyping was performed by PFGE analysis.Pseudomonas aeruginosa in the NICU of the Federico II University hospital  and the infection control measures adopted to stop the spreading of P. aeruginosa in the ward were described. From July 2005 to June 2007, P. aeruginosa was isolated from 135 neonates and caused severe infections in 11 of them. Macrorestriction analysis of clinical isolates from 90 neonates identified 20 distinct genotypes, one major PFGE type (A) being isolated from 48 patients and responsible for 4 infections in 4 of them, four other distinct recurrent genotypes being isolated in 6 to 4 patients. Seven environmental strains were isolated from the hand of a nurse and from three sinks on two occasions, two of these showing PFGE profiles A and G identical to two clinical isolates responsible for infection. The successful control of the outbreak was achieved through implementation of active surveillance of healthcare-associated infections in the ward together with environmental microbiological sampling and an intense educational programme on hand disinfection among the staff members.The molecular epidemiology of P. aeruginosa infections in the NICU were caused by the cross-transmission of an epidemic clone in 4 neonates, and by the selection of sporadic clones in 7 others. An infection control programme that included active surveillance and strict adherence to hand disinfection policies was effective in controlling NICU-acquired infections and colonisations caused by P. aeruginosa. Klebsiella pneumoniae and Serratia marcescens in the NICU of the Federico II University Hospital of Naples between 2002 and 2004 [Gram-negative bacteria have become relevant causes of healthcare-associated infections in the neonatal intensive care unit (NICU) environment. ,2. Outbrand 2004 .Pseudomonas aeruginosa, a non-fermentative, gram-negative rod, is responsible for a wide variety of clinical syndromes in NICU patients, including sepsis, pneumonia, meningitis, diarrhea, conjunctivitis and skin infections [P. aeruginosa in NICU settings have been much less reported up-to-date and have been associated with both environmental reservoirs and healthcare workers' carriage [fections . Neverthcarriage -10.P. aeruginosa has been observed in the NICU of our university hospital between 2005 and 2007. The aims of this study were: i) to analyze the molecular epidemiology and antimicrobial susceptibility patterns of P. aeruginosa isolates; ii) to describe the infection control measures undertaken to limit P. aeruginosa spread in the ward.An increased number of infections and colonisations by P. aeruginosa isolated from surveillance swabs and from clinical samples  of babies in the NICU were included in the study. Environmental samples were obtained from the following sites: air, room surfaces, sinks, hand disinfectants, baby incubators, monitors, and staff hands. All three sinks present in the ward were sampled.The tertiary-level NICU of the University 'Federico II' hospital of Naples, Italy serves approximately 350 admissions per year including both inborn and outborn patients and consists of three rooms with a maximum capacity of eight neonates per room. Sinks, chlorhexidine/alcohol hand disinfectants and gloves are available in each room. Sinks, 4% chlorhexidine hand disinfectants, and gloves are available in each room, together with hand disinfection instructions for staff members and visiting parents. Healthcare-associated infections were defined using standard Centers for Disease Control and Prevention definitions adapted to neonatal pathology . InfectiAn educational programme on hand disinfection was repeatedly performed as part of the ward's plan for healthcare-associated infections control. It involved both medical and nursing staffs, it was carried out each time for one week, and it consisted of a 30 minutes review of the main topics on hand disinfection according to the US Centers for Disease Control and Prevention (CDC) recommendations . Hand diHand disinfection compliance was defined as hand-washing with the appropriate quantity of 4% chlorhexidine disinfectant and water for the recommended time, before and after each patient contact and it was evaluated by carrying out an observational study. Moreover, surveillance cultures from 30 randomly selected healthcare workers' hands were obtained by means of contact plates before and after each educational programme.A trained, disguised observer monitored staff's (doctors and nurses) compliance to hand disinfection for the two weeks preceding and the two weeks following each series of educational meetings. Four patients were randomly selected each day (Monday through Friday) and all healthcare workers (HCWs) who cared for the target neonates were observed for 1 hour period during morning shifts and their compliance to hand disinfection procedures before and after each patient contact was recorded on a dedicated form.Data were analysed using SPSS 11.0 . Pearson's Chi-squared test was used to compare hand hygiene compliance before the beginning of the educational programme and after the first and the last series of educational meetings. Pearson's correlation coefficient between hand disinfection compliance in the same periods and colonisation rates was also calculated. All results were considered to be statistically significant at p < 0.05.Isolates were identified using the API NE manual identification system  or the Phoenix automatic system . The susceptibililty of isolates to 12 selected antimicrobials was determined by the standard antimicrobial susceptibility methods . The antXbaI enzyme and pulsed-field gel electrophoresis (PFGE) was performed on all P. aeruginosa infection isolates and on available surveillance culture isolates as previously described [DNA macrorestriction with escribed .P. aeruginosa has circulated in the ward in an endemic fashion, being responsible for a mean colonisation rate of 10.6% and for two ocular infections (data not shown). During the study period (July 2005 to June 2007), 616 neonates were prospectively surveilled for healthcare-associated infections  and 568 of them had their weekly surveillance swabs taken at least once. One hundred-thirty-five neonates  became colonised by P. aeruginosa during their stay in the ward , after Candida spp. (21.8%) and Escherichia coli (16.8%). Moreover, no pathogen was identified in 18.8% of infants diagnosed as having an infection. P. aeruginosa was responsible for 11 severe infections in 11 neonates, with 3 and 4 of them having their birth-weights below 1000 and 750 grams, respectively , all 11 infected patients had positive cultures for P. aeruginosa at nasal/pharynx or rectum surveillance swabs.In the two years preceding the outbreak period P. aeruginosa isolates) identified twenty PFGE types, named A through T, which showed up to six fragments variation in macrorestriction pattern , gentamicin (MIC > 8) and ciprofloxacin (MIC > 2); in addition, PFGE type G appeared to be resistant to piperacillin/tazobactam (MIC > 64/4). Moreover, such resistant profiles were responsible for two sepsis in two neonates with extremely low birth-weight, both having a fatal outcome Table .P. aeruginosa during the fourth quarter of 2005, a combination of targeted infection control measures were undertaken .Although no further isolations of multi-drug resistant d Figure . ReportiP. aeruginosa at the following sites: three sinks on both occasions and a nurse's hand on the second sampling. Genotyping of such strains demonstrated that the isolate recovered from one of the sinks on the first environmental sampling displayed an A profile and the one from the nurse's hand on the second environmental sampling displayed a G profile. The other environmental isolates showed different profiles, not corresponding to any of the profiles isolated from patients' surveillance swabs or clinical specimens.Environmental microbiological sampling identified P. aeruginosa were diagnosed and colonisation rate returned to pre-epidemic values.No further targeted control measures were undertaken after June 2007 as no other infections by P. aeruginosa of PFGE profile G was isolated only once from surveillance cultures of a total of 90 randomly selected healthcare workers' hands before and after each educational programme, as described above. In addition, other 16 surveillance cultures proved to be inappropriate . Hand disinfection compliance of HCWs before the first educational programme proved to be 23.4% and 11.7% before and after each patient contact, respectively . Conversely, no significant correlation was found between the latter and improvement in hand disinfection compliance after patient contact . Finally, hand disinfection compliance of HCWs before and after patient contact proved to be significantly different at all times of observation  and 7 of them were of extremely low birth weight (ELBW), i.e. below 1000 grams. ELBW neonates have actually been shown to have a significantly increased risk of acquiring P. aeruginosa when compared to higher birth-weight infants [P. aeruginosa was of 57%. Although no attributable mortality rate was calculated, three of the four neonates died soon after (0\u201324 hours) the infection was diagnosed, thus our data indirectly confirm other Authors' findings regarding the very high mortality rates related to P. aeruginosa infections [P. aeruginosa antibiotypes, both displaying resistance to imipenem, meropenem, gentamicin and ciprofloxacin, have probably affected the final outcome in two of the four fatal cases. We did not analyse mechanisms of resistance as no further such phenotypes were identified. Nevertheless, to our knowledge, this is one of the first accounts on two carbapenem-resistant P. aeruginosa genetically unrelated strains which caused two sepsis in a NICU.The overall incidence rate of tely 10% ,15, whiltely 10% . Higher tely 10% ,17, but  infants . MoreoveP. aeruginosa frequently causes multi-clone outbreaks, with the concurrent isolation of genetically distinct strains among patients and healthcare workers (HCWs) and in the environment. During a 15 months-long epidemic in a NICU, Moolenaar et al. [P. aeruginosa genotypes A, B, and C, isolated in 75%, 15%, and 10% of case-patients, respectively. Such genotypes were also found on three nurses' hands, while two positive environmental isolates showed two distinct genotypes, unrelated to any human isolate. Moreover, Foca et al. [P. aeruginosa PFGE profiles over a 33 months-period in the NICU, showing the presence of a major clone, which was also isolated from the hands of a nurse, of two other PFGE types, and of eight unique clones. No environmental specimen proved to be positive for P. aeruginosa. Our study, covering a 24 months time span, identified a predominant PFGE type which was responsible for 36% of infections by P. aeruginosa and at least 35% of colonisations by the same pathogen. Such PFGE profile was also found in one sink, but not on any nurse's hand and circulated in the ward together with less recurrent and with sporadic strains, which caused the remaining infections and colonisations. Other five environmental samples proved to be positive for distinct P. aeruginosa PFGE types, unrelated to the ones colonising or infecting the patients. Transmission of P. aeruginosa from environmental sources to patients and HCWs has been thoroughly described [P. aeruginosa reservoirs, both environmental and human, and, owing to the long time period between the appearance in neonates (July 2005) and the environmental isolation (2nd quarter 2006), we are not able to understand whether the only sink sample found to be positive for P. aeruginosa PFGE profile A has been a result, rather than the origin, of the pathogen's circulation in the ward.r et al.  identifia et al.  describeescribed ,20. Our P. aeruginosa in the NICU setting [P. aeruginosa, displaying the G genotype. The culture was drawn when the epidemic was at its peak value, with nearly 50% of neonates being colonised. The detection of HCWs who are colonised at any body site by P. aeruginosa epidemic clones may sometimes identify the pathogen's reservoir, thus enabling a successful and timely outbreak containment [P. aeruginosa epidemic clone has not been recognized as an independent risk factor for acquiring P. aeruginosa colonization or infection [P. aeruginosa epidemic clone on multivariate analysis [P. aeruginosa may be underestimated during outbreaks investigations and that reinforcement of hand disinfection and of correct gloves use should always be promptly initiated when an increased number of P. aeruginosa isolations is detected. In agreement with previous data [P. aeruginosa circulation of in the ward, the hand disinfection educational programme was the most effective one. The programme started during the fourth quarter of 2006, when the outbreak was at its peak value, and by the end of the second quarter of 2007 the outbreak was over. Owing to the programme's success, the meaning of different hand disinfection compliance rates before and after patient contact and how this may have affected P. aeruginosa circulation in the ward were not further investigated. A possible explanation for the partial ineffectiveness of the traditional infection control interventions may be the molecular heterogeneity of P. aeruginosa outbreaks. Thus, the timely identification of increased isolation of this pathogen, achieved by means of active surveillance, appears to be crucial to limit the spreading of P. aeruginosa in NICU settings.Healthcare workers' (HCWs) hands have been frequently implicated in the spreading of  setting ,10,17. Anfection . In turnous data , our stuP. aeruginosa outbreaks.This study suggests that an infection control programme based on active surveillance and strict adherence to hand disinfection and gloves use policies and supported by environmental sampling and molecular analysis is effective in controlling NICU multi-clone The authors declare that they have no competing interests.P. aeruginosa strains and carried out the antimicrobial susceptibility experiments, ADP performed the PFGE experiments, VC, MT and RZ conceived the study and participated in its design and coordination, VC and RZ drafted the manuscript. All authors read and approved the final manuscript.VC, AS, AC and MDR carried out the active surveillance of healthcare-associated infections and infection control interventions in the NICU, AL, ADP and TB isolated the The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/70/prepub"}
{"text": "Pseudomonas aeruginosa and Acinetobacter baumanii are important nosocomial pathogens with wide intrinsic resistance. However, due to the dissemination of the acquired resistance mechanisms, such as extended-spectrum beta-lactamase (ESBL) and metallo beta-lactamase (MBL) production, multidrug resistant strains have been isolated more often.P. aeruginosa, PER-1 producing A. baumannii, SHV-5-producing Klebsiella pneumoniae and VIM-2-producing P. aeruginosa isolates were subcultured from the patient's samples in Hungary. Comparing the pulsed-field gel electrophoresis (PFGE) patterns of the P. aeruginosa strains from the patient to the P. aeruginosa strains occurring in this hospital, we can state that the PER-1-producing P. aeruginosa and VIM-2-producing P. aeruginosa had external origin.We report a case of a Hungarian tourist, who was initially hospitalized in Egypt and later transferred to Hungary. On the day of admission PER-1-producing P. aeruginosa,and PER-1-producing A. baumanii strains in Hungary. This case highlights the importance of spreading of the beta-lactamase-mediated resistance mechanisms between countries and continents, showing the importance of careful screening and the isolation of patients arriving from a different country.This is the first report of PER-1-producing  Pseudomonas aeruginosa and Acinetobacter baumanii are very important nosocomial pathogens mainly in intensive care units, being responsible for various types of infections with more and more limited therapeutic options [ options .P. aeruginosa have significant intrinsic resistance to antibiotics [P. aeruginosa which are resistant to third-generation cephalosporins produce a chromosomally mediated molecular class C beta-lactamase, the AmpC enzyme [P. aeruginosa and in Acinetobacter spp. as well. Acquired resistance to beta-lactams can lead to therapeutic failure, especially when it is associated with resistance to other classes of drugs, such as aminoglycosides and fluoroquinolones. Among these enzymes acquired, PER (Pseudomonas extended resistance), a class A extended-spectrum beta-lactamase (ESBL), occurring less frequently has clinical importance by conferring resistance to oxyimino beta-lactams [P. aeruginosa among which the VIM-type enzymes appear to be the most prevalent [The ibiotics . TherefoC enzyme . However-lactams . Poor ou-lactams . The alsrevalent .P. aeruginosa, A. baumannii isolates and VIM-producing P. aeruginosa in Hungary from a patient, who was hospitalized in Egypt and transferred to Hungary. This work illustrates the dissemination of bacteria carrying PER-type ESBL and VIM-type MBL enzymes.Here we report the first detection of PER-producing P. aeruginosa strains \u2013 an ESBL-producing P. aeruginosa (PA1), an imipenem-resistant P. aeruginosa (PA2), an MBL-producing P. aeruignosa (PA3), were observed and furthermore ESBL-producing Klebsiella pneumoniae (ESBL-KP), methicillin-resistant Staphylococcus aureus (MRSA) and Enterococcus faecalis (EF) were isolated. Next day ESBL-producing A. baumanii (ESBL-AB) and PA2 were cultured from the patient's canul. During his hospitalization from his nose PA1, ESBL-AB, ESBL-KP, MRSA, from his throat PA1, ESBL-AB, ESBL-KP, from his trachea PA3, ESBL-AB, ESBL.KP,-MRSA and from his wound PA1, PA3, ESBL-AB, ESBL-KP, MRSA and EF were isolated. Blood cultures were taken nine occasions and PA1, ESBL-KP, MRSA and EF were subcultured. The patient received adequate supportive treatment and empirically cefepime, subsequently meropenem and vancomycin were administered intravenously at high dosage. The aminoglycosides were synergy resistant. On the 8th day of the hospitalization in Hungary the patient died.In April, 2006 a 53-year-old Hungarian tourist was involved in a severe terror-attack in Egypt. He was initially hospitalized because of his burn, mechanical injuries and sepsis syndrome in Egypt. Five days later he was transferred in comatose, hypoxic and hypothermic condition to the Burn Unit of State Health Center, Budapest, Hungary. On the day of admission, bacterial cultures taken from burn wound. Based on the different colony morphology and antibiotic susceptibility patterns three different  in K. pneumoniae and in A. baumanii strains but no synergy was observed in P. aeruginosa strains. The minimum inhibitory concentrations (MICs) of the antimicrobial agents were determined by E-test  and by using the interpretative criteria of the Clinical and Laboratory Standards Institute [SpeI-digested  genomic DNA of P. aeruginosa was performed and analyzed as described previously [blaTEM [blaSHV [blaPER [blaOXAs [blaIMP, blaVIM and blaclassI genes [The isolates were identified by VITEK 2 . On a routine antibiogram synergy was observed between amoxycillin/clavulanic acid and cefepime or ceftazidime disks nstitute . Pulsed-eviously . Isoeleceviously . In the  [blaTEM , blaSHV  [blaSHV , blaPER  [blaPER , blaOXAs[blaOXAs , blaIMP,sI genes  were useP. aeruginosa strains isolated from the patient on the day of admission  was sensitive only to meropenem and both PA1 and PA2 were resistant to all the other tested antibiotics. The third P. aeruginosa (PA3) strain was sensitive to aztreonam and netilmicin and resistant to the all cephalosporins and carbepenems. However, the imipenem MIC value decreased in the presence of EDTA from > 256 to 12 \u03bcg/ml suggesting the presence of an MBL enzyme. The A. baumanii isolate was resistant to all cephalosporins and aztreonam, but the ceftazidime and cefotaxime MIC values decreased in the presence of clavulanic acid suggesting the presence of an ESBL enzyme. The K. pneumoniae strain had also ESBL phenotype based on the MIC values and it was sensitive to carbapenems, amikacin and ciprofloxacin as well.Three different antibiotic susceptibility patterns were observed in on Table . All of A. baumanii and K. pneumoniae. OXA genes were recognized in PA1 and PA3 strains. PER-1 genes were found in PA1 and A. baumanii isolates and SHV-5 was found in K. pneumoniae. Only the PA3 isolate harbored the VIM-2 gene. The OXA-10 and VIM-2 genes were located on the same class I integrons, as the sequencing result of class I integron showed.The PCR and sequencing results are summarized in Table According to IEF test results, all the isolates contained \u03b2-lactamases. Isoelectric focusing confirmed the expression of PER-1 (pI 5.3), TEM-1 (pI 5.4), OXA-1 (pI 7.4), OXA-10 (pI 6.1), SHV-5 pI 8.2), VIM-2 (pI 5.3) and the chromosomal AmpC cephalosporinase (pI 8 or > 8.5) enzymes in the different strains  suggesting that they belonged to different clones , the OprD-loss P. aeruginosa (PA2) and VIM-2-producing P. aeruginosa (PA3) strains \u2013 had external origin and could be transferred from Egypt to Hungary. The PER-1 producing P. aeruginosa and A. baumanii strains disappeared from the hospital, no more infections have been detected with these strains since then.Furthermore the result of the PFGE analysis of the PA1, PA2 and PA3 confirms, that the three P. aeruginosa strains. The CLSI recommendation for screening the ESBL-production in different bacteria species is uncomplete, exist just for Klebsiella spp. and Escherichia coli strains [The emergence and subsequently spread of PER-producing and MBL-producing strains are alarming. Supposing, that these resistance mechanisms might also exist in other countries the dissemination of PER-enzyme could be more prevalent over the world, particularly due to the unsolved problem of routine screening for ESBL-production in  strains .P. aeruginosa and A. baumannii isolate, VIM-2 producing P. aeruginosa strains in Hungary. Furthermore it illustrates the possibility of the inter-country and the inter-continent spread of the beta-lactamase-mediated resistance mechanisms. Our study features the intercontinental spread of antimicrobial resistance, showing the importance of careful screening and the isolation patients arriving from a different country.In conclusion, this work confirms the emergence of PER-1-producing The authors declare that they have no competing interests.LR and ZJ provided clinical care, literature search and edited the manuscript, JS and KK identified the bacteria, performed the antibiotic susceptibility tests, DS carried out the molecular studies, characterized the bacteria and drafted the manuscript, NK drafted the manuscript. All authors read and approved the final manuscript.Written informed consent was obtained from the patient's relative for publication of this case report. A copy of the written consent is available for review by the Editor-in-Chief of this journal."}
{"text": "Pseudomonas aeruginosa in cystic fibrosis (CF) chronic infections is based on a genetic adaptation process consisting of mutations in specific genes, which can produce advantageous phenotypic switches and ensure its persistence in the lung. Among these, mutations inactivating the regulators MucA , LasR (quorum sensing) and MexZ (multidrug-efflux pump MexXY) are the most frequently observed, with those inactivating the DNA mismatch repair system (MRS) being also highly prevalent in P. aeruginosa CF isolates, leading to hypermutator phenotypes that could contribute to this adaptive mutagenesis by virtue of an increased mutation rate. Here, we characterized the mutations found in the mucA, lasR, mexZ and MRS genes in P. aeruginosa isolates obtained from Argentinean CF patients, and analyzed the potential association of mucA, lasR and mexZ mutagenesis with MRS-deficiency and antibiotic resistance. Thus, 38 isolates from 26 chronically infected CF patients were characterized for their phenotypic traits, PFGE genotypic patterns, mutations in the mucA, lasR, mexZ, mutS and mutL gene coding sequences and antibiotic resistance profiles. The most frequently mutated gene was mexZ (79%), followed by mucA (63%) and lasR (39%) as well as a high prevalence (42%) of hypermutators being observed due to loss-of-function mutations in mutL (60%) followed by mutS (40%). Interestingly, mutational spectra were particular to each gene, suggesting that several mechanisms are responsible for mutations during chronic infection. However, no link could be established between hypermutability and mutagenesis in mucA, lasR and mexZ, indicating that MRS-deficiency was not involved in the acquisition of these mutations. Finally, although inactivation of mucA, lasR and mexZ has been previously shown to confer resistance/tolerance to antibiotics, only mutations in MRS genes could be related to an antibiotic resistance increase. These results help to unravel the mutational dynamics that lead to the adaptation of P. aeruginosa to the CF lung.Survival of  Pseudomonas aeruginosa is the leading cause of morbidity and mortality in CF patients, producing chronic pulmonary infections that can persist over decades P. aeruginosa, generally acquired from environmental reservoirs P. aeruginosa lineage diversifies into phenotypes specifically adapted to the hostile environment of the CF lung, thus allowing its long-term persistence P. aeruginosa to the CF lung The opportunistic pathogen P. aeruginosa CF adaptive phenotypes is mainly based on the occurrence (and further selection) of loss-of-function mutations in specific genes. Among these, the most commonly mutated is mucA, which encodes for a negative regulator of the biosynthesis of the exopolysaccharide alginate and whose inactivation is the basis of the conversion to the mucoid phenotype P. aeruginosa CF infections, is lasR, which is the main quorum sensing regulator controlling the expression of several virulence traits mexZ, a negative regulator of the MexXY-OprM multidrug-efflux pump, whose inactivation increases the resistance to aminoglycoside and other drugs The acquisition of these P. aeruginosa isolates from CF patients is the hypermutator phenotype P. aeruginosa infections. In fact, the link between the acquisition of antimicrobial resistance and hypermutators has been well-established by in vitro and in vivo approaches P. aeruginosa MRS-deficient strain in vitro, we previously established an association between hypermutability and both mucoid conversion lasR inactivation P. aeruginosa infections in the CF airways. Similarly, Waine et al. P. aeruginosa isolates from adult CF patients with chronic lung infections. Nevertheless, the role of hypermutability in P. aeruginosa phenotypic diversification in the natural scenario of a human infection has only very recently been investigated by Mena et al. lasR, the latter of which showed a higher number of mutations). Hence, these results show that the involvement of hypermutability in the acquisition of the mutations which drive the adaptive process of P. aeruginosa into the CF airways is complex. Also, exactly how P. aeruginosa acquires those mutations which enable it to persist into the CF lung environment is still an open question. These issues need to be resolved in order to shed light on the mutational mechanisms involved in P. aeruginosa adaptation.Another highly prevalent phenotype observed in mucA (mucoid phenotype), lasR (quorum sensing deficient phenotype), mexZ (multi-drug resistant phenotype) and the MRS genes (hypermutator phenotype) in a collection of P. aeruginosa isolates obtained from Argentinean CF patients. mexZ turned out to be the most frequently mutated gene followed by mucA and lasR, but mutations in all these three genes were highly prevalent in our collection. Also, the occurrence of hypermutators among Argentinean CF patients was very high, with hypermutability being a consequence of mutations affecting the MRS genes . However, the mutational spectra of each gene were clearly different, suggesting that more than one mechanism could be involved in the mutational process of each gene. Our results show a lack of association between hypermutability and the frequency of adaptive mutations occurring in mucA, lasR and mexZ, and, although hypermutability was associated with an increased resistance to most of the antibiotics tested on P. aeruginosa isolates from the Argentinean CF population, this association was not observed for mucoid variants, quorum sensing deficiency or the mexZ related multi-drug resistant phenotype.In the present work, we carried out an exhaustive survey and characterization of mutations in P. aeruginosa CF isolates in Latin America which is focused on mucoidy, lasR-deficiency, hypermutability and antibiotic resistance, critical issues regarding CF chronic infections, and provides new insights into the mutational mechanisms required for bacterial persistence.This is the first detailed characterization of P. aeruginosa isolates were collected from the sputum of twenty-six CF patients during the course of chronic pulmonary infection . Moreover, the strains from different patients were epidemiologically unrelated  as well as with those from the MPAOMS (2.8\u00d710\u22126\u00b11.6\u00d710\u22126) and MPAOML (1.3\u00d710\u22126\u00b10.6\u00d710\u22126) hypermutator mutant strains. In this sense, clinical isolates were considered hypermutators when their mutation frequencies were \u22652\u00d710\u22127, with this being an arbitrary value which has been previously established to be reached/surpassed mostly by MRS-defficient strains P. aeruginosa isolates (42%), with these hypermutable P. aeruginosa strains being obtained from 12 patients (46%). It is important to mention that the prevalence of P. aeruginosa hypermutator strains was very high in the adult population as well as in the child/teenaged population.Thus, the results were compared with those obtained for the PAO1 reference strain  were responsible for the hypermutator phenotype in both the mutS and mutL genes, including deletions and insertions . This amino acid is one of the last 10 C-terminal residues that abolishe MutL homodimerization upon deletion, a phenomenon that has a key function in communicating mismatch recognition by MutS to downstream repair processes. To our knowledge, these three missense mutations have not been previously reported.It has been described that the stable hypermutators found among sertions . FurthermutL, respectively. In addition, a third hypermutator isolate (3c) was obtained from the same patient in 2008, which possessed an unaltered mutL sequence but which failed to amplify a region of the mutS gene. This result indicates that during four years of chronic infection in patient 3, three different hypermutator lineages emerged, suggesting a strong selection for hypermutability in the CF lung.Finally, it is interesting to highlight the results obtained for patients 1 and 3. From patient 1, we isolated a previous hypermutator strain in 2004 (1a) and a subsequent hypermutator strain in 2007 (1b) . Both thmucA, lasR and mexZ genes were analyzed in our collection of isolates to score for mutations that could be involved in the phenotypic switches to mucoidy, deficiency in the quorum sensing and antimicrobial (aminoglycoside) resistance respectively, three phenotypes considered to be characteristics of P.aeruginosa chronic CF infections. Thus, only nonsynonymous mutations which are expected to cause partial or complete loss of function in these genes were considered in the analysis . This was followed by mucA, which showed mutations in 24 of the 38 isolates (63%), and finally lasR, which was mutated in 15 isolates (39%). Taken together, these results and the data from the MRS gene mutational inactivation (42%) confirm that the occurrence of mutations in all the analyzed genes was highly prevalent among Argentinean CF patients.As shown in mucA, lasR, mexZ, and mutS/mutL, which were particular to each gene  with the rest of the mutations consisting of different kinds of transitions (25%) and transversions (8.3%) , with a 2\u22361 ratio for transitions (57%) over transversions (29%) , of which there was a high prevalence of large deletions (>4 bp) (50%) respect to small deletions (1\u20134 bp) (15%), followed by transitions (20%) and transversions (15%)  . Notablys (8.3%) , indicatns (29%) , which mns (29%) . In conteletions . mexZ, ons (15%) . Howeverp codons . As menttivation , includitivation .mucA, lasR, mexZ and MRS, indicating that each gene has a particular way of being mutated. Taken together, these observations suggest that different mechanisms of mutagenesis are responsible for the loss-of-function mutations in the analyzed genes.By comparing the mutational spectra obtained in the Argentinean isolates with those reported in other studies P. aeruginosa chronic lung infection, it has been proposed that the proliferation of the hypermutators in the population infecting an individual patient may be sustained by their association (hitchhike) with mutations adaptive to growth in the lung in vitro that the MRS loss-of-function was a key determinant in targeting mucA for mucoid conversion and lasR for quorum sensing deficiency Theoretical studies suggest that, under stressful conditions, selective pressure favors hypermutator strains over nonmutator strains mucA, lasR and mexZ genes in the Argentinean CF isolate collection, we analyzed the proportion of mutations that occurred in each gene in the hypermutator and nonmutator isolates. As shown in mexZ and mucA genes was not significantly different to that observed in the nonmutator isolates (P\u200a=\u200a0.17 and P\u200a=\u200a1.00 respectively). In the case of lasR, we saw that among the hypermutators, the number of mutations per isolate was higher (0.56) than nonmutators (0.27), although this difference was not statistically significant (P\u200a=\u200a0.09), indicating that, as in the case of mexZ and mucA, it was not possible to establish an association between the occurrence of mutations in lasR and the hypermutator phenotype. Furthermore, as shown in In order to investigate if an association could be established between hypermutability and the mutations observed in the mucA, lasR and mexZ genes. It was observed that although the hypermutator isolates showed a tendency towards substitutions (53%), which were either transversions or transitions, with nonmutator isolates displaying a higher number of deletions (62%) , there was not a statistically significant difference between hypermutators and nonmutators with respect to the kind of mutations occurring in the analyzed genes. Furthermore, whatever the type of mutations, their distribution among any particular analyzed gene in hypermutators and nonmutators isolates did not show any statistically significant differences  to any of the specific adaptive traits studied.We now investigated if hypermutability could be associated with any particular kind of mutations in ferences . TherefoP. aeruginosa strains isolated from CF patients not only possess a substantially higher antibiotic resistance than nonmutator isolates P. aeruginosa CF isolates, we tested the 38 isolates by measuring the inhibition zone diameters and scoring for RMS within the inhibition zones of five different antimicrobial agents . As shown in P. aeruginosa with detectable levels of ciprofloxacin and ceftazidime resistance was significantly higher than the proportion observed in non-mutator strains (P\u200a=\u200a0.02 and P\u200a=\u200a0.02 respectively), indicating that in the Argentinean CF population, hypermutability correlated with ciprofloxacin and ceftazidime resistance. In fact, 62.5% of the hypermutators were ciprofloxacin resistant compared to a proportion of 22.7% found among nonmutators. Although a smaller proportion of hypermutators (25%) were ceftazidime resistant, all nonmutator strains were susceptible to this antibiotic . Nevertheless, it is important to point out that only one isolate (isolate 19a) that was a hypermutator showed resistance to all the antibiotics tested  (By quantifying the emergence of the resistant mutant subpopulation (RMS) P<0.001) . These oFinally, it is important to remark that in the Argentinean population, the disk diffusion tests showed similar results for the child/teenage and the adult groups of CF patients.P. aeruginosa isolated from sputa of CF patients mexZ inactivation is involved in the development of stable aminoglycoside resistance among CF strains of P. aeruginosalasR, which was not sufficient to alter the MIC, but resulted in a greater production of spontaneous resistant colonies lasR loss-of-function mutations confered resistance to ciprofloxacin and tobramycin when oxygen was limited and there was increased nitrate utilization mucA, lasR or mexZ could be associated with an altered antibiotic resistance in our collection. As shown in mucA, lasR or mexZ. Moreover, scoring for RMS within the inhibition zones of the five antimicrobial agents tested showed that the presence of resistant mutants was not a phenomenon related to the inactivation of any of these three regulators, not even when the lasR mutants were tested for \u03b2-lactam antibiotics (not shown).Previous studies have reported an enhanced resistance to antibiotics for mucoid strains of P. aeruginosa establishes chronically in the CF airways by a diversification process that allows fine tuning-adaptation and long-term survival within the host. Since this process is mainly mutagenic P. aeruginosa acquires these mutations may help to identify the functions required for bacterial persistence.P. aeruginosa to the CF lung, due to their being the most mutated among CF patients mucA, lasR and mexZ genes as well those implicated in the inactivation of MRS, mutS and mutL, were analyzed in a collection of P. aeruginosa isolates obtained from Argentinean CF patients, with this constituting the first study of this nature in Latin America. According to our results, mutations in the first three genes were highly prevalent in the Argentinean population, with mexZ being the most frequently mutated followed by mucA and lasR , our analysis was focused on strong MRS deficient hypermutators, not considering weak mutators  which can also be found among the CF P. aeruginosa isolates In this study, we carried out a survey and a molecular characterization of the mutations that occurred in the genes which had been previously described as important determinants for the adaptation of and lasR . In addiand lasR , in agreary role . It is wP. aeruginosa in the airways of CF patients is a consequence of their second-order selection with other adaptive mutations, since a higher mutation rate would increase their probability to be acquired lasR quorum sensing-deficient phenotype mexZmucA/lasR/mexZ, may confer a level of antibiotic resistance detectable by disk diffusion, which is the methodology used in this study.It is proposed that the high prevalence of stable hypermutator strains of in vitro that MRS-deficiency accelerates the acquisition of mucAlasRin vivo. In line with this, Waine et alP. aeruginosa isolates obtained from CF patients. However, in the present study, by scoring for mutations in hypermutator and nonmutator CF isolates of our collection, no association could be established between hypermutability and mutagenesis, not only for mucA but also for the lasR and mexZ mutations. A possible explanation for this discrepancy is that in Waine et al., the phenomenon was not characterized at the genetic level, and that the reversion phenomenon of the mucoid to a nonmucoid phenotype, which is highly frequent in isolates recovered from CF patients mucA, indicating that they had previously been mucoid before reverting to the phenotype. Furthermore, contrary to our isolates which were clonally different, almost half of the isolates in Waine et al. corresponded to epidemic clones, a feature that increases dissimilarities among collections.In a previous recent work, we determined mucA, lasR and mexZ genes of hypermutator and nonmutator isolates. However and most interestingly, these mutational spectra vary in a gene dependant manner, with mucA being dominated by small deletions (1 bp), lasR by base substitutions and mexZ by large deletions (>4 bp). This observation is intriguing, since it suggests the involvement of different mechanisms of mutagenesis, possibly operating simultaneously, during the process of CF chronic infection. mucA and lasR, but not mexZ mutational spectra coincide well not only with the spectrum generated by a MRS deficiency P. aeruginosa to this environment. Consistent with this hypothesis, we have recently shown that Pol IV activity is an essential ingredient to establish mucA as the main target for mutagenesis in mucoid conversion, with this factor having a prominent role in the generation of -1 deletion in a monomeric simple sequence repeats of five Gs (G5-SSR426) one of the most prevalent mutations among CF mucoid isolates 5SSR426 by site directed mutagenesis not only significantly reduces the mutation frequency in mucA, but also makes mucA to be no longer the major pathway for mucoid conversion mucA and lasR mutations was also found lasR-deficient isolates occur prior to the appearance of hypermutator strains, which had previously been shown to accumulate at later stages of the infection mucA, lasR and mexZ arise by different mechanisms in each gene, with these being independent of MRS-deficiency. However, further research is required to achieve a better understanding of the complex and variable mutagenic strategies used by P. aeruginosa to continuously adapt to the environment of the CF lung.It has been recently shown that hypermutator strains accelerate the mutagenic genetic adaptation thus enhancing the accumulation of new mutations P. aeruginosa isolates, representing different colony morphotypes , were collected from sputum samples of 26 Argentinean CF patients with chronic P. aeruginosa lung infection (with at least four years of continuous isolation of P. aeruginosa). These patients were either children/teenagers or adults, who had been treated at two local Hospitals: Hospital de Ni\u00f1os Sant\u00edsima Trinidad (C\u00f3rdoba city)  or Hospital Alem\u00e1n (Buenos Aires city) . The P. aeruginosa reference strain PAO1 and hypermutable strains MPAOMS and MPAOML were used as controls  and Hospital Alem\u00e1n (Buenos Aires), Argentina, as byproducts of the routine established for bacterial typing and antimicrobial susceptibility testing. In this sense, sputa sampling was not performed with the aim to fulfill the study described in this work, and isolates recovered from these sputa were just a derivative of the habitual CF patient therapeutic controls. Thus, we obtained a collection of 38 P.aeruginosa isolates which was characterized in this work. It is important to clarify that bacterial isolates were processed anonymously, there was no contact with the patients or access to medical records, and that the therapeutic treatments of the patients were not modified in any case as a consequence of the results obtained in this study. The research protocols followed in this study were approved and reviewed by the Institutional Review Board of the Biological Chemistry Research Center of C\u00f3rdoba , which waived the need for a written consent from the patients involved.The SpeI enzyme as described elsewhere et al.All isolates were genotyped by PFGE using the P. aeruginosa CF isolates, we performed the quantification of rifampin-resistant mutant frequencies which is considered to be proportional to the estimation of mutation frequencies. Mutation frequencies were determined as previously described P. aeruginosa isolate were cultured in LB medium at 37\u00b0C for 24 h with shaking performed at 225 r.p.m. Appropriate dilutions of the cultures were plated on LB agar plates to determine the total number of viable cells, or on LB agar supplemented with 100 \u00b5g ml\u22121 rifampin to count the number of rifampin-resistant cells, following incubation overnight at 37\u00b0C. Then, the mutation frequency was determined as the ratio of the number of rifampin\u2013resistant cells and the number of viable cells. Strains were considered hypermutators when their mutation frequencies were \u22652\u00d710\u22127, which corresponds to a mutation frequency approximately 20 fold higher than that obtained from the reference P. aeruginosa PAO1 strain (2.4\u00b11.3\u00d710\u22128) and which has been shown to score for strong MRS-deficient mutators Mutation rates determined via fluctuation analysis can provide good estimations of mutagenesis mucA, lasR, mexZ, mutS and mutL genes are shown in mucA, mexZ, mutS and mutL) or at 50\u00b0C (lasR) 2 min at 72\u00b0C, and a final extension of 10 min at 72\u00b0C. The PCR products were cleaned with a Gel Purification kit (QIAGEN) and both strands were directly sequenced by using their respective PCR primers . To score for mutations within the genes, the sequencing results were compared with the corresponding gene sequences of the PAO1 strain (www.pseudomonas.com) by using the BLAST program of the NCBI database (www.ncbi.nlm.nih.gov/blast/).Primers for PCR amplification and DNA sequencing of mucA, lasR and mexZ included only nonsynonymous mutations, which are expected to cause partial or complete loss of function in the genes by generation of premature stop codons, shifts of reading frames or deletions/insertions in the coding sequence. To predict the effect of nonsynonymous (missense) mutations on protein function, the SIFT software was P<0.05.The analyses of the linkage between hypermutability and mutations observed in P. aeruginosa wild-type mutS and mutL genes  agar plates by using conventional disks (Rosco). Approximately 0.5 McFarland standard suspensions were used for the inocula standardization of each isolate, and the diameters of the inhibition zones were measured after 24 h and 48 h of incubation at 37\u00b0C. The relative number  of resistant mutant subpopulations growing within the inhibition zones was determined for each antibiotic after 48 h of incubation at 37\u00b0C, as described previously P. aeruginosa PAO1 strain and the hypermutable MPAOMS and MPAOML strains (The inhibition-zone diameters of the thirty eight  strains  were useAntibiotic multiresistance was defined as resistance to at least three antibiotics.P value of >0.05 as significant.Statistical analyses were performed using Fisher's exact test, considering a"}
{"text": "Aconitum alkaloid in Radix Aconiti Lateralis Preparata  with potent pharmacological activities, such as analgesia and anti-inflammation. The present study developed a simple and reliable method using BMA as a marker compound for the quality control of processed aconite roots and their products.Benzoylmesaconine (BMA) is the main 18 column by gradient elution with acetonitrile and aqueous phase, containing 0.1% phosphoric acid adjusted with triethylamine to pH 3.0.After extraction, a high-performance liquid chromatography (HPLC) determination of BMA was conducted on a RP-CA distinct peak profile was obtained and separation of BMA was achieved. Method validation showed that the relative standard deviations (RSDs) of the precision of BMA in all intra-day and inter-day assays were less than 1.36%, and that the average recovery rate was 96.95%. Quantitative analysis of BMA showed that the content of BMA varied significantly in processed aconite roots and their products.This HPLC method using BMA as a marker compound is applicable to the quality control of processed aconite roots and their products. Aconitum are widely distributed across Asia and North America. For over two thousand years, Radix Aconiti Lateralis Preparata  has been used in China to relieve joint pain and treat rheumatic diseases [Aconitum alkaloids including aconitine, mesaconitine and hypaconitine. For example, before used in proprietary herbal products, the toxicity of these alkaloids can be lowered by hydrolysis into much less poisonous benzoylaconines which are the products of deacetylation of the 8\u03b2-acetoxyl [Aconitum alkaloids [per oral) significantly increased the pain threshold in rats. Its analgesic potency was as potent as that of aconite roots at 1000 mg/kg  [Plants of the genus diseases . Studiesdiseases ,3. Proceacetoxyl . Previoulkaloids . By complkaloids . It was er oral) . Recentler oral) , antinocer oral) . Due to 18 column when its percentage was over 10% [18 column was required to stand such an alkaline buffer (pH > 8) [The present study developed a suitable analytical method for identification and quantification of BMA to simplify the quality control procedures. Several HPLC methods have been reported , none of(pH > 8) ,11. At t(pH > 8) -14. In tNine batches of the processed aconite roots were purchased from herbal medicine markets in Sichuan, Shanxi and Guangdong provinces in China Table .Guifulizhong Wan , Sanqisangyao Capsule , Haimabushen Wan , and Jinguishenqi Wan . The main indications of these products are muscular disorders, joint pain and arthritis. Qingfuguanjieshu Capsule (QC), a new antiarthritic herbal preparation being developed in our research group [The Chinese proprietary products containing processed aconite roots used in this study included ch group ,16, was Acetonitrile was of HPLC grade . Twenty-eight per cent (28%) ammonia solution , 95% ethanol , chloroform , ethyl acetate, triethylamine, 85% phosphoric acid, diethyl ether anhydrous  and hydrochloric acid  were of guaranteed reagent grade. Deionized water was prepared using a Millipore water purification system .1H-NMR and MS) [The reference standard for BMA was prepared from mesaconitine  which was heated at 100\u00b0C in dioxane-water (1:1) for 6 hours and purified by column chromatography and crystallization ,11. The  and MS) .An Agilent 1100 series LC system  was used in the study, which consisted of a G1311A quaternary pump, a G1322A degasser, a G1315A diode-array detector and a G1313A autosampler.18  was used as the stationary phase companied by Alltima RP-C18 guard column (ID 7.5 \u00d7 4.6 mm). Elution of the alkaloids was carried out using a gradient of acetonitrile (A) and buffer solution  at a flow-rate of 1.0 ml/min. The gradient elution of the mobile phase was 13\u201318 % A in 0\u201320 min, 18\u201321 % A in 20\u201340 min, 21\u201322 % A in 40\u201345 min and 22\u201370 % A in 45\u201350 min. Detection was carried out at 240 nm with a reference wavelength of 550 nm at room temperature. The injection volume was 20 \u03bcl for all HPLC runs.Alltima RP-CProcessed aconite roots were pulverized into powder, passed through a 0.45 mm sieve, and stored in a desiccator. The powder (1.5 g) was extracted with 50% ethanol three times  by sonication  at room temperature, and then vortexed for 2 min respectively. The mixture was centrifuged for 10 min at 3000 rpm . The supernatants were combined and transferred to a 10.0 ml volumetric flask, with 50% ethanol making up the volume.Powdered pills or contents of capsules of the proprietary products (approximately 1.0 g) were accurately weighed. Each sample was dissolved in 10 ml of HCl solution (0.05 M) by sonication for 60 min, and extracted with ethyl acetate three times (10 ml each time). The acidic aqueous solution was separated and basified with 600 \u03bcl of 28% ammonia solution and further extracted with 10 ml of mixed solvents of diethyl ether and ethyl acetate (1:1) three times by vortexing for 2 min. The resulting mixtures were centrifuged at 3000 rpm  for 5 min and the combined supernatants were evaporated to dryness under air stream. The residue was dissolved in 1.0 ml of HCl solution (0.01 M) by sonication for 1 min.BMA was accurately weighed and dissolved in HCl solution (0.01 M) to produce a stock standard solution at a final concentration of 0.4084 mg/ml. This stock solution was used to prepare standard solutions for method validation and calibration curves. The standard solutions were stored at 4\u00b0C and remained stable for at least one month. Calibration curves were established at seven concentration (\u03bcg/ml) points of 4.08, 10.21, 20.42, 40.84, 81.68, 122.52 and 204.20 respectively. For recovery test, a standard solution was prepared at a concentration of 12.25 \u03bcg/ml.Expressed as relative standard deviations (RSDs), precision was evaluated by HPLC runs with standard solutions at three concentrations under the optimal condition five times in one day for intra-day variation test and twice a day on three consecutive days for inter-day variation test.Six aliquots of QC were conducted for repeatability test. The processing of the aliquots followed the same method described in the section of preparation of sample solutions. The RSDs of the six aliquots were calculated for evaluation of repeatability.HCl solution  was added to accurately weighted QC (approximately 0.1 g) in which the content of BMA was known. The sample solution was spiked with 1000 \u03bcl of the standard solution of BMA for recovery test. The processing of the prepared samples (n = 6) followed the method described in the section of preparation of sample solutions.Data analysis, including calculation of standard deviation (SD) and linear regression, was conducted using Excel 2003 . P values less than 0.05 were considered as statistically significant.The use of phosphoric acid (0.1 %) with triethylamine as the mobile phase produced better symmetry of the peak in the chromatogram. A gradient elution program was developed to isolate BMA and to determine the content of BMA in the proprietary products. Figure By adjusting the triethylamine content to obtain the pH values from 2.3 to 5.6, we investigated the pH dependence of the retention time. The results show BMA retention time remained relatively stable in the range of 42\u201344 min as pH value increased  were evaluated for their efficiency in extracting BMA from processed aconite roots. Since BMA is an alkaloid, an acidic extraction solvent (0.01 M HCl) was also tested. The results show that the extraction efficiency of these solvents was in the following order: 50 % ethanol > 25% ethanol > 0.01 M HCl > 75 % ethanol > 95 % ethanol. For highest efficiency, 50 % ethanol was selected for extracting BMA in processed aconite roots in the present study  by sonication for 60 min, which were subsequently extracted with ethyl acetate for three times (10 ml each time). The acidic aqueous solutions were then basified with 600 \u03bcl of 28 % ammonia solution and further extracted with 10 ml of mixed solvents of diethyl ether and ethyl acetate (1:1) for three times. The recovery rate of BMA was 90.64% (SD 0.58%) when diethyl ether was the extraction solvent. The recovery rate was nearly perfect when ethyl acetate was the extraction solvent; however, there was a small interference peak at the retention time of 43 min. Thus, a mixed solvent of diethyl ether and ethyl acetate (1:1) was used, whereby the recovery rate was 96.95% (SD 1.01%) and no interference peak was observed.The BMA peaks in processed aconite roots and in their proprietary products were identified through comparison of the retention times and UV spectra with those of the reference standards. Peak purity was confirmed by data from a photodiode array detector (DAD). Furthermore, a comparative study was carried out with QC samples and QC without processed aconite roots (negative control). There is no peak corresponding to BMA in the chromatogram of the negative control Figure .2). The following equation was obtained: Y = 18.518X + 5.651 .The linearity of the BMA concentrations (\u03bcg/ml) versus peak areas was investigated in the range of 4.08\u2013204.20 \u03bcg/ml; the result is expressed as the value of the coefficient of determination  at least three times larger than noise (N), was determined to be 8 ng for BMA with an injection volume of 20 \u03bcl.The precision of the intra-day (five times per day) and inter-day (twice a day for three consecutive days) data was indicated by RSDs which were less than 1.36% for BMA at three concentrations (Table The RSDs of the repeatability test were less than 0.29% for BMA at 132.8 \u03bcg/g (SD 0.4 \u03bcg/g) in the QC samples (n = 6). The average recovery rate obtained was 96.95% (SD 1.01%) with RSDs of 0.01% (n = 6). This chromatographic system is suitable for quantitative determination of BMA in processed aconite roots and their proprietary products.The content of BMA in the five proprietary products, and nine batches of processed aconite roots were determined using the established HPLC method described above. The content of BMA Tables  and 4 waSignificant variations in terms of BMA content were found among different batches of processed aconite roots and among different proprietary products Tables  and 4. DAs herbal products containing processed aconite roots are increasingly used for anti-inflammation and analgesia, simple and reliable methods for quality control of these products are urgently needed. It was reported that BMA was effective in anti-inflammation and analgesia in animals ,6. Thus,In the present study, extraction method was optimized. Results from the recovery test show that the use of two solvents is better than that of a single solvent in preparing samples of proprietary products.Aconitum alkaloids using a reversed phase C18 HPLC column, tailing peaks are usually caused by the retention effects of free silanol groupings. Instead of using THF as an organic solvent or basic buffer in the mobile phase, we used triethylamine to improve separation and peak shapes. Moreover, this HPLC method should be easily repeated in other labs. The present study also indicates that the retention volumes of BMA remained relatively unchanged over an acidic pH region (Figure In the analysis of n Figure .Method validation data indicate that the developed HPLC method as described in this paper is reliable, reproducible and accurate for the determination of BMA in processed aconite roots and their products. The results also show that the content of BMA varied significantly in different batches of the processed aconite roots including five proprietary products. This method is suitable for routine assessment of the quality of processed aconite roots and their products.BMA: benzoylmesaconine; DAD: photodiode array detector; GC-MS: gas chromatography-mass spectrometry; HPLC: high-performance liquid chromatography; LC-MS: liquid chromatography-mass spectrometry; RSDs: relative standard deviations; SD: standard deviation; SPE: solid phase extraction; THF: tetrahydrofuranThe authors declare that they have no competing interests.Qingfuguanjieshu Capsule and helped with data acquisition, HX contributed to the design of the study, LL, the principal investigator of the project, contributed to the conception and design of the study, revised and finalized the manuscript. All authors read and approved the final version of the manuscript.YX contributed to the conception and design of the study, carried out the experimental work, and drafted the manuscript, ZJ contributed to the design of the study and helped revise the manuscript, HZ participated in the design of the study and performed statistical analysis, YW and ZL participated in the experimental work of"}
{"text": "To the Editor: New Delhi metallo-\u03b2-lactamase 1 (NDM-1) and OXA-48-group \u03b2-lactamase have been increasingly reported as carbapenemases responsible for carbapenem resistance in Enterobacteriaceae worldwide (Klebsiella pneumoniae carbapenemase (KPC)\u2013type \u03b2-lactamase is the most common carbapenemase among Enterobacteriaceae, especially K. pneumoniae. Isolates producing NDM-1 were first reported in the United States in 2010 . She was readmitted to the same hospital because of fever in March 2013.K. pneumoniae and extended-spectrum \u03b2-lactamase\u2013producing E. coli. Although production of KPC-type \u03b2-lactamase was initially suspected in K. pneumoniae, the unusually high level of resistance to amikacin (MIC >32 \u03bcg/mL) and gentamicin (MIC >8 \u03bcg/mL) increased concern for presence of an NDM-1 producer, which is frequently highly resistant to aminoglycosides because of production of 16S rRNA methyltransferase (A urine culture collected at the time of readmission grew carbapenem-resistant K. pneumoniae isolates from India (armA) was also confirmed by PCR and sequencing and accounted for the high-level aminoglycoside resistance. The isolate belonged to sequence type (ST) 14, as determined by multilocus sequence typing, and has been reported to be common among NDM-1\u2013producing K. pneumoniae in Europe , and dedicated personnel monitored compliance with these measures around the clock.Enterobacteriaceae by using rectal swab specimens was conducted for all inpatients at the acute-care hospital and for all residents of the unit at LTCF 2. Testing did not identify any other patients colonized with NDM-1\u2013producing Enterobacteriaceae.The patient was eventually discharged to another long-term care facility (LTCF 2) in April 2013. A point surveillance testing for NDM-1\u2013producing K. pneumoniae, but those carrying the NDM-1 gene could not be obtained by either method, suggesting that the 2 genes were not located on the same plasmid. For E. coli, transformants and transconjugants carrying the NDM-1 gene were obtained, which indicated that this gene was located on a self-conjugative plasmid.In transformation and conjugation experiments, transformants carrying the OXA-232 gene were obtained from Enterobacteriaceae, in particular K. pneumoniae, poses a diagnostic challenge in regions to which KPC-producing K. pneumoniae is endemic. In our case, recognition of resistance to multiple aminoglycosides by an automated instrument, which was confirmed to be high level by the disk diffusion method , prompted early detection and implementation of appropriate infection prevention measures. Production of 16S rRNA methyltransferase by KPC-producing K. pneumoniae is extremely rare, and no cases have been identified in the United States. Therefore, we propose that high-level resistance to amikacin and gentamicin can serve as a clue for suspecting potential NDM-1\u2013producing isolates in clinical diagnostic laboratories.Detection of NDM-1\u2013 or OXA-48-group\u2013producing Enterobacteriaceae producing OXA-48-group carbapenemase, including variants such as OXA-232, do not have characteristic susceptibility patterns and may easily not be recognized in areas with a high background prevalence of KPC-producing organisms. Therefore, organisms producing OXA-48 or their variants might have already spread in the United States.Conversely,"}
{"text": "The endoplasmic reticulum (ER) is a continuous membrane network in eukaryotic cells comprising the nuclear envelope, the rough ER, and the smooth ER. The ER has multiple critical functions and a characteristic structure. In this study, we identified a new protein of the ER, TMCC1 (transmembrane and coiled-coil domain family 1). The TMCC family consists of at least 3 putative proteins (TMCC1\u20133) that are conserved from nematode to human. We show that TMCC1 is an ER protein that is expressed in diverse human cell lines. TMCC1 contains 2 adjacent transmembrane domains near the C-terminus, in addition to coiled-coil domains. TMCC1 was targeted to the rough ER through the transmembrane domains, whereas the N-terminal region and C-terminal tail of TMCC1 were found to reside in the cytoplasm. Moreover, the cytosolic region of TMCC1 formed homo- or hetero-dimers or oligomers with other TMCC proteins and interacted with ribosomal proteins. Notably, overexpression of TMCC1 or its transmembrane domains caused defects in ER morphology. Our results suggest roles of TMCC1 in ER organization. The functions of the ER, one of the largest organelles in cells, have been studied extensively, including the translocation of proteins across the ER membrane The ER has a characteristic shape that is evolutionarily conserved. Based on membrane curvature, the ER structure can be divided into 2 distinct morphological domains: sheets and tubules First, 2 families of integral membrane proteins have been identified as being responsible for the formation of ER tubules: reticulons and DP1/Yop1p Second, ER sheets assemble through the actions of proteins restricted to ER sheets, such as CLIMP-63, p180, and kinectin. CLIMP-63 is involved in attaching ER membranes and microtubules tmcc1 locus in humans has been reported to be involved in hereditary congenital facial palsy tmcc1 may not be the causative gene Genes encoding putative proteins of the transmembrane and coiled-coil domain (TMCC) family have been found in many organisms. However, the properties and functions of TMCC proteins are unknown. TMCC1, a representative member of the TMCC family, also remains uncharacterized. However, the Caenorhabditis elegans. Sequence alignment of TMCC1 from various organisms showed several conserved regions that share high sequence similarity . Sequence alignment showed that the 3 TMCCs have highly similar protein sequences , and thamilarity . This evTo identify the TMCC1 protein, we generated an anti-TMCC1 antibody in rabbits. An N-terminal fragment, TMCC1(1\u2013200), was chosen as the antigen because this region is unique among TMCC family members in human; the protein fragment was also used to purify the polyclonal antibody against this region of TMCC1. In western-blotting experiments performed on whole cell extracts of HeLa cells, anti-TMCC1 recognized a protein band with a molecular weight similar to the theoretical molecular weight of TMCC1, and this band was not detected by the pre-immune serum . MoreoveNext, we tested for TMCC1 protein expression in several human cell lines. As shown in After identifying TMCC1 as a protein expressed widely in human cells, we examined the subcellular localization of TMCC1. We chose COS-7 cells for immunolabeling experiments because these cells are large. Labeling by anti-TMCC1  showed tOur immunolabeling results indicated that TMCC1 localized to the rough ER. To confirm this, we monitored the localization of TMCC1 transiently transfected into cells: HeLa cells were transfected with a plasmid encoding GFP-TMCC1 and then examined by fluorescence microscopy. When expressed at low levels, GFP-TMCC1 localized throughout the ER, showing an almost identical distribution as calnexin, an integral ER protein that is used widely as an ER marker . The locBecause TMCC1 contains 2 adjacent transmembrane domains at the C-terminus, we investigated whether these domains were responsible for targeting TMCC1 to the ER or if other regions of the protein were also necessary. We transfected HeLa cells with plasmids to express either GFP-TMCC1 lacking the transmembrane domains (aa 1\u2013575) or only the C-terminal transmembrane domains of TMCC1 (aa 571\u2013653), and then stained the cells with calnexin antibody. GFP-TMCC1(1\u2013575) localized in the cytosol and showed no specific pattern of distribution, whereas GFP-TMCC1(571\u2013653) colocalized with calnexin , much liTo confirm the ER localization of TMCC1 further, we isolated ER proteins from cells: HeLa cells were homogenized and ER proteins were purified using discontinuous sucrose-gradient centrifugation . BecauseAfter identifying the C-terminal transmembrane domains of TMCC1 as the potential ER-targeting region of the protein, we sought to examine the topology of the N-terminal region of TMCC1. We transfected TMCC1 with GFP tagged to the N-terminus into COS-7 cells and then immunolabeled these cells. The cells were first fixed with paraformaldehyde and then permeabilized with either digitonin or Triton X-100. Digitonin selectively permeabilizes the plasma membrane and leaves other membranes intact, whereas Triton X-100 permeabilizes cellular membranes non-selectively. The fixed and permeabilized cells were labeled with GFP and calnexin antibodies. Calnexin has a large ER luminal domain and a short cytoplasmic tail. Because the monoclonal calnexin antibody recognizes an epitope present within the ER lumen, and the ER membrane was intact in digitonin-permeabilized cells, calnexin was detected only in cells permeabilized with Triton X-100 . By contTo further confirm the above result, we performed protease protection assays. HeLa cells were incubated with digitonin to permeabilize the plasma membrane, and then treated with trypsin to digest exposed proteins. Under these conditions, the control protein cathepsin D, which is an aspartyl protease present within lysosomes, was not digested by trypsin because it was protected by the lysosomal membrane. By contrast, TMCC1 was digested by trypsin, indicating that the N-terminus of TMCC1 was present in the cytoplasm . Thus, tCoiled-coil domains are known to mediate protein-protein interactions, and several ER proteins containing coiled-coil domains are thought to form oligomers by using these domains Because the coiled-coil domain adjacent to the C-terminus of TMCC1 is highly conserved among TMCC family members and this domain is required for intermolecular interaction between TMCC1 proteins, we tested whether TMCC1 interacts with other TMCC proteins. We transfected HEK293T cells with plasmids encoding GFP-tagged TMCC2 or TMCC3 and then immunoprecipitated endogenous TMCC1. Rabbit IgG was used as the negative control for immunoprecipitation, and GFP-TMCC1(571\u2013653) served as the negative control for the interaction of exogenous proteins with endogenous TMCC1 because this fragment did not interact with full-length TMCC1 . Both GFEscherichia coli. As shown in To understand the functions of TMCC1, we performed mass spectrometry to identify TMCC1-binding proteins. HEK293T cells were transfected with the FLAG-TMCC1 plasmid, and cell lysates were used for anti-FLAG immunoprecipitation. Immunoprecipitated proteins were resolved by SDS-PAGE and stained with Coomassie Brilliant Blue R-250, and protein bands were identified using mass spectrometry. As shown in We have shown that TMCC1 is an evolutionarily conserved protein and have provided first evidence of TMCC1 expression in human cells. Using immunolabeling and ER-isolation experiments, we have demonstrated that TMCC1 is a rough ER protein. The C-terminal transmembrane domains of TMCC1 were shown to target the protein to the ER, and the N-terminal region and C-terminal tail of TMCC1 were shown to face the cytoplasm. Furthermore, we have demonstrated that TMCC1 can interact with TMCC proteins and with ribosomal proteins, and that TMCC1 overexpression deforms the ER. Therefore, we conclude that TMCC1 is a rough ER protein that may regulate ER membrane organization and the attachment of ribosomes to the ER.TMCC1 localization in rough ER was demonstrated by immunolabeling and also by isolating ER proteins. We observed almost identical labeling patterns for GFP-TMCC1 and calnexin by immunostaining. In the magnified immunofluorescence micrographs, the signals of GFP-TMCC1 overlapped with, but were not exactly merged with, those of calnexin . The difBy immunostaining, we found that each transmembrane domain of TMCC1 localized to the ER . We BLASWhen TMCC1 transmembrane domains and full-length protein were transiently transfected into cells and expressed at high levels, the ER structure was deformed. Overexpression of several ER-membrane proteins has been reported to cause similar defects in ER morphology E. coli, this protein stimulates transcription termination in the S10 operon leader Our selective-permeabilization experiments using digitonin showed that the N-terminal region of TMCC1 resides in the cytoplasm and not in the ER lumen. Thus, the long, cytoplasmic N-terminal region of TMCC1 may bind to diverse targets much like other ER proteins In human, TMCC family includes at least 3 members. As shown in In summary, we have characterized TMCC1, a member of the conserved TMCC family, and have shown that TMCC1 is an integral ER-membrane protein. Consistent with these results, the overexpression of TMCC1 or its transmembrane domains perturbed ER organization. However, we did not observe any substantial defect in ER morphology after RNAi-mediated suppression of TMCC1 expression, which may be because of the presence of other TMCC members. We have also identified the association of TMCC1 with ribosomal proteins. Thus, TMCC proteins may help recruit proteins such as those associated with ribosomes to the ER membrane and thereby regulate ER organization.The cDNA clones of human TMCC1 (Accession No.: NM_001017395) and TMCC3 (Accession No.: NM_020698) were purchased from American Type Culture Collection (I.M.A.G.E. Clone ID: 5527623 and 5264859). The cDNA clone of human TMCC2 (Accession No.: NM_014858) was obtained from Kazusa DNA Research Institute, Japan. The coding sequences of the TMCCs were cloned into pEGFP-C1 (Clontech), pEGFP-N3 (Clontech), or pFLAG-CMV2 (Sigma-Aldrich). TMCC1 fragment aa 1\u2013200 was cloned into pET-28a(+) (Novagen). TMCC1 fragments aa 1\u2013200 and 101\u2013350 were cloned into pGEX-4T-3 . TMCC1 fragments aa 1\u2013575, 571\u2013653, 571\u2013615, and 615\u2013653 were cloned into pEGFP-C1. TMCC1 fragments aa 1\u2013575, 1\u2013200, 225\u2013460, 310\u2013575, 571\u2013653, 460\u2013575, and 225\u2013315 were cloned into pFLAG-CMV2.E. coli BL21 (DE3) as a fusion with either a 6xHis or a glutathione S-transferase (GST) tag. The 6xHis and GST fusion proteins were purified using Ni2+-nitrilotriacetic acid resin (Qiagen) and GSH-beads , respectively. The 6xHis-tagged TMCC1 fragment was used to immunize rabbits, and the antibody produced against TMCC1 was purified from rabbit sera using the GST-tagged protein immobilized on nitrocellulose membranes . Mouse monoclonal antibodies against FLAG (M2), \u03b1-tubulin (DM1A), \u03b2-actin (AC-15), and a rabbit polyclonal antibody against FLAG were obtained from Sigma-Aldrich. Normal rabbit IgG, a rabbit polyclonal antibody against GFP (FL), and a goat polyclonal antibody against Sec61\u03b1 (G-20) were from Santa Cruz Biotechnology. A mouse monoclonal antibody against mitochondria (MTC02) was purchased from Abcam, and a goat polyclonal antibody against GST was from Amersham Pharmacia Biotech. A mouse monoclonal antibody against CLIMP-63 (G1/296) was obtained from Alexis, and a mouse monoclonal antibody against RPL4 (4A3) was from Abnova. Mouse monoclonal antibodies against calnexin and BAP31 were kindly provided by Cancer Institute and Hospital, Tianjin, China. A rabbit polyclonal antibody against cathepsin D (Ab-2) was from Calbiochem and a rabbit polyclonal antibody against RPS6 was from Cell Signaling Technology. Secondary antibodies conjugated with Alexa Fluor dyes  were purchased from Invitrogen.To generate antibodies against TMCC1, a fragment of TMCC1, 1\u2013200, was expressed in 2. Plasmids were transfected into HEK293T cells by using Lipofectamine and Plus reagents (Invitrogen). Lipofectamine 2000 (Invitrogen) was used for transfecting plasmids and small interfering RNAs (siRNAs) into HeLa and COS-7 cells. Two siRNA duplexes targeting TMCC1 were synthesized by Shanghai GenePharma: siTMCC1-1, CGAUUGGAAGAACAGCUAA; siTMCC1-2, GCAGACAGAAUCAGAACAA.HEK293T, HeLa, U2OS, and COS-7 cells were cultured in Dulbecco\u2019s Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS). Hep G2, U-937, and HEL cells were cultured in RPMI 1640 Medium supplemented with 10% FBS. SH-SY5Y and U87 cells were cultured in Eagle\u2019s Minimum Essential Medium (EMEM) supplemented with 10% FBS. Caco-2 cells were cultured in EMEM supplemented with 20% FBS. HL-60 cells were cultured in Iscove\u2019s Modified Dulbecco\u2019s Medium supplemented with 20% FBS. A549 cells were cultured in F-12K Medium supplemented with 10% FBS. All cells were obtained from the American Type Culture Collection and grown at 37\u00b0C in a humidified atmosphere with 5% COCells grown on glass coverslips were fixed with cold methanol at -20\u00b0C for 5 min or with 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature for 15 min. After fixation, cells were labeled with primary antibodies and subsequently with Alexa Fluor dye-conjugated secondary antibodies. Nuclei were labeled with Hoechst 33258 (Sigma-Aldrich). Coverslips were mounted with Mowiol  and examined using an inverted fluorescence microscope . To label Sec61\u03b1, COS-7 cells were extracted with 1 mg/mL saponin in PBS for 5 min at room temperature before fixing with methanol.g for 20 min at 4\u00b0C to remove cell debris, nuclei, and mitochondria. The supernatant was then centrifuged at 150,000 \u00d7 g for 30 min at 4\u00b0C in an ultracentrifuge (Beckman Coulter) using a TLA-100.4 rotor to obtain a total microsomal pellet. The pellet was resuspended in ice-cold resuspension buffer  by using a Kontes 18 glass homogenizer. Next, a discontinuous sucrose gradient was prepared in centrifuge tubes with the following solutions layered from top to bottom: 1.2 mL of 0.3 M sucrose, 0.3 mL of 1.15 M sucrose, 0.1 mL of 1.25 M sucrose containing the total microsomes, 0.3 mL of 1.35 M sucrose, and 0.4 mL of 2 M sucrose. The tubes were centrifuged at 180,000 \u00d7 g for 90 min at 4\u00b0C using a TLS-55 swinging-bucket rotor. The material at each interface was diluted to 0.3 M sucrose and collected by centrifugation at 150,000 \u00d7 g for 30 min at 4\u00b0C. These samples were analyzed by western blotting.The protocol for isolating ER was adapted from methods described elsewhere 2) for 5 min at room temperature, and then treated in the absence or presence of 0.25% trypsin for 5 min at 37\u00b0C. Reactions were stopped by adding a protease inhibitor cocktail (Roche Applied Science), and samples were analyzed by western blotting.HeLa cells were incubated with or without 20 \u00b5M digitonin (Sigma-Aldrich) in KHM buffer  and clarified by centrifugation. To immunoprecipitate TMCC1, Protein A Agarose beads (Invitrogen) were pre-incubated with normal rabbit IgG or the TMCC1 antibody at 4\u00b0C, and then incubated with cell lysates. To immunoprecipitate FLAG-tagged proteins, anti-FLAG M2 Agarose beads (Sigma-Aldrich) were added directly to cell lysates and incubated at 4\u00b0C. After incubation, the beads were washed with lysis buffer and boiled in electrophoresis sample buffer. Samples were resolved by SDS-PAGE and analyzed by western blotting.HEK293T cells were lysed on ice using a lysis buffer , and protein bands were excised from the gels, reduced, alkylated, and digested in-gel with trypsin 2, 0.25 M sucrose, and protease inhibitor cocktail) by using a Kontes 7-mL glass homogenizer. The homogenates were centrifuged at 3,000 \u00d7 g for 30 min and then at 14,000 \u00d7 g for 30 min at 4\u00b0C to remove cell debris, nuclei, and mitochondria. The supernatant was then centrifuged at 270,000 \u00d7 g for 1 h at 4\u00b0C in an ultracentrifuge using a TLA-100.4 rotor. The pellet was resuspended in ice-cold buffer B  by vigorously vortexing for 30 min at 4\u00b0C, and then the sample was centrifuged at 14,000 \u00d7 g for 15 min at 4\u00b0C. The supernatant was carefully laid on the top of buffer C  in a centrifuge tube, and then was centrifuged at 270,000 \u00d7 g for 1 h at 4\u00b0C to collect ribosomes. The ribosomes were resuspended in ice-cold buffer D , incubated with GST or GST-TMCC1(101\u2013350) at 4\u00b0C, and then pulled down using GSH-beads. The pull-down samples were analyzed by western blotting.GST and GST-TMCC1(101\u2013350) proteins were purified using GSH-beads. The protocol for ribosome preparation was adapted from methods kindly provided by Dr. Alan M. Lin . HeLa cells were homogenized in ice-cold buffer A ; 24 h post-transfection, cells with low and high levels of exogenous proteins were fixed with methanol and co-stained with FLAG and calnexin antibodies. Scale bar, 10 \u00b5m.(TIF)Click here for additional data file.Figure S2Subcellular localization of TMCC2 and TMCC3. COS-7 cells were transfected with plasmids encoding GFP-tagged TMCC2 or TMCC3; 24 h post-transfection, cells were fixed with methanol and stained with an anti-calnexin antibody. Scale bar, 10 \u00b5m.(TIF)Click here for additional data file."}
{"text": "Extramedullary myeloid tumor (EMMT) is a rare neoplasm of immature myeloid cells that arises at an extramedullary site . The mos9/L. Magnetic resonance imaging (MRI) of the right thigh demonstrated a heterogeneous mass extending towards the distal part in the anterolateral section of the right femoral neck, completely involving the vastus lateralis and intermedius muscles  induction chemotherapy regimen consisting of idarubicin  and cytosine arabinoside . After 4 weeks, the control bone marrow aspiration was completely normal. The lesion had also disappeared completely in the control MRI of the thigh. The patient was administered a high-maintenance dose of ara-C at 3 g/m2 for 6 days for consolidation. Treatment is ongoing.A 47-year-old male patient was admitted to the orthopedics clinic because of swelling and pain in the right thigh for 1 month. His past medical history was unremarkable. Physical examination indicated a 10 cm-long solid soft tissue lesion in the anterior and lateral parts of the right thigh. Complete blood count results were as follows: white blood cell count of 15.1x109/L, hemoglobin level of 11.9 g/dL, and platelet count of 94x10 muscles . The pat muscles . After tEMMTs are composed of myeloid blasts. They can easily be confused with lymphomas or soft tissue sarcomas ,4. EMMTsConsequently, EMMT might be taken into consideration in the differential diagnosis of venous thromboembolism and soft tissue malignancies in the case of swollen thighs.The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included."}
{"text": "V\u02d9O2 kinetics in pediatric populations investigated gender differences in prepubertal children during submaximal intensity exercise, but studies are lacking in adolescents. The purpose of this study was to test the hypothesis that gender differences exist in the V\u02d9O2 and heart rate (HR) kinetic responses to moderate (M) and heavy (H) intensity exercise in adolescents. Twenty\u2010one healthy African\u2010American adolescents  performed constant work load exercise on a cycle ergometer at M and H. The V\u02d9O2 kinetics of the male group was previously analyzed . For both genders, V\u02d9O2 and HR kinetics were described with a single exponential at M and a double exponential at H. The fundamental time constant (\u03c41) of V\u02d9O2 was significantly higher in female than male at M  and H , respectively. The functional gain (G1) was not statistically different between gender at M and statistically higher in females than males at H: 9.7\u00a0\u00b1\u00a01.2 versus 10.9\u00a0\u00b1\u00a01.3\u00a0mL\u00a0min\u22121\u00a0W\u22121, respectively. The amplitude of the slow component was not significantly different between genders. The HR kinetics were significantly  slower in females than males at M  and H . The G1 of HR was higher in females than males at M: 0.53\u00a0\u00b1\u00a00.11 versus 0.98\u00a0\u00b1\u00a00.2\u00a0bpm\u00a0W\u22121 and H: 0.40\u00a0\u00b1\u00a00.11 versus 0.73\u00a0\u00b1\u00a00.23\u00a0bpm\u00a0W\u22121, respectively. Gender differences in the V\u02d9O2 and HR kinetics suggest that oxygen delivery and utilization kinetics of female adolescents differ from those in male adolescents.The majority of the studies on  V\u02d9O2) response to exercise is used to evaluate cardiorespiratory and skeletal muscle function in exercise physiology (Whipp and Wasserman V\u02d9O2 response to constant work rate exercise reflects indirectly muscle oxygen (O2) consumption  and cardiac output kinetics  and body mass with a balance beam scale . Stage of maturation was estimated by self\u2010assessment method proposed by Morris and Udry  and gas exchange threshold (LTGE) via respiratory measurements  and LTGE were used to determine the individual work rates for each of the exercise intensity domains investigated. On the subsequent visits, the subjects performed a series of six square\u2010wave exercise tests; two per day, at selected work rates, which corresponded to: (a) 90% LTGE  and (b) LTGE\u00a0+\u00a025% of \u0394 . Each subject exercised three times at the moderate and heavy intensities. The tests were preceded by a 3\u2010min baseline period and a 3\u2010min warm\u2010up period at 20\u00a0W. At the end of the test, the work rate was abruptly reduced to 20\u00a0W for a 10 min (active recovery period) and followed by an additional 5\u00a0min (passive recovery) while the subjects remained seated quietly on the cycle. The pedaling rate was kept constant at 60\u00a0rpm for all exercise intensity tests. During moderate exercise, subjects exercised for 5\u00a0min at the predetermined work rate. During heavy exercise, subjects were asked to pedal until they had achieved a steady state which was defined as 2\u00a0min of a <5% change in V\u02d9O2 and a <3% change in HR and respiratory exchange ratio.The exercise tests were performed on an electronically braked cycle ergometer  at approximately the same time of day. The subjects were reported to the laboratory on four occasions within a 2\u2010week period. They were instructed to refrain from eating and exercising in the 2 hours prior to their scheduled exercise tests. The experimental procedures were the same of those used to study the male adolescents. In the first experiment, the subjects performed a 20\u00a0W\u00a0minInstructions to begin and end testing were given by voice without warning. \u2018\u2018Steady\u2010state\u2019\u2019 values were calculated by averaging data recorded over the last 30\u00a0sec of exercise. All square\u2010wave tests performed were assigned in a randomized sequence to avoid ordering effects. A break of 60\u201390\u00a0min was enforced between exercise bouts conducted on the same day.2 and CO2 analyzers were calibrated as previously reported , pulmonary oxygen uptake (V\u02d9O2), and carbon dioxide release (V\u02d9CO2)] were continuously monitored. These measurements permitted the determination of the ventilatory equivalents for O2 (VE/V\u02d9O2) and CO2 (V\u02d9E/V\u02d9CO2) as well as the respiratory exchange ratio (V\u02d9CO2/V\u02d9O2). A three\u2010lead electrocardiogram (SensorMedics) was continuously displayed and used to record HR during the test. Systemic systolic/diastolic blood pressure was measured every 3\u00a0min during the maximal exercise test with an automated cuff system .A facemask  was carefully fitted and sealed with a gel  before the exercise and data collection to obviate any gas leaks. The subjects were given several minutes to familiarize themselves with the breathing apparatus in order to minimize unusual breathing patterns. To measure gas exchange, subjects breathed through a mass flow sensor (hot\u2010wire anemometer) connected to a metabolic cart system . Before each exercise test, the volume sensor was calibrated using a 3\u2010L syringe while the OV\u02d9O2and HR kinetics data from individual repetitions of moderate and heavy exercise intensities were processed before the estimates of the parameter values. First, the data values greater than 2 SD from their local mean were omitted from those used for parameter estimation. Second, the responses for each trial were linearly interpolated to obtain a value at each second. Corresponding values on a second\u2010by\u2010second basis were then ensemble averaged to produce a mean dynamic response. Then, averaged values every 5\u00a0sec were calculated and utilized for kinetic analysis. The data obtained during the first 20\u00a0sec were excluded from the analysis  available in Matlab  customized and applied to the mean responses. The following models were used:The Y\u00a0=\u00a0V\u02d9O2 and HR, YBL represents the steady\u2010state values at baseline ; A1 and A2 are the amplitudes of the exponential terms; \u03c41 and \u03c42 are the time constants; and \u03b41 and \u03b42 are the time delays. The Heaviside step function (Abramowitz and Stegun H(t\u2212\u03b41) and H(t\u2212\u03b42) are used to constrain the exponential terms to their corresponding time domains. Subscripts \u2018\u20181\u2019\u2019 and \u2018\u20182\u2019\u2019 denote the fast  and slow components of V\u02d9O2 and HR dynamic response, respectively. From the fundamental and slow\u2010phase amplitudes  and the change in work rate from baseline (\u0394WR), the functional gains of the primary response (G1=A1\u2032/\u03b4WR) and the end\u2010exercise response (GTOT=[A1\u2032+A2\u2032]/\u03b4WR) were calculated. Both models  were used to characterize each dataset obtained at moderate and heavy exercise intensities.Model 1:t1/2, half time) of the V\u02d9O2 and HR kinetics was determined to assess the relationship between V\u02d9O2 and HR responses to moderate and heavy exercise intensities in both adolescent groups.The interval of time to reach half of the amplitude .All data are expressed as means\u00a0\u00b1\u00a0SD. Comparison of estimated kinetic parameters within a group were performed using a mixed model analysis of variance accounting for repeated measures on each subject. Post hoc analysis with a t\u2010test and least significant differences was used to discern differences in the parameters among intensity domains. An F\u2010test was performed to evaluate whether the data were fit significantly better by model 2 than model 1. The square of the correlation coefficient was used to evaluate the goodness of fit for each model. Pearson's correlation was used to assess a linear association between selected variables. For all tests, a V\u02d9O2 and peak of V\u02d9O2 normalized to the body weight of the female group were 59 and 73% of that of the male group, respectively. The WR in female was 64% of that of the male group, whereas the peak of HR (191\u00a0\u00b1\u00a06\u00a0bpm) was similar in both adolescent groups. V\u02d9O2 and WR at the LTGE were significantly higher (P\u00a0<\u00a00.05) in males. In females as compared to males, the\u00a0V\u02d9O2 at the LTGE was 0.89\u00a0\u00b1\u00a00.16 versus 1.56\u00a0\u00b1\u00a00.28\u00a0L\u00a0min\u22121 and occurred at work rates of 73\u00a0\u00b1\u00a014 and 115\u00a0\u00b1\u00a023\u00a0W, respectively.The female group was selected to match the age and body mass index of the male group previously investigated  and reported in Table\u00a0V\u02d9O2 kinetics of the male group were estimated and analyzed in another previous study  increased with increasing exercise intensity in both groups  increased with exercise intensity in both groups  differed significantly among the two exercise intensity domains only for the females but not for the males, moreover, it differed between groups at any intensity. The fundamental time constant (\u03c41) was independent of exercise intensity only for the females. In both groups, a V\u02d9O2 slow component became evident after approximately 2\u20133\u00a0min (\u03b42) of the phase II of exercise responses at H. The mean value of the Phase III time constant of the response (\u03c42) was not different between the two gender . The exhaustion time of the heavy exercise test for females (7.6\u00a0\u00b1\u00a00.6\u00a0min) was similar to that observed in males (7.8\u00a0\u00b1\u00a00.6\u00a0min). The magnitude of the functional gain of the fundamental phase (G1) in males was similar to that measured in females at moderate intensity while was lower than females at heavy exercise intensity. Moreover, there was no gender difference in GTOT at M, whereas it was found lower in males than females at H.In both adolescent groups, the kinetics response at M was well fitted by a monoexponential model , whereas that at H by a double\u2010exponential model  according to the F\u2010test. The mean \u03c41 of V\u02d9O2 and V\u02d9O2,peak for male  and female  adolescents.There was no correlation between the V\u02d9O2 kinetics were characterized by the single\u2010and double\u2010exponential model for M and H, respectively. The HR mean value at the end of the exercise (HRE) increased by 20% with exercise intensity in both groups  of the Phase II of exercise response at H for males and females, respectively. The mean value of the \u03c42 was similar for both gender . In males, the G1 and GTOT were approximately 50% lower than that determined in females at M and H. The GTOT was independent from the exercise intensity for both gender groups.The HR kinetics as for the V\u02d9O2 and HR kinetics, a linear association between \u03c41 of V\u02d9O2 and HR kinetics was investigated in both groups of adolescents  and was not significant at H , whereas in females the correlation between \u03c41 of V\u02d9O2 and HR was not significant at both exercise intensities . The correlation between t1/2 of V\u02d9O2 and HR kinetics was also investigated in both adolescent groups. In males, a significant correlation was observed at M  and H , whereas in females the correlation was not statistically significant at both exercise intensities .To assess the relationship between ts Table\u00a0. In maleV\u02d9O2 kinetics in pediatric populations have investigated age and gender differences in prepubertal children during submaximal high\u2010intensity exercise, but studies are lacking in adolescents. In this study, V\u02d9O2 and HR responses to constant work rate exercise of moderate and heavy intensities were characterized in females and compared to those of African\u2010American male adolescents. The main findings of this study showed gender differences in the V\u02d9O2 and HR kinetic response to moderate and heavy exercise intensity in adolescents: (1) the primary time constant of V\u02d9O2 and HR kinetics in females is lower than that of males; (2) the primary gain of V\u02d9O2 kinetics is independent of exercise intensity for both groups, whereas it is greater in females than males only at heavy exercise intensity while the primary gain of HR kinetics is higher in female than male; (3) there was no gender difference in the slow component of V\u02d9O2 kinetics; and (4) V\u02d9O2 and HR kinetics were significantly correlated only for the male adolescent group.The majority of the studies of V\u02d9O2 kinetics response to moderate and heavy exercise. This result confirms that not only boys   of males was 50% lower than females for both moderate and heavy exercise intensities. As the total gain \u0394V\u02d9O2/\u0394WR in males was only 5\u201312% significantly lower than females, the corresponding \u0394V\u02d9O2/\u0394HR in males was 78 and 61% higher than those in females at moderate and heavy exercise intensities, respectively. The higher total gain of HR of female in comparison to that found in male at both exercise intensity suggest that gender differences exist in the cardiovascular regulation during exercise. This result suggests a difference in stroke volume and/or oxygen extraction between male and female. Previous studies showed that the higher HR during exercise in females than males is related to regulatory mechanisms of the cardiovascular system to compensate the lower stroke volume changes in girls than boys (Armstrong and Welsman Beside the V\u02d9O2 kinetics at moderate was different than that at heavy exercise intensity. For M condition, several studies attributed the V\u02d9O2 kinetic regulation to the bioenergetic processes at cellular level rather than central or peripheral oxygen delivery limitations which appear to be relevant only at H or above (Grassi V\u02d9O2 kinetics in adults reported as indirect evidence of oxygen delivery limitation at H, a slower HR kinetics at H than M (McNarry et\u00a0al. \u03c41 and G1 of V\u02d9O2 were found dependent on exercise intensity. In contrast, our results showed a G1 of V\u02d9O2 independent of exercise intensity in females similarly to the previous finding on male adolescents (Lai et\u00a0al. V\u02d9O2 kinetics supports our results, suggesting that this kinetics are limited by oxygen delivery in adolescents (Marwood et\u00a0al. 1 parameters are linearly related to the work rate from rest to V\u02d9O2peak (Whipp and Wasserman Although gender difference observed on HR kinetics is substantial at both exercise intensity, it cannot be excluded that their effect on e Grassi . A previ1 and \u03c41 between M and H to specific recruitment of type I and II fibers during muscle contraction in adults (Barstow et\u00a0al. V\u02d9O2 kinetics (Breese et\u00a0al. \u03c41 (Pringle et\u00a0al. 1 (Pringle et\u00a0al. V\u02d9O2 kinetics of female in comparison to male adolescents are consistent with a lower percentage of type I muscle fibers in girls than boys as previous reported on a study in adolescents (Glenmark et\u00a0al. 1\u00a0was similar in females and males at M while it was even higher in females than males at H. The relationship between G1 and type I muscle fiber reported in previous studies (Pringle et\u00a0al. 1 is expected to increase with higher amounts of type II muscle fiber as G1 is related to the phosphate cost and P/O2 ratio (Rossiter Several studies attributed the differences observed in GRossiter . NMR stuRossiter  indicateRossiter  confirmeRossiter  in femal1 and \u03c41 observed cannot be explained only by muscle fiber distribution but rather by a combination of factors related to gender differences in biochemical properties, oxygen delivery, and pattern of the recruitment of muscle fiber at moderate and heavy exercise intensity.The slow component observed in female adolescents was consistent with that observed in male adolescent (Lai et\u00a0al. V\u02d9O2 and HR kinetics found in male provides only indirect evidence for impairment of systemic oxygen delivery. Measurement of cardiac output kinetics provides quantitative information to investigate the relationship between oxygen delivery and utilization at the onset of exercise. Nevertheless, cardiac output kinetics are quite close to those observed for HR as the stroke volume varies during the first 10\u201330\u00a0sec of the onset of a constant workload exercise (Miyamoto et\u00a0al. The results of this study should also be interpreted in light of several considerations reported in the following paragraphs. The relationship between V\u02d9O2/WR slope and stroke volume by V\u02d9O2/HR slope in both males and females (Cooper et\u00a0al. V\u02d9O2/HR slope increased with age regardless of the gender and were both higher in boys than girls for all age groups investigated. Under the assumption that females would be more mature than male participants, the gender differences observed in our age\u2010matched study appear to be conservative. The gender differences between boys and girls with similar maturation level are expected to be higher than those observed in our study.The growth and maturation affect the cardiorespiratory response to exercise. In our experimental design, the adolescent groups were age matched without a maturity assessment as suggested by previous investigators (Mirwald et\u00a0al. V\u02d9O2 kinetics study in young women reported that high progesterone and estrogen level during the follicular and luteal phases of the menstrual cycle were not associated with changes in the regulation of V\u02d9O2 kinetics and local muscle oxygen delivery at the onset of moderate exercise (Gurd et\u00a0al. Another potential factor affecting the cardiovascular and respiratory responses of the girls of this study is the hormonal changes during the menstrual cycle which could have contributed to the variability in the physiological responses (Wheatley et\u00a0al. V\u02d9O2 kinetics. Previous studies applied mass balance relationships at steady state to quantify the extent of central and peripheral factors limiting maximal oxygen consumption at whole\u2010body level (Di Prampero and Ferretti Beside the empirical models used to characterize the kinetics of physiological variables and to identify the limitations to the physiological response, biophysical\u2010based mathematical models of the system can be used to describe the processes of oxygen transport and metabolism during exercise and analyze the effect HR kinetic parameters on V\u02d9O2 kinetics at both exercise intensity. Although the primary gain is independent of exercise intensity, female adolescent showed a higher primary gain than male only at high exercise intensity providing evidences in gender differences in the energy cost. The faster HR kinetics in male than female and the association between HR and V\u02d9O2 kinetics in male can in part explain the gender difference observed in V\u02d9O2 kinetics. The HR changes relative to work rate are higher in female than male indicating gender differences in the mechanisms regulating the cardiorespiratory response to exercise.In summary, the dynamic responses to square\u2010wave exercise of moderate and heavy intensity in a group of female adolescents differ from those previously observed in male adolescents. Female adolescents consistently displayed slower"}
{"text": "Protein-protein interface holds important information of protein-protein interactions which play key roles in most biological processes. In the past few years, a lot of efforts have been made to improve interface residue recognition by characterizing protein-protein interfaces and extracting relevant features. However, most previous studies were carried out in a qualitative level, and there are also some inconsistencies between them.In the present work, to improve interface residue recognition, we built a novel quantitative residue protein-protein interface propensity index (QIPI) and gained a comprehensive picture of protein-protein interface through analyzing protein-protein interfaces on our comprehensive protein-protein interfaces dataset . Furthermore, in order to assess the effect of QIPI in improving the protein-protein interface prediction, we developed an interface residue recognition method SPR (Single domain based Patch Recognition) based on the QIPI. The evaluation results proved that our novel QIPI is able to improve the interface residue recognition.Through a comprehensive quantitative analysis of protein-protein interface, we constructed a novel quantitative protein-protein interface propensity index (QIPI), which could be easily applied to improve the interface residue recognition and helpful in understanding the protein-protein interface.http://www.scbit.org/QIPI/.QIPI and SPR are available to non-commercial users at our website: The online version of this article (doi:10.1186/s12918-016-0351-7) contains supplementary material, which is available to authorized users. Protein-protein interactions play crucial roles in many biological functions \u20133. A detIt is indicated that protein-protein interfaces are characterized by several distinguishing properties from the rest of the surfaces in terms of geometric and chemical complementarities between interfaces, ranging from hydrophobic forces, electrostatic forces, surface planarity, interface biased residue composition to inter-residue contacts \u201315. KnowIn this work, we performed a novel analysis of protein-protein interface on our comprehensive protein-protein interfaces dataset . Because the interface and non-interface surfaces have different solvent accessibility, it is not well known whether their difference is due to the differences in solvent accessibility or differences in functionality (such as protein-protein interaction). The bias effect of solvent accessibility should be excluded in the protein-protein interface analysis. We analyzed the interface using non-interface surface as reference to remove the bias effect of solvent accessibility. In a convincing manner, a novel quantitative residue interface propensity index (QIPI) was constructed from our analysis and an interface residue recognition method SPR (Single domain based Patch Recognition) was developed based on the quantitative index to evaluate the interface prediction power of QIPI. The result shows that the QIPI not only characterizes protein-protein interfaces, but also helps to improve the interface residue recognition.Protein complexes were retrieved from the latest version of Structural Classification of Proteins \u2014 extended (SCOPe) database (v2.05) . A previA dataset of protein-protein interfaces , which consists of 4506 interfaces, was thus obtained from the Astral2.05-40 dataset.The Astral2.05-40-4506 was used as the comprehensive interface dataset to analyze characteristics of protein-protein interfaces and develop our interface prediction method. We used the independent dataset Docking Benchmark 2.0  to evaluTwo protein-protein interface datasets were widely used to assess interface residue recognition methods in the previous study. The first dataset consists of 25 CAPRI targets and 176 interfaces. The second dataset Enz35 set consists of 35 protein interfaces  and thes2 is defined as surface residue. Surface residues were classified into two groups: interface and non-interface. The interface is formed by spatially neighboring residues whose ASA between single domain and complex were changed more than 1\u00a0\u00c52 per site and cross-interface contacts distance\u2009<\u20095\u00a0\u00c5. The other surface residues are non-interface [http://www.bioinf.manchester.ac.uk/naccess/). Only surface residues were considered in the analysis and assessment. Similarly, only unbound structures were used for interface prediction.For a single domain, the residue whose accessible surface area (ASA)\u2009>\u20091\u00a0\u00c5nterface , 26, 27.fi be the number of interface residues of type i, and Fi be the number of non-interface surface residues of type i. The frequency of residue i in the interface and non-interface surface were calculated as wi\u2009=\u2009fi/\u2211mfm and Wi\u2009=\u2009Fi/\u2211mFm (m is the residue type), respectively. The relative interface ratio (RIR) of residue type i was given by (wi/Wi). As the similar criteria, we analyzed the frequency and RIR of secondary structure elements in interface. In order to analyze the independent and cooperation effect of residues and secondary structures, we considered 60 classes of residues as defined by 20 residue types multiplied by 3 secondary structure states and analyzed the frequency and RIR of the 60 kinds of residues at interface.Let At for residue type i from the Astral2.05-40-4506. The ASA threshold At was defined that ASA frequency (percentage of residues in the ASA bins) of interface residue type i was very close to the ASA frequency of non-interface surface ones in the At bin was the number of interface residue type i whose ASA\u2009<\u2009At, and fIL(i) was the number of interface residue type i whose ASA\u2009\u2265\u2009At. As the similar definition, the fSS(i) and fSL(i) are generated for the non-interface surface residue type i. The relative interface ratio (RIR) of residue type i in ASA was given by (fIL(i)/fIS(i))/(fSL(i)/fSS(i)).In order to describe the ASA propensities for interface and non-interface surface residues, we got the ASA threshold Cij was the number of interface-crossing contacts between residues of types i and j. The raw contact frequency between residues of types i and j was calculated as . Here, m and n are residue types in the interface-crossing contacts. The contact preference between residue types i and j was calculated as log2/(wi\u2009\u00d7\u2009wj)), where wi and wj were defined as above.Interface size and residue number is calculated separately for each side of an interface. Domain size is also calculated for each domain. The summary of statistic result was shown in histogram and probability density function curve.Based on characteristics of interface especially the QIPI in our analysis, a novel method SPR (Single domain based Patch Recognition) was developed as an interface predictor to assess the effect of interface features founded by us. Therefore, in SPR, we focus on (i) patches generated on the protein surface as virtual interfaces, which is described in the section of patch generation and (ii) the scoring function to evaluate the quality of a virtual interface, which is described in the section of scoring function.Patch generation on the protein surface2.Step I: Identification of surface residues. As in the above analysis, surface residues are defined as accessible surface area (ASA)\u2009>\u20091\u00a0\u00c5Step II: Generation of residue side-chain distance matrix. For a protein sequence, the minimum distance between side-chain atoms of each residue pair (C\u03b1 to C\u03b1 distance in the case of glycine) was calculated as the element of residue side-chain distance matrix. If the minimum distance of a residue pair >25\u00a0\u00c5, the corresponding element in the matrix was 25\u00a0\u00c5.Step III: Construction of candidate interface patches. A random surface residue was selected as the seed residue, and neighboring surface residues whose ASA and distance to the seed residue satisfy the standard in the Table\u00a0Step IV: Merging the candidate interface patches. For candidate interface patches in a protein, two patches were merged into a new patch when the ratio of identity residues between two patches was not less than the threshold Table\u00a0. The merIn the SPR algorithm, the patch generation on the protein surface follows the four steps.The final predicted interface is defined as the top-ranked candidate interface patch measured by the following scoring function for interface-residue recognition.patch for measuring the predicting patch as an interface is a linear combination of four terms: the interface preference potential for residues preference (Eres), hydrophobic score (Ehydro), residue conservation preference (Econs) and solvation score (Esol). That is given as follows:i are to-be-determined weight factors, which are obtained by training on Astral2.05-40 dataset (see below). The Eres and Ehydro are used potentials from the AAindex database [Eres, Ehydro, Econs, and Esol sees below.Eres was calculated as:Residue interface propensity score. We use a scoring function to calculate similarity between patch and interface based on the sum of residue interface propensity which is calculated from QIPI. The score for a given patch, whose residue interface propensity score i is the relative accessible surface area of residue r at sequence position i which belongs to the patch; RIRr and REFr are the relative interface ratio and the reference ASA of residue type r, respectively. The RIRr for 20 amino acid residues are obtained from QIPI. The REFr is the element of JANJ780101 [2.Ehydro is the hydrophobic score of the query patch, which is given below:Hydrophobic score. The term i is the hydrophobic score in the CASG920101 [3.Residue conservation score. Residue conservation was assessed by the self-substitution score based on the sequence profile. Sequence profiles were built by using PSI-BLAST  to searcir is the self-substitution score in the position-specific substitution matrix produced by PSI-BLAST for the residue type r at sequence position i, and Brr is the diagonal element of BLOSUM62 for residue type r.4.Esol was adapted from the one used in Cyscore [Solvation energy score. The  Cyscore , which ii,sphere is defined as the sphere volume in the solvent accessible surface and Vi,out represents the volume out of the solvent accessible surface on residue i in the patch, respectively. The radius of the sphere is set to be 1.2\u00a0\u00c5. The Cyscore is a new empirical scoring function for protein\u2013ligand scoring and outperforms famous methods in the field. A novel curvature-dependent surface-area model of the solvation energy score contributes obviously to improve the prediction power of Cyscore. So we used this term in our interface residue recognition scoring function.The score Edatabase . The AAiNJ780101  in AAindNJ780101  for resiSG920101  matrix oInterface prediction has to satisfy two competing demands, covering as many real interface residues as possible, meanwhile predicting as few false positives as possible. These two demands are evaluated by coverage and accuracy, respectively. For all predictions of interface residues, the numbers of true and false positives are TP and FP, respectively. The number of real interface residues which isn\u2019t identified by the predictor is false negative (FN). Then, the coverage isThe two criteria were used as the performance assessment in our study because a good interface recognition method could identify more real interface residues with less false positives.The parameters used in SPR were trained on the Astral2.05-40-4506 dataset that consists of 4506 interfaces from domains with less than 40% identity to each other. Subsequently, the SPR was trained and optimized with a cost function (F) as follows:The optimization goal was to maximize the cost function F value. This training process could balance the accuracy and coverage to avoid the overfitting of parameters. To evaluate the robustness of the SPR, a 10-fold cross-validation for SPR on Astral2.05-40-4506 dataset was carried out.After training of SPR using the above process, the performance of SPR was tested on two datasets CAPRI25 and Enz35 using accuracy and coverage compared with several popular interface recognition programs , 23.To gain an overall performance of SPR, we further tested it on two independent datasets, CAPRI25 and Enz35, by making comparison with several popular interface prediction programs, Meta-PPISP , con-PPIIn this section, we first show the characteristics of protein interfaces in our analysis and develop a novel quantitative residue interface propensity index (QIPI). Secondly, we explore the contribution of the QIPI to improvement of interface-residue recognition. Finally, we demonstrate the performance of SPR by comparing it with several existing popular interface prediction programs.Each protein surface was divided into two disjoint groups: interface and non-interface. Interface properties including residue composition, secondary structure, solvent accessibility, contact preference and interface size were analyzed using Astral2.05-40-4506.Figure\u00a0relative interface ratio (RIR) of residues by comparing the residue composition of the interfaces with that of the non-interface surfaces. Figure\u00a0We calculate the The secondary structures are represented simply by three states: helix (H), strand (E) and coil(C). Fig.\u00a0Figure\u00a0In summary, the residue composition is a crucial interface feature and the QIPI could be used in improving the interface-residue recognition.relative interface ratio (RIR) of residue type i in ASA was calculated by comparing ASA propensities between interface and non-interface surface residues. The RIR results show that the percentage of interface residues with larger ASA are more than that of non-interface surface ones as the above threshold At. The solvent accessibility features of residues may be used in generating candidate interface patches for interface prediction.In order to analyze solvent accessibility, ASA propensities of interface and non-interface surface residues are compared in Fig.\u00a0Cij/\u2211m,nCmn), where Cij is the number of contacts formed by residues of types i and j. Figure\u00a02/(wi\u2009\u00d7\u2009wj)), where wi and wj are frequencies of residue types i and j, respectively. In Fig.\u00a0In Fig.\u00a0Combined with the RIR of residues and contact preferences, we may conclude that Arg, Phe, Trp and Tyr have the highest interface propensity. The reason is that RIR of these residues >1.2 . As shown in Table\u00a0To evaluate the robustness of SPR, a 10-fold cross-validation was carried out on the training set Astral2.05-40-4506. The average of coverage and accuracy were 0.506\u2009\u00b1\u20090.020 and 0.267\u2009\u00b1\u20090.019 respectively  a large-scale comprehensive interface dataset Astral2.05-40-4506 for analysis; 2) novel quantitative interface propensities using non-interface surface as reference to remove the bias effect of solvent accessibility; 3) a novel quantitative residue interface propensity index (QIPI) and other interface features improving interface residue recognition confirmed by the interface prediction method SPR.Previously, lots of researches revealed that the interfaces have more hydrophobic and aromatic residues but puzzled by the observation that Arg and His also present more frequently at interface , 22, 40.The interface contact preference contacts in our analysis included three types of contacts: Cys\u2013Cys, contacts between residues with opposite charges, and contacts between hydrophobic residues. The fact that Cys\u2013Cys contacts have one of the highest preferences indicates the important role of this type of contacts in protein\u2013protein interactions. These results are consistent with previous reports which claimed that disulfide bonds, salt bridges, and hydrophobic interactions represent the main forces in protein\u2013protein interactions , 41\u201344. 2 and about 86% of interface sizes is in the range of 0-2000\u00a0\u00c52. Our observation is consistent with the interface size distribution reported by previous researches. In these studies, Yan et al. found that the distribution of interface sizes has a peak in the range of 600-800\u00a0\u00c52 (whose average is 1227\u00a0\u00c52) [2 [We analyzed the distributions of interface size, interface number and domain size. As shown in Fig.\u00a01227\u00a0\u00c52)  and Lo C7\u00a0\u00c52) [2 . CompareBased on the above results, we constructed a novel quantitative residue interface propensity index (QIPI) which could be easily applied in the interface residue recognition approach. We concluded that QIPI shows clearly the effective improvement in interface residue recognition especially the coverage but its expense is losing accuracy as shown in Table\u00a0In conclusion, we constructed a novel quantitative residue interface propensity index (QIPI) through building a comprehensive non-redundant protein-protein interface dataset Astral2.05-40-4506 and quantitatively analyzing the protein-protein interface by considering the effect of relative solvent accessibility of interface residues factors distributions. The QIPI with other interface features from our analysis was helpful to explore protein-protein interfaces, and solved some inconsistent observations in previous studies such as interface propensity of Arg and His. Moreover, the QIPI successfully improved the protein-protein interface residue recognition, which was confirmed by the contribution test Table\u00a0, perform"}
{"text": "Environmental factors are determinant for the appearance of autoimmune thyroid diseases (AITD) in susceptible subjects. Increased iodine intake, selenium, and vitamin D deficiency, exposure to radiation, from nuclear fallout or due to medical radiation, are environmental factors increasing AITD. Cigarette smoking is associated with Graves\u2019 disease and Graves\u2019 ophthalmopathy, while it decreases the risk of hypothyroidism and thyroid autoimmunity. Viral infections are important environmental factors in the pathogenesis of AITD, too, particularly human parvovirus B19 (EVB19) and hepatitis C virus. Among the many chemical contaminants, halogenated organochlorines and pesticides variably disrupt thyroid function. Polychlorinated biphenyls and their metabolites and polybrominated diethyl ethers bind to thyroid transport proteins, such as transthyretin, displace thyroxine, and disrupt thyroid function. Among drugs, interferon- and iodine-containing drugs have been associated with AITD. Moreover intestinal dysbiosis causes autoimmune thyroiditis. To reduce the risk to populations and also in each patient, it is necessary to comprehend the association between environmental agents and thyroid dysfunction. Graves\u2019 disease (GD) and Hashimoto\u2019s thyroiditis (HT) are the principal clinical presentations of autoimmune thyroid diseases (AITD), characterized by lymphocytic infiltration of the thyroid parenchyma, and clinically by thyrotoxicosis and hypothyroidism, respectively. AITD lead to an immune attack on the thyroid, whose mechanisms are still unclear. Genetic susceptibility and environmental triggers interact as the principal active part toward the development of the disease.Autoimmune thyroid diseases prevalence is about 5% , 2 whileAutoimmune thyroid diseases commonly affect more frequently females than males, such as in many other autoimmune diseases .This is probably due to differences between male and female immune systems , which aIn females, the immunological changes during pregnancy and their regression in the postpartum period are determinant, even if the predisposition of females to AITD is observed in nulliparous women, too. Microchimerism  is an endogenous factor associated with AITD .Antithyroid antibodies frequency has a peak around 45\u201355\u2009years, and hypothyroidism due to HT is more frequent in advanced age.The HT prevalence and that of ATAs differ among races \u201310.per se  in siblings of AITD patients) . The conAmong genes linked to AITD and/or the presence of ATA , 16, whoEnvironmental factors influence the occurrence of AITD of approximately 20%, as they are associated with the activation of innate immune response and AITD development in susceptible individuals , 18.The prevalence of ATA increased in children and adolescents exposed to radiations about 6\u20138\u2009years after the Chernobyl accident. Thyroid peroxidase antibodies (TPOAb) prevalence was higher in radiation-exposed Belarusian children (6.4 versus 2.4% in not exposed) and in adolescents exposed to radioactive fallout 13\u201315\u2009years after the Chernobyl accident . The radIodine is essential for thyroid function. Constant iodine prophylaxis and increased iodine intake gradually reduce iodine deficiency-related thyroid disorders . In the P\u2009<\u20090.001). Elevated circulating selenium level was associated with reduced odds ratio  of subclinical hypothyroidism , hypothyroidism , AT , and enlarged thyroid   .l-selenomethionine treatment. The authors concluded that the short-term l-selenomethionine supplementation has a restricted impact on the natural course in euthyroid HT.A paper  evaluateThe data about the effect of smoking on ATA (TgAb and TPOAb) and chronic AT , 33 are A meta-analysis reported the association of smoking with HT and postpartum thyroid dysfunction . By contOn the whole, smoking decreases the risk of appearance of TPOAb and TgAb and autoimmune hypothyroidism of approximately 40%; this protective effect disappears few years after cessation. It has been suggested that while activating nicotine receptors on immune cells, the autoimmune profile moves away from Th1 and Th17 responses , 43.The proportion of smoking people was more elevated in patients with severe ophthalmopathy (64.2% in GO and 47.9% in GD versus 30% in control subjects) , 44\u201347. Viruses activate the adaptive and innate immunity and might cause HT. Human T-cell lymphotropic virus-1, herpes simplex virus, rubella, mumps virus, Epstein\u2013Barr virus, enterovirus in HT, retroviruses  in GD have been shown . AcquireP\u2009<\u20090.03), suggesting that acute EVB19 infection could be associated with the appearance of AT , particularly in papillary TC (PTC), leading to hypothesize that EVB19 is implicated in thyroid carcinogenesis . In anotin situ hybridization  . AmiodarAs intestinal dysbiosis occurs, the epithelial barrier fails to function and there is the appearance of intestinal and systemic disorders. The intestinal tract is determinant in metabolizing nutrients, drugs, and hormones, exogenous and endogenous iodothyronines, and micronutrients implicated in thyroid homeostasis. Different autoimmune disorders have a pathogenetic link with dysbiosis, not yet clarified in AITD. It has been hypothesized that intestinal dysbiosis may cause AT. Hyper- and hypothyroidism, frequently in AITD, are associated with bacterial overgrowth in small intestinal or with changes in composition of microbiota .BsmI and TaqI polymorphism) or environmental factors (lack of dietary uptake and sun exposure) (Vitamin D is responsible for anti-inflammatory and immunoregulatory effects . Differexposure) . A studyxposure) , 109.Long-term human studies on the effects of environmental chemicals on thyroid-related outcomes such as growth and development are still lacking. The human exposure scenario with lifelong exposure to a vast mixture of chemicals in low doses and the large physiological variation in thyroid hormone levels between individuals render human studies very difficult. Polychlorinated biphenyls (PCBs) have thyroid-disrupting effects, and it is suggested that also bisphenol A, phthalates, brominated flame retardants, and perfluorinated chemicals show thyroid-disrupting characteristics , 111. PCCadmium (Cd) is considered a category I carcinogen . Cd accumulates in liver, pancreas, kidneys, and also in the thyroid. Cd in blood correlates with concentrations in the thyroid. Cd blood and urine levels are more elevated in women in fertile age, than in men. Mitochondria are the main intracellular targets for Cd. In chronic Cd toxicity, multinodular goiter, thyroglobulin hyposecretion, and parafollicular cell hyperplasia are frequent .Manganese (Mn) is toxic at high levels. Oxidoreductases, transferases, hydrolases, lyases, isomerases, ligases, glutamine synthetase, and Mn superoxide dismutase are Mn-containing enzymes. Mn superoxide dismutase is the main antioxidant enzyme able to neutralize the toxic effects of reactive oxygen species. Environmental or occupational exposure to high levels of Mn causes a neuropathy similar to idiopathic Parkinson\u2019s disease, known as manganism. Dopamine and its metabolites are altered in manganism and Parkinson\u2019s disease, as they are able to inhibit TSH secretion. Dopamine and dopaminergic receptors are involved in neurodevelopment and TSH modulation. This suggests that excessive Mn exposure during gestation is linked to altered neurodevelopmental outcomes, due to a dysregulation of dopaminergic control of TSH on thyroid hormones levels .via the food chain, biocontaminate the residents as documented by high levels in the urines and the scalp hair compared to individuals living in adjacent non-volcanic areas. Trace amounts of metals are essential nutrients but, at higher concentrations, can be toxic for living cells. Metals can behave both as endocrine disruptors, perturbing the hormonal system, and as carcinogens, promoting malignant transformation. Similar to other carcinogens, the transforming effect of heavy metals is higher in developing organisms, such as the fetus (contaminated via the mother), and individuals in early childhood. The metal concentration in tissues has been rarely measured in the thyroid (Thyroid cancer incidence is markedly increased in volcanic areas. In the volcanic area of Mt. Etna in Sicily, a non-anthropogenic pollution with heavy metals has been documented, a consequence of gas, ash, and lava emission. Soil, water, and atmosphere contamination,  thyroid .Although the genetic background accounts for approximately 70% of the risk for developing AITD, environmental triggers have an important role in the AITD development in susceptible individuals. Radiation exposure, and increased iodine intake, selenium, and vitamin D deficiency are environmental factors increasing the AITD risk. GO and GD are associated with cigarette smoke , 118, whFSM, FP, AA, and BS gave substantial contribution in the conception and design of the work, and in writing the paper; gave the final approval of the version to be published; agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. AA and BS revised it critically for important intellectual content.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The behavior of L divided by the stiffness parameter A Monte Carlo study of the mean-square radius of gyration  SpecifiM is not very large [Considering the fact that for (semiflexible) circular DNA, the configurations not only of the trivial knot but also of non-trivial knots are visualized by electron microscopy ,13, and notation ,23), whiN junction points connected by N bonds of length b. Let ith bond vector from the ith point to the Nth bond vector U of the ring has been given in terms of the angle N) between \u03b2 the reciprocal of the product of the Boltzmann constant T [The present MC model and method are the same as those in the previous studies ,8,9\u2014i.e. follows ,10,11, instead of It is seen from Equation  that \u03bb\u22121Equation , we makeN-sided regular polygon of side length b\u2014which is the most stable configuration\u2014and sequentially deform it by the virtual motion introduced by Deutsch [v be the unit vector along the vector distance between a pair of joints randomly chosen under the condition that they not be next to each other. If the ith and jth joints  is the angle between N. An ensemble of U, which we call the mixed ensemble.Then, the adoption of the next trial configuration sampling  on the bFollowing the procedure of Vologodskii et al.  and of tiioannou . Howeveriioannou . Furtherk of the scattering vector are evaluated. The quantity ith junction point, given byN identical isotropic point scatterers at each junction, ith and jth junction points.Now, by the use of the trefoil-knot ensemble, the mean-square radius of gyration N: N with In practice, MC simulations have been carried out for the discrete KP rings of ishimura  has beenN.The ratio  Deguchi  are alsoemselves ,17 usingemselves  of degreN are also plotted against For comparison, the ratio  of Ref.  and thos of Ref. , respectus study . The impFor small .=\u03c02/\u03b2\u03bbL . AdditioIn Equation , and thoEquation  with EquEquation  are plotN.The mean-square radius of gyration Equation  with EquEquation . The val of Ref.  1.2 . Consideis limit ,34, therk of the scattering vector. The function Finally, we give the results for the scattering function Equation  for the =Lk2P(k) . The sol of Ref. . The ploian ring .k being the magnitude of the scattering vector have been evaluated for the KP ring of the trefoil knot by MC simulations. The behavior of L measured in units of the stiffness parameter The mean-square radius of gyration The double-logarithmic plots of M  excluded-volume effects on semiflexible ring polymers. Even for semiflexible polymers, the excluded volume effects become remarkable if ) scheme . In thisprevious ,8,9 studprevious . The str"}
{"text": "In a ferric chloride injury model of the carotid artery, GF C57BL/6J mice had increased occlusion times compared to colonized controls. Interestingly, in late atherosclerosis, HFD-fed GF  \u2212/\u2212Ldlr) mice as germfree (GF) and kept these mice for 16\u2009weeks on an atherogenic high-fat Western diet (HFD) under GF isolator conditions and under conventionally raised specific-pathogen-free conditions (CONV-R). In spite of reduced diversity of the cecal gut microbiome, caused by atherogenic HFD, GF \u2212/\u2212Ldlr mice and CONV-R \u2212/\u2212Ldlr mice exhibited atherosclerotic lesions of comparable sizes in the common carotid artery. In contrast to HFD-fed mice, showing no difference in total cholesterol levels, CONV-R \u2212/\u2212Ldlr mice fed control diet (CD) had significantly reduced total plasma cholesterol, very-low-density lipoprotein (VLDL), and LDL levels compared with GF \u2212/\u2212Ldlr mice. Myeloid cell counts in blood as well as leukocyte adhesion to the vessel wall at the common carotid artery of GF \u2212/\u2212Ldlr mice on HFD were diminished compared to CONV-R \u2212/\u2212Ldlr controls. Plasma cytokine profiling revealed reduced levels of the proinflammatory chemokines CCL7 and CXCL1 in GF \u2212/\u2212Ldlr mice, whereas the T-cell-related interleukin 9 (IL-9) and IL-27 were elevated. In the atherothrombosis model of ultrasound-induced rupture of the common carotid artery plaque, thrombus area was significantly reduced in GF \u2212/\u2212Ldlr mice relative to CONV-R \u2212/\u2212Ldlr mice. Ex vivo, this atherothrombotic phenotype was explained by decreased adhesion-dependent platelet activation and thrombus growth of HFD-fed GF \u2212/\u2212Ldlr mice on type III collagen.Atherosclerotic plaque development depends on chronic inflammation of the arterial wall. A dysbiotic gut microbiota can cause low-grade inflammation, and microbiota composition was linked to cardiovascular disease risk. However, the role of this environmental factor in atherothrombosis remains undefined. To analyze the impact of gut microbiota on atherothrombosis, we rederived low-density lipoprotein receptor-deficient ( Atherosclerosis, a major burden of Western lifestyle-associated diseases, is a chronic inflammatory process of the vessel wall arising at sites of disturbed blood flow. The development of atherosclerotic plaques depends on hypercholesterolemia and has been linked to low-grade inflammation-triggered by innate immune signaling . In addi2\u20136\u2013\u2212/\u2212Apoe) mouse model, lacking the Toll-like receptor (TLR) adaptor protein Myeloid differentiation primary response 88 (MyD88), a reduction in lesion size was noted (Tlr2)-deficient hypercholesterolemic \u2212/\u2212Ldlr mice were shown to have only minimal lesions compared with wild-type (WT) \u2212/\u2212Ldlr controls , did not show an altered lipid profile and had similar levels of aortic cholesterol esters and aortic root plaque size compared to their conventionally raised (CONV-R) controls  or a high-fat Western diet (HFD) for 16\u2009weeks, respectively. Our results demonstrate that the commensal microbiota reduced plasma cholesterol levels in CD-fed \u2212/\u2212Ldlr mice, but not in HFD-fed \u2212/\u2212Ldlr mice. The presence of the microbiota in HFD-fed \u2212/\u2212Ldlr mice did not affect late atherosclerotic lesion size at the carotid artery but increased myeloid blood cell counts and platelet deposition to collagen coatings, associated with increased thrombus growth in the carotid artery following ultrasound-induced plaque rupture.The possible contribution of commensal microbiota to Western diet-induced carotid artery atherosclerosis and plaque thrombogenicity in the \u2212/\u2212Ldlr mice are a well-established model of familial hypercholesterolemia, characterized by 2-fold higher plasma cholesterol levels compared to WT controls on a normal CD  control. Download FIG\u00a0S1, PDF file, 0.03 MB.Sterility controls on the feces from GF Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the \u2212/\u2212Ldlr littermates on CD with mice that at the same age were fed with an atherogenic HFD for 16\u2009weeks. We noted vast changes in diversity between the groups (beta-diversity)  . In CONVecreased . Generalecreased  and D. Fntestine , was signtestine . Collect10.1128/mBio.02298-19.2FIG\u00a0S2FIG\u00a0S2, PDF file, 0.2 MB.Taxon summary on the genus level. Download Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02298-19.7TABLE\u00a0S1Table\u00a0S1, PDF file, 0.03 MB.Differences in microbial taxa between HFD and CD mice. Download Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the \u2212/\u2212Apoe mice  particles. Intriguingly, this microbiota-dependent effect on the plasma cholesterol levels and the lipoprotein profile was abolished when the \u2212/\u2212Ldlr mice were fed atherogenic HFD for 16\u2009weeks  Representative ultrasound B-images of the carotid arteries of HFD mice. (B) Measurement of the wall thickness of the anterior carotid wall from the right (RCC) and left common carotid (LCC) arteries. (C) Cumulative atherosclerotic plaque size of RCC (right) and LCC (left) in B-mode. Mean plus SEM (error bars) are shown for the groups (2 to 5 mice per group). For panels B and C, CONV-R mice are shown by gray bars, and GF animals are shown in white bars. Independent samples were tested by Student Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02298-19.8TABLE\u00a0S22) and relative (%) values for atherosclerotic plaque area at the carotid artery and aortic root (zero-level) of the 40 CONV-R (gray) and GF (white) animals fed for 16 weeks with HFD. Animals are color coded as in Table\u00a0S2, PDF file, 0.04 MB.Absolute  with group assignment and sex as factors and age as covariate. The effect of age was statistically significant  = 7.002, P = 0.0125). However, there was no significant difference between male and female animals  = 0.48, P = 0.493) and between CONV-R and GF mice  = 1.41, P = 0.244) even after adjusting for the effect of age. In conclusion, the age of \u2212/\u2212Ldlr mice influenced relative plaque size, but the GF housing condition had no significant influence on late atherosclerotic lesion size in the carotid artery after 16\u2009weeks of HFD feeding.To investigate whether age significantly impacts atherosclerotic lesion size of the e values  and E. I\u2212/\u2212Ldlr mice on HFD relative to CONV-R controls. Feeding on a HFD for 16\u2009weeks increased white blood cell counts in CONV-R \u2212/\u2212Ldlr mice relative to GF \u2212/\u2212Ldlr mice about 2-fold    and C. I\u2212/\u2212 mice . In cont\u2212/\u2212 mice . In linecontrols . Thus, o3) injury model of the common carotid artery, GF C57BL/6J mice kept on a CD also showed reduced thrombus growth compared to CONV-R C57BL/6J controls, as shown by significantly prolonged occlusion times (846.7\u2009\u00b1\u200954.5\u2009s in GF mice relative to 635.1\u2009\u00b1\u200943.8\u2009s in CONV-R mice)  . Likewisin vivo, we applied an established ultrasound-induced plaque rupture model of the carotid artery plaque, resulting in local collagen exposure -positive surface area coverage on type I and type III collagen compared to the blood of HFD-fed CONV-R \u2212/\u2212Ldlr mice (IIb\u03b23) was decreased on type III collagen in platelets from GF \u2212/\u2212Ldlr mice compared to CONV-R \u2212/\u2212Ldlr mice when fed CD  compared to CONV-R \u2212/\u2212Ldlr mice (12 mice/group). The degree of reduction relative to CONV-R \u2212/\u2212Ldlr mice is indicated in green. The numbers below the panels indicate the following parameters: 1, morphological score; 2, platelet surface area coverage; 3, thrombus contraction score; 4, multilayer score; 5, thrombus surface area coverage; 6, phosphatidylserine exposure; 7, P-selectin expression; 8, integrin \u03b1IIb\u03b23 (GPIIbIIIa) activation. Independent samples were tested by Student t tests. *, P < 0.05. (B and C) End-stage representative images of whole-blood platelet deposits after 3.5 min on collagen type I (B) and collagen type III (C). Download FIG\u00a0S4, PDF file, 0.7 MB.(A) Standardized whole-blood flow chamber analysis for platelet deposition on collagen type I and collagen type III. (A) Subtraction heatmap of control diet (CD)-fed GF Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02298-19.5FIG\u00a0S5\u2212/\u2212Ldlr and CONV-R \u2212/\u2212Ldlr mice on collagen type I and collagen type III. Means \u00b1 SEM are shown for groups. For all the panels, CONV-R animals are shown as black dots, while GF animals are shown as white dots. Download FIG\u00a0S5, PDF file, 0.1 MB.Descriptive statistics on the standardized whole-blood flow chamber analysis for platelet deposition of HFD-fed GF Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02298-19.6FIG\u00a0S6\u2212/\u2212Ldlr and CONV-R \u2212/\u2212Ldlr mice on collagen type I and collagen type III. Means \u00b1 SEM are shown. Independent samples were tested by Student t tests. **, P < 0.01. For all the panels, CONV-R animals are shown as black triangles, while GF animals are shown as white triangles. Download FIG\u00a0S6, PDF file, 0.1 MB.Descriptive statistics on the standardized whole-blood flow chamber analysis for platelet deposition of CD-fed (control diet fed) GF Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the \u2212/\u2212Ldlr mice atherogenic HFD for 16\u2009weeks resulted in a significantly reduced diversity of the cecal gut microbiota compared to feeding mice CD. In accordance with previous reports, this resulted in a decrease of the Bacteroidetes phylum and an increase in Firmicutes in the HFD group compared with littermate controls kept on a CD   , but the\u2212/\u2212Ldlr mice compared with their HFD-fed CONV-R \u2212/\u2212Ldlr counterparts, pointing to a stimulatory effect of the gut microbiota on experimental atherothrombosis. This finding expands on previous work from our laboratory, demonstrating that the presence of commensals promotes arterial thrombus growth in the ligation-injured carotid artery   , 48, a cI (GPVI) \u201351. Sinc\u2212/\u2212Apoe mouse model  (\u2212/\u2212Ldlr mice were rederived as germfree (GF) by aseptic hysterectomy and maintained as a GF mouse colony in sterile flexible film mouse isolator systems. The germfree status of mice was tested weekly by PCR for detection of 16S rDNA and by bacterial culture. All experimental animals were 9- to 29-week-old male or female mice housed in the Translational Animal Research Center (TARC) of the University Medical Center Mainz under specific-pathogen-free  or GF conditions in EU type II cages with two to five cage companions with standard autoclaved lab diet and water ad libitum, 22\u00b0C\u2009\u00b1\u20092\u00b0C room temperature, and a 12-h light/dark cycle. All groups of mice were sex and age matched, and all mice were free of clinical symptoms. All procedures performed on mice were approved by the local committee on legislation on protection of animals .B6.129S7Ldlrtm1Her/J mice (/\u2212 mice)  were pur\u2212/\u2212Ldlr mice were fed 16\u2009weeks with an adjusted calories diet  that had been vacuum packaged, irradiated, and microbial analyzed . Control mice were kept on an autoclaved control diet .http://www.wernerlab.org/software/macqiime)  correction . Linear discriminant analysis (LDA) effect size (LEfSe) was performed using the online tool available at http://huttenhower.sph.harvard.edu/galaxy/.MiSeq 16S amplicon V4-V5 sequence data were analyzed using MacQIIME v1.9.1 (acqiime)  as descracqiime) , 55. BriPlasma samples were subjected to fast-performance liquid chromatography . Different lipoprotein fractions were separated and evaluated based on flowthrough time. Cholesterol levels were quantified using an enzymatic assay  according to the manufacturer\u2019s protocol.Lesion development in the left common carotid artery was quantified by hematoxylin-and-eosin (H&E) staining of 4-\u03bcm longitudinal cryosections.EDTA anticoagulated mouse whole blood was collected from anesthetized mice , by intracardial puncture. Platelet and total and differential white blood cell counts were determined using an automatic cell counter .g, and cell pellets were subsequently stained with different antibody cocktails for analysis by flow cytometry. Flow cytometry was conducted with a FACS Canto II, using FACSDiva software (BD Biosciences). Cell populations were discriminated by the following antibody cocktail: anti-CD45 , anti-CD115 , anti-Gr1 , anti-CD11b , anti-B220 , and anti-CD3 . Cell populations and marker expression were gated using the FlowJo analysis program (Treestar): leukocytes (CD45+), neutrophils (CD45+ CD115-Gr1high), monocytes (CD45+ CD11b+ CD115+), and lymphocytes (CD45+ CD3+ and CD45+ B220+).Whole blood was collected in an EDTA-buffered tube, subjected to red blood cell lysis, and centrifuged for 5 min at 300 \u00d7 Cytokine levels in mouse plasma samples were measured using the ProcartaPlex Multiplex Immunoassay technology from Affymetrix , according to the manufacturer\u2019s protocol.3 platelets/\u03bcl, and 250\u2009\u03bcl of suspension was injected via a jugular vein catheter. Thrombus formation of murine platelets was assessed by high-speed epifluorescence microscopy 10\u2009min after plaque rupture. To characterize leukocyte adhesion and rolling in vivo, leukocytes stained with acridine orange  were imaged.Mice were anesthetized by intraperitoneal injection of a solution of midazolame (5\u2009mg/kg body weight), medetomidine (0.5\u2009mg/kg body weight), and fentanyl (0.05\u2009mg/kg body weight). Citrated whole blood was collected by intracardial puncture. Murine platelets were isolated and labeled with Rhodamin B (20\u2009\u03bcg/ml). The labeled platelet suspension was adjusted to a final concentration of 150\u2009\u00d7\u200910\u2212/\u2212Ldlr mice were fed high-fat diet with 42% from fat for 16\u2009weeks. After the mice were anesthetized by intraperitoneal injection of a solution of midazolame , medetomidine , and fentanyl , a polyethylene catheter  was implanted into the right jugular vein, and the right carotid artery was dissected free from surrounding tissue. The animal was injected intravenously with Rhodamin B-labeled platelets obtained from a donor mouse with the same genetic background, hygiene status, and feeding procedure. A subset of mice were also injected with acridine orange for leukocyte staining.Plaque rupture and measurement of acute thrombus formation were performed as described earlier . Ldlr\u2212/\u22122 filter paper that was soaked with 10% (wt/wt) FeCl3 solution for 3 min laterally to the common carotid artery  , 34. Mea2, 0.42\u2009mM NaH2PO4) containing 1% bovine serum albumin (BSA) and mounted in parallel plate flow chambers.Experiments were performed as described previously  with min\u22121, over the microspot coatings. The platelets were stained by 2\u2009min after perfusion with Tyrode\u2019s HEPES buffer (pH 7.45) , supplemented with fluorescein isothiocyanate (FITC)-labeled rat anti-mouse CD62P monoclonal antibody (MAb) (1:40) , phycoerythrin (PE)-labeled rat anti-mouse JON/A MAb (1:20) , and Alexa Fluor 647 (AF647)-labeled annexin A5 (1:200) . Representative end-stage bright-field microscopic images were taken from each microspot during staining. After 2\u2009min of stasis, remaining labels were washed away by perfusion with label-free Tyrode\u2019s HEPES buffer, after which three representative end-stage fluorescence images were collected per microspot.Blood samples were collected by retro-orbital puncture of mice under isoflurane anesthesia into 40\u2009\u03bcM PPACK, 5 U/ml heparin, and 50 U/ml fragmin  and perfused for 3.5 min, at a wall shear rate of 1,000 sMicroscopic images  were recorded with an EVOS fluorescence microscope , equipped with green fluorescent protein (GFP), red fluorescent protein (RFP), and Cy5 light-emitting diode (LED) cubes, and an Olympus 60\u00d7 oil immersion objective, basically as described previously . RecordeP < 0.05  after correction for multiple comparisons, where required. Subtraction heatmaps were produced by using the R package version 3.2.5 (www.r-project.org).For each flow run, parameter values from individual bright-field and fluorescence images were averaged to obtain one value per parameter per microspot. These values were linearly normalized to a scale from 0 to 10 per individual parameter. Gene effect heatmaps were obtained by subtracting the normalized average values per parameter of GF mice minus CONV-R mice. Differences compared to CONV-R mice were considered statistically significant with t test to compare two groups and analysis of variance (ANOVA) with Tukey post hoc test for more than two groups.Data are presented as means \u00b1 standard errors of the means (SEM). Statistical calculations were performed with GraphPad Prism 5  using the independent samples Student\u2019s https://www.ebi.ac.uk/ena) under the accession numbers ERS2865886 to ERS2865897. The applied commands and the LDA effect size are provided as supplemental material (Sequence files and metadata for all samples used in this study have been deposited in the ENA database (material . Other d10.1128/mBio.02298-19.9TEXT\u00a0S1TEXT S1, DOCX file, 0.1 MB.Commands. Download Copyright \u00a9 2019 Kiouptsi et al.2019Kiouptsi et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the"}
{"text": "Develop a sparse and locally low rank (LLR) regularized reconstruction to accelerate MR fingerprinting (MRF).1/T2 phantom acquisition, and in vivo brain acquisitions in 5 healthy subjects with different undersampling factors. Acceleration was also used in vivo to enable acquisitions with higher in\u2010plane spatial resolution in comparable scan time.Recent works have introduced low rank reconstructions to MRF, based on temporal compression operators learned from the MRF dictionary. In other MR applications, LLR regularization has been introduced to exploit temporal redundancy in local regions of the image. Here, we propose to include spatial sparsity and LLR regularization terms in the MRF reconstruction. This approach, so called SLLR\u2010MRF, further reduces aliasing in the time\u2010point images and enables higher acceleration factors. The proposed approach was evaluated in simulations, TSimulations, phantom, and in vivo results show that low rank MRF reconstructions with high acceleration factors  have residual aliasing artifacts that propagate into the parametric maps. The artifacts are reduced with the proposed SLLR\u2010MRF resulting in considerable improvements in precision, without changes in accuracy. In vivo results show improved parametric maps for the proposed SLLR\u2010MRF, potentially enabling MRF acquisitions with 1 radial spoke per time\u2010point in approximately 2.6 s (~600 time\u2010point images) for 2 \u00d7 2 mm and 9.6 s (1750 time\u2010point images) for 1 \u00d7 1 mm in\u2010plane resolution.The proposed SLLR\u2010MRF reconstruction further improves parametric map quality compared with low rank MRF, enabling shorter scan times and/or increased spatial resolution. Non\u2010Cartesian sampling trajectories are usually used to reduce scan time in MRF, under the premise that residual aliasing artifacts mimic pseudorandom noise in each voxel fingerprint. Nevertheless, if the aliasing is not spatiotemporally incoherent or the aliasing is too severe, these errors may propagate from the time\u2010point images into the parametric maps.MR fingerprinting (MRF)2 mapping, locally low rank (LLR) constraints have been shown to be powerful regularizers.Recent works have focused on developing MRF tailored reconstructions to further improve parametric map quality and/or reduce scan time. Frameworks incorporating compressed sensing,1/T2 phantom acquisitions, and in vivo brain acquisitions in 5 healthy subjects.In this work, we propose to include sparsity and LLR regularization terms in the low rank MRF framework. Spatial sparsity is enforced in the wavelet domain and LLR is enforced in the temporally compressed domain of the low rank approximation. The proposed sparse and LLR regularized MRF (SLLR\u2010MRF) approach was evaluated in simulations, standardized T22.1tN (~1000) time\u2010point MRF images can be temporally compressed to sN (~10) singular images (s < NtN). The MRF reconstruction of sN singular images is faster (less images) and better conditioned (more data per image) than reconstructing individual time\u2010points. As proposed in McGivney et al,D may be used to determine a global low rank approximation of the MRF signals: D=U\u03a3VH. The temporal compression operator Ur follows from a truncation (to the appropriate rank r) of the matrix U. This global low rank constraint may be enforced directly in the encoding operator E=AFCUr, where C are the coil sensitivities,F is the Fourier transform and A is the sampling operator.MRF is designed to lead the magnetization through a continuous transient state evolution. Different tissues experience distinct signal evolutions; however, the magnetization evolutions are correlated in time, according to the underlying sequence parameters. Thus, the sequence of FUr or UrF. F and Ur have been shown to commuteC and Ur can also be shown to commute. Thus, the encoding operator may be re\u2010written as E=AUrFC, which is beneficial because only sN Fourier transforms are needed instead of tN.Ur) has been investigated recently in several works.Ur is a valid projection matrix (as long as the dictionary D accurately characterizes the acquisition and the expected tissues). The global low rank MRF reconstruction may be cast as a linear inverse problemIn McGivney et al,x^ are the singular images, and k are the acquired k\u2010space data. In the formulation above, \ud835\udc99 \u2208 CNsNn, C\u2208CNsNnNc\u00d7NsNn, F\u2208CNsNnNc\u00d7NsNnNc, Ur\u2208CNtNnNc\u00d7NsNnNc, \ud835\udc68 \u2208 CNtNkNc\u00d7NtNnNc,k\u2208CNtNkNc; Nn is the number of pixels, Nc is the number of coils and Nk is the number of k\u2010space points (per time\u2010point). The low rank MRF reconstruction can be solved with the conjugate gradient algorithm.where 2.21\u2010norm.MR images are known to have sparse representations in certain domains. This information can be leveraged to regularize an otherwise ill\u2010posed reconstruction by means of minimization of an largminx\u2211brank(Rbx), where Rb selects an image block around pixel b and reshapes the block into a local Casorati matrix. The solution to this problem is known to be NP\u2010hard, so the nuclear norm is commonly used as a surrogate functional for rank minimization. Thus, the proposed SLLR\u2010MRF reconstruction is given by:Locally low rank regularization\u03bbb controls the strength of sparsity in the singular values of Rbx, \u2016\u00b7\u2016\u2217 denotes the nuclear norm, \u03bbw is the sparsity strength in the compressed spatial domain, W is the wavelet transform (chosen sparsity domain) and \u2016\u00b7\u20161 denotes the l1\u2010norm. The above optimization is solved here using the alternating direction method of multipliers (ADMM).where yielding the corresponding Lagrangian form:\u03bci determines regularization strengths and Ub and v are Lagrangian multipliers. Following the ADMM, a solution is found by iteratively optimizing the above functional with respect to x, then with respect to y, then with respect to z and then followed by updating the dual variables Ub and v. This leads to the following set of sub problems:where j is the iteration number. Equation 5 amounts to a Tikhonov regularized problem, where x can be solved for using efficient methods like the conjugate gradient.ybj+1=SVT\u03bbb/\u03bc1Rbxj+1+Ubj\u03bc1.b, the SVD of Rbxj+1+Ubj\u03bc1 is computed, truncated to the rank determined by \u03bbb/\u03bc1 and stored in the corresponding location in ybj+1. Similarly, the solution to Equation 7 is given by soft thresholding (ST): zj+1=ST\u03bbw/\u03bc2Wxj+1+Vj\u03bc2. Finally, the updates of Ub and v are performed according to Equations 8 and 9. A diagram with the main operations within each ADMM iteration of the proposed SLLR\u2010MRF is shown in Figure \u03bbb\u2016Rbx\u2016\u2217. The singular images are also sparse in the wavelet domain, which is exploited with the term \u03bbw\u2016Wx\u20161.where 2.3The proposed SLLR\u2010MRF was evaluated in simulations, phantom acquisitions, and in vivo brain data acquired on a 1.5T Ingenia MR system  using a 15\u2010element head coil. The study was approved by the institutional review board, and written informed consent was obtained from all subjects according to institutional guidelines.2.41, T2, and M0 values. The simulation featured an acquisition similar to the one used in Jiang et al,9) were used. White Gaussian noise was added to the time\u2010point images with a standard deviation such that the signal\u2010to\u2010noise ratio (SNR) in the first time\u2010point image was approximately 20. The simulated k\u2010space was uniformly undersampled in time by keeping (1:n:1750) k\u2010space lines. Different simulated acquisition lengths were tested, with n = , resulting in accelerated series with tN =  time\u2010points, respectively. Each series was reconstructed with both the low rank MRF approximation and the proposed SLLR\u2010MRF. To investigate the performance of sparsity and LLR constraints separately, each series was additionally reconstructed using only the sparse regularization (S\u2010MRF) and LLR regularization (LLR\u2010MRF). The normalized root mean square error (NRMSE) was measured on the reconstructed parametric maps with a mask excluding the cerebrospinal fluid (CSF), skull, and scalp of the digital phantom.SLLR\u2010MRF was studied in a digital phantom based on in vivo brain data with realistic T2.51/T2 phantom2, field of view = 320 \u00d7 320 mm2, 10 mm slice thickness, total scan time = 7.5 s. For both the phantom and in vivo acquisitions, the acquired k\u2010space data were retrospectively undersampled in time (as previously described for the simulations) resulting in accelerated series with tN =  time\u2010points.2D MRF acquisitions were performed on a standardized T2 in\u2010plane resolution, 1750 time\u2010points) a second MRF acquisition was performed on the healthy subjects. High in\u2010plane spatial resolution data were acquired with the same parameters as in the previous in vivo experiment, except for TE/TR = 1.73 / 5.5 ms, in\u2010plane spatial resolution = 1 \u00d7 1 mm2, total scan time = 9.6 s.To investigate the use of SLLR\u2010MRF to enable higher in\u2010plane spatial resolution in comparable scan time than current reference . The SLLR\u2010MRF reconstruction used the following parameters in simulations: rank r = 10, block size = 7, \u03bbb = 0.03Sb1, \u03bbw= 0.01, \u03bc1 = \u03bc2 = 0.0005, ADMM iterations = 20, conjugate gradient iterations = 5. Phantom data were reconstructed with the same parameters, except \u03bbb = 0.05Sb1, \u03bc1 = 0.01, \u03bbw=\u03bc2=0 . In vivo data at 2 \u00d7 2 mm2 and 1 \u00d7 1 mm2 resolutions used the following parameters, respectively: block size = 7 and 17, \u03bbb = 0.05Sb1 and 0.04Sb1, \u03bbw= 0.02 in both cases, \u03bc1 = \u03bc2 = 0.005 in both cases.The proposed SLLR\u2010MRF reconstruction was implemented off\u2010line in MATLAB . Coil sensitivity maps were estimated from the data itself using ESPIRiT.\u03bbb=\u03bc1=0 or \u03bbw=\u03bc2=0, respectively. A \u201cwarm start\u201d strategy was used to improve the starting solution of subsequent ADMM iterations.r = 10 was chosen based on results from McGivney et al\u03bbb were chosen in a similar way to Zhang et alO([aN+bNlogN]2rcNcg), where a\u2248170 is related to gridding and interpolation costs, b\u22482 is used for accuracy, N is the number of data points, r is the number of singular values, c is the number of coil channels and Ncg is the number of Conjugate gradient iterations; Equation 6 has an estimated cost of Os2r2N, where s is the block size for the locally low rank; Equation 7 has an estimated cost of O(2rN). The full estimated computational cost of the proposed approach is O[aN+bNlogN]2rcNcg+sr2N+2rNNADMM, where NADMM is the number of ADMM iterations.Reconstructions in simulations using only sparse (S\u2010LLR) or only LLR\u2010MRF regularizations were obtained by setting 2 and 1 \u00d7 1 mm2, respectively) on a Linux workstation with 12 Intel Xeon X5675 (3.07 GHz) and 200 GB RAM. The 2 \u00d7 2 mm2 resolution data were reconstructed with  time\u2010point series. The 1 \u00d7 1 mm2 resolution data were reconstructed using the full 1750 time\u2010point series. For each case, images were reconstructed using the conventional low rank MRF approximation and the proposed SLLR\u2010MRF approach.In practice for this work, the bottleneck of operations was solving Equation 5, followed by solving Equation 6 and finally a negligible time to solve Equation 7. The reconstruction with 1750 time\u2010points took approximately 35 and 80 min  used the following: T1\u2208  ms, T2\u2208  ms.MRF dictionaries were simulated using extended phase graphs based on the code available in Weigel.33.1Parameter maps obtained in simulations with low rank MRF, S\u2010MRF, LLR\u2010MRF, and the proposed SLLR\u2010MRF using 875 and 438 time\u2010points are shown in Figure 1 and residual aliasing in T2 maps; these artifacts are considerably reduced with the proposed SLLR\u2010MRF. Corresponding error maps are shown in Supporting Information Figure 2. Selected reconstructed time\u2010point images corresponding to these maps are shown in Supporting Information Figure Parametric maps reconstructed with low rank MRF and SLLR\u2010MRF are shown in Figure 3.23.2.11 and T2 measurements in the phantom can be seen in Figure 1 and T2 for high values can be observed for SLLR\u2010MRF; bias of low rank MRF varied with the number of time\u2010points due to the induced aliasing artifacts. Corresponding parametric maps are shown in Supporting Information Figure Plots for T3.2.22 resolution, using different lengths of the time\u2010point series (1750 and 584), are shown in Figures 1 and noise amplification in T2 can be seen with low rank MRF, which increase with decreasing number of time\u2010points. SLLR\u2010MRF improves the parametric map quality in every case and maintains good map quality even when only a third of time\u2010points are used. Corresponding reconstructed time\u2010point images are shown in Supporting Information Figure 1 and T2 encoding power are shown . Low rank MRF has residual artifacts when the number of time\u2010points is reduced, whereas these are considerably reduced with the proposed SLLR\u2010MRF.Low rank MRF and SLLR\u2010MRF parametric maps for 2 representative healthy subjects at 2 \u00d7 2 mmseries 170 and 5842 resolution can be seen in Figure 1 for this case, but noise amplification was once again observed with low rank MRF and reduced with SLLR\u2010MRF. Corresponding time\u2010point images are shown in Supporting Information Figure Low rank MRF and SLLR\u2010MRF parametric maps for corresponding subjects at 1 \u00d7 1 mm1 and T2 values in selected regions on interest . SLLR\u2010MRF considerably reduced residual aliasing, improving parametric map quality. Simulation results agreed with a T1/T2 phantom acquisition showing superior accuracy and precision for SLLR\u2010MRF in comparison to low rank MRF for different lengths of the time\u2010point series. A slight underestimation of T2 was generally observed in the phantom experiments, more so at high T2 values. A small difference in T2 measurements was also observed in vivo between 2 \u00d7 2 mm2 and 1 \u00d7 1 mm2 resolution. These errors can be reduced by incorporating B1 correction,1 values was also observed; this bias could also be reduced by accounting for magnetization transfer and inversion efficiency.Aliasing and noise amplification in the reconstructed singular images (and thus in the time\u2010point series) can propagate into the MRF parametric maps. Low rank MRF results in simulations indicate that residual artifacts from radial sampling generally lead to blurring and noise amplification in the reconstructed T0 and B1 corrections become increasingly necessary with increasing field strength. If B0 is accounted for in the MRF model  bSSFP MRF can be used to achieve superior SNR in similar scan time. Finally, recent studies have revealed optimal MRF sequencesThe large slice thickness (10 mm) used is also a limitation in this study. Thinner slices (in the order of 5 mm) are generally desirable and will have a corresponding reduction in SNR. Sparse and low rank constraints are generally well suited to suppress noise\u2010like artifacts, although this problem can be complementarily addressed in the acquisition. Increasing the amount of acquired data or reducing the receiver bandwidth will both improve SNR at the expense of scan time. A more data efficient trajectory such as spiral can lead to SNR improvements with no scan time penalty. Improved SNR can be achieved at 3T; however, B2 in\u2010plane resolution showed that both low rank MRF approximation and SLLR\u2010MRF achieved good map quality with 1750 time\u2010point images. However, a reduction of the number of time points resulted in decreased quality for the low rank MRF reconstruction. Conversely, with SLLR\u2010MRF the number of time\u2010points could be reduced by a third  while maintaining good parametric map quality. Retrospective uniform undersampling in time by keeping (1:n:1750), with n = 1, 2, 3, 4, was used here to approximate a similar encoding of T1 and T2 values for experiments with different amounts of data. If only the first time\u2010point images were considered the influence of the initial inversion pulse and the reduced number of FA values would result in different T1 and T2 encodings that those achieved by longer scans, and thus direct comparison between acquisitions would not be adequate.In vivo scans with 2 \u00d7 2 mm2 spatial resolution and the same amount of data (1750 time\u2010points), thus comparable scan time, as the 2 \u00d7 2 mm2 maps. T2 noise amplification was considerable with low rank MRF and consequently reduced with SLLR\u2010MRF. Optimal FA patterns1 and T2 encoding for 2D MRF with highly reduced scan time. Moreover, the advantages of the proposed approach should be more evident in 3D acquisitions where higher undersampling factors are required. The extension of the proposed method to 3D MRFThe better performance of SLLR\u2010MRF, demonstrated in simulations, phantom, and in vivo scans, was used here to enable in vivo acquisitions with higher in\u2010plane spatial resolution (and thus higher undersampling factor and lower SNR). Acquisitions were performed with 1 \u00d7 1 mmThe proposed SLLR\u2010MRF is expected to be sensitive to motion, as previously observed in other MRF studies.\u03bbb, \u03bbw, \u03bci, ADMM iterations, conjugate gradient iterations) that will affect the reconstruction if improperly chosen. The same parameters were used for all the results reported here; however, future studies in larger cohort of subjects need to be performed to investigate the sensitivity of the chosen parameters. The proposed approach was compared against a ground\u2010truth in simulations and phantom experiments; however, comparison with a fully sampled MRF in vivo was not possible due to scan time constraints. Current reconstruction times were in the order of 1 h for high in\u2010plane resolution data; this will need to be reduced in the future with implementations in more efficient compiled languages  and/or graphical processing units.Another limitation of the proposed approach is related to parameter selection. Similar to most MRI reconstruction methods, the proposed approach has several tuneable parameters  while maintaining map quality in 2 \u00d7 2 mm2 in\u2010plane resolution data. SLLR\u2010MRF enabled a considerable improvement in parametric map quality compared with low rank MRF in 1 \u00d7 1 mm2 resolution data acquired in 9.6 s.A sparsity and LLR regularization for the low rank approximation reconstruction in MRF has been introduced and validated in simulations, standardized phantom, and in vivo brain acquisitions. The proposed SLLR\u2010MRF approach removed blurring in TFIGURE S1 T1 and T2 error maps (in milliseconds), for the corresponding parameter maps in Figure 2, reconstructed with the proposed sparse and local low rank constraints (SLLR\u2010MRF), only local low rank constraint (LLR\u2010MRF), only sparse constraint (S\u2010MRF) and unconstrained low rank MRF. Skull and CSF have been masked out when computing errors. Error maps correlate with the parameter maps shown in Figure 2, with higher errors obtained for the low rank MRF and the lowest errors obtained for the proposed SLLR\u2010MRFFIGURE S2 T1 and T2 error maps (in milliseconds), for the corresponding parameter maps in Figure 3, reconstructed with unconstrained low rank MRF and the proposed SLLR\u2010MRF. A mask has been used to exclude skull and CSF tissue in the error maps. Errors gradually increase with increasing acceleration factor (decreasing Nt) for both approaches, however, errors are generally milder for the proposed SLLR\u2010MRF. Corresponding normalized root mean square errors (NRMSE) for these maps can be found in Table FIGURE S3 Reconstructed time points #100 and #1600 reconstructed with low rank MRF and the proposed SLLR\u2010MRF in simulations. Both methods achieve similar time\u2010point image quality with 1750 time\u2010points. Aliasing artifacts appear in low rank MRF when the number of time\u2010points is reduced; these artifacts are considerably reduced with SLLR\u2010MRFFIGURE S4 T1 and T2 maps for a standardized phantom reconstructed with low rank MRF and the proposed SLLR\u2010MRF with 1750 and 584 time\u2010points. Larger errors are generally present with low rank MRF, more so when less data is used. When using 584 time\u2010points, the proposed SLLR\u2010MRF achieves similar quality to the low rank MRF with 1750 time\u2010pointsFIGURE S5 Time points #100 and #1600 for low rank MRF and the proposed SLLR\u2010MRF, reconstructed using 1750 and 584 total number of time\u2010points, for subject 1, 2 \u00d7 2 mm2 resolution. Residual aliasing is visible for low rank MRF when the number of time\u2010points is reduced. Conversely, these artifacts are reduced with the proposed SLLR\u2010MRFFIGURE S6 Time points #100 and #1600 for low rank MRF and the proposed SLLR\u2010MRF, reconstructed using 1750 and 584 total number of time\u2010points, for subject 2, 2 \u00d7 2 mm2 resolution. Residual aliasing is visible for low rank MRF when the number of time\u2010points is reduced. Conversely, these artifacts are reduced with the proposed SLLR\u2010MRFFIGURE S7 Time points #100 and #1600 for low rank MRF and the proposed SLLR\u2010MRF, reconstructed using 1750 and 584 total number of time\u2010points, for subjects 1 and 2, 1 \u00d7 1 mm2 resolution. Residual aliasing is present with low rank MRF, whereas SLLR\u2010MRF reduces aliasing artifactsClick here for additional data file."}
{"text": "Clinacanthus nutans Lindau leaves (family Acanthaceae) demonstrated peripherally and centrally mediated antinociceptive activity via the modulation of opioid/NO-mediated, but cGMP-independent\u00a0pathway. In the present study, MECN was sequentially partitioned to obtain petroleum ether extract of C. nutans (PECN), which was subjected to antinociceptive study with aims of establishing its antinociceptive potential and determining the role of opioid receptors and l\u2013arginine/nitric oxide/cyclic-guanosine monophosphate (l\u2013arg/NO/cGMP) pathway in the observed antinociceptive activity.Methanol extract (MECN) of n\u2009=\u20096). The effect of PECN on locomotor activity was also evaluated using the rota rod assay. The role of opioid receptors was determined by pre-challenging 500\u2009mg/kg PECN (p.o.) with antagonist of opioid receptor subtypes, namely \u03b2\u2013funaltrexamine , naltrindole  or nor\u2013binaltorphimine  followed by subjection to the abdominal constriction test. In addition, the role of l\u2013arg/NO/cGMP pathway was determined by prechallenging 500\u2009mg/kg PECN (p.o.) with l\u2013arg , 1H- oxadiazolo quinoxalin-1-one , or the combinations thereof (l\u2013arg\u2009+\u2009ODQ) for 5 mins before subjection to the abdominal constriction test. PECN was also subjected to phytoconstituents analyses.The antinociceptive potential of orally administered PECN  was studied using the abdominal constriction-, hot plate- and formalin-induced paw licking-test in mice (p\u2009<\u20090.05) inhibited nociceptive effect in all models in a dose-dependent manner. The highest dose of PECN (500\u2009mg/kg) also did not significantly (p\u2009>\u20090.05) affect the locomotor activity of treated mice. The antinociceptive activity of PECN was significantly (p\u2009<\u20090.05) inhibited by all antagonists of \u03bc-, \u03b4-, and \u03ba-opioid receptors. In addition, the antinociceptive activity of PECN was significantly (p\u2009<\u20090.05) reversed by l\u2013arg, but insignificantly (p\u2009>\u20090.05) affected by ODQ. HPLC analysis revealed the presence of at least cinnamic acid in PECN.PECN significantly (PECN exerted antinocicpetive activity at peripheral and central levels possibly via the activation of non-selective opioid receptors and modulation of the NO-mediated/cGMP-independent pathway partly via the synergistic action of phenolic compounds. Pain is an essential sensation that plays a vital role as a body\u2019s natural defence system by alerting us to possible tissue injury while nociception is described as \u201cthe neural processes of encoding and processing noxious stimuli\u201d that usually leads to pain . The proPain can be modulated by various analgesic drugs that suppress pain signals by acting in various mechanisms on the peripheral (PNS) and central nervous system (CNS) . HoweverClinacanthus nutans (C. nutans) Lindau, known to the Malay as \u201cBelalai Gajah\u201d, is one of the medicinal plants that have received considerable attention from many research groups within the past few years. This small shrub belongs to the Acanthaceae family and commonly grows in tropical Southeast Asian countries. Local communities in the Southeast Asian countries including Malaysia have traditionally used C. nutans for the treatment of various disorders , including pain relief  oxadiazole quinoxaline\u20131\u2013one (ODQ) were purchased from Sigma\u2013Aldrich , while \u03b2\u2013funaltrexamine hydrochloride (\u03b2\u2013FNA), nor\u2013binaltorphimine dihydrochloride (nor\u2013BNI), and naltrindole hydrochloride (NALT) were purchased from Tocris Bioscience . Acetic acid and dimethyl sulfoxide (DMSO) were purchased from Fisher Scientific . Formaldehyde was obtained from R & M Chemicals . All drugs were dissolved in physiological saline (0.9% [w/v] NaCl) except for PECN, ASA, DZP and MOR, which were dissolved in 10% DMSO (v/v). The vehicle that was used alone had no effects per se on the nociceptive responses in mice. The other solutions  were prepared in 0.9% NaCl. All drugs, chemicals, PECN solutions were administered in 10\u2009mL/kg volumes and were freshly prepared immediately prior to use.The following drugs, namely acetylsalicylic acid (ASA), morphine hydrochloride (MOR), diazepam (DZP), n\u2009=\u20096) were treated with vehicle , negative control), ASA , or PECN  60\u2009min before the administration of phlogistic agent . The number of abdominal constrictions produced was counted from 5\u2009min after acetic acid administration cumulatively for 25\u2009min, as described previously in detail [The animals (n\u2009=\u20096) were treated with vehicle , MOR  or PECN  60\u2009min before the test.In order to evaluate the central antinociceptive effect of PECN, a hot plate test was carried out according to the method previously described in detail by Sani et al. . The anin\u2009=\u20096) received vehicle , ASA , MOR , or PECN  60\u2009min before the intraplantar (i.pl) administration of 5% (v/v) formalin into the right hind paw. The nociceptive response, indicated by the sum of time that the animal spent licking the injected paw, developed between\u20090-5\u00a0min after formalin injection (early phase) and 15\u201330\u2009min after formalin injection (late phase) were recorded for 30\u2009min.The procedure used was similar to the one used in our previous work . Mice (nn\u2009=\u20096) were treated with the vehicle , DZP , or PECN  60\u2009min before the test. The average time the mice spent to stay on the rota\u2013rod was measured for 120\u2009s at 5, 10, and 15\u2009min after the administration of PECN, respectively.The method used was conducted similarly to the one that was described previously . The appThe possible role of opioid receptor system in the modulation of PECN-induced antinociceptive activity was investigated as previously described . Brieflyl\u2013arg/NO/cGMP pathway to the antinociceptive effect of PECN, the previously described method was adopted\u00a0from Jim\u00e9nez\u2013Andrade et al. [n\u2009=\u20096) were pre\u2013treated (i.p.) with 20\u2009mg/kg\u2009l\u2013arg (a NO precursor) or 2\u2009mg/kg ODQ (a specific soluble guanylyl cyclase inhibitor) 5\u2009min before the administration of vehicle  or PECN . Sixty minutes after the administration of test solutions, the mice were subjected to acetic acid\u2013induced abdominal constriction test as described above.To investigate the possible contribution of e et al. . The micThe qualitative phytochemical screening of PECN was performed to determine the presence of flavonoids, saponins, triterpenes, tannins, alkaloids and steroids according to the conventional protocols as adopted by Mamat et al. .The HPLC analysis of PECN was conducted at the Laboratory of Phytomedicine, Forest Research Institute of Malaysia, Kepong, Malaysia according to the similar protocols as reported in Zakaria et al. . The HPLp\u2009<\u20090.05.Data are expressed as mean\u2009\u00b1\u2009standard error of mean (SEM). Except for the hot plate test, the mean differences between the control and treatment groups for the other tests were analysed using the one\u2013way analysis of variance (ANOVA) followed by Dunnet\u2019s post\u2013test . Data for the hot plate test were analysed using the two-way ANOVA followed by the Bonferroni\u2019s post hoc test. In all cases, the differences were considered as significant if p\u2009<\u20090.001) and dose\u2013dependent decrease in the number of abdominal constrictions in comparison to the control group. The percentage of antinociception calculated for the three respective doses of PECN ranged between 63.8 to 77.3%. ASA  also caused significant (p\u2009<\u20090.001) inhibition of abdominal constriction with the percentage of antinociception recorded at approximately 46.8%.The effect of PECN against acetic acid\u2013induced abdominal constriction test in mice is shown in Fig.\u00a0p\u2009<\u20090.01) changes in response latency to thermal stimulus\u2013induced nociception, which started 60\u2009min after PECN administration and lasted until the end of the experimentation when compared against the control group. Concurrently, MOR given via oral administration at the dose of 5\u2009mg/kg also caused a highly significant (p\u2009<\u20090.001) prolongation of latency response starting at the interval of 60\u2009min and lasted until the end of the experimentation (210\u2009min).The effect of PECN on thermal-induced nociception was assessed using the hot plate test and is shown in Table\u00a0p\u2009<\u20090.001) reduction in the latency of formalin\u2013induced paw licking in the first phase  of the test as shown in Fig.\u00a0p\u2009<\u20090.001) reduced the latency of formalin\u2013induced paw licking in the second phase  of the test as shown in Fig. Figure\u00a0p\u2009<\u20090.001) reduction in the latency spend by the mice to remain on the rota-rod at all interval measured indicating its potential to affect motor coordination.The effect\u00a0of orally administered PECN on motor coordination of mice was measured using the rota\u2013rod test and is shown in Fig.\u00a0p\u2009<\u20090.001) reversed after i.p. pretreatment with 10\u2009mg/kg \u03b2\u2013FNA, 1\u2009mg/kg NALT or 1\u2009mg/kg nor\u2013BNI, which did not exert any significant (p\u2009>\u20090.05) effect on nociceptive response when tested alone.Effect of PECN on opioid receptors-mediated nociceptive response was determined using the acetic acid-induced abdominal constriction test and is shown in Fig.\u00a0l\u2013arg/NO/cGMP pathway in the modulation of PECN-induced\u00a0antinociception is shown in Fig.\u00a0l\u2013arg or ODQ, alone or in combination with PECN, were assessed using the acetic acid\u2013induced abdominal constriction test. As shown in Fig. l\u2013arg (the NO precursor) alone did not affect the acetic acid-induced nociception but caused significant reversal (p\u2009<\u20090.001) on PECN-induced antinociception when pretreated together. Moreover, ODQ, given alone, caused significant (p\u2009<\u20090.001) attenuation of the acetic acid\u2013induced nociception while pretreatment with PECN caused significant (p\u2009<\u20090.01) reversal of the antinociceptive activity of PECN \u2009=\u200917.265\u2009min), P2 (retention time (RT)\u2009=\u200918.332\u2009min), P3 (RT\u2009=\u200918.631\u2009min), P4 (RT\u2009=\u200920.136\u2009min) and P5 (RT\u2009=\u200927.494\u2009min). Further analysis demonstrated that the three major peaks showed their \u03bbmax values in the region of 222.5\u2013332.6, 192.0\u2013336.2, and 216.6\u2013335.0\u2009nm, respectively, thus, suggesting the presence of phenyl chroman (C6\u2013C3\u2013C6) skeletal structures. As depicted in Fig.\u00a0The HPLC profiles of PECN were measured at six different wavelengths, namely 210, 254, 280, 300, 330 and 366\u2009nm to obtain the best separation. Based on the respective chromatograms obtained, chromatogram established at the wavelength of 254\u2009nm was found to show the best peaks separation , ethyl acetate and aqueous semi-purified fractions [The current work is a continuation of previous study by Abdul Rahim et al.  on the aractions , which w2 and PGF2), lipoxygenase (LOX) and cyclooxygenase (COX) in the peritoneal cavity that lead to indirect liberation/activation of various endogenous inflammatory mediators. These mediators stimulate the peripheral nociceptive neurons that are sensitive to opioid (i.e. MOR) and non-opioid (i.e. ASA) analgesics [Other than the acetic-acid-induced abdominal constriction test, PECN was found to attenuate nociceptive response when assessed using the hot plate test and formalin-induced paw licking test. The acetic acid\u2013induced abdominal constriction test, which represents inflammatory\u2013mediated peripheral nociceptive response, has been associated with increased production of prostaglandin (PG)  , involveBased on its ability to attenuate both the acetic acid- and thermal-induced nociceptive responses, PECN is suggested to have a potential to inhibit nociceptive response at the peripheral and central levels \u201322. ThisAlthough the three nociceptive assays used in the present study finally established that PECN possesses antinociceptive potential, it is necessary to determine the extract ability to modulate motor coordination of the mice upon consumption due to its centrally-acting effect since centrally-acting drugs are known to cause possible alterations in the motor coordination, balance and equilibrium ability of the animals . Accordil\u2013arg/NO/cGMP pathway. The opportunity to study and identify any drugs/substances that modulate nociceptive response via mechanisms partly used by standard analgesic (MOR) (viz. opioid receptors and l\u2013arg/NO/cGMP pathway) could be an added advantage in an attempt to find replacement to MOR, which has been associated with side effects such as dependence and tolerance.In an attempt to establish the antinociceptive profile of PECN, the mechanisms of antinociception modulated by PECN were also investigated by focusing on the role of opioid receptor systems  and Role of opioid receptor system in the modulation of antinociceptive action of drugs/substances can be determined via exploitation of certain pharmacological tools such as various antagonists of opioid receptor , 28. Thel\u2013arg/NO/cGMP pathway in the regulation of analgesics action at peripheral and central levels haa been reported [l\u2013arg to l\u2013citrulline and NO by NO synthase, is known to play a complex part in the transmission of nociceptive signals peripherally and centrally [l\u2013arg exerted insignificant increase in the nociceptive intensity when administered alone, it significantly reduced the antinociceptive intensity of PECN when pretreated together indicating the importance of NO presence in the modulation of PECN antinociceptive potential. On the other hand, increased presence of NO at the intracellular level stimulates the soluble guanylate cyclase (sGC), which augments the cGMP synthesis. The important of cGMP in the modulation of hyperalgesic response at peripheral sensory neurons and the involvement of NO/cGMP signaling pathway in the central and peripheral nociceptive processing have been established [l\u2013arg/NO/cGMP pathway plays a pivotal role in the development of tolerance to MOR [C. nutans as an analgesic-based product with lack of unwanted side effects seen with MOR due to the difference in NO-mediated pathway modulated by the former.The involvement of reported . NO, derentrally . In factentrally . Althougablished . In the ablished . One exaablished , 38. Take to MOR , it is rC. nutans leaves demonstrated the presence of flavonoids, phenolic compounds, diterpenes, saponins, chlorophyll and its various derivatives, and steroids (i.e. \u03b2\u2013sitosterol and stigmasterol) [Earlier investigation on the phytochemical content of asterol) , 5. Concasterol) , 41, triasterol) , 43, andasterol) , 45 exerGalanthus elwesii. Concurrent with this finding, there are reports on the potential of cinnamic acid derivatives [Further phytoconstituents analysis using HPLC revealed the presence of traces of only a few bioactive compounds , which upon comparison with several pure bioactive compounds revealed the presence of, at least, cinnamic acid. The lack of number of peaks and the presence of small peaks as detected in the chromatogram of PECN might be due to the lack of hydrophilic (water-soluble) bioactive compounds in the hydrophobic-based extract. The presence of cinnamic acid in PECN is parallel to the report of T\u00fczan and \u00d6zdemir  on the pivatives  to exertl\u2013arg/NO-mediated, but cGMP-independent, pathway.In conclusion, PECN, partly through the presence of cinnamic acid, exerted antinociceptive activity at the peripheral and central levels via the non-selective activation of opioid receptors and modulation of the"}
{"text": "The aim of this study was to assess the lifetime economic benefits of assisted reproduction in Spain by calculating the return on this investment. We developed a generational accounting model that simulates the flow of taxes paid by the individual, minus direct government transfers received over the individual\u2019s lifetime. The difference between discounted transfers and taxes minus the cost of either IVF or artificial insemination (AI) equals the net fiscal contribution (NFC) of a child conceived through assisted reproduction. We conducted sensitivity analysis to test the robustness of our results under various macroeconomic scenarios. A child conceived through assisted reproduction would contribute \u20ac370,482 in net taxes to the Spanish Treasury and would receive \u20ac275,972 in transfers over their lifetime. Taking into account that only 75% of assisted reproduction pregnancies are successful, the NFC was estimated at \u20ac66,709 for IVF-conceived children and \u20ac67,253 for AI-conceived children. The return on investment for each euro invested was \u20ac15.98 for IVF and \u20ac18.53 for AI. The long-term NFC of a child conceived through assisted reproduction could range from \u20ac466,379 to \u20ac-9,529 (IVF) and from \u20ac466,923 to \u20ac-8,985 (AI). The return on investment would vary between \u20ac-2.28 and \u20ac111.75 (IVF), and \u20ac-2.48 and \u20ac128.66 (AI) for each euro invested. The break-even point at which the financial position would begin to favour the Spanish Treasury ranges between 29 and 41 years of age. Investment in assisted reproductive techniques may lead to positive discounted future fiscal revenue, notwithstanding its beneficial psychological effect for infertile couples in Spain. Birth and fertility rates in Spain have declined significantly in recent years. In 2011 the birth rate stood at 10.2 births per 1000 inhabitants, its lowest level since 2003, while the fertility rate was 1.36 children per woman , which iPrevious studies have shown that, even under the most optimistic projections, a declining birth rate combined with an ageing population might result in fiscal imbalances that can only be mitigated through spending cuts or tax increases . A higheIn this context, public funding of assisted reproductive treatment could have a positive effect not only on mitigating the excess demand and the current inequity in access to healthcare services, but it could help restore replacement rates and improve fiscal stability . Indeed,The long-term fiscal implications of public funding of assisted reproductive treatment have been estimated previously in countries as diverse as Brazil , DenmarkIn order to investigate whether funding assisted reproduction might be considered an efficient use of public resources in Spain, this analysis models the long-term tax implications that public funding of assisted reproduction might have in the country. Using a generational accounting model, we analyse the fiscal balance of the economic transfers between the government and an individual conceived through assisted reproductive treatment over his/her lifetime. Both IVF and AI treatments are considered.N is the individual\u2019s life expectancy, T is gross revenues received by the government through taxes paid by the individual, X is direct transfers to the individual , K is the cost of assisted reproductive treatment, r is the discount rate and t corresponds to 1 year. Revenues and transfers are apportioned to each year of the individual\u2019s life, from age 0 to the age of life expectancy. We assume that an individual conceived through assisted reproductive treatment is an average individual in terms of education, income, health status, life expectancy, probability of being unemployed and likelihood of being a public servant. Therefore, the model apportions transfers and taxes weighted by the probability of the individual belonging to any category of taxpayers or potential recipients . The model adopts the perspective of the Spanish government and includes the full official list of revenues collected by the State, which comprise not only taxes paid by individuals in the labour force, but also those paid by individuals regardless of age or employment status . Transfers to individuals include education, healthcare and pensions from birth to life expectancy, plus the average cost of IVF or AI cycles needed to achieve a successful pregnancy, which is assumed only once, in year zero of the model. For an overview of all revenues and expenditures, see A generational accounting model was built to estimate the net fiscal value of an individual conceived through assisted reproductive treatment . To analThe base year is the hypothetical year of birth of the individual whose net tax value the model calculates. In the base case, the model assumes that the base year macroeconomic parameters, especially the rate of economic growth and the unemployment rate, are constant over the time horizon. In order to account for possible business cycles contractions and expansions that will occur during the lifetime of the individual, we conducted a linear regression of the annual growth rate of gross domestic product (GDP) in Spain for the period 1970\u20132012 . In thisThe model\u2019s time horizon is the individual\u2019s life expectancy at birth in Spain in the base year (78 years), which is consistent with previously published empirical models . Table 2To reflect the depreciation of money over time, we applied a discount rate of 3.5% on all transfers to and from the government. This is consistent with discount rates used in previous studies, which range between 2.5%  and 4.0%There are no official data available on the cost of assisted reproduction in the Spanish public health system. IVF and AI costs were based on two published studies that estimate direct healthcare costs of both IVF and AI cycles in two different Spanish hospitals . An averTransfers from the government to the individual were obtained from different sources. In most cases the data are available at the aggregate level, so we estimated what the average individual received on each item. When possible the average by age year is imputed. Otherwise, when data is available by age groups, the average by age group is imputed to each age year within the same age group. In the minority of cases, when age distributions are not available, an average per capita is imputed to all years. All data were obtained for 2006.t can be expressed as:E is education, H is healthcare, W is salaries of governmental employees, and U is unemployment benefits.The sum of transfers from the government to the citizens at time Education expenditure by schooling level  and through grants (non-university and university grants) was obtained from the Ministry of Education databases . EnrolmePublic healthcare expenditure by age group  was obtained from the Ministry of Health  for 2006Pensions received by individuals include orphanhood, widowhood and retirement pensions. The proportion of pensioners and the average amount in euros received in each pension category can be obtained by age (0\u201378) from the Spanish Labour Force Survey, which is representative at the national level and collects information at the individual level . We assiThis model includes the wages spent by the government on all governmental employees. Total wages were obtained from the . The disAverage unemployment benefits and unemployment rates by age group  are available from the Spanish Treasury databases . We impuTax exceptions due to parenthood are implicitly included in the income tax declared by the individual, which is a transfer from the individuals to the government in the model. As opposed to other countries, child benefit payments do not exist in Spain, and data on paid leave due to parenthood are not available. These two parameters were therefore not included in the model.t is:SS stands for Social Security contributions, I is income tax, C is corporate tax, N is non-resident income tax, A is tax paid on alcohol and beer consumption, H is tax paid on petrol and diesel, Tob is tax paid on tobacco consumption, VAT is value added tax, and O refers to other transfers.The sum of transfers received by the government from the individual at time In Spain all employed persons pay a Social Security contribution. Contributions are age- and employment regime-dependent. We used the Spanish Labour Survey , which cThis category includes the income tax paid by employed individuals in the private sector (including self-employed) and public sector employed individuals. Private sector income tax is available at the individual level from the Spanish Labour Force Survey . Income Corporate tax is paid by business owners, and is available at the aggregate level from the Treasury\u2019s Annual Report . The numThis tax is paid by Spaniards living abroad. It is available at the aggregate level from the Treasury\u2019s Annual Report . The numThe revenue from alcohol and beer, and tobacco consumption are available from the Spanish Treasury Annual Report  at the aThe revenue from the sale of petrol and diesel is available from the Spanish Treasury Annual Report  at the aThe revenue from VAT is available from the Spanish Treasury Annual Report  at the aOther transfers include taxes paid for inheritance, electricity, insurances, sugar consumption, and fiscal sanctions. All are available from the Spanish Treasury Annual Report  at the aDue to the uncertainty of the country\u2019s economic growth, and to test the robustness of the model\u2019s results in a scenario of economic crisis, one-way deterministic sensitivity analysis was performed. The analysis included eight different scenarios where we vary, either alone or combined, those parameters most likely to change in the future and to have an impact on the results: discount rate (1% and 5%), GDP growth rate (\u00b1\u00a0100%), inflation rate (\u00b1\u00a0100%), and unemployment rate (\u00b1\u00a0100%).In the base case, the present value of all taxes paid by a naturally conceived individual equals \u20ac370,482, while the transfers made to the individual add up to \u20ac275,972. Therefore, the NFC of a naturally conceived individual throughout his/her lifetime is \u20ac94,510. In year zero the cost of achieving a live birth through IVF  is \u20ac4173 while that of AI is \u20ac3629. Therefore, in the base case scenario, an individual conceived through assisted reproduction will have a NFC over his/her life cycle of \u20ac66,709 if conceived through IVF and of \u20ac67,253 if conceived through AI. These results imply returns on investment of \u20ac15.98 and \u20ac18.53 for every euro invested in IVF and AI, respectively.If the government were to finance only the first three cycles of either assisted reproductive technique (as it does now) as opposed to financing the necessary cycles to reach a pregnancy, the expected cost of a successful pregnancy would equal \u20ac2661 if conceived through IVF and \u20ac1424 if conceived through AI, and the net fiscal contributions would be \u20ac42,528 for an individual conceived through IVF and \u20ac26,387 for an individual conceived through AI, which imply returns on investment of \u20ac15.98 and \u20ac18.53, respectively. The return on investment does not vary depending on whether the government decides to finance only three cycles or the total number of cycles required for conception, because the expected benefits increase in the same proportion as the expected costs.This is the first empirical study that estimates the NFC of an individual conceived through assisted reproduction in Spain. It is also the first study to compare IVF with AI techniques. Previous studies that have calculated the NFC for the life cycle of an IVF-conceived individual have shown that this can vary, but that, with the exception of The Netherlands , it remaOur model is significantly more accurate than most previous empirical models for several reasons. First, previous empirical models assume that an individual\u2019s economic life cycle can be divided into specific periods depending on his/her age (for example: \u2018childhood\u2019 (0\u201319 years), \u2018working years\u2019 (20\u201364 years), \u2018senior years\u2019 (65 + years)) in which the same average transfers and taxes are apportioned for all individuals belonging to the same periods, and regardless of exact age, true schooling level or working status . In our Of course, this model, like all mathematical representations of real-life situations, also has limitations. First, the model estimates the tax benefits that public funding of assisted reproduction would have in women up to 40 years of age. Although performing assisted reproductive techniques in women over 40 years of age has lower associated rates of success, studies in other countries also obtain positive \u2013 though less substantial \u2013 NFC for individuals born to women over 40. In Spain the public health system finances assisted reproduction only for women up to 40 years of age, a restriction that influences our data. We believe it would be beneficial to carry out a study that would include the costs of financing pregnancies in women over 40 years, to see whether public resources would be well invested in age ranges above 40.Second, it is important to consider that 20% of IVF pregnancies are multiple . Data onThird, since this analysis is performed from the perspective of the Spanish Treasury, our results do not include the estimated individual benefits in terms of quality of life that conceiving provides for couples who suffer from infertility, even extending to the \u2018peace of mind\u2019 experienced by those couples who should they fail to conceive, know that they have tried everything. Inclusion of the psychological and social benefits of artificial conception would reveal even greater advantages associated with public funding of assisted reproduction. Finally, our results are only applicable to Spain.In conclusion, an increase in public funding for assisted reproductive techniques in Spain might have positive effects in at least three respects. Notwithstanding the fact that general accounting is only a speculation, our results show that public funding of assisted reproduction might lead to positive net fiscal results for the Spanish Treasury during the life cycles of children conceived through assisted reproduction. Moreover, it would decrease the problem of lack of access to healthcare service, while most likely improving equity in access to the service and quality of life of infertile couples."}
{"text": "ROP of \u03b3-benzyl-l-glutamate N-carboxyanhydride initiated by P(Glx-r-PDLy)-NH2 provided neutral poly(\u03b3-benzyl-l-glutamate)-grafted copolyesters, which were converted by hydrolysis into negatively charged hybrid copolymers. Both water-soluble and nonsoluble copolymers were produced depending on copolymer charge and their grafting degree, and their capacity for self-assembling in nano-objects were comparatively examined. The emulsion solvent-evaporation technique applied to the chloroform-soluble copolymers grafted with benzyl glutamate rendered well-delineated spherical nanoparticles with an average diameter of 200\u2013300 nm. Conversely, micellar solutions in water were produced from copolyesters bearing grafted chains composed of at least 10 units of glutamic acid in the free form. The copolymer micelles were shown to be able to load doxorubicin (DOX) efficiently through electrostatic interactions and also to release the drug at a rate that was markedly pH dependent.The enzymatic ring-opening copolymerization (eROP) of globalide (Gl) and pentadecalactone (PDL) was performed in solution from mixtures of the two macrolactones at ratios covering the whole range of comonomeric compositions. The resulting P(Gl Polypeptides coming from either natural or synthetic sources are regarded as a class of highly refined polymers closely related with nature. Combination of synthetic polymers with polypeptides commonly results in hybrid copolymers in which the properties of each component are profited to surmount their individual limitations . Thus, tMacrolactones (MLs) stand out as ideal monomers for green polymer chemistry . MLs mayThe double bond present in Gl provides a versatile tool for chemical functionalization. Gl has been polymerized on several occasions to render polyglobalide (PGl), an unsaturated polyester  that wasl-glutamate (BLG) from Bachem, and 2,2\u2032-Azobis(2-methylpropionitrile) (AIBN) (98%) and HBr (33% w/w in acetic acid) were acquired from Sigma-Aldrich . Globalide (Gl) was provided by Grupo Indukern (Barcelona), and \u03c9-pentadecalactone (PDL) was purchased from Sigma-Aldrich and distilled under vacuum previous to use. Novozyme 435 (Candida antarctica Lipase B immobilized on cross-linked polyacrylate beads) was a gift of Novozymes , and 2-(Boc-amino)ethanethiol (BAET) (97%) and Sodium trifluoroacetate (98%) were purchased from Sigma-Aldrich and used without further purification. Anhydrous DMF (99.8%), CHCl3 (99.9%), THF (99.9%), ethyl acetate (99.9%), and n-heptane were purchased from Across Organics  and used directly from the bottle under an inert atmosphere. Additionally, 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) was purchased from Apollo Scientific (UK), and doxorubicin hydrochloride (DOX\u00b7HCl) (98%) was purchased from AK Scientific Inc. .Triphosgene and \u03b1-pinene were supplied by Sigma-Aldrich and \u03b3-benzyl-1H and 13C NMR spectra were recorded on a Bruker AMX-300 spectrometer  at 25 \u00b0C, operating at 300.1 and 75.5 MHz, respectively. Compounds were dissolved in deuterated chloroform (CDCl3) or a mixture of trifluoroacetic acid (TFA) and CDCl3, and spectra were internally referenced to tetramethylsilane (TMS). About 10 mg of sample in 1 mL of solvent were used, and 64 scans were recorded for 1H NMR. FTIR measurements were performed in a Frontier Perkin-Elmer FTIR spectrophotometer . Spectra were obtained from powder samples using a Universal ATR sampling accessory. For spectra recorded at variable temperature, films were prepared by casting an HFIP solution containing 5 mg of polymer in 1 mL of solvent on a NaCl plate and the plate set on a VT FTIR Cell (Specac). Eight scans with a resolution of 4 cm\u22121 were collected for each sample in the spectral region of 450\u20134000 cm\u22121.w/v) sample solution was injected and chromatographed with a flow of 0.4 mL\u00b7min\u22121 using as solvent HFIP with sodium trifluoroacetate added (0.05 M). HR5E and HR2 Waters linear Styragel columns  packed with cross-linked polystyrene and protected with a precolumn were used. Molar mass averages and distributions were calculated against PMMA standards.Molecular weight analysis was performed by gel permeation chromatography (GPC) on a Waters equipment provided with RI and UV detectors. Precisely, 100 \u00b5L of 0.1%  using a Perkin-Elmer DSC 8500 apparatus. Thermograms were recorded from 4 to 6 mg samples at heating and cooling rates of 10 \u00b0C\u00b7min\u22121 under a nitrogen flow of 20 mL\u00b7min\u22121. Indium and zinc were used as standards for temperature and enthalpy calibration.Thermogravimetric analyses were performed on a Mettler-Toledo TGA/DSC 1 Star System under a nitrogen flow of 20 mL\u00b7minDynamic light scattering studies (DLS) were performed at the Parc Cient\u00edfic de Barcelona using a Zetasizer Nano ZS series Malvern instrument equipped with a 4 mW He\u2013Ne laser operating with a wavelength of 633 nm. The noninvasive backscatter optic arrangement was used to collect the light scattered by the particles at an angle of 173\u00b0. The samples were analyzed in disposable cuvettes at 25 \u00b0C.\u22121. The energy employed corresponded to a 0.10 nm wavelength, and the spectra were calibrated with silver behenate (AgBh) and Cr2O3.Real-time X-ray diffraction (XRD) studies were carried out using synchrotron radiation at the BL11 beamline for noncrystalline diffraction (NCD) at ALBA . Spectra were recorded from powder samples subjected to heating\u2013cooling cycles at a rate of 10 \u00b0C\u00b7min\u03b3-Benzyl L-glutamate N-carboxyanhydride (BLG-NCA): \u03b3-benzyl L-glutamate , \u03b1-pinene , and ethyl acetate (80 mL) were weighed in a three-neck round-bottom flask and refluxed under nitrogen for 15 min. Then, triphosgene  dissolved in ethyl acetate (20 mL) was added dropwise and refluxing continued until most of the solids disappeared which took about 3 h. The reaction mixture was then cooled down and filtered, and the filtrate was reduced to approximately 30% of its original volume by rotaevaporation. BLG-NCA was precipitated by addition of heptane (60 mL), recovered by filtration under vacuum, recrystallized twice using an ethyl acetate/heptane mixture (90:10 v/v), washed with heptane, and finally dried under vacuum. Yield: 90%.x-r-PDLy) copolyesters by eROP:Synthesis of P was placed in a round-bottom flask and dried over P2O5 for 16 h at 50 \u00b0C in a desiccator. Dry toluene (7 mL) and 2 g of the mixture of the two MLs at the selected molar ratio  were then added. The flask was immediately immersed in an oil bath at 70 \u00b0C, and the reaction left to proceed for 24 h under stirring in a nitrogen atmosphere. Finally, the reaction mixture was cooled down and toluene was removed by rotaevaporation. The solid residue was dispersed in chloroform, and the enzyme was filtered out. The polymer was precipitated by pouring the filtered chloroform solution into cold methanol, recovered by filtration, and dried before characterization. Yield: 80%\u201390%. x-r-PDLy) copolyesters via thiol-ene reaction:Functionalization of the P(Gl P(Gl13-r-PDL87) and P(Gl48-r-PDL52) copolyesters were chosen for the synthesis of the grafted copolymers. Briefly, the corresponding copolyester (0.2 g), BAET (1.11 g), and AIBN (50 mg) were weighed in a Schlenk tube purged with nitrogen, and then, 1 mL of THF was added. The reaction was initiated by immersing the tube into an oil bath at 80 \u00b0C and left to proceed for 24 h under magnetic stirring. The reaction was terminated by addition of dichloromethane (DCM) and immersion of the tube in an ice bath. The reaction product was precipitated in cold methanol and recovered by centrifugation. This process was performed twice to render the BAET-modified copolymers P[(Gl-BAET)13-r-PDL87] and P[(Gl24-r-(Gl-BAET)24-r-PDL52]. Yield: 90%.Removal of Boc-protecting groups: Solutions of copolyesters, P[(Gl-BAET)13-r-PDL87] and P[Gl24-r-(Gl-BAET)24-r-PDL52], (100 mg in 2 mL of TFA), were stirred at room temperature for 10 min. The solution was then added to an excess of diethyl ether, and the precipitate was then recovered by centrifugation and washed twice with a saturated 0.5 M NaHCO3 aqueous solution. The products, P[(Gl-NH2)13-r-PDL87] and P[Gl24-r-(Gl-NH2)24-r-PDL52], were dried under vacuum at room temperature and stored under such conditions until being used. Yield: 90%.x-r-PDLy)\u2013g\u2013BLGz] graft copolymers:Synthesis of P[(Gl Graft copolymers were prepared by ROP of BLG-NCA using P[(Gl-NH2)13-r-PDL87] and P[Gl24-r-(Gl-NH2)24-r-PDL52] as multiple macroinitiators. To prepare P[(Gl13-r-PDL87)\u2013g\u2013BLG10], the P[(Gl-NH2)13-r-PDL87] copolymer  in 2 mL of dried CHCl3 was injected with a syringe into a Schlenk tube through a rubber septum containing a solution of BLG-NCA  in 6 mL of dry CHCl3. The tube was placed in a NaCl water bath at 0 \u00b0C, and the reaction was left to proceed under stirring for 48 h or until the BLG-NCA was completely consumed as monitored by FTIR spectroscopy. The final reaction mixture was poured into an excess of diethyl ether, and the precipitate was recovered by centrifugation and dried under vacuum. The same methodology was used to prepare P[(Gl48-r-PDL52)\u2013g\u2013BLG2] copolymer from P[Gl24-r-(Gl-NH2)24-r-PDL52]  and BLG-NCA  but using DMF as solvent instead of CHCl3. Yield: 80%\u201390%.Graft copolymer deprotection: A general procedure was used for deprotection of PBLG pendant groups. Briefly, a solution of 170 mg of P[(Gl13-r-PDL87)\u2013g\u2013BLG10] in 2 mL of TFA was first prepared. Then, a solution of HBr in glacial acetic acid in a molar excess of 2.5\u20135 times respect to the \u03b3-benzyl L-glutamate repeating unit was added slowly to the copolymer solution at 0 \u00b0C, and after 2 h, the mixture was poured into an excess of diethyl ether. The precipitate was centrifuged and washed twice with diethyl ether. The obtained polymer was dissolved in 0.5 M NaHCO3 aqueous solution and then dialyzed (MWCO 2000) against distilled water to yield P[(Gl13-r-PDL87)\u2013g\u2013LGA10] in the salt form. P[(Gl48-r-PDL52)\u2013g\u2013BLG2] was treated in the same way to yield P[(Gl48-r-PDL52)\u2013g\u2013LGA2] in 70% yield. l-glutamic acid) (PLGA):Synthesis of poly(\u03b3-benzyl-L-glutamate) (PBLG) and poly was dissolved in 7 mL of anhydrous DMF in a Schlenk tube. The tube was immersed in a 0 \u00b0C NaCl water bath, and 80 \u00b5L  of a stock solution 0.76 M of hexylamine (HA) in DMF was injected through a rubber septum with a syringe ([NCA]0/[HA]0 = 50). The reaction was left until the BLG-NCA had been completely consumed as monitored by FTIR spectroscopy. After complete monomer conversion, the polypeptide was precipitated into an excess of chilled diethyl ether, filtered, and dried under vacuum. Yield: 84%. Removal of benzyl groups from PBLG was carried out in a similar manner as in the graft copolymer P[(Gl13-r-PDL87)\u2013g\u2013(BLG)10] to produce PLGA in 70% yield. 13-r-PDL87)\u2013g\u2013BLG10] copolymer were prepared by the emulsion-solvent evaporation technique. Precisely, 10 mg of the copolymer was dissolved in 2 mL of chloroform, and the solution was added to 10 mL of 1% (w/w) poly (PVA) (Mn = 2000 g\u00b7mol\u22121) aqueous solution. The mixture was then sonicated thrice for 15 s each time to yield a homogeneous oil-in-water emulsion. This emulsion was immediately poured into 10 mL of 0.3% PVA aqueous solution and magnetically stirred in an open beaker at room temperature for 3 h to evaporate the organic solvent. The NPs were collected by centrifugation at 11,000 rpm and washed three times with distilled water prior to characterization.Spherical nanoparticles (NPs) made of P[(Gl13-r-PDL87)\u2013g\u2013LGA10] to load positively charged drugs by electrostatic conjugation. Briefly, 5 mg of the copolymer was solubilized in 4 mL of deionized water, and the solution (pH 7.0) was stirred for 10 min before passing it through a 0.45 \u03bcm filter. Then, DOX\u00b7HCl  dissolved in water (1 mL) was added dropwise into the polymer\u2013aqueous mixture under magnetic stirring (300 rpm) and left under stirring for 12 h. Afterward, the mixture was dialyzed  for 24 h against distilled water to remove the free DOX\u00b7HCl, and the dialysate was then lyophilized. Drug loading efficiency (DLE) and drug loading content (DLC) were calculated according to the following equations:Doxorubicin hydrochloride (DOX\u00b7HCl) was used as a drug model to appraise the capacity of P[(Gl48-r-PDL52)\u2013g\u2013LGA10] conjugate was placed in a dialysis bag  which was then immersed in 25 mL of buffer and kept under constant mild shaking at 37 \u00b0C. For measuring the amount of drug released, 1.5 mL aliquots were taken out from the releasing medium at selected time intervals, and the solution was replenished with an equal volume of fresh medium. Quantification of DOX was accomplished by absorption spectrometry at 480 nm using a UV\u2013Vis spectrophotometer.The effect of the pH on drug release was assessed by incubating the DOX-loaded NPs in following buffers: PBS pH 7.4, citrate\u2013phosphate pH 4.2, and hydrochloric acid\u2013potassium chloride pH 2.0. The DOX\u00b7P and P[(Glx-r-PDLy)\u2013g\u2013(LGA)z], respectively, are depicted in x-r-PDLy) random copolyesters made of globalide (Gl) and pentadecalactone (PDL) was prepared by enzymatic ring-opening polymerization (eROP) using Candida antarctica Lipase B . The results obtained in these copolymerizations are shown in 1H and 13C NMR spectra of P(Gl13-r-PDL87) are given in 1H NMR spectra for the whole series are compared in x-r-PDLy) was difficult due to their scarce solubility in the solvents commonly used as eluents, their chain sizes were estimated by end-group NMR analysis. The area of signals due to CH2OH end groups appearing at 3.6 ppm (peak \u201cd\u201d in 2OOC appearing at 4.2 ppm (peaks d and d\u2019), and assuming that chains were ended by both hydroxyl and carboxyl end groups, the degree of polymerization was estimated. Number-average molecular weights (Mn) oscillating in the 9000\u201312,000 g\u00b7mol\u22121 range without showing apparent correlation with composition were measured. Determination of comonomers distribution along the copolymer chain was unfeasible because NMR spectra were scarcely sensitive to sequence distribution effects given the long distance between ester groups and also extremely complex due to the existence of both constitutional and geometric isomerism. In fact, the Gl sample used in this work consisted of a 60/40 mixture of two monounsaturated isomers corresponding to the double bond placed at either 11- or 12-position with an overall diastereomeric E/Z configuration ratio of 78/22. 13C NMR spectra of Gl and PGl are compared in The set of reactions leading to the synthesis of the x-r-PDLy) copolyesters in the absence of oxygen was evaluated by TGA along the 30\u2013600 \u00b0C interval under a circulating nitrogen flow. Their TGA traces along with those recorded for the two homopolyesters, PGl and PPDL, as well as their respective derivative curves are shown in maxTd values closely around those of PGl and PPDL. As it is characteristic of most of aliphatic polyesters and according to what should be expected from the high resistance to heat displayed by PGl and PPDL, the TGA data collected in this study ascertain the great thermal stability of the P(Glx-r-PDLy) copolyesters and reveal their ability to decompose cleanly without hardly leaving residual product.The thermal stability of P(Glx-r-PDLy) copolyesters was performed by recording heating\u2013cooling\u2013reheating cycles over the \u221230 to 200 \u00b0C interval. The first heating and cooling traces are shown in Tm at 42 and 95 \u00b0C, respectively, according to what is recurrently reported for these poly(macrolactone)s  copolyesters were then grafted by ROP of the BLG-NCA. Amino groups initiated the grafting reaction with an amino conversion close to 100%. The GPC analysis of the grafted copolymers provided chromatograms consisting essentially in a single peak \u2013g\u2013(BLG)z] with a TFA/HBr mixture, the COOH functionality of glutamic acid was readily regenerated to render P[(Glx-r-PDLy)\u2013g\u2013(LGlu)z] copolymers which were then duly characterized by NMR. For illustrative purposes, the 1H NMR spectra of P[(Gl13-r-PDL87)\u2013g\u2013(BLG)10] and P[(Gl13-r-PDL87)\u2013g\u2013(LGA)10] are shown in 48-r-PDL52)\u2013g\u2013(BLG)2] and P[(Gl48-r-PDL52)\u2013g\u2013(LGA)2] are included in the SI file as 2\u2013 with any of the signals characteristic of the copolyester \u2013g\u2013(LGlu)z] copolymers were measured by TGA and DSC, respectively. They are collected in x-r-PDLy) copolyesters \u2013g\u2013(LGlu)z] copolymers together with those of the parent polypeptides are shown in 13-r-PDL87)\u2013g\u2013(BLG)10] over the 115\u2013120 \u00b0C range is attributed to the helical transition undergone by the (BLG)10 side chains. The inobservance of this transition in the other copolymers is according to expectations given the short number or/and charged state of the glutamic acid units in such cases.The heating, cooling, and reheating DSC traces recorded from the P[(Glx-r-PDLy)\u2013g\u2013(LGlu)z] copolymers was examined in detail by FTIR using homopolypeptides poly(\u03b3-benzyl L-glutamate) (PBLG) and poly(L-glutamic acid) (PLGA) as reference. The 1800\u20131500 cm\u22121 region of the infrared spectra recorded from samples in the powder form is shown in \u22121 on the spectra of both P[(Gl13-r-PDL87)\u2013g\u2013(BLG)10] and PBLG50, respectively, as well as the absence of absorption around 1630 cm\u22121, are solid indications of the arrangement of the (BLG)10 side chain in \u03b1-helix conformation [48-r-PDL52)\u2013g\u2013(BLG)2] show a conspicuous peak at 1630 cm\u22121 consistent with the presence of a considerable amount of the (BLG)2 in \u03b2-form. The spectra of the unprotected copolymers showed broad amide bands more according with the polypeptide in a disordered state although the band at 1620 cm\u22121 observed in the spectrum of P[(Gl48-r-PDL52)\u2013g\u2013(LGA)2] suggests the presence of some \u03b2-form in this copolymer. These FTIR results are in good agreement with that is commonly accepted for the conformational properties of polypeptides, i.e., the \u03b1-helical conformation is favored by longer amino acid sequences but becomes incompatible with the ionically charged form [13-r-PDL87)\u2013g\u2013(BLG)10] and P[(Gl48-r-PDL52)\u2013g\u2013(BLG)2] copolymers within the 20\u2013200 \u00b0C range \u2013g\u2013(BLG)10] copolymer recorded at real time at temperatures varying over the 0\u2013200 \u00b0C range are shown in x-r-PDLy) copolyesters. According to DSC results, these peaks disappeared at temperatures above melting, i.e., ~75 \u00b0C to be replaced by a broad peak at 0.46 nm arising from the disordered state. Additionally, a set of peaks corresponding to lattice spacings roughly related by the 1:\u221a3:2 ratio,  was observed. As it has been previously reported on several occasions [48-r-PDL52)\u2013g\u2013(BLG)2] are provided in X-ray diffraction (XRD) of the hybrid copolymers in the solid state afforded complementary information in support of the results obtained by both DSC and FTIR. XRD profiles of the P[\u2013g\u2013(LGlu)z], i.e., with the carboxyl group free or in the ester form, determined their solubility and consequently, the procedure suitable for promoting their self-assembly into nanometric entities. Thus, the emulsion-solvent evaporation method was applied to the nonwater-soluble P[(Gl13-r-PDL87)\u2013g\u2013(BLG)10] copolymer to obtain spherical nanoparticles of average diameter around 250 nm displaying an acceptable polydispersity and a zeta potential of \u22123.75 mV. The SEM analysis of these nanoparticles revealed that they have a nearly round shape and are well delineated without showing apparent aggregation \u2013g\u2013(BLG)10] led to the strongly amphiphilic and water-soluble P[(Gl13-r-PDL87)\u2013g\u2013(LGA)10] copolymer. The emulsion-solvent evaporation method successfully used with the protected copolymer was not applicable after deprotection because the carboxylic copolymer is not soluble in the usual volatile solvents required for preparing the organic solution. Conversely, when P[(Gl13-r-PDL87)\u2013g\u2013(LGA)10] was dissolved in water at concentrations above 0.5 mg\u00b7mL\u22121, it became spontaneously self-organized to form micelle-like objects as it was revealed by the DLS analysis. The critical micelle concentration (cmc) of P[(Gl13-r-PDL87)\u2013g\u2013(LGA)10] measured by DLS was 0.15 mg\u00b7mL\u22121 (\u22121 (Deprotection of the benzyl carboxylate groups of P[(Gl mg\u00b7mL\u22121 . The micmL\u22121 (\u22121 . The Z-p3+ group provided that they are located at the particle surface [13-r-PDL87)\u2013g\u2013(LGA)10] as nanocarrier, this copolymer was mixed with DOX\u00b7HCl in water at different LGA:drug molar ratios , and the resulting DOX-loaded micelles were examined by DLS. The results found for 1.25 and 3 mg\u00b7mL\u22121 copolymer concentrations with an LGA:drug ratio of 1:0.4 are shown in DOX is a well-known amphiphilic drug that is commonly used in cancer therapy . The ami surface ,45,46,4713-r-PDL87)\u2013g\u2013(LGA)10] for DOX loading was assessed by estimating the drug-loading efficiency (DLE) and drug-loading content (DLC) for the three LGA:drug molar ratios tested in this study. The bar plot in 13-r-PDL87)\u2013g\u2013(LGA)10]\u00b7DOX to deliver the drug as well as to assess the response of the system to pH changes. The DOX-releasing profiles obtained upon incubation of this conjugate at pH 2.0, 4.2, and 7.4 are compared in The suitability of P[(Glx-r-PDLy) made of two macrolactones, i.e., globalide (Gl) and pentadecalactone (PDL), and covering the whole range of compositions as well as the homopolyesters PGl and PPDL were successfully prepared by enzymatic ROP. The DSC study demonstrated that the copolyesters were crystalline and able to recrystallize from the melt. Crystallinity and density of double bonds in these copolyesters were tuned by composition. Amino acid grafting of P(Glx-r-PDLy) was satisfactorily performed by ROP of BLG-NCA initiated by amino functions previously inserted in the Gl units of the copolyester. The benzyl-protecting group could be then readily removed to produce strongly amphiphilic copolyesters bearing free carboxylate groups in the grafting side chains. Both the amount of grafted Gl units and the average length of the grafting polyglutamate side chains could be accurately controlled so that copolymers displaying different water solubility were prepared. Neutral nonwater-soluble copolymers were able to self-assemble in spherical nanoparticles with an average diameter of 200\u2013300 nm. These nanoparticles based on graft copolyester are unique in containing a crystalline highly hydrophobic core covered by a shell of polypeptide in \u03b1-helical conformation. On the other hand, the water-soluble graft copolyesters bearing ionized glutamic acid side chains produced micelles that were able to load fair amounts of DOX with a high capturing efficiency. Electrostatic ammonium\u2013carboxylate interactions were responsible for the good loading capacity exhibited by the graft copolymer and also for the remarkable changes in the drug delivery profile displayed by the DOX-loaded micelles when incubated in aqueous medium at different pHs.Random copolyesters P(Gl"}
{"text": "Cycled under 6\u2009C (6.6\u2009mA\u2009cm\u22122), a 1.0\u2009mAh\u2009cm\u22122 LiNi0.6Co0.2Mn0.2O2 electrode maintains a substantial 74% of its capacity by pairing with such anode.To achieve good rate capability of lithium metal anodes for high-energy-density batteries, one fundamental challenge is the slow lithium diffusion at the interface. Here we report an interpenetrated, three-dimensional lithium metal/lithium tin alloy nanocomposite foil realized by a simple calendering and folding process of lithium and tin foils, and spontaneous alloying reactions. The strong affinity between the metallic lithium and lithium tin alloy as mixed electronic and ionic conducting networks, and their abundant interfaces enable ultrafast charger diffusion across the entire electrode. We demonstrate that a lithium/lithium tin alloy foil electrode sustains stable lithium stripping/plating under 30\u2009mA\u2009cm 22Sn5 alloy design to address this issue. The composite anode sustains stable Li stripping/plating cycling\u00a0with a low overpotential of 20\u2009mV under 30 mA cm\u22122\u00a0in a commercial carbonate electrolyte.Sluggish lithium diffusion on the surface of Li metal anodes poses a fundamental challenge. Here the authors report a Li/Li However, these conventional LIBs are reaching the limits regarding energy and power density5. The development of rechargeable lithium-based batteries with much higher energy and power density is of vital importance for fast expanding their applications, which certainly relies on breakthroughs in materials and electrode design7. An effective approach is to search for high-capacity anode materials with low potential against cathode materials and high lithium-ion diffusion rate to replace the most widely used graphite material, which delivers a relatively low theoretical capacity of 372\u2009mAh\u2009g\u22121 and slow lithium-ion diffusion rate (10\u221212 and 10\u22126\u2009cm2\u2009s\u22121)8. Lithium metal is a holy grail anode due to its high theoretical specific capacity (3860\u2009mAh\u2009g\u22121) and low potential (\u22123.040\u2009V vs. standard hydrogen electrode). However, the practical application of lithium metal anode suffers from unsatisfactory cyclability, inferior rate capability and safety issues12. The high chemical reactivity makes lithium metal react with the liquid electrolyte to form an unstable solid-electrolyte interphase (SEI) layer. Such SEI layer breaks under considerable volume variation and repairs after the exposure of fresh lithium surface to the liquid electrolyte during cycling, leading to the continual consumption of active lithium and liquid electrolyte, and finally failure of the cell14. The slow lithium diffusion at the electrode/electrolyte interface may cause large overpotential under high current densities and therefore confine the rate capability of lithium metal anode. The infinite relative volume change of lithium metal electrode without a host material leads to the absence of the spatial control of lithium deposition and thereby the growth of lithium dendrites, and eventually causes safety concerns10.Lithium-ion batteries (LIBs) based on intercalation chemistry with the combination of a lithium transition metal oxide (or phosphate) cathode and a graphite anode have been widely used in consumer electronics and are making their way to electric vehicles and grids16, self-healing electrostatic shield17, fluorinated electrolyte18, and high salt concentration20) and interface engineering  for stabilizing the interface between the electrode and electrolyte, use of solid electrolytes for preventing dendrite growth28, and design of stable scaffolds/hosts for minimizing volume change33. These efforts effectively alleviated certain problems of lithium metal anode mainly under moderate/low current densities . However, achieving high rate capability of lithium metal anode still remains challenging34. The issues of lithium metal anode are aggravated under high current densities and high areal capacities, resulting in more severe battery failures. Recently, lithium metal structural design with high electrolyte-accessible surface area showed improved rate capability by reducing the local currents32. However, the increased contact area with electrolytes may lead to severe side reactions and reduce the lifespan of batteries. To date, there have been few significant breakthroughs that enable long-term stable cycling of lithium metal anodes at high current densities  and moderately high areal capacities  with acceptable overpotentials in commercial carbonate electrolytes.Considerable effort has been devoted to tackling the challenges of lithium metal anodes, including electrolyte  and Li3PO4 phases have high lithium-ion diffusion coefficients (10\u2009\u00d7\u200910\u22128 to 10\u2009\u00d7\u200910\u22126\u2009cm2\u2009s\u22121)38 and a surface layer of such phases on lithium metal has proved to be effective in improving lithium diffusion at the electrode/electrolyte interface25. However, high rate capability requires fast lithium-ion diffusion kinetics over the entire electrode, including both the surface and interior, which relies rational electrode design.High rate capability of electrodes requires fast lithium-ion diffusion kinetics22Sn5) integrated networks. The 3D nanostructured metallic lithium network acts as active lithium source of the electrode. The 3D nanostructured Li22Sn5 network keeps composition and structure invariant and acts as a \u201cpathway\u201d for lithium diffusion and electron conduction during the stripping and plating of metallic lithium. The strong affinity between the 3D metallic Li and Li22Sn5 networks, and their abundant interfaces enable small interface impedance and therefore ultrafast lithium diffusion at these Li/Li22Sn5 interfaces. A moderate potential difference (~0.3\u2009V) between the Li22Sn5 and metallic lithium functions as the driving force for lithium diffusion within the entire electrode. As a result, the as-achieved Li/Li22Sn5 nanocomposite delivered ultrahigh-rate capability and good stability for long-term lithium stripping/deposition cycling. Under an ultrahigh current density of 30\u2009mA\u2009cm\u22122 and high areal capacity of 5 mAh\u2009cm\u22122, the Li/Li22Sn5 nanocomposite sustained stable electrodeposition/dissolution over 200 cycles with a very low overpotential of 20\u2009mV in a commercial carbonate electrolyte. Furthermore, by pairing with a Li/Li22Sn5 anode, a substantial 74% of the capacity was maintained for a 1.0\u2009mAh\u2009cm\u22122 LiNi0.6Co0.2Mn0.2O2 electrode cycled at 6 C (6.6\u2009mA\u2009cm\u22122). A Li/Li22Sn5|LiFePO4 cell delivered a high specific capacity of 132\u2009mAh\u2009g\u22121 at 5\u2009C (4\u2009mA\u2009cm\u22122) and showed stable and flat potential profiles with high-capacity retention of 91% for 500 cycles.Here, we report a nanostructured lithium metal foil electrode with in situ formed three-dimensional (3D) interconnected metallic lithium and mixed electron and lithium-ion conductive lithium tin alloy Li\u2009+\u20095Sn\u2009\u2192\u2009Li22Sn5\u2009+\u2009xLi(excess)], featuring 3D interconnected metallic lithium and Li22Sn5 integrated networks with strong affinity and abundant interfaces between metallic Li and Li22Sn5. Since the Li/Li22Sn5 nanocomposite foils with Li/Sn atomic ratios of 44/5 and 88/5 showed same structure and very similar electrochemical performance (discussed in the next section), we performed the detailed materials and battery characterizations using the foil with Li/Sn atomic ratio of 44/5 as an example unless otherwise stated. The Li/Li22Sn5 nanocomposite exhibits a foil structure  analyses were performed after Ar sputtering to reveal the surface electronic state of the elemental composition. Different from a single characteristic peak at 55.0\u2009eV in the high-resolution Li 1s spectrum for the pure lithium metal foil39, two distinct peaks at 55.2\u2009eV and 56.3\u2009eV were observed for the Li/Li22Sn5 nanocomposite, the latter of which was ascribed to the lithium element in Li22Sn5  in the conventional Li metal anode. Thus, the local current density for the metallic Li in the Li/Li22Sn5 composite electrode can be greatly reduced in comparison to that of the conventional Li metal anode when same overall current density is applied.The Li/Libox Fig.\u00a0. During oil Fig.\u00a0. The sigSn5 Fig.\u00a0. In the Sn5 Fig.\u00a0. Scanninoil Fig.\u00a0. After eces Fig.\u00a0. Therefo22Sn5 network forms an lithium diffusion \u201cpathway\u201d over the entire Li/Li22Sn5 electrode. Metallic lithium can easily transport through such \u201cpathway\u201d back and forth. Meanwhile, the 3D nanostructured metallic lithium and Li22Sn5 networks both provide an electron \u201cpathway\u201d over the entire Li/Li22Sn5 electrode. Second, the potential difference (~0.3\u2009V) between Li22Sn5 and metallic lithium can act as the driving force for lithium diffusion through such a \u201cpathway\u201d. These advantages enable fast lithium diffusion over the entire the Li/Li22Sn5 electrode, leading to good rate capability. Furthermore, fast lithium diffusion helps to alleviate the formation of lithium metal dendrites during cycling41 and thus improves the safety of rechargeable lithium metal batteries. Third, the Li22Sn5 is less reactive with the liquid electrolyte than the metallic lithium due to its higher chemical potential. Thus, less electrolyte consumption and longer cycle life can be expected. Fourth, the 3D interconnected Li22Sn5 network remains invariant in the composition and structure on cycling and is capable of working as a stable host for stripping/plating of lithium metal and thus addressing the challenge of significant volume change.Such unique nanostructure allows fast lithium diffusion over the entire electrode and enables stable lithium stripping/plating cycling under high current densities without lithium dendrite growth due to its multiple advantages: First, due to the high lithium-ion diffusion coefficient, strong lithium affinity and abundant interfaces to metallic lithium, the 3D nanostructured Li22Sn5 electrode for high-power-density lithium metal batteries, stripping/plating measurements were performed with a practical high areal capacity of lithium (5\u2009mAh\u2009cm\u22122) at various high current densities  in symmetric cells using commercial carbonate-based electrolytes. Figure\u00a022Sn5|Li/Li22Sn5 symmetric cells and the Li|Li counterparts for different cycles at 5\u2009mA\u2009cm\u22122 with fixed areal capacity of 5\u2009mAh\u2009cm\u22122. Supplementary Fig.\u00a022Sn5|Li/Li22Sn5 symmetric cells. For Li|Li symmetric cells cycled at 5\u2009mA\u2009cm\u22122, a high overpotential of 0.65\u2009V was observed at the beginning of the first cycle , indicating much better charge carrier transport through the entire Li/Li22Sn5 electrode. The overpotential of the Li/Li22Sn5 electrode further decreased and remained under 5\u2009mV after five cycles after the surface activation  and stable cycling for 200 cycles  and LiFePO4 (LFP) cathodes. The electrochemical measurement of NCM|Li/Li22Sn5 and NCM|Li cells was performed at increasing current rates based on a theoretical specific capacity of 170\u2009mAh\u2009g\u22121 for NCM and ~6.5\u2009mg\u2009cm\u22122 active mass loading , such a NCM|Li/Li22Sn5 cell can fill up 74% of its capacity within 10\u2009mins, suggesting the good rate capability of the Li/Li22Sn5 electrode. Similar rate capacities were achieved on five NCM|Li/Li22Sn5 cells, showing the repeatability |Li/Li22Sn5 cells exhibited a stable discharge capacity of 1\u2009mAh\u2009cm\u22122 at 33.1\u2009mA\u2009cm\u22122 (15\u2009C), suggesting the good stability of the Li/Li22Sn5 electrode at ultrahigh current density  and low areal capacity ratio of negative to positive electrodes  were further built and their electrochemical performance was investigated. A NCM|Li/Li22Sn5 full cell delivered an initial capacity of 3.33\u2009mAh\u2009cm\u22122 for the 1st cycle and 2.80\u2009mAh\u2009cm\u22122 for the 100th cycle at 4\u2009mA\u2009cm\u22122, with a capacity retention of 84 %  for the 1st cycle and 120\u2009mAh\u2009g\u22121 for the 500th cycle, delivering high-capacity retention of 91%. Also, the capacity vs. cycle number profile of the LFP|Li/Li22Sn5 cell showed little fluctuation during cycling  can be an ideal Li reservoir to evaluate the Coulombic efficiency of a Li metal anode since it has near 100% Coulombic efficiency and does not provide Li during cycling. 10\u2009mAh\u2009cm\u22122 Li/Li22Sn5 electrode and pristine Li metal electrode were paired with ~2.8\u2009mAh\u2009cm\u22122 of LTO at 1.4\u2009mA\u2009cm\u22122 (0.5\u2009C) in a commercial carbonate electrolyte. The capacity of the LTO|Li cell started to quickly decay at the 30th cycle, showing a Coulombic efficiency of 91.2%, and the LTO|Li cell lost all its capacity after 60 cycles  for 75 cycles, giving a higher Coulombic efficiency of 96.5%  elemental mapping images exhibit strong signals of C, F, and P elements on the surface layer and weak signals on the bottom layer  extend within the structure as cycling takes place. The formation of this loose interphase consumes active lithium and electrolyte, suggesting the serious corrosion of the bulk Li metal electrode. In contrast, the Li/Li22Sn5 electrode preserves its dense structure and the signals of C, F, and P elements are very weak over the entire cross\u00a0section . Although the volume change at the electrode level would be reduced by using these mechanical supports, side reactions between the electrolyte and electrode would be enhanced due to the movement of electrode/electrolyte interface  by pairing such a Li/Li22Sn5 anode. High\u00a0capacity retention of 91% and stable potential profiles were achieved for an LFP|Li/Li22Sn5 cell for 500 cycles at 5\u2009C (4\u2009mA\u2009cm\u22122). These results suggest the potential application of Li/Li22Sn5 nanostructured electrode in lithium metal batteries with high power and long lifespan.In this work, we demonstrated that, a unique nanostructured lithium metal electrode with 3D interconnected metallic lithium and Li22Sn5 foil was realized using a repeated folding and calendaring method, and a spontaneous reaction between metallic lithium and tin. A tin foil and two lithium foils with same size and designed ratio of Li/Sn were first stacked to form a Li\u2013Sn\u2013Li \u201csandwich\u201d and pressed together by mechanical rolling using a roll squeezer in an Ar-filled glove box. The overall thickness of the produced Li\u2013Sn\u2013Li foil was 0.5\u2009mm, which could be changed by tuning the spacing between the two rollers of the roll squeezer. The Li\u2013Sn\u2013Li \u201csandwich\u201d was folded and rolled repeatedly, which led to the gradual increase in the number and reduction in the thickness of each metal layer. Such process produced rich amount of fresh Li/Sn interfaces, where the metallic lithium and tin reacted spontaneously, and formed a 3D Li22Sn5 framework with excess lithium evenly embedded in [(22\u2009+\u2009x)Li\u2009+\u20095Sn\u2009\u2192\u2009Li22Sn5\u2009+\u2009xLi (excess)]. The as-achieved Li/Li22Sn5 foil was cut into 12-mm-diameter electrodes for electrochemical measurements.The fabrication of the Li/Li22Sn5 foil were investigated using XRD , field-emission scanning electrode microscopy , X-ray photoelectron spectroscopy  and transmission electron microscopy . Before the XRD measurement, samples were loaded on a glass slide and covered with Kapton tape in the Ar-filled glove box to avoid the reactions between the samples and ambient air. Samples for SEM, XPS, and TEM measurements were sealed in the Ar-filled glove box before being transferred into the chamber of the equipment. To observe the Li22Sn5 framework of the Li/Li22Sn5 foil, metallic Li was electrochemically stripped away using a Li/Li22Sn5|Li cell configuration. The sample for characterization was rinsed by dimethyl carbonate. In situ optical microscopy  observations of lithium metal electrodeposition on the Li/Li22Sn5 and the pristine Li foil substrates were carried out using a side-by-side-type cell . The Li metal counter and reference electrodes and GFF separator were assembled in an argon-filled glove box with less than 1 ppm of oxygen and moisture. The monitoring of the Li metal was performed by a BioLogic SP-300.The morphology, microstructure, and component of the Li/Li6) in 1:1:1 ethylene carbonate (EC)/propylene carbonate (PC)/diethyl carbonate (DEC) with 10% fluoroethylene carbonate (FEC) and 1% vinylene carbonate (VC). Celgard 2300  was used as the separator. Battery performance was investigated in a galvanostatic mode at various current densities using a LAND battery tester. The electrochemical impedance spectroscopy (EIS) measurement was performed on a Biologic VMP3 system. The NCM and LFP electrodes were fabricated with 80% active materials, 10% polyvinylidene fluoride (PVDF) and 10% carbon black. The active mass loadings of NCM and LFP electrodes were ~6.5 and ~5.0\u2009mg\u2009cm\u22122, respectively. The current rates for NCM and LFP are based on their practical specific capacities of 170\u2009mAh\u2009g\u22121 and 160\u2009mAh\u2009g\u22121, respectively. For full cell measurement with high mass loading, the active mass loading of NCM electrode was ~23.7\u2009mg\u2009cm\u22122.2032 coin-type cells were assembled in an Ar-filled glove box for electrochemical measurements. The electrolyte was 1\u2009M lithium hexafluorophosphate (LiPFSupplementary InformationDescription of Additional Supplementary FilesSupplementary Movie 1Supplementary Movie 2"}
{"text": "Uniform migration of lithium (Li) ions between the separator and the lithium anode is critical for achieving good quality Li deposition, which is of much significance for lithium metal battery operation, especially for Li\u2013sulfur (Li\u2013S) batteries. Commercial separators such as polypropylene or polyethylene can be prepared by wet or dry processes, but they can indeed cause plentiful porosities, resulting in the uneven Li ion stripping/plating and finally the formation of Li dendrites. Thence, we constructed an atomic interlamellar ion channel by introducing the layered montmorillonite on the surface of the separator to guide Li ion flux and achieved stable Li deposition. The atomic interlamellar ion channel with a spacing of 1.4\u00a0nm showed strong absorption capacity for electrolytes and reserved capacity for Li ions, thus promoting rapid transfer of Li ions and resulting in even Li ion deposition at the anode. When assembled with the proposed separator, the Coulombic efficiency of Li||Cu batteries was 98.2% after 200 cycles and stable plating/stripping even after 800\u00a0h was achieved for the Li||Li symmetric batteries. Importantly, the proposed separator allows 140% specific capacity increase after 190 cycles as employing the Li\u2013S batteries.The online version contains supplementary material available at 10.1186/s11671-021-03508-z. Nevertheless, the existence of irregular pores in commercial separators can lead to poor quality of deposited lithium, which can result in dendritic formation and consuming more lithium metals and electrolytes during the repeated plating/stripping processes [With ever-increasing demand for high-performance electronic applications such as electric vehicles and portable systems, the research focused on energy storage devices with high energy density and long cycle life has received extensive attention \u20133. Specirocesses , 8.Consequently, Li dendrites could form the \u201cdead\u201d Li metal when they are easily broken away from the conductive collector, resulting in low Coulomb efficiency (CE) and irreversible capacity loss , 10. Add\u22122. To improve the\u00a0critical\u00a0current\u00a0density of LMBs, the addition of inorganic particles within the separator to improve the porous structure and increase critical current density can be another effective method. However, uneven pore distribution in the separator can generally lead to disordered diffusion of Li ions during the plating/strip process, leading to the uneven deposition of Li ions and the formation of Li dendrites [Among the components of LMBs, the separator not only plays a key role to segment anode and cathode electrodes for avoiding short circuit, but also directly affects the performance of batteries via authorizing Li ion migration , 20, 21.endrites . Therefo\u22122 with a capacity of 1 mAh cm\u22122. Moreover, the batteries with Li-MMT@PP separators also deliver good cycle stability with 140% specific capacity increased as compared to PP separators after 190 cycles at 0.5\u00a0mA\u00a0cm\u22122 with sulfur loading of 1.5\u00a0mg\u00a0cm\u22122.In this work, aiming to guide the migration of Li ions evenly through the separator, a Li-based montmorillonite (Li-MMT) modified composite separator is fabricated via constructing atomic interlamellar ion channels on the PP separator. The as-prepared separator embedded with interlamellar spacing (~\u20091.4\u00a0nm) provides abundant active sites for Li ion diffusion and electrolyte wetting . Thus, t2SO3) were obtained from Sinopharm Chemical Reagent Co., Ltd. Sulfur powder (S) and acetylene black (denoted as C powder) were purchased from Alfa Aesar. Celgard 2500 was used as separator. The Li-MMT powder was prepared via cation exchange. Typically, 0.2\u00a0M H2SO3 solution was used to covert the cations within the interlayer of MMT to ions and then LiOH solution was used to make the solution at PH\u2009=\u20097 as well as covert the hydrogen ions to the Li ions. Freeze-drying technology was used to collect the Li-MMT powder. For the preparation of Li-MMT@PP separator, only one side of the separator was coated the Li-MMT slurry that Li-MMT and PVDF powder with mass ratio 9:1 were uniform dispersed in the NMP solution and the average mass loading of Li-MMT is only ~\u20090.15\u00a0mg\u00a0cm\u22122.Montmorillonite (MMT), polyvinylidene fluoride (PVDF), and lithium hydroxide (LiOH) were purchased from Aladdin. The N-methyl pyrrolidone (NMP) and sulfuric acid (HX-ray diffraction (XRD) spectrum using a UltimaIV diffractometer with CuK\u03b11 radiation (\u03bb\u2009=\u20091.4506\u00a0\u00c5) was employed to investigate the crystal structure of Li-MMT powder. High-resolution transmission electron microscope (HRTEM) was used to observe the interlayer of Li-MMT and the scanning electron microscope  was used to analyze the surface morphologies.\u22122 to use as the Li sources. The electrolyte was 1\u00a0M bistrifluoromethanesulfonimide lithium salt (LiTFSI) in a mixture of 1,3-dioxacyclopentane (DOL) and 1,2-dimethoxyethane (DME) (1:1 v/v) with 2\u00a0wt% lithium nitrate (LiNO3) as additive. For the Li\u2013S battery tests, the S cathode was prepared via our previous method that The C and S powder were mixed and heated at 155\u00a0\u2103 for 24\u00a0h with a mass ratio of 8:2 [\u22122 which was coated on the carbon coated aluminum\u00a0foil. The batteries were assembled via stainless steel coin battery (CR2025) in an argon-filled glove box. Li foil was used as anode. 20 uL electrolyte was used to wet the lithium anode and additional 20\u00a0\u00b5L was used to wet the separator and cathode. Before testing, the assembled Li\u2013S batteries was rest 12\u00a0h and then 0.2\u00a0mA\u00a0cm\u22122 with 5 cycles was used to active the battery performance. The electrochemical test system was CT2001A battery test system . The cut-off voltage was 1.7\u20132.7\u00a0V. Electrochemical impedance spectroscopy (EIS) was tested by Electrochemical workstation .For the Li||Cu and Li||Li battery tests, typically, the Cu foils were firstly washed with deionized water and ethanol three times to remove the possible impurities. Then, the lithium foil was cut into circles with area of 1\u00a0cmo of 8:2 . And the+, Na+, Mg2+, Ca2+, etc. Therefore, cation exchange method is necessary to covert the host cations to Li ions [To illustrate the lithium ion flux across the commercial PP separator, the schematics are shown in Fig.  Li ions . The bas Li ions . With th Li ions , 25. TheThe precise measurement of interlayer space of Li-MMT is shown in Fig.\u00a0\u22122 with a capacity of 1 mAh cm\u22122. During the tests, it can be observed that all of the CE present an upward trend in the first 5 cycles, caused by the surface passivation of Li deposition. However, higher average CE in the first 5 cycles of Li-MMT@PP separator highlights the advantages that the deposited Li metal suffers lower side reaction with the liquid electrolyte as coupled with Li-MMT@PP separator. With the reduplicative plating/stripping, the shortcoming of PP separator is gradually exposed that the assembled Li||Cu battery only endures ~\u200950 cycles and its CE decreases sharply to 60% and almost to zero after 150 cycles. On the contrary, the CE of Li||Cu battery assembled with Li-MMT@PP separator still delivers stable cycles with lower over-potential  measurements show the pore size distribution of Li-MMT powder within the scope of 1\u20133\u00a0nm   measurement. As shown in Fig.\u00a0+). The cyclic voltammetry (CV) tests were conducted and presented in Additional file \u22121 with negligible voltage hysteresis. However, for the PP separator, only ~\u2009210 mAh g\u22121 capacity is observed, indicating that partially released long-chain polysulfides  are not involved in the subsequent redox reaction to contribute the capacity. The higher discharge capacity during the first plateau implies the Li-MMT layer can effective avoid the shuttle of soluble long-chain polysulfides to the Li anode surface. At the second conversion steps, obviously, for the PP separator, small amounts of short-chain polysulfides are formed due to the existence of shuttle effect within the ether-based electrolyte, which has been confirmed by our previously work [\u22121. Long-term cycles with good stability are the primary goals for the commercial batteries. The long-term cyclability of Li-MMT@PP separators is shown in Fig.\u00a0To demonstrate the potential of Li-MMT@PP separator in the practical application of Li metal batteries, the S cathode with S loading of 1.5\u00a0mg\u00a0cmsly work . In contsly work . The exc\u22121  with a 100% CE after 190 cycles at the current density of 0.5\u00a0mA\u00a0cm\u22122 with the sulfur loading of 1.5\u00a0mg\u00a0cm\u22122.In summary, the interatomic ion channel (Li-MMT) was constructed on the porous PP separator to modulate the Li ion flux and then guide the even deposition of Li ion on the Li anode during the electroplating/stripping. Due to the wide interlayer space (~\u20091.4\u00a0nm) of Li-MMT, the Li-MMT@PP separator greatly ensures the cyclability of Li metal anode by unifying the flow direction of lithium ions, resulting in the uniform deposition of Li ions on the anode surface, thus forming a dendritic free lithium anode. As assembled with the Li-MMT@PP separator, the Li\u2013S battery exhibits a remarkable reversible capacity of 776 mAh gAdditional file 1:\u00a0Table S1. The comparison of Li-MMT@PP separator with previously reported functional separator. Fig. S1. BET results of Li-MMT powder. Fig. S2.\u00a0Cyclic voltammograms of PP and Li-MMT@PP separator, recorded at 0.1\u00a0mV/s."}
{"text": "Li metal batteries have been considered as the most promising batteries with high energy density for cutting-edge electronic devices such as electric vehicles, autonomous aircrafts, and smart grids. However, Li metal anode faces the issues of safety and capacity deterioration, which are closely related to Li dendrite growth. In this paper, we review the main strategies to improve the performance of Li metal anode. Due to Li dendrite's catastrophic influence, suppression of Li dendrite growth is prerequisite for each strategy. Apart from Li dendrite, interfacial resistance between electrolyte and electrode, ionic conductivity of electrolytes, mechanical strength, and volume fluctuation of Li metal anode are also discussed in these strategies. We outline these strategies based on the classifications of constructing solid electrolyte interphase, engineering of solid-state electrolyte and adopting matrix for Li metal anode. Each strategy is illustrated and discussed in detail by exemplification. For better understanding, some important theories related to Li metal anode have been also introduced. Finally, the outlooks for future research of Li metal anode are presented. Li-ion batteries (LIBs) have achieved great success since their commercial application in portable electronic devices in 1991  and lowest electrochemical potential (\u22123.04 V vs. the standard hydrogen electrode), and consequently it has been considered as an ideal anode for the rechargeable batteries such as Li-S and Li-O2 batteries  diffusion of Li+ ions, rather than one direction diffusion in flat surfaces, thereby accelerating Li precipitation on the tips , but the different dendrites have a similar mechanism on their formation and growth .SEI was firstly discovered by Peled , and it e of SEI . AccordiThe most severe problem of Li metal anode is Li dendrite growth on its surface, which not only causes catastrophic safety hazards, but also greatly deteriorates the performance of Li metal anode. Therefore, suppression of Li dendrite growth is prerequisite for each strategy. Nevertheless, some methods are effective to suppress Li dendrite formation, but they can also induce disadvantageous influence on the property of LMB at same time. Therefore, an optimal strategy should maximize the performance of Li metal anode while it can effectively suppress the formation of Li dendrites.4, LiBr, and LiAsF6  and organ polymers. Carbon is one of the commonly used inorganic materials for artificial SEI film. Zhang et al. have successfully coated a-CNx layer on the Li metal anode by magnetron sputtering technique  (PDMS) layer using spin-coating method, and then the layer was treated by HF acid, intentionally constructing nanopores as the pathways for transporting Li+ ions in the PDMS layer  can probably settle these safety issues .Synthesis method, including mechanical mixing and + ions. In the composite electrolyte, polymer can act as a binder to connect the inorganic electrolyte while maintaining high mechanical flexibility. The investigation conducted by Zhang et al. indicated that the utilization of nanosized solid inorganic electrolyte can greatly increase its contact area with PEO, and thus it significantly enhances the ionic conductivity of the composite electrolyte .Nanosized inorganic electrolytes. It is known that nanocrystallization can lead to high ionic conductivity because it can improve the diffusion routes for Li6.4La3Zr2Al0.2O12 (LLZO) nanofiber by electrospinning way, and then added the fillers into the PEO matrix, resulting in a 3D inorganic/polymer network. In the electrolyte, the randomly distributed nanofibers together with the interconnected nanofibers constitute the 3D networks, which are the framework for transporting continuous Li+ ion . Compared with 0D inorganic particles, 1D nanowire filler can induce larger contact area between the inorganic and polymer electrolytes, hence ameliorating the mechanical performance. In addition, 1D inorganic fiber fillers are very beneficial to form an ionic conduction networks in the composite electrolyte, significantly increasing the ionic conductivity of the electrolyte. Fu et al. synthesized a garnet-type LiApart from the ionic conductivity, the interfacial resistance between electrode and electrolyte is another important issue in the solid-state electrolyte.2O3 with an atomic layer deposition technique 3 with a rhombohedral structure react with Li metal anode at room temperature to form a Li+-conducting passivation layer 3 and also are wet by Li, thus resulting in a small Li+ charge transfer resistance at the interface. Recently, introduction of a third phase is commonly used to decrease the interfacial resistance. For example, addition of little liquid electrolyte can effectively wet the solid-state electrolyte, and ameliorate the contact between the Li metal anode and electrolyte, considerably decreasing the interfacial resistance , cells with GF layers exhibited enhanced coulombic efficiencies . Using graphene oxide (GO) as a porous matrix for Li metal, Lin et al. prepared Li-reduced oxide (rGO) by a facile \u201cspark\u201d technique  at 10 C using lithium cobalt oxide cathode.Liang et al. utilized lithiophilic oxidized polyacrylonitrile nanofiber (PAN) as a matrix to modify Li metal anode and the investigation indicated that the nanofibers can maintain the stable cycling performance of Li metal anode with a high coulombic efficiency (~97.4%) for 120 cycles at the current density of 3 mA cm+ ions to plate in it, instead of on the tip of the formed Li dendrites, consequently suppressing the Li dendrite growth. This assumption was verified by preparing Li7B6 with 3D structure (Cheng et al., 7B6 anode achieved a dendrite-retarded morphology at a high current density of 10 mA cm\u22122, while the normal Li plate anode rendered severe dendrite formation. Besides Li7B6, several structured Li metal anodes have been also developed, such as carbon nanotubes, graphene materials, carbon nanofibers, and Cu nanowires. The matrix plays a pivotal role for Li metal anode in that it can not only suppress Li dendrite growth, but also effectively relieve the large volume change during Li plating/stripping. However, the ratio of the matrix in the composite Li metal anode needs to optimize to ensure the high volume/mass energy density of the composite anode.A Li metal anode with a conductive matrix possesses excellent electrical conductivity and unique surface chemistry, which can obstruct and recycle the dead Li. Adoption of conductive matrix for Li anode has been demonstrated to be a successful approach to inhibit Li dendrite formation (Cheng et al., For better grasping the essential of the strategies in this review, we summary the main purpose and characteristic for each strategy/method, which are listed in To make Li metal anode to be a viable technology, many strategies have been proposed to overcome the dilemmas of Li metal anode, including the growth of Li dendrites, volume fluctuation, low mechanical strength, and high interfacial resistance between electrolyte and electrode. In this review, we outlined the main strategies to improve Li metal anode according to the classifications of constructing SEI, engineering of solid-state electrolyte and adopting matrix for Li metal anode. For better understanding, we illustrated the preparation, characteristic and mechanism of each strategy in detail by exemplification. Although great progress has been made in theoretical and experimental investigations, Li metal anode is in the early stage of LMBs development. We think that the following researches on Li metal anode should be further strengthened.+ ions transport through the interface of ceramic/polymer in the inorganic/polymer electrolyte while later investigations demonstrated that the ceramic phase is the transport channel for Li ion. This discovery rendered a revolution in designation of the composite electrolyte.More detailed and deeper theories on Li anode should be developed to guide the design of SEI, solid-state electrolyte and structured anode. For example, several models have been proposed to explain Li nucleation and growth, but they are limited to some specific parameters. A more general mechanism should be need to understand the whole process for Li dendrite growth. For another example, previous theories held that the LiA joint strategy is required to solve the problems of Li metal anode. Although each strategy has its unique advantage to deal with a dilemma of Li metal anode, it also has its own fatal weakness. For example, solid polymer electrolyte has enough mechanical strength to suppress the Li dendrite, but its ionic conductivity is very low. The joint strategy combining various methods can fully takes advantages of each method, and the synergetic effect among them could ultimately make Li metal anode a viable technology.With the development of science and technology, the advanced electronic devices are successively emerging and they urgently need high energy density batteries as their power sources. In addition, the rise of nanotechnology and advanced characterization technique render the golden age for LMBs researches. The problems hindering the application of Li metal anode will be perfectly solved, and the era of LMBs will come true in the near future.All authors wrote the manuscript. ZH and YZ supervised the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The handling editor declared a past co-authorship with one of the authors YZ."}
{"text": "The metal chloride perovskite protection strategy could open a promising avenue for advanced lithium metal batteries.Fabricating a robust interfacial layer on the lithium metal anode to isolate it from liquid electrolyte is vital to restrain the rapid degradation of a lithium metal battery. Here, we report that the solution-processed metal chloride perovskite thin film can be coated onto the lithium metal surface as a robust interfacial layer to shield the lithium metal from liquid electrolyte. Via phase analysis and density functional theory calculations, we demonstrate that the perovskite layer can allow fast lithium ion shuttle under a low energy barrier of 0.45\u2009eV without the collapse of framework. Such perovskite modification can realize stable cycling of LiCoO Metal halide perovskite is well-known for the high absorption coefficient; however, its Li-ion transport property remains poorly explored. Here the authors coat an ion conducting metal chloride perovskite interfacial layer on the Li metal anode, enabling good battery performance. It stimulates extensive search of new materials to meet the increasing demands of high-energy densities of rechargeable batteries4. With 10 times the specific capacity of graphite (3860 versus 370\u2009mAh\u2009g\u22121), metallic lithium (Li) is among the most promising candidates for future anode to support high-energy density batteries6. However, the practical application of Li metal batteries is hindered by a major issue associated with loose structure of deposited Li during cycling, which would result in accelerated electrolyte \u201cdry-out\u201d failure and probably short circuit of the battery7.Rapidly developing electronic devices provide us with better product experience, but simultaneously set a higher standard for energy storage systems9. In the early stage to reinforce the SEI layer, various electrolyte additives, including vinylene carbonate10, LiNO311, and fluorinated ethylene carbonate12, have been tried, but the obtained mechanical strength is not enough to suppress the growth of Li dendrites. Lately, the fabrication of artificial SEI protection layer via pre-treatment methodology has been proposed. A series of artificial SEI protection layers, including carbon spheres13, polymers15, alloy layer16, composite films18 have been applied on the surface of Li metal anodes. Despite these artificial SEI layers exhibited the capability to suppress the growth of Li dendrites19, the ultra-dense deposition of Li along with the suppressed detrimental side reactions with liquid electrolyte have not been achieved due to the permeation of liquid electrolyte throughout the protection layers.The solid electrolyte interphase (SEI) layer on the surface of Li metal anode plays a predominate role in controlling the deposition of Li metal20. To design a dense interfacial layer for Li+ ion conduction, the framework structure of material should own continuous channels for Li+ ion migration22. The perovskite structure with the general formula ABO3  provides a highly symmetric host to generate a classical Li+ ion conductor, lithium lanthanum titanate (LLTO)23, but the fabrication of this perovskite host needs high temperature sintering25, which hindered the application of LLTO thin film on the surface of Li metal anode. Similar to the LLTO perovskite solid electrolyte, other ceramic Li+ ion conductors with high shear modulus are also very challenging to be coated as thin films on the Li metal anodes due to their critical preparation conditions27.Directly fabricating a highly ionic conductive dense thin film on the surface of Li metal anode is a promising route to fully shield the Li metal from liquid electrolyte3  can be produced as the form of thin film via a facile solution-processable method30. The metal halide perovskites have shown high photoelectric conversion efficiency in planar solar cells and attracted intensive attention in the past decade31. Aside from their unique photo-electronic properties, the framework feature of metal halide perovskite can realize the Li+ ion intercalation33, indicating its potential as a fast Li+ ion transport material. In addition, to be an electronic insulating layer, metal halide perovskites can get its bandgaps enlarged by using chloride ions as the halide sources34. These features of metal chloride perovskite make it as an attractive interfacial material with high Li+ ion transport capability to isolate the Li metal anode from liquid electrolyte.As a new kind of perovskite, metal halide perovskite with a general formula ABX+ ion transport throughout its framework with a low energy barrier, endowing homogenous ion flux with excellent isolation from liquid electrolyte. Thus, the ultra-dense deposition of Li with high areal capacity (30\u2009mAh\u2009cm\u22122) induced by a high current density of 5\u2009mA\u2009cm\u22122 is demonstrated and the Li metal anode under the protection of metal chloride perovskite exhibits a stable Li stripping/plating voltage curve (<40\u2009mV) at the current density of 1\u2009mA\u2009cm\u22122 for over 800\u2009h. Attractively, with lean electrolyte (20\u2009\u03bcl\u2009mAh\u22121) and thin Li foil (50\u2009\u03bcm), the LiCoO2-Li cell with an areal capacity of 2.8\u2009mAh\u2009cm\u22122 can be cycled for more than 100 cycles.Herein, we develop a solid-state transfer process to apply solution processed metal chloride perovskite thin film as a new type of interfacial layer onto the Li metal anode. The metal chloride perovskite interfacial layer can allow fast Li+ ion transport gradient layer model to illustrate the shielding mechanism of perovskite thin film for the dense deposition of Li metal  calculation to simulate the migration of Li+ ions in the perovskite framework  and the potential energy surface along the migration pathway of Li+ ion is shown in Fig.\u00a0+ ion at its initial state, transition state and final state are displayed as the insets. To accommodate the migration of Li+ ions, the lattice undergoes mild yet measurable distortion, accompanied by the orientation adjustments of MA ion due to the nonuniform distribution of electric potential in the lattice 35, indicating the ease of Li+ ion conduction in the metal chloride perovskite framework.To unravel the conduction mechanism of Li3 or MAPbCl3 with high film quality on the substrates via solution spin-coating technique at first . Such highly oriented crystalline structure is consistent with our proposed framework structure in Fig.\u00a0+ ion transport throughout the perovskite layer.To demonstrate the gradient layer model of the perovskite, we fabricated the metal chloride perovskite thin films composed of MASnCl+ ions appearing at the potential peak higher than 1\u2009V  in comparison to the flat current curve in the CV of bare substrate without the characteristic Li+ ion intercalation process. The other CV peaks with the potential around 0.4\u20130.7\u2009V belong to the reduction process of interfacial perovskite to Li-Sn or Li-Pb alloy, and the final state of as-formed alloy is Li17Sn4 or Li17Pb438. As the potential approaches to \u22120.1\u2009V, the current density of the substrate with MASnCl3 or MAPbCl3 is around 1.5\u2009mA\u2009cm\u22122, much higher than the current density of bare substrate (~0.6\u2009mA\u2009cm\u22122). Similarly, at the symmetric voltage position near +0.1\u2009V, the perovskite-modified substrates also present much higher response currents, indicating the promotion of Li plating/stripping kinetics by the perovskite thin films. To further show the unique role played by the perovskite framework rather than as-formed Li\u2013M alloy layer, we compared the CV curves of MAPbCl3 and PbCl2-coated substrates  of Li plating on these thin film-coated substrates and compared them to that of bare substrate. As shown in Fig.\u00a0trate ~0.\u2009mA\u2009cm\u22122.3 and 15 % for MAPbCl3), corresponding to the absolute quantities  of perovskites, was reduced to form Li17Sn4 or Li17Pb4 layer. The limited perovskite consumption independent of the original thickness values of perovskite layer implies that the perovskite thin films are not completely reduced due to the formation of insulating LiCl layer, as well as the intrinsic property of wide band gap of metal chloride perovskite to isolate electrons coming from the current collector. Therefore, the finally formed gradient interfacial layer is consisted of perovskite framework on the top surface followed by the Li\u2013M alloy/LiCl layer beneath, which is evidenced by the depth X-ray photoelectron spectroscopy (XPS) analysis  analyses  in vertical direction near the surface, implying a perovskite-alloy-lithium interfacial layer on the Li metal anode surface to resist the liquid electrolyte corrosion. Similarly, the ultra-dense Li deposition can be also realized on the MPC-Li anode with the retention of perovskite protection layer  was performed to deeply expose the cross-sectional morphologies of bare Li and MSC-Li after 2\u2009h Li plating under a current density of 4\u2009mA\u2009cm+ ion transfer kinetics caused by as formed nonuniform SEI layer. The symmetric cell of MPC-Li electrodes also shows attractive advantages with low overpotential of around 40\u2009mV and a stable cycling life of over 600\u2009h , which indicates the chemical stability of perovskite on the top surface of MSC-Li and high consistence with the XRD result. The XPS result is similar for MPC-Li electrode, showing that the lead on the top surface of MPC-Li electrode always retained the oxidation state before and after cycling /perovskite coated Li cells at a high rate of 5\u2009C. As shown in Fig.\u00a0\u22121 at 400th cycle. In contrast, the cells using MSC-Li and MPC-Li anode show stable cycling for more than 500 cycles with a low capacity decay rate of 0.07 % per cycle. The charge/discharge voltage profiles in Fig.\u00a0To demonstrate the efficiency of perovskite protection for Li metal batteries, we tested the electrochemical performance of Li\u22122), limited Li source  and lean electrolyte (20\u2009\u03bcl\u2009mAh\u22121) in the LiCoO2|Li cell at 0.5\u2009C. As shown in Fig.\u00a0We further explored the performance of perovskite protected Li metal battery by applying strict conditions including high-areal capacity cathode  and 0.948\u2009g of stannous(II) chloride  were dissolved in 10\u2009mL of N, N-dimethylformamide  to form MASnCl3 precursor solution with a concentration of 0.5\u2009M. 0.676\u2009g of methylamine hydrochloride . For MAPbCl3 perovskite thin films, 2.781\u2009g of Lead chloride  were dissolved in 10\u2009mL dimethyl sulfoxide  to form MAPbCl3 solution with a concentration of 1\u2009M. Each type of as-prepared perovskite precursor solution was spun-coated onto UV\u2013ozone treated stainless steel foil substrate (50\u2009\u03bcl for every 1\u2009cm\u22122 of substrate area) at 2000\u2009r/min for 90\u2009s. Then the perovskite coated stainless steel foils were annealed at 70\u2009\u00b0C for 5\u2009min. All the MASnCl3 and MAPbCl3 thin films were fabricated and stored in an argon-filled glove box with <1\u2009ppm O2 and <1\u2009ppm H2O.Stainless steel foil (50 or 100\u2009\u03bcm) was washed with deionized water, acetone and ethanol in an ultrasonic cleaner  sequentially before drying in an oven at 70\u2009\u00b0C for 30\u2009min. For MASnCl\u22122 for 10\u2009s. The perovskite thin film can be easily transferred from the stainless steel substrate onto the surface of Li metal after separating the Li foil from the stainless steel substrate. MSC-Li and MPC-Li electrodes are thus obtained. The transfer operations were performed at the room temperature of 25\u2009\u00b0C in the glove box with <1\u2009ppm O2 and <1 \u2009ppm H2O.Li metal foil  was polished to remove the oxidation layer to obtain a smooth and shinning surface. Then, the as-treated Li foil was pressed onto the perovskite-coated substrate with a pressure of 10\u2009N\u2009cm\u03bb\u2009=\u20090.15406\u2009nm). The samples were tested in the Kapton tape-sealed devices for the XRD characterizations . All the Li electrodes unloaded from coin cells were washed with a mixed solvent of ethylene carbonate/dimethyl carbonate (EC:DMC\u2009=\u20091:1 vol%) and thoroughly dried before characterizations. All the characterizations were performed at the room temperature of 25\u2009\u00b0C.XRD measurements were carried out on a X-PERTPRO powder X-ray diffractometer operating at 40\u2009kV and 30\u2009mA with a scanning step of 0.02 degree, using Cu K radiation (6 in ethylene carbonate/dimethyl carbonate (EC:DMC\u2009=\u20091:1 vol%). In deposition experiments tests using perovskite-coated stainless steel foils as electrodes, electrolyte containing 1\u2009M LiPF6 in ethylene carbonate/dimethyl carbonate (EC:DMC\u2009=\u20091:1 vol%) with 2\u2009vol% fluorinated ethylene carbonate (FEC) was applied. Supplementary Tables\u00a06 in ethylene carbonate/dimethyl carbonate (EC:DMC\u2009=\u20091:1 vol%) with 1\u2009vol% fluorinated ethylene carbonate (FEC) was applied. The Li4Ti5O12 (LTO) cathodes used for full cell tests were made by blade-coating the N-methyl-2-pyrrolidone (NMP) slurry composed of 80\u2009wt% Li4Ti5O12 powder, 10\u2009wt% super-P and 10\u2009wt% poly(vinylidene difluoride) (PVDF) onto carbon-coated Al foil. The areal loading of active material is 3.2\u2009mg\u2009cm\u22122. The LiCoO2 (LCO) cathodes were made by blade-coating the N-methyl-2-pyrrolidone (NMP) slurry composed of 80\u2009wt% LiCoO2 powder, 10\u2009wt% super-P and 10\u2009wt% poly(vinylidene difluoride) (PVDF) onto carbon-coated Al foil. The areal loading of active material is 20\u2009mg\u2009cm\u22122. Thin Li foil with thickness of 50\u2009\u03bcm was purchased from Cellithium company. Electrochemical impedance spectroscopy (EIS) was tested on a VMP-3 (Biologic) electrochemical working station with a frequency range of 100\u2009kHz to 100 mHz and an amplitude of 10\u2009mV. Cyclic voltammetry tests were performed on a VMP-3 (Biologic) electrochemical working station with voltage ranges of 1\u2009V to \u22120.1\u2009V for perovskite-coated stainless steel foils at a scanning rate of 1\u2009mV\u2009s\u22121. Other electrochemical data including cycling tests of Li/Li symmetric cells and Li/LTO full cells was collected by a multi-channel cell testing station . All the electrochemical measurements were conducted at a constant temperature of 25\u2009\u00b0C.All the electrochemical tests were performed using CR2032 coin cells with a layer of commercial polypropylene (PP) separators . The electrolyte used for electrochemical deposition experiments on MSC-Li and MPC-Li electrodes, optically transparent cells, symmetric cells and full cells was 1\u2009M LiPFSupplementary InformationPeer Review File"}
{"text": "Background: Overuse of antibiotics significantly fuels the development of Antimicrobial resistance, which threating the global population health. Great variations existed in antibiotic prescribing practices among physicians, indicating improvement potential for rational use of antibiotics. This study aims to identify antibiotic prescribing patterns of primary care physicians and potential determinants.Methods: A cross-sectional survey was conducted on 551 physicians from 67 primary care facilities in Hubei selected through random cluster sampling, tapping into their knowledge, attitudes and prescribing practices toward antibiotics. Prescriptions  made by the participants from 1 January to March 31, 2018 were extracted from the medical records system. Seven indicators were calculated for each prescriber: average number of medicines per prescription, average number of antibiotics per prescription, percentage of prescriptions containing antibiotics, percentage of antibiotic prescriptions containing broad-spectrum antibiotics, percentage of antibiotic prescriptions containing parenteral administered antibiotics, percentage of antibiotic prescriptions containing restricted antibiotics, and percentage of antibiotic prescriptions containing antibiotics included in the WHO \u201cWatch and Reserve\u201d list. Two-level latent profile analyses were performed to identify the antibiotic prescribing patterns of physicians based on those indicators. Multi-nominal logistic regression models were established to identify determinants with the antibiotic prescribing patterns.Results: On average, each primary care physician issued 909  prescriptions over the study period. The mean percentage of prescriptions containing antibiotics issued by the physicians reached 52.19% (SD = 17.20%). Of those antibiotic prescriptions, an average of 82.29% (SD = 15.83%) contained broad-spectrum antibiotics; 71.92% (SD = 21.42%) contained parenteral administered antibiotics; 23.52% (SD = 19.12%) contained antibiotics restricted by the regional government; and 67.74% (SD = 20.98%) contained antibiotics listed in the WHO \u201cWatch and Reserve\u201d list. About 28.49% of the prescribers were identified as low antibiotic users, compared with 51.18% medium users and 20.33% high users. Higher use of antibiotics was associated with insufficient knowledge, indifference to changes, complacency with satisfied patients, low household income and rural location of the prescribers.Conclusion: Great variation in antibiotic prescribing patterns exists among primary care physicians in Hubei of China. High use of antibiotics is not only associated with knowledge shortfalls but also low socioeconomic status of prescribers. Antimicrobial resistance (AMR), one of the most alarming threats to global health, has resulted in significant human and economic loss worldwide. It was estimated that AMR led to 700,000 deaths in 2014 . WithoutOveruse of antibiotics is widely believed to be associated with the development of AMR . Given tPast studies revealed that great variations existed in antibiotic prescribing practices among physicians , which cInternationally, both restrictive and persuasive measures have been attempted to curtail irrational antibiotic prescribing behaviors . But verThis study aimed to identify individual antibiotic prescribing patterns in primary care physicians through latent profile analyses, a method that categorizes prescribing behaviors using multiple indicators. Our current understanding about antibiotic prescribing patterns is quite limited . Previou2 and more than 59 million populations. With a gross domestic product at $8,915 per capita in 2017, its economic status is ranked in the middle range of all provinces in China. According to the World Bank  having the authority to independently prescribe antibiotics; 2) having issued at least 100 prescriptions during the three-month study period, which contained at least one antibiotic prescription.In total, 645 physicians met the inclusion criteria and 551 (85.58%) agreed to participate in the study. Of those who agreed, 458 (71.01%) returned a valid questionnaire.Eight field investigators were recruited and trained to conduct data collection. A pair of the trained investigators visited each participating facility. The investigators had no servicing relationships with the facilities or their employees at the time. All eligible primary care physicians were approached and invited to participate in the study. Informed written consents were obtained prior to data collection.n = 458) during 23 April to June 6, 2018, tapping into their socioeconomic status and professional characteristics, and their knowledge and attitudes toward antibiotic prescribing. The respondents were asked to complete the questionnaire independently, which took roughly 15\u00a0min. A token gift ($1.65) was given to those who returned the questionnaire to the investigators. Missing items, if any, were re-filled by the investigators through an additional interview.Prescribing records issued by the 551 study participants over a three-month period (1 January\u201331 March 2018) were extracted from the medical records system of the participating facilities, including the name, formulation, dosage, administration route, and price of the prescribed medicines, and information about the prescribers and facilities. This was followed by a questionnaire survey of prescribers  \u201cWatch and Reserve List.\u201dSeven indicators were identified for measuring antibiotic prescribing patterns through a comprehensive literature review and expert consultations:The first three indicators were adapted from the prescribing indicators recommended by the WHO . They meWe added two additional indicators (indicator 4 and 5) in order to better assess irrational prescribing of antibiotics. Empirical evidence shows that broad-spectrum antibiotics is frequently used and is perhaps the most common form of antibiotic abuse in primary care . In addiOver the past two decades, China introduced some restrictive measures to reduce irrational antibiotic prescribing. These included a list of restricted antibiotics for primary care imposed by the regional governments . RestricAntibiotic prescribing behaviors can be influenced by the knowledge and attitudes of prescribers, their personal circumstances, availability of guidelines and influence of pharmaceutical companies, especially in LMICs. . PrescriThis study used a 37-item questionnaire to measure the knowledge, attitudes and personal circumstances of prescribers. The questionnaire was developed based on some existing instruments  with furThe questionnaire respondents were asked to indicate whether they agreed to prescribe antibiotics for 11 common conditions such as upper respiratory tract infections and diarrhea . A correThe attitudes of the questionnaire respondents toward antibiotic prescribing were assessed by 17 items, coded as a 5-point Likert scale . The scores were summed up to measure the tendency of complacency to satisfied patients (0\u20138 measured by four items), fearful of adverse events (0\u201312 measured by six items), ignorance of AMR (0\u201316 measured by eight items), indifference to changes (0\u20134 measured by two items), and responsibility avoidance by blaming others (0\u201328 measured by seven items), respectively . All iteThe personal circumstances measured in this study included the demographic characteristics (age and gender) of the respondents, and their socioeconomic status  and professional experiences . These factors have been proved to be significant determinants of antibiotic prescribing behaviors .Two datasets were prepared for data analyses. The first dataset contained 501,072 prescriptions made by 551 primary care physicians. For each physician, the seven prescription indicators were calculated. Antibiotics were defined according to the Anatomical Therapeutic Chemical (ATC) classification system and included only systemic use of antibiotics (ATC code J01) . They weTo determine the antibiotic prescribing patterns, latent profile analyses (LPA) were performed using the seven prescribing indicators at the physician level. LPA belong to finite mixture modeling which can identify and describe \u201chidden groups\u201d within a population. Because the 551 physicians were clustered in 67 primary care facilities, a two-level LPA model was established. Differences at the facility level were treated as random effect. Maximum likelihood parameter estimates with standard errors (MLR) were applied. The model identification was checked using 1,000 initial stage starts and 1,000 final stage starts .p value (>0.05) represents a lack of statistical significance between the two compared models. cmP provides an overall assessment of all estimated models and a larger cmP value indicates a better model fit. Entropy assesses the accuracy of classification, with a higher value indicating better classification , Sample-size Adjusted BIC (SABIC), Vuong-Lo-Mendell-Rubin Adjusted Likelihood Ratio Test (VLMR-LRT), Correct Model Probability (cmP) and Entropy. A lower value of BIC and SABIC indicates better fitness of data into the estimated model. VLMR-LRT compares the model fit between two neighboring models . A non-significant fication . To avoiThe second dataset contained the 458 returned questionnaires, as well as the classification of the antibiotic prescribing patterns of the 458 respondents. A three-group model was identified in the LPA. Each questionnaire respondent was assigned into one of the antibiotic prescribing pattern groups with the highest probability.Differences in knowledge and attitudes scores and personal circumstances among the respondents in different antibiotic prescribing pattern groups were examined using Kruskal-Wallis rank tests, one-way analysis of variance (ANOVA), or chi-square tests. Post-hoc pairwise comparisons were performed using Dunn and Bonferroni tests. Multi-nominal logistic regression models were applied to determine significant factors predicting the three groups of antibiotic prescribing patterns after adjustments for variations in other factors. In the regression analyses, knowledge and attitudes scores were transformed into dichotomous variables with mean scores serving as a cut-off point. An enter approach was adopted in the modeling.p value < 0.05 was treated statistically significant.The statistical analyses were conducted using STATA (version 12.0) as well as Mplus (version 6.0). A On average, 909  prescriptions were issued by the 551 participating physicians over the three-month study period. Each physician prescribed an average of 2.87 (SD = 0.78) medicines and 0.65 (SD = 0.26) antibiotics per prescription, respectively. Of the prescribed antibiotics, cephalosporins (J01D) was the most commonly used (38.50%), followed by macrolides .The mean percentage of prescriptions involving antibiotics prescribed by the physicians was 52.19% (SD = 17.20%). Of those prescriptions containing antibiotics, an average of 82.29% (SD = 15.83%) involved broad-spectrum antibiotics; 71.92% (SD = 21.42%) involved parenteral administered antibiotics; 23.52% (SD = 19.12%) involved restricted antibiotics imposed by the provincial government; and 67.74% (SD = 20.98%) involved antibiotics listed in the WHO \u201cWatch and Reserve\u201d list .TABLE 1PThe latent profile analyses  identifiThe 20.33% high antibiotic prescribers contributed to 23.56% of prescribed medicines, 24.48% of prescribed antibiotics, 26.27% of broad-spectrum antibiotics, 27.84% of parenteral administered antibiotics, 23.65% of government-restricted antibiotics, and 27.36% of antibiotics in the WHO \u201cWatch and Reserve\u201d list.The 458 questionnaire respondents had an average age of 43.5 years (SD = 9.3) and 72% were male. Only 38.2% obtained a university degree. The vast majority worked in a rural setting (78.0%) and had an annual household income of less than 80,000 yuan (79.5%). About 48% of the respondents worked as a general practitioner. Slightly more than half (51.1%) had a junior professional title. The average knowledge score of the respondents sat in the middle range even though more than 75% reported attending continuing education on antibiotics .TABLE 2Cp = 0.003), had a lower educational qualification (p = 0.018), lived with a lower household income (p < 0.001), worked in rural facilities (p < 0.001), had a junior professional title (p = 0.017), and had a lower knowledge score (p = 0.002) were more likely to be in the high user group. There were also significant differences in the antibiotic prescribing patterns across sub-specialties (p = 0.025)  .The multinomial logistic regression analyses confirmed that knowledge, attitudes, clinical experiences, household income and workplace settings were significant predictors of the antibiotic prescribing patterns after adjustments for variations in other variables .TABLE 3Mp = 0.005) or high  antibiotic user groups as compared with the odds of low antibiotic user group. Similarly, those who reported lower indifference to changes were also less likely to be assigned into the medium  or high  antibiotic user groups. However, the respondents with lower complacency to satisfy patients were more likely to be assigned into the medium antibiotic user group only  as compared with the odds of low antibiotic user group.The respondents with a higher than average knowledge score were less likely to be assigned into the medium (Relative Risk Ratio (RRR) = 0.440, p < 0.001) or high  antibiotic user groups as compared with the odds of low antibiotic user group. The odds of being assigned into the medium  and high  antibiotic user groups decreased with household income. The respondents with an older age had a slightly lower odds of being assigned into the high antibiotic user group . But longer years of practice slightly increased the odds of being assigned into the high antibiotic user group .The respondents who worked in a rural facility were more likely than their urban counterparts to be assigned into the medium , much higher than the maximal level of 30% as recommended by the WHO . Of the About 20.33% of the prescribers in primary care were identified as high users of antibiotics in this study, compared with 51.18% medium users and 28.49% low users. This is a result of the combined effect of the seven prescribing indicators. The high user group contributed disproportionally across all the seven indicators. Previous studies usually classify high antibiotic prescribers using a single indicator .This study shows that great variation in primary care physicians\u2019 antibiotic prescribing patterns in Hubei of China, which is shaped not only by the knowledge and attitudes of the prescribers, but also by their personal circumstances. High levels of antibiotic knowledge and attitudes in favor of practice changes are associated with low use of antibiotics. But lower household income and rural facilities are associated with high use of antibiotics.It seems that antibiotic prescribing in primary care in Hubei declined over time. The percentage of prescriptions containing antibiotics dropped from 68% in 2011  to the lDespite the decline, irrational antibiotic prescribing remains a serious issue of concern. The use of parenteral route for antibiotics is still very high at an average level of 71.92% as a proportion of antibiotic prescriptions, despite a slight decline in comparison with the level (84%) five years ago . The higThe domination of broad-spectrum antibiotics in antibiotic prescribing in Hubei of China is comparable to findings of other studies. A study monitoring antibiotic sales in primary cares in Hubei showed that broad-spectrum antibiotics were increasingly used in recent years, rising from 74.87% as a proportion of antibiotic sales in 2012 to 85.69% in 2017 . This isHowever, ignorance of the WHO AWaRe list in Hubei of China deserves increasing policy attention. There is serious under-use of the antibiotics in the WHO \u201cAccess\u201d list in Hubei. The mean percentage of antibiotic prescriptions covered in the WHO \u201cAccess\u201d list did not exceed 33% in the primary care participants in this study. This level is very low compared with the percentage of 60.17%\u201363.29% of \u201cAccess\u201d antibiotics prescribed in primary care in the United Kingdom over the period from 2011 to 2017 . AlthougIn this study, three distinctive groups of prescribers were identified through the LPA. Great variations in the seven indicators across the three groups were revealed. The gap in the percentage of prescriptions containing antibiotics reached 2.02 times between the high and low user groups (74.43% vs. 36.76%). Despite a shortage of studies comparing individual prescribers, many existing studies point to the great variations in antibiotic prescribing across facilities and regions . The EurThis study found that knowledge and attitudes are significant predictors of antibiotic prescribing patterns in primary care, which is consistent with findings of previous studies . Good knPrescribing behaviors can also be shaped by work and policy environments , as wellHousehold income was found to be a significant predictor of high use of antibiotics in primary care. This is not surprising given that prescribing can bring financial gains to the prescribers in the Chinese health system. Although primary care workers are no longer able to make a profit margin on sales of medicines, a service fee and charge for disposable syringes can still be collected . PerversTo address AMR, many countries and institutions have established a surveillance system monitoring the use of antibiotics. The LPA adopted in this study can help identify high antibiotic prescribers. Such a strategy should only be used for targeted interventions for continuing quality improvement. It is inappropriate to punish those deemed \u201chigh users\u201d because the major drivers of high use of antibiotics come from the system, not the individuals .To curb overuse of antibiotics in primary care in China, multiple strategies need to be taken. Both restrictive and persuasive measures should emphasize on the overall reduction of antibiotic prescriptions, as well as the limited use of broad-spectrum, parenteral administrated, and the WHO \u201cWatch and Reserve\u201d antibiotics. In addition, the regional list of restricted antibiotics imposed by the government should be better aligned with the WHO AWaRe list. Significant increase in governmental budget support to primary care is needed to break the perverse financial incentives .In addition, several potential initiatives could be considered to help change physicians irrational antibiotic prescribing patterns, which have been highlighted in existing evidence , includiExtensive studies have been undertaken to explore variations in antibiotic prescribing practices . But verThis study identified factors associated with antibiotic prescribing patterns based on an extended knowledge-attitude-practice theory, a framework commonly used for exploring behaviors of health practitioners . ValidatThere are several limitations to be mentioned. The study was conducted in Hubei province using a cross-sectional design. This does not allow us to draw causal conclusions. The results should not be generalized to other regions. Instead, replications of the study in other regions using the proposed approach are advised. Further studies also need to consider risk-adjustments, in particular in hospital settings where patient conditions vary considerably. This study was not able to adjust the results for variations in patient conditions, simply because such data and risk-adjustment tools were not available.In primary cares, over-use of antibiotics is prevalent in Hubei of China, particularly in the prescribing of broad-spectrum, parenteral administrated and restricted antibiotics. Great individual variation in antibiotic prescribing patterns exists. Those who are deemed high users contribute disproportionally to the inappropriate use of antibiotics. Prescribers worked in a rural setting and those with insufficient knowledge, low motivations for behavioral changes, and low household income are more likely to be high users. To curb physician irrational use of antibiotics in primary care, multiple strategies should to be taken, including developing a surveillance system comprehensively monitoring and analyzing physician antibiotic practices, training and education emphasizing on broad-spectrum and parenteral administrated antibiotic use and sufficient financial support for primary cares to break incentives.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by This study has been approved by the Ethics Committee of Tongji Medical College, Huazhong University of Science and Technology (No: IORG 0003571). The patients/participants provided their written informed consent to participate in this study.CXL designed the project and participated in the collection and interpretation of data. DW contributed to the acquisition, analysis and interpretation of data and drafted the manuscript. CJL participated in data analysis, interpretation of results, and writing of the manuscript. XZ participated in the cleaning and interpretation of data. All authors have read and approved the final version of the article.This study was funded by the National Natural Science Foundation of China (grant no. 71373092 & 71904053). The funding body played no part in the study design, collection, analysis and interpretation of data, writing of the manuscript or the decision to submit the manuscript for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.Inappropriate and over-prescriptions of antibiotics is commonly witnessed worldwide, contributing to antibiotic resistance and threatening global health and economic development. To address this issue, promoting physician\u2019s rational prescribing of antibiotics is significant. However, our understanding about antibiotic prescribing patterns is quite limited, despite great variations existed in physician\u2019s antibiotic prescribing practices which indicated huge potential for improvement. Therefore, this study adopted seven indicators to comprehensively assess physician\u2019s antibiotic use behaviors and applied a two-level latent profile analysis to objectively classify physicians into different antibiotic use patterns. In addition, the identified physician\u2019s prescribing patterns were further linked with their knowledge, five sub-kinds of attitudes and personal characteristics to diagnose why physicians showed different antibiotic use patterns. Based on the current study, physicians were classified as three different antibiotic use patterns and those who are deemed as high users contribute disproportionally to the inappropriate use of antibiotics. Higher antibiotic use pattern was linked with insufficient knowledge, indifference to changes, complacency with satisfied patients, limited household income and rural setting of the prescribers. The classification technique used in the current study can help identify high antibiotic prescribers and explore the underlying determinants of their behavioral patterns, informing more targeted interventions generated for improvement."}
{"text": "Background: Currently, there is no comprehensive evaluation of the quality of antibiotic prescribing in China\u2019s primary care facilities based on longitudinal data.Methods: We randomly selected 11 community health centers in Shenzhen, China, and collected all outpatient prescriptions of these centers from 2010 to 2015. To evaluate the quality of antibiotic prescribing, we used six quality indicators for analysis, including number of antibiotics per 100 consultations, ratio between broad-spectrum and narrow-spectrum antibiotics (B/N ratio), percentage of first-line antibiotics recommended by guidelines, percentage of oral antibiotics with a duration exceeding the guideline recommendation, and new pediatric-specific indicators such as percentage of antibiotics with amoxicillin (A index) and ratio between amoxicillin and broad-spectrum antibiotics (A/B ratio).Results: During the study period, 571,362 outpatient consultations resulted in antibiotic prescriptions, which contained 706,411 antibiotics. The overall number of antibiotics per 100 consultations decreased significantly from 93.50 in 2010 to 19.98 in 2015 (p = 0.004), but the B/N ratio showed an upward trend over time (p = 0.009). In different populations and different common infections, the number of antibiotics used decreased to varying degrees, while the B/N ratio increased to varying degrees, with the most obvious change in children <5\u00a0years. The percentage of first-line antibiotics for common infections was not high, ranging from 3.45 to 44.25% during 2014\u20132015. The percentage of oral antibiotics with an exceeded duration ranged from 0.70 to 19.39%. Moreover, the A index and A/B ratio in children remained low for a long time, which was 0.76% and 0.01 in 2015.Conclusion: A review of antibiotic prescribing in Shenzhen, China, showed a substantial reduction in antibiotic use in primary care. However, problems such as widespread use of broad-spectrum antibiotics, insufficient use of first-line antibiotics and low use of amoxicillin were prevalent. Improving and optimizing the quality of antibiotic prescribing, particularly in children prescriptions, will be the focus of future antibiotic stewardship in China. Excessive and inappropriate use of antibiotics not only caused a huge economic burden to global health systems, but also rapidly increased the risk of antimicrobial resistance (AMR). Many countries, including China, are trying to tackle global AMR by reducing unnecessary or inappropriate prescribing . CrucialReliable quality indicators are needed to identify the quality of antibiotic prescribing. A common methodology for collecting and reporting national antimicrobial consumption data developed by the WHO program of surveillance provided information on the level of use and types of antimicrobials to prescribers . The quaGuidelines for Clinical Application of Antimicrobial Agents in China. In 2011, a long-term national antimicrobial stewardship campaign was launched nationwide. In 2012, China also implemented the strictest regulation yet for antibiotic stewardship, the Administrative Measures for Clinical Use of Antimicrobial Agents. Previous studies showed that overuse of antibiotics in China\u2019s medical institutions at all levels have been significantly controlled .International Statistical Classification of Diseases, Tenth Revision (ICD-10) codes was used to classify and code disease diagnoses  classification, code J01 .We first adopted four quality indicators including number of antibiotics per 100 consultations, ratio between broad-spectrum and narrow-spectrum antibiotics (B/N ratio), percentage of first-line antibiotics recommended by guidelines and percentage of oral antibiotics with a duration exceeding the guideline recommendation to evaluate the quality of antibiotic prescribing in the overall populations . Then, tIn China, a patient is typically prescribed one prescription per outpatient consultation. A single prescription contains one or more drugs. The number of antibiotics (J01) per 100 consultations was used to reflect the amount of antibiotics consumed by outpatients. The B/N ratio was expressed as the ratio between the number of broad-spectrum antibiotics used and that of narrow-spectrum antibiotics. The smaller the B/N ratio, the most appropriate the prescribing. The percentage of first-line antibiotics recommended by guidelines was expressed as the percentage of the number of first-line antibiotics used over the total number of antibiotics. The percentage of oral antibiotics with a duration exceeding the guideline recommendation was expressed as the percentage of the number of oral antibiotics with an exceeded duration over the total number of oral antibiotics. So the higher the percentage of first-line antibiotics or the lower the percentage of oral antibiotics with an exceeded duration, the most appropriate the prescribing. Furthermore, the A index was defined as the percentage of the number of amoxicillin (J01CA04) used over the total number of antibiotics. The A/B ratio was defined as the ratio between the number of amoxicillin used and those of broad-spectrum antibiotics. Thus, the greater the A index or A/B ratio, the most appropriate the amoxicillin prescribing for children.In calculating percentage of first-line antibiotics and percentage of oral antibiotics with an exceeded duration, we included the 12 common infections in Chinese guidelines, including acute sinusitis, acute sore throat, acute cough and bronchitis, community-acquired pneumonia, acute otitis media, gastroenteritis, pericoronitis, acute periapical abscess, pelvic inflammatory disease, bacterial vaginosis, acute prostatitis, cellulitis . These ip values <0.05 were considered significant. All statistical analyses were performed using SAS version 9.4 .To explore the quality of antibiotic prescribing in different populations, particularly in children, we performed a stratified analysis by age group . To analyze trends in the quality of antibiotic prescribing, we combined all available annual data into three 2-year time periods  and reported the absolute changes in quality indicators during 2010\u20132011 vs. 2014\u20132015. Moreover, we also calculated the total number of excess antibiotic days for 12 common infections, defined as the cumulative number of days beyond the recommended duration in the guidelines. We used linear regression analysis to test linear trends of indicators over time. The confidence interval (CI) was calculated using a logit transformation based on the estimated standard error. All statistical tests were two sided, and Between 2010 and 2015, 1,482,223 outpatient consultations were conducted from 11 participating CHCs. Of these, 571,362 (38.55%) consultations led to antibiotic prescriptions, which contained 706,411 antibiotics. Among all antibiotic prescriptions, 79,496 (13.91%) antibiotic prescriptions were issued in young children <18\u00a0years. And the top three systematic diagnoses for antibiotic prescriptions were the diseases of respiratory, digestive, and genitourinary systems, accounting for 69.54, 9.84, and 8.49%, respectively. Among all antibiotics, the frequencies of oral antibiotics used were 337,208 (47.74%). A total of 90% of antibiotics were in turn covered by cephalosporins, macrolides, aminoglycosides, quinolones, imidazoles, and penicillins, involving 23 antibiotic classes. See p = 0.004). The number of antibiotics used in different age groups decreased to different degrees, and the decrease was most evident in children aged <5\u00a0years, from 85.47 in 2010 to 10.37 in 2015 (p = 0.009) (p = 0.009), and the increase was also most evident in children aged <5\u00a0years (p = 0.020) (p = 0.054) (p = 0.181)  . The ove= 0.020) . Referri= 0.054) . The per= 0.181) . Detailep = 0.198), the number of antibiotics used for other infections decreased to varying degrees. Acute otitis media decreased the most, with the number of absolute antibiotic changes per 100 consultations being \u221293.73 between 2010\u20132011 and 2014\u20132015 (p < 0.001) (p = 0.026), 19.39% (95% CI: 18.32\u201320.49%) was still found in this percentage of acute cough and bronchitis  . The B/N< 0.001) . Moreove< 0.001) . The totonchitis .p = 0.262 and p = 0.539)  . These tThis study comprehensively evaluated the quality of antibiotic prescribing in primary care facilities in Shenzhen, China. We found that, despite a significant decline in the number of antibiotic used, the B/N ratio increased over time, and the percentages of first-line antibiotics used for most infections and the use of amoxicillin in children were low. These inappropriate antibiotic prescribing might be an important aspect of future antibiotic stewardship in primary care facilities.In this study, both the overall antibiotic usage and the use of antibiotics for common infections showed a significant downward trend. This was consistent with those reported in previous studies in China , suggestAdministrative Measures for Clinical Use of Antimicrobial Agents in 2012, was to control the quantity of antibiotic use. For example, the stewardship campaign required that the percentage of outpatient prescriptions with antibiotics not exceed 20% by the end of 2013. However, there was no strict control requirement for the appropriate type of antibiotic use, such as broad-spectrum antibiotics. Second, although China formulated the Guidelines for Clinical Application of Antimicrobial Agents in China, insufficient attention had been paid to the implementation of this guidelines in prescribing behaviors. Because there was basically no research on evaluating the type conformity and time appropriateness of antibiotic prescribing based on Chinese guidelines. Therefore, improving the contents of the antibiotic policy and paying more attention to the practice guidelines, so as to guide the prescriber to prescribe antibiotics correctly, are also the work that cannot be ignored in the antibiotic stewardship.Our study suggested that the quality of antibiotic prescribing in Shenzhen\u2019s primary care was not high. This might be due to the following reasons. First, the contents of China\u2019s antibiotic policies were not perfect. The primary objective of these interventions, whether the national antimicrobial stewardship campaign in 2011 or the This study was the first to evaluate in detail the quality of antibiotic prescribing for common infections in primary care facilities in China. Our study selected rich quality indicators, involved many common infections, and carried out the specific evaluations of children. This comprehensive report provided clues to the future antibiotic stewardship from various aspects in China. Second, we used the published Chinese guidelines to evaluate the quality of antibiotic prescribing. This kind of guideline-based evaluation study was of great significance to identify the compliance of prescribers with the guidelines and the rationality of prescribing behaviors. Third, the data of our study were based on the entire prescriptions rather than sampling data, which avoided sampling bias and provided more realistic and reliable assessment. Furthermore, this electronic information system was regularly checked by data inspectors, which ensured the accuracy of the data in this study.However, our study had several limitations when interpreting the findings. First, this study only carried out the evaluation of prescription quality in primary care facilities in Shenzhen. Further studies with wider coverage and larger sample sizes are needed to evaluate the quality of antibiotic prescribing in China\u2019s primary care. Nevertheless, this study serves as a practical case to provide policy makers and researchers with valuable information on prescription quality. Second, only one primary diagnosis, which was determined by the physician based on a patient\u2019s chief complaint, was documented on our prescription records. It was not clear whether the prescriber decided to replace antibiotics or longer the duration of treatment because of the patient\u2019s other diseases or conditions. Thus, the magnitude of irrational antibiotic use in this regard might be overestimated. Third, we did not get records for culture of infecting pathogens in patients. Therefore, we could not identify whether the antibiotic usage was based on empirical or definitive therapy. We also could not combine patients\u2019 prescription records with laboratory results to determine the objective medication regimen developed by the prescribers. This is difficult because we have limited access to outpatient information. This implied the need to strengthen the standardization and integrity of prescription records in primary care facilities in order to provide more reliable data for prescription evaluation. Fourth, there is a time lag in this study. However, considering that inappropriate use of antibiotics in China\u2019s medical institutions is a long-standing problem, the poor quality of these antibiotic prescriptions is unlikely to be improved significantly. Thus, our results should be still applicable. Furthermore, the comprehensive evaluation model of the quality of antibiotic prescribing in this study can optimize antibiotic stewardship and is worthy of reference in other regions.In summary, a practice study in Shenzhen, China, found a significant decrease in the use of antibiotics in primary care facilities. However, the prevalence of broad-spectrum antibiotics in most common infections, the low use of first-line antibiotics, and the poor quality of antibiotic prescribing in children were serious problems. China\u2019s future antibiotic stewardship campaign should be devoted to improving the rationality of antibiotic types and treatment time, and standardizing the content of antibiotic use in children, so as to comprehensively improve the quality of antibiotic prescribing."}
{"text": "In China, more and more older people have encountered a situation called \u201cempty nest.\u201d Meanwhile, the health status of empty-nest older adults is an increasing public health concern. This research aims to examine the effectiveness of Self-Mutual-Group (SMG) model in improving quality of life of the empty-nest older adults to provide a scientific evidence for improving their health.A prospective intervention study was conducted among empty-nest older adults in Taiyuan, Shanxi. Multi-stage stratified random cluster sampling was employed to selected participants. A total of 396 empty nesters were enrolled as participants, of which 204 and 192 were in the intervention and control group, respectively. The intervention group received a seven-month SMG-based intervention. A participant\u2019s quality of life was measured at the baseline and seven months after using the Short Form 36-Item Health Survey (SF-36).P\u2009>\u20090.05). After the intervention, participants\u2019 scores on Mental Component Summary (MCS), Physical Component Summary (PCS), role emotional (RE), vitality (VT), social function (SF), mental health (MH) and general health (GH) increased significantly in the intervention group. Additionally, these scores differed significantly from those in the control group (P\u2009<\u20090.05).No significant difference was found between the intervention and control groups in terms of participant characteristics at baseline . Registration date: 26-04-2018. Retrospectively registered.Study on the \u2018SMG\u2019 Health Management Model Based on Community Organization Theory among empty-nest older adults (The online version contains supplementary material available at 10.1186/s12877-021-02155-4. With rapid economic development, the extension of average life expectancy, and the decrease in fertility rate, China has entered a period of accelerated population aging. Currently, on the mainland China, approximately one fifth of the total population is aged 60\u2009years and older, accounting for more than 200 million people . At the Healthy aging is manifested in not only the extension of the life of the older people but also, more importantly, the improvement of their quality of life . HoweverPrevious studies have proposed various interventions to improve the quality of life of the older adults but showed limited effectiveness. Van Uffelen et al.  conducteBased on the above, we focused on improving individuals\u2019 awareness of health management and ability in self-management, mutual-management, and group-management by increasing their self-efficacy, and then constructed a Self-Mutual-Group (SMG) model . ConsideFrom October 2016 to May 2017, a randomized controlled trial was conducted in Shanxi province, located in northern China. A multi-stage stratified random cluster sampling method was used to select participants. The study was approved by the institutional review boards of Shanxi Medical University, which was registered in a clinical trial registry (ChiCTR1800015884). A written informed consent was obtained from all participants.N1\u00a0=\u2009N2=d: Mean1-Mean2. , \u03c3: the standard deviation of control group. According to the pretest survey, d\u2009=\u20096.77, \u03c3\u2009=\u200915.69, \u03b1\u2009=\u20090.05, Z\u03b1\u2009=\u20091.96, \u03b2\u2009=\u20090.1, Z\u03b2\u2009=\u20091.282. The sample size was determined to be 112. An additional 10% was added to this sample estimate in anticipation that the final sample would include individuals who would not consent to participate in the survey. Thus, the final sample size was estimated to be 150 at least. Factually, a total of 396 empty nesters were enrolled as participants, of which 204 and 192 were in the intervention and control group, respectively. Figure\u00a0Taiyuan is the capital of the Shanxi Province and has six districts. In the first stage, according to the gross domestic product (GDP) based on the government\u2019s website, the three districts Yingze (high economic level), Jiancaoping (medium economic level), and Jinyuan (low economic level) were randomly selected as the study sites. In the Second stage, each community in the three selected districts was numbered according to the order of communities in the government website, then two communities were selected randomly in each district using a random-number table. Finally, all the empty-nest older adults living in the selected communities were considered candidates for participation in the study. Inclusion criteria were aged greater than or equal to 60\u2009years, who had no cognitive disorder or other mental illnesses, provided informed consent, were willing and able to complete the investigation, and were residing in the community for at least a year before the study. The exclusion criterion was having cognitive disorders or serious diseases, such as deafness, psychiatric disorders, or Alzheimer\u2019s disease. The sample size was estimated according to the following formula The intervention group participated in a seven-month SMG-based intervention, which consisted of three stages: self-management 2\u2009months), mutual-management (2\u2009months), and group-management (3\u2009months). The first stage (self-management) was aimed at the empty-nest older adults individuals to develop their self-health management awareness and ability, such as self-care awareness, active medical awareness, self-health assessment ability, and self-service medical equipment use ability. At mutual-management stage, the empty nesters in the same community were paired according to their age, sex, relationship status, home distance, and other factors to form mutual-management; if necessary, volunteers or study staff members were introduced to participate in the pairing. At this stage, empty nesters can share their experiences and knowledge with each other and provide necessary help through life or emotional support. The third stage involved the implementation of group health management based on the first two levels. Groups were categorized by disease type and residential area. For the former, because the empty-nest older adults often face common health problems, there is a common interest in implementing certain goals. For the latter, the principle of proximity was considered; participants were expected not to drop out of the intervention because of distance problems. Group interventions provided an arena within which participants can both provide and receive support. Details of the intervention are shown in Fig.\u00a0\u2009months, All participants were invited to complete a self-made standardized questionnaire , which was developed in the United States and designed to allow self-evaluation of quality of life , 20. ThiQuestionnaires were administered at baseline and post-intervention (seven months). The questionnaire was completed following a face-to-face interview between an interviewer and a participant and collected on the spot. To ensure quality, completed questionnaires were checked carefully by quality supervisors after the interview. The response rate was 100%.P value was statistically significant at (P\u2009<\u20090.05).EpiData was used for entering and checking the validity of data, and SPSS 22.0 software for statistical analysis. Data were expressed as mean\u2009\u00b1\u2009SD (standard deviation). Difference between groups in terms of baseline characteristics was tested using chi-square test. The effect of the intervention versus control conditions was examined using ANCOVA analysis on post-intervention measurement values, controlling for pre-intervention scores. Cohen\u2019s d was provided to evaluate the effect size with a guideline: trivial (<\u20090.20), small (0.20 to <\u20090.50), moderate (0.50 to <\u20090.80), and large (\u22650.80) . P valueP\u2009>\u20090.05).Participants\u2019 sociodemographic characteristics are shown in Table\u00a0F\u2009=\u2009105.146, P\u2009<\u20090.001, Cohen\u2019s d\u2009=\u20090.62) and PCS  for intervention and control groups were significantly different. The scores of MCS and PCS increased significantly in the intervention group. Yet, for the eight subscales of QOL, the score changes of each dimension were different. For mental components, the scores on VT , SF , MH  and RE  for intervention and control groups were significantly different. For physical components, except for GH , no significant differences in the scores on PF, RP, and BP were observed between the intervention and control groups.The mean scores on the SF-36 for intervention and control groups at baseline and after the seven-month follow up are shown in Table\u00a0The main finding of this study was that in comparison to the control group, empty nesters who participated in the seven-month SMG-based intervention had significant improvement in quality of life. The mean scores for MCS, PCS, RE, VT, SF, MH, and GH among empty-nest older adults increased significantly. Moreover, these scores differed significantly from the corresponding scores in the control group.In simplest terms, self-management describes what a person does to manage his/her disease . A crossSeveral studies have found that good social relationships  are the most commonly reported factor influencing quality of life in the older adults , 32. AftA cross-sectional study in Shaanxi province showed that education has a major influence on the quality of life among the older adults in China . For exaIn this study, no positive main effect on PF, RP, and BP was observed among empty-nest older adults. For physical function, this study assessed mainly the impact of participants\u2019 health on daily life, such as strenuous exercise, housework, and going up and down the stairs. For physical role, this study assessed the impact of health status on the completion of work or social activities. For bodily pain, this study assessed the extent of physical pain. The result indicated that intervention had limited effects on improving physical health, which may be related to the limited duration of intervention In this survey, we found that some empty nesters have one or more chronic diseases. Therefore, the intervention has limited effect on improving the chronic disease status of empty nesters in the short term. Previous studies have showed that chronic disease is among the significant risk factors affecting quality of life in the older adults , 37. ChrAlthough there was no significant improvement in other dimensions of PCS, such as PF, RP, and BP, the current results indicated that the scores of GH and PCS also increased significantly after the intervention. The GH dimension is a self-assessment of overall health, whereas the PCS encompassed physical component scores. Findings indicate that participants felt their health improved after the intervention, which could be attributed to subjectivity of their self-assessment. Therefore, in future studies, multi-point measurement should be considered to evaluate better the intervention process and outcomes.There are some limitations in this study that must be acknowledged. First, the low literacy level and advanced age of the study population might have caused participants to misunderstand the questions or give inaccurate responses. Second, researchers were not blinded to group allocation and the final statistical analyses. Therefore, subjective biases might have occurred inevitably when researchers conducted face-to-face interviews with participants. This requires researchers to fully understand the purpose of the study and be familiar with the content of the study, so as to help the participants better understand and complete the survey. So, investigators need to be trained before investigation. Moreover, although the group allocation was not actively disclosed to participants during the research process, participants in the intervention group might have guessed what the researchers wanted, the intervention effects might have been exaggerated. In addition, studies have shown the potential value of using more than one measures in a trial . HoweverOur study demonstrated that the SMG-based health management has a positive effect on improving quality of life of empty-nest older adults. It provided a new perspective on bettering the quality of life of empty nesters, thereby establishing an important theoretical and practical foundation for the improvement and promotion of the model. These results should be tested further in larger samples and different settings.Additional file 1. A Study on Quality of Life of the Empty-nest Older adults."}
{"text": "Mycobacterium avium complex (MAC) is a major cause of non-tuberculous pulmonary and disseminated diseases worldwide, inducing bronchiectasis, and affects HIV and immunocompromised patients. In MAC, Mycobacterium avium subsp. hominissuis is a pathogen that infects humans and mammals, and that is why it is a focus of this study. It is crucial to find essential drug targets to eradicate the infections caused by these virulent microorganisms. The application of bioinformatics and proteomics has made a significant impact on discovering unique drug targets against the deadly pathogens. One successful bioinformatics methodology is the use of in silico subtractive genomics. In this study, the aim was to identify the unique, non-host and essential protein-based drug targets of Mycobacterium avium subsp. hominissuis via in silico a subtractive genomics approach. Therefore, an in silico subtractive genomics approach was applied in which complete proteome is subtracted systematically to shortlist potential drug targets. For this, the complete dataset of proteins of Mycobacterium avium subsp. hominissuis was retrieved. The applied subtractive genomics method, which involves the homology search between the host and the pathogen to subtract the non-druggable proteins, resulted in the identification of a few prioritized potential drug targets against the three strains of M. avium subsp. Hominissuis, i.e., MAH-TH135, OCU466 and A5. In conclusion, the current study resulted in the prioritization of vital drug targets, which opens future avenues to perform structural as well as biochemical studies on predicted drug targets against M. avium subsp. hominissuis. Mycobacterium species that do not cause tuberculosis are referred to as non-tuberculous mycobacteria (NTM) and are ubiquitous in nature. NTM cause pulmonary diseases in which organisms of Mycobacterium avium complex (MAC) are widely distributed [M. avium is found to be higher than that of the other Mycobacterium species. For example, a literature survey showed that the pulmonary infection rate in Japan is sevenfold greater by M. avium than any other Mycobacterium species [M. intracellulare and M. avium [M. avium is comprised of four subspecies: M. avium subsp. paratuberculosis (MAP), M. avium subsp. avium (MAA), M. avium subsp. silvaticum (MAS) and M. avium subsp. hominissuis (MAH); and each one is host specific. The first two subspecies cause avian infection, while the third causes diseases in wild livestock and the last one is the most common pathogen in humans and other mammals, including pigs, and therefore has huge economic impact [tributed . The inc species . MAC conM. avium . Furtherc impact .Opportunistic MAH is responsible for causing disseminated and pulmonary infections that affect immunocompromised patients who are suffering from AIDS, leukemia, lung diseases or chemotherapy ,6. The bAcinetobacter baumannii [Helicobacter pylori [Mycobacterium species [Pseudomonas aeruginosa [MAC pulmonary diseases are controlled by treatment with antibiotics that include macrolide-based multidrug therapy, comprising macrolides (clarithromycin or azithromycin) in combination with rifampin, ethambutol, aminoglycosides (streptomycin or amikacin) and ciprofloxacin ,11. Howeaumannii , Helicobr pylori , Mycobac species , Pseudomruginosa  and otheruginosa ,26,27,28M. avium subsp. hominissuis (MAH), the subtractive genomics method was used, which is the most applicable approach to prioritize potential drug targets [With the aim to identify unique and potential druggable targets of  targets ,29,30,31M. avium subsp. hominissuis in the UniProt database. Their complete proteomes were downloaded in FASTA format in February 2019. On applying CD-HIT algorithm with 80% identity, 20 sequences were identified as paralogous out of 4614 proteins in MAH-TH135, 54 out of 5165 in MAH-OCU466 and 14 out of 4502 proteins of A5 strain. The CD-HIT clustered the paralogous sequences and, hence, reduced the total number of sequences of each strain. The sequence dataset was comprised of 4596, 5111 and 4488 protein sequences for the MAH-TH135, OCU466 and A5 strains, respectively.Three strains of MAH, i.e., MAH-TH135, OCU466 and A5, were selected from the available non-redundant strains of In this step, protein sequences that were only present in the pathogens were segregated. Thus, by applying a subtractive approach, sequences were excluded that showed similarity to the human host. The remaining orthologous sequences, retrieved from the previous step, were subjected to BLASTp against the complete human proteome, and the resultant file was parsed. The only sequences that were retained were those that showed \u201cno hits found\u201d, and a total of 3151, 3619 and 3072 non-homologous sequences were found in the MAH-TH135, OCU466 and A5 strains, respectively.http://www.essentialgene.org/). Homology with the sequences found in the DEG database is the basis of essentiality of non-homologous proteins. To do this, the parsed results of each strain from the last step were subjected to BLASTp against the DEG with a 10\u22125 threshold. The BLASTp results depict 1360, 1451 and 1352 essential protein sequences in MAH-TH135, OCU466 and A5, respectively. These identified sequences were considered viable for the pathogen\u2019s life cycle. These sequences include functional, non-functional or uncharacterized proteins, and they were dealt with using different bioinformatics tools for further characterization.The Database of Essential Genes (DEG) provides information on essential genes of Gram-positive and Gram-negative bacteria determined from experimental methods  tool. Only the sequences whose functions were not known earlier were submitted to this tool. Hence, only uncharacterized sequences were retrieved from the non-homologous essential proteins\u2019 sequences. About 193, 119 and 187 uncharacterized sequences of TH135, OCU466 and A5 strains, respectively, were predicted by the SVM-Prot method. The results of the SVM-Prot tool are depicted in The KEGG database provides a network of metabolic pathways with their complete annotation. It helps to predict which protein sequences are essential in playing a unique role in metabolism. This step predicts the potential drug target based on the pathogen\u2019s unique metabolism. Metabolic pathways analysis was carried out for the essential protein sequences using the KEGG database. The DEG\u2019s results were subjected to the KEGG database via the KEGG Automated Annotation Server (KAAS). Briefly, out of 675 protein sequences of the MAH-135 strain, 72, 70, 29, 16 and 103 proteins were found to take part in carbohydrate metabolism, energy metabolism, lipid metabolism, nucleotide metabolism and amino acid metabolism, respectively. For OCU-466, 76 were involved in carbohydrate metabolism, while 69, 30 and 15 took part in energy metabolism, lipid metabolism and nucleotide metabolism, respectively, whereas the A5 strain possessed 93 proteins that majorly contributed to amino acid metabolism. The distribution of proteins in different metabolisms is presented in Bacterial metabolism refers to the collection of the biochemical reactions required for bacterial survival and growth, which mainly includes respiration (aerobic and anaerobic) and fermentation. Bacteria, as a pathogen to humans, conduct all the same types of basic biochemical reactions a human cell performs. However, bacteria may have several types of energy generating metabolisms that do not exist in human or eukaryotic cells. This diversity of energy generation and metabolism allows bacteria to survive in a variety of habitats and flourish in otherwise not-suitable conditions. On the other hand, these differential metabolic pathways make bacteria susceptible by serving as an ideal target for antibiotics. Metabolic pathways that exist only in pathogens are called unique metabolic pathways (UMP). These UMPs are listed in Energy is a potential, needed to perform work and maintain life, usually acquired by breaking a chemical bond and stored by making another chemical bond, very often in the form of ATP. Methane metabolism is one of the UMPs by which bacteria can obtain energy by oxidizing one-carbon compounds . Methanotrophic bacteria are generally considered environmentally friendly organisms, as they contribute to oxidizing environmental methane, thereby mitigating the effects of global warming . MethaneSecondary metabolites are molecules not essentially required for the survival of an organism. A large portion of bacterial metabolism deals with the biosynthesis of secondary metabolites. However, these pathways have a minimal role in bacterial growth and viability and are not considered a suitable target for antibiotics. Even though secondary metabolites are not considered to be ideal as drug targets, many of these pathways are manipulated by researchers for valuable purposes such as penicillin and cephalosporin biosynthesis, carbapenem biosynthesis and streptomycin biosynthesis. D-alanine metabolism is a significant target; an antibiotic D-cycloserine targeting D-alanine metabolism is already in clinical use against Mycobacterium tuberculosis [Amino acid metabolism in bacteria is diverse in nature and performs a pivotal role in maintaining bacterial growth. Amino acid metabolism has emerged as a potential target for new antibiotics, and a number of new drug targets have been proposed in recent years ,35,36,37rculosis ,41. The Other types of metabolic activities in bacteria, such as terpenoids and polyketides, glycan biosynthesis and drug resistance, also perform supportive functions for bacterial growth and survival; however, these metabolic routes are not prioritized targets for anti-bacterial drugs. Rather, these metabolic routes are often manipulated for advantageous purposes . The potential drug targets were shortlisted based on obtained information from earlier successful literature reports. The druggability of non-host uncharacterized protein sequences was determined by performing BLASTp against the druggable protein sequences present in the DrugBank Database. For this purpose, the earlier shortlisted, non-host, uncharacterized proteins, which are essential in metabolic pathways, were analyzed for druggability by comparing their sequences with the DrugBank Database. In this search, only one protein was prioritized in TAH-135, whereas four and seven potential drug targets emerged with the OCU-466 and A5 strains, respectively . All theIt is noteworthy that all the proposed drug targets could be analyzed for 3D structural information to prioritize novel drug targets against pathogens. Therefore, BLASTp was performed for the target proteins against the Protein Data Bank (PDB) database, which revealed that 12 protein sequences had no 3D structure available yet in the PDB. Therefore, this study offers those 12 proteins\u2019 sequences to not only consider as a potential druggable genome, but also for future studies of 3D structure determination either by homology modeling (template-based) or by ab initio (template-free) methods .An overview of the subtractive genomics approach is illustrated in Homo sapiens, and pathogen, i.e., Mycobacterium avium subsp. Hominissuis, were downloaded from the UniProt KB database [The whole proteome of the host, i.e., database  to retriThe CD-HIT tool  clustersH. sapiens database with an expectation value  of 10\u22123 [Standalone BLAST version 2.8.1 was downloaded from the NCBI FTP server . The ort of 10\u22123 . The outM. avium subsp. hominissuis). The non-homologous proteins were aligned with the DEG database using BLASTp, and the expectation value was set to 10\u22125. As a result, the non-homologous essential genes, which may have hypothetical or uncharacterized proteins, were obtained.The genes required to sustain the life cycle of bacteria are called essential genes. The Database of Essential Genes (DEG) contains lists of genes with their corresponding sequences, which are essential for the survival of bacterial life. . TherefoThe metabolic pathways of the identified non-homologous essential proteins were searched in the Kyoto Encyclopedia of Genes and Genomes (KEGG)  through Annotation of proteins includes information about the location of proteins in various regions of the cell and the family to which it belongs. PSORTb version 3.0  is well \u22123. The DrugBank Database provides detailed information on drugs and drug targets. A large database shows up to 8261 drugs, including FDA-approved drugs; experimental and nutraceutical drugs are available in the DrugBank Database.In order to detemine the novel drug targets, standalone BLASTp was run between hypothetical non-homologous essential proteins, and drug target sequences were taken from the DrugBank Database  with an Mycobacterium avium subsp. hominissuis. Protein sequences of M. avium subsp. hominissuis were parsed using multiple steps of the subtractive genomics approach, and a few of them were shortlisted as possible drug targets because they fulfilled the druggability criteria. The shortlisted sequences were non-homologous to the human host; thus, these can be proposed as ideal drug targets. All the identified drug targets of different strains of MAH have never been characterized before as drug targets, and we proposed them here as potential drug targets against which new drug compounds can be designed. Therefore, the study is significant to the scientific community, as it provides a prioritized list of possible drug targets sorted by the computational subtractive genomics method, and it has the potential to lead to the discovery of new and novel drug targets against M. avium subsp. hominissuis. Different bioinformatics tools were applied in this study to identify vital drug targets of"}
{"text": "Glyphosate, formulated as glyphosate-based herbicides (GBHs) including the best-known formulation Roundup, is the world's most widely used herbicide. During the last years, the growing and widespread use of GBHs has raised a great concern about the impact of environmental contamination on animal and human health including potential effect on reproductive systems. Using an in vitro model of pig oocyte maturation, we examined the biological impact of both glyphosate and Roundup on female gamete evaluating nuclear maturation, cytoplasmic maturation and developmental competence of oocytes, steroidogenic activity of cumulus cells as well as intracellular levels of glutathione (GSH) and ROS of oocytes. Our results indicate that although exposure to glyphosate and Roundup during in vitro maturation does not affect nuclear maturation and embryo cleavage, it does impair oocyte developmental competence in terms of blastocyst rate and cellularity. Moreover, Roundup at the same glyphosate-equivalent concentrations was shown to be more toxic than pure glyphosate, altering steroidogenesis and increasing oocyte ROS levels, thus confirming that Roundup adjuvants enhance glyphosate toxic effects and/or are biologically active in their side-effect and therefore should be considered and tested as active ingredients. N-(phosphonomethyl)glycine, is a non-selective herbicide widely used worldwide to control weeds1. Gly is commonly applied as part of glyphosate-based herbicides (GBHs), which include the popular commercial formulation Roundup (R), in which adjuvants enhance the herbicidal properties.Glyphosate (Gly), or 3. Only a small amount of Gly is metabolized by mammals, while the majority is excreted unmodified by urine in which Gly residues have been detected in both humans4 and animals as rats5, cows7, rabbits7, dogs and cats8.During the last years, the growing and widespread use of GBHs has raised a great concern about the impact of environmental contamination on animal and human health. Human and animal Gly exposure may occur through various routes such as food and drinking water, skin contact or by inhalation14. However, findings of both in vitro and in vivo studies are conflicting and several authors concluded that Gly is safe at levels below regulatory permissible limits22.The possible risk associated with Gly exposure to human and animal health is a matter of an intense public debate for both its potential carcinogenic and non-carcinogenic effects, including potential adverse effects on nervous, digestive, endocrine and reproductive systems24, thus determining an endocrine disarray in cell lines (e.g. 26). Furthermore, R exposure in rats has been demonstrated to interfere with both steroidogenic enzymes and reproductive health28. It has been suggested that the modification in reproductive hormone concentrations induced by GBHs could be due to changes in the number and activity of Leydig cells and modification of steroidogenic acute regulatory protein (StAR) or aromatase levels and activity30. According to another study, R seems to exert an inhibitory effect at the hypothalamic-pituitary level and to disrupt cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) pathway and corticosterone synthesis in the adrenal gland31. Moreover, Gly and R have been demonstrated to impair bovine and swine granulosa cells growth and steroid production34. In female rat and mice, Gly and GBHs have been reported to cause hormonal imbalances, oxidative stress and alterations in folliculogenesis including an increase of atretic follicles36. Recently Yahfoufi et al.37 reported that Gly exposure of mature mouse oocyte (MII) induces spindle fibre destruction, disturbance in chromosomal alignment, depletion of intracellular zinc bioavailability and ROS accumulation. Similar effects were found in mouse embryos exposed to Gly during embryo culture37. Induction of oxidative stress and apoptosis were also observed in bovine embryos cultured in presence of R38.Nevertheless, GBHs have been clearly demonstrated to exert their effects through a chemical endocrine disruption; in fact, they have been shown to impair the androgen/estrogen balance39. Zang et al.40 observed that Gly interferes with in vitro mouse oocyte maturation impairing nuclear maturation, generating oxidative stress and inducing DNA damage and early apoptosis.However, very few data are available in literature on possible effects of Gly and GBHs on mammal oocyte maturation, which prepare oocyte for fertilization events and affect early embryonic development41.On these bases, the objective of this study was to characterize the impact of Gly and R on female gamete using an \u201cin vitro\u201d model of pig oocyte maturation (IVM) evaluating nuclear maturation, cytoplasmic maturation and developmental competence of oocytes, steroidogenic activity of cumulus cells as well as intracellular levels of glutathione (GSH) and ROS of oocytes. We tested concentrations ranging from either 360\u00a0\u00b5g/mL Gly or 0.1% Roundup (containing 360\u00a0\u00b5g/mL Gly) to 70-fold lower on the basis of previous in vitro studies on reproductive tissues and gametesWhen COCs were matured in presence of Gly at 0, 5, 10, 100, 200 and 360\u00a0\u00b5g/mL or R at the same Gly-equivalent doses, no significant variations in the proportion of oocytes completing nuclear maturation showing a MII nuclear morphology were recorded  did not affect the cleavage rate, it caused a significant p\u2009<\u20090.01) reduction of the percentage of oocytes that developed to blastocyst stage at the higher concentration (360\u00a0\u00b5g/mL). Moreover, a significant decrease in the mean number of blastomeres per blastocyst was observed starting from Gly 200\u00a0\u00b5g/mL (p\u2009<\u20090.05)  it induced a significantly lower blastocyst rate  and mean number of blastomeres per blastocyst (p\u2009<\u20090.01 and p\u2009<\u20090.001 for R 200 and R 360 respectively) compared to control  at 44\u00a0h of culture compared to 22\u00a0h irrespective of Gly and R concentrations.E2 and P4 production was not affected by Gly exposure in none of the 2\u00a0days of culture   decreased the proportion of polar body extrusion of mouse oocytes due to misaligned chromosomes and abnormal spindle morphology; the authors suggested that Gly toxicity on mouse oocytes could be mediated by the increase of intracellular ROS levels.As a first step of this study we investigated the effect of Gly and R exposure during IVM on nuclear maturation of pig oocytes. None of the concentrations tested  modified the percentage of oocytes reaching MII stage compared to control. These results are in contrast with the only study performed up to now on the effect of Gly exposure during IVM on nuclear maturation of mammalian oocytes40 and our results could be due to a species-dependent sensitivity to Gly and/or it can be ascribed to different cultural conditions: Zang et al.40 matured mouse oocytes in M2 medium, while, in our model, pig IVM was performed in NCSU 37 medium supplemented with cysteine and \u03b2-mercaptoethanol, molecules known to reduce pig oocyte ROS levels, and 10% porcine follicular fluid (pFF), endowed with high radical scavenging activity elicited from SOD isoenzymes48; these supplementations, increasing the antioxidant activity of the system, may have masked the potential Gly toxic effects on nuclear maturation. In fact, it has been recorded that cell damage encompassed by ROS are difficult to detect in pig oocytes cultured in a medium supplemented with 10% pFF, even in the presence of ROS generated by the hypoxanthine-xanthine oxidase system47. Anyway, it must be kept in mind that in vivo oocytes are normally protected from the harmful effects of ROS by anti-oxidant enzymes which are present in the follicular fluid49 and therefore it can be assumed that our culture system is capable of closely mimicking the in vivo environment during oocyte maturation. In our pig model, a significant increase of the intracellular levels of ROS with R at the concentration of 360\u00a0\u00b5g/mL, but not with pure Gly, was recorded; this increase, however, was not as dramatic as that recorded in mouse oocyte after Gly exposure40.The discrepancy between Zang et al.50. The maintained sperm nuclear decondensing ability of the exposed oocytes agree well with the absence of any effect of either Gly or R on intracellular GSH levels which was recorded in this study. Even if an inverse relationship between oocytes intracellular ROS and GSH levels has been observed by many authors48, in this study, R 360 significantly increased the intracellular levels of ROS; it is likely that this rise was not so strong to significantly reduce oocyte GSH levels and, in turn, to impair oocyte decondensing activity.In order to evaluate the potential toxic effect of Gly and R exposure on cytoplasmic maturation, as a first step, fertilization parameters and oocytes ability to decondense sperm head and sustain male pronucleus formation after in vitro fertilization were evaluated. As observed for nuclear maturation, no detrimental effect of all the Gly and R doses tested on these parameters was recorded. Adequate oocyte GSH levels are needed in order to reduce protamine disulfide bonds that represent the first step in the induction of sperm nuclear decondensation and hence male pronucleus formation after in vitro fertilizationThe developmental competence of exposed oocytes after IVF was used as a further parameter of proper cytoplasmic maturation. Even the highest doses tested of both Gly and R had no effect on embryo cleavage. By contrast, R, and to a lesser extent Gly, induced a dose dependent reduction of both blastocyst rate and blastomere number per blastocyst. Therefore, oocyte exposure to R and Gly during IVM impaired the acquisition of a proper cytoplasmic maturation leading to a reduction of developmental competence, even if pesticides were not more present during embryo culture. This toxic effect was more evident with R compared to Gly, thus suggesting a synergistic effect provoked by the adjuvants present in the commercial formulation.52, likely due to cumulus cell differentiation-luteinization and R was markedly effective in inhibiting this P4 increase as P4 produced after 48\u00a0h of culture was significantly lower in R treated groups, starting from 100\u00a0\u00b5g/mL, as compared to control. Similarly, treatment of bovine granulosa cells with Gly (10 and 300\u00a0\u00b5g/mL) had no effect on P4 and E2 production33 while R (10\u00a0\u00b5g/mL) dramatically decreased steroid levels (P4 and E2). Other researches carried out by Gigante et al.34 on swine granulosa cell showed that Gly  induced a significant inhibitory effect on granulosa cell E2 secretion, viability and proliferation; in contrast, P4 secretion was stimulated at all tested concentrations. It must be considered that the researches carried out by Perego et al.33 and Gigante et al.34 were performed on plated granulosa cell with the addition of testosterone or androstenedione as estradiol precursors while our model, consisting of cumulus cell-oocyte complexes, is completely different. In fact, cumulus cells and mural granulosa cells are phenotypically/functionally different: cumulus cells play an essential role in the normal growth and development of the oocyte, while mural granulosa cells primarily exert an endocrine function and support follicle growth53. Moreover, evidence exists that oocyte plays an active role in determining the fate of follicle somatic cells; results obtained by Coskun et al.54 demonstrated that porcine oocytes secrete molecule(s) that inhibits steroid production by cumulus and granulosa cells. Therefore, based on these information we cannot strictly compare our results on steroidogenesis with those obtained by Perego et al.33 and Gigante et al.34.Concerning the effects on cumulus cell steroidogenesis, while Gly did not induce any alteration of E2 and P4 levels, R decreased P4 (but not E2) production. In our system, P4 secretion by COCs dramatically increased during the second half of culture, as already observed56. Therefore, the more serious negative effects of R compared to the pure molecule on oocyte developmental competence can possibly be due, at least in part, to the observed perturbation induced by R on P4 production by cumulus cells. Anyway, the mechanism through which R exerts its effects on cumulus cell steroidogenesis needs further investigations.P4 produced by cumulus complexes has been reported to positively influence porcine oocyte cytoplasmic maturation and to improve developmental competence to the blastocyst stage following IVF57.The decrease in P4 production by cumulus cells recorded in presence of R could have contributed to the increase in intracellular ROS levels induced by R 360. Previous studies, in fact, demonstrated that progesterone possesses antioxidant properties that are blocked by RU486, a P4 receptor antagonist58 or exert an intrinsic toxicity inducing membrane disruption59, apoptosis60, inhibition of mitochondrial respiration61 and DNA damage62.All these results support the hypothesis that surfactants/adjuvants present in GBHs are responsible for the increased toxicity of GlyTo the best of our knowledge, the present study is the first work describing the effects of Gly and R on pig oocytes maturation.Our results indicate that the exposure to Gly and its commercial formulation R during IVM, even if it does not affect nuclear maturation and embryo cleavage, impairs oocyte developmental competence in term of blastocyst rate and cellularity. Moreover, R at the same Gly-equivalent concentrations resulted to be more toxic than pure Gly, altering steroidogenesis and increasing oocyte ROS levels, thus confirming that R adjuvants enhance Gly toxic effects and/or are biologically active in their side-effect and therefore should be considered and tested as active ingredients.65; mean levels of 0.26\u00a0\u00b5g/mL (range <\u20090.020\u201317.2\u00a0\u00b5g/mL) in occupationally exposed workers have been recently reported66. These concentrations are far lower than those observed to be toxic in this study. Blood glyphosate levels recorded in human acute intoxications were 61\u00a0\u00b5g/mL (range 0.6\u2013150\u00a0\u00b5g/mL) and 838\u00a0\u00b5g/mL respectively in mild\u2013moderate and severe intoxication cases67, concentrations of the order of magnitude of those that were toxic in our study.Glyphosate concentrations detected in human urine has been reported to be at ng/mL levels with higher level in specifically exposed individualsObviously, the effects induced by Gly and formulants should be lower in vivo than in culture, and in vitro methods cannot provide the information that can be derived from in vivo tests. Nevertheless, in vitro maturation of pig oocytes, that can be obtained in large number from ovaries collected at the slaughterhouse, can be used as a reliable model to screen toxic agent for female gamete allowing the reduction of the number of laboratory animals used in vivo accordingly to 3R principles.The consequences of the massive use of GBHs remain a matter of concern on public health. We found that Gly and R exposure during IVM detrimentally affect the subsequent developmental ability of embryos, providing further evidence of their potential toxic effect on female reproductive system that is worth of a deeper investigation.N-(Phosphonomethyl)glycine  as well as the other chemicals, unless otherwise specified, were purchased from Sigma-Aldrich  except Roundup Bioflow  containing 360\u00a0g/L of glyphosate acid in the form of 480\u00a0g/L isopropylamine salts of glyphosate (41.5%), water (42.5%) and surfactant .68 supplemented with 5\u00a0\u03bcg/mL insulin, 1\u00a0mM glutamine, 0.57\u00a0mM cysteine, 10\u00a0ng/mL epidermal growth factor (EGF), 50\u00a0\u03bcM \u03b2-mercaptoethanol and 10% porcine follicular fluid (IVM medium), groups of 50 COCs were transferred to a Nunc 4-well multidish containing 500\u00a0\u03bcL of the same medium per well and cultured at 39\u00a0\u00b0C in a humidified atmosphere of 5% CO2 in air. For the first 22\u00a0h of in vitro maturation the medium was supplemented with 1.0\u00a0mM db-cAMP and 0.12\u00a0IU/mL Pluset . For the last 22\u00a0h COCs were transferred to fresh maturation medium69.Ovaries were collected from pre\u2010pubertal gilts at a local slaughterhouse and transported (in 0.9% wt/vol NaCl solution) to the laboratory within 2\u00a0h. Cumulus\u2010oocyte complexes (COCs) were aspirated from antral follicles, 3\u20136\u00a0mm in diameter, with a 18\u2010gauge needle fixed to a 10\u2010mL disposable syringe. Intact COCs were selected under a stereomicroscope and only COCs with more than three layers of compact cumulus cells and with uniform cytoplasm were transferred into a petri dish  prefilled with 2\u00a0mL of modified PBS supplemented with 0.4% BSA. After three washes in NCSU 37In order to assess the effect of Gly and R on nuclear maturation, pig COCs were exposed during in vitro maturation period (44\u00a0h) to 0, 5, 10, 100, 200 and 360\u00a0\u00b5g/mL Gly or R at the same Gly-equivalent doses.70.At the end of the maturation period the oocytes were denuded by gentle repeated pipetting and then mounted on microscope slides, fixed in acetic acid/ ethanol (1:3) for 24\u00a0h and then stained with Lacmoid. The oocytes were observed under a phase contrast microscope in order to evaluate the meiotic stage achieved . Oocytes with a nuclear morphology corresponding to metaphase-II stage (MII) were considered matureCytoplasmic maturation was assessed by evaluating:a) insemination parameters and ability of oocytes to sustain male pronucleus formation after in vitro fertilization. or R at the same Gly-equivalent doses, the oocytes were fertilized with frozen boar semen purchased from a commercial company . Straws were thawed in a waterbath at 37\u00a0\u00b0C under agitation for 30\u00a0s and immediately diluted, at the same temperature, in Beltsville Thawing Solution (BTS) at a dilution rate 1:3.71 supplemented with 12% fetal calf serum  and 0.7\u00a0mg/mL caffeine (IVF medium). Forty-five to fifty oocytes freed from cumulus cells were washed twice in IVF medium and transferred to 500\u00a0\u00b5L of the same medium containing 0.25\u2009\u00d7\u2009106 sperm/mL. After 1\u00a0h of gamete coincubation, oocytes were transferred to fresh IVF medium previously equilibrated under 5% CO2 and cultured for 17\u00a0h until fixation as above described .After 1\u00a0h semen was washed twice with BTS and finally resuspended with Brackett and Oliphant\u2019s mediumParameters evaluated were: penetration rate , monospermy rate  and the ability of oocytes to sustain male pronucleus formation.Degenerated and immature oocytes were not counted.b) developmental competence of embryos after 7\u00a0days of in vitro culture. FCS to reach a final FCS concentration of 10% (v/v). At Day 7 post-fertilization, percent of blastocysts and number of blastocyst nuclei were determined by fixing and staining embryos as above described for oocytes . Embryos with at least 20 blastomeres and a clearly visible blastocoel were considered as blastocysts.Based on the results obtained from in vitro fertilization, a set of experiments was carried out to evaluate the effect of Gly and R exposure during IVM on embryonic development of oocytes after IVF. At the end of maturation period in presence of different concentrations of Gly  or R at the same Gly-equivalent doses, oocytes were coincubated with frozen-thawed spermatozoa for 1\u00a0h as described above, washed twice in IVF medium and incubated 3\u00a0h in the same medium. Then presumptive zygotes were washed twice in NCSU-23g for 5\u00a0min and the supernatants were stored at \u2212\u200920\u00a0\u00b0C until assayed for progesterone (P4) and estradiol-17\u03b2 (E2) by validated radioimmunoassays52. At the end of the maturation period, cumulus cells were counted using a Thoma\u2019s hemocytometer, after being freed from matured oocytes by gentle repeated pipetting. For P4, the intra- and interassay coefficients of variation were 6.8% and 10.1%, respectively; assay sensitivity was 4.4\u00a0pg/tube. The intra- and interassay coefficients of variation for E2 were 5.4% and 10.5%, respectively; assay sensitivity was 1.7\u00a0pg/tube. Steroid concentrations are expressed as ng/106 cells.IVM media of both the first and the second day of culture of COCs in presence of Gly  or R at the same Gly-equivalent doses, were collected, centrifuged at 900\u00d736. From each treatment group, oocytes were incubated in the dark for 30\u00a0min at 39\u00a0\u00b0C in PBS/0.1% (wt/vol) PVA supplemented with 10\u00a0\u03bcM H2DCFDA or 10\u00a0\u03bcM CellTracker Blue. Following incubation, the oocytes were washed in PBS/0.1% (wt/vol) PVA, placed into 10\u2011\u03bcL droplets, and fluorescence was evaluated under a Nikon Eclipse E 600 epifluorescence microscope . The fluorescence images were analysed with Image J software (public domain). Relative oocyte fluorescence was measured by normalizing the oocyte fluorescence with the background and with each oocyte area. Five independent experiments were performed .Intracellular GSH and ROS levels of oocytes at the end of maturation period in presence of Gly  or R at the same Gly-equivalent doses, were determined using 4\u2011chloromethyl\u20116.8\u2011difluoro\u20117\u2011hydroxycoumarin  or 2\u2032,7\u2032\u2011dichlorodihydrofluorescein diacetate  respectively as previously described72. Values are expressed as mean\u2009\u00b1\u2009standard deviation (SD) and level of significance was at p\u2009<\u20090.05.Statistical analyses were performed using R (version 3.4.0)Data on nuclear maturation, IVF trials, blastocyst formation and cumulus cell steroidogenesis were analysed using a general linear model with binomial distribution and a Tukey post-hoc test was subsequently run to determine differences between treatments.Data on blastomere number were analysed using a Poisson distribution and a Tukey post-hoc test was subsequently run to determine differences between treatments.Data on GSH and ROS intracellular levels, after being tested for normality and homogeneity of variances through Shapiro\u2013Wilk test, were analysed using Non-parametric Kruskal\u2013Wallis Test and Wilcoxon test was subsequently used to assess differences between treatments."}
{"text": "Calendula officinalis L., and recently proved as a promising anti-Alzheimer. The effect of the critical process parameters (CPP) viz. PLGA amount, Wlecithin/WPLGA ratio, and Tween 80 concentration on critical quality attributes (CQA); entrapment, size and size distribution, was statistically analyzed via design of experiments, and optimized using the desirability function. The optimized CPP were maintained while substituting Tween 80 with other PEG-SAA. All hybrid particles exhibited spherical shape with perceptible lipid shells. The biocompatibility of the prepared NPs was confirmed by hemolysis test. The pharmacokinetic assessments, post-intravenous administration to rats, revealed a significant higher RU bioavailability for NPs relative to drug solution. Biodistribution studies proved non-significant differences in RU accumulation within brain, but altered phagocytic uptake among various LPHNPs. The present study endorses the successful development of LPHNPs using PEG-SAA, and confirms the prospective applicability of TPGS and Solutol in enhancing brain delivery.The blood\u2013brain barrier is considered the leading physiological obstacle hindering the transport of neurotherapeutics to brain cells. The application of nanotechnology coupled with surfactant coating is one of the efficacious tactics overcoming this barrier. The aim of this study was to develop lipid polymer hybrid nanoparticles (LPHNPs), composed of a polymeric core and a phospholipid shell entangled, for the first time, with PEG-based surfactants (SAA) viz. TPGS or Solutol HS 15 in comparison with the gold standard Tween 80, aiming to enhance brain delivery and escape opsonization. LPHNPs were successfully prepared using modified single-step nanoprecipitation technique, loaded with the flavonoid rutin (RU), extracted from the flowers of  The effectiveness of these actives is generally compromised due to failure reaching the site of action sufficiently. The blood\u2013brain barrier (BBB) is considered the most dominant physiological barrier impeding the passage of neuropharmaceuticals to the brain cells. It is a highly fortified membrane system, composed of specialized capillary endothelial cells, that protects the brain from extraneous organisms and harmful chemicals, and supplies the brain with the nutrients required  is considered the gold standard effectively crossing BBB. The fact is due to the preferential adsorption of apolipoprotein E (Apo E), present in blood, on NP surfaces coated with Tween 80, rendering particles resembling the low density lipoproteins (LDL), hence interacting with LDL receptors on BBB and enhancing their cellular uptake via receptor-mediated transcytosis mechanism  and Solutol\u00ae HS 15 (polyethylene glycol-15-hydroxy stearate) -mediated drug transport to the brain has been governed by particle coating with surfactants. The surfactant Tweenco-glycolide (PLGA), respectively. They exhibit a number of advantages compared with liposomes; the extended stability upon storage, the robust structural integrity and the controlled release pattern for encapsulated drugs , was developed combining the characteristics of both systems. These platforms are composed of a polymeric core surrounded by a self-assembly phospholipid shell intertwined with a PEG-containing substrate, typically a PEG-lipid warranting the protracted circulation time  is the most common neurodegenerative disorder causing dementia among the elderly population in the world. It is usually manifested by a bundle of disruptions in memory, thinking, understanding, learning abilities, linguistics, calculation and coordination , the glycoside of the flavonol quercetin, is found in many plants, for instance, citrus fruits , apples, berries, peaches and green tea , a novel promising candidate reported to exert a boosting anti-AD effect. RU . The results were statistically analyzed and then optimized through the desirability function parameter. A comparative study was then developed to compare different coating materials in terms of characterization, biocompatibility, pharmacokinetic and biodistribution studies.In the present work, a novel attempt was studied targeting the anti-AD polyphenol drug (RU) to the brain via the innovative nanoconstructs \u2018LPHNPs\u2019 coupled with surfactant coating. As a new approach, the classical PEG-lipid component in LPHNPs was substituted, for the first time, with PEG-based surface active agents (SAA) aiming to afford equivalent stealth character to the hybrid particles. Among these SAA, Tween 80, TPGS and Solutol HS 15 are prototypes. These SAA also combined the reported persuasive roles in enhanced brain delivery. In this context, RU was first extracted from the flowers of 2.2.1.2.1.1.C. officinalis L., family Asteraceae were collected from the Botanical Garden of El-Orman, Giza, Egypt. The plant was authenticated by Mrs. Trease Labib, Plant Taxonomy Consultant at the Ministry of Agriculture. A voucher specimen has been deposited at Pharmacognosy Department, Faculty of Pharmacy, Ain Shams University, Abbassiah, Cairo, Egypt (PHG-P-CO-1). All used solvents used for extraction were of high analytical grade.The edible flowers of 2.1.2.dl-lactide-co-glycolide (PLGA)  was gently provided from Corbion Purac Biomaterials . The lecithin, Soybean phosphatidylcholine  was kindly supplied by Lipoid GmbH . TPGS was generously delivered by Isochem . Tween\u00ae 80 and Solutol\u00ae HS 15 were obtained from Sigma-Aldrich, Chemical Co. . Methanol (HPLC grade) was purchased from Fluka . Potassium dihydrogen phosphate, disodium hydrogen phosphate, sodium chloride, potassium chloride (KCl), acetone, dimethyl sulfoxide (DMSO) and ortho-phosphoric acid were obtained from Adwia, El-Nasr Pharmaceutical Co. (Egypt). Spectra/Por\u00ae dialysis membrane, 12,000\u201314,000 MWCO was purchased from Spectrum Medical Industries . Nanosep\u00ae centrifuge tubes, fitted with an ultra-filter of 100\u2009kDa MWCO, were provided from Pall Life Sciences . Deionized water provided from Milli-Q Gradient A10 System was employed all over the research study. All other chemicals and reagents were of analytical grade.Poly-2.2.2.2.1.C. officinalis L.) flowers (2\u2009kg) were dried in shade, and extracted with neat methanol several times till complete exhaustion. The methanol in the combined extracts was distilled off at 50\u2009\u00b0C in a rotary evaporator. The remaining concentrated extract was then subjected to preparative TLC using the BAW solvent system butanol: acetic acid: water . A major band showing a dark purple color upon using UV lamp at 365\u2009nm and quenched the UV light at 254\u2009nm, was scratched, dissolved in methanol and the solvent was evaporated in vacuo at 50\u2009\u00b0C, to obtain a yellow powder that was subjected to UV and NMR spectroscopic analysis. 1H and 13C-NMR spectroscopic data were measured at 400 and 100\u2009MHz, respectively, in DMSO on a Bruker Ascend-400 spectrometer . The chemical shifts (recorded in ppm) were measured using tetramethyl silane (TMS) as internal standard. The UV spectroscopic measurement was performed on UV-Spectrophotometer .The marigold  was dispersed in 10\u2009ml deionized water heated to 65\u2009\u00b0C. The resulting PLGA/SPC/RU organic solution was then added into the preheated SAA solution dropwise under gentle stirring. The mixed solution was then agitated vigorously for 5\u2009min. followed by gentle stirring for 2\u2009h at room temperature to ensure complete evaporation of the organic solvent. The drug-loaded PLGA NPs were also prepared, for comparison purpose, using the same method described above except lecithin was excluded from the preparation.2.2.3.X1), Wlecithin/WPLGA ratio (X2) and Tween 80 concentration (X3), each at two levels; 50 and 100\u2009mg, 1/1 and 3/1, 0.5 and 1%, respectively. The critical quality attributes (CQA) considered were Y1; the percent of drug entrapment efficiency (EE), Y2; the particle size (PS) and Y3; the polydispersity index (PDI) of the formed NPs. The typical statistical design of the experiment is displayed in A response surface methodology (RSM) using two-level full factorial design was implemented aiming to optimize the critical process parameters (CPP) of LPHNPs. The experiment studied the effect of three CPP, namely PLGA amount . A sample of 50\u2009\u00b5l of NP dispersion was diluted with 450\u2009\u00b5l deionized water, placed in the upper part of a Nanosep2.2.5.2.Particle size and polydispersity index measurements were accomplished using dynamic light scattering (DLS) technique via Zetasizer Nano ZS instrument . The PS and PDI of three independent samples were measured in disposable cuvettes at a temperature of 25\u2009\u00b1\u20090.5\u2009\u00b0C after 50-fold dilution with deionized water.2.2.5.3.Laser Doppler anemometry (LDA) technique was applied for zeta potential (ZP) measurements using Zetasizer Nano ZS instrument . Three independent samples were suitably diluted with 10\u2009mM KCl and then placed in zeta cells for measurement at a temperature of 25\u2009\u00b1\u20090.5\u2009\u00b0C.2.2.5.4.via HR-TEM  with an acceleration voltage at 200\u2009kV. All samples for TEM imaging were initially prepared by allowing a single drop of NP suspension to dry at room temperature on a carbon-coated copper meshwork after being stained with 1% phosphotungstic acid.The imaging of the selected RU-loaded LPHNPs, as well as PLGA NPs, was performed 2.2.5.5.The thermal properties of different samples of RU, PLGA, SPC and selected loaded NP formulations were studied using a differential scanning calorimeter . The NP formulations were left to dry overnight in a desiccator. Powdered samples were sealed in aluminum pans with lids and heated from 25 to 300\u2009\u00b0C at a rate of 10\u00b0C/min. under nitrogen flow at a rate of 25\u2009ml/min.In vitro release experiments of RU from loaded LPHNPs were performed in PBS (pH 7.4) for 12\u2009h. An aliquot of NPs, equivalent to 1\u2009mg RU, was introduced in a dialysis bag and then placed in a closed container containing 50\u2009ml PBS, acquiring the sink conditions, adjusted at 37\u2009\u00b0C under gentle magnetic stirring. At predetermined time intervals, 1\u2009ml of the medium was withdrawn and then replaced with an equal volume of fresh medium. The amount of RU released was calculated by HPLC at \u03bbmax 360\u2009nm. The release of free drug was also performed similarly. The in vitro release experiments were done in triplicate for each formulation.\u03bbmax 414\u2009nm. The hemolysis index was then calculated using the following equation:t, ODnc, and ODpc are the optical densities of the test sample, the negative control and the positive control, respectively.Erythrocytes separated from rat blood was used to evaluate the potential hemolytic activity of the prepared SAA-coated LHPNPs. Serial dilutions of each nanosuspension type were prepared to assess the biocompatibility of each SAA at different concentration levels in the blood. The hemolytic assay was conducted according to the method adopted by Mourtas et\u00a0al.  with fewThe negative and positive controls were prepared by incubating the erythrocytes suspension with normal saline or deionized water, respectively.2.2.8.3-U100 insulin syringe equipped with 28\u2009G needle at RU dose level of 5\u2009mg/kg  were divided into 4 groups each of six animals. The study protocol was reviewed and approved by the Experiments and Advanced Pharmaceutical Research Unit (EAPRU), Faculty of Pharmacy, Ain Shams University on the use of the animals. The treatment was performed as follows; group I received RU solution prepared in 10% DMSO while groups II, III and IV received RU-loaded Tween 80-LPHNPs, TPGS-LPHNPs, Solutol-LPHNPs, respectively. All formulae were injected into the tail vein of the rats using a 1\u2009cm/kg Zhu, . SamplesCmax) and the time to reach Cmax (Tmax) were detected from plasma drug charts. The areas under the curve from time zero to last sampling time (AUC0\u2212t), the area under the curve from time zero to infinity (AUC0\u2212\u221e), and those under the first moment curve (AUMC) were determined. Mean residence time (MRT) was computed by dividing AUMC by AUC. The relative bioavailability (Fr), defined as the ratio of AUC0\u2212\u221e of either TPGS or Solutol-LPHNPs to that of Tween 80-LPHNPs at the same doses administered, was also calculated.The plasma RU concentrations versus time data for different groups were analyzed by non-compartmental estimations using PKsolver, the add-in program for pharmacokinetic and pharmacodynamic data analysis in Microsoft Excel. Maximum plasma concentration  were randomly divided into three groups administered the three loaded formulae under study  intravenously through the tail vein via a 28\u2009G-needle insulin syringe at a dose of 5\u2009mg/kg. At different time intervals after drug injection; 0.25, 0.5, 1, 2, 4 and 6\u2009h, three mice from each group were sacrificed by decapitation. Different organs; brain, liver, spleen, and kidney were dissected from each mouse, washed with normal saline, blotted with filter paper to remove excess fluid, weighed and then stored at \u221220\u2009\u00b0C until analysis.On the day of analysis, organ samples are allowed to thaw and then subjected to homogenization after the addition of a calculated volume of normal saline. The tissue homogenates were centrifuged at 4000\u2009rpm for 15\u2009min, and the supernatants were collected for drug extraction. The RU concentrations in tissue samples were analyzed by LC/MS, similarly to plasma samples, and the mean RU amounts per g organ were then calculated and plotted versus time, and all pharmacokinetic parameters were computed as described earlier.2.2.10.in vitro samples according to Kunti\u0107 et\u00a0al.  was used and maintained at temperature =40\u2009\u00b0C. The mobile phase constituted of a binary mixture of methanol\u2013water 1:1 (v/v), pH 2.8 (adjusted with phosphoric acid) adjusted at flow rate of 1\u2009mL/min. The wavelength of UV detector was set at \u03bbmax 360\u2009nm. The method was first validated according to the International Conference on Harmonization guidelines . The data was analyzed using ChemStation B.04.01 software .An isocratic RP-HPLC was adopted to quantify RU in all \u0107 et\u00a0al.  using Ag2.2.11.m/z 608.9 precursor ion to the m/z 300.0 for RU and m/z 295.6 precursor ion to the m/z 268.9 for IS. Quadrupoles Q1 and Q3 were set on unit resolution and the analytical data were processed using Analyst software (Version 1.4.2).A sensitive, selective and accurate LC\u2013MS/MS method was developed and validated for the determination of RU concentrations in plasma. Stock solution of hydrochlorothiazide internal standard (IS) was prepared by dissolving 10\u2009mg in methanol and serially diluted with mobile phase to give a final working concentration of 200\u2009ng/ml. A shimadzu Prominence  series LC system equipped with degasser (DGU-20A3), solvent delivery unit (LC-20AB) along with auto-sampler (SIL-20 AC) was used to inject 20\u2009\u00b5l aliquots of the processed samples on a Luna C  (50\u2009\u00d7\u20094.6) mm, 5\u2009\u03bcm particle size. The isocratic mobile phase (pH 4.5) consisted of acetonitrile and (0.02\u2009M) ammonium acetate buffer  and 0.1% formic acid which was delivered at a flow rate of 0.50\u2009ml/min into the mass spectrometer\u2019s electrospray ionization chamber. All analysis was carried out at room temperature. Quantitation was achieved by MS/MS detection in negative ion mode for both RU and IS, using a MDS Sciex  API-3200 mass spectrometer, equipped with a Turbo ionspray interface at 400\u2009\u00b0C. The ion spray voltage was set at \u22124500\u2009V. The nebulizer gas was set at 30\u2009psi, curtain gas at 15\u2009psi, auxiliary gas at 55\u2009psi and collision gas at 9\u2009psi. The compound parameters, namely, declustering potential, collision energy, entrance potential and collision exit potential were \u22121\u2009V, \u221252\u2009V, \u221210\u2009V, and 19\u2009V for RU and \u221245\u2009V, \u221222\u2009V, \u221210\u2009V, and \u221212\u2009V for hydrochlorothiazide (IS), respectively. The ions were detected in the multiple reaction monitoring mode, monitoring the transition of the 2.2.12.in vitro experiment was performed in triplicates; the average data and their standard deviations (SD) were then calculated. Results of the in vivo studies were expressed as mean\u2009\u00b1\u2009standard error of the mean (SE). For statistical comparisons, a paired t-test was used; p\u2009<\u20090.01 was considered significant statistically.Each \u00ae version 7.0.0 software  applying design of experiment (DoE) by means of RSM and two-level full factorial design. The following polynomial equation model was employed fitting the experimental data and predicting the new trials (out of the design): Y\u2009=\u2009\u03b20\u2009+\u2009\u03b21X1\u2009+\u2009\u03b22X2\u2009+\u2009\u03b23X3\u2009+\u2009\u03b212X1X2\u2009+\u2009\u03b213X1X3\u2009+\u2009\u03b223X2X3\u2009+\u2009\u20ac where Y represents the predicted response, X1, X2, and X3 are the independent variables, \u03b20 is the intercept, \u03b21, \u03b22, and \u03b23 are the main effect coefficients, while \u03b212, \u03b213, and \u03b223 are the two-way interaction coefficients, and \u20accorresponds to the model residual. The quality of fit the experimental data by the polynomial model equation was expressed by the coefficient of determination (R2) and its adjusted R2. The analysis of variance (ANOVA) was adopted. The significance of each coefficient term and the lack of fit of the suggested model were evaluated via p-value and F-value with 95% confidence level. Main effects, contour and 3D-response surfaces plots were all designed.The statistical relationships between the CPP and CQA in the experimental design were adopted using Design Expert2.2.13.After statistical analysis of the experimental design data, a numerical optimization was statistically adopted by applying the desirability function (D) which transforms the values of a response into  where 0 stands for a non-acceptable value of the response and 1 for ideal target values of this response  of 0.5 on TLC using the solvent system butanol:acetic acid:water  which was in accordance with the authentic compound Rf value.Phytochemical investigation of \u03bbmax (nm) MeOH: 257, 266 (sh), 301 (sh), 362. 1\u2009H-NMR  \u03b4 ppm: 1.00 , 3.10-3.72 , 5.11 , 5.35 , 6.20 , 6.41 , 6.85 , 7.55 , 7.59 , 9.20 , 9.68 , 10.85 , 12.59 . 13\u2009C-NMR  \u03b4 ppm: 18.19 (C-6\u2032\u2032\u2032), 68.70 (C-5\u2032\u2032\u2032), 67.45 (C-6\u2032\u2032), 70.45 (C-2\u2032\u2032\u2032), 70.83 (C-3\u2032\u2032\u2032), 71.01 (C-4\u2032\u2032\u2032), 72.30 (C-4\u2032\u2032), 74.52 (C-2\u2032\u2032), 76.35 (C-5\u2032\u2032), 77.30 (C-3\u2032\u2032), 94.05 (C-8), 99.14 (C-6), 101.19 (C-1\u2032\u2032), 101.60 (C-1\u2032\u2032\u2032), 104.42 (C-10), 115.68 (C-2\u2032), 116.72 (C-5\u2032), 121.63 (C-6\u2032), 122.05 (C-1\u2032), 133.74 (C-3), 145.19 (C-3\u2032), 148.85 (C-4\u2032), 156.87 (C-2), 157.07 (C-5), 161.66 (C-9), 164.51 (C-7), 177.80 (C-4), as illustrated in Figure S2.Yellow amorphous powder (100\u2009mg), UV 3.2.Wlecithin/WPLGA ratios, as previously reported in such cases , not dispersed in water as usual, together with the polymer and drug. It could be assumed that the precipitation of PLGA into NPs simultaneously occurred with self-assembling of lecithin around them owing to hydrophobic interactions. The lipid hydrophobic tails were anchored to the polymeric hydrophobic core while the hydrophilic head was extended to the external aqueous medium stabilizing the hybrid NPs formed. The steric stabilization of LPHNPs was conventionally afforded by the PEG chains of a lipid-PEG element. Nevertheless, this was compensated in this study by; (1) higher Wlecithin/WPLGA ratios and Tween 80 concentrations was studied on drug EE, PS, and PDI. The formulation results, depicted in The effect of different PLGA amounts, 3.3.3-full factorial design was applied and the product design space was defined leading to eight sets of experiments with three replicates. The statistical significance of three CPP, i.e. polymer amount, Wlecithin/WPLGA ratio and Tween 80 concentration, each at two levels, on different LPHNPs CQA; EE, PS, and PDI; were considered using RSM.A DoE was conducted to evaluate and quantify the effect of independent factors on the selected CQA. A 2Table S1.The Box\u2013Cox Plot for power transforms was initially diagnosed. This is typically used as a guideline for selecting the correct power law transformation (lambda) set at the minimum point of the curve generated by the natural log of the sum of squares of the residuals  for both EE and PS while the linear equation was recommended for PDI. The coefficient of determination (R2) was calculated to be higher than 0.9 for all responses under study (Table S1) indicating the satisfactory adjustment of the suggested models to the experimental data as well as the high predictability of these models. The non-significant \u2018Lack of Fit\u2019 (p\u2009>\u20090.05) for all models is considered a good sign implying its insignificance relative to the pure error. The \u2018Predicted R2\u2019 were in reasonable agreement with the \u2018Adjusted R2\u2019 for all models under study. The \u2018Adequate Precision\u2019 measures the signal to noise ratio. A ratio greater than 4 is desirable indicating an adequate signal, hence all models can be used to navigate the design space.The statistical models were developed by regression analysis using the experimental data for the drug EE, PS, and PDI, as displayed in Table S2, it was found that all main effects model terms  were found significant in terms of EE and PS (p\u2009<\u20090.05). In the case of PDI, only X1 was considered significant. The interaction model terms were found significant in EE and PS models only. Note that the non-significant model terms were omitted, so that the model reduction may improve its applicability.By means of observation of ANOVA analysis, based on Table S2) show that all factors studied had significant effects on RU EE (p\u2009<\u2009.01), being the effect of Wlecithin/WPLGA ratio the highest. A clear positive influential EE response was associated with PLGA amount and Wlecithin/WPLGA ratio and, whereas the SAA concentration impacted a negative effect, as presented in Table S1 equations. As illustrated in contour and 3D-response surface plots (Wlecithin/WPLGA ratio parameter. The highest RU EE was attained at the highest levels (+1) of both factors; 100\u2009mg PLGA and 3/1 Wlecithin/WPLGA ratio.The ANOVA results  with the most prominent effect goes for PLGA amount. Increasing polymer amount led to an enlargement in PS while the opposite followed in case of Wlecithin/WPLGA ratio as well as SAA concentration, as shown in X1 and X2 where at high level (+1) of Wlecithin/WPLGA ratio (3/1), the both lowest and highest PS were manifested yet when combined with the low (\u22121) and high (+1) levels of PLGA amount, respectively. Also, the lowest PS was reached when the lower level (\u22121) of PLGA amount was accompanied with the higher level (+1) of Tween 80 concentration, as revealed in The effect of polymer amount in the prepared hybrid NPs was found similar to that in case of nonhybrid (polymeric) NPs. Increasing polymer content increased drug EE, PS and heterogeneity of the NPs formed. This could be ascribed to the rapid precipitation of the polymer on the surface of the internal droplets hindering drug diffusion, hence EE improved. The increased viscosity of the dispersed phase increases the diffusion resistance of drug molecules from the organic to the aqueous phase leading to the formation of non-uniform larger particles of longer diffusional pathways for the drug, thereby reducing its loss and increasing its entrapment ) were constructed relating X1 and X2 at 0.5 and 1% Tween 80 concentration, respectively. These plots show the optimal goal parameters for attaining the QTPP required. As displayed in Figure S3(A and B), the highest D attained was 0.69 and 0.64, at 0.5% and 1% SAA concentration, respectively. The target areas in plots are manifested in yellowish green color. Therefore and based on D values, the optimal CPP; PLGA amount, Wlecithin/WPLGA ratio and Tween 80 concentration, were adjusted to 75\u2009mg, 3/1 and 0.5%, respectively.After statistical analysis, a numerical optimization was conducted aiming to select the most optimum CPP for the preparation of LPHNPs. The optimal quality target product profile (QTPP) was set in terms of EE, PS, and PDI, as tabulated in 3.5.Figure S3(C\u2013E), the predicted CQA of the optimized formula consisting of 75\u2009mg PLGA, 3/1 Wlecithin/WPLGA ratio and 0.5% Tween 80 were 69.13%, 241.89\u2009nm and 0.3 for EE, PS, and PDI, respectively. The optimized formulation was then prepared using the optimized CPP and all actual CQA were measured, recorded in Table S4 and compared with the predicted values. By computing the prediction error percent, it could be concluded the validity and predictability of the model equations generated from DoE owing to the small %bias which did not exceed 20%  the highest EE and the lowest PS among all prepared NPs. The fact could be attributed to the apparent increase in viscosity of the aqueous phase in which SAA was dissolved, owing to the higher Mw of TPGS (1513\u2009g/mol) compared with other SAA (Tween 80 Mw =\u20091310\u2009g/mol and Solutol HS15 Mw=\u2009963.24\u2009g/mol), which would reduce the drug diffusion and loss in the surrounding medium, and hence improve drug EE. In the same context, the efficiency of TPGS as emulsifier has been previously reported during the preparation of polymeric NPs  of the prepared NPs were also measured and tabulated in 3.7.p\u2009>\u2009.05) in PS and surface charge of the dialyzed suspensions (data not shown) in comparison with the non-dialyzed ones, as recorded in in vitro hemolysis assay.A dialysis-based purification step was applied aiming to recover NPs as well as eliminate excess SAA and unentrapped drug from the prepared nanosuspensions. Only 30\u2009min. was found sufficient to get rid of all free drug, after which the release of entrapped RU began. Though this short dialysis duration was found not satisfactory to wipe out completely the excess SAA present, this was confirmed by the non-significant alteration (3.8.3.8.1.Tg)  Percent Hemolysis induced by incubation of various types of RU-loaded LPH NPs with rat blood at different SAA concentrations. Each data represents the mean\u2009\u00b1\u2009SD (n\u2009=\u20093). The black dotted line in (d) denotes the permissible threshold hemolysis percent. NS; Nonsignificant difference at p\u2009>\u2009.05.(A) DSC thermograms of RU, PLGA, SPC and loaded LPH NPs. (B) HR-TEM micrographs of RU-loaded Tween 80-LPH NPs (a), TPGS-LPH NPs (b), Solutol-LPH NPs (c) and polymeric NPs prepared with 50\u2009mg PLGA and 1% Tween 80 (d). (C) 3.8.2.co-exist adjacent to hybrid particles, as pointed out by red arrows in TEM was used to visualize the morphology of RU-loaded LPHNPs coated with different PEG-based SAA. As illustrated in in vitro release study of RU from different formulations was performed using dialysis bag technique in PBS pH 7.4 adjusted at 37\u2009\u00b0C under sink conditions. The comparative drug release profiles of different types of loaded LPHNPs were illustrated in .,The p\u2009<\u2009.05) compared with the corresponding nanocarriers either coated with TPGS or Solutol at all SAA concentration levels. The low toxicities of TPGS and Solutol were previously reported by Pooja et\u00a0al. (p\u2009>\u2009.05) in hemolysis was detected in case of Tween 80 between concentrations 0.25 and 0.5\u2009mg/ml, 0.5 and 1\u2009mg/ml while for TPGS and Solutol the insignificance was recognized at concentration range 0.1\u20130.5\u2009mg/ml. Based on numerous studies, the in vitro percent hemolysis is assessed as \u2018no concern\u2019 when it ranges from 5% to 25%  by about 160-fold, 98-fold, and 159-fold was perceived for Tween, TPGS, and Solutol-based particles, respectively, relative to the drug solution  and Fr values almost equal 1 , expressed by non-significant differences in AUCs  especially in liver and spleen, expressed by lower AUCs. This excitingly reveals the efficiency of this PEG-SAA in sheathing NPs away from macrophages recognition, compared with other SAAs. Unexpectedly, TPGS-LPHNPs exhibited higher drug accumulation in RES organs; liver\u2009>\u2009kidney\u2009>\u2009spleen, reflected by significant higher AUCs (p\u2009<\u2009.05) compared with Tween-sheathed particles, translated by high Fr values, computed as 2.26, 2.69 and 1.14 in liver, kidney and spleen, respectively. The predominant cause of NPs loss from the systemic circulation is its phagocytic uptake by RES. These results demonstrate that the surface modification with TPGS did not avoid the opsonization process and engulfment of particles by macrophages. Similar finding was previously reported by Dur\u00e1n-Lobato et\u00a0al.  for all prepared hybrid NPs relative to the drug solution. However, TPGS\u2013LPHNPs exhibited a much lower drug bioavailability compared with the other NPs. The biodistributions of different LPHNPs were also studied. Nonsignificant differences in brain drug uptake (p\u2009>\u2009.05) were detected among the different types of LPHNPs However, NP surface treatment with TPGS specifically exhibited a noticeable higher phagocytic uptake in RES organs. The results of the present study highlighted the potential applicability of Solutol and TPGS in brain targeting being equivalent to the gold standard Tween 80. This study opens the door for further investigations in the field of neuro-pharmaceuticals aiming to confirm the competency of these PEG-SAA in brain delivery, phagocytic uptake evasion, and long circulation in blood.We have successfully developed the novel LPHNPs composed of a PLGA polymeric core and soybean lecithin intertwined, for the first time, with a PEG-SAA instead of PEG-lipid, forming the lipid shell for the effective delivery of RU to the brain. Single-step modified nanoprecipitation method was adopted to prepare LPHNPs using Tween 80. A 2Click here for additional data file."}
{"text": "People living with Long Term Neurological Conditions (LTNCs) value peer support and social activities. Psychological support and wellbeing enables them to manage their condition. Social prescribing is a formal process of referring patients to a link worker to co-design a plan to improve their health and wellbeing. Intervention involves supporting participation in activities based within the individual\u2019s local community. This study aimed to explore the barriers and enablers to accessing social prescribing for people living with LTNCs (plwLTNCs).A total of four focus groups were carried out with 17 participants, including different neurological conditions such as multiple sclerosis, Fragile X Syndrome, epilepsy, and traumatic brain injury. Two participants were family carers and supported people living with epilepsy and motor neurone disease. Findings were analysed using thematic analysis.Five themes were identified: (1) Lack of knowledge; (2) Service provision difficulties; (3) Benefits of social prescribing activities; (4) Physical barriers and (5) Psychological barriers. There was a lack of knowledge about social prescribing and what it actually was. Participants anticipated service provision difficulties relating to funding, link workers need for knowledge of LTNC\u2019s and for activities to be varied and individualised. The potential benefits of social prescribing activities were recognised across the groups especially its potential to tackle loneliness and to offer plwLTNC\u2019s purpose. Participants highlighted a number of physical barriers such as transport and accessibility; and psychological barriers such as anxiety and stigma.Social prescribing aims to address the health inequalities of those living with long-term conditions, however currently it is likely to exclude plwLTNCs. Recommendations for practice and future research are made.The online version contains supplementary material available at 10.1186/s12913-021-07213-6. There are an estimated 14.7 million neurological cases in England, equating to at least 1 in 6 people living with one or more neurological condition . Neurolon\u2009=\u20093459) of the neurology patients they surveyed reported living with at least one other co-morbid condition  prior to study commencement.A copy of the topic guide can be found in supplementary materials  is an occupational therapist and working in the field of long-term neurological conditions, with an MRes degree and some experience in qualitative data. She received further qualitative data support from CG, educated at PhD level in Psychology, who has in-depth experience in conducting qualitative research with vulnerable population groups. Both of their backgrounds made them aware of the population groups as a whole, whilst they were solely guided by the data and not by their background.A total of four focus groups (minimum 4 participants) were carried out with a total of 17 participants, 12 female and 5 male. Participants represented the views of people living with a variety of neurological conditions, this included multiple sclerosis (2), Fragile X Syndrome (1), epilepsy (4), traumatic brain injury (1), essential tremor (2), ataxia (2) and subarachnoid haemorrhage (3). Two participants were family carers and supported people living with epilepsy (1) and motor neurone disease (1).Across the four focus groups five themes were identified: (1) Lack of knowledge; (2) Service provision difficulties; (3) Benefits of social prescribing activities; (4) Physical barriers and (5) Psychological barriers. Within these themes subthemes were identified and are outlined.The majority of participants had not heard of the term social prescribing. Those who had had been made aware of it by the charity where the focus groups took place or had seen information in the media. Reference was made to the term social prescribing and its link to a medical model of care and the potential difficulties the term would introduce when searching for information.\u201cI don\u2019t think I\u2019d necessarily heard the term but I know what that means. I\u2019d seen stuff about people gardening and people being outdoors so I presumed it was all interlinked in to that side of things.\u201dFocus Group 1 Participant\u201cI have heard it in the media and the papers and actually I think there was something on BBC news actually all about it. I might not be right but I think it is all about coming up with something that you can do to aid your condition or your recovery after what might \u2026 all of us have some sort of neurological condition so it is about that.\u201dFocus Group 4 Participant\u201c \u2026 because it was just like a two-minute thing my consultant recommended coming here because there was no more that he could do, because he was so busy it was just like go there for help with practical support, I hadn\u2019t even thought of it but I was told here (referring to the charity).\u201dFocus Group 2 Participant\u201cI think also it is getting GPs on board as well because if they do, GPs are obviously snowed under aren\u2019t they?\u201dFocus Group 4 ParticipantNone of the participants had knowingly accessed a social prescribing service. For the few who had accessed activities or groups, the trigger was a passing comment made by a health professional or was the outcome of their own motivation to participate. Participants highlighted the need for education of health care professionals about social prescribing so that they could consistently signpost or refer people living with LTNCs.Participants felt link workers would need to have knowledge and understanding of LTNCs. There was recognition amongst the groups that this would be a challenge given the number of neurological conditions and the vast array of difficulties faced by people living with LTNCs. Participants made reference to link workers needing good communication and social skills. Participants felt some people living with their conditions would need link workers to use a variety of communication approaches such as e-mail, text message and sykpe as well as face to face to engage with people. For those with memory problems the use of text reminders was highlighted as an important enabler. They felt given the challenge link workers would face, they would need to feel valued and have access to training and support.\u201cI think something like this (referring to the charity), or like a booklet for people potentially going in as link workers would help them. Like the different diagnosis, what to expect \u2026 \u201dFocus Group 2 Participant\u201cYou need people who are like, no matter who the person is or whether they are autistic or epileptic or I don\u2019t know, no matter what the problem is they\u2019ve got to be able to actually communicate with that person which would probably be difficult to find\u201dFocus Group 3 ParticipantThe need for knowledge from link workers extended to services and activity providers. In order to achieve this understanding, emphasis was placed on the need to involve people living with LTNCs in the development and delivery of services. Participants recognised the cost of providing services and that activities needed to be adequately funded.\u201cI mean the big thing is funding isn\u2019t it, I mean, the NHS is struggling and we, you know social prescribing requires money to have a link worker and valuing the fact that this link worker is important. You know you can go to your GP and go and see the specialist nurse and whatever but they don\u2019t fully understand what your condition is and there are so many different conditions so funding is a big thing\u201dFocus Group 4 Participant\u201cIt\u2019s all more workers thought isn\u2019t it? You know it\u2019s not an easy fix you know. One to one is all more work and it\u2019s all more expense if it\u2019s being paid for by the NHS.\u201dFocus Group 2 ParticipantRecognition of individual differences despite the same diagnosis was important with participants emphasising that one size does not fit all and that activities would need to be varied. Ensuring services got to know the person living with a LTNC and focused on their abilities rather than their disabilities was a priority. Participants considered the impact finances had on the ability to participate in activities as many were unemployed or living on a reduced income. Some highlighted problems negotiating the benefits system.\u201cCause like you were saying before, if your benefit that you\u2019re entitled to is stopped your income is going to go down, so of course money to access anywhere or there being places that are local for you to go to. It\u2019s more expensive to get to if they\u2019re not local anymore\u201dFocus Group 2 Participant\u201cI think with social prescribing for neurological conditions there has to be realisation that not one size fits all, because of the variety of the conditions you can\u2019t just say you\u2019ve got MS, you\u2019ve got epilepsy whatever maybe I\u2019ll send you off to a gardening group. So there has got to be a real thought process behind what\u2019s being prescribed for people.\u201dFocus Group 1 Participant\u201cMaybe it will put a lot of emphasis on the things that you can\u2019t do anymore, and even if you can\u2019t do things anymore, they don\u2019t put the emphasis on all of the stuff that you actually still can do and focus on that instead.\u201dFocus Group 3 Participant\u201cI think sometimes with neurological conditions the person needs to be there to support them a little bit longer than maybe someone who doesn\u2019t have a neurological condition\u201dFocus Group 4 ParticipantParticipants felt access to support to attend groups would be important and they felt consideration was needed as to how long this support was provided. Participants felt people living with LTNCs may require a more prolonged period of support to be able to continue participation independently. Due to the high levels of anxiety and reduced confidence experienced by plwLTNCs, they believed it was unlikely a single accompanied visit would be sufficient.Participants discussed the difficulties faced by people living with LTNCs. Social isolation was seen as a significant problem in all focus groups. Participants expressed feelings of loss, difficulties maintaining relationships, managing families concerns and the impact of not working.\u201cThe isolation is the worst part because you go from, well depending on what issue you have, I have gone from what I had which was a very pressurised work environment, kind of working at the top of what I could do in a very busy, I suppose in and I know this sounds stupid, but being quite important in terms of what I did to everything has gone.\u201dFocus Group 1 Participant\u201cI think getting a diagnosis is isolating in itself because you can still have your friends and your family and everyone that you used to have still around you but it\u2019s something that has only happened to you. So things to help people feel less isolated\u201dFocus Group 3 ParticipantSocial prescribing was considered an opportunity to reduce social isolation for people living with LTNCs. Activities provided the opportunity to socialise and connect with others. Attending activities could provide a reason to leave the house and participation in activities provided a sense of purpose. New activities offered the opportunity to learn a new skill and for some this was felt to act as a form of rehabilitation promoting further recovery. Others felt activities provided important mental stimulation. For those participants living with ataxia physical exercise and sport was seen as a valuable activity for supporting mental and physical health as well as providing opportunity to socialise. Participants living brain injury felt participation in activities could aid recovery, whilst others with degenerative conditions focused more on the sense of purpose activities provided.\u201cI do a stitch club because my brain has not been working properly and I have been like well if my brain needs to work out new ways to work let\u2019s do something that your brain has never done before, so I stitch and actually from stitching that got me involved in other bits and bobs so it\u2019s just been super cool\u201dFocus Group 1 Participant\u201cI think volunteering gives you a real sense of purpose. It\u2019s really important. Obviously it\u2019s easier to access for people with neurological conditions, looking for a job might be difficult, but getting in to volunteering can be easier\u201dFocus Group 2 Participant\u201cI don\u2019t want to sit at home and not doing anything, I don\u2019t think anyone wants that\u201dFocus Group 4 ParticipantParticipants made particular reference to the benefits of volunteering and peer support. Opportunities to volunteer were key to providing people with feelings of purpose and could provide an alternative to paid employment. Meeting with people with the same or similar conditions was important for many of the participants. Attendees could choose to talk about their conditions and gain support, alternatively they could talk about anything other than their condition, but knew they were with people who understood.\u201cThat\u2019s actually probably the best thing about me being in an environment with people who have got head injuries is that nobody talks to me about it.\u201dFocus Group 1 ParticipantParticipants raised a number of concerns regarding accessing social prescribing activities. The availability of activities and the accessibility of buildings was recognised to be a physical barrier to participation. For those participants who were wheelchair users lack of access to an appropriately adapted toilet was often a barrier to participation, some participants explained that they would either not drink or minimise the length of time they were out. Timing of activities was also discussed in relation to how medications or symptoms of a neurological condition can impact on a person\u2019s ability to attend activities at certain times particularly early in the morning. Fatigue was a symptom experienced by the majority of participants and is recognised as a symptom of many neurological conditions.\u201cYes, and even the time of day perhaps as well. I know speaking perhaps for XXX is that she is always better, livelier because of medications in the morning, and we\u2019ve spoken to other people and by the afternoon because of the medications they are on they\u2019re weary and need a rest and tend not to go out in the evenings as well for various reasons, so mornings tend to be, certainly for us and others that we know, are better.\u201dFocus Group 1 ParticipantSome participants highlighted the need to consider the activities and the potential need to adapt an activity to enable participation. This was especially pertinent to those who were wheelchair users or had reduced hand function. Risk assessment was also important for those living with epilepsy and having the option to complete activities whilst seated.\u201cI have tonic clonic seizures so I could go from kind of like standing up to automatically being on the floor and therefore I am not able to kind of work in a garden, whereas I could quite happily be watching kind of a film \u2026 .or discuss books or that sort of thing, it\u2019s a safer environment.\u201dFocus Group 1 ParticipantDiagnosis with a neurological condition can result in temporary or permanent restrictions on driving. All the groups talked about the impact of being unable to drive and issues relating to accessing public or private hire transport.\u201cI\u2019m sort of the isolated sort of way because I\u2019m unable to drive due to my condition so when my mum who is also sitting next to me, is out then I can\u2019t drive so I\u2019m sort of isolated. I\u2019m just sort of sat there and there is no outreach like kind of groups for me unless I\u2019m able to get taxis to places\u201dFocus Group 1 Participant\u201cYou go out and you might have a seizure on the train or on the train platform or on a bus, and people won\u2019t help you or in a taxi and you might get chucked out the taxi just anywhere or the taxi driver\u2019s going to act real funny about it. So you end up sort of thinking \u2018oh, you know, it\u2019s just sensible if I stay at home\u2019 \u2026 and then you do stay at home and then you never leave \u2026 and then you just get comfortable staying in\u201dFocus Group 3 ParticipantAll groups highlighted a number of psychological barriers. Reduced confidence and anxiety was regarded as a barrier to people with LTNCs visiting new places or joining groups and activities. Concerns related to physical symptoms, communication and duration of increasing isolation was discussed. Families\u2019 worries about the person living with a LTNC and needing to manage their concerns was explored as another potential barrier.\u201cI\u2019d love to get out and about a bit more but the fear of going out and the fear of tripping that\u2019s what makes me think about, I know I shouldn\u2019t because I\u2019m over reacting or you may think so but me, I\u2019m not. I panic, I am a panicker.\u201dFocus Group 3 Participant\u201cI think one of the biggest issues is the actual carer or family that are trying to maybe cocoon the person with the neurological condition and making assumptions like \u2018well I don\u2019t think they can do that\u2019 because they are trying to be overprotective. So I think if the link worker tried to work with the family to ensure the family are and the carers are comfortable because once they feel that comfort then they will work with the link worker\u201dFocus Group 3 ParticipantStigma and lack of acceptance by others was seen as a significant barrier for people living with LTNCs. The general public\u2019s awareness of LTNCs was felt to be poor in particular their understanding of hidden or invisible disabilities. Those participants living with epilepsy felt many groups immediately put up barriers when hearing their diagnosis and were worried something might happen to trigger a seizure and the consequences of this for the group. Some participants felt their mental capacity was questioned when they revealed their diagnosis and people would change their behaviour towards them often in a negative way. There appeared to be a strong desire to be accepted and treated like everyone else.\u201cWell the main worry is if you haven\u2019t gone so long without a seizure and you\u2019re frightened of people\u2019s reactions... Cause I\u2019ve been stopped by the police for being drunk and I don\u2019t even drink \u2026 because they don\u2019t understand the condition, you know there\u2019s people with different disabilities they don\u2019t understand. Because I always say role reversal, you\u2019ve got to have been through it to understand it\u201dFocus Group 3 Participant\u201cI think with anybody who has had a neurological condition physically you look fine, it is what\u2019s going on in the inside and people don\u2019t, don\u2019t know and that is due to lack of knowledge, lack of education.\u201dFocus Group 4 Participant\u201cA lot of people are like \u2018oh you can\u2019t do this and you can\u2019t do that\u2019 and you know, you can\u2019t do these things and you\u2019ve got to take these meds and you can\u2019t stay out late at night and you can\u2019t do all these myriad of things where really I probably can or could if I had some support.\u201dFocus Group 3 ParticipantThese are amongst the first findings to explore the potential benefits and perceived barriers to accessing social prescribing for people living with LTNCs. Participants highlighted that there was very little knowledge of social prescribing amongst people living with LTNCs. Those who had accessed social prescribing activities had done so by chance and as a result of their own proactiveness. The lack of signposting by health professionals was apparent and there was an agreed need for health professionals to be educated about social prescribing. Bickerdike et al. (2017) reported that social prescribing was unfamiliar to many GPs and in order to engage participants they required a good clear explanation . This seThe benefits of participation in activities was recognised by all the focus groups. Participation was seen to provide meaning and purpose. A strong emphasis was placed on the social benefits of participation. Similar findings have been demonstrated in social prescribing studies. An evaluation of a social prescribing service in Northern England found that accessing a range of activities provided a sense of independence and gave individuals a sense of purpose . A recenStigma was found to impact on social identity leading to loss of confidence and anxiety. Research into stigma particularly the impact of living with epilepsy has shown that stigma can result in a perceived reduction in social value and poor quality of life . InterveSupport to return to work or to find volunteering opportunities was a desirable area for link worker support for many of the participants. People with LTNCs who fail to return to work after injury or onset, or who are encouraged to relinquish work prematurely may be financially disadvantaged, have a poorer quality of life and suffer adverse health outcomes such as anxiety and depression \u201363. For Participants discussed the physical barriers to accessing social prescribing activities. Transport was seen as a significant barrier to participation. Many studies have highlighted that transportation is often a barrier to participation in community based activities , 68\u201370. Participants emphasised the need for knowledgeable link workers and services given the complexity of LTNCs, the challenges faced by many living with a neurological condition and the importance of individuality. A recent systematic review  examinedThe provision of group and individual programmes that promote health, social interaction and self-efficacy have been at the forefront of occupational therapy intervention historically . AccordiOccupational therapists should be recruited to work alongside link workers to reach those living with LTNCs in order to tackle many of the barriers highlighted in this study. With the push to introduce New Roles in primary care networks this could be achieved through direct referral to occupational therapists based within primary care who would then work collaboratively with a link worker . This moThe National Institute for Health and Care Excellence (NICE) public health guideline \u2018Mental Wellbeing in over 65\u2019s\u2019  focuses This study was subject to some limitations. It is recognised that the study included a small number of plwLTNC and participants and may not be representative of all LTNCs. As a result of convenience sampling, our study included people with multiple sclerosis, Fragile X Syndrome, epilepsy, traumatic brain injury, essential tremor, ataxia and subarachnoid haemorrhage. The family carers supported people living with epilepsy and motor neurone disease. The investigators took the decision to keep demographic data to a minimum in order to help participants to feel their responses would be completely anonymised especially given the small sample size. This article will be accessible to all and that will include the charity where the study took place. Details regarding age, ethnicity and locality were not collected and quotes do not indicate who is responding or their diagnosis as this would identify who the respondent was especially single representatives of a condition. However, this is one of the very first studies exploring social prescribing with plwLTNCs, indicating steps for future research to build on, such as expanding the participant pool to incorporate a greater variation of LTNCs. The majority of participants were regular attendees at the charity where the focus groups were run and this may have influenced their responses leading to potential response bias. This might have included avoiding making critical comments about the activities run by the charity or adapting responses due to being familiar with other members of the focus group. The decision to have mixed groups of family carers and plwLTNCs is acknowledged to be another limitation of the study as the presence of each might have resulted in people holding back to avoid offending or upsetting another participant due to their status. The study may not represent those plwLTNC who experience significant difficulty leaving the house and are in greater need of social prescribing than those people represented in this study. Future research should aim to reach out to those who are unable to leave their homes to establish if they experience the same or different barriers to social prescribing activities. Research should also examine the impact the pandemic has had on the wellbeing of plwLTNCS. This should include potential positive changes such as online groups and activities which aimed to enable social interaction and inclusion during the pandemic , but alsThis study emphasises the need to consider the whole system and how social prescribing can be framed to meet the needs of plwLTNC. Future research should explore how best to enable participation by overcoming physical and psychological barriers and by identifying interventions that reduce the impact of psychological barriers such as stigma. A particular focus needs to be set on the impact of the COVID-19 pandemic on engaging with social prescribing, as this is likely to have thrown up further barriers in accessing general social support, as emerging evidence highlights. The pandemic has also provided positive learning opportunities and the potential to utilise technology in the delivery of social prescribing going forward. Local infrastructure needs to evolve in order to reduce the physical barriers faced by plwLTNC in particular transport. Without major changes, plwLTNC will endure further inequalities relating to the delivery and accessibility of social prescribing. This paper has made recommendations to consider the role occupational therapists could take in the development and delivery of social prescribing given their expertise.Additional file 1. Focus group topic guide."}
{"text": "Volumetric muscle loss (VML) is associated with irreversibly impaired muscle function due to traumatic injury. Experimental approaches to treat VML include the delivery of basic fibroblast growth factor (bFGF) or rehabilitative exercise. The objective of this study was to compare the effects of spatially nanopatterned collagen scaffold implants with either bFGF delivery or in conjunction with voluntary exercise. Aligned nanofibrillar collagen scaffold bundles were adsorbed with bFGF, and the bioactivity of bFGF-laden scaffolds was examined by skeletal myoblast or endothelial cell proliferation. The therapeutic efficacy of scaffold implants with either bFGF release or exercise was examined in a murine VML model. Our results show an initial burst release of bFGF from the scaffolds, followed by a slower release over 21 days. The released bFGF induced myoblast and endothelial cell proliferation in vitro. After 3 weeks of implantation in a mouse VML model, twitch force generation was significantly higher in mice treated with bFGF-laden scaffolds compared to bFGF-laden scaffolds with exercise. However, myofiber density was not significantly improved with bFGF scaffolds or voluntary exercise. In contrast, the scaffold implant with exercise induced more re-innervation than all other groups. These results highlight the differential effects of bFGF and exercise on muscle regeneration. Volumetric muscle loss (VML) is characterized by irreversible damage in skeletal muscle structure and function due to the loss of a significant portion of skeletal muscle. Traumatic injuries leading to VML are associated with impaired endogenous muscle regeneration, long-term disability, and cosmetic deformities ,2. CurreSkeletal muscle is generally composed of bundles of parallel-aligned myofibers, interspersed with blood vessels within close proximity  that proThe promise of regenerative medicine is the full regeneration of damaged tissues, either by promoting repair from endogenous stem cells or by the transplantation of cells to enhance regeneration . To dateRecent studies suggest that rehabilitative exercise may be beneficial for the treatment of VML ,25. In pSince rehabilitative exercise and bFGF elaboration are two potential strategies for the treatment of VML, the objective of this study was to compare the effects of implanted spatially nanopatterned bFGF-releasing scaffolds to that of implanted scaffolds in conjunction with voluntary caged wheel exercise. By evaluating muscle physiology and tissue histology in a mouse model of VML, we show that bFGF and voluntary exercise have differential therapeutic benefits for the treatment of VML.\u22121 in 0.02 N in acetic acid (pH 3.5) and then extruded from a 22 G blunt tip needle onto glass slides that were submerged in phosphate-buffered saline  at 37 \u00b0C, leading fibrillogenesis along the direction of extrusion. To fabricate parallel-aligned 3D scaffold bundles, 16 scaffolds strips were intrinsically sticky and adhered in parallel to one another before immobilizing the scaffold bundle onto surface-reactive Nexterion H  slides. The scaffolds were washed with 1\u00d7 PBS, dried overnight in a laminar flow hood, and then disinfected with 70% ethanol.Aligned nanofibrillar collagen scaffolds were fabricated as described in our previous work ,16,28. I\u22121, Peprotech, Cranbury, NJ, USA) overnight at 37 \u00b0C and 5% CO2. Control scaffolds were incubated in 0.1% bovine serum albumin . After overnight incubation, scaffold bundles were removed from the Nexterion H Slides and then trimmed to 4 mm \u00d7 3 mm \u00d7 2 mm scaffolds for implantation or in vitro studies. The surface topography of the scaffolds was assessed by routine scanning electron microscopy, based on previous methods [In order to prepare growth factor-laden scaffolds, the scaffolds were submerged within a solution of recombinant human bFGF .To determine the kinetics of bFGF release from the scaffolds over time, the bFGF-laden scaffolds or control scaffolds were incubated in 0.1% BSA. At time points over 21 days, the supernatant was sampled and then replaced with fresh BSA. The release of bFGF was quantified by an enzyme-linked immunosorbent assay (ELISA) using a Human bFGF Quantikine ELISA Kit  according to the manufacturer\u2019s instructions. Readings were taken at 10 min following the addition of the stop solution at a wavelength of 450 nm with correction at 540 nm . The Ki67 + cells were expressed as a percentage of the total cells (n = 3).To demonstrate the bioactivity of bFGF-releasing scaffolds, the mitogenic effect of bFGF was quantified by the proliferation of mouse myoblasts  and human endothelial cells . Each cell type was cultured on bFGF-laden nanofibrillar scaffolds or control nanofibrillar scaffolds in growth media . After 4 days, the cells were fixed in 4% paraformaldehyde for immunofluorescence staining of the S-phase cell cycle marker, Ki67. Immunofluorescence staining was carried out based on previously published methods ,30,31. IC57BL/6 mice  underwent a bilateral induction of VML. The animals were anesthetized with isoflurane (2\u20133%) at an oxygen flow rate of 1 L/min. A longitudinal incision was made in the skin directly above the tibialis anterior (TA) to expose the muscle. The TA was dissected from the extensor digitorum longus (EDL). A spatula was placed in between the EDL and TA muscles, and then a 2-mm diameter biopsy punch was applied to produce two adjacent holes in the central region of the TA, creating a 4 mm \u00d7 4 mm \u00d7 2 mm full-thickness defect that was approximately 20% of the weight of the TA. Immediately after tissue ablation, scaffold bundles that contained either bFGF or vehicle control (BSA) were placed into the defect, and the sides of the ablation were approximated using an 8\u20130 suture (S&T). The skin was then closed with an 8\u20130 nylon suture. Animals were placed in a cage on top of a warming pad to recover. The animals received sustained-release buprenorphine  for analgesia along with antibiotics .After induction of VML, the mice were allowed to rest for 7 days before further randomizing to receive non-exercise or exercise regimens, leading to four treatment groups with the following denotations: (1) scaffold (control), (2) bFGF-laden scaffold (bFGF scaffold), (3) scaffold with voluntary caged wheel exercise; or (4) bFGF-laden scaffold with caged wheel exercise. The mice in exercise groups were placed into running wheel cages  from days 7 through 21 post-surgery for voluntary exercise. To track running habits, each caged wheel was attached to an electronic counter that recorded the time and distance traveled every 15 s , as was conducted previously ,28. The n = 6). The running distances of the mice were recorded for 2 weeks to evaluate the post-injury timepoint in which running habits reach steady-state levels.To identify an optimal time after induction of VML to administer rehabilitative exercise, a separate animal study was performed in which C57BL/6 mice were allowed to run on caged wheels starting from the day of VML induction (n = 7\u20138).On day 21, after induction of VML, the mice underwent TA force measurement testing. An incision was made longitudinally in the skin of the lower leg to expose the TA. The distal tendon of the TA was severed, and the muscle was partially dissected so that the surrounding muscles did not contribute to the measurements. The dissected end of the tendon was attached to a 5\u20130 suture and secured to the transducer . A needle was placed through the leg above the patella to secure the knee. Two electrodes were placed touching but not penetrating the TA to stimulate the muscle directly for isometric contraction. The Instantstim function from Dynamic Muscle Control (DMC) LabBook software  was used to stimulate twitch contractions in the TA muscle using a pulse of 0.2 ms and a train frequency of 0.5 Hz. While the muscle was being stimulated at 2 s intervals, the current was slowly increased until the TA achieved maximal stimulation. After the current was optimized, the length of the muscle was slowly increased until the optimal resting length was obtained. A single twitch force was then performed with a pulse width of 0.2 ms per leg for analysis (The TA muscles were explanted for routine cryosectioning and hematoxylin and eosin (H&E) staining. Immunofluorescence staining of tissue samples was carried out by fixation in 4% paraformaldehyde, followed by permeabilization in 0.5% Triton-X-100 ,33. For 2, n = 5). For the quantification of neuromuscular junction formation, the total number of \u03b1-bungarotoxin-expressing junctions were quantified within a 500-\u00b5m radial distance from the scaffold and expressed as neuromuscular junction density .To quantify muscle regeneration at the periphery of the scaffold implants, the total number of laminin + myofibers with centrally located nuclei within 500 \u00b5m radial distance from the implanted scaffold\u2019s periphery was quantified. The data were expressed as regenerating muscle density  with post hoc Tukey\u2019s adjustment  was performed. Data are shown as a mean \u00b1 standard deviation (SD). Significance was accepted at p < 0.05 (*). All graphs were created in Microsoft Excel. Sample size reflects per operated leg unless otherwise noted.Statistical analysis was performed using an unpaired Aligned nanofibrillar scaffolds were fabricated by a facile shear-based extrusion technique, in which monomeric collagen was extruded from a syringe needle into a pH neutral saline, leading to rapid fibrillogenesis. The resultant collagen scaffolds were long and thin, with a scaffold width of approximately 300 \u00b5m. To create a scaffold bundle, 16 strips were immobilized adjacent to one another onto a glass substrate A. Owing p < 0.05). Additionally, skeletal myoblasts showed nearly a five-fold increase in proliferation on bFGF-laden scaffolds, compared to scaffolds without bFGF (p < 0.05). These studies demonstrated that the bFGF released from the scaffolds were bioactive in inducing cellular proliferation.To confirm the bioactivity of bFGF upon release from the scaffolds, we performed in vitro experiments to characterize the mitogenic response of skeletal muscle myoblasts or endothelial cells to bFGF stimulation. Skeletal myoblasts or endothelial cells were seeded onto the bFGF-laden scaffolds for 4 days before fixing the samples for immunofluorescence staining of the S-phase cell cycle marker, Ki67 A. QuantiUpon validating the bioactivity of the bFGF-laden scaffolds in vitro, we next tested the therapeutic efficacy of bFGF-laden scaffolds in a murine model of VML. The bFGF-laden scaffolds were manually detached from the glass substrates to form a delaminated bundle of 16 scaffolds. The mice underwent bilateral full-thickness ablation of the TA muscle, followed by acute implantation of the bFGF-laden scaffold or the control scaffold into the site of muscle ablation A,B. The The selection of a 7-day delay for voluntary caged wheel running was based on a study in which animals were allowed to undergo caged wheel running immediately after VML induction. Based on their daily running habits, we observed an unusually high degree of running distance on day 1, presumably due to the effect of post-surgery analgesics that masked the pain associated with running . Startinp < 0.05). To assess for differences in running habits of animals with implants of the control scaffold or bFGF-laden scaffolds, the daily running distance was recorded for 21 days after induction of VML. The voluntary running habits showed a cumulative increase in running distance over the course of 21 days for animals treated with control scaffolds or bFGF-laden scaffolds, but no significant differences between these two exercise groups  was significantly higher than in animals treated with the combination of the bFGF-laden scaffold with exercise (69 \u00b1 52 mN), whereas exercise alone appeared to not have led to significant improvements in twitch force  staining. From the H&E staining, the partially degraded collagen scaffold could be observed within the ablated muscle region, based on its characteristic ribbon-like fibrillar appearance . Regardl2), compared to the scaffold treatment group . Interestingly, the combined treatment of bFGF-laden scaffold with exercise did not show any significant difference compared to the control group  bFGF and voluntary caged wheel exercise have differential effects on the treatment of VML; and (2) treatment of scaffolds releasing bFGF significantly improved muscle physiology after 3 weeks, whereas caged wheel exercise promoted neuromuscular junction formation. VML is a traumatic injury in which improved treatment strategies are in high demand. The delivery of pro-regenerative factors such as bFGF is a promising off-the-shelf therapy that can be applied in even austere settings. Since bFGF has been demonstrated to be safe in clinical trials for other indications such as wound healing and peripheral arterial disease ,35, it iTo account for the large volume of muscle defect, an aligned nanofibrillar scaffold was implanted to the scaffold for the spatially controlled release of bFGF as well as for promoting cellular infiltration into or near the scaffold. Collagen was selected because of the ease of fabricating aligned nanofibrillar scaffold bundles using a highly facile extrusion process ,20,29. NIn recognition that rehabilitative strategies can augment the benefits of tissue regeneration, we compared the effect of voluntary caged wheel running to that of localized bFGF release from nanofibrillar collagen scaffold. Similar to our previous findings using a partial thickness TA muscle ablation model, voluntary caged wheel running stimulation and the implantation of aligned nanofibrillar scaffolds promoted neuromuscular junction formation . Our finOur results also show that the interaction between bFGF and voluntary caged wheel exercise is complex. For example, the implantation of bFGF-releasing scaffolds significantly increased twitch force generation A compareAlthough bFGF-releasing scaffolds could significantly improve muscle physiology, histological analysis of regenerating myofiber density did not reveal a statistically significant increase in regenerating myofiber density. Since the twitch force measurements quantitatively reflect the global function of the entire muscle, whereas histological methods semi-quantitatively reflect muscle regeneration in smaller regions of interest, it is plausible that the findings between both assays might contrast. However, the global nature of muscle force quantification possibly suggests a more reliable metric than tissue histological quantification.In summary, we demonstrated that bFGF-laden aligned nanofibrillar collagen scaffolds for the treatment of VML in full-thickness muscle ablation model led to significantly improved muscle physiology, whereas collagen scaffold implants with voluntary caged wheel exercise promoted greater neuromuscular junction formation. Intriguingly, the combination of bFGF-laden scaffolds with rehabilitative exercise showed no therapeutic effect on the treatment of VML. Further studies to explore the optimal timing, dosing, and duration of exercise and bFGF treatments for therapeutic efficacy are warranted. This study highlights the differential therapeutic benefits of these two therapies separately, but not when prescribed in combination."}
{"text": "Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and coronavirus disease 2019 (COVID-19) emerged in China in December 2019. Healthcare workers (HCWs) are one of the high-risk groups of infection and knowledge of the seroprevalence of SARS-CoV-2 antibodies among this class is very important, not only\u00a0to understand the spread of COVID-19 among health institutions but also to assess the success of public health interventions. The objective of this prospective study was to determine the seroprevalence of COVID-19 immunoglobulin G (IgG) antibodies after vaccine administration and assess the symptomatology associated with the number of IgG antibodies. A total of 75 HCWs from an intensive care unit were studied three and six months after the second administration of the COVID-19 vaccine. They were divided into three groups: IgG antibodies between 4,160 and 6,350 (group one), greater than 6,350 (group two), and less than 4,160 (group three). After the first administration of the vaccine, 80% had symptoms in both groups one and two, whereas only 13.8% had symptoms in group three. After the second dose of the vaccine, all elements of group one and 80% of group two developed symptoms, but only 40% of group three manifested symptoms. With the exception of one, all professionals showed a decrease in the number of IgG antibodies from three to six months. Our findings show that professionals with a higher number of IgG antibodies had more symptoms and that these rapidly declined over the three-to-six-month period. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has swept the globe at a shocking rate, with a reported 265,970,247 cases and 5,267,137 deaths [HCWs were informed about the conduction of the COVID-19 antibody serological study and approval was acquired from the hospital's ethics committee  to analyze the prevalence of SARS-CoV-2 antibodies among HCWs of the ICU after Pfizer-BioNTech vaccine administration. The HCWs included doctors (n = 5), nursing staff (n = 57), operational assistants (n = 11), and administrative staff (n =\u00a02).The study population was divided into three groups: immunoglobulin G (IgG) antibodies between 4,160 and 6,350 (group one), greater than 6,350 (group two), and less than 4,160 (group three). Clinical and demographic data such as sex, age, symptoms after the first and second administration of the vaccine, contact with positive patients, comorbidities, and the difference in antibodies between three and six months were analyzed.The SARS-CoV-2 IgG II Quant assay is a chemiluminescent microparticle immunoassay used for the qualitative and quantitative determination of IgG antibodies to the receptor binding domain of the S1 subunit of the spike protein of SARS-CoV-2 in human serum and plasma. If the IgG antibodies were between 4,160 and 6,350, there was a 95% probability of presence of neutralizing antibodies, and if they were superior to 6,350, there was a 99% probability.Data analysis was performed using the chi-square test for categorical variables and the one-way analysis of variance (ANOVA) test to compare means between groups. The Wilcoxon test was used to analyze differences between antibodies. Data analysis was performed using SPSS for Windows version 25.0\u00a0.A total of 75 HCWs were included in this study. Group one had an average age of 33 years and\u00a0all were female. As for group two, the average age was 40 years, where 60% were female\u00a0and 40% were male. Group three had an average age of 39 years and 61.5% were female and 38.5% were male. In group one, most HCWs did not have comorbidities (60%); however, in groups two and three, most had associated pathologies . The most frequent were hypertension, hypothyroidism, and asthma.There was a prevalence of 6.66% of SARS-CoV-2 antibodies in groups one and two and 86.7% in group three. After the first administration of the vaccine, 80% of HCWs had symptoms in both groups one and two and only 13.8% had symptoms in group three. After the second dose of the vaccine, all elements of group one and 80% of group two had symptomatology, but only 40% of group three developed symptoms.Table Symptoms included fever, asthenia, myalgia, arthralgia, cephalgia, vomiting, diarrhea, and dizziness. The frequency of symptoms in the three groups after the first dose of the COVID-19 vaccine is shown in Table After the second administration of the vaccine, the frequency of symptoms was higher. The frequency of symptoms in the three groups after the second dose of the COVID-19 vaccine is depicted in Table Most professionals in group two had regular contact with infected patients (80%) as well as group three (63.1%); however, the majority of group one had no contact with these patients (60%).At three months, mean and median IgG antibodies were 2668.6 and 2373.1, respectively, where the minimum was 3.4 and the maximum was 8336.8. At six months, we calculated a mean of 1373.5 and a median of 1256.9 IgG antibodies, where the minimum was 4.6 and the maximum was 5192.7.The mean and median of IgG antibodies at three and six months after the second dose of the COVID-19 vaccine are depicted in Figure With the exception of one, all HCWs showed a decrease in the number of antibodies in the three-to-six-month period after the administration of the second dose.Humoral and cell-mediated response against SARS-CoV-2 is one of the major aspects for understanding viral clearance and vaccination effectiveness. One study confirmed that HCWs reach adequate humoral and cellular response after a single dose of an mRNA vaccine . Since SIn the present prospective study, we found a substantial decline in IgG levels in the three-to-six-month period after the second dose of the COVID-19 vaccine, except in one HCW. Our findings are similar to those of Nag et al. . Mishra Studies observed that spike IgG concentrations are durable, with modest declines after six to eight months. Kinetics of humoral response over a longer time period should be evaluated to obtain information on the long-term immunity in vaccinated subjects\u00a0.Vaccination has been shown to provide significantly better protection against severe diseases.\u00a0Boosting with vaccines is an effective strategy to combat the waning of immunity and the current variants of concern\u00a0.In group two, we found HCWs who presented with the highest number of IgG antibodies . This group was the one with a higher average age and female ratio, with a significant percentage of comorbidities and symptomatology after the first and second administration of the COVID-19 vaccine and all had consistent contact with infected patients. In group one, we found the professionals with antibodies between 4,160 and 6,350. They were all female, younger, mostly with no comorbidities, and had no contact with COVID-19 patients. Like group two, they predominantly had symptoms after the first and second vaccine administration. Group three\u00a0comprised HCWs with the lowest number of antibodies, inferior to 4,160. This group was mostly female with associated previous pathologies and with contact with infected patients. However, they had fewer symptoms after vaccine administration.Limitations of our clinical study include the small sample size.Our study concluded that professionals with a higher number of antibodies presented with more symptoms after vaccine administration. It also came to light that in the three-to-six-month period after vaccine administration, there was a significant decrease in the number of antibodies.However, it is important to note that this is an area of investigation where data are still quite scarce and further studies are needed on this subject, especially about the third dose of the vaccine."}
{"text": "Different contents of KIO4 and KClO4 were added to nano Al/CuO and the composites were assembled by sonication. When the peak pressure of nano Al/CuO was increased ~5\u201313 times, the pressurization rate was improved by ~1\u20133 orders of magnitude, the ignition delay time was shortened by ~0.08 ms\u20130.52 ms and the reaction completeness was adjustable when 30\u201370% KIO4 and KClO4 were added into the composites. The reaction of Al/KIO4 and Al/KClO4 at a lower temperature was helpful to ignite the ternary composite. Meanwhile, CuO significantly reduced the peak temperature of oxygen released from the decomposition of KIO4 and KClO4. The synergetic effect of binary oxidizers made the combustion performance of the ternary composites better than that of the binary composites. The present work indicates that KIO4 and KClO4 are promising additives for nano Al/CuO to tune and promote the combustion performance. The ternary composites have potential application in energy devices and combustion apparatus.In this study, we studied the synergetic effect of potassium oxysalts on combustion and ignition of nano aluminum (Al) and nano copper oxide (CuO) composites. Potassium periodate (KIO With the development and application of nanotechnology, MIC have recently received more and more attention in the field of energetic materials. The ultra-refinement or nanocrystallization of the energetic materials can significantly improve the energy release and increase the reaction rate ,2,3,4. Nd abroad ,15,16,174ClO4, AP), potassium perchlorate (KClO4), potassium periodate (KIO4), potassium permanganate (KMnO4), etc., with high oxygen content and strong oxidizability, are also used to replace traditional metallic oxidizers, both of which can increase the reaction rate of MIC. Huang found that the binary mixture of Bi2O3 and CuO was more effective than any single oxide in improving the combustion performance of B [2O3/WO3 ternary MIC system prepared by Zachariah was dramatically higher than that of any single system [4 was much higher than that of Al/Fe2O3 due to the high concentration of the free oxygen [4 and Al/sodium periodate (NaIO4) binary system prepared by Jian was lower than that of Al/CuO, and its peak pressure and pressurization rate were much higher than that of Al/CuO [4 and found that its activation energy was lower than that of Al/MnO2 and its combustion rate increased [However, due to the low oxygen content in common metallic oxides, MIC with these metallic oxidizers as the single oxidizer possess less gas production and slower reaction rate. In order to solve this problem, suitable double oxidizers are introduced to replace the single oxidizers in the MIC system to form a ternary system, or ammonium perchlorate  was used to characterize the prepared energetic composite particles. The theoretical adiabatic flame temperature (AFT) of the energetic composite material was calculated by REAL software. The thermal decomposition reaction behavior of CuO/xKIO4 and CuO/xKIO4 was studied by differential scanning calorimetry (DSC) and thermogravimetric analysis (TG). The peak pressure and pressurization rate of the MIC were characterized by the combustion test. A carbon dioxide (CO2) laser igniter and a high-speed camera were used to test and record the ignition delay time of the composite material. The calorimeter was used to measure the heat release of Al/CuO/xKIO4 and Al/CuO/xKClO4 composites. The results show that KIO4 and KClO4 play important roles in enhancing the combustion performance of nano Al-based MIC composites.Herein, the effects of KIO4 and KClO4 were purchased from Sinopharm Chemical Reagent Corporation , they were ground in the agate mortar before being used in the experiment. The formulations of composites are shown in 4 means that the molar percentage of KClO4 and CuO in the oxidizers are 30% and 70%, respectively. The content of Al was stoichiometric assuming the fuel reacted with the oxidizer completely. The samples were prepared via sonication method. The weighted Al and oxidizers were put into a vial with ~10 mL hexane, followed by sonication of ~30 min, and dried in a hood for 24 h. Finally, the dried powders could be obtained for further measurements.Aluminum nanoparticles (~30\u201350 nm) and copper oxide nanoparticles (<50 nm) were purchased from Aladdin Industrial Corporation , and KIO4 and CuO/xKClO4 binary systems and potassium oxysalts. The sample was heated from room temperature to 700 \u00b0C in an argon atmosphere (50 mL min\u22121) at a heating rate of 10 \u00b0C min\u22121.Scanning electron microscope  was used to analyze the morphologies of the raw materials and composites. Thermogravimetric analysis and differential scanning calorimetry  were used to characterize the thermodynamic behavior of CuO/xKIO3. The samples were ignited via joule heating through a nichrome wire above the samples, which was connected to a voltage supply. When ignited, the changes of pressure in time were recorded electrically. The pressurization rate was obtained by calculating the initial slope of the pressure rise, which has been used to present the reactivity of energetic materials. A detailed description about pressure cell could be found in the reference [The peak pressure was evaluated by combustion cell. Around 25 mg-samples were weighted and loaded into a combustion cell with a constant volume of ~20 cm2 laser of 60 W in air. Ignition delay was defined as the time length from the start of the laser to the initial visible spark spot captured by a high-speed camera  at 50,000 fps.Typically, ~15 mg samples were weighted and placed in the center of the specimen stage and the ignition performance of the samples was evaluated by a COThe released heat by energetic materials has been evaluated via a calorimeter .The diagrammatic sketch of the calorimeter is shown in 4 and KClO4 on the adiabatic flame temperature (AFT) of the Al/CuO system. As demonstrated in 4 and KClO4 can enhance the AFT of Al/CuO significantly. The calculated AFT increase monotonously with the increasing molar percentages of potassium oxysalts. 4 and 50% KClO4 can raise the AFT by ~900 \u00b0C and ~1100 \u00b0C, respectively. Consequently, the addition of potassium oxysalts could improve the AFT of Al/CuO theoretically. In the reaction process, the addition of potassium salts can significantly increase the adiabatic flame temperature of the system, thus promoting the decomposition of the oxidizers, and enabling the Al and oxidizers to react more completely [Based on the formulations of composites, assuming the reaction between the fuel and oxidizers occurs in a constant volume, the REAL code was used based on the principle of minimum free energy to calculate the influence of the addition of KIOmpletely .4 and Al/CuO/xKClO4 composites were characterized via SEM. As shown in 4 and KClO4 evenly, indicating that the fuels and oxidizers could be mixed up well via sonication.The morphologies of the raw materials, Al/CuO/xKIO4 and KClO4, the combustion performance of Al/CuO was improved significantly. Among the Al/CuO/potassium oxysalts ternary systems, the highest combustion performance, including the highest peak pressure and pressurization rate, was achieved by Al/CuO/30% potassium oxysalts.As shown in 4 is 10 times and 4 times higher than that of Al/CuO and Al/KClO4, respectively. With the increase of the content of KClO4, the peak pressure reduced slightly compared with Al/CuO/30% KClO4. The peak pressures of Al/CuO/50% KClO4 and Al/CuO/70% KClO4 are still higher than that of Al/CuO and Al/KClO4, which are 8 times and 5 times higher than that of Al/CuO, respectively. Similarly, the peak pressure of Al/CuO/30% KIO4 is 13 times and 8 times higher than Al/CuO and Al/KIO4, respectively. Therefore, the peak pressure of Al/CuO/30% KIO4 (49600 KPa/g) is the highest among all the ternary systems.As shown in 4 and Al/CuO/xKClO4 is higher than that of conventional Al/KIO4, Al/KClO4, and Al/CuO binary composites. In the meanwhile, the reactivity of Al/CuO/30% potassium oxysalts is the highest. With the addition of 30% KIO4, the pressurization rate is tremendously raised, which is three orders of magnitude higher than Al/CuO and Al/KIO4, which is the highest pressurization rate in this study. With the increasing content of KIO4, the pressurization rate reduced slightly. The pressurization rates of Al/CuO/50% KIO4 and Al/CuO/70% KIO4 are 107 times and 152 times higher than that of Al/CuO, respectively. Similarly, the pressurization rate of Al/CuO/30% KClO4 is three and two orders of magnitude higher than that of Al/CuO and Al/KClO4. Thus, the reactivity of Al/CuO can be significantly improved and tailored by the addition of different contents of potassium oxysalts.For the pressurization rate, which refers to the reactivity of energetic materials , the tre4 and KClO4 can be speculated that the reaction between Al/KIO4 and Al/KClO4 starting at a low temperature is helpful to ignite the ternary composite materials. Meanwhile, it is speculated that CuO can accelerate the decomposition of KIO4 and KClO4 to release O2, leading to the reaction of Al with a large amount of gas. The higher flame temperature of Al/KIO4 or Al/KClO4 improves the pressure of the combustion cell and promotes the decomposition of the oxidizers further, thus more oxygen is produced, the oxidation of Al is further accelerated and the reaction rate is accelerated [4 and KClO4, the TG analysis and DSC analysis of CuO/xKIO4 and CuO/xKClO4 were carried out in the later section.The reason why the combustion performance of Al/CuO is significantly enhanced by the addition of KIOelerated ,27,28. A4 and CuO/xKClO4 at a low heating rate. 4 decomposes and releases O2 in two stages, which is consistent with the reported studies [4 decomposes exothermically into KIO3 and O2 with a peak temperature of the O2 release at ~343 \u00b0C. In the second stage, KIO3 starts the decomposition at ~535 \u00b0C with an endothermic peak at ~552 \u00b0C. 4 during the first stage with exothermic peak temperatures ranging from ~336 \u00b0C to ~339 \u00b0C. However, with the addition of CuO, the initiation and the endothermic peak of the second-stage decomposition of KIO4 advance by ~100 \u00b0C and ~90 \u00b0C compared with pure KIO4, respectively.TGA/DSC were used to study the thermal decomposition reaction process of CuO/xKIO studies . In the 4 is shown in 4 decomposes exothermically into KCl and O2 at ~595 \u00b0C with an exothermic peak at ~631 \u00b0C [4, and the endothermic peak at ~609 \u00b0C is caused by the melting of KClO4. The addition of CuO has basically no influence on the crystal transformation of KClO4, which is ~300 \u00b0C. However, the addition of CuO advanced the melting and thermal decomposition of KClO4 significantly, resulting in the disappearance of endothermic peak of the melting and thermal decomposition at a lower temperature. The peak temperature of the thermal decomposition reaction of CuO/xKClO4 is ~500 \u00b0C, which is ~130 \u00b0C lower than that of pure KClO4. Moreover, the initial decomposition temperatures of KClO4 with different contents of CuO are between ~340 \u00b0C to ~390 \u00b0C, which are ~200 \u00b0C to ~250 \u00b0C lower than that of pure KClO4. This can be attributed to the fact that CuO, as a p-type transition metal oxide, promotes the electron transfer process during the decomposition of the oxidant [The thermal decomposition of KClO ~631 \u00b0C . The end oxidant .4 and KClO4, which makes the thermal decomposition reaction process earlier significantly. Meanwhile, the initial temperature and peak temperature of the oxygen releasing are greatly reduced, leading to the rapid reaction of Al with a large amount of gas through the pathways of the oxide shell, which may cause the internal molten Al to continuously absorb heat and expand, accelerating the rupture of the oxide layer, and further promoting the diffusion of Al core and oxidation of Al, thus enhancing the combustion performance of the composites [Therefore, the addition of CuO has a significant effect on the thermal decomposition reaction process of KIOmposites ,28,33,344 and Al/CuO/xKClO4 composites has been recorded via high-speed camera. As shown in 4 and KClO4 in the ternary systems, the initiation time of the reaction is earlier than that of Al/CuO.The combustion process of Al/CuO/xKIO4 ternary composites is shorter than that of the binary composites. Compared with Al/CuO (~1.28 ms), the ignition delay time of the composite with 50% KIO4 is shortened by ~0.38 ms. The ignition delay time of Al/CuO/70% KIO4 (~0.88 ms) is shorter than that of Al/KIO4 by ~0.32 ms. Among the Al/CuO/KIO4 composites, the ignition delay time of Al/CuO/30% KIO4 is the shortest, ~0.76 ms, which is ~0.52 ms and ~0.44 ms shorter than Al/CuO and Al/KIO4, respectively. As for the Al/CuO/xKClO4 systems, it is shown in 4 and 50% KClO4 occurs ~0.08 ms and ~0.14 ms earlier compared to Al/CuO. The ignition delay time of Al/CuO/70% KClO4 is the shortest, ~1.08 ms, which is ~0.20 ms and ~0.16 ms earlier than that of Al/CuO and Al/KClO4, respectively.4 and Al/CuO/xKClO4 ternary composites is shorter than that of that of both Al/CuO and Al/potassium oxysalts binary systems. It is reported that in the ternary thermites systems [4 and Al/KClO4 reaction is lower than that of Al/CuO [4 and KClO4, the reaction between Al and potassium oxysalts in ternary systems can initiate earlier than Al/KIO4 and Al/KClO4. Therefore, the application of CuO/potassium oxysalts binary oxidizer system results in a synergetic effect including a lower ignition temperature and earlier oxygen release of oxidizers, thus significantly shortening the ignition delay of ternary thermites.Herein, the ignition delay time of Al/CuO/xKIO systems , the inif Al/CuO ,28, the 4 and Al/KClO4 as shown in Equations (1)\u2013(3), and their molar percentage in the ternary composites according to Hess\u2019s law [4 and KClO4, the heat release of the composites increases monotonously, which can be attributed to the reason that the theoretical enthalpy of Al/KIO4 and Al/KClO4 is higher than that of Al/CuO according to the Equations (1)\u2013(3). The heat release of Al/CuO/30% KIO4 is 4958 \u00b1 111 J g\u22121 (\u22121 higher than that of Al/CuO. 4 (6926 \u00b1 150 J g\u22121) is ~3200 J g\u22121 higher than that of Al/CuO, which has been increased significantly. In addition, the experimental heat release of the composites is less than the theoretical heat release because the composites cannot react completely during the experiment, which can be confirmed by the XRD characterization of the combustion products (Assuming that the oxidant reacts completely with the fuel, the theoretical heat release of the composites is calculated based on the theoretical enthalpy of Al/CuO, Al/KIOss\u2019s law . Figure 11 J g\u22121 a, which products . A more 4, the reaction completeness of the ternary composite is higher than that of the binary systems. The highest reaction completeness of 96.1% for Al/CuO/xKIO4 ternary systems is achieved by Al/CuO/50% KIO4, which is 4.8% higher than that of Al/CuO. The reaction completeness of Al/CuO/xKClO4 is higher than that of Al/KClO4, and the reaction completeness of Al/CuO/30% KClO4 is 82.1%, which is 6.8% higher than that of Al/KClO4. It is presumed that as a transition metal oxidizer, CuO can promote the combustion of Al/KIO4 and Al/KClO4 as a catalyst. The relatively lower reaction completeness of Al/CuO/70% KClO4 might be caused by the lower ratio of CuO and the weakening catalysis of CuO.The reaction completeness of composite system is obtained by calculating the ratio of the experimental calorific values to the theoretical ones. For the systems of Al/CuO/xKIO4 and Al/CuO/KClO4 composites (It is reported that when there is more released gas during the combustion process of MIC, higher combustion efficiency could be achieved due to less aggregation of nAl . Consistmposites a means t4 and Al/CuO/xKClO4 ternary composites are significantly higher than that of Al/CuO, Al/KIO4 and Al/KClO4 binary composites. It is speculated that the synergistic effect of CuO/KIO4 and CuO/KClO4 binary oxidizers make the combustion performance of the ternary composites better than that of the binary composites. In other words, the reaction of Al/KIO4 and Al/KClO4 at a lower temperature is helpful to ignite the ternary composite. Meanwhile, CuO promotes the decomposition of KIO4 and KClO4 to release oxygen, which makes Al react quickly with a large amount of gas, accelerates the rupture of the oxide layer, and further promotes the diffusion of Al core and oxidation of Al, thus enhancing the combustion performance of the composites. The results of TG-DSC show that CuO significantly advances the initial temperature and peak temperature of KIO4 oxygen release in the second-step decomposition by ~100 \u00b0C and ~90 \u00b0C, respectively, and decreases the initial temperature and peak temperature of KClO4 oxygen release by ~200 \u00b0C and ~130 \u00b0C, respectively. Moreover, the results of ignition tests and heat release measurement show that the ignition delay time of the ternary composites is shorter than that of Al/CuO. The addition of KIO4 and KClO4 can tailor the reaction completeness and heat release of the composites due to more released gas by the reaction between Al and potassium oxysalts. Therefore, KIO4 and KClO4 are promising additives for Al/CuO to tune and promote the combustion performance.In this study, the binary oxidizers composed of potassium oxysalts and CuO were applied in nano Al-based MIC, and their energetic performance has been tested. The pressure cell tests show that the pressure peak and pressurization rate of Al/CuO/xKIO"}
{"text": "Hyaluronic acid (HA), a glycosaminoglycan ubiquitous in the skin, has come into the limelight in recent years for its role in facilitating dermal wound healing. Specifically, HA\u2019s length of linearly repeating disaccharides\u2014in other words, its molecular weight (MW)\u2014determines its effects. High molecular weight (HMW)-HA serves an immunosuppressive and anti-inflammatory role, whereas low molecular weight (LMW)-HA contributes to immunostimulation and thus inflammation. During the inflammatory stage of tissue repair, direct and indirect interactions between HA and the innate and adaptive immune systems are of particular interest for their long-lasting impact on wound repair. This review seeks to synthesize the literature on wound healing with a focus on HA\u2019s involvement in the immune subsystems. Skin injury leads to the cascade of highly interrelated processes known as wound healing, which, beginning with hemostasis, can take months to years to finish remodeling. Each year, more than 100 million people in developed countries are expected to develop scars from irregular wound healing outcomes, adding physical, financial, and psychosocial burdens to the problem ,3,4. HowThis review aims to explicate the combined role of HA and various immune cell populations in dermal wound repair using relevant literature from the past decade when possible.HA is a unique glycosaminoglycan in that it is non-sulfated and lacks a core protein, with the bulk of its structure comprising continuous residues of  . Upon tiThe influence of HA on immune responses also goes beyond interactions with specific HA receptors; chemokines interacting with glycosaminoglycans in the ECM modulate the immune response at areas of tissue inflammation. For example, IL-8 binds to matrix bound heparin sulfate to generate a chemoattractive gradient for neutrophils ,18. IL-8Among the roles of hyaluronan, perhaps the most compelling reason to examine the interactions of HA in wound healing is its role in regenerative healing. Mid-gestational fetal wounds are known to heal without a scar ,23. The The mammalian immune system is supported by two subsystems known as the innate immune system and adaptive immune system, which work in concert to defend the body against various pathogens. While activating a response to destroy foreign invaders, a key challenge of this system is to avoid damaging the body\u2019s own tissues and cells in the process. In regard to hyaluronan\u2019s role in immunity, HA can promote or inhibit TLR signaling pathways, which facilitate downstream activation of the innate immune system. In terms of the adaptive immune system, antigen activation of na\u00efve T lymphocytes increases their CD44 expression and thus their ability to bind HA and trigger the adaptive immune system ,27,28. FThe innate immune system provides the body with a first line of defense to a pathogenic invasion by mounting a rapid and robust, though nonspecific, response. Pattern recognition receptors (PRRs) enable a nonspecific reaction by recognition of damage-associated molecular patterns (DAMPs), such as DNA or heat shock proteins, or pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharides, double-stranded RNA, or bacterial DNA . Of the As primary receptors of LMW-HA, TLR activation has been speculated to produce a dose-dependent effect on wound healing, with lower concentrations noted to stimulate regeneration . FurtherThe following sections will delve deeper into specific cell populations of the innate immune system. Refer to HA is found in great abundance in mast cell granules , and masMacrophages, by way of phagocytosis, promote transition of the dermal wound from a pro-inflammatory milieu to an anti-inflammatory environment . AccordiIn the skin, specialized dendritic cells are known as Langerhans cells. As these CD44-rich cells migrate through the dermis, they leverage the HA of nearby keratinocytes as an adhesion substrate . HA promLiterature on the role of other immune cell types, including neutrophils and NKT cells, specifically interacting with HA in the context of wound healing is sparse. In dermal wound repair, neutrophil involvement is generally controversial as neutrophils can release enzymes such as elastase, which can be detrimental to surrounding tissue and increase the likelihood of scarring . In contThe functional cells of the adaptive immune response are lymphocytes, which can be further subdivided into T and B lymphocytes. T cells direct and regulate immune responses via secretion of characteristic profiles of cytokines and chemokines, while B cells are responsible, upon activation, for the production of antigen-specific antibodies. As we will demonstrate below, more studies have been done on HA interactions with T cells in the wound environment rather than on B cell interactions.+ or CD8+, the former involved in production of cytokines directed towards a particular immune response, and the latter responsible for destruction of virally infected host cells. Another subset of T lymphocytes is known as gamma-delta (\u03b3\u03b4) T cells, which are able to bridge the innate and adaptive immune systems.Na\u00efve T lymphocytes initially have low expression of CD44 and thus relatively little binding with HA; however, once they are activated by antigen-presenting cells and begin proliferating, their expression of CD44 expands, increasing their capacity to bind HA. ,27. This+ T lymphocytes, their effector or regulatory function in the wound environment is determined by the specific subtype to which they are polarized. The polarization of CD4+ cells is largely governed by the local inflammatory cytokine and growth factor milieu produced by innate lymphoid and tissue resident cells\u2019 response to tissue injury or pathogen invasion [Upon the arrival of activated CD4invasion ,68,69,70Regulatory T lymphocytes (Treg) express the Foxp3 transcription factor and function to curtail both innate and adaptive immune responses . TreatmeLess is known of the interaction between type 1 or 2 helper T cells (Th1/Th2) and hyaluronan in the wound environment. In vitro differentiated Th1 and Th2 demonstrate a somewhat higher binding capacity to HA when compared to na\u00efve T lymphocytes . Despite\u03b3\u03b4 T cells are a group of T lymphocytes that demonstrate behavior that blurs the line between being the first line of defense in innate immunity and coordinating a targeted response along with B cells and more conventional T cells as part of adaptive immunity. Regarding innate immunity, studies have shown phagocytic capabilities of human V\u03b39/V\u03b42 T cells, a feature previously thought to be solely the domain of innate myeloid lineage cells . In the The role of B lymphocytes in wound healing is not well studied, and thus the literature regarding HA\u2013B cell interactions in wound healing is lacking. In a mouse model of B cell deficient mice, wound healing was delayed with a decreased inflammatory cell infiltration . SimilarThe human body\u2019s defense system against outside intruders is a marvel of well-orchestrated mechanisms. In dermal wound healing, the interactions of HA with the innate and adaptive immune systems help regulate the skin\u2019s response to injury, fine-tuned by the high and low molecular weight variants of HA. In the innate immune system, the interaction of LMW-HA with decreased levels of TLRs 2/4 were associated with healing wounds, although a lack of TLR 4 altogether resulted in delayed epithelialization. Moreover, innate immune cells such as macrophages, mast cells, and dendritic/Langerhans cells further regulate wound repair by leveraging HA-dependent mechanisms. In the adaptive immune system, B cells generate antigen-specific antibodies upon activation, and T cells mediate immune responses by their secretion of cytokines and chemokines. For example, augmentation of Foxp3 expression of Tregs by HMW-HA leads to the production of anti-inflammatory cytokines such as IL-2, IL-10, and growth factors such as TGF-\u03b2. T cell subsets, such as \u03b3\u03b4 T cells, toe the line of conventional immune cells and exhibit properties of both subsystems depending on their mechanism of action. Similarly, the mammalian complement system works alongside dynamic cell types such as \u03b3\u03b4 T cells and NKT cells to enhance the immune response. In sum, this review serves as a reference and tool for researchers to understand the current literature on the role of the immune system and extracellular matrix biology in the context of wound healing in the skin."}
{"text": "Pan-carpal dissociation is very rare injury and there is little information as to diagnosis, treatment, and prognosis of this injury.A 35-year-man presented to our hospital with severe pain and swelling of the left wrist and forearm after slipping and falling while riding a motorcycle.The wrist simple radiographs demonstrated unrecognizable severe fracture-dislocation of the carpal bones concomitant with fractures of the radioulnar shaft. Three-dimensional computed tomography revealed a capitate fracture-dislocation, as well as hamate dislocation, lunotriquetral (LT), and scapholunate (SL) dissociation. These findings suggested pan-carpal dissociation.To prevent compartment syndrome, fasciotomy, carpal tunnel release, and open reduction and plate fixation for both bone fracture were performed first. Then, for pan-carpal dissociation, the capitate, carpometacarpal joint (CMCJ), and hamate were reduced and fixed first. Then, the SL, LT, and other intercarpal ligaments were repaired. Finally, additional trans-carpal pins to reinforce the ligament repair and 2.0\u200amm plate to buttress the third CMCJ were fixed. The patient was instructed to begin gentle range of motion exercises of the wrist with pins from four weeks after surgery and all pins were removed at six weeks postoperatively.12\u200amonths after the operation, the patient exhibited almost full range of motion with mild pain with VAS  1\u20132 at rest and VAS 3\u20134 with effort. Quick DASH  score was 25 and modified Mayo score was 70. The radiographs demonstrated union of the radioulnar shaft, and the carpal bone alignment was successfully maintainedPan-carpal dissociation can be diagnosed in patients with capitate fracture-dislocation, hamate dislocation, LT, and SL dissociation. This pattern of injury is very rare and the authors recommend reduction and fixation of the distal carpal row, followed by the proximal row to facilitate an easy approach to the distal carpal row. Although it is very severe injury, rigid anatomical fixation and an early rehabilitation can lead to favorable functional outcomes. Only one case report has been published, but this case was more consistent with capitate fracture-dislocation than pancarpal dissociation.Carpal dislocation and fracture-dislocation are usually caused by high-energy trauma.Diagnosis of this type of injury may be difficult and treatment can be challenging. Pancarpal dissocation may be regarded as most severe form of perilunate injury, however, it is different because it involves more complex injuries to the distal carpal row. To the authors\u2019 knowledge, there has been no report of a case with pancarpal dissociation. The authors experienced a patient with \u201cpancarpal dissociation\u201d and would like to share this injury with a review of the relevant literature.2A 35-year-man presented to our hospital with severe pain and swelling of the left wrist and forearm after slipping and falling while riding a motorcycle. The wrist posteroanterior and lateral view demonstrated unrecognizable severe fracture-dislocation of the carpal bones, and fractures of the radioulnar shaft. Three-dimensional computed tomography (3DCT) revealed a capitate fracture-dislocation, as well as hamate dislocation, lunotriquetral (LT), and scapholunate (SL) dissociation Fig. . These fSurgery was performed on the day of the injury to prevent compartment syndrome. Fasciotomy, open reduction, and internal fixation using 3.5\u200amm LCP plates  were performed on his forearm fractures. Since the forearm swelling was severe, wiring sutures were applied to the volar-side of the forearm for gradual closure. To address the pancarpal dissociation, a longitudinal incision was made at the dorsum of the wrist. First, the capitate was reduced and fixed with a 1.1\u200amm Kirschner wire (K-wire). Second, the third to fifth carpometacarpal joint (CMCJ) and hamate were reduced and fixed with the K-wires. Then, a 3.0 Headless Compression Screw (Synthes Inc.) was inserted to rigidly fixate the capitate. Third, the SL and LT ligaments were repaired using two mini Mitek devices, and the other intercarpal ligaments were repaired with 2-0 Ethibond sutures. Finally, additional transcarpal pins were inserted to reinforce the ligament repair, and the 2.0\u200amm LCP (Synthes Inc.) was fixed to buttress the third CMCJ (Fig. Postoperatively, an above-elbow splint was applied with the forearm in neutral position. Two weeks postoperatively, the splint was changed to a short-arm splint. The patient was instructed to begin gentle range of motion exercises of the wrist with pins from four weeks after surgery and all pins were removed at six weeks postoperatively.Twelve months after the operation, the radiographs demonstrated union of the radioulnar shaft, and the carpal bone alignment was successfully maintained Fig. . There w3Acute carpal instability has numerous variations and pancarpal dissociation may be the most severe form of injury. Because of the rarity of this injury, however, pancarpal dissociation has not been clearly defined so far and there is no standard treatment. The patient presented here showed combination of perilunate dislocation, capitate fracture-dislocation, and hamate dislocation and the authors believe that this pattern can be regarded as pancarpal dissociation. A significant amount of force is required to create additional fractures and dislocation of the capitate that accompany perilunate injury or other complex carpal abnormalities. A typical perilunate injury associated with capitate injury is scaphocapitate syndrome. This injury is defined as combination of a scaphoid fracture and a capiate fracture which was reported as a unique form of carpal bone injury. Our case is similar to scaphocapitate syndrome, but it also had hamate dislocation, which were different from scaphocapitate syndrome.Among the carpal bones, the capitate has inherent stability because of its cuboid shape, central location, and the surrounding ligaments.,9 Axial disruptions are mostly reported to be caused by industrial crushing injuries such as punch or rolling presses machines. Our case had hamate dislocation but axial injury pattern was not observed. To the authors\u2019 knowledge, this is the first case of hamate dislocation associated with perilunate injury and capitate fracture-dislocation. Although the mechanism of injury is unclear, it is believed that a significant amount of force after a fall while riding a high-speed motorcycle caused hyperextension and crushing of the palm and wrist, causing pancarpal dissociation.Hamate dislocation is also very rare injury and has been classified under axial carpal instability. discussed wrist fusion as a treatment for pancarpal dissociation, but in this case, anatomical reduction was performed. One year after surgery, the patient had near-full range of motion, and radiographs showed adequate carpal bone alignment.Although surgical treatment is usually indicated, the treatment strategy for pancarpal dissociation has not been standardized, and it is challenging. The authors recommend performing the surgery in the following order. First, the displaced capitate is reduced and fixed to prevent avascular necrosis. Next, the CMCJ, hamate are reduced and fixed. Then, proximal row is treated sequentially. Ting et al.In this brief communication, the authors shared a rare case of pancarpal dissociation demonstrated surgical methods. Pancarpal dissociation can be defined as combination of perilunate dislocation, capitate fracture-dislocation, and hamate dislocation. The authors recommend reduction and fixation of the distal carpal row, followed by the proximal row. This sequence facilitates an easy approach to the distal carpal row. Although it is very severe injury, an early rehabilitation can lead to favorable functional outcomes.Conceptualization: Ho Youn Park, Il-Jung Park.Data curation: Ho Youn Park.Supervision: Dohyung Lim.Validation: Yoo Joon Sur.Visualization: Ho Youn Park.Writing \u2013 original draft: Kwanwoo Lee.Writing \u2013 review & editing: Il-Jung Park, Ho Youn Park."}
{"text": "To identify adherence to follow-up recommendations in long-term breast cancer survivors (LTBCS) of the SURBCAN cohort and to identify its determinants, using real-world data.We conducted a retrospective study using electronic health records from 2012 to 2016 of women diagnosed with incident breast cancer in Spain between 2000 and 2006 and surviving at least 5\u00a0years. Adherence to basic follow-up recommendations, adherence according to risk of recurrence, and overall adherence were calculated based on attendance at medical appointments and imaging surveillance, by year of survivorship. Logistic regression models were fitted to depict the association between adherence and its determinants.A total of 2079 LTBCS were followed up for a median of 4.97\u00a0years. Of them, 23.6% had survived\u2009\u2265\u200910\u00a0years at baseline. We estimated that 79.5% of LTBCS were overall adherent to at least one visit and one imaging test. Adherence to recommendations decreased over time and no differences were found according to recurrence risk. Determinants of better overall adherence were diagnosis in middle age (50\u201369\u00a0years old), living in a more-deprived area, having fewer years of survival, receiving primary treatment, and being alive at the end of follow-up.We identified women apparently not complying with surveillance visits and tests. Special attention should be paid to the youngest and eldest women at diagnosis and to those with longer survival. Breast cancer is the most frequent cancer in women worldwide. Improvements in diagnosis, treatment, access to health care systems, and screening programs have greatly enhanced the likelihood of surviving the disease . CurrentThe guidelines of the American Society of Clinical Oncology, the European Society of Medical Oncology, and the Spanish Society of Medical Oncology (SEOM) recommend that follow-up include active surveillance of recurrence and new primary tumors, treatment of complications and late adverse effects, management of comorbidities, general preventive care for other conditions as in the rest of the population, and health promotion. All guidelines recommend an annual consultation and mammography for active surveillance \u201311. SincThere is no established threshold to define adequate adherence and it is usually defined following investigators\u2019 criteria. Adherence to surveillance imaging tests and visits has been assessed separately. Evidence so far indicates that LTBCS visit a physician at least once a year, although not necessarily in primary care; furthermore, they are not screened as recommended, whether because they underuse or overuse recommended tests . DescribIn this study, we aimed to (1) estimate adherence to follow-up recommendations in LTBCS in the Spanish SURBCAN cohort, in general and according to recurrence risk and (2) to identify the factors associated with adherence using real-world data.The Spanish National Health System (NHS) provides universal coverage and is mainly financed by tax revenue. The system is decentralized and consists of three organizational levels: (1) Central, The Ministry of Health; (2) autonomous communities (AC); and (3) administrative health areas, smallest territorial areas within each AC responsible for the management of the health services offered. Residents are insured under two categories according to their affiliation to the Social Security System: active, for workers contributing to Social Security, and pensioners, for those receiving benefits due to retirement, permanent disability, widow/orphan-hood, or old age. Also, around 16% of the population buys voluntary private health insurance and becomes double covered . PrivateThis observational retrospective study was conducted among the Breast Cancer Survival (SURBCAN) Cohort . Briefly, this cohort includes information on 19,416 women. Of these, 6512 are LTBCS diagnosed with incident cancer between January 1, 2000 and December 31, 2006 in the NHS from five Spanish regions , aged 18 or older at diagnosis, and who were alive at the beginning of the follow-up period . The remaining 12,904 are women without breast cancer matched two-to-one by age and administrative health area to LTBCS. To be included, women in each group were required to have at least one contact with primary care during follow-up. Information was retrieved during 2018. More information on the SURBCAN cohort is detailed elsewhere , tumor behavior at diagnosis (in situ or invasive), treatment received , and Charlson Comorbidity Index at baseline . Charlson Comorbidity Index was calculated using the original diagnoses captured by International Classification of Diseases (ICD 9th and 10th edition) or the International Classification of Primary Care (CIAP2), although, excluding breast cancer diagnosis from the algorithm. Risk of recurrence is established by the SEOM according to tumor behavior, tumor receptors, size, invasion, and response to treatment, as well as the genetic platform profile. In the absence of this information for most participants, risk of recurrence was established according to the treatment received: (a) women at low risk, defined as those treated with surgery and radiotherapy only and (b) women at high risk, defined as those treated with chemotherapy either alone or in combination with surgery and/or radiotherapy.Health services use variables included annual contact rate per women, during the follow-up period. Rates were calculated for primary care , specialized care , cancer-related visits , complementary exams , imaging tests , and mammograms. Type of imaging test was not available for Andalusia; therefore, annual mammogram rate was not calculated for women from the region.n\u2009=\u20092079) and (2) considering mammograms only, when information on type of imaging test was available (n\u2009=\u20091758).The main study variable was adherence to follow-up recommendations. Three types of variables for adherence were created: annual adherence to basic recommendations, annual adherence by risk of recurrence, and overall adherence. Each type was defined twice according to the available information: (1) considering any imaging test  with its 95% confidence intervals (CI). Statistical tests were two-sided and the significance level was set at p\u2009<\u20090.05. All analyses were performed using the statistical software IBM SPSS Statistics 25.We performed a descriptive univariate analysis of the cohort using frequencies and percentages for categorical variables, mean, and standard deviation for continuous normally distributed variables and median and inter-quartile range for continuous not normally distributed variables. Health services use is described as annual contact rates per woman. The total number of contacts to each service was used as the numerator and the total number of women-year throughout the study period as the denominator. Percentage of women adherent to basic recommendations and adherent to recommendations according to risk of recurrence is described by survival year (6th through 17th) and trend in adherence was assessed using the Study participants are described in Table n\u2009=\u20091032) of LTBCS were adherent and 3.32% (n\u2009=\u200969) consistently received less than recommended care each year of follow-up. The remaining 64.4% switched between adherence and non-adherence during the study period (Table n\u2009=\u2009315) of women were adherent to basic recommendations each year. When we included women with more than one mammogram in some years of their follow-up, the percentage of adherent women increased to 26.6% (n\u2009=\u2009468). A total of 19.2% (n\u2009=\u2009337) received less than recommended care in each year of follow-up and the rest showed irregular adherence over the study period. Assessed annually, the percentage of women adherent to basic recommendations decreased over time. When we analyzed all imaging tests, adherence ranged from 82.8% in the 8th year to 68.1% in the 17th year ; when considering mammography, adherence ranged from 61.9% in the 7th year to 27.5% in the 17th year . The percentage of women with more than one mammogram per year never exceeded 10%.When we included all imaging studies, 49.6% n\u2009=\u2009103 of LTBCS\u03c72 test for trend, p\u2009<\u20090.001). No differences were found in the percentage of adherent women on comparison of groups at low and high recurrence risk in any year .Figure\u00a0We estimated that 79.5% of LTBCS were adherent for more than half of the follow-up period to at least one visit and one imaging test. This percentage decreased to 63.3% if only mammograms were included as imaging tests , while if mammograms only were analyzed, adherence was highest among women aged 50\u201359\u00a0years (71.3%). Analysis by treatment showed that women receiving surgery, radiotherapy and chemotherapy were more adherent than those who did not received these treatments. However, women receiving hormone therapy were less adherent than those not receiving it, when we considered all imaging tests and were more adherent when we considered mammograms alone. Regarding the Medea index, women living in less-deprived areas showed the lowest adherence .The results of the multivariate logistic regression models are shown in Table When mammograms were considered, women aged 50 to 69 at diagnosis and those living in deprived areas were more adherent . In contrast, those who died during follow-up had the lowest odds of being adherent . Women who had survived 10 or more years from diagnosis at the beginning of follow-up showed 27% lower odds of being adherent than those surviving 5\u20139\u00a0years . Women receiving any kind of treatment had higher odds of being adherent than those who did not.Only a few studies have focused on adherence among LTBCSs, including\u2009\u2265\u200910\u00a0years survivors \u201323 or inThis study is the first to analyze adherence with real-world data among Spanish LTBCS, and the results are in line with those of studies performed in other contexts , 26\u201331.Irrespective of imaging type and recurrence risk, adherence decreased over time. This pattern has been reported by other studies , 32, 33.Age at diagnosis seems to play an important role in adherence. Compared with women under 40\u00a0years, those aged\u2009\u2265\u200970\u00a0years at diagnosis were less likely to be adherent when we analyzed all imaging tests, whereas women aged between 40 and 69\u00a0years were more likely to be adherent when we analyzed mammograms only. This result aligns with previous studies \u201323, 27. Prior studies have reported that women with a high comorbidity burden were less likely to receive surveillance mammograms , 23, 28,Similar to our findings, other studies have reported that treatment with radiation and chemotherapy was associated with higher rates of adherence , 32\u201334. Unlike other authors , we founIn our study, we had access to complete longitudinal data on health services use for up to 5\u00a0years, for a large population of insured LTBCS in Spain. Other strengths include a mixed age population and a novel focus on long-term survival using real-world data. Although we consider regional diversity a strength of this study and all three AC work within the framework of the Spanish National Health Service, each region has a different health service organization and management model. Therefore, the availability of data differs in each sub-cohort. Electronic health records from primary care and hospital databases provide detailed information on demographics, breast cancer characteristics, treatment, consultations, and comorbidities, reducing memory bias and allowing chronic processes to be analyzed from a multi-causal approach. This study provides valuable information to improve current practices and survivors\u2019 adherence to follow-up recommendations.This study also has some limitations. Adherence could be overestimated. Because we could not ascertain the reasons for consultations and test prescriptions or symptoms at the time of the test, we could have included visits unrelated to breast cancer follow-up and diagnostic exams. While relevant, no data were available on the type and site of surgery, recurrence, metastasis, or menopausal status. In addition, it is difficult to ascertain time intervals, because some women may receive two mammograms in a year (at the beginning and at the end) and therefore none the following year. We intended to minimize misclassification with overall adherence analysis. Most of our population was Spanish (94.4%) with no other comorbidities (69.7%) at baseline. Estimates may be lower in populations with less access to medical services and those with more comorbid conditions , 37. DatOther aspects that might influence adherence and were not considered in this study include participants\u2019 educational level, preferences, fear and health literacy, and provider recommendations. These may act as unobserved confounders.A considerable percentage of women in contact with health services are not been properly followed up. These findings reinforce the need for active engagement of all breast cancer survivors in long-term aftercare, especially the youngest and eldest at diagnosis and those with the longest survival. Further research is needed to better understand patient and provider attitudes to survivorship care as well as guideline adequacy."}
{"text": "Sophora tonkinensis Gagnep., a traditional Chinese medicine, is known as Shan Dou Gen in the Miao ethnopharmacy. A large number of previous studies have suggested the usage of S. tonkinensis in the folk treatment of lung, stomach, and throat diseases, and the roots of S. tonkinensis have been produced as Chinese patent medicines to treat related diseases. Existing phytochemical works reported more than 300 compounds from different parts and the endophytic fungi of S. tonkinensis. Some of the isolated extracts and monomer compounds from S. tonkinensis have been proved to exhibit diverse biological activities, including anti-tumor, anti-inflammatory, antibacterial, antiviral, and so on. The research progress on the phytochemistry and pharmacological activities of S. tonkinensis have been systematically summarized, which may be useful for its further research.The roots of  Sophora tonkinensis Gagnep. belongs to the Sophora genus of the Leguminosae family, which is widely distributed in the southwest provinces of China .rophages . Moreove,75.ropha on IL-6 . Sophotoal cells . MoreoveL fluids . Anotherrageenan .S.tonkinensis  for leukemia U937 cells were investigated [The anti-tumor effect was one of the most reported activities of kinensis . The chlt manner . Meanwhima cells . The antma cells . The natstigated .S. tonkinensis were reported significant protective effects against immune induced liver injury , aspartate aminotransferase (AST) serum, malondialdehyde (MDA), and nitric oxide (NO), as well as increased the superoxide dismutase (SOD) and glutathione (GSH) in mice with immune-induced liver injury [S. tonkinensis alleviated hepatic inflammation, liver fibrosis, and hepatic lipids accumulation [1) and oxymatrine (4) may be the main components contributing to the lipid-lowering activity of the water extract of S. tonkinensis [S. tonkinensis have been reported to attenuate hepatic oxidative damage in vivo [34) from S. tonkinensis have been reported to significantly improve liver injury in mice [The components of r injury . Previour injury . The watmulation . Compounkinensis . Meanwhi in vivo . In addi in mice . S. tonkinensis (75), cermizine C (70), jussiaeiine A (68), jussiaeiine B (67), (+)-5\u03b1-hydroxyoxysophocarpine (17), (\u2212)-12\u03b2- hydroxyoxysophocarpine (18), and (\u2212)-clathrotropine (64), have reported the anti-coxsackie virus B3 (CVB3) activities with IC50 values rang of 0.12~6.40 \u00b5mol/L [188) and (\u2212)-trifolirhizin (190) from S. tonkinensis exhibited anti-tobacco mosaic virus (TMV) activities with the inhibition rates of 69.62% and 68.72%, respectively, at a concentration of 100 \u00b5g/mL [23), sophtonseedline F (8), and (\u2212)-N-formylcytisine (52), have been reported to have anti-TMV activities as well [20), (\u2212)-sophocarpine (34), and (\u2212)-13,14-Dehydrosophoridine (16) have showed anti-HBV activities [The compounds isolated from kinensis , such as0 \u00b5mol/L . The com00 \u00b5g/mL . The othlirhizin 0 from S.N-butanol, and ethanol extracts of S. tonkinensis have been tested (S. tonkinensis exhibited antioxidant activities. It is noteworthy that shandougenine A (263), shandougenine C (127), shandougenine D (128), and 7,4\u2019-Dihydroxyisoflavone (103) showed stronger superoxide anion radical scavenging capacity than the known flavanone luteolin. Shandougenines B (264) showed DPPH free radical and ABTS cation radical scavenging capacity. Shandougenine A (263), shandougenine C (127), shandougenine D (128), bolusanthin IV (261), 2--5,6-methylenedioxybenzofuran (260), and demethylmedicarpin (179) were reported parallel ABTS cation radical scavenging capacity to the positive control [The antioxidant activities of chloroform, ethyl acetate, n tested . The res control .S. tonkinensis were the famous toxic Miao drug  to zebrafish was mainly characterized as hepatotoxicity, neurotoxicity, cardiovascular toxicity, and nephrotoxicity in the acute toxicity model [1), oxymatrine (4), cytisine (50), and sophocarpine (34) of S. tonkinensis showed significant cardiotoxicity [The roots of iao drug  and wereatocytes ,112. Meae stress . The obvty model . Besidestoxicity .S. tonkinensis have the ability to reduce blood glucose and resist microbial activities (310) and H (306) inhibit a variety of plant pathogens [S. tonkinensis administrated orally to mice significantly increased sensibility to insulin, as well as reduced fasting blood-glucose levels [1) from S. tonkinensis could improve glucose metabolism and increased insulin secretion in diabetic mice, which may be used as a potential drug for diabetes treatment [S. tonkinensis exhibited antidiarrheal activities [S. tonkinensis and its endophytic fungi have been reported [The extracts of tivities . Cytochaathogens . The flae levels . Moreovereatment . Methanotivities . Moreovereported ,67.S. tonkinensis. Structurally, more than 300 compounds have been isolated from S. tonkinensis and its endophytic fungi, including alkaloids, triterpenes and triterpenoid saponins, flavonoids, and so on. Some of the star molecules, including matrine (1) and oxymatrine (4), were documented to exhibit well biological activities [S. tonkinensis in the folk treatment of upper respiratory tract infection diseases. It is generally believed that the alkaloid components of S. tonkinensis were the main active substances in the roots of S. tonkinensis [S. tonkinensis have been reported for hepatotoxicity, while the other related studies showed the opposite hepatoprotective effects. The in-depth toxicological or structure-activity relationship study may be worth for further research. Moreover, the roots of S. tonkinensis combined with other medicines form dozens of marketing Chinese patent medicine for the treatments of pharyngitis, tonsillitis, and aphthous ulcers [In this review, we provide a detailed summary of the medicinal chemistry, pharmacological activities, and related toxicity research of tivities . For itskinensis . Interess ulcers ,10,11. H"}
{"text": "A highly efficient technology for generating new monoclonal single-domainrecombinant antibodies (nanobodies) was used to obtain a panel of nanobodiesrecognizing human apo- and/or holo-transferrin. This article is devoted to theprimary analysis of the properties of two different variants of the newnanobodies obtained by us, as well as to the demonstration of the uniquepotential of their application for diagnostic studies. The simultaneous use ofimmunosorbents based on these nanobodies apparently makes it possible to detectchanges in the relative abundance of apo- and holo-transferrin in humanbiological fluids. Such changes could potentially be indicative of an increasedrisk or degree of development of pathological processes, such as malignantneoplasms in humans. The iron-saturated form of Tf is referred to as holo-Tf. An iron-free formof Tf is known as apo-Tf. The apo-Tf binds Fe3+ in blood with highefficiency and transports it to the cell surface for internalization throughinteraction with TfR [Kd1 < 0.1nM, Kd2 = 3.8 nM, pH 7.4), while the affinity in case ofapo-Tf is ~ 100 times lower  [3+) is converted toferrous iron (Fe2+); the receptor/apo-Tf complex then returns to thecell surface, where apo- Tf is released from its bonding with the receptor atneutral pH [Iron is a vital element for a number of key biological processes. Transferrin(Tf) and its receptors TfR1 and TfR2) are the key proteins regulating ironmetabolism in the human body [ and TfR2utral pH .The transferrin iron saturation ratio is a widely used clinical parameter,which is calculated as the ratio between the iron content in thepatient\u2019s blood and the indicator of the total iron-binding capacity ofserum . It is aThe peripheral blood plasma of three patients diagnosed with FIGO stage IVovarian cancer and a urine sample of one patient with invasive bladder cancerwere kindly provided by the National Medical Research Center for Radiology ofthe Ministry of Health of the Russian Federation. Blood plasma from healthydonors was obtained from blood samples taken from employees at a medicallaboratory, with their consent, according to the standard protocol. Thepreviously obtained libraries of sequences encoding nanobodies  were useThe binding constants of nanobodies to each form of transferrin (holo-Tf andapo-Tf) in standard phosphate- buffered saline  were determined ona MicroCal PEAQ-ITC microcalorimeter  using the MicroCalPEAQ-ITC Analysis Software at the Shared Use Center of the Institute of GeneBiology. The fitting model  was unambiguous fromthe data.To perform an electrophoretic analysis of the proteins, aliquots of the eluateswere collected and analyzed in a 5\u201319% gradient SDS polyacrylamide gelaccording to Laemmli. We used the MiniProtean 3 device ; thepower source was Elf-4 . Spectra Multicolor Broad RangeProtein Ladder  was used as a protein marker.\u201cNative\u201d polyacrylamide gel electrophoresis developed by Novakovskyet al.  was adapTable).Using commercially available transferrin preparations, we selected two markedlydifferent major variants of high-affinity nanobodies which had relativelydifferent affinities for holo-Tf and apo-Tf and, apparently, recognizeddifferent transferrin epitopes,these nanobodies worked unexpectedly selectively in the solution(Table)and as a part of an immunosorbent.The aTf1 nanobody in solution (PBS) at pH 7.4 binds holo-Tf witha very high affinity, while binding apo-Tf is 100 times weaker. Interestingly,the TfR1 receptor interacts with transferrin in a similar manner[Whereas the difference in binding of different forms of transferrin by theresulting nanobodies was only slightly noticeable in ELISA.In the case of aTf2, CDR3 is significantly increased and thereappears to be an additional Cys\u2013Cys bond between CDR1 and CDR3. Bothvariants of nanobodies were adapted, produced in bacterial periplasm, andpurified as described previously [Fig. 2A).To our surprise, in the column format,the aTf2 nanobody barely binds holo-Tf while binding apo-Tf very efficiently.In contrast, the aTf1 nanobody binds holo-Tf very well and binds the purifiedapo-Tf much weaker than aTf2. Next, immunosorbents in a column format were usedin parallel to test potential differences in the relative abundances of thebound forms of transferrin in normal and pathological conditions. The firstresults of such testing are presentedin Fig. 2. One can seethat while for blood plasma samples from healthy donors the eluates from both columns contain approximately the same amount oftransferrin, for the samples obtained from cancer patients , one can clearly see that more protein isbound and then eluted in the case of aTf2 nanobodies. A very similar situationis observed when analyzing transferrin in the urine of a patient with aninvasive form of bladder cancer (sample 7). In healthy donors, the urinarylevel of transferrin is ten times lower, and, according to our preliminaryobservations, we do not see noticeable differences in the amounts oftransferrin bound by these two immunosorbents. Hence, this test makes itpossible to detect changes in the relative amounts \u2013 and availability forbinding \u2013 of certain epitopes of different transferrin forms usingnanobodies. This could probably have a diagnostic potential, including forcancer monitoring; however, the reliability and reproducibility of the proposedtest needs to be evaluated on a larger number of samples.The sequences of these two nanobodies are very different of apo-Tf (this may be Tfwith one bound iron ion). As a result, both immunosorbents bind approximately2/3 of the total plasma transferrin (differing in composition). Cancer cellsare known to consume iron particularly efficiently, which can lead to irondeficiency in the biological fluids surrounding the tumor and a relativeincrease in the proportion of apo-Tf. On the other hand, holo- Tf, unlikeapo-Tf, binds very efficiently to the TfR1 receptor on the cell surface.However, TfR1 is also detected in free, extracellular form (as soluble sTfR1). It canIn conclusion, we note that in this study we have obtained new single-domainantibodies and immunosorbents based on them which differently bind forms oftransferrin differing in iron saturation. This ability of differential bindingof the resulting immunosorbents makes it possible to observe relative changesin the representation of different transferrin forms that are either directlyor indirectly associated with cancer."}
{"text": "Escherichia coli (ExPEC) can cause systemic infections in both humans and animals. As an essential nutrient, iron is strictly sequestered by the host. Circumventing iron sequestration is a determinant factor for ExPEC infection. However, the ExPEC iron acquisition mechanism, particularly the mechanism of transferrin (TF) acquisition, remains unclear. This study reports that iron-saturated holo-TF can be utilized by ExPEC to promote its growth in culture medium and survival in macrophages. ExPEC specifically bound to holo-TF instead of iron-free apo-TF via the surface located elongation factor G (EFG) in both culture medium and macrophages. As a moonlighting protein, EFG specifically bound holo-TF and also released iron in TF. These two functions were performed by different domains of EFG, in which the N-terminal domains were responsible for holo-TF binding and the C-terminal domains were responsible for iron release. The functions of EFG and its domains have also been further confirmed by surface-display vectors. The surface overexpression of EFG bound significantly more holo-TF in macrophages and significantly improved bacterial intracellular survival ability. Our findings reveal a novel iron acquisition mechanism involving EFG, which suggests novel research avenues into the molecular mechanism of ExPEC resistance to nutritional immunity.Extraintestinal pathogenic IMPORTANCE Extraintestinal pathogenic Escherichia coli (ExPEC) is an important pathogen causing systemic infections in humans and animals. The competition for iron between ExPEC and the host is a determinant for ExPEC to establish a successful infection. Here, we sought to elucidate the role of transferrin (TF) in the interaction between ExPEC and the host. Our results revealed that holo-TF could be utilized by ExPEC to enhance its growth in culture medium and survival in macrophages. Furthermore, the role of elongation factor G (EFG), a novel holo-TF-binding and TF-iron release protein, was confirmed in this study. Our work provides insights into the iron acquisition mechanism of ExPEC, deepens understanding of the interaction between holo-TF and pathogens, and broadens further researches into the molecular mechanism of ExPEC pathogenicity. Escherichia coli (ExPEC) is responsible for infections in both humans and farm animals , which impose a substantial burden on both public health and economics  critical for iron acquisition from TF, whereas TbpB is a surface-exposed lipoprotein that enhances the efficiency of iron uptake  and OmpC are considered to be TF-binding proteins; however, it is unknown whether E. coli can utilize the iron in TF . Dose-dependent effects were observed among different holo-TF concentrations at 6 to 8 h . In macrophages, significantly greater numbers of bacteria per cell were isolated in holo-TF-supplemented THP-1 cells (P\u2009<\u20090.05) (P\u2009<\u20090.05) . These results indicated that holo-TF promoted ExPEC RS218 growth in culture medium and survival in macrophages.ExPEC strain RS218 is a clinical neonatal meningitis isolate that can cause bacteremia and meningitis . To dete\u2009<\u20090.05) . Dose-deP\u2009<\u20090.05) (P\u2009>\u20090.05). The binding of fluor-TF to the RS218 surface was also detected by fluorescence microscopy  , which icroscopy . In addi3+) but not by Ca2+ or Mg2+. As shown in P\u2009<\u20090.05), which indicated that iron had been acquired. With increasing holo-TF concentrations, the iron acquisition of bacteria significantly increased (P\u2009<\u20090.01).Bacteria have been reported to take up the iron in holo-TF . To deteM. tuberculosis has been reported to recruit holo-TF to the cytoplasm to acquire iron . However, there was no significant difference when bacteria were incubated at 4\u00b0C, indicating that ExPEC RS218 cannot convert holo-TF at 4\u00b0C (P\u2009<\u20090.05) (P\u2009>\u20090.05), whereas the total TF signals significantly decreased following incubation at 4\u00b0C (P\u2009<\u20090.05). This finding indicated that the conversion of holo-TF to apo-TF by RS218 should be performed at 37\u00b0C instead of 4\u00b0C. Bacterial binding to holo-TF occurred at 4\u00b0C. Moreover, when RS218 was incubated with bio-TF at 37\u00b0C, the total TF signal levels were similar to that in the reference (P\u2009>\u20090.05), whereas iron-carrying TF signals levels were significantly lower than the reference signals (P\u2009<\u20090.05), indicating that converted apo-TF detached from the bacteria and was released into the supernatant  instead of apo-TF was detected by enzyme-linked immunosorbent assay (ELISA) using anti-TF antibodies . Therefore, the iron uptake event could be characterized through comparison of the difference of relative desthiobiotin signals  and relative iron-carrying TF signals after RS218 was incubated with bio-TF. As shown in \u2009<\u20090.05) . Furtherernatant .The above results indicated that ExPEC RS218 bound to holo-TF and acquired the TF-associated iron. This process did not involve the transport of holo-TF to the cytoplasm. After the iron of holo-TF was plundered by RS218, apo-TF detached from the surfaces of bacteria.The desthiobiotin pulldown assay from ExPEC RS218 total membrane fractions to determine the identity of holo-TF-binding protein(s) indicated the presence of proteins . The subsequent mass spectrometry analysis indicated that EFG is one of the proteins with the largest number of matched peptides (Table S1), so it was selected for further research.E. coli BL21 carrying the pET-32a plasmid) bands interacting with holo-TF or rEFG were detected, indicating that the interaction between EFG and holo-TF was specific. The results of the ELISA plate binding assays indicated that rEFG bound to bio-TF in a concentration-dependent manner (P\u2009<\u20090.05)  was expressed  and the interaction between rEFG and holo-TF was detected by far-Western blotting, ELISA plate binding assays, desthiobiotin pulldown assays, and recombinant protein inhibition assays. The results of far-Western blotting detected that the holo-TF signal was associated with the rEFG on the polyvinylidene difluoride (PVDF) membrane and the rEFG signal was associated with the holo-TF on the PVDF membrane  and B. Nt manner . In addit manner  and G. T\u2009<\u20090.05) .http://pfam.xfam.org/), and the results indicated that EFG contains five domains: the GTP_EFTU (amino acids 8 to 288), GTP_EFTU_D2 , EFG_III , EFG_IV , and EFG_C (amino acids 611 to 689). In this study, amino acids 1 to 288 were regarded as Dm1 and amino acids 611 to 704 were regarded as Dm5. The schematic diagram of domains is showed in Fig. S5. To identify TF-binding domains in EFG, recombinant proteins with domain deletions  were constructed . The results of ELISA binding assays in P\u2009<\u20090.01), which indicated that Dm1 and Dm2 of EFG were key regions of EFG binding to holo-TF.The domains of EFG were predicted by Pfam , and recombinant proteins deficient in each region were constructed . The results in The above results indicated that the EFG interacted with holo-TF via its N-terminal domains .450; iron-carrying TF/total TF) were significantly lower in the 0.5\u2009\u03bcM rEFG and 1\u2009\u03bcM rEFG groups than in the reference group (P\u2009<\u20090.05). When incubated at 37\u00b0C, the relative values of OD450 were significantly lower in the 0.2, 0.5, and 1\u2009\u03bcM rEFG groups than in the reference group (P\u2009<\u20090.05)  , indicat450  of rEFG, \u0394Dm1, and \u0394Dm2 were significantly lower (P\u2009<\u20090.01), which indicated the production of apo-TF. The relative values of OD450 of \u0394Dm3, \u0394Dm4, and \u0394Dm5 were not significantly different from those of the reference group (P\u2009>\u20090.05), indicating that the deletion of Dm3, Dm4, and Dm5 of EFG resulted in the failure of apo-TF generation. These results suggested that the C-terminal domains of EFG, including Dm3, Dm4, and Dm5, were involved in the process of iron release after binding with holo-TF.The key domains of EFG associated with iron release were also explored. As shown in The reported bacterial TF-binding proteins  are surface proteins. To investigate whether EFG might be located on the surface of RS218, Western blotting, colony blotting, and immunofluorescence assays were performed. The positive signals of EFG and OmpA on RS218 outer membrane fractions  and the efg are presented in PBP57058) was used as the anchoring motif to enable display of heterologous proteins on the surfaces of E. coli. The mCherry protein (GenBank: MK753226.1) was used as an indicator of protein expression on the surfaces. The fusion expression of EFG or its variants with InaZN and mCherry enabled heterologous expression of EFG or its variants on the surfaces of bacteria.The pEImC plasmid for heterologous protein surface-display was constructed according to previous studies with modifications \u201329. Gene\u2013efg, pEImC::\u0394Dm1, pEImC::\u0394Dm2, pEImC::\u0394Dm3, pEImC::\u0394Dm4, and pEImC::\u0394Dm5, were transformed into E. coli BL21(DE3). The obtained strains were named BL21-pEImC, BL21-pEImC-EFG, BL21-pEImC-\u0394Dm1, BL21-pEImC-\u0394Dm2, BL21-pEImC-\u0394Dm3, BL21-pEImC-\u0394Dm4, and BL21-pEImC-\u0394Dm5, respectively -induced bacterial pellet turned bright fuchsia (P\u2009<\u20090.05) (P\u2009<\u20090.01) (P\u2009>\u20090.05)  . Whole b\u2009<\u20090.01) . Outer m\u2009<\u20090.01) . Gray in\u2009>\u20090.05) . These rP\u2009<\u20090.001) (P\u2009<\u20090.05) (P\u2009<\u20090.01). However, the fluorescence intensity of fluor-TF bound to BL21-pEImC-\u0394Dm1 and BL21-pEImC-\u0394Dm2 was significantly lower than that of BL21-pEImC-EFG (P\u2009<\u20090.01), which indicated that Dm1 and Dm2, not the Dm3 to Dm5 of EFG, were involved in holo-TF binding.Our study revealed that the binding of rEFG and holo-TF facilitated iron release in phosphate-buffered saline (PBS). To detect the interaction between EFG and holo-TF at bacterial level, the binding of fluor-TF to BL21 strains containing a series of pEImC plasmids was detected. As shown in <\u20090.001) . An exce\u2009<\u20090.05) , thus exP\u2009<\u20090.05). BL21-pEImC-EFG acquired TF-related iron in a concentration-dependent manner (P\u2009<\u20090.01) (P\u2009<\u20090.001) (P\u2009<\u20090.001), indicating that overexpressed EFG significantly promoted the conversion of holo-TF to apo-TF. The BL21-pEImC-EFG converted holo-TF to apo-TF in a bio-TF concentration-dependent manner (P\u2009<\u20090.01) (P\u2009<\u20090.001)  . The flu<\u20090.001) . In addi\u2009<\u20090.01) . For BL2<\u20090.001) .E. coli to holo-TF. The deletion of iron-releasing domains and the holo-TF-binding domains in EFG suppressed the iron uptake capacity on the whole bacterium level.These results indicated that the overexpression of EFG on the bacterial surfaces was positively correlated with holo-TF-binding and iron absorption ability. The N-terminal domain of EFG played an important role in the binding of P\u2009<\u20090.05). However, the deletion of Dm1 and Dm2 impaired the holo-TF-binding ability of BL21-pEImC-EFG (P\u2009<\u20090.05).To determine the effects of the interaction between EFG and holo-TF on bacterial viability in macrophages, the ability of BL21 strains containing a series of pEImC plasmids strains to bind holo-TF and their ability to survive in THP-1 cells were determined. As shown in P\u2009<\u20090.005), which suggested that holo-TF promoted the tolerance of bacteria to macrophages. Furthermore, the survival ability of BL21-pEImC-EFG was significantly stronger than that of the BL21-pEImC strain in holo-TF-supplemented THP-1 cells (P\u2009<\u20090.001) (P\u2009>\u20090.05) (P\u2009<\u20090.05)  . No sign\u2009>\u20090.05) , which e\u2009<\u20090.05) . These rMetal ions  are the components of metalloproteins, including metalloenzymes, transcription factors, and storage proteins . These iEnterobacteriaceae enterobactin has been shown to chelate and subsequently import iron through FepA receptors in the FepBCDG system  to acquire ferric iron or secrete hemolysin to release hemoglobin-bound heme from erythrocytes  holo-TF had a stronger effect on bacterial growth than the high-dosage holo-TF (50\u2009\u03bcg/mL). This is because excessive iron is harmful to bacteria. Moreover, iron is a mediator of oxidative stress. Excess iron can produce hydroxyl free radicals that damage DNA and proteins, which affects bacterial growth , 43.E. coli, obtain iron from the labile iron pool in host cell, although some of the iron in the unstable iron pool comes from holo-TF  of the E. coli genome did not identify TbpA-like or TbpB-like proteins. To identify the holo-TF-binding proteins associated with ExPEC RS218, desthiobiotin pulldown assays were used to capture the bound membrane proteins with bio-TF. Surprisingly, EFG was screened as a holo-TF-binding protein.To study the mechanism by which ExPEC RS218 uses holo-TF, the combination of RS218 and holo-TF was tested. Some bacteria, such as uropathogenic  holo-TF . Howeverain iron . The obsE. coli isolates, such as other pathotypes, commensal strains, or even laboratory workhorse strains . It is speculated that EFG might have the potential to bind TF and release iron from TF if EFG is a surface protein in these E. coli strains even in these various pathogens.In general, EFG is a cytoplasmic protein. In this study, the surface location of EFG was confirmed. In various pathogens, EFG, elongation factor Tu, and glycolytic enzymes without signal peptides are detected in membrane components \u201346. Thes\u201349\u2013M. tuberculosis has suggested that for bacteria that do not possess professional TF-binding proteins, the moonlighting protein is a key breakthrough in studying the mechanism of iron uptake in holo-TF. Furthermore, we also found that although both EFG and GAPDH were moonlighting proteins with the function of binding holo-TF, their iron uptake mechanisms, especially iron release mechanisms, were quite different.Research into the EFG of ExPEC and GAPDH of https://swissmodel.expasy.org/) was used to predict the EFG structure, the result presented in Fig. S8 indicated that the EFG did not contain a 22-stranded \u03b2-barrel or an N-terminal plug domain, which are common structures for most TBDRs. This result further confirms that EFG was not a TBDR. Previous studies have also reported that TbpA and TbpB utilize FbpA rather than TonB to mediate iron transport . Bacteria were cultured at 37\u00b0C with shaking at 180\u2009rpm in a Tecan Spark microplate reader. The value of ODTEM assays were performed as previously described with few modifications . Log pha8 CFU) was blocked as described in TEM assays. The bacteria were incubated with 20\u2009\u03bcg fluor-TF alone or in the presence of unlabeled holo-TF for 1 h at 4\u00b0C. Bacteria were incubated with unlabeled holo-TF functioned as the background control. Bacteria with FITC-apo-TF were also subjected to the same process. The fluor-TF was purchased from Life Technologies (USA). FITC-apo-TF was prepared by labeling apo-TF with FITC  according to manufacturer\u2019s instructions. After washing, the fluorescence intensity of the 107 cells was detected at an excitation of 485\u2009nm and an emission of 535\u2009nm. The fluorescence of the background control group was subtracted from all values. The ExPEC incubated with fluor-TF was observed under a fluorescence microscope.Fresh ExPEC strain RS218 . Anti-OmpA antibodies prepared in our laboratory  was washed with M9 medium. Then, bacteria incubated with 200\u2009\u03bcg bio-TF for 4 h at 37\u00b0C or 4\u00b0C. Bio-TF was prepared by labeling holo-TF with EZ-Link sulfo-NHS-LC-desthiobiotin  according to the manufacturer\u2019s instructions. Bacteria were washed four times with cold PBS. The cytosolic fractions were isolated and then incubated with streptavidin agarose resins . Captured proteins were loaded on a PVDF membrane and detected using horseradish peroxidase (HRP)-streptavidin . The isolated cytosolic fractions were verified by Western blotting using anti-LexA and anti-OmpA antibodies. The outer membrane proteins of ExPEC RS218 were used as a positive control for anti-OmpA antibodies.Log phase ExPEC strain RS218 (5\u2009\u00d7\u200910efg (locus_tag W817_18790) and its domain deletion genes (\u0394Dm1 to \u0394Dm5) or regions deletion genes (\u03944.1 to \u03944.4) were recombined into pET-28a using a ClonExpress II one step cloning kit  or ClonExpress MultiS one step cloning kit . Recombinant plasmids were transformed into E. coli BL21(DE3). Expression and purification of recombinant proteins were performed as described previously  and the Bio-Rad ChemiDoc touch imaging system  according to the manufacturer\u2019s instructions.The far-Western blotting was performed as previously described with modifications . The holThe ELISA plate binding assays were performed as previously described with modifications , 58. Rec7 bacterial cells was detected. Data were calculated as the fold change relative to the reference group.Fluor-TF (20\u2009\u03bcg) was incubated with rEFG  for 2 h at 4\u00b0C. The mixtures were coincubated with ExPEC RS218 as described in the holo-TF-binding assays of ExPEC. Bacteria incubated with fluor-TF were used as the reference control. The fluorescence intensity of 10Desthiobiotin pulldown assays were performed according to the manufacturer\u2019s instructions of an EZ-Link desthiobiotinylation and pulldown kit . Bio-TF (50\u2009\u03bcg) and desthiobiotin labeled  were incubated with streptavidin agarose resins according to the manufacturer\u2019s instructions. Bio-CA was prepared as described in the bio-TF preparation section. The interacted proteins were RS218 total membrane proteins (1\u2009mg) or rEFG (100\u2009\u03bcg). Captured proteins were detected by Western blotting using anti-EFG antibodies. To detect the total membrane fractions in this assay, Western blotting was performed using anti-OmpA and anti-LexA antibodies, and the whole bacterial proteins were used as a control.450 values of iron-carrying TF and total TF signals in the mixtures were detected using anti-TF antibodies and HRP-streptavidin, respectively. Background readings of the wells coated without proteins were subtracted from the samples. The relative OD450 value was calculated as the ratio of the OD450 value of the iron-carrying TF signal to that of total TF signal.The rEFG  and \u0394Dm1 to \u0394Dm5 (1\u2009\u03bcM) were incubated with bio-TF (0.1\u2009\u03bcM) for 2 h in a total volume of 200\u2009\u03bcL PBS at 4\u00b0C or 37\u00b0C. The same concentration of bio-TF was used as a reference. The protein mixtures were diluted and coated on an ELISA plate. The ODWestern blotting, colony blotting, and suspension immunofluorescence assays were performed as previously described with some modifications , 59. OutmCherry were recombined into the pET-28a vector. All of the above genes were codon optimized and synthesized by GenScript (Nanjing). The new plasmid was termed pEImC. efg and \u0394Dm1 to \u0394Dm5 were recombined into the pEImC plasmid, respectively. The recombinant plasmids were termed pEImC::efg, pEImC::\u0394Dm1, pEImC::\u0394Dm2, pEImC::\u0394Dm3, pEImC::\u0394Dm4, and pEImC::\u0394Dm5. All seven of these series pEImC plasmids were transformed into E. coli BL21(DE3).The heterologous protein surface-display plasmid was constructed as described in previous studies with some modifications \u201329. Gene\u20137 cells of the seven induced BL21 strains containing a series of pEImC plasmids at an excitation of 579\u2009nm and an emission of 624\u2009nm. Background readings of uninduced bacterial controls were subtracted from the samples. The surface expression of EFG in the BL21-pEImC-EFG and BL21-pEImC strains was measured by whole strain ELISAs as described previously  for 150\u2009min at 37\u00b0C. After washing, the bacteria were incubated with or without holo-TF for 6 h at 37\u00b0C. For the ExPEC, BL21-pEImC-EFG, and BL21-pEImC strains, the concentration of supplementary holo-TF was 0, 5, 10, 20, and 50\u2009\u03bcg/mL. For the BL21-pEImC-\u0394Dm1 to BL21-pEImC-\u0394Dm5 strains, the holo-TF concentration was 10\u2009\u03bcg/mL. After washing, the fluorescence intensity of 107 cells was measured at an excitation of 490\u2009nm and an emission of 538\u2009nm.Calcein-AM fluorescence quenching assays were performed as described previously with modifications , 60. Log8 bacterial cells were incubated with bio-TF  in M9 medium for 6 h at 37\u00b0C or 4\u00b0C. The bacteria were then placed on ice for 10\u2009min to stop the iron acquisition process. Culture supernatants were diluted and coated on an ELISA plate. The total TF and iron-carrying TF signals in the culture supernatants were detected using HRP-streptavidin and anti-TF antibodies, respectively. The value of the blank control M9 medium was subtracted from all values. The same concentration of bio-TF was used as the reference control. The relative values of total TF signals or iron-carrying TF signals were calculated as the ratio of the OD450 value of the experimental group to the OD450 value of the reference group.Fresh ExPEC strain RS218 was washed twice with M9 medium. Then, 1\u2009\u00d7\u200910450 values of total TF and iron-carrying TF signals in culture supernatants were detected as described above. The relative values were calculated as the ratio of the OD450 value of the iron-carrying TF signal to the OD450 value of the total TF signal.For seven BL21 strains containing a series of pEImC plasmids, bacteria were incubated with 10\u2009\u03bcg/mL bio-TF at 37\u00b0C. ODIntracellular survival assays were performed according to previous studies with some modifications . ExPEC s2 for 1 h to allow for fluor-TF internalization. After washing, the cells were fixed, permeabilized, and blocked as described previously  as described in the colocalization detection assay. After the extracellular bacteria were cleaned, cells were incubated with 1\u2009mg bio-TF for 1 h at 4\u00b0C. Then, cells were incubated at 37\u00b0C, 5% CO2 for another 1 h. Cells were washed four times with cold RPMI 1640 medium. The intracellular E. coli cells were isolated from THP-1 cells as described previously . The filter containing the captured E. coli was cut and subjected to Western blotting. Bio-TF, bacteria, and THP-1 cells were used as controls. Anti-LexA antibodies were used to detect bacteria recovered from inside THP-1 cells. Anti-GAPDH antibodies  were used to detect the THP-1 cells, and HRP-streptavidin was used to detect the bio-TF bound with bacteria.Seven BL21 strains containing a series of pEImC plasmids were incubated with THP-1 cells  and unpaired"}
{"text": "Eine hohe Versorgungsqualit\u00e4t in der pr\u00e4klinischen Notfallmedizin zeichnet sich durch eine leitliniengerechte Therapie aus. Grundvoraussetzung f\u00fcr diese Therapie ist das Vorhalten der ben\u00f6tigten Medikamente entsprechend den g\u00fcltigen Leitlinienempfehlungen. Ob dies fl\u00e4chendeckend gew\u00e4hrleistet wird, ist aktuell unklar. Ein einheitlicher Standard zur medikament\u00f6sen Ausstattung arztbesetzter Rettungsmittel in Deutschland existiert nicht. Ziel der vorliegenden Arbeit ist die Identifikation von wichtigen Diagnosen und der zu ihrer Therapie ben\u00f6tigten Medikamente. Ein Abgleich dieser Ergebnisse mit der realen Ausstattung arztbesetzter Rettungsmittel erm\u00f6glicht die Bewertung hinsichtlich leitliniengerechter Therapieoptionen.Nach einer strukturierten Leitlinienrecherche wurden Tracerdiagnosen definiert und ihnen relevante Medikamente zugeordnet. Hier wurde auch der Evidenz- und Empfehlungsgrad ber\u00fccksichtigt. In einem zweiten Schritt wurden \u00c4rztliche Leitungen Rettungsdienst zu der Ausstattung der von ihnen verantworteten Rettungsmittel befragt und die Ergebnisse mit den empfohlenen Medikamenten verglichen.Insgesamt wurden 156 verschiedene Medikamente identifiziert. Der Median der vorgehaltenen Medikamente betr\u00e4gt\u00a058 bei einer minimalen Vorhaltung eines Standorts von 35\u00a0Medikamenten und maximaler Vorhaltung mehrerer Standorte von 77\u00a0Medikamenten.In der vorliegenden Erhebung wurden die in Leitlinien empfohlenen Medikamente mit der realen Ausstattung von arztbesetzten Rettungsmitteln verglichen. Insgesamt zeigt sich, verglichen mit einer Studie aus dem Jahr 2011, eine verbesserte Strukturqualit\u00e4t. Die empfohlenen Medikamente werden zu einem hohen Ma\u00df pr\u00e4hospital vorgehalten. Die Daten dieser Erhebung k\u00f6nnen von Rettungsdienstbereichen in ganz Deutschland zur Beurteilung ihrer individuellen Strukturqualit\u00e4t genutzt werden.Die Online-Version dieses Beitrags (10.1007/s10049-022-01036-6) enth\u00e4lt erg\u00e4nzende \u00dcbersichtstabellen. Leitlinien wissenschaftlicher Fachgesellschaften sind Grundlage f\u00fcr eine optimale Patientenversorgung im Rahmen der evidenzbasierten Medizin. Leitlinien dienen hierbei dem Transfer von wissenschaftlicher Evidenz und Konsensempfehlungen von Fachexperten in den klinischen Alltag. Die Umsetzung dieser Leitlinien stellt einen wichtigen Qualit\u00e4tsindikator der klinischen Versorgung dar . F\u00fcr dieIm Rahmen der pr\u00e4hospitalen Patientenversorgung in Deutschland konnten R\u00f6rtgen und Kollegen im Jahr 2011 zeigen, dass eine leitliniengerechte Therapie am Einsatzort nach h\u00f6chstem Evidenzgrad aufgrund mangelnder medikament\u00f6ser Ausstattung h\u00e4ufig nicht erfolgen konnte . Je nachDie vorliegende Arbeit ist eine deskriptive Beobachtungsstudie, die in zwei Schritten erfolgte. Zun\u00e4chst erfolgte eine Leitlinienrecherche hinsichtlich notfallmedizinisch relevanter Leitlinien und deren Empfehlungen f\u00fcr die medikament\u00f6se Therapie. In einem zweiten Schritt f\u00fchrten wir eine Befragung der \u00c4LRD bez\u00fcglich der medikament\u00f6sen Ausstattung der arztbesetzten Rettungsmittel durch. F\u00fcr die Studie lag ein positives Votum der Ethikkommission der Medizinischen Hochschule Hannover (Nr.\u00a09191_BO_K_2020) vor.Es erfolgte eine Schlagwortsuche innerhalb der Leitliniendatenbank der Arbeitsgemeinschaft der Wissenschaftlichen Medizinischen Fachgesellschaften e.\u202fV. (AWMF). Hierf\u00fcr wurden die Schlagw\u00f6rter \u201eNotarzt\u201c, \u201eNotfallmedizin\u201c, \u201epr\u00e4hospital\u201c, \u201ePr\u00e4klinik\u201c sowie \u201eRettungsdienst\u201c verwendet. Die ermittelten Leitlinien wurden zun\u00e4chst durch zwei Untersucher gesichtet und anhand des Titels wurde eine m\u00f6gliche Relevanz f\u00fcr die Fragestellung erfasst. In einer zweiten Sichtung erfolgte durch f\u00fcnf Untersucher mit mindestens 5\u2011j\u00e4hriger Erfahrung in der Notfallmedizin die Identifizierung von pr\u00e4klinisch relevanten Empfehlungen. F\u00fcr die oben genannten Tracerdiagnosen wurde erg\u00e4nzend eine MEDLINE-Recherche durchgef\u00fchrt und die nationalen Empfehlungen um die der europ\u00e4ischen Leitlinien erg\u00e4nzt. Die Leitlinienempfehlungen werden, wenn m\u00f6glich, f\u00fcr eine bessere Vergleichbarkeit hinsichtlich Empfehlungs- und Evidenzgrad nach dem Vorbild der European Society of Cardiology  dargestwww.bv-aelrd.de) erfolgte eine Kontaktdatenakquise auch auf Bundeslandebene. Die \u00c4LRD wurden per E\u2011Mail kontaktiert und um \u00dcbersendung der Medikamentenausstattungslisten der arztbesetzten Rettungsmittel in ihrem Zust\u00e4ndigkeitsbereich gebeten. Alle \u00c4LRD, die nach drei Wochen keine Antwort \u00fcbermittelt hatten, wurden maximal zweimal erneut angeschrieben.Es erfolgte die Kontaktaufnahme \u00fcber im Internet frei zug\u00e4ngliche Kontaktdaten von \u00c4LRD. Neben der Homepage des Bundesverbands der \u00c4rztlichen Leiter Rettungsdienst e.\u202fV.  deskriptiv erfasst. Kategoriale Variablen wurden als numerische Werte und prozentuale Anteile angezeigt.Am Erhebungstag konnten 127 Leitlinien identifiziert werden, die mindestens f\u00fcr eines der verwendeten Schlagw\u00f6rter einen Treffer ergaben. Abb.\u00a0Nach der Stufenklassifikation des AWMF-Regelwerks  zur PlanDie Sichtung der 127 Leitlinien durch zwei Untersucher hinsichtlich einer m\u00f6glichen Relevanz bez\u00fcglich der medikament\u00f6sen Ausstattung ergab f\u00fcr 27\u00a0Leitlinien die Nennung durch beide Untersucher. Hiervon waren 10\u00a0Leitlinien in ihrer G\u00fcltigkeit abgelaufen, wurden jedoch aufgrund ihrer vermuteten Relevanz im folgenden Schritt der Auswertung ber\u00fccksichtigt. Dar\u00fcber hinaus gab es weitere 16\u00a0Leitlinien (3\u00a0abgelaufene), die von jeweils einem Untersucher genannt wurden. Somit ergaben sich 43\u00a0Leitlinien, die durch die 5\u00a0erfahrenen Notfallmediziner begutachtet wurden. Die Sichtung der Leitlinien ergab, dass in 22\u00a0Leitlinien Empfehlungen unterschiedlicher Graduierung f\u00fcr eine medikament\u00f6se Therapie in der Initialphase der Versorgung formuliert sind. Die MEDLINE-Recherche zeigte f\u00fcr 5 der 8\u00a0Tracerdiagnosen relevante Leitlinien von europ\u00e4ischen Fachgesellschaften.F\u00fcr insgesamt 216 Rettungsdienstbereiche konnte ein \u00c4LRD identifiziert werden. Tab.\u00a0Insgesamt wurden 156 verschiedene Medikamente benannt. Der Median der vorgehaltenen Medikamente betr\u00e4gt 58\u00a0bei einer minimalen Vorhaltung eines Standorts von 35\u00a0Medikamenten und maximaler Vorhaltung mehrerer Standorte von 77\u00a0Medikamenten. Alle genannten Wirkstoffe mit der zugeh\u00f6rigen Vorhaltung in Prozent sind bei absteigender Sortierung in den erg\u00e4nzenden \u00dcbersichtstabellen im Online-Material dargestellt. In Tab.\u00a0In der vorliegenden Studie wurde die medikament\u00f6se Ausstattung arztbesetzter Rettungsmittel untersucht und mit den Empfehlungen von nationalen und europ\u00e4ischen Leitlinien verglichen.Nach Empfehlung der Bundes\u00e4rztekammer  unterlie2-Sympathikomimetika werden bei f\u00fchrender bronchialer Obstruktion zus\u00e4tzlich zum Epinephrin empfohlen. Mindestens ein Vertreter dieser Substanzgruppe ist auf allen Medikamentenlisten der Befragten zu finden. Insgesamt zeigt sich somit eine hohe Implementierung der Empfehlungen.In der zum Erhebungszeitpunkt aktuellen, jedoch bereits 2018 abgelaufenen Leitlinie zur Therapie der anaphylaktischen Reaktion von 2014  wird Epi2-Sympathomimetika (SABA), deutlich zugenommen [Die in den Leitlinien , 14 zum Die zum Befragungszeitpunkt g\u00fcltige Leitlinie des European Resuscitation Council  empfiehIn dem Kapitel zu Peri-Arrest-Arrhythmien werden unver\u00e4ndert seit 2010 weitere Medikamente empfohlen. F\u00fcr Bradykardien wird Atropin als Mittel der ersten Wahl empfohlen und fl\u00e4chendeckend vorgehalten. Bei einer urs\u00e4chlichen Bradykardie durch Intoxikation mit Beta- oder Kalziumkanalblockern ist die Wirkung von Atropin h\u00e4ufig nicht ausreichend. Hier empfiehlt die Leitlinie den Einsatz von Glukagon. Die Vorhaltung dieser Substanz ist mit 4\u202f% sehr selten und sollte verbessert werden. Bei Breitkomplextachykardien wird neben Amiodaron der Einsatz von Magnesium bei der Sonderform der Torsade-de-pointes-Tachykardie empfohlen. Hier zeigt sich eine verbesserte Implementierung der Empfehlung mit 94\u202f% gegen\u00fcber 2011 mit 45,3\u202f% [Die ESC ver\u00f6ffentlichte 2019 eine europ\u00e4ische Leitlinie zur Therapie von supraventrikul\u00e4ren Tachykardien . BemerkeDer ST-Hebungs-Infarkt stellt eine der h\u00e4ufigsten Notarztindikationen dar . Die EmpDie Empfehlung zum Einsatz von Morphin zur notwendigen Analgesie ist aufgrund einer m\u00f6glichen Interaktion mit ADP-Rezeptor-Antagonisten im Vergleich zu fr\u00fcheren Versionen herabgestuft worden. Eine 2019 ver\u00f6ffentlichte Metaanalyse [Guidelines for the management of arterial hypertension\u201c der ESC und der European Society of Hypertension (ESH) aus dem Jahre 2018 ist hier richtungsweisend [Abweichungen des Blutdrucks von den Normwerten sind ein h\u00e4ufiges, oft auch akut behandlungsbed\u00fcrftiges Symptom im Rettungsdienst. F\u00fcr die Senkung hypertensiver Werte stehen verschiedene Substanzen zur Verf\u00fcgung. Die gemeinsame europ\u00e4ische Leitlinie \u201esweisend  und Kommsweisend  wird in Der aufgrund seiner kurzen Halbwertszeit und daraus resultierenden guten Steuerbarkeit besonders empfohlene Betarezeptorblocker Esmolol wurde bei keiner der Antworten genannt. Das alternativ vorgeschlagene Metoprolol hingegen wird auf jeder Liste gef\u00fchrt. Weder in der englischsprachigen Originalpublikation noch in der deutschen \u00dcbersetzung wird f\u00fcr die Substanzgruppe der Betarezeptorblocker eine Differenzierung nach Empfehlungsgrad vorgenommen. Insgesamt kann f\u00fcr die pr\u00e4klinische Therapie bei zu hohen Blutdruckwerten ein sehr hoher Implementierungsgrad der Leitlinienempfehlungen der 1. und 2.\u00a0Wahl festgestellt werden. Lediglich f\u00fcr das bei bestehender Agitiertheit, Unruhe oder Alkoholentzugssyndrom empfohlene zentrale Sympatholytikum Clonidin trifft dies mit 30\u202f% nicht zu. Aufgrund der deutlichen Verzichtsempfehlung f\u00fcr den Einsatz von sublingual verabreichten, unretardierten Kalziumkanalblockern wie Nitrendipin (44\u202f%) und Nifedipin (2\u202f%) ist hier eine Anpassung der Medikamentenbest\u00fcckung sinnvoll.Die medikament\u00f6se Therapie einer kritischen Hypotension ist zum einen bei der Versorgung von Patienten mit schwerem isoliertem Sch\u00e4del-Hirn-Trauma  indizierAuf Grundlage einer 2012 ver\u00f6ffentlichten Leitlinie  der DeutIm Wesentlichen befassen sich zwei S1-Leitlinien der Deutschen Gesellschaft f\u00fcr An\u00e4sthesiologie und Intensivmedizin e.\u202fV. (DGAI) und die S3-Leitlinie Polytrauma/Schwerverletzten-Behandlung unter Federf\u00fchrung der Deutschen Gesellschaft f\u00fcr Unfallchirurgie e.\u202fV. mit der pr\u00e4hospitalen Notfallnarkose , 30 und Die Befragung der \u00c4LRD erfolgt zu einem ung\u00fcnstigen Zeitraum im Rahmen der SARS-CoV-2-Pandemie (August bis November 2020). Pandemiebedingt ist von einer hohen Arbeitsbelastung der \u00c4LRD auszugehen. Dies k\u00f6nnte ein Grund f\u00fcr die mit R\u00f6rtgen  verglichInsgesamt zeigt sich verglichen mit den Daten von R\u00f6rtgen et\u00a0al. eine verbesserte Implementierung der Leitlinienempfehlungen. R\u00f6rtgen und Kollegen mussten 2011 noch feststellen, dass f\u00fcr bestimmte Tracerdiagnosen eine medikament\u00f6se Therapie nach h\u00f6chstem Evidenzgrad mit einer H\u00e4ufigkeit von bis zu 80\u202f% nicht m\u00f6glich war . Im VergUm tats\u00e4chlich eine einheitliche Ausstattung aller arztbesetzten Rettungsmittel nach h\u00f6chstem Evidenzniveau sicherzustellen, w\u00e4re der bereits vor 20\u00a0Jahren formulierte Vorschlag zur Konsensfindung durch die Deutsche Interdisziplin\u00e4re Vereinigung f\u00fcr Intensiv- und Notfallmedizin e.\u202fV. (DIVI) und der Bundesvereinigung der Arbeitsgemeinschaften der Not\u00e4rzte Deutschlands e.\u202fV. (BAND) sowie des Bundesverbands der \u00c4rztlichen Leiter Rettungsdienst Deutschland e.\u202fV. sinnvoll."}
{"text": "GLUL (GS) and GLUD1 (GDH) may be the cause of glutamate alterations in astrocytes in AD. These results provide a basis for understanding the characteristic changes in astrocytes in AD and provide ideas for the study of AD pathogenesis.Astrocytes play an important role in the pathogenesis of Alzheimer\u2019s disease (AD). It is widely involved in energy metabolism in the brain by providing nutritional and metabolic support to neurons; however, the alteration in the metabolism of astrocytes in AD remains unknown. Through integrative analysis of single-nucleus sequencing datasets, we revealed metabolic changes in various cell types in the prefrontal cortex of patients with AD. We found the depletion of some important metabolites , as well as the inhibition of some metabolic fluxes  in astrocytes of AD. The abnormality of glutamate metabolism in astrocytes is unique and important. Downregulation of  Alzheimer\u2019s disease (AD) is the most common neurodegenerative disease in the world. The clinical features include memory loss, and the pathological features include amyloid-\u03b2 (A\u03b2) accumulation, neurofibrillary tangle formation (accumulation of p-tau), extensive neuroinflammation, and synaptic toxicity. Unfortunately, there is currently no cure for AD, and the development of drugs, such as those targeting A\u03b2 has not been successful, possibly because the focus of the field is narrow. Therefore, new concepts of AD are needed.APOE, APOJ, and SORL  of patients with AD by integrating a single-nucleus sequencing (snRNA-seq) database. Our analysis results illustrated the unique metabolic state of astrocytes in AD brains. Some of important metabolites, such as 2-oxoglutarate (2OG), acetyl-coenzyme A (CoA), aspartate, pyruvate, and glucose-6-phosphate (G6P), are consumed or accumulated. Glutamate metabolism is an important and unique metabolic process in astrocytes. In the astrocytes in AD brains, glutamate accumulates, while levels of the glutamine and 2OG are downregulated. This reprogrammed metabolism in astrocytes may result from the downregulation of The snRNA-seq datasets (raw or gene expression matrices) of the human PFC used in this study were downloaded from the NCBI Gene Expression Omnibus database (GEO)Single-cell flux estimation analysis scFEA;  was usedWGCNA) and module preservations. The 5,000 most highly variable genes and the differentially expressed enzymes were used. A softPower of 6 was selected as the soft-threshold parameters to ensure a signed co-expression gene network. After filtering, there left a total of 5,007 genes. The correlation coefficient calculation process uses the Spearman correlation coefficient method of the Cor function. To identify the genes in the yellow module that were regulated in AD, gene set enrichment analysis (GSEA) and hypergeometric tests with the clusterProfiler R package were used for functional enrichment analysis.The WGCNA R package  was usedWe used the pyscenic  based onAQP4+, SLCA2+), endothelial cells , excitatory neurons , inhibitory neurons , microglia , oligodendrocytes , and oligodendrocyte precursors  flux, the metabolites (aspartate), and flux-related transporter (SLC1A3) were also significantly downregulated  were included in the astrocytes by performing SCENIC. We performed a hierarchical clustering analysis of the transcriptional regulators and obtained five modules . Using ttrocytes . Interese SLC1A2 , which we SLC1A2 . The intnd GLUD1 .Recent proteomics studies on human AD brain samples have found a strong correlation between the severity of AD pathology and the proteins associated with astrocytes metabolism . By inteGLUL), which is specifically expressed in astrocytes  can be found in the article/L-YF and G-YG collected and analyzed the data. L-YF wrote the manuscript. JY, M-LL, R-YL, YK, and S-YD conceptualized and oversaw the study and data analysis. J-HY and Y-MX provided funding supports. All authors have read and approved the final manuscript.This work was supported by the National Natural Science Foundation of China (Grant U1904207); National Key R&D Program of China (Grant 2017YFA0105003); Non-profit Central Research Institute Fund of Chinese Academy of Medical Sciences (Grant 2020-PT310-01); Innovative and Scientific and Technological Talents Training Project of Henan Province (Grant YXKC2021062).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.https://www.frontiersin.org/articles/10.3389/fnmol.2023.1136398/full#supplementary-materialThe Supplementary material for this article can be found online at: Click here for additional data file."}
{"text": "Neuropathic pain, whose symptoms are characterized by spontaneous and irritation-induced painful sensations, is a condition that poses a global burden. Numerous neurotransmitters and other chemicals play a role in the emergence and maintenance of neuropathic pain, which is strongly correlated with common clinical challenges, such as chronic pain and depression. However, the mechanism underlying its occurrence and development has not yet been fully elucidated, thus rendering the use of traditional painkillers, such as non-steroidal anti-inflammatory medications and opioids, relatively ineffective in its treatment. Astrocytes, which are abundant and occupy the largest volume in the central nervous system, contribute to physiological and pathological situations. In recent years, an increasing number of researchers have claimed that astrocytes contribute indispensably to the occurrence and progression of neuropathic pain. The activation of reactive astrocytes involves a variety of signal transduction mechanisms and molecules. Signal molecules in cells, including intracellular kinases, channels, receptors, and transcription factors, tend to play a role in regulating post-injury pain once they exhibit pathological changes. In addition, astrocytes regulate neuropathic pain by releasing a series of mediators of different molecular weights, actively participating in the regulation of neurons and synapses, which are associated with the onset and general maintenance of neuropathic pain. This review summarizes the progress made in elucidating the mechanism underlying the involvement of astrocytes in neuropathic pain regulation. As a result, astrocytes potentially transmit calcium waves and participate in the dissemination of various long-distance signaling molecules. Astrocytes also form a physical barrier around synapses, thus \u201cshielding\u201d them from glutamate overflow while simultaneously providing metabolic support. Furthermore, owing to their proximity to synapses, astrocytes modulate the local intervening ionic and chemical environment during synaptic formation and propagation. Thus, astrocytes play a pivotal role in governing synaptic formation, maturation, removal, and maintenance as well as supporting synaptic activity via a combination of diffusible and interaction factors. Loss-of-function disorders of astrocytes may constitute the basis of various forms of neurological dysfunction and pathology, including trauma, stroke, multiple sclerosis, and Alzheimer\u2019s disease  to the sciatic nerve , partialIn the CNS, glial cells outnumber neurons by a factor of 10\u201350, predominantly including astrocytes, microglia, and oligodendrocytes . Astrocyin vivo non-traumatic approaches , astrocytes have been thoroughly studied, and their roles encompass a broad variety of dynamic physiological compositions and functionalized features: water and ion homeostasis, metabolic specialization, and brain oxidation  or hours  to follow also exist. Longer activation states, such as astrogliosis, may require longer periods of time, such as tens of hours or even days to appear .Astrocytes are generally believed to regulate pain mainly through the following three activation states: (1) changes in glial signaling pathways, such as changes in the phosphorylation level of mitogen-activated protein kinase (MAPK) and expression of transcription factors; (2) changes in the expression of receptors and channel proteins, such as the upregulation of inflammatory factor receptors and gap junction proteins and downregulation of glutamate transporters; and (3) continuous production and excretion of various glia-derived factors, such as cellular factors, chemokines, and proteinases .via obstructing a glial cell enzyme in the astrocytic Krebs cycle. Several mouse models of pain that had undergone intrathecal injection of FC or fluoroacetate demonstrated relief from pain sensation  inhibitors AG490 and JAK inhibitor I to the spine resulted in the inhibition of astrocyte proliferation during astrocyte restriction and STAT3 activation. Furthermore, the inhibition of astrocyte proliferation by JAK-STAT3 signaling inhibitors potentially leads to the recovery of haptic pain . Therefoin vitro studies have also confirmed that miR-135-5p potentially inhibits the JAK2-STAT3 signaling pathway in bone cancer pain, and histological staining has proven that miR-135-5p can directly interrupt the activity process of JAK2 and its upstream and downstream molecules in astrocytes (via the modulation of astrocyte activation.Some experiments have demonstrated that the proliferative capacity of astrocytes intervened by AG490 or with STAT3 defects is reduced to a certain extent . Liu et trocytes . These sOligodendrocyte transcription factor 2 (Olig2) is an essential transcription factor required for the proliferation and derivation of developmental astrocytes. Olig2-labeled subsets of astrocytes have been detected in clusters and in greater numbers in certain fixed zones of the thalamus, midbrain, and spinal cord of rodents . By ablaTransforming growth factor betas (TGF-\u03b2s), as versatile growth factors, are involved in critical events in the body that regulate growth, illness, and wound healing. TGF-\u03b21 has been extensively known to be a cytokine implicated in injury, especially in the activation of astrocytes and scar production . TGF\u03b2 isAs a member of the Ras homolog gene family, the small G protein RhoA is widely expressed in astrocytes and participates in cytoskeletal regulation together with its downstream effector Rho-dependent kinase (ROCK) by regulating myosin and actin . The expMany signaling molecules exist in astrocytes, including intracellular kinases, channels, receptors, and transcription factors, exhibiting pathological changes and playing a role in pain regulation after injury.The MAPK family, which is composed of P38, extracellular signal-regulated kinase (ERK), and C-Jun N-terminal kinase (JNK), plays a crucial role in pain regulation . DifferePhosphorylated ERK has been observed in spinal astrocytes during the late stage of pain induced by complete Freund\u2019s adjuvant . In an eJanus kinase has been shown to engage in the regulation and sustainment of nociception by astrocytes after nerve damage . P-JNK iTo date, relatively few ion channels and receptors that are involved in the activation of astrocytes, thus ultimately leading to the development of neuropathic pain, have been identified .Toll-like receptor 4 (TLR-4) is widely present throughout astrocytes. Overexpression of the high mobility group box-1 (HMGB1) protein potentially downregulates the paw withdrawal mechanical threshold and paw withdrawal thermal latency in CCI rodents by enhancing the activation of astrocytes, the TLR4/NF-\u03baB axis, and its upstream and downstream molecules, resulting in the enhancement of neuropathic pain . A subjeA shortened isomeric form of tyrosine receptor kinase B (TrkB) has recently been found to be implicated in the pathological process of neuropathic pain . The TrkConsidering the prevalence of neuropathic pain and incurable suffering associated with it, the study of ion channels and receptors associated with astrocytes is a potentially new opportunity to bring hope to affected people worldwide. AV411 (ibudilast), an antagonist of TLR4, is currently undergoing phase II clinical trials and has previously been shown to exert satisfactory efficacy in various models of neuropathic pain by inhibiting cytokines produced by glial cells as well as promoting the production of the anti-inflammatory cytokine IL-10 and neurotrophic factors . This prAstrocytes form a network of gap junctions through Ca2+ signals in the form of calcium oscillations . The maiAstrocytes regulate neuropathic pain by releasing a series of mediators of different molecular weights. Macromolecular mediators are represented by cellular factors , chemokines , growth factors , and proteases , among others. Small molecular media predominantly comprise glutamic acid and ATP, among others. These mediators actively participate in the regulation of neurons and synapses and are inextricably linked to the onset and maintenance of neuropathic pain.IL-1\u03b2 is a well-known proinflammatory cytokine. IL-1\u03b2 upregulation has been observed in spinal cord astrocytes following peripheral nerve lesions. Increasing evidence suggests that IL-1\u03b2 is involved in pain sensitivity . IntrathChemokines, a specific group of cell factors possessing over 50 family components, are widely believed to exist in the blood and immune system and have recently been found to be widespread in the CNS and particularly active in astrocytes . ChemokiCCL3 has also been found to cause neuropathic pain through IL-1\u03b2 upregulation . CXCL1, Proteases expressed in astrocytes, such as matrix metalloproteinases (MMPs) and tissue-type plasminogen activators (tPAs), have been found to play a key role in the development of neuropathic pain driven by astrocytes . DiffereAs an extracellular serine protease, tPA participates in the regulation and revision of tissue components located outside the cell, leading to alterations in neuroplasticity . One stuGABA) and decreased conductance of presynaptic gamma-aminobutyric acid (GABA). These provide BDNF the ability to enhance the synaptic activity of excitatory neurons, thus promoting the development of neuropathic pain , which play a key role in nociceptive regulation . Belief CCL2 and CXCL1 have been found to be expressed in spinal cord astrocytes, act on CCR2 and CXCR2 in spinal cord neurons, and thus potentially play a role in increasing excitatory synaptic transmission. Studies on electrophysiological aspects found CCL2 to immediately enhance NMDA-induced currents and increase the frequency of excitatory postsynaptic currents in spinal cord lamina II neurons. Co-stimulation of spinal cord neurons with CCL2 and GABA resulted in a dose-dependent and rapid decrease in GABA-induced inward currents . CCL7 m. These fvia astrocytes may emerge as a new alternative for affected patients. In fact, several experimental studies are already underway. Dexmedetomidine has been found to effectively inhibit HMGB1-mediated astrocyte activation and the TLR4/NF-\u03baB signaling pathway in CCI rats and successfully relieve neuropathic pain in rats , and some anticonvulsants. These drugs only provide pain relief but do not completely eradicate neuropathic pain, and they often produce a number of side effects . Other a in rats . Koumine in rats . Triptol effects . All theTo conclude, astrocyte activation and the changes in the signaling pathways and molecular mechanisms involved in the spinal cord and supraspinal structures contribute indispensably to the progression and sustainment of neuropathic pain. Elucidating the mechanism underlying astrocyte activation is of great significance to the progress and development of pain management worldwide. Currently, the exploration of new targeted pain treatments in the wake of opioid overdependence and overuse is of particular importance. Research on the role played by astrocytes in neuropathic pain is expected to realize the clinical transformation of animal experimental research, which is of great significance for human happiness and quality of life.XM: conceptualization, writing-reviewing, and editing. TC: writing-original draft preparation. ZX: supervision. All authors have approved the final version of the manuscript to be submitted."}
{"text": "Older patients are increasingly showing multi-comorbidities, including advanced chronic diseases. When admitted to the emergency department (ED), the decision to pursue life-prolonging treatments or to initiate a palliative care approach is a challenge for clinicians. We test for the first time the diagnostic accuracy of the Supportive and Palliative Care Indicators Tool (SPICT) in the ED to identify older patients at risk of deteriorating and dying, and timely address palliative care needs.We conducted a prospective bicentric cohort study on 352 older patients (\u2265\u200975 years) admitted to two EDs in Belgium between December 2019 and March 2020 and between August and November 2020. SPICT  variables were collected during the patients\u2019 admission to the ED, along with socio-demographic, medical and functional data. The palliative profile was defined as a positive SPICT assessment. Survival, symptoms and health degradation  were followed at 12 months by phone. Main accuracy measures were sensitivity, specificity and likelihood ratios (LR) as well as cox regression, survival analysis using the Kaplan Meier method, and ordinal regression.Out of 352 patients included in the study , 167 patients (47%) had a positive SPICT profile. At one year follow up, SPICT positive patients presented significantly more health degradation (72%) compared with SPICT negative patients . SPICT positivity was correlated with 1-year health degradation . The sensitivity and specificity of SPICT to predict health degradation were 0.65  and 0.72  respectively, with a negative LR of 0.48  and a positive LR of 2.37 (1.78\u20133.16). The survival time was shorter in SPICT positive patients than in SPICT negative ones (p\u2009<\u20090.001), the former having a higher 1-year mortality rate .SPICT successfully identifies older patients at high risk of health degradation and death. It can support emergency clinicians to identify older patients with a palliative profile and subsequently initiate a palliative care approach with a discussion on goals of care. The benefits of a palliative care approach are well known. It increases patients\u2019 chance of passing away in the comfort of their own home, improves the quality of life and alleviates burdensome symptoms such as depressive symptoms and pain \u20136. PatieUp to a quarter of ED patients are aged 65 and over . Older pInitiating a palliative care approach remains a challenge in EDs. It is difficult for emergency clinicians to decide whether to pursue invasive and uncomfortable life-prolonging treatments or to reassess intensity of treatment and consider a palliative care approach . For somInitiating a palliative care approach in EDs is not much studied, but presents interesting results such as shortened hospital stay , reducedHowever, a major challenge in implementing a palliative care approach is to identify which patients might benefit from such care. There is a lack of consensus about the illness stage from which it is advisable to initiate palliative care for each specific disease . TransitSeveral tools aim to identify patients who might benefit from a palliative care approach , 30. TheThe aim of this study is to assess the SPICT accuracy to predict 1-year health degradation and death in older patients admitted to ED.The paper is reported following the STROBE statement.www.spict.org.uk. Permission to use it was obtained.The aim of the study is to assess the SPICT  accuracy to predict 1-year health degradation and mortality while used during an ED admission of older patients aged 75 years old or more. The SPICT is a tool composed of 6 general indicators of health deterioration and 23 indicators of severity of specific-diseases which aim at identifying patients with a palliative profile . SPICT aWe conducted a prospective cohort study in the emergency department of two tertiary Belgian hospitals between end-December 2019 and November 2020. The patient\u2019s inclusion lasted 6 months in total, with an interruption between mid-March to mid-August 2020 due to the Covid-19 pandemic.All French speaking patients of 75 years old or more admitted to ED were eligible for the study. Patients unable to give consent were included if their legal representative approved the participation. We excluded dying patients or patients previously included in the study. Dying patients were defined as likely to die within 24\u00a0h following admission to the ED.Three researchers collected data during office hours (8 am to 6 pm). Training and supervision on data collection was performed before and during the whole period to ensure the quality and homogeneity of data collection. The supervision was realised by the main investigator who is a geriatrician (IDB) and included weekly discussions on patient inclusion and random checks of SPICT completion based on medical records.The researchers carried out face-to-face interviews with the patient or their legal representative during ED admission to obtain data on demographic, psycho-social characteristics, functional status using Katz , Lawton From the beginning of the COVID-19 pandemic, we did not include patients admitted in COVID-area of the ED for practical and security reasons.The principal researcher (DB) followed-up patients by phone at 12 months after ED admission. Data collected in the follow-up calls were mortality , functional status (Katz), place of residence in the last 3 months of life, number of readmissions , palliative care in the last 3 months and symptoms  .The main outcome measure is health degradation. Health degradation is a composite outcome that intends to be more comprehensive than mortality alone, as mortality has its limits in justifying a palliative care approach. Health degradation combines the Katz score, the institutionalisation in a nursing home and mortality. Health degradation is a categorical variable with three levels. Score 1 corresponds to an improvement or constancy in the person\u2019s health status . Score 2 corresponds to a decrease in functional capacity according to the Katz scale  or to a patient being institutionalized. Score 3 corresponds to death.The palliative profile was defined by a positive SPICT assessment, i.e. when at least one general and one disease specific indicator of the SPICT were identified . The indContinuous variables were described using mean and standard deviation. Categorical variables were described using the number and their percentage. Comparisons of patient characteristics, between patients with or without a palliative profile, were assessed with t-test for continuous variables and Chi-squared for categorical variables. Symptoms at 1 year after ED admission were compared between groups with and without a palliative profile with a non-parametric median test for independent groups, corrected for Yates continuity.The accuracy of SPICT to predict 1-year health degradation and death is assessed by sensitivity, specificity, likelihood ratio, positive and negative predictive values and the overall accuracy (proportion correctly classified). To perform these analyses, the variable \u201chealth degradation\u201d was binarised, i.e., no health degradation (0\u2009=\u2009score 1) and health degradation (1\u2009=\u2009score 2 or 3). Association between SPICT and health degradation (3 levels variable) was assessed through a 3-level ordinal regression, adjusted for age (continuous variable) and gender . A multi-variable cox-regression was used to assess the association between SPICT and 1-year mortality, also adjusted for age (continuous variable) and gender . A survival analysis was performed on mortality using Kaplan Meier method.The statistical analyses were computed using IBM SPSS software V27 and NCSS 2021.The Ethical Committees of the two participating hospitals gave their agreement. The study registered number is B403201941609. Informed consent was signed before any data collection by the patients and/or their legal representative.The flowchart for the inclusion of patients in the study is presented in Fig.\u00a0The mean age of our participants was 83 years old. Of the 352 patients included, 43% n\u2009=\u2009150) were male and 49% (n\u2009=\u2009172) were living in partnership. Wishes for end-of-life care or DNR code was known for 2.3% (n\u2009=\u20098). Results of advance care planning weren\u2019t available for any patient. The main diagnoses (ICD-10CM chapters) at admission to ED were \u2018abnormal signs\u2019 (23%), circulatory system (19%), injury and other consequences of external causes (15%) and digestive system (9%)  had a palliative profile, i.e. a positive SPICT assessment. Patients with a palliative profile were significantly older  with a higher proportion of patients aged 85 or more . They more often lived in nursing homes  and received more formal or informal care . Patients with a palliative profile were more dependant for daily activities  and for the instrumental activities of daily living (iADL)  which means their functional status was poorer. They had more often comorbidities  and used more medications . During ED admission, patients with a palliative profile got more treatment limitations . After ED admission, patients with a palliative profile were more often hospitalised , and died significantly more at 6-month  and 12-month   Table\u00a0.2\u2009=\u200934.0, p\u2009<\u20090.001)   and they presented significantly more health degradation 72%) compared the non-palliatives ones . Most deaths occurred in the first 6 months after the ED admission. The odds ratio of health degradation was 5 times greater and the hazard ratio of death was 4 times greater for older patients with a palliative profile compared to the non-palliative ones. The results of the diagnostic accuracy of the SPICT were moderate in predicting 1-year health degradation (AUC: 0.69) and death (AUC: 0.65). Our preliminary analyses showed that using health degradation instead of death improved slightly the overall accuracy of the SPICT, the specificity (0.72 vs. 0.61), the positive LR (2.37 vs. 2.00) and the positive predictive value (0.72 vs. 0.37). However, it reduces the sensitivity (0.65 vs. 0.77)  0.82, sensitivity 0.82, specificity 0.49 ; AUC 0.7The main objective of the SPICT is to support clinician to early identify patient at risk of health degradation and death, who may benefit from palliative care approach, which is a major difficulty for clinicians (41). In our study we found that patients with a positive SPICT assessment have 72% risk of health degradation within the year. The overall accuracy of 69% to predict health degradation is satisfying. In addition, the SPICT positive patients surviving after one year have exacerbated symptoms compared to SPICT negative patients. These elements should alert clinicians to think about palliative care and adapt their routine of care in ED. The early identification of patients who might need palliative care is important for patients who will gradually present health degradation and die in the next months. SPICT can sensitise the ED clinicians on early palliative care which is not reserved for the very end-of-life (last days or weeks of life) and which is also appropriate for other chronic conditions than cancerous diseases . When a A strength of our study is our main outcome measure \u201chealth degradation\u201d and the symptoms assessment during follow-up, while most studies on the SPICT measures death as main outcome. In testing SPICT within EDs, we tried to conciliate two \u201ca priori\u201d opposite logics of care, namely palliative care and urgent-life sustaining care. Research on palliative care in ED and their guidelines are quite rare and recent .The impact of covid-related deaths was not assessable because the cause of death was missing in 36% of the patients due to the follow-up by phone calls. For the other patients, covid was incriminated in 11% of cases (data not shown).Our cohort of old patients admitted in ED may differ from the entire population. We included patients during office hours, we collected data on patients we could not include during our shift. We do not have information about the patient\u2019s characteristics outside office hours.SPICT successfully identifies older patients at high risk of health degradation and death within one year. SPICT could be an interesting tool to support emergency clinicians to identify older patients with a palliative profile and subsequently initiate a palliative care approach with a discussion on the goals of care. Further research is needed to assess the feasibility of implementing SPICT and the ED\u2019s role in early introduction of a palliative care approach."}
{"text": "The GEMA presented good practicality, acceptability, and evidence of specificity regarding the stability of the INR. The validity of the construct was partially supported by the relationship with self\u2010reported measures of adherence.Although self\u2010report instruments are currently considered a valuable tool for measuring adherence, due to their low cost and ease of implementation, there are still important factors that impact measurement accuracy, such as social desirability and memory bias. Thus, the Global Assessment of Medication Adherence Instrument (GEMA) was developed to provide an accurate measure of this construct. The aim of this study was to evaluate the properties of the measurement of the Global Evaluation of Medication Adherence Instrument (GEMA) among patients with chronic diseases. A methodological study was conducted in the public hospital of the state of S\u00e3o Paulo, Brazil. The adherence to anticoagulants as well as the international normalized ratio (INR) was assessed on 127 patients. Besides GEMA, two other instruments were used to assess adherence: the Morisky Medication Adherence Scale\u20108 (MMAS\u20108) and the Measurement of Adhesion to Treatments (MAT). The GEMA presented a satisfactory level of specificity (0.76) to identify adherents among those with a stable INR, low sensitivity (0.43) for the identification of non\u2010adherents among those with an unstable INR, and a Positive Predictive Value of 0.70. Positive and weak to moderate correlations were observed between the proportion of doses assessed with GEMA and the scores on the MMAS\u20108 ( COSMINConsensus\u2010based Standards for the Selection of Health Measurement InstrumentsGEMAGlobal Assessment of Medication Adherence InstrumentINRInternational Normalized RatioMATMeasurement of Adhesion to TreatmentsMMAS\u20104Morisky Medication Adherence Scale\u20104MMAS\u20108Morisky Medication Adherence Scale\u20108NCDsNo Communicable DiseasesNPVNegative Predictive ValueOACOral AnticoagulantsPPVPositive Predictive ValueTTRTime in therapeutic range1In the treatment of chronic no communicable diseases (NCDs), adherence to medication use has been associated with optimization of clinical outcomes, especially better disease control, reduction of hospitalizations, mortality, and health care costs.Theory of Self\u2010care of Chronic Illness, self\u2010care can be defined as a process of health maintenance by means of health practices and disease management, which can be applied to health and disease situations.Medication adherence is one of the most complex self\u2010care behaviors in the treatment of NCDs.Nurses have a central role in promoting self\u2010care,There are several difficulties in measuring adherence.Morisky Medication Adherence Scale (MMAS) consisting of four items (MMAS\u20104)Several self\u2010report scales that measure adherence in chronic diseases are available in the literature.Global Evaluation of Medication Adherence Instrument (GEMA)In order to provide an accurate measure of medication adherence, the This new instrument seeks to fill the gaps in the literature regarding the imperfections of self\u2010report measures.22.1This was a methodological study outlined according to the COnsensus\u2010based Standards for the selection of health Measurement Instruments\u2014COSMIN2.2The study included 127 adult patients taking OAC in an outpatient follow\u2010up service. Patients who had been using OAC for at least 6\u2009months were included. Patients whose OAC dosage was modified in the last month prior to the interview, who presented hemorrhagic or thromboembolic complications in the last 3\u2009months, or who underwent surgery in the last 6\u2009months prior to the interview were excluded.2.3The sample size was calculated with the aim of estimating the sensitivity of the tool for assessing overall medication adherence. Sensitivity, in the present study, can be defined as the probability of an individual being classified as adherent by means of the global adherence assessment instrument, given that he/she has been classified as adherent by the gold standard instrument . To carry out the sample calculation, estimates of sensitivity, specificity and prevalence were obtained from a pilot sample composed of 50 subjects. In addition, a significance level of 5%, a test power of 80% and a sensitivity value equal to 0.50 were established as a null hypothesis. From the pilot sample, estimates of sensitivity, specificity and prevalence equal to 0.65, 0.57 and 0.86 were obtained, respectively. The results indicated a sample of 105 subjects. Considering a loss rate of 20%, the final sample will consist of 127 participants.2.4Data were obtained by means of interview, using instruments. The results of the last three INR dosages, and the individual therapeutic goal recommended for each patient, were obtained from the medical record.2.5Instrument of sociodemographic and clinical characteristics: was developed in a previous study2.5.1Part I: Completed by the interviewer, in order to transcribe the OAC prescribed, and in use by the patient, considering the dose, the dosing schedule (number of tablets/day), how to use it, , as well as calculating the total pills taken per day , care taken when taking the OAC, the proportion of adherence, and classification of care, in the past day, past week and past month. Items regarding medication intake in the previous day and week, were aimed at minimizing memory bias. The percentage of adherence to the prescribed dose is estimated considering the dose prescribed and the dose missed or taken beyond prescribed according to the calculation: ([prescribed doses\u2212wrong doses]\u2009\u00d7\u2009100/prescribed doses). Considering that the use of OAC than those prescribed does not result in adherence, the adherence results higher than 100% are converted by subtracting the percentage related to the over dosage, as shown below: 120% adherence, subtraction of the overdose (20%) resulting in adherence (100%\u201320%\u2009=\u200980%).2.5.2Is composed of eight items: seven with dichotomous answers (yes/no), and one Likert\u2010type item .2.5.3The Measurement of Adherence to Treatments (MAT) consists of seven items that evaluate the daily behavior of medication intake, and whether the patient stopped taking the medications, for any reason. These items were adapted from other adherence measures. The Brazilian version of the MAT was adapted in patients using OAC,2.5.4In order to determinate of the stability of the INR, three INR dosage results, performed up to 4\u2009months prior to and on the day of the interview, were used to calculate INR stability2.6p\u2010value lower than .0167 was considering after applying the Bonferroni correction to the significance level in the McNemar's test. The Bonferroni correction in the significance level was applied because the same comparison was done in each of the three time points . To the remaining tests the significance level was of 5%. The Shapiro\u2013Wilk test was applied to evaluate the data distribution.Sociodemographic/clinical characteristics and adherence data were submitted to descriptive analysis. Friedman's ANOVA test was used to identify the differences in adherence ratios estimated by GEMA on the past month prior to the interview, using Dunn\u2013Bonferroni post\u2010test to locate the differences. The McNemar's test was used to compare adherent and non\u2010adherent individuals the previous day, the past week, and the past month prior to the interview. A Practicality and acceptability: Evaluated by the mean time spent administering the questionnaire, and by the percentage of respondents who answered all the items, respectively.Sensitivity, specificity, PPV and NPV: The sensitivity and specificity of the GEMA, MMAS\u20108 and MAT in relation to the INR stability, the clinical reference pattern for assessing the level of anticoagulation, were tested. Sensitivity was defined as the proportion of patients who were classified as non\u2010adherent in the instruments among all patients that were classified as having an unstable INR (by means of the INR stability criteria). Specificity was defined as the proportion of patients who were classified as adherent among all patients that were classified as having a stable INR. The PPV was defined as the proportion of patients who were classified as having an unstable INR among all patients that were classified as non\u2010adherent. The NPV was defined as the proportion of patients who were classified as having a stable INR among all patients that were classified as adherent.Construct validity: It was tested considering the hypothesis that the global adherence measure provided by the GEMA and the measurements of the MAT and MMAS\u20108 evaluate related but not identical constructs. This validity was estimated by the relationship between the percentage of doses (past month) of GEMA and MAT and MMAS\u20108 scores. The Spearman correlation coefficient was used; the magnitude of the correlations was considered: weak for correlations close to 0.29; moderate for correlations between 0.30 and 0.49; and strong for those with correlations >0.50.Convergence construct validity was also tested by agreement between the GEMA\u2014global evaluation adherence (percentage of doses and care taken in medication intake) and the adherence score obtained by the MAT and the MMAS\u20108. It was assumed that the GEMA evaluates adherence based on the proportion of medication effectively taken according to medical prescription as well as on medication\u2010taking self\u2010care to classify patients into adherents and non\u2010adherents. MAT and MMAS\u20108, in turn, are based on factors related to nonadherence to proceed the classification. Thus, as the tools are not measuring the same factors underlying adherence, agreement of weak or moderate magnitude were hypothesized between the classifications of adherents and non\u2010adherents by GEMA (past month), and those based on the MAT and the MMAS\u20108. The Kappa coefficient was used, considering: poor agreement <.00; negligible\u2009=\u20090.00\u20130.20; weak\u2009=\u20090.21\u20130.40; moderate\u2009=\u20090.41\u20130.60; strong\u2009=\u20090.61\u20130.80; and almost perfect\u2009=\u2009081\u20131.0.A significance level of 5% was adopted for these analyses.3The sample consisted of 50.4% women, married (63.8%), aged 56.5 (12.1) years, with 5.5 (3.7) years of study, unemployed (65.4%), and with a mean monthly family income of 2.6 (2.2). The sample presented about 1.9 (1.3) clinical conditions associated and mean time of anticoagulation was 55.5 (51.8) months.3.1The descriptive data for adherence measurements are presented in Table\u00a0p\u2009=\u2009.0027 and <.0001, respectively, McNemar's test).The values of adherence provided by GEMA presented a progressive reduction as the period of reference of the measure passed from the day prior the interview to the last past month. These differences were significant to the proportion of patients classified as adherents 84.2% (107); 72.4% (92) 65.3% (83)  were considered unstable in relation to the individual therapeutic goal. The mean stability of INR was 44.1% (34.7).3.2Regarding practicality, the application of GEMA by interview took a mean time of 3.6 (1.6)\u2009min. Regarding acceptability, the rate of responses for the items was 100%.The sensitivity and the specificity of the GEMA in the past month were tested against the INR, considering its stability in the last three measurements, according to the indicated therapeutic goal.It was observed that GEMA is specific (0.76) for detecting the proportion of people who were adherent among those with a stable INR, but the GEMA is less sensitive (0.43) for detecting who was non\u2010adherent among those with an unstable INR. In other words, among the patients with a stable INR, most are assessed as adherent; among those with the non\u2010stable INR, although there are more adherents than non\u2010adherent's patients, there is a good concentration of non\u2010adherent patients. The GEMA also presented a PPV of 0.70 and NPV of 0.52.It was verified that the performance of the GEMA is more consistent with the stability and instability results of the INR, when compared to the other adherence measures used in the present study. The MAT does not distinguish between adherence and non\u2010adherence among patients who present stable and unstable INR, as it classifies the expressive majority as adherents. The MMAS\u20108 performs more similarly to GEMA, but among patients with stable INR, most patients are considered non\u2010adherent. The limits of both tools (MAT and MMAS\u20108) in detecting those who were non\u2010adherent seems to be related to an overestimating of adherence in the studied sample Table\u00a0.3.3The convergent construct validity was tested by correlation between the adherence ratio, estimated by proportion of doses of the GEMA, and the adherence scores obtained by MAT and MMAS\u20108. Positive low magnitude correlations were expected between the percentages of doses obtained  and the adherence scores of the MAT and MMAS\u20108 Table\u00a0.r\u2009=\u2009.30) and in the past week (r\u2009=\u2009.22), estimated by the GEMA and MAT scores. Correlations of low magnitude were identified between the proportion of GEMA adherence in the past week, and the total score of MMAS\u20108 (r\u2009=\u2009.26), and in the month prior to the interview . The agreement among GEMA and the adherence classification of the MMAS\u20108 was higher, according Landis & Koch,4The study aimed to evaluate the properties of measurement of the GEMA instrument, when administered to outpatients in use of OAC.The application of GEMA by interview seems to be relatively fast, even with the need of thinking about the use of the medication in three different periods, what reinforces the acceptability of the tool. The short time of application of instrument is an important aspect, especially in patients with chronic diseases, whose treatment involves several simultaneous evaluations. Consequently, the use of measurement with a long time of application can imply in the commitment of the dynamism in the care of these patients.The rate of responses to the items was 100%, although it could be facilitated by the mode of interview. With the sample population, the interview was the choice for the application of the tool due to the low level of schooling. It would be interesting in further studies to analyze the potential of self\u2010administration of the tool.Regarding, the GEMA sensitivity, specificity, PPV and NPV analyses, in relation to INR stability, considered as the clinical reference measure, the data showed that the GEMA is an instrument capable of identifying those who are adherent among those who had a stable INR. There was a limited ability noted to identify individuals who were non\u2010adherent among those with unstable INRs, which makes it possible to classify a large proportion of individuals with unstable INRs as non\u2010adherent (PPV\u2009=\u20090.70).However, the GEMA presents an overall better performance to the Brazilian versions of MAT and MMAS\u20108, considering that MAT seems to overestimate adhesion, while MMAS\u20108 overestimates non\u2010adhesion, and a possible explanation is that both instruments (MAT and MMAS\u20108) do not consider self\u2010care, which includes the assessment of adequate dose implementation, schedule, time frames associated with taking the OAC, and adoption of specific care. On the other hand, the MMAS\u20108 showed a slightly higher sensitivity to INR stability than the GEMA, that is, a better ability to identify those who were non\u2010adherent among individuals with unstable INR, but with limited capacity to identify who was adherent among those with stable INRs.A Korean validation study of the MMAS\u20108, which adherence to antihypertensive medication was classified as low (score <6) and medium/high adherence (score \u22656), showed sensitivity, specificity, PPV and NPV in relation to blood pressure measurement of 64.3%, 72.9%, 29.5% and 92%, respectively. However, when the classification of low and medium adherence (score <8) and high adherence (score\u2009=\u20098) were used, the MMAS\u20108 presented sensitivity, specificity, PPV and NPV of 82.1%, 36.9%, 18, 7% and 92.1%, respectively.In contrast, in the MMAS\u20108 validation study performed in Singapore that considered those with a score <8 to be non\u2010adherent, and which used the time in therapeutic range (TTR) of the INR as the gold standard, the sensitivity, specificity, PPV and NPV results were 73%, 35.6%, 49.5% and 60.5%, respectively,GEMA performs better probably because it considers factors that describe behavior more than the other two measures, which are based on factors that influence adherence and the establishment of arbitrary cutoff points.The convergent construct validity of the GEMA, tested by means of the ratio between the proportion of doses , and the MAT and MMAS\u20108, showed significant positive correlations between low and moderate magnitude between the estimated proportion of GEMA in the past month prior to the interview, and the MAT and MMAS\u20108 scores, partially supporting the validity convergent construct of the GEMA.As to the agreement between the global adherence (proportion and care) of the GEMA and the Brazilian versions of the MAT and MMAS\u20108, used to test validity, showed a negligible agreement with the MAT and weak agreement with the MMAS\u20108, according to the Brazilian classification, which corroborates the hypothesis that the MAT and MMAS\u20108 instruments measure related constructs, but not concepts that are identical to the GEMA adherence measure. The MMAS\u20108 items evaluate different aspects related to nonadherence, while the GEMA, when measuring the percentage of doses and the care taken in the medication, deviates the focus away from nonadherence factors. In fact, these factors are investigated among patients classified as non\u2010adherent, but are not considered in the measurement of the adherence measure provided by the GEMA, which may have contributed to the poor agreement obtained among the instruments.The findings obtained with the use of GEMA suggest that the search in one's memory for the behavior of adhering to medications at different moments in time, that is, from the day before the interview to the past month , enable more accurate measurement, evidencing an important role of the GEMA in reducing memory bias in adherence measurement.Gagn\u00e9 and Godin consider that memory bias should be minimized by specifying the period of time for questions that investigate nonadherence.The measurement provided by GEMA has potential applications for clinical and research practice. With regard to clinical implications, this instrument can be used to identify specific situations in different chronic conditions, related to the proportion of adherence and self\u2010care in taking medication as prescribed by the physician, thus enabling health professionals to direct actions toward promoting adherence to pharmacological treatment.As a research tool, the medication adherence construct provided by GEMA could be a valuable variable of outcome, which could be measured over time in response to a behavioral, cognitive or educational intervention, providing evidence on the effectiveness of different strategies for promoting health. Thus, the instrument can be used in studies that aim to deepen knowledge about the mediating and/or moderating variables of this complex behavior.In the present study, limitations such as the administration of the GEMA by means of interview can contribute to overestimation of adherence; the small sample size may also have influenced the findings. We recommend continuity of investigation on the GEMAS's measurement properties, especially the refinement of its validity, analyzing the relationship with direct measurement of adherence\u2014concentration of the medicine or its metabolite in body fluids and/or the use of biological markers.5In conclusion, GEMA is a practical instrument, easy to administer by means of interviews, with little time and resources required for its administration. In addition, this measurement presents evidence of acceptable, sensitivity and specificity considering self\u2010reported measures of adherence available in the Brazilian culture (MMAS\u20108 and MAT). The GEMA is a sensitive and specific tool regarding the stability of the INR. Construct validity was partially supported by significant positive correlations of low to moderate magnitude between the mean proportions of doses of the GEMA and scores of the MAT and MMAS\u20108.Mariana Dolce Marques, Rafaela Batista dos Santos Pedrosa, Henrique Ceretta Oliveira, Maria Cec\u00edlia Bueno Jayme Gallani, Roberta Cunha Matheus Rodrigues participated in research conception and design. Mariana Dolce Marques, Rafaela Batista dos Santos Pedrosa, Henrique Ceretta Oliveira collected and assembled the study data, and execute the study including informed consent. Mariana Dolce Marques, Rafaela Batista dos Santos Pedrosa, Henrique Ceretta Oliveira, Maria Cec\u00edlia Bueno Jayme Gallani, Roberta Cunha Matheus Rodrigues considered the study result and method of analysis. Mariana Dolce Marques, Rafaela Batista dos Santos Pedrosa, Henrique Ceretta Oliveira, Maria Cec\u00edlia Bueno Jayme Gallani, Roberta Cunha Matheus Rodrigues provided final approval of the manuscript. Henrique Ceretta Oliveira performed the statistical analysis. All authors read and approved the final manuscript.The authors report no conflicts of interest in this work.The authors confirm that the research carried out in this study was conducted in accordance with the ethical guidelines and regulations of their institution. The study was approved by the Ethics Committee of the University in the state of S\u00e3o Paulo, Brazil (document no. 928.775) and the enrolled patients signed the Informed Consent Form. Confidentiality and anonymity of the participants were maintained throughout the study, and any personal information was protected in accordance with institutional policies and regulations."}
{"text": "Although there is great emphasis on nursing care interaction, there is a lack of knowledge about the quality of nurse-patient care interactions in Iran. The lack of knowledge is mainly related to a lack of short Persian instruments that measure nurse-patient interaction from a caring perspective. The present study aimed to validate a Persian version of the nurse and patient versions of the Caring Nurse-Patient Interaction scale (CNPI-23).The scale (CNPI-23) was translated to Persian using the forward-backward translation method. After translation and re-translation, the scale was given to 15 nurses and faculty members of Kerman University of Medical Sciences, and CVI and CVR indices were calculated based on their opinions. The analytical cross-sectional study was conducted in Kerman/Iran in 2022. In this study, 230 working nurses and 230 hospitalized patients in hospitals affiliated with Kerman University of Medical Sciences were recruited using the convenience method to complete the 23-item Caring Nurse-Patient Interaction scale. Exploratory and confirmatory factor analyses were used to analyze the validity of the scale, and Cronbach\u2019s alpha and Raykov\u2019s rho indices were also calculated to evaluate internal consistency and composite reliability. Data were analyzed using R 4-1-2 software.The scale was completed by 230 nurses and 230 patients. It included four dimensions: humanitarian care, clinical care, comforting care, and communication care. The results of the content validity ratio (CVR) and content validity index (CVI) were acceptable for all items. The minimum value of reliability was 0.49. All the items were approved at the end of the content validity assessment. In the patients\u2019 scale, these four factors explained 81% of the total variance, and for the exploratory model, all the indices show the adequacy of the model. All factor loadings were significant and higher than 0.5. Raycov\u2019s rho and Cronbach\u2019s alpha indices for all numbers were higher than 0.7. The findings of the exploratory factor analysis showed that the nurses\u2019 scale reflected four caring domains, which explained about 62% of the total variance, and the results of Raycov\u2019s rho and Cronbach\u2019s alpha indices confirmed the final fit of this model.In general, the Persian version of the Caring Nurse-Patient Interaction scale has good validity and reliability and can be used to evaluate the quality of care interaction between Persian-speaking nurses and patients. Nursing is a process of interpersonal interaction and care provision because every day, nurses encounter different patients and have to meet their varying needs and expectations . CommuniCare interaction is one of the most necessary skills in nursing practice, and the correct implementation of nursing interventions requires proper and correct interaction between nurses and other nurses, managers, and patients. Because effective interaction is among the important needs of the patient, it is considered the basis of nurses\u2019 work in caring for patients. The meaning of interaction is mutual respect for professional values and individual abilities using the knowledge and experiences of colleagues through asking for opinions and advice during decision-making . Caring The quality of nursing care means providing safe services that satisfy the patient according to nursing standards. Interactions are important sources for evaluating the quality-of-care interaction for the patient and the nurse, but most studies only address the patient\u2019s perspective . Nurse-pJean Watson\u2019s theory emphasizes how nurses care for patients, how care affects recovery, and how care enhances health. She describes care in nursing as a scientific, ethical, esthetic and professional process that involves physical, mental, psychological, and socio-cultural interactions between two people. She guides nurses to maintain a caring interaction with love, respect, and trust. Her goal is to help nurses create a treatment setting that meets the patients\u2019 needs. Her theory of human care enables nurses to improve the nurse-patient relationship . She lisThe Caring Nurse-Patient Interaction-Long Scale was created by Cossette et al. They created it to evaluate attitudes and behaviors connected to Watson\u2019s 10 factors. They made a shorter version  because the 70-item questionnaire was too long for clinical research, especially with very ill patients. The shorter scale has three caring domains that come from the original 10 factors [Some studies have used and psychometrically tested this scale in different languages. For instance, Calong et al. validated the scale among Filipino nurses , and ShaThe present study is an analytical cross-sectional study with validation and psychometric testing conducted in 2022 in Iran.The study was done in Kerman, Iran. Kerman is the largest province in Iran. The study recruited participants from three major hospitals affiliated with Kerman University of Medical Sciences.The statistical population of this study consisted of 230 working nurses and 230 patients hospitalized in hospitals affiliated with Kerman University of Medical Sciences in 2022. The researchers selected the patients and the nurses randomly by checklist.Inclusion criteria for nurses included having at least six months of clinical work experience and enough time to complete the scale.Inclusion criteria for patients included being hospitalized in the heart or general departments for at least three days, having a good general condition, reading and writing literacy in the Persian language, and consent to participate in the study.Exclusion criteria included failure to complete the scale (more than 10%) and having dementia or psychological problems according to self-report.The researchers translated and validated the Caring Nurse-Patient Interaction Scale (CNPI-23), This scale consists of 23 items rated using a five-point Likert scale from 1 (never) to 5 , which reflects four caring domains: humanistic care (questions 1 to 4), relational care (questions 5 to 11), clinical care (questions 12 to 20), and comforting care (questions 21 to 23). In the present research, two separate scales were used to examine the caring interaction from the patient\u2019s and nurse\u2019s perspectives, the patient\u2019s scale from the patient\u2019s point of view and the nurses\u2019 scale from the nurses\u2019 point of view, but the options of both scales were the same. Each question is stated positively, and the scores range from 23 to 115, with a minimum score of 23 and a maximum score of 115. A higher score indicates a higher quantity and quality of interaction between the nurse and patient [In the first step, the English version of the Caring Nurse-Patient Interaction scale was translated to Persian. The researchers of this study obtained permission from the author of the scale through email, and then the English scale was translated through forward-backward translation. At first, the researcher, whose native language was Persian and who had sufficient knowledge about the concepts raised in the scale, translated the English scale to Persian. It should be noted that more attention has been paid to the meaning of the translations for the patients than verbal similarity with the original . In the second stage, two faculty members of Kerman Razi Midwifery and Nursing Faculty who were familiar with Persian and English reviewed the instrument translation and discussed the inconsistencies between the original and the translated version, applied the necessary corrections, and translated it into English. In the next stage, the translation was checked by 15 faculty members of Kerman University of Medical Sciences and nurses with a master\u2019s degrees who were fluent in Persian and English for content validity and compatibility with Iranian culture. Then, the final corrections were made, and the scale was compiled.The statistical population of this study consisted of 230 working nurses and 230 patients. For each item, 10 people were recruited to complete the caring nurse-patient interaction scale. These samples were used for exploratory and confirmatory analysis. The researchers selected nurses and patients randomly. First, the researchers explained the aim of the study to them, and then the participants completed the scale.The psychometric properties of the scale were evaluated using the content validity index and the content validity ratio. A form including an explanation of the study topic and the objectives was prepared to check the content validity. Then, the experts, including 15 faculty members of Razi School of Nursing and Midwifery and nurses with master\u2019s degrees were asked to examine each area based on a three-part spectrum from the point of view of necessity , and then the CVR was calculated. Also, the experts panel evaluated the CVI of each item using the three criteria of simplicity , clarity , and relevance . After collecting the experts\u2019 opinions, the necessary corrections were made to the scale. The CVI of each item was calculated as the number of respondents giving a 3 or 4 rating divided by the total number of respondents. The validated scale was administered among the patients and nurses of selected hospitals of the Kerman University of Medical Sciences.P-values less than 0.05 were considered significant. Univariate normality was assessed through the Anderson-Darling test, and multivariate normality was evaluated using the Henze-Zirkler\u2019s test. Exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) was used for construct validity analysis for both groups of nurses and patients separately. Cronbach\u2019s alpha and Raykov\u2019s rho indices were calculated to evaluate internal consistency and composite reliability. The polychoric correlation coefficient matrix was used in exploratory factor analysis and varimax rotation was used to determine the dimensions. The KMO index was calculated and Bartlett\u2019s P-value was also calculated to evaluate the sufficiency of the data for exploratory factor analysis. The number of factors was examined using the scree plot. Confirmatory factor analysis was evaluated using the robust maximum likelihood method. Indices like X2/df, comparative fit index (CFI), Tucker-Lewis index (TLI), root-mean-square error (RMSE), and standardized root mean square residual (SRMR) were also used to determine the model\u2019s appropriate fit.Data were analyzed using R 4-1-2 software. Among the 230 patients and 230 nurses participating in this study, the average age of patients was 54.3 years old, and the average age of nurses was 37.22 years old. The number of participating female patients and nurses was slightly higher than males . The awareness level of patient communication methods among nurses was 66.5%, which is average, and 69.6% of nurses had completed patient communication or patient training courses. Among the patients, 36.5% had more than one underlying disease, and in about 40% of them, the disease started or was diagnosed about a year ago (Table\u00a0The results of the reliability ratio (CVR) and content validity index (CVI) were also evaluated, according to Lavshe\u2019s table. The minimum value of the reliability ratio for 15 experts was 0.49, which was acceptable for all items. At the end of the content validity check, all the items were approved.P-value for both scales showed that the exploratory factor analysis was suitable for the data . The present study indicated the Persian version of the Caring Nurse-Patient Interaction scale has good validity and reliability and can be used to evaluate the quality of the care interaction between Persian-speaking nurses and patients.Access to valid and reliable instruments for measuring caring nurse-patient interaction is considered the first requirement for planning and measures related to maintaining and improving the quality of nursing care . Due to The CNPI-23 is commonly used for measuring the caring nurse-patient interaction. The scale has been used in many countries \u201316. In SThe results of the content validity in present study showed that the process used in translating the scale into Persian was correct and logical and the Persian content is not only consistent with the original version but also clear and expressive for the target population. Repeatability is the reliability of a test, which is measured by different methods .The internal stability of the instrument method was used to assess the reliability of the scale. Cronbach\u2019s alpha coefficient was used for the whole scale and also for each of the dimensions separately. Cronbach\u2019s alpha coefficient for all factors in the present study ranged from 0.73 to 0.96. In a study by Kathyrine Calong and Gil Platon Soriano (2019) in the Philippines, the internal correlation of the instrument for all sub-dimensions was reported between 0.81 and 0.94, and in this study also the instrument had good internal consistency . By compIn the present study, exploratory and confirmatory factor analysis was used to investigate the structure of the factors. Factor analysis with different factor rotation methods extracted four factors that explain about 62% of the variance. These factors, as in the original version, include clinical care, relational care, humanistic care, and comforting care . The facColang et al., using a sample consisting of 124 subjects in Manila, reported that the Caring Nurse-Patient Interaction scale developed by Cossette et al. is a valid and reliable instrument . These fThe strengths of the current study include the use of 10 participants per item. However, the generalizability of the findings of this research may be limited because the samples were selected only from patients who were hospitalized in heart and general wards and nurses who worked in Kerman hospitals. Therefore, to confirm the results, it is suggested that research be conducted on larger samples and nurses working in other parts of Iran in the future. Also, as in this research, a questionnaire was used to collect data, some people may have refused to provide real answers and given unrealistic answers.The Caring Nurse-Patient Interaction scale (CNPI-23) has good validity and reliability to evaluate the caring nurse-patient interaction and can be used to measure the caring nurse-patient interaction in all research and treatment departments. The use of the scale in future studies is recommended to researchers interested in this field.CNPI-23 can be used in all nursing fields to improve the quality-of-care interactions. Nursing managers can also use this scale to check the quality-of-care interactions and provide solutions for improvement."}
{"text": "The purpose of this paper is to present evidence regarding the associations between smoking and the following urologic cancers: prostate, bladder, renal, and upper tract urothelial cancer (UTUC).This is a narrative review. PubMed was queried for evidence-based analyses and trials regarding the associations between smoking and prostate, bladder, renal, and UTUC tumors from inception to September 1, 2022. Emphasis was placed on articles referenced in national guidelines and protocols.Prostate\u2014multiple studies associate smoking with higher Gleason score, higher tumor stage, and extracapsular invasion. Though smoking has not yet been linked to tumorigenesis, there is evidence that it plays a role in biochemical recurrence and cancer-specific mortality. Bladder\u2014smoking is strongly associated with bladder cancer, likely due to DNA damage from the release of carcinogenic compounds. Additionally, smoking has been linked to increased cancer-specific mortality and higher risk of tumor recurrence. Renal\u2014smoking tobacco has been associated with tumorigenesis, higher tumor grade and stage, poorer mortality rates, and a greater risk of tumor recurrence. UTUC\u2014tumorigenesis has been associated with smoking tobacco. Additionally, more advanced disease, higher stage, lymph node metastases, poorer survival outcomes, and tumor recurrence have been linked to smoking.Smoking has been shown to significantly affect most urologic cancers and has been associated with more aggressive disease, poorer outcomes, and tumor recurrence. The role of smoking cessation is still unclear, but appears to provide some protective effect. Urologists have an opportunity to engage in primary prevention by encouraging cessation practices. The association between smoking tobacco and urologic cancers has been extensively studied. While it is well known that smoking is among the leading predisposing factors for bladder cancer, prostate cancer, renal cancer, and upper tract urothelial cancer (UTUC) \u20134, the iIt should be noted that\u2014just as cessation methods are evolving\u2014consumption methods are evolving as well. Tobacco is more frequently partaken through the use of e-cigarettes and waterpipes . While data on these methods is lacking, preliminary studies reveal potential evidence of cytotoxic effects, cell damage, DNA damage, and oxidative stress \u201311.Importantly, cancer and subsequent therapy is a powerful teaching moment for patients. The role of the urologist in smoking cessation should not be understated, and efforts to quit tobacco and its products should be undertaken if possible. Evidence has demonstrated that cessation efforts by urologists can have significant effects on smoking cessation and readiness to quit . FurtherIn this narrative review, we observe and compile current evidence regarding the impact of smoking on the following cancers: prostate, bladder, renal, and UTUC.Prostate cancer (PCa) is the second most diagnosed cancer in men worldwide . Many poHowever, while the existence and mechanism of an etiologic link between smoking and prostate cancer is unclear, there have been several proposed mechanisms. The prevalent hypothesis involves the mutation of various cancer progression genes by tobacco-related carcinogens. Other proposals involve inflammatory response, hormone alterations, proliferation of tumor angiogenesis, and immune suppression , 18.The same report by the Surgeon General in 2014 also concluded that \u201cin men who have prostate cancer, the evidence is suggestive of a higher risk of advanced-stage disease and less-well-differentiated cancer in smokers than in non-smokers, and\u2014independent of stage and histologic grade\u2014a higher risk of disease progression\u201d .p\u2009=\u20090.01) and extracapsular extension (p\u2009=\u20090.004) [A study by Mari et al. in 2017 assessed 214 patients, and found that patients with a higher cumulating smoking history reported a higher pathologic Gleason score (=\u20090.004) .Another study by Kenfield et al. included 5366 patients. This study found that 14.7% of patient with current smoking status had stage T3 or higher disease compared to 8.3% of never-smokers. Additionally, 16.0% of current smokers had a Gleason score of 7 or more compared to 10.7% of never-smokers .Smoking is a known risk factor for poorer surgical recovery times and increased post-operative complications . AdditioTobacco smoking has been associated with recurrence of disease following therapy for prostate cancer.p\u2009<\u20090.001). Similarly, an integration of 7 studies showed that former smoking status was significantly associated with biochemical recurrence  [A systematic review and meta-analysis by Foerster et al. analyzed a total of 16 studies assessing the effect of smoking tobacco on biochemical recurrence. These studies observed 21,797 participants over a median of 61\u00a0months. Of the studies assessing the effects of current smoking status, 10 studies had a hazard ratio permitting inclusion into the meta-analysis, which showed a significant association with biochemical recurrence  or stage (p\u2009=\u20090.166) between smokers and non-smokers, high-dose smokers were found to have significantly higher grade (p\u2009=\u20090.026) and stage (p\u2009=\u20090.037) compared to other assessed groups [It is unclear if smoking is associated with higher grade or stage of bladder cancer at diagnosis. Several studies show a potential association, with several possible acknowledged confounding factors. One study by Chamssudin et al. evaluated 300 patients with bladder cancer to assess if smoking status could be associated with advance tumor grade or stage. While the study could not find a significant difference between tumor grade (d groups .p\u2009<\u20090.001) and were at increased risk of a higher grade initial tumor  [A retrospective study by Pietzak et al. queried the records of 1795 patients with urothelial cell carcinoma of the bladder. A multivariate analysis showed that patients who met the National Lung Cancer Screening Trial selection criteria were at a higher risk of initial muscle invasive tumor  .p\u2009=\u20090.008), duration in years (p\u2009=\u20090.007), and cumulative amount in pack-years (p\u2009=\u20090.003) was associated with increased tumor aggressiveness. However, this association was not observed in current smokers [A retrospective study by Barbosa et al. in 2018 assessed 1859 patients. Among former smokers, increased smoking amount per day  .A large-scale database analysis by Al Hussein Al Awamlh et al. assessed 493,282 patients, 42.6% of whom reported having smoked tobacco. This study showed a significant association between smoking initiation in teenage years and bladder cancer-specific mortality  .Smoking tobacco has been associated with poorer outcomes and recovery following both trans-urethral resection and radical cystectomy , 24. OneThe role of smoking cessation should not be understated. For cases of non-muscle invasive bladder cancer, smoking cessation has been shown to decrease the risk of disease progression and progression . Though p\u2009<\u20090.0001). In an analysis of patients who specifically underwent neoadjuvant chemotherapy, smokers were found to have a higher rate of recurrence , but this was not statistically significant [Smoking status has been associated with recurrence of bladder cancer. One systematic review and meta-analysis found that current smokers have a significantly higher risk for recurrence than former and never-smokers (Hazard Ratio (HR)\u2009=\u20091.24, nificant .Rink et al. in 2012 found a dose\u2013response relationship between smoking and disease recurrence. Heavy short-term smoking (HR\u2009=\u20091.54), light long-term (HR\u2009=\u20091.70), and heavy long-term smoking (HR\u2009=\u20092.22) were all found to be associated with a progressively higher, statistically significant risk of disease recurrence compared to light short-term smoking. Additionally, smoking cessation for 10\u00a0years or more was associated with a lower risk of disease recurrence (HR\u2009=\u20090.44) .Wang et al. found a similar association, where light long-term (HR\u2009=\u20091.4), heavy short-term (HR\u2009=\u20091.4), and heavy long-term smoking (HR\u2009=\u20092.0) all conveyed a higher risk of disease recurrence compared to light short-term smoking .The strong association between smoking and renal cancer has been known for decades, and even published in the 1982 report of the surgeon general , which sIn particular, smoking and increased smoking intensity have been linked to renal cell carcinoma (RCC) , 42, thoA Study by Macleod et al. found a dose-dependent increase in risk for RCC. Patients who had smoked up to 7.5 pack-years experienced a slightly increased risk of RCC . This rate increased for patient who smoked between 22.5 and 37.5 pack-years  .An analysis by Lotan et al. utilized the data from the Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial and the National Lung Screening Trial (NLST). The PLCO data generally showed a gradually increasing trend in RCC incidence as cumulative smoking in pack-years increased up to\u2009\u2265\u200950 pack-years . Similarly, the NLST showed a dose-dependent increase in RCC risk with cumulative smoking trends up to\u2009\u2265\u200950 pack-years  .A study of 30,282 RCC cases by Gansler et al. in 2020 showed an increase in an adjusted prevalence ratio (aPR) for chromophobe RCC in smokers  compared to non-smokers  .p\u2009<\u20090.001) when compared to non-smokers. This risk was increased in current smokers  [One meta-analysis by Cumberbatch et al. found the relative risk of developing RCC was significantly higher for smokers  .A study by Setiawan et al. analyzed 347 cases of RCC, found an increase in incidence in RCC in men  and women . This risk decreased with former smoking status in men  and  in women .Smoking has been associated with higher stage cancer and more aggressive phenotypes at diagnosis. This in turn likely increases disease-specific mortality. A study by Sweeney et al. assessed 132 cases of RCC, finding that current smokers were slightly over twice as likely to be diagnosed with distant or unknown stage disease compared to non-smokers  .Smoking has been linked to poor perioperative outcomes, recovery, post-operative complications, and disease progression. Additionally, smoking has been linked to poorer disease-specific mortality. The aforementioned study by Sweeney et al. found that current smokers experienced an increased risk of death following RCC diagnosis  compared to former smokers  .p\u2009=\u20090.430). Rather, other risk factors were found to be significantly associated, including male gender, increased T stage, nuclear grade, clear cell histology, and presence of diabetes or hypertension.Data regarding any association between smoking tobacco and recurrence of renal cancer is lacking, but in 2019, van der Mjin et al. analyzed 873 patients and found that a history of smoking was not significantly associated with recurrence of RCC  and more lymph node metastases (p\u2009\u2264\u20090.003) compared to non-smokers [Another study by Rink et al. assessed 865 patients undergoing RNU for UTUC, and found that current smokers had a higher stage , which may cause increased and higher grade complications .Following radical nephroureterectomy for UTUC, studies have shown that smoking has been associated with intravesical recurrence, disease recurrence, and cancer-specific mortality.One systematic review found that the majority of studies following patients after radical nephroureterectomy for UTUC were able to associate tobacco smoking with intravesical recurrence, disease recurrence, cancer-specific mortality, and/or any cause mortality . This reA study in 2012 by Rink et al. found that current smokers had a significantly increased risk of UTUC disease recurrence after therapy. In addition, both current and former smokers had a higher risk of cancer-specific mortality. Additionally, a dose-dependent relationship was found between smoking and the risk of disease recurrence. Heavy-long-term smoking was found to be independently associated with the highest risk of disease recurrence .p\u2009\u2264\u20090.031). In women, a similar risk of recurrence was observed (p\u2009\u2264\u20090.003).Another study by Rink et al. containing 865 patients found that in men, current smokers experienced an increased risk of recurrence (p\u2009=\u20090.045) and metastases (log-rank p\u2009=\u20090.016).Additionally, the aforementioned paper by Miyata et al. analyzed 134 patients, and found that the smoking status of a patient was a significant predictor of tumor recurrence (A meta-analysis by Crivelli et al. in 2014 found that of six criteria-appropriate studies that assessed intra-vesicular recurrence, five found a statistically significant increase in risk associated with smoking tobacco .Smoking has been firmly linked to most urologic cancers including prostate, bladder, renal, and upper tract urothelial cancers. In general, tobacco smoking has been associated with higher grade and stage tumors, increased disease recurrence, poor surgical outcomes, worse postoperative complications, disease progression, and tumor recurrence. Smoking cessation appears to have beneficial effects with most urologic cancers, particularly if maintained in the long term. Curbing smoking habits is therefore critical for urologic health and should be a priority for urologists."}
{"text": "Further, an in-vitro experiment using the sperm-BEECs co-culture model was applied to investigate the effect of HA on sperm attachment and inflammatory response. Here, low molecular weight (LMW) HA at different concentrations  was incubated with BEECs for 2 h followed by the co-culture without- or with non-capacitated washed sperm (106/ml) for additional 3 h was performed. The present in-silico model clarified that CD44 is a high-affinity receptor for HA. Moreover, TLR2 interactions with HA oligomer (4- and 8-mers) target a different subdomain (h-bonds) compared to TLR2-agonist (PAM3) which targets a central hydrophobic pocket. However, the interaction of LMW HA (32-mers) with TLR2 revealed no stability of HA at any pocket of TLR2. Notably, the immunofluorescence analysis revealed the HA localization in both endometrial stroma and epithelia of ex-vivo endometrial explant. Moreover, ELISA showed significant levels of HA in BEECs culture media. Importantly, BEECs pretreatment with HA prior to sperm exposure increased the number of attached sperm to BEECs, and upregulated the transcriptional levels of pro-inflammatory genes  in BEECs in response to sperm. However, BEECs treated with HA only (no sperm exposure) did not show any significant effect on the transcript abundance of pro-inflammatory genes when compared to the non-treated BEECs. Altogether, our findings strongly suggest a possible cross-talk between sperm and endometrial epithelial cells via HA and HA binding receptors (CD44 and TLR2) to induce a pro-inflammatory response in bovine uterus.Recently, we reported that sperm induce cluster of differentiation 44 (CD44) expression and Toll-like receptor 2 (TLR2)-mediated inflammatory response in bovine uterus. In the present study, we hypothesized that the interaction between CD44 of bovine endometrial epithelial cells (BEECs) and hyaluronan (HA) affects sperm attachment and thereby enhancing TLR2-mediated inflammation. To test our hypothesis, at first,  Upon mating or artificial insemination (AI), semen provokes a physiological inflammatory reaction in the female genital tract of humans and animals \u20136. A sucvia employing a series of in vitro- , a transmembrane protein with multiple isoforms due to its frequent alternative splicing and post-translational modifications, is a major HA receptor . CD44 prproteins . Further process , 37. Lig process , 39, T-c process , 41, as  process , 42\u201344.via immunofluorescence and enzyme-linked immunosorbent assay (ELISA). Further, sperm-BEECs in-vitro co-culture model was applied to investigate the impact of BEECs pretreatment with exogenous HA on sperm attachment and subsequent immune response.Lately, we have shown that sperm upregulate the gene and protein expression of CD44 adhesion molecule, in both BEECs- and uterine explant models, in the course of sperm-induced uterine inflammation in bovine . AltogetFor conducting the in-silico investigations, human HA-binding proteins  were applied; the sequence identity between human- and bovine HA binding proteins is 92.5 and 72.27 for CD44 antigen and TLR2 extracellular domain, respectively. Additionally, template-based modeling  showed tThe three-dimensional (3-D) structure of HA with 4-, 8- and 32-mers were generated as previously described , 48. ForThe optimized HA4, HA8 and HA32 structures, obtained from phase I, were used for docking studies by AutoDock VINA (v.1.2.0) . In thisMD simulation (during 150 ns) and molecular mechanics Poisson\u2013Boltzmann surface area (MM-PBSA) methods were used to calculate and predict the binding free energy (BFE) . Radial The uterine samples used for immunostaining as well as isolation and culture of BEECs were brought from a local slaughterhouse . Simply, the bovine uterine horns  were carefully opened and grossly examined to be free from any abnormalities. Only healthy uterine horns  from the pre-ovulatory phase (Days 19-22) were collected, immersed in physiological saline with antibiotics [1% penicillin-streptomycin  and 1% amphotericin B (Gibco)], and then transported to the laboratory within 1-1.5 h on ice. Of note, the phase of estrous cycle was determined on the basis of corpus luteum appearance, size, and color as well as the follicular diameter .The endometrial sections used for immunostaining were prepared as previously described . In brie2 culture flasks , and cultured at 38.5\u02daC in a humidified atmosphere of 5% CO2 in air. Upon reaching 70-80% (sub-confluence), the cells were passaged, trypsinized, and re-seeded (at 1 x 105 cells/ml) in 1.5 ml/well culture medium  in 12 well plates  until sub-confluence. These plated cells were exposed to estradiol-17\u03b2  and progesterone  throughout the whole culture period to simulate the pre-ovulatory phase in situ   .For getting sperm, frozen 0.5 ml semen straws were obtained from three highly fertile Holstein bulls belonging to Genetics Hokkaido Association, Hokkaido, Japan. Frozen semen straws from three bulls were thawed in a water bath at 38.5\u00b0C for 30 sec, pooled, and washed 3 times in a Tyrode\u2019s albumin, lactate, and pyruvate medium (Sp-TALP) . The pro3, 0.1% gentamicin, 1% amphotericin, 0.1% FCS as well as E2 and P4 at the above-mentioned concentrations) supplemented with LMW HA  at different concentrations  for 2 h followed by the co-culture without- or with non-capacitated washed sperm (106/ml) for additional 3 h  was used for determination of HA concentrations in BEECs-conditioned media. A 50 \u00b5L aliquot of each sample was analyzed according to the manufacturer\u2019s instructions. All samples were run in duplicate. Optical density (OD) readings were performed at 450 nm. Control group was run to determine the baseline concentration of HA in DMEM culture media. This experiment was repeated four times using epithelial cells from four different uteri.6/ml) for 30 min followed by video capturing using a light microscope (at 200 x magnification) equipped with a stage warmer and digital camera connected to EOS utility software\u00ae ; the focus was adjusted during video capturing to visualize all attached sperm. Five random fields were captured per each group. Of note, videos of the different groups within the same experiments were captured under the same field area and video setting  were exposed to washed sperm  from the total number of sperm (106/well)  were exposed to 1006/well) .At the end of sperm-BEECs co-culture, RNA was extracted from BEECs using Trizol reagent , quantified by means of a NanoDrop Spectrophotometer 2000c , and then pure RNA samples  were kept in RNA storage solution  at -80\u00b0C till cDNA synthesis .via SuperScript II Reverse Transcriptase kit (Invitrogen) according to the manufacturer instructions. In brief, the DNase-treated RNA was incubated with the second mixture  at 65\u00b0C for 5 min. Then, the third mixture  was added per each tube and incubated at 42\u00b0C for 2 min. Finally, 0.2 \u03bcl of 200 units/\u03bcl SuperScript II Reverse Transcriptase was added and the thermal cycler was programmed at 25\u00b0C for 10 min, 42\u00b0C for 50 min and then 70\u00b0C for 15 min. The synthesized cDNA was stored at -30\u00b0C.The synthesis of cDNA was performed as previously decribed  with minvia a quantitative real-time polymerase chain reaction (PCR) by means of an iQ5 real-time PCR detection system . To clarify, a total 10 \u03bcl reaction mix [i.e., 2 \u03bcl/sample synthesized cDNA, 5 \u03bcl of QuantiTect SYBR Green PCR Master Mix , 0.2 \u03bcl of the targeted primer pairs (listed in \u2013\u0394\u0394Ct) method was applied to estimate the fold change between the different samples  alpha (TNFA), Interleukin (IL)-1 beta (IL-1B), IL-8, and Prostaglandin E synthase (PGES) were detected  samples , 67, 68.Each experiment was repeated at least three times using epithelial cells from 3\u20134 different uteri. In each uterus, 3 replicates were performed (3 wells per treatment per experiment) and data are presented as mean \u00b1 standard error of the mean (SEM). Student\u2019s t-test was applied to compare the data between two groups, while one-way ANOVA followed by Tukey\u2019s multiple comparisons test was used for more than two groups. The results were considered statistically significant at P< 0.05 and P< 0.0001.The determination of initial structure of HA-receptors complex for MD simulations and energy analysis have been performed using docking simulations. The top three binding orientations of HA with main binding site of proteins with estimated BFEs through Autodock VINA were detected   could not stay in the vicinity of the main binding site of TLR2 during MD simulation Figure\u00a01To ensure the localization of HA to bovine endometrium, the endometrial sections were subjected to immunostaining using bHABP. Indeed, HA was localized to bovine endometrium. Although a higher expression was observed in the endometrial stroma, HA was also expressed by luminal- and glandular epithelia of bovine endometrium Figure\u00a03in-vitro produced via incubating the culture media with BEECs monolayers showed detectable levels of HA with an average of 16.05 \u00b1 2.33 ng/ml.Concurrently, the conditioned media Accordingly, it was essential to elucidate the possible role(s) of HA in sperm-BEECs crosstalk. BEECs monolayers were enriched with different concentrations of HA  for 2 h prior to the co-culture with sperm for further 3 h. At a glance, we observed that the number of attached sperm was significantly higher in BEECs treated with HA (at either 1 or 10 \u00b5g/mL) than in the non-treated BEECs  and chemokines (IL-8) as well as PGES were quantified in BEECs via a real-time PCR. Our data showed that the pre-incubation of BEECs with HA at lower concentration (0.1 \u00b5g/mL) has no effect on TLR2, TNFA, IL-1B, IL-8, and PGES mRNA expressions in BEECs triggered with sperm . For instance, HA create h-bonds with residues of CD44  to interact strongly. TLR2 presented h-bonds  in a peripheral subdomain, away from the main pocket, which involved in the HA-TLR2 interaction (for 4- and 8-mers HA). It is obvious that polar and electricity charged amino acids play an important role in HA binding affinity. CD44 has three topographically main binding for HA, however HA has the high potential affinity only to crystallographic mode . In harmBased on the above computational analyses, it was fundamental to confirm the existence of HA in bovine uterus. Importantly, the immunohistochemical detection of HA in the pre-ovulatory uterus showed its localization to both endometrial stroma and epithelia. The staining revealed that HA were strongly localized within the stroma and weakly expressed by luminal and glandular epithelium of the endometrium. Similar observations  were reported in other species such as in ovine  and mousin-silico investigations, HA has a much stronger binding affinity to CD44 than TLR2. As well, we have previously reported that CD44 adhesion molecule plays a principal role in sperm attachment to the endometrial epithelia in bovine uterus; the addition of anti-CD44 neutralizing antibody negatively impacted sperm-BEECs interaction  and chemokines (IL-8) as well as prostaglandins E synthesis (PGES). However, higher exogenous HA concentrations  added to BEECs prior to exposure to sperm weakened sperm-triggered inflammation in BEECs.Since sperm attachment to the endometrial epithelia is a prerequisite for promotion of a pro-inflammatory response in bovine uterus  pathway , 64, 70,Via binding with HA receptors, mainly CD44 adhesion molecule  HA, low molecular weight (LMW) HA as well as oligosaccharides. Under the physiological conditions, HMW HA primarily contributes to tissue integrity , 77. Upomolecule , these Hmolecule  such as molecule , 79. Conmolecule , macrophmolecule , as wellmolecule .via using CD44- specific antibody or knockdown, prior to TLR2 activation downregulates NF-\u03baB transcription and thereby lowers proinflammatory cytokines\u2019 (IL-1B and TNFA) production. In addition, they reported that pretreatment of human macrophages with higher doses of HA  dose-dependently inhibits their pro-inflammatory response upon TLR2 ligation  . Moreovein-silico and in-vitro investigations proposed a possible cross-talk between sperm and uterine epithelial cells via hyaluronan and hyaluronan binding receptors (CD44 and TLR2), to induce pro-inflammatory response in bovine uterus  from the sperm side which regulate the TLR2 to induce inflammation after sperm attachment.In conclusion, the present e uterus Figure\u00a06The original contributions presented in the study are included in the article/The animal study was reviewed and approved by committee on the ethics of animal experiments of the Obihiro University of Agriculture and Veterinary Medicine, Japan (Permit number 27-74).ME, AlM, IA, MY, RK, and AkM conceived and designed the experiments. ME, AlM, IA, and MY performed the experiments. ME, AlM, IA, and MY analyzed the data. AlM, RK, and AkM provided reagents/materials/analysis tools. ME, AlM, IA, MY, RK, and AM wrote the manuscript. All authors contributed to the article and approved the submitted version."