{"text": "Nidation of floating tumour cells initiates peritoneal carcinosis and limits prognosis of gastro-intestinal tumours. Adhesion of tumour cells to extracellular matrix components is a pivotal step in developing peritoneal dissemination of intraabdominal malignancies. Since phospholipids efficaciously prevented peritoneal adhesion formation in numerous animal studies we investigated their capacity to reduce adhesions of gastric cancer cells to extracellular matrix components (ECM).Human gastric cancer cells  were used in this study. Microtiter plates were coated with collagen IV (coll), laminin (ln) and fibronectin (fn). Non-specific protein binding of the coated wells was blocked by adding 1% (w/v) BSA  and rinsing the wells with Hepes buffer. 50.000 tumour cells in 100 \u03bcl medium were seeded into each well. Beside the controls, phospholipids were added in concentrations of 0.05, 0.1, 0.5, 0.75 and 1.0/100 \u03bcl medium. After an incubation interval of 30 min, attached cells were fixed and stained with 0.1% (w/v) crystal violet. The dye was resuspended with 50 \u03bcl of 0.2% (v/v) Triton X-100 per well and colour yields were then measured by an ELISA reader at 590 nm. Optical density (OD) showed a linear relationship to the amount of cells and was corrected for dying of BSA/polystyrene without cells.The attachment of gastric cancer cells to collagen IV, laminin, and fibronectin could be significantly reduced up to 53% by phospholipid concentrations of 0.5 mg/100 \u03bcl and higher.These results, within the scope of additional experimental studies on mice and rats which showed a significant reduction of peritoneal carcinosis, demonstrated the capacity of phospholipids in controlling abdominal nidation of tumour cells to ECM components. Lipid emulsions may be a beneficial adjunct in surgery of gastrointestinal malignancies. In the treatment of gastro-intestinal cancer the detection of free, isolated tumour cells in the peritoneal cavity serve as a prognostic marker for postoperative survival -4. Sincein vitro study was focused on the influence of phospholipids on adhesion of gastric cancer cells to extracellular matrix components with broad reactivity to several integrins. Collagen IV (coll IV), and laminin (ln) are main components of the basement membrane and fibronectin (fn) plays an important role in wound healing [Phospholipids, polar phosphoric acid di-esters, are natural constituents of the abdominal fluid. The substance is able to form a lubricant layer on the peritoneal surface . Additio healing ,18.2, Falcon, Becton Dickinson-Gambil, Heidelberg, Germany) in RPMI 1640 medium , supplemented with 10% foetal bovine serum (GIBCO), penicillin and streptomycin (GIBCO). Cell cultures were incubated at 37\u00b0C in a humidified atmosphere of 5% CO2 in air. Cells were passaged after treatment with 0.125% trypsin for 6 min. The cells were pelleted after centrifugation for 10 min at 200 g, suspended in 20 ml PBS, and pelleted. The cell pellet was resuspended in 30 ml complete medium and seeded with a splitting ratio of 1:3. Only cells from three passages were used for the experiments.The human gastric cancer cell line NUGC-4 was purchased from the Japanese Cancer Research Resources Bank . The cells were maintained in monolayers in tissue culture flasks (75 cm2 in air (ln), respectively. Nonspecific protein binding of the coated wells was blocked by adding 1% (w/v) BSA  and rinsing the wells with Hepes buffer.Flat-bottom polystyrene microtiter plates  were coated for adhesion experiments. The purified ECM components were dissolved in PBS with the following concentrations: coll IV \u2013 2,5 \u03bcg/ml , fn \u2013 10 \u03bcg/ml , ln \u2013 50 \u03bcg/ml . We found these concentrations to be optimal in foregoing dilution series. They were added to the wells and incubated at 4\u00b0C for 24 hours , or at 37\u00b0C for 45 min in a humidified atmosphere of 5% CO3 and 5 \u00d7 104 cells per well, as determined by a dilution series.For adhesion experiments gastric cancer cells were detached with collagenase I , washed once with RPMI 1640, centrifuged (200 g for 10 min), resuspended in RPMI 1640, and preincubated for 30 min in a humidified atmosphere of 5% CO2 in air (37\u00b0C). Fifty thousand tumour cells in 100 \u03bcl medium were seeded into each well. Evaluation of adherent cells was performed using crystal violet staining according to the method described by Aumeilley et al., and Tietze et al. ,20. AfteControl dying of BSA/polystyrene without cells led to Optical Density (OD) values of 0.01\u20130.07. These values were subtracted from those obtained in the experiments.After complete preparation of the tumour cell suspension, the PL solution was added in the following concentrations: 0.05, 0.1, 0.5, 0.75, and 1 mg per 100 \u03bcl medium. The concentrations used were correlated to our in vivo experiments. The phospholipid solution consists of phosphatidylcholine 70% by weight, phosphatidylethanolamine 15% by weight, neutral lipids 8% by weight, sphingomyelin <3% by weight and lysophosphatidylcholine <3% by weight.All experiments were performed three times in quadruplicate. The data are expressed as means +/- standard error of the mean (SEM). Student's t-test for unpaired data was used for statistical analysis. Differences were regarded as significant for p values < 0.05.The analysis of tumour cell adhesion to BSA 1% resulted in a mean extinction of 0.27 (SEM 0.01) at 590 nm. Coating with ln and fn led to a nearly twofold increase of tumour cell adhesion with mean values of 0.59  and 0.63 . The cancer cells showed a most pronounced adhesion to coll IV with a mean extinction of 0.97 (0.02).The tumour cell adhesion to ln registered after addition of PL was significantly reduced. The effect was concentration dependent compared to the controls. Even the minimum amount of PL 0.05 mg/100 \u03bcl led to a reduced extinction of 0.4 (0.01). Treatment with 0.1 or 0.5 mg/100 \u03bcl PL revealed extinction values of 0.32 (0.02) and 0.28 (0.02), respectively. The maximum effect could be demonstrated with 0.75 mg/100 \u03bcl PL with an extinction of 0.24 (0.02). The relative reduction of tumour cell adhesion compared to the control amounts to 59%. Treatment with 1 mg/100 \u03bcl PL showed no further decrease of tumour cell adhesion to ln. The mean extinction was 0.26 (0.01)  and 0.59 (0.01). However, a significant reduction of tumour cell adhesion could be observed after treatment with 0.5 mg/100 \u03bcl PL, 0.42 (0.02); as well as with 0.75 mg/100 \u03bcl PL (0.39 (0.02)) and 1 mg/100 \u03bcl PL (0.38 (0.02)). We found a similar situation compared to ln with equal effects of 0.75 mg/100 \u03bcl and 1 mg/100 \u03bcl PL indicating that the maximum influence on adhesion is reached. The relative reduction of tumour cell adhesion compared to the control values amounts to 40%  after administration of 0.05 mg/100 \u03bcl PL to a maximum effect after treatment with 1 mg/100 \u03bcl PL with a value of 0.44 (0.02) table . In compCell adhesion to the extracellular matrix plays a fundamental role in peritoneal carcinosis. The adhesion is mediated by transmembrane Integrins. Several proteins including fibronectin in the interstitial matrix, laminin and collagen IV in the basement membrane were identified as important ligands ,22. Manyin vitro as well as a reduction of tumour weight after intraperitoneal tumour injection [In our experiments the reduced rate of cell attachment in the presence of phospholipids was independent from the extracellular matrix. A similar effect on intraperitoneal tumour growth was described by Jacobi et al. who could demonstrate that taurolidine/heparin and povidone iodine lead to a significant reduction of tumour cell growth njection . Predominjection . Dextrannjection ,32. Howenjection ,34. PhosThe hypothesis is that phospholipids form a lubricant layer on the peritoneum by binding with its negatively charged cholin branch chain to the positively charged peritoneal surface ,14,35. Pin vitro experiments with tumour cells as soluble agents added to ECM immobilized onto plastic surfaces cannot appropriately mimic the situation in situ. Recently we found that phospholipids significantly reduce the attachment area and the tumour volume of peritoneal carcinosis caused by the colonic cancer cell line DHD/K12/TRb in rats. These results were supported by a prolonged survival rate of the treated animals as compared to the control group. Additionally, we found a similar effect of phospholipids on the adhesion of the human rectal cancer cell line HRT-18 on the same ECM-components in vitro [The in situ tumour cell \u2013 ECM interaction is influenced by adhesive and non-adhesive ECM components and can be understood as a three dimensional network . Therefoin vitro . Consistin vitro ,6,38,39.We performed this study to ascertain the results of the foregoing animal experiments and to demonstrate the influence of phospholipids to three different ECM components, even though matrices of collagen IV, laminin and fibronectin alone may not be predictive of peritoneal membrane nidation.These results, within the scope of additional experimental studies on mice and rats which showed a significant reduction of peritoneal carcinosis, demonstrated the capacity of phospholipids in controlling abdominal nidation of tumor cells to ECM components. Lipid emulsions may be a beneficial adjunct in surgery of gastrointestinal malignancies.The work was financially supported by Fresenius Kabi, Bad Homburg, Germany.The results are part of an international patent application.The pre-publication history for this paper can be accessed here:"}
{"text": "To function properly, cells must keep constant tabs on the environmental conditions around them, such as the presence of growth hormones in the blood or the proximity of neighboring cells. These external cues are relayed into the cell through a cascade of chemical and physical reactions referred to as signal transduction. Signal transduction pathways inform and regulate almost all activity within the cell, from protein production to cell division. Understanding these processes is fundamental to biology, but the sheer number of molecules and interactions in some pathways makes thorough documentation difficult.Taking a holistic approach that combines both computational models and experimental manipulations, scientists have described the web of interactions involved in the aryl hydrocarbon receptor (AHR) signal transduction pathway. AHR belongs to the Per\u2013Arnt\u2013Sim (PAS) superfamily of sensor molecules that regulate functions like development, the sleep-wake cycle, and cellular reaction to oxygen deprivation. Unlike many receptors that are embedded in the cell membrane, AHR floats freely in the main body of the cell, called the cytosol. There it waits for a stimulus or ligand, such as a dioxin molecule, to enter the cell and bind to it. Once bound, AHR undergoes a host of changes, glomming on to additional molecules before it enters the cell nucleus and acts as a transcription factor, initiating the production of enzymes to digest foreign, or xenobiotic, compounds. The AHR pathway is a curiosity; though found in all vertebrates, the natural, or endogenous, ligand remains unknown. Without this knowledge, researchers are limited in the kind of experiments they can perform to evaluate the pathway.Christopher Bradfield and colleagues used yeast as a model system to elucidate the steps involved in this pathway, which regulates vertebrate cell response to pollutants like dioxins. To first assess the molecules involved in the AHR pathway, the team used 4,507 yeast \u201cdeletion\u201d strains, each strain missing one gene from its genome. They then inserted the AHR gene into the strains using small rings of movable DNA called plasmids. Though yeast does not naturally possess AHR, it is an ideal genetic model for studying signaling pathways due to its quick generation time, small, well-characterized genome, and similarity to vertebrate systems.Bradfield's team exposed each strain to a receptor stimulus or agonist and screened them for AHR response. If a deletion strain showed significantly reduced activity, they concluded that the missing gene was a key component to the signal pathway. The researchers identified 54 genes that had a significant influence on AHR response. Only two of these genes, termed modifiers, had been previously identified.Signaling pathways usually boil down to a series of discrete steps. To identify steps of the AHR pathway, the researchers constructed a spider web-like map called a \"protein interaction network,\" or PIN, based on previously known interactions between the proteins encoded by the 54 modifier genes. The resulting map revealed groups of highly connected, related modifiers, which the authors proposed to be steps in the pathway. Though other studies have used the newly developed PIN strategy to investigate cellular processes, Bradfield's team also annotated their PIN through a series of experiments both to support the identity of and to better understand the protein groups, referred to as functional modules.With tests based on discrete receptor signaling events, known active structural regions, reaction to different types and concentrations of agonists, and functional location within the cell, Bradfield's team organized the functional modules into five steps. One group of modifiers is involved in AHR folding, the conformational change that occurs when the receptor binds to a toxin. With the help of other modifiers, the new AHR complex is then translocated into the cell nucleus. Once in the nucleus, a series of modifiers assist the AHR in its role as a transcription factor. The researchers also identified a step in the pathway that controls production of AHR itself and another unknown \"step\" that takes place inside the nucleus.As AHR is thought to be a prototype PAS receptor, understanding the steps in this pathway will likely guide future research on the entire family, allowing scientists to study in detail individual steps in these complex pathways. The highly integrated method reported here could also be used to study most other mammalian signaling pathways, giving scientists a new tool as they attempt to understand how cells respond to their changing environment."}
{"text": "DJ-1 were recently described in two families with autosomal recessive inherited PD (Parkinson's disease (PD) pathology is characterized by the degeneration of midbrain dopamine neurons (DNs) ultimately leading to a progressive movement disorder in patients. The etiology of DN loss in sporadic PD is unknown, although it is hypothesized that aberrant protein aggregation and cellular oxidative stress may promote DN degeneration. Homozygous mutations in rited PD . In a corited PD , we show The interaction of the proteins DJ-1 and \u03b1- synuclein described here may be important for understanding the molecular basis of Parkinson's disease Parkin, lead to autosomal recessive primary Parkinsonism (Parkinson's disease (PD) is a progressive movement disorder that is characterized pathologically by the relatively selective degeneration of midbrain DNs and the presence of prominent intracytoplasmic neuronal inclusions, termed Lewy bodies . The ideinsonism . Parkin insonism .DJ-1, were recently associated with autosomal recessive primary Parkinsonism , many of which function as molecular chaperones to assist other proteins in folding. Hsp31, an in vitro . We hypoin vitro A. The chin vitro B.DJ-1 similarly functioned as a molecular chaperone in the context of the heat-induced aggregation of GST see . In cont2O2 , and subsequently chaperone activity was measured in the CS thermal aggregation assay. H2O2 effectively reactivated the chaperone activity of DTT-treated DJ-1 . These results suggest that redox regulation of DJ-1 is reversible and is regulated by the redox environment.To test the redox regulation of DJ-1, we assayed chaperone activity in the CS aggregation assay in the presence or absence of the reducing agent DTT. DJ-1 chaperone activity in the CS aggregation assay was completely abrogated by preincubation of DJ-1 with 0.5 mM DTT in aggregation buffer for 10 min at 4 \u00b0C D. DTT dited DJ-1 D. This wMolecular chaperones typically display marked stability to thermal stress . ConsistWe extended the analysis of DJ-1 chaperone function to a candidate DJ-1 substrate, \u03b1Syn . The agg\u03b1Syn protofibrils have been shown to be an intermediate in the formation of mature amyloid fibrils. Because DJ-1 chaperone activity is effective at inhibiting the accumulation of \u03b1Syn protofibrils, we sought to investigate the role of this activity in the generation of Congo red\u2013positive mature fibrils. Congruently, WT DJ-1 inhibited formation of Congo red-positive \u03b1Syn fibrils, while L166P DJ-1 and GST did not C. Thus, 2 treatment ) were recorded on an Aviv 62A sCD spectrometer at 4 \u00b0C in a 0.02-cm path length cuvette, and \u03b1-helix and \u03b2-sheet content were estimated as described (2 \u00b7 dmol\u22121) at 222 nm as a function of temperature. Thermal melts were performed in 4 \u00b0C increments with an equilibration time of 1 min and an integration time of 30 sec, using a 0.1-cm path length cuvette.(E) Far-ultraviolet CD spectra of WT DJ-1 (blue triangles) and the L166P mutant (red squares); mean residue ellipticity (\u0398) equals \u00b0C \u00b7 cmescribed . Based o222 is equal to \u00b0C \u00b7 cm2 \u00b7 dmol\u22121 at 222 nm.(F) Thermal denaturation curves for WT and mutant L166P DJ-1; mean residue ellipticity (\u0398)(G) Redox regulation is unaffected by the C106A mutation. Redox regulation of C106A DJ-1 was assayed via DTT inactivation (0.5 mM) in the CS aggregation suppression assay.(H) Protofibril preparations (as in (1.2 MB PDF).Click here for additional data file.Figure S22 (Fe) or media alone (0) as described in (A) Undifferentiated ES cells were transfected with Flag-\u03b1Syn and treated with 2 mM FeCl5 cells in a 24-well format were transiently transfected with eukaryotic expression constructs encoding WT human DJ-1 or empty vector. After 36 h, cells were starved for 1 h with DMEM lacking cysteine and methionine and supplemented with 8% dialyzed FBS. Cells were pulsed for 2 h with 10 \u03bcCi[35S]-L-Met/L-Cys  per well, washed twice, and chased at the indicated intervals with complete medium. Flag-\u03b1Syn was immunoprecipitated with Flag antibody-conjugated agarose beads (Sigma), subjected to SDS-PAGE, and visualized by autoradiography.(B) Overexpression of WT DJ-1 does not significantly alter the half-life of soluble Flag-\u03b1Syn. CAD murine neuroblastoma cells were stably transfected with Flag-tagged human \u03b1-synuclein using standard techniques. 2 \u00d7 10(C) Flag-\u03b1Syn from (B) was quantitated using NIH Image J.(815 KB PDF).Click here for additional data file.Figure S3p < 0.(A) Overexpression of WT DJ-1 or L166P DJ-1 in the context of \u03b1Syn aggregation does not alter cell number. Cells from p < 0.(B) Overexpression of WT DJ-1 or L166P mutant DJ-1 in the context of Q333P mutant NFL aggregation does not alter cell number. GFP positive transfected cells from p < 0.(C) Overexpression of WT DJ-1, but not L166P mutant DJ-1, rescues cells from Q333P mutant NFL toxicity. HeLa cells were transfected with Q333P mutant NFL along with WT human DJ-1, L166P mutant DJ-1, or vector control. After 72 h, cells were assayed by MTT reduction assay -2,5-diphenyltetrazolium bromide by metabolic enzymes) . Data arp < 0.(D) C53A mutant DJ-1 is unable to rescue cells from Q333P mutant NFL toxicity. Undifferentiated ES cells were transfected with Q333P mutant NFL along with WT human DJ-1, C53A mutant DJ-1, or vector control. After 72 h, cells were assayed by MTT reduction assay . Data ar(E) Coexpression of DJ-1 with NFL does not alter NFL expression levels. CAD cells were transfected with Q333P mutant NFL and vector, WT DJ-1, C53A mutant DJ-1, or L166P mutant DJ-1. Cells were differentiated for 72 h and lysed to produce Triton X-100-soluble and -insoluble fractions. Lysates were exposed to Western blotting with an antibody against transfected human NFL. NFL is present only in the insoluble fraction, and expression of WT or mutant DJ-1 does not alter NFL expression levels.(685 KB PDF).Click here for additional data file.Figure S42 (G\u2013L) for 18 h prior to fixation with PFA. Cells were immunostained with rabbit anti-DJ-1 as described, followed by donkey anti-rabbit Cy5 . Nuclei  were visualized by incubation with the nuclear stain ToPro3 prior to imaging.CAD cells were transfected with WT DJ-1 and differentiated by serum withdrawal for 72 h. Cells were treated with medium alone (A\u2013F) or medium with 2 mM FeCl(1.6 MB PDF).Click here for additional data file.Table S1(45 KB DOC).Click here for additional data file."}
{"text": "Several cell lines and primary cultures benefit from the use of positively charged extracellular matrix proteins or polymers that enhance their ability to attach to culture plates. Polyethyleneimine is a positively charged polymer that has gained recent attention as a transfection reagent. A less known use of this cationic polymer as an attachment factor was explored with several cell lines.Polyethyleneimine compared favorably to traditional attachment factors such as collagen and polylysine. PC-12 and HEK-293 cells plated on dishes coated with polyethyleneimine showed a homogeneous distribution of cells in the plate, demonstrating strong cell adhesion that survived washing procedures. The polymer could also be used to enhance the adherence and allow axonal outgrowth from zebrafish retinal explants. The effects of this coating agent on the transfection of loosely attaching cell lines were studied. Pre-coating with polyethyleneimine had the effect of enhancing the transfection yield in procedures using lipofection reagents.Polyethyleneimine is an effective attachment factor for weakly anchoring cell lines and primary cells. Its use in lipofection protocols makes the procedures more reliable and increases the yield of expressed products with commonly used cell lines such as PC-12 and HEK-293 cells. Molecular cell biology experimentation often requires the culture of primary cells or immortalized cell lines. The most common substratum used in cell culture consists of a plastic dish that offers a negatively charged surface. A drawback of this technology is that some anchorage-dependent cell types do not produce sufficient amounts of positively charged extracellular matrix proteins, adhering only weakly to the plastic substratum. Pre-coating of the plastic surface with extracellular matrix proteins such as collagen, fibronectin, laminin, etc., usually enhances the attachment of these cell types ,2. SynthPolyethyleneimine (PEI) is an organic polymer that has a high density of amino groups that can be protonated. At physiological pH, the polycation is very effective in binding to DNA and can mediate the transfection of eukaryotic cells . The oriThis report presents a comparison of PEI with other traditional coating agents as attachment factors for several cell lines and primary cultures of retina tissue. Additionally, an enhancement of the transfection yield of weakly anchoring cell lines is shown by the combination of PEI coating with lipofection.PC-12 cells are used as a model of neuronal differentiation in the laboratory, as treatment of these cells with nerve growth factor (NGF) induces neurite extension and the expression of biochemical markers of the sympathetic neuronal phenotype . They grin vitro by the accelerated extension of long neurites. However, this phenomenon requires the use of extracellular matrix or attachment factors (for example collagen or PDL coating), as the explants show very low affinity for the uncoated plastic surface. Experiments were conducted to observe if PEI could act as an attachment factor conducive to axonal outgrowth from zebrafish retinal explants. Retinal explants from control zebrafish eyes were able to attach to PEI-pretreated culture dishes . Plates pretreated with the diverse attachment factors were compared with plates that received no pretreatment (untreated). Experiments were performed in triplicate, and the averages of dye retained in the plates that received each treatment were calculated. Those averages were normalized to the average obtained with the PEI pretreatment, which was assigned the arbitrary value of 100.0% in all the experiments. The results from representative experiments with the 3 cell lines are shown in Figure To provide an indication of the variation among experiments, the averages \u00b1 standard deviations of the relative cell counts obtained in the independent experiments were calculated for each cell line and treatment . The comparative results for the other treatments are indicated below. For the PC-12 cells, the relative counts were 81.5% \u00b1 8.8% for collagen-pretreated wells (n = 4), 93.9% \u00b1 21.2% for PDL-pretreated wells (n = 4), and 52.1% \u00b1 13.7% for untreated wells (n = 4). For the HEK-293 cells, the relative counts were 16.3% \u00b1 12.7% for collagen-pretreated wells (n = 3), 99.6% \u00b1 2.5% for PDL-pretreated wells (n = 3), and 9.0% \u00b1 4.1% for untreated wells (n = 3). In the experiments with MYS cells, the average of the relative counts with collagen-pretreated wells was 92.7% \u00b1 16.2% (n = 3), 71.1% \u00b1 6.7% for PDL-pretreated wells (n = 3), and 78.4% \u00b1 11.5% for untreated wells (n = 3). Statistical analysis indicates that the enhancement of adhesion of both PC-12 and HEK-293 cells to PEI-pretreated dishes versus untreated plastic is significant , while it is not statistically significant for MYS cells (p > 0.05).5 HEK-293 cells and 1.5 \u00d7 106 PC-12 cells). The results indicate that PEI worked well as an attachment factor over a wide range of cell numbers for both PC-12 and HEK-293 cells. Lower cell numbers could not be tested reliably because they were close to the limit of sensitivity of the neutral red assay. The results shown are representative of at least 4 independent experiments performed with each cell line. Figure 2 incubator for 3 days, with a medium change performed every 24 h. The performance of PEI in these plates was then compared with plates treated with PEI using the standard protocol described for previous experiments. The results show relative cell counts normalized to the average of the absorbances obtained with the standard PEI-treated plates, which was given the arbitrary value of 100.0%. The results indicate that the PEI coating remains stable on the surface of the plastic dish for at least 10 days of refrigeration, and that it is not removed by incubation at 37\u00b0C in medium or even by repeated medium changes. Results are representative of 4 independent experiments performed in triplicate.To further characterize the properties of PEI as an attachment factor for weakly anchoring cells, experiments were carried out to analyze the dosage of PEI that can provide optimal cell anchoring, the range of cell numbers that can benefit from the presence of PEI, and the stability of PEI as attachment factor. Figure Transfection of eukaryotic cells by lipofection involves several steps, media additions and replacements, which can take a toll in weakly anchoring cells. Even if care is practiced to avoid cell loses, the weakly anchored cells may be less efficient in the uptake of the transfection complexes. Since PEI pretreatment of cell culture dishes increased the strength of attachment of cells to such surfaces, it was hypothesized that the attachment factor may have a positive effect in transfection yields obtained by lipofection. The three cell lines described above were used to test this hypothesis utilizing the coating agents previously examined. Transfections were performed with a plasmid encoding the reporter enzyme \u03b2-galactosidase. The transfection yield was monitored by determination of reporter enzyme activity in lysates from the transfected cells. At least two independent assays in triplicate were performed with each cell line. Representative plots are shown in Figure Compiling the results from all the experiments performed, the average fold-induction (\u00b1 standard deviation) observed in the transfection yield of PC-12 cells anchored to PEI as compared with cells on untreated wells was 2.4-fold , while the enhancement with HEK-293 cells was 6.3-fold . t-test statistical analysis indicates that both increases are significant (p < 0.05). No significant transfection enhancement was observed in the experiments with MYS cells, with an average fold-change of 1.0-fold  by the pretreatment with PEI .4 to 3.2 \u00d7 105 cells per well. When larger numbers of HEK-293 cells were utilized the results were more variable, suggesting that when these cells are near confluency they may be able to form monolayers that attach more firmly to the plate, however further experiments are necessary to study this hypothesis. The effects of PEI and the other cationic attachment factors on PC-12 and HEK-293 cells suggest that these cells have a limited capacity to produce an effective extracellular matrix to allow them to attach to the plastic surface, resulting in weak anchoring to the dishes on their own. Cationic polymers such as PEI and PDL seem to work very effectively to coat the surface of the dish and substitute for the absence of the extracellular matrix components. On the other hand, fibroblast cells (such as the MYS cells) are very efficient producing extracellular matrix proteins, which allows them to attach firmly to the culture dishes, therefore no benefit was observed by the use of attachment factors with these cells , but this is not so for protocols with HEK-293 cells. PEI was very effective in improving lipofection protocols with both cell lines. The firm attachment afforded by PEI allowed transfections with cationic lipids (lipofection) to provide higher yields and more consistent results.2 atmosphere in a tissue culture incubator (NuAire). Zebrafish retinal explants were maintained in L-15 complete medium: L15 medium (Sigma) supplemented with 1% fetal bovine serum (Hyclone), 100 u/ml penicillin, 100 \u03bcg/ml of streptomycin and 2 mM glutamax . The explants were incubated at 28\u00b0C at normal atmospheric CO2 concentrations.PC-12  cells were cultured with RPMI complete medium: RPMI medium (Invitrogen) supplemented with 10% horse serum and 5% fetal bovine serum (both from Hyclone), 100 u/ml of penicillin, 100 \u03bcg/ml of streptomycin, 10 mM HEPES, 2 mM glutamax and 1 mM sodium pyruvate . HEK-293  and MYS  cells were cultured in DMEM complete medium: DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), 100 u/ml of penicillin, 100 \u03bcg/ml of streptomycin and 2 mM glutamax . Cell lines were maintained at 37\u00b0C in a 5% CO6 cells) was added to each well of the MW12 and the plate was incubated at 37\u00b0C in a 5% CO2 atmosphere for 48 h. The cells were then examined under a phase contrast Olympus-CK40 microscope and photomicrographs were obtained with a Pixera Penguin 150 CL camera. The experiment was performed in triplicate and pictures were taken at the center, near the edge and midway between center and edge of the plate, to evaluate the distribution of cells on the wells.For the culture and microscopic observation of PC-12 cells, the wells of a multiwell-12 tissue culture dish  were pretreated for 20 min with 100\u2013200 \u03bcl of the different solutions of attachment factors: PEI-800 kDa, from Fluka, at 25 \u03bcg/ml in 150 mM NaCl; PDL, from ICN, at 100 \u03bcg/ml in deionized water; bovine dermal collagen, from ICN, 3 mg/ml aqueous solution. Usually, each column of wells in the MW12 was pretreated with one of the attachment factors, while the last column was left untreated. After removal of the different attachment factor solutions, 1 ml of a PC-12 cell suspension  was performed retro-orbitally with anesthetized zebrafish 10 days prior to explantation, using protocols previously described ,25. Cont5 PC-12 cells and cultured with RPMI complete medium as previously described. After 24 h, the medium was replaced by RPMI medium with low serum , which was supplemented with NGF (Sigma) at 100 ng/ml to induce differentiation. The culture medium was replaced by new RPMI low serum medium with 100 ng/ml of NGF every two days. At different times during the differentiation process , photomicrographs were obtained as previously described.The wells of a MW12 were pretreated with PEI as described above. The wells were then seeded with 2.5 \u00d7 106 cells per well for the experiments with PC-12 cells, 1.5 \u00d7 105 cells for the experiments with HEK-293 cells, or 3 \u00d7 104 cells for the experiments with MYS cells. The MW12 dishes were incubated at 37\u00b0C in a 5% CO2 atmosphere for 48 h in the case of PC-12 cells, or 24 h for HEK-293 and MYS cells. In all the experiments, the wells were washed 4 times with phosphate buffered saline (PBS) to test the strength of anchorage to the substratum. To estimate the number of cells remaining after the multiple washings, a procedure that utilizes the vital dye neutral red was employed [Pretreatment of MW12 dishes with the attachment factors was performed as described above. PC-12, HEK-293 and MYS cells were counted using a Neubauer hemocytometer, and the MW12 plates were seeded with 1 \u00d7 10employed . BrieflyTwo-sample (unpaired) t-test analyses were performed with a Microsoft Excel worksheet designed for this purpose. The worksheet calculates the t-factor by comparing 2 independent sets of data and estimates the probability (p) of obtaining that result assuming that the two samples came from the same population  based on the Student's t-distribution (two-tailed). The averages of the two samples from the same experiment were considered statistically different whenever p was lower than 0.01. For comparisons of the independent experiments, one-sample t-test analyses were utilized to estimate the p values and assess the statistical significance of the difference observed between the PEI-treated wells and the untreated controls. The effect of PEI was considered significant whenever p was lower than 0.05.5 HEK-293 cells were seeded onto the dishes and incubated at 37\u00b0C for 24 h. Untreated wells were seeded in the same manner as controls.For the determination of optimal concentrations of PEI for the pretreatment procedure, a series of solutions of PEI were prepared so that their final concentrations of PEI polymer (w/v) were 0.025, 0.25, 2.5, 25 and 250 \u03bcg/ml. They were used to coat MW12 tissue culture dishes as previously described for the 25 \u03bcg/ml solution. To test the efficacy of coating of the solutions, 2 \u00d7 10The dishes were then subjected to the multiple washing procedure described above and the number of cells remaining in the dishes was measured by the neutral red dye procedure as described previously. All experiments were performed in triplicate and the relative cell counts were calculated by normalization to the values obtained with 25 \u03bcg/ml of PEI, which was assigned a value of 100.0%.4, 8 \u00d7 104, 1.6 \u00d7 105 and 3.2 \u00d7 105) or PC-12 cells . Control untreated MW12 culture dishes were seeded with the same numbers of cells in parallel with the treated plates. After 24 h for the HEK-293 cells or 48 h for the PC-12 cells, the strength of anchoring of the cells to the dishes was measured as described before and relative cell numbers were determined . All experiments were performed in triplicate.The wells of MW12 culture dishes were pretreated with 25 \u03bcg/ml of PEI as described above. The wells were then seeded with various numbers of either HEK-293 cells . The strength of attachment of cells to these dishes was determined as mentioned before, and relative cell counts were calculated by normalization to the value obtained with the standard PEI-treated wells, which was assigned arbitrarily a value of 100.0%. All experiments were performed in triplicate.To analyze the stability of the PEI attachment factor onto the plastic surface of the tissue culture dish, two tests were performed. One MW12 dish was coated with 25 \u03bcg/ml of PEI as previously described, then the PEI solution was replaced by PBS and the dish was kept at 4\u00b0C for 10 days. A second MW12 dish was coated with 25 \u03bcg/ml of PEI, then the PEI solution was replaced by DMEM complete medium and the dish was kept at 37\u00b0C in the CO2 atmosphere for 48 h for the PC-12 cells, or 24 h for the HEK-293 and MYS cells, the transfection yield was determined by measuring \u03b2-galactosidase activity in cell extracts [2HPO4, 36 mM NaH2PO4, 2 mM MgCl2 and 100 mM \u03b2-mercaptoethanol). The reaction mixture was incubated at 37\u00b0C until development of yellow coloration was apparent . Reactions were stopped by the addition of 500 \u03bcl of 1 M Na2CO3. The relative levels of \u03b2-galactosidase activity were obtained by determination of the absorbance at 420 nm in a spectrophotometer (Beckman DU500). Parallel assays with cells transfected with pcDNA3 plasmid (Invitrogen) were conducted as negative controls in every experiment, and subtracted from the experimental absorbances to correct for endogenous activities. The experiments were conducted in triplicate. Absorbances were normalized to the values obtained with PEI-pretreated wells.MW12 culture dishes were pretreated and seeded with cells as indicated above for the cell number measurements. The cells were subjected to lipofection with 1 \u03bcg per well of the plasmid pcDNA3-\u03b2gal  and Lipoextracts . The celThe authors declare that they have no competing interests.A.R.V. performed the experiments comparing the various attachment factors. S.G. and K.L.V.P. performed the PEI dosage, cell number and PEI stability analysis experiments, as well as the NGF differentiation experiments with PC-12 cells. M.J. participated in the experiments with MYS cells. R.P.B. and M.G.G. collaborated as Principal Investigators in this project, participating in the design of the experiments and the writing of the manuscript. R.P.B. performed the experiments with zebrafish retinal explants."}
{"text": "S. cerevisiae as a model system. Through the use of arrayed yeast strains harboring ordered deletions of open reading frames, we determined that 54 out of the 4,507 yeast genes examined significantly influence AHR signal transduction. In an effort to describe the relationship between these modifying genes, we constructed a network map based upon their known protein and genetic interactions. Monte Carlo simulations demonstrated that this network represented a description of AHR signaling that was distinct from those generated by random chance. The network map was then explored with a number of computational and experimental annotations. These analyses revealed that the AHR signaling pathway is defined by at least five distinct signaling steps that are regulated by functional modules of interacting modifiers. These modules can be described as mediating receptor folding, nuclear translocation, transcriptional activation, receptor level, and a previously undescribed nuclear step related to the receptor's Per\u2013Arnt\u2013Sim domain.The aryl hydrocarbon receptor (AHR) is a vertebrate protein that mediates the toxic and adaptive responses to dioxins and related environmental pollutants. In an effort to better understand the details of this signal transduction pathway, we employed the yeast  4500 yeast deletion mutants, transformed with a reporter construct that is sensitive to dioxin, were used to create a protein-interactive map that outlines five distinct steps required for dioxin-mediated cell signaling The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor found in a variety of vertebrate species. The AHR is a prototype member of the Per\u2013Arnt\u2013Sim (PAS) superfamily of signaling molecules. Members of this superfamily regulate cellular responses to a variety of environmental stimuli, including pollutants, hypoxia, and external light cues . Our iniCYP1A1, CYP1A2, and CYP1B1  strategy to provide a framework to describe AHR signaling. By coupling both computational and experimental annotations, we were able to deduce the minimum number of genetic loci and signaling events required for AHR signaling.Saccharomyces cerevisiae is a valuable model system for the study of signaling by mammalian nuclear receptors  and large-scale databases describing protein and genetic interactions  . This chSaccharomyces Genome Deletion Project (wt) BY4742 strain (p < 10\u20136). To minimize false positives, we selected clones that influenced signaling at no less than two of the six concentrations of agonist tested. In addition, we retested each positive strain in a secondary screen with another AHR system containing the same LacZ reporter and a high-copy AHR\u2013LexA chimera (pAHR)  . By thest strain .To eliminate those deletions that influenced the AHR pathway in a nonspecific manner, each of the 92 deletion strains was examined with a control plasmid pGal4TAD see . This coOf these \u201cAHR-specific\u201d factors, Hsc82p and Cpr7p were previously described AHR modifiers, and the other 52 were novel  Table S. The anaRecent experiments from a number of laboratories have provided data to support the idea that protein interaction network (PIN) can be used to portray the workings of complex biological systems . To invemax). One common feature of AHR\u2013PINs with Dmax values greater than 1 was that the majority of M-nodes were interconnected in a single large network with no breaks (max was set at low stringency (Dmax \u2265 3), the representation of M-nodes in AHR\u2013PIN was high. For example, at Dmax = 3, 46 of 54 M-nodes were included. However, AHR\u2013PINs resulting from these inclusive, yet low-stringency conditions exhibited high complexity, which made it impossible to assess the interactions visually (max was set at higher stringency (Dmax = 2), the resultant AHR\u2013PIN now comprised 34 closely interconnected M-nodes and was much easier to visualize  are interconnected, while in corresponding random PINs with mock M-nodes, this number drops to 18.5% (10/54). Although the AHR\u2013PINs at Dmax = 3 and Dmax = 4 also exhibited statistically significant differences from random PINs, these AHR\u2013PINs were not considered further for two reasons. First, these networks were visually complex and could not be simply annotated in two dimensions. Second, the ratios of interconnected M-nodes in these AHR\u2013PINs to those of random PINs were quite low . This observation suggests a much greater potential for displaying false positive interactions at these settings as compared to the AHR\u2013PIN at Dmax = 2, where this ratio was 3.4 (34/10).For further exploration, we chose to focus on the network with the greatest statistical significance, i.e., the PIN generated at DOur next objective was to use the PIN to enumerate and define steps in AHR signaling. It has been suggested that PINs exhibit a modular nature, with each module comprising highly interconnected proteins of related cellular functions . Our hypmax = 2). Each distance (d) in the matrix refers to the length of the shortest path between a pair of nodes in the full network space of yeast genomic PIN and was transformed into an \u201cassociation\u201d value (21/d). The resultant pairwise association matrix was used to identify network clusters in the AHR\u2013PIN by a hierarchical average-linkage clustering algorithm  at various agonist concentrations, times, and temperatures, as well as after exposure to two distinct AHR agonists, \u03b1-naphthoflavone (\u03b1NF) and \u03b2-naphthoflavone (\u03b2NF). The relationship between each modifier and signaling was then examined using a hierarchical average-linkage clustering algorithm  Figure A. It waswt strain was transformed with the plasmid pAHRGFP, it was found that the fusion protein was evenly distributed in the cell in the absence of AHR agonist. In the presence of the agonist \u03b2NF, the AHR\u2013GFP protein translocated to the nucleus (wt strain (group I). Approximately 30% of the strains were found to contain a marked reduction in the level of AHR protein in the cell (group II). Approximately 10% of the deletion strains displayed receptor aggregates in the cell (group III). The final 10% of the deletion strains displayed a normal level of AHR protein, but the receptor failed to translocate into the nucleus in the presence of agonist (group IV). When overlaid with the previously determined experimental layers, group I was found to overlap with the modules of C and D, and groups II, III, and IV corresponded to modules B, A, and E, respectively . When the  nucleus A. To exa nucleus B. About ectively C. Accordectively C.Our initial objective was to identify the number of loci that are required for AHR signal transduction. In this regard, our high-throughput deletion screen identified 52 novel and two known AHR modifiers. Although this is a surprisingly large number of modifiers for the function of a single protein, it is probably an underestimate since the deletion screen cannot identify modifiers that are encoded by essential genes. Moreover, our criteria of including only strong modifiers (influence of 4-fold compared to control) may have caused us to miss some important modifiers of this pathway. Nevertheless, the number of AHR modifier loci reported here is approximately 10-fold greater than what has been reported using mammalian cell culture and animal models .max was set at 2, 3, or 4, the resultant AHR\u2013PIN was of a complexity that could not have resulted from random chance. Furthermore, the comparison of various simulations at different Dmax settings guided us to select the linking parameter at Dmax = 2. This setting of intervening links resulted in the highest level of statistical significance, displayed the lowest potential for false positive interactions, and decreased the map's visual complexity to a level that was readily understood in a two-dimensional map.Once we identified these AHR modifiers in yeast, we sought a way to position and characterize them in the context of the AHR pathway. Given the idea that PINs can be used to portray the cellular workings, we attempted to use our deletion data to generate and annotate an AHR\u2013PIN . To consOur analysis of the AHR\u2013PIN revealed an underlying modular structure. That is, there are areas in the AHR\u2013PIN that display high interconnectedness of nodes, and these regions represent functionally related modifiers. The modularity of AHR\u2013PIN was revealed by both computational and functional tests. In our initial computational approach, a total of ten clusters were identified, and the functional enrichment of each cluster was calculated by hypergeometric distribution .Although the computational approaches of module identification and annotation were useful in hypothesis generation, they did not provide a direct description of AHR signaling. Therefore, we set out to annotate the AHR\u2013PIN with a number of functional tests. In our first annotation experiment (\u201cdomain influence\u201d), we found that the AHR\u2013PIN could be divided into three discrete functional modules . Additionally, each of these modules was found to overlap with one to several network clusters see . This tiA module that regulates AHR folding was identified by the known activities of its constituents, as well as the appearance of receptor aggregates when these modifiers were absent see . In addiThe AHR folding module can also be used to explain the existence of I-nodes within a functional module. Given their \u201clinker\u201d position and the observation that they often share similar annotated function with their neighboring M-nodes (data not shown), it is a logical prediction that I-nodes play a role in AHR signaling that is functionally similar to their modifier neighbors. We propose that I-nodes most commonly arise as the result of their essential gene nature  or because they represent a redundant gene product (white nodes in the figures). We offer two examples that support this idea. First, one essential gene I-node in the folding module, Cns1p, has recently been reported to be involved in AHR signaling . Second,The composition of the transcriptional activation module suggests that the AHR activates target genes via the coordination of histone acetylation, ATP-dependent chromatin remodeling, and direct recruitment of basal RNA polymerase II transcriptional apparatus see . We baseOur network analysis has also identified a functional module that regulates the ligand-dependent translocation of the AHR see . This nuA module that regulates the amount of receptor protein was also identified in our AHR\u2013PIN see . This moA novel PASB-dependent step in AHR signaling appears to have been revealed by this network analysis see , group IWe began this study with the objective of defining the AHR signal transduction pathway in a manner that would allow us to quantify the number of loci and enumerate the steps involved in signaling. By integrating our deletion screen with the PIN framework and through subsequent computational and experimental annotations, we were able to identify modifier modules that regulate five distinct AHR signaling steps. In this regard, we found that the integration of multiple annotation approaches is vital for the reconstruction of the final picture by connecting and cross-validating individual information pieces. As interaction datasets become more fully developed and annotated, such a map will steadily improve and provide more accurate description of AHR signaling. Lastly, the systematic strategy that we developed in this work should be readily applicable to the study of most mammalian proteins to reconstruct corresponding modifier networks that regulate their signaling.S. cerevisiae strain BY4742  was used in this study. This deletion set was obtained from Research Genetics  in a 96-well arrayed format. The plasmid pCEN-AHR (PL1605) was constructed by replacing the TRP1 autotrophic marker of PL883 (HIS3 marker using a \u201cmarker swap\u201d method (ADH1) promoter. LexA-AHRN\u0394166 is a chimeric AHR, with its amino acid residues 1\u2013166 replaced by residues 1\u2013202 of bacterial repressor LexA, and is referred to in the Results section simply as \u201cAHR\u201d for convenience. The reporter plasmid pSH18\u201334 (PL623)  is a 2\u03bc-based, URA3-selectable vector that contains the bacterial LacZ gene, as a reporter, under the control of eight LexA-binding sites. The plasmid pEG202  is a 2\u03bc-based, HIS3-selectable plasmid containing the LexA1\u2013202 sequence under the control of the ADH1 promoter. The plasmid pAHR (PL700) has been described previously (GAL4 inserted into the EcoRI site of pEG202. The control plasmid pAHR\u0394PASB (PL1799) is the same as pAHR except for the removal of the C-terminal half of the PAS domain. This pAHR\u0394PASB plasmid was constructed by subcloning the EcoRI fragment of PL248 . The OD600 was measured using a SpectraMax 250 microplate reader . Cells were then subjected to centrifugation at 3,500 rpm for 8 min, and the supernatant was decanted. The 96-well plates were placed upside-down on a stack of paper towels for 10 min to drain residual medium. For transformation, each plate was vortexed at maximal speed for 15 s before dispensing 22 \u03bcl of DNA in \u201cOneStep\u201d buffer  into each well. To make the DNA in \u201cOneStep\u201d buffer, one volume of DNA  was mixed vigorously by vortexing with ten volumes of \u201cOneStep\u201d buffer. After DNA was dispensed, the plate was quickly vortexed again at maximal speed for 10 s to resuspend the cells, followed by incubation at 45\u00b0C for 40 min. After this \u201cheat shock\u201d step, 5 \u03bcl of the transformation mix from each well was inoculated into a fresh 96-well flat-bottomed plate containing 96 \u03bcl per well of dropout medium without Trp, Ura, and His (dropout minus TUH medium) plus G418. The inoculum was gently mixed by vortexing and incubated at 30\u00b0C for about 4 d until transformants grew out.A high-throughput protocol was developed for 96-well transformation based on work previously described . Unless LacZ reporter assay, transformants from the 96-well plates were rearrayed into 384-well stock plates containing 30 \u03bcl per well of dropout minus TUH medium. The inoculum was incubated at 30\u00b0C for 2\u20133 d to allow cell growth. For the LacZ reporter assay at each agonist concentration, 0.5 \u03bcl of cell culture was transferred from the 384-well stock plate (30\u00b0C) into a clear-bottomed/black-walled 384-well assay plate  using a disposable 384-pin replicator (GenomeSystems/Incyte Genomics). In the 384-well assay plate, each well contained 18 \u03bcl of dropout minus TUH medium (diluted 1:4 in water) plus agonist at the tested concentration. The plates were then incubated at 30\u00b0C for 48 h to allow all strains to reach stationary phase. Cell growth was monitored by measuring the OD600 of each well using a SpectraMax Plus384 microplate reader (Molecular Devices). To initiate the fluorescence assay, 18 \u03bcl of lysis/assay buffer was added to each well. Lysis/assay buffer contained a mixture of CUG substrate , 10% SDS, 1 M NaPO4, and 25\u00d7 TAE in the ratio of 1:1.4:350:17.5. For assays with pCEN-AHR transformants, no TAE was required. Plates were vortexed at medium speed for 1 min and left at room temperature for 20 min. The reaction was stopped by dispensing 6.5 \u03bcl of 25\u00d7 TAE to each well and vortexing at medium speed for 1 min. The fluorescence emission of each well was detected using a Wallac \u201cVICTOR V\u201d microplate reader . The fluorescence reading was normalized to the corresponding OD600 value to obtain the LacZ reporter activity of each deletion strain.To perform the Selected deletion strains were transformed with the plasmid pAHRGFP. Transformants were incubated in a 96-well microtiter plate containing 100 \u03bcl per well of dropout minus TH medium at room temperature. Given that we have observed that small temperature shifts can affect AHR's localization, we found it more convenient to both grow and examine cells at the same temperature. For some samples, assays were repeated at 30\u00b0C using a heating chamber attached to the microscope. Such results were found to be comparable to those obtained at room temperature. For strains that reached early log phase, 0.5 \u03bcl of culture was mounted on a glass slide, and the AHR\u2013GFP subcellular localization was examined using a Zeiss  Axiovert 200M microscope (\u03b1 Plan-FLUAR 100\u00d7 objective). Images were captured using an AxioCam HR digital microscope camera (Zeiss). To stain the nucleus in living cells, 4,6-diamidino-2-phenylindole (DAPI) was added to the dropout minus TH medium to a final concentration of 5 \u03bcg/ml.LacZ reporter activity of each deletion strain was compared to the average of wt BY4742 strain controls included in the same plate, and the fold change was obtained and log2 transformed. These data-processing steps, as well as subsequent modifier selection, were performed automatically using Perl scripts written \u201cin house.\u201d In brief, for the primary screen involving 4,507 deletion strains with low-copy pCEN-AHR system, a stringent cutoff of 4-fold change over wt control was chosen for selecting a pool of most significant AHR signaling mutants. This cutoff corresponds to a p value of less than 10\u20136 at all six assessed concentrations (null distribution: wt control). The initial positives were subject to validation and characterization in secondary screens with high-copy pAHR and control systems. The cutoffs for control pathways pGal4TAD and pAHR\u0394PASB in the secondary screens were chosen at 2-fold change over wt control, which corresponds to p values of 3.3 \u00d7 10\u20132 and 5.6 \u00d7 10\u20134 (null distribution: wt control), respectively.To identify deletions that modify AHR signaling, the http://dip.doe-mbi.ucla.edu) and the genetic interaction table from the MIPS database (http://mips.gsf.de/proj/yeast/). Perl scripts, written \u201cin house,\u201d were used to search the combined physical and genetic interaction database and identify all valid paths  that linked each pair of modifiers. The network graph was rendered using the Graphviz tool kit (http://www.research.att.com/sw/tools/graphviz/)  .Within experimental annotation layers of the AHR\u2013PIN, the region corresponding to each functional module was outlined by a closed line (boundary) drawn manually on the network map. This boundary was delineated to include the maximal number of modifier nodes that are members of the corresponding functional module and the minimal number of modifier nodes that are nonmembers. This boundary was also defined in such a way that all enclosed modifier nodes were interconnected via paths within the enclosed region or through at most one modifier node outside. When defining functional modules in the summary AHR\u2013PIN, the highest weight was given to the results from the localization influence experiments because these results provided the most direct indication of a modifier's effect on AHR signaling, and the lowest weight was given to the pharmacology clustering result because this result was highly sensitive to the choice of clustering algorithm.Table S1wt BY4742 strain. Also shown are their known gene names, products, gene descriptions, and Gene Ontology (GO) annotations .Click here for additional data file.Table S2This table contains all of the ORFs that were observed to influence the signaling of the AHR but not the pGal4TAD control. Also shown are their known gene names, products, gene descriptions, and GO annotations .(27 KB XLS).Click here for additional data file.Table S3This table summarizes the annotation on cellular functions of AHR modifiers. The annotation was derived from the YPD database, as of May 2002  .(23 KB XLS).Click here for additional data file.Table S4max = 2). Also shown are their known gene names, products, gene descriptions, and GO annotations .Click here for additional data file.Table S5p value is shown .This table summarizes the functional enrichment of each network cluster as calculated by the hypergeometric distribution of MIPS and GO annotations. For each cluster, the functional enrichment is determined by using M-nodes alone and both M- and I-nodes, respectively. In each case, the annotation that corresponds to the largest number of nodes in the cluster and the smallest (22 KB XLS).Click here for additional data file."}
{"text": "The 5T33 multiple myeloma is one of a series of transplantable murine myelomas arising spontaneously in C57BL/KaLwRij mice. This study describes the establishment and characterisation of the 5T33 murine myeloma in vitro as a cultured cell line in terms of its morphology, growth rate, expression of paraprotein (IgG2b) and tumorigenicity in syngeneic animals. The 5T33 cell line has been in continuous culture for over 10 months and has achieved more than passage 34. In culture, 5T33 myeloma grows as single cells or in small clusters of loosely adherent cells on an adherent stromal cell layer. Maximum doubling time is approximately 25 h, and over 90% of the cells express cytoplasmic IgG2b paraprotein. The cultured 5T33 myeloma cells are highly tumorigenic in C57BL/KaLwRij mice with as few as 500 cells inducing paralysis and death as early as day 36 post-tumour inoculation. Kinetics of tumour development and detection of IgG2b paraprotein are dose dependent. Two weeks following intravenous inoculation of 5 x 10(5) cultured 5T33 myeloma cells, tumour cells were readily identified in the bone marrow. By 3 weeks post-tumour inoculation, 5T33 myeloma cells were found in various tissues throughout the animal. Studies are now underway to determine the sensitivity of this cell line to various therapeutic modalities."}
{"text": "Our previous studies demonstrated that, in other cell types, galangin is a potent inhibitor of the aryl hydrocarbon receptor (AhR), an environmental carcinogen-responsive transcription factor implicated in mammary tumor initiation and growth control. Because some current breast cancer therapeutics are ineffective in estrogen receptor (ER) negative tumors and since the AhR may be involved in breast cancer proliferation, the effects of galangin on the proliferation of an ERFhAhRR) were studied in Hs578T cells by western blotting for nuclear  AhR and by transfection of an AhR-driven reporter construct, pGudLuc. The effects of these agents on cell proliferation were studied by 3H-thymidine incorporation and by flow cytometry. The effects on cyclins implicated in mammary tumorigenesis were evaluated by western blotting.AhR expression and function in the presence or absence of galangin, a second AhR inhibitor, \u03b1-naphthoflavone (\u03b1-NF), an AhR agonist, indole-3-carbinol, and a transfected AhR repressor-encoding plasmid . Galangin inhibited transition of cells from the G0/G1 to the S phases of cell growth, likely through the nearly total elimination of cyclin D3. Expression of cyclins A and E was also suppressed.Hs578T cells were shown to express high levels of constitutively active AhR. Constitutive and environmental chemical-induced AhR activity was profoundly suppressed by galangin as was cell proliferation. However, the failure of \u03b1-NF or Galangin is a strong inhibitor of Hs578T cell proliferation that likely mediates this effect through a relatively unique mechanism, suppression of cyclin D3, and not through the AhR. The results suggest that this non-toxic bioflavonoid may be useful as a chemotherapeutic, particularly in combination with agents that target other components of the tumor cell cycle and in situations where estrogen receptor-specific therapeutics are ineffective. Flavonoids are a diverse class of naturally occurring polyphenolic plant compounds that have a variety of therapeutically important biological activities. Several thousand plant flavonoids have been identified and biologically significant levels of bioflavonoids are consumed about 1 g/day) by humans living in Western cultures  g/day by, flavonoAlpinia officinarum, a plant used for many years in Asia as an herbal therapeutic -thymidine incorporation experiments, cell cycle and apoptosis analyses, and western immunoblotting, participated in the experimental design and coordination of this project, and participated in writing the manuscript. XY performed transient transfections and reporter assays and western immunoblotting, participated in the experimental design and coordination of the project, and contributed to the writing of the manuscript. DHS conceived of the experimental design, performed statistical analyses, and prepared the manuscript. All authors approved the final manuscript.TJM performed ["}
{"text": "Cell killing can be achieved in an acidic environment in tissue culture (medium pH less than 7.0) by agents ) which transport protons from the extracellular space into the cytoplasm. Cell killing is enhanced when these agents are used in combination with compounds ) which inhibit the membrane-based exchangers responsible for the regulation of intracellular pH (pHi). We describe experiments which assess the ability of these agents to kill tumour cells in spheroids and in vivo. Both nigericin and CCCP were observed to penetrate tissue based on their ability to kill tumour cells in spheroids. The mean extracellular pH (pHe) of the KHT fibrosarcoma and the EMT-6 sarcoma were observed to be 0.21 and 0.32 pH units more acidic than the mean pHe in muscle tissue. Intraperitoneal (i.p.) administration of the vasodilator hydralazine (10 mg kg-1) caused a reduction of the mean pHe of the KHT but not the EMT-6 tumour. Nigericin  plus amiloride  followed 30 min later by hydralazine  reduced the surviving fraction of cells in the KHT and EMT-6 tumours, but had minimal effects on growth delay. When KHT tumours were treated with 15 Gy X-rays followed immediately by nigericin plus amiloride and hydralazine a reduced surviving fraction as well as an increase in tumour growth delay was observed compared to radiation alone. The administration of nigericin  or the combination of nigericin  followed by hydralazine ) resulted in reductions of tumour pHi of 0.27 and 0.29 pH units respectively as determined by 31P magnetic resonance spectroscopy (MRS). Our results show that the combination of nigericin and hydralazine (with or without amiloride) can kill cells in rodent solid tumours and that cell killing is associated with a reduction in the mean pHi of tumour cells."}
{"text": "The effects of cholera toxin (CT) and 8-chloro-cAMP (8-Cl-cAMP) on cell growth were investigated using two human pancreatic carcinoma cell lines . CT, which catalyses the ADP ribosylation of Gs, suppresses the proliferation of MIA PaCa-2(PC) cells. CT at the low dose of 0.1 pg ml-1 was inhibitory of PC cell growth, and the maximum suppression (70%) was achieved at a CT concentration of 100 pg ml-1. This phenomenon was reversible. The production of cAMP by CT (100 pg ml-1) in PC cells was enhanced 320-fold compared with the control. In addition, cAMP analogues  and forskolin decreased the growth rate of PC cells in a dose-dependent manner. These results support the view that CT suppresses PC cell growth by stimulating cAMP production. Conversely, Panc-1 cells were far less sensitive to CT in cell growth and cAMP production. 8-Cl-cAMP was also less effective on Panc-1 cell growth. The binding of an insulin-like growth factor (IGF)-I and transforming growth factor (TGF)-alpha, which has been shown to stimulate PC cell growth in an autocrine manner, to PC cells was not modified in cells treated with CT or 8-Cl-cAMP. The results suggest that the inhibitory actions of these substances do not occur at the level of the receptor for IGF-I or EGF/TGF-alpha. We have previously shown that phorbol esters, which decrease the binding of TGF-alpha to PC cells, has an anti-proliferative activity on these tumour cells. Inhibited cell growth by maximum suppressive dose of CT or 8-Cl-cAMP was further inhibited by TPA. In addition, an oncogene product of K-ras which is commonly activated in pancreatic cancer, was increased by CT and 8-Cl-cAMP. It is concluded that CT and 8-Cl-cAMP inhibit PC cell growth, presumably in a similar manner, and their mechanism(s) of action may be different from that of TPA. The anti-proliferative effect of CT or 8-Cl-cAMP was enhanced by TPA, implying that the combination of these substances results in increased inhibition of the PC cell growth."}
{"text": "Dioxins and related compounds are suspected of causing neurological disruption in human and experimental animal offspring following perinatal exposure during development and growth. The molecular mechanism(s) of the actions in the brain, however, have not been fully investigated. A major participant in the process of the dioxin-toxicity is the dioxin receptor, namely the aryl hydrocarbon receptor (AhR). AhR regulates the transcription of diverse genes through binding to the xenobiotic-responsive element (XRE). Since the AhR has also been detected in various regions of the brain, the AhR may play a key role in the developmental neurotoxicity of dioxins. This study focused on the effect of AhR activation in the developing neuron.The influence of the AhR on the developing neuron was assessed using the Neuro2a-AhR transfectant. The undifferentiated murine neuroblastoma Neuro2a cell line (ATCC) was stably transfected with AhR cDNA and the established cell line was named N2a-R\u03b1. The activation of exogenous AhR in N2a-R\u03b1 cells was confirmed using RNAi, with si-AhR suppressing the expression of exogenous AhR. The neurological properties of N2a-R\u03b1 based on AhR activation were evaluated by immunohistochemical analysis of cytoskeletal molecules and by RT-PCR analysis of mRNA expression of neurotransmitter-production related molecules, such as tyrosine hydroxylase (TH).N2a-R\u03b1 cells exhibited constant activation of the exogenous AhR. CYP1A1, a typical XRE-regulated gene, mRNA was induced without the application of ligand to the culture medium. N2a-R\u03b1 cells exhibited two significant functional features. Morphologically, N2a-R\u03b1 cells bore spontaneous neurites exhibiting axon-like properties with the localization of NF-H. In addition, cdc42 expression was increased in comparison to the control cell line. The other is the catecholaminergic neuron-like property. N2a-R\u03b1 cells expressed tyrosine hydroxylase (TH) mRNA as a functional marker of catecholaminergic neurotransmitter production. Thus, exogenous AhR induced catecholaminergic differentiation in N2a-R\u03b1 cells.The excessive activation of AhR resulted in neural differentiation of Neuro2a cells. This result revealed that dioxins may affect the nervous system through the AhR-signaling pathway. Activated AhR may disrupt the strictly regulated brain formation with irregular differentiation occurring rather than cell death. AhR in (TCDD) ,4. Severn (TCDD) ,6.The AhR is activated by binding to ligands, including dioxins, translocates from the cytoplasm to the nucleus and then binds to the consensus sequence known as XRE (xenobiotic responsive element) . XREs arOne of the dioxins, TCDD, can also influence the developing brain. After exposure to experimental animals, TCDD was detected in the brain and impaired their learning behavior. Perinatal exposure to TCDD has also been found to remarkably affect learning ability in rats and monkeys -17. HoweThe dioxin receptor, namely the AhR, is expressed in various regions of the brain ,19 durinin vivo [The regulation of neurogenesis is key event for controlling brain development. To understand the regulatory mechanisms of neurogenesis, neuroblastoma is widely used as an experimental model. Neuroblastoma usually arises from the proliferation of neural crest-derived precursors resulting in defective differentiation in vivo . Neuroblin vivo ,25. Neurin vivo ,27. In t2/95% air.Neuro2a, a murine neuroblastoma cell line, was purchased from American Type Culture Collection, and was routinely grown in Dulbecco's modified Eagle's medium and medium F12 in a 1:1 ratio, supplemented with 10% fetal calf serum. Cells were grown at 37\u00b0C in a humidified atmosphere of 5% COPyrobest DNA polymerase . PCR primers were designed to contain appropriate restriction sites for subcloning. The sequences of the primers were: 5'-CCCAAGCTTACCATGAGCAGCGGCGCCAACATCA-3' (HindIII) and 5'-CCGCTCGAGAGGAATCCGCTGGGTGTGATATCAG-3' (XhoI). After digestion with HindIII and XhoI, the PCR product was cloned into the mammalian expression vector pcDNA4/V5-His  digested with HindIII and XhoI. The resulting vector contained the coding sequence of AhR fused to the V5/His tag under the control of cytomegalovirus promoter. Correct insertion of the PCR product was verified by DNA sequencing.The coding sequence of AhR was obtained by RT-PCR from rat brain RNA with 4) were transfected with 0.8 \u03bcg of constructed plasmid using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen Japan KK). Cells transfected with a vector without the insert were used as a control. After culturing for 72 h in normal medium, the cells were switched to medium supplemented with 250 \u03bcg/ml antibiotic zeocin (Invitrogen Japan KK). The medium was changed every 3 days during selection of viable cells. After 2 weeks, viable cells were isolated using cloning rings. The isolated clones were cultured in medium supplemented with 250 \u03bcg/ml zeocin for another 2 weeks and the viable clones were selected for further characterization.Neuro2a cells were maintained and grown in Dulbecco's modified Eagle's medium and medium F12 in a 1:1 ratio, supplemented with 10% fetal calf serum. The cells (8 \u00d7 10Ex Taq polymerase (TAKARA BIO Inc.) using gene-specific primers. The primer sequences were as follows: AhR, 5'-CCGTCCATCCTGGAAATTCGAACC -3', 5'-CCTTCTTCATCCGTTAGCGGTCTC; CYP1A1, 5'-TTGCCCTTCATTGGTCACAT-3', 5'-GAGCAGCTCTTGGTCATCAT-3'; AhRR, 5'-CCCAAACTCAATTACTTAGCAGG-3', 5'-GCTTCCAGGGTAGGGCACACAGG-3'; GST, 5'-CCTGGCTGCAGCAGGGGTGGAG-3', 5'-CGGTTTTTGGTCCTGTCTTTTGC-3'; cdc42, 5'-GATACTGCAGGGCAAGAGGA -3', 5'-CAGGCACCCACTTTTCTTTC-3'; TH, 5'-CCACGGTGTACTGGTTCACT-3', 5'-GGCATAGTTCCTGAGCTTGT -3'; Nurr, 5'-CCAATCCGGCAATGACCAG-3', 5'-GTCAGCAAAGCCAGGGATCTTC-3'; Cyclophilin, 5'-GTCTCCTTCGAGCTGTTTGCAG-3', 5'-CCATCCAGCCATTCAGTCTTGG-3'. PCR products were electrophoresed on 3% Nusieve 3:1 agarose gel (TAKARABIO inc.) and then stained with ethidium bromide. The intensities ofthe bands were quantified using ImageJ software [Total RNA was isolated from cultured cells following a 2-day culture using RNeasy . Rat brain RNA was extracted from 8-week-old Sprague-Dawley rats. The rats were killed by cervical dislocation under ether anesthesia and the brains were dissected.Total RNA was extracted by Quick Prep Total RNA Extraction Kit . Total RNA of mouse brains were purchased from ZYAGEN laboratories . These RNAs were reverse-transcribed into cDNA using Superscript II reverse transcriptase (Invitrogen Japan KK). PCR was performed with software  and thenTwo siRNAs, si-AhR and scramble, were synthesized (Qiagen KK) and transfected into the cells using RNAiFect according to the manufacturer's instructions (Qiagen KK). The siRNA sequences were: si-AhR, 5'-UCCCACAUCCGCAUGAUUATT-3', 5'-TTAGGGUGUAGGCGUACUAAU-3'; scramble, 5'-UACCCAUCAUGACCCUGAUTT-3', 5'-TTAUGGGUAGUACUGGGACUA-3'. Two days after transfection, total RNA was extracted from the cells and reverse-transcribed with Superscript II reverse transcriptase. The cDNAs were used in real-time PCR as templates for quantification.AhR, CYP1A1 and cdc42 mRNA expression were quantified in AhR by real-time PCR. The primers used in real-time PCR were the same as those described above. Real-time PCR was carried out with DNA engine  using the DyNAamo SYBR Green qPCR Kit . The PCR conditions were: 95\u00b0C for 5 min, 40 cycles of 95\u00b0C for 10 s, 58\u00b0C for 10 s, and 72\u00b0C for 20 s with fluorescence measurements read during each cycle. The expression levels of AhR and CYP1A1 mRNAs were normalized to those of cyclophilin mRNA. The series of measurements was performed four times.Tissues and cells were homogenized in phosphate buffered saline (PBS) and denatured with SDS. Total protein concentrations were determined by Bio-Rad Protein Assay . Proteins (30 \u03bcg/lane) were fractionated on 10% SDS-PAGE and transferred to PVDF membrane . Membranes were blocked with Block Ace  and then incubated with an anti-AhR mouse monoclonal antibody . After incubation with the primary antibody, the membrane was washed three times with tris-buffered saline (TBS). The blots were subsequently exposed to an alkaline phosphatase-conjugated rabbit anti-mouse IgG . The blots were visualized with BCIP-NBT substrate solution .After being cultured for 2 days, the cells were rinsed with phosphate-buffered saline (PBS) and fixed with methanol for 25 min at 4\u00b0C. They were incubated with monoclonal anti-phosphorylated neurofilament 200-kDa antibody . After washing five times with PBS, the cells were treated with FITC-conjugated goat anti-mouse IgG  and were then subjected to fluorescence microscopy.3) were seeded in each well of a 96-well flat bottom culture plate and cultured for 1, 3 and 7 days. Cell proliferation was measured by Alamar Blue dye reduction assay . Briefly, Alamar Blue solution  was added to each well and the plate was incubated for 2h at 37\u00b0C. Dye reduction was measured in a Mithras LB940 microplate reader  at 530 nm excitation and at 590 nm emission. Cell proliferation rate was calculated as the fold increases, compared with the value at day 1.Cells . All experiments were replicated at least three times. Data were analysed using Student's T-test with the Exel software package.To investigate the function of AhR in developmental neurotoxicity, we attempted to establish Neuro2a-AhR transfectants. The murine neuroblastoma cell line, Neuro2a, was transfected with AhR cDNA in the expression vector (pcDNA4/V5-His), which includes the V5 epitope and the cytomegalovirus promoter. Seventy-five stably transfected clones were obtained after selection with zeocin. One of the clones, named N2a-R\u03b1, was selected and used in a further series of experiments. Figure RT-PCR analysis was performed using mRNA isolated from transfectants to evaluate the expression of AhR mRNA with AhR-specific primers. The AhR primers were designed for rat AhR, but also specifically recognize and amplify mouse AhR under identical PCR conditions Fig . AhR mRNIn order to confirm the transcriptional activity of the exogenous AhR in N2a-R\u03b1, we analyzed CYP1A1, GST and AhRR (AhR repressor) mRNA expression as functional markers of AhR -11,29. TIf the AhR stimulated the expression of XRE-mediated genes in N2a-R\u03b1, such as CYP1A1, this expression would be attenuated by suppressing AhR activity. In this context, we attempted to suppress the AhR transcription using RNA interference. Two siRNAs  were transfected into N2a-R\u03b1 cells. Two days after transfection, the expression of AhR and CYP1A1 mRNA was measured by real-time quantitative PCR. As a result, AhR mRNA was decreased about 30% in N2a-R\u03b1 cells transfected with AhR siRNA, while the CYP1A1 mRNA level was decreased about 60%  and Nurr-1. TH is the rate-limiting enzyme in the production of neurotransmitters and is considered an adequate marker of catecholaminergic neurons ,41. NurrActivation of the AhR by dioxins results in the induction of xenobiotic metabolism and successive toxic responses, including hepatocellular damage, immune system disorders, reproductive system disorders, teratogenesis and carcinogenesis -48. In tIn the nervous system, dioxins and related compounds are suspected to cause neurological disruption in human and experimental animal offspring following perinatal exposure during development and growth ,53. The AhR-mediated pathways exist to mediate the effects of TCDD in many organs such as the liver, reproductive organs or immune tissues. ,6. HowevWe have shown that the AhR is also functional in N2aR\u03b1 cells even in the absence of ligand. This is based on the finding that the increase of CYP1A1 mRNA expression caused by over-expression of exogenous AhR was clearly suppressed by repression of the AhR with siRNA. There have been several other examples in which transfected AhR has been found to be active in the host cells ,57, althThe possible underlying mechanisms of AhR responses have been discussed previously. In many cell models, the AhR has been shown to stimulate growth arrest and apoptosis . For exaDespite the fact that little evidence supporting the physiological function of the AhR in neural cells has been found so far, it has been reported that AhR is a member of the bHLH family transcription factor family. Although the AhR is an orphan receptor whose function has not been revealed, it is helpful for understanding AhR function to consider the relationships between AhR and other members of the bHLH family. Members of the bHLH family form a molecular-signaling network related to neural development and differentiation. For example, Hes-1 (the Hairy and Enhancer of Split homolog-1) and Hes-5 down-regulate Mash-1 and Math-1, respectively. Mash-1 and Math-1 subsequently down-regulate NeuroD and Math-2, and finally regulate the expression of nerve-specific genes . In thisConsequently, in developing neurons, irregular or excessive activation of AhR possibly causes disrupted neural development rather than cell death. In the brain, TCDD exposure during the perinatal period may affect XRE-regulated gene expression through AhR activation and disrupt the differentiation of neurons, which are strictly regulated for developing brain formationIn this study, we have shown that over-expression of AhR caused neural differentiation of Neuro2a cells. Neruo2a cells transfected with AhR, named N2a-R\u03b1, may mimic the neurons forming the neural network during the perinatal stages, expressing AhR in the presence of the ligand. The AhR is a major participant in the expression of neurotoxicity and plays a role in the structural and functional development of neural cells. We hypothesized that perinatal exposure to dioxins may disrupt the strict regulation of brain formation with irregular differentiation rather than cell death. In consequence, the decline of neural function based on excess differentiation of neurons by AhR activation may play an important role in the developmental neurotoxicity of dioxins.AhR, aryl hydrocarbon receptorXRE, xenobiotic responsive elementTH, tyrosine hydroxylasebHLH-PAS, basic helix-loop-helix/Per-Arnt-Simp-dioxinTCDD, 2, 3, 7, 8, -tetrachlorodibezo-CYP, cytochrome P-450FITC, fluorescein isothiocyanateThe author(s) declare that they have no competing interests.EA designed the study and performed all experiments. SY was responsible for the cloning and maintenance of all cell strains constructed. MIS collaborated on experimental design, participated in data analysis, and wrote the manuscript. All authors read and approved the final manuscript."}
{"text": "Drosophila. Flies lacking the DJ-1 gene showed selective sensitivity to widely used agricultural toxicants that kill neurons mainly through oxidative stress. The studies, published 6 September 2005 in Current Biology, suggest that normally \u201cDJ-1 has a neuroprotective role against different oxidative stimuli,\u201d says Darren Moore, an instructor in neurology at the Johns Hopkins University School of Medicine who has studied the gene. However, if DJ-1 stops working\u2014because of either an inherited mutation or toxicant exposure\u2014oxidative stress may wreak havoc on the brain, killing dopamine-producing neurons.A gene linked to familial Parkinson disease (PD) may protect neurons from oxidative damage, according to two independent studies in the fruit fly DJ-1 mutations may sensitize cells to the harmful effects of oxidative stress. This type of oxidative damage happens when unstable oxygen molecules react with certain components inside cells in a manner similar to the process that converts iron to rust. Many environmental insults\u2014including exposure to certain agricultural chemicals\u2014can generate these unstable oxygen molecules.Experiments in cultured cells and in knockout mice have hinted that DJ-1 interacts with such oxidative stress agents, Nancy Bonini, a professor of biology at the University of Pennsylvania, Philadelphia, and her colleagues first identified DJ-1 in Drosophila, which they found exists in two forms: DJ-1\u03b1 (expressed primarily in the testes) and DJ-1\u03b2 (expressed everywhere). They then created a line of Drosophila mutants completely lacking both forms.To pin down how DJ-1 had normal life spans and showed no neuronal degeneration. However, when Bonini and her colleagues exposed flies to the herbicide paraquat, DJ-1 mutants died much sooner than normal flies. The mutants also showed marked sensitivity to the insecticide rotenone and to hydrogen peroxide\u2014both agents that promote oxidative stress. These results suggest that DJ-1 normally protects against oxidative stress and that its inactivation may leave neurons susceptible to oxidative damage. The team also found that exposure to paraquat led to biochemical modification of the DJ-1\u03b2 protein, a change Bonini says may somehow influence the ability of DJ-1 to protect neurons from oxidative damage.The flies with no Drosophila DJ-1 mutant. They disrupted the function of DJ-1\u03b2 by inserting a mutation into the middle of the gene. Surprisingly, Min says, they found that dopamin-ergic neurons in these mutants survived longer into old age than did neurons of normal flies. They also found that their DJ-1\u03b2 mutants were much more resistant to paraquat insult than were normal flies.In the other paper, Kyung-Tai Min, an investigator at the National Institute of Neurological Disorders and Stroke, and his colleagues examined a different type of DJ-1\u03b1 expression\u2014the loss of DJ-1\u03b2 somehow encouraged a compensatory upregulation of DJ-1\u03b1, which the authors believe protected the fly from paraquat-induced oxidative damage. When they treated the same flies with hydrogen peroxide, however, they found that the DJ-1\u03b2 mutants were extremely susceptible to early death. Min says this suggests that DJ-1\u03b1 and DJ-1\u03b2 may normally protect cells against different types of agents that promote oxidative stress.Further examination revealed that these flies had elevated DJ-1 fly strains will probably make an ideal model for PD, according to Moore, because the flies don\u2019t suffer from the neurodegeneration seen in humans with DJ-1 mutations. Nevertheless, says Bonini, studies of DJ-1 in Drosophila will provide greater understanding of fundamental activities of the gene, helping to elucidate how its function may be critical in PD.Neither of the mutant"}
{"text": "Evidence was obtained showing that GSH protects against the cytotoxicity of 4-hydroperoxycyclophosphamide (4-OOH-CP) by minimizing the spontaneous fission of 4-hydroxycyclophosphamide (4-OH-CP), its breakdown product, to the ultimate toxic species, phosphoramide mustard (PM). This conclusion was borne out in two series of experiments. The first demonstrated that 4-OH-CP was progressively more stable in aqueous solutions containing increasing concentrations of GSH. The second series of experiments were carried out with tumour cell lines with high (SKOV-3) and low (KHT) GSH contents. The cytotoxicity of 4-OOH-CP, a stable precursor that rapidly gives rise to 4-OH-CP spontaneously under physiological conditions, was enhanced in GSH-depleted SKOV-3 cells, but was unchanged in GSH-depleted KHT cells. It is concluded that the high GSH content of SKOV-3 cells provides a significant protection against 4-OH-CP by limiting the breakdown/activation of 4-OH-CP. Deschloro-4-hydroperoxycyclophosphamide (deschloro-4-OOH-CP), an analogue of 4-OOH-CP that generates acrolein (AC) but not PM in the spontaneous fission reaction, is essentially non-toxic when compared with 4-OOH-CP but is equally potent in depleting GSH. It is postulated that AC may promote the cytotoxicity of the parent 4-OH-CP by depleting cellular GSH. Consequently, the stabilising influence of GSH on 4-OH-CP is removed, leading to increased formation of PM, the ultimate cytotoxic agent."}
{"text": "The relationship between colony numbers and concentration of cells plated is an important parameter of clonogenic assay systems. The cloning efficiency for an ideal sample should be independent of cell concentration, thus giving a straight line through the origin when colony numbers are plotted against cell concentration. A simple statistical method has been developed to test if this is the case for individual tumour samples. Colony data from 51 freshly obtained tumour samples, which had sufficient cells to plate 3 or more dilutions and gave at least 20 colonies per plate at one or more of the dilutions, were tested. The results indicated that colony formation was linear for 27 (53%) of the samples. The remaining 24 samples could be classified into 2 groups: type I, in which cloning efficiencies increased with increasing cell concentration and type II, which had reduced cloning efficiencies at high cell concentrations. Fifteen (29%) of the samples had type I non-linearity and 9 (18%) exhibited non-linearity of type II. These findings indicate that the relationship between colonies and cells plated should be examined for each biopsy sample particularly in each experiment where the effects of cytotoxic drugs are tested."}
{"text": "Interestingly, DJ-1 expression was increased in brains of zebrafish under conditions of oxidative stress, indicating that DJ-1 is a part of stress-responsive machinery. Since oxidative stress is one of the major contributors to the development of Alzheimer's disease (AD), we also examined DJ-1 expression in AD brains. Using DJ-1 specific antibodies, we failed to detect a robust staining of DJ-1 in brain tissues from control subjects. However, DJ-1 immunoreactivity was detected in hippocampal pyramidal neurons and astrocytes of AD brains. Therefore, our results strongly suggest that DJ-1 expression is not necessary during zebrafish development but can be induced in zebrafish exposed to oxidative stress and is present in human AD brains.Mutations in the DJ-1 gene have been linked to autosomal recessive familial Parkinson's disease. To understand the function of DJ-1, we determined the DJ-1 expression in both zebrafish and post mortem human brains. We found that DJ-1 was expressed early during zebrafish development and throughout adulthood. Knock down (KD) of DJ-1 by injection of morpholino did not cause dramatic morphologic alterations during development, and no loss of dopaminergic neurons was observed in embryos lacking DJ-1. However, DJ-1 KD embryos were more susceptible to programmed cell death. While a slight reduction in staining for islet-1 positive neurons was observed in both DJ-1 KD and H Parkinson's disease (PD) and Alzheimer's disease (AD) are the two most common neurodegenerative disorders. PD is characterized by loss of dopaminergic (DA) neurons in the substantia nigra and accumulation of intraneuronal inclusions known as Lewy bodies. AD is characterized by two major hallmarks, neurofibrillary tangles and neuritic plaques. Genetic studies of PD have demonstrated that two autosomal dominant genes (\u03b1-synuclein and LRRK2) -3 and thin situ hybridization [2O2 significantly increases the immunoreactivity of DJ-1 [High levels of DJ-1 mRNA have been detected in neuronal and non-neuronal populations of several regions in mouse brain by dization . A recen of DJ-1 . This up of DJ-1 .Pharmacological studies have shown that DJ-1 is needed for the protective effects of certain compounds which are known to inhibit the production of reactive oxygen species . DJ-1 prL166P in addition to E64D, M26I, A104T, and D149A is one of known mutations within DJ-1 that has been identified from familial PD cases. These mutant forms of DJ-1 show different levels of structural alteration (except for E64D due to similar residue replacement), which lead to reduced stability of DJ-1 ,21. The 2O2, and DJ-1 appeared to function as a peroxiredoxin-like peroxidase in these animals [DJ-1 knockout (KO) mice do not differ from wild type mice with respect to morphology or dopaminergic cell loss -24, with animals . In zebr animals , and KD  animals . In Dros animals .Zebrafish are beginning to be used for aging research, e.g., brief exposure of zebrafish embryos with Dichlorodihydrofluorescein diacetate allows repeated measurement of the level of reactive oxygen species generation in live fish . For neu2O2. We found that KD of DJ-1 and H2O2 had similar effects on islet-1 positive neurons  homeodomain protein), with both groups of embryos showing an increased number of apoptotic cells. Since the oxidative stress is one of the major contributors to the AD pathogenesis [In this report, we compared KD of DJ-1 to oxidative stress in zebrafish embryos. In addition, we examined DJ-1 expression in the adult fish brain by treating live animals with Hogenesis ,39, we eEmbryos were obtained from natural spawning of wild-type (Tubingen longfin strain) adults and were raised and staged according to Kimmel et al. .DJ-1 MO, directed against the 5' untranslated region (UTR) of DJ-1  was injected into fertilized zebrafish eggs at the one-cell stage at which time morpholinos can rapidly spread into all cells. The morpholino sequences were as follows: DJ-1 MO, 5'-GCGTCTAATAACCTGTGCGTGTCTG-3' control MO, 5'-CCTCCTACCTCAGTTACAATTTATA-3'.The above standard control MO was synthesized against the zebrafish \u03b2-globin intron. MO oligonucleotides were dissolved in 1\u00d7 Danieu solution at 5 mM, diluted to 0.1 mM prior to injection, and ~4 ng was injected into each embryo. After injection, embryos were incubated at 28.5\u00b0C in embryo medium  containiTUNEL assay was performed using the TMR-RED in situ cell death detection kit  accordinIn situ hybridization was carried out according to standard protocols  using a Human postmortem cortical tissue was collected in accordance with Institutional Review Board-approved guidelines at Brigham and Women's hospital. Blocks of cortex were fixed for ~2 hrs in 10% neutral buffered formalin, as previously described . ParaffiHuman, mouse and zebrafish brain samples were homogenized in lysis buffer containing 0.2% NP-40. The lysates were collected after 1 hr of centrifugation at 100 000 \u00d7 g (human and mouse) or after 5 min of centrifuge at 18,000 \u00d7 g (zebrafish). Individual de-chorionated and de-yolked embryos were lysed, and all samples were heated in 1 \u00d7 sample buffer  and then separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Antibodies KAM-SA100  and anti-DJ-1-N (1:500) and an enhanced chemiluminescence system  were used to detect the western blots.Wildtype CHO cells and APP stably transfected CHO cells (CHO+APP) were grown for 24 hrs before the conditioned media were collected for the measurement of A\u03b2 levels by ELISA, as previously described . The samWe generated an affinity purified polyclonal antibody DJ-1-N against the N-terminus of DJ-1 that recognizes a single band at 23 kDa corresponding to endogenous DJ-1 from human cortex homogenate; this band was absent when the antibody was preabsorbed with its cognate peptide Fig. . The samUsing the human DJ-1 sequence, we identified multiple zebrafish ESTs and obtained the complete zebrafish DJ-1 sequence by the alignment of these ESTs with genomic zebrafish DJ-1 sequences from the Sanger Institute. We only found one DJ-1 homologue in zebrafish. Zebrafish DJ-1 has 4 exons that encode 189 amino acids, and the protein is 87% homologous to human DJ-1. cDNA from zebrafish embryos at the 1-somite stage was prepared and the full-length zebrafish DJ-1 cloned. The sequence of cDNA was confirmed and found to be identical to the one previously reported .A morphant technology that uses morpholino phosphodiamidate anti-sense oligonucleotides  to target genes in vivo -49 was uBoth control and DJ-1 MO injected embryos shared an almost identical morphology Fig. , and no 2O2 to induce an environment of oxidative stress. We found that control MO injected embryos showed well defined islet-1 positive neurons along the spinal cord  also showed DJ-1 immunoreactivity in scattered astrocytes (data not shown), but they showed weak or no DJ-1 staining in pyramidal neurons of the CA1, CA2, CA3 sub-regions and the hilus of the dentate gyrus (CA4) Fig. , except To search for any mechanistic cause for DJ-1 expression in AD brains, we examined the effect of A\u03b2 on the regulation of DJ-1 expression. We have used two cell lines, CHO that expresses endogenous levels of APP, and CHO+APP that expresses high levels of APP and generates a large amount of A\u03b2. When we measured the conditioned media from CHO and CHO+APP cells, we found elevated levels of A\u03b240 Fig.  and 7B. It is known that oxidative stress and mitochondrial dysfunction contribute to the pathogenesis of AD and PD. In AD, A\u03b2 may directly interact with mitochondria and lead to increased free radical production; in PD, DJ-1, parkin and PINK1 are all linked to oxidative stress and/or mitochondrial dysfunction {Reviewed by ,53}. In Consistent with earlier studies in DJ-1 KO mice -24, KD oWe found that DJ-1 KD embryos have an increased number of apoptotic cells, consistent with an earlier report showing a p53 dependent apoptosis in DJ-1 KD zebrafish embryos . In cult2O2 on DJ-1 expression in the brains of adult zebrafish in vivo. For the first time, we found an increase in DJ-1 protein in brains of adult fish subjected to a stressful environment such as oxidative stress. While it is difficult to discern whether the increase in DJ-1 was derived from neuronal or glial sources, we predict that it was a global response from exposure to H2O2 in the environment.Recent studies have shown that DJ-1 expression is up-regulated in cultured cells in an environment that promotes the formation of intracellular reactive oxygen species ,14. We hTo further address this relationship, we utilized brain sections from post mortem AD and control subjects. We found that the avidity of different antibodies and the methods for preserving brain tissues were critical for revealing DJ-1 immunostaining. Whereas antibodies raised against the C-terminus of DJ-1 Park7) ,9 or ful ,9 or fuOur comparison staining with DJ-1-N and other DJ-1 antibodies  reveals an important finding on the potential binding region of DJ-1 when it dimerizes. Earlier reports, including ours, have demonstrated that DJ-1 dimerizes and forms a high molecular weight complex in cultured cells and human brains ,59. It s2O2. Therefore, the similarity of increased DJ-1 staining in H2O2 treated zebrafish and AD brains suggest that a common pathway might be elicited under damaging conditions. As previously reported, DJ-1 is needed to avoid oxidative stress-induced cell death in cultured neuroblastomas, dopaminergic cells and primary neuronal cells [The intriguing finding of positive staining of DJ-1 in AD brains but not control brains has important implications for both PD and AD pathogenesis. In brains of AD patients, the neuritic plaque composed of A\u03b2 is one of the major characteristics of AD pathology. A lack of change in DJ-1 expression in cultured cells exposed to high levels of A\u03b2 suggests that A\u03b2 has no direct effect on steady state levels of DJ-1. During the neurodegenerative process, accumulation of reactive oxygen species renders neurons, such as pyramidal neurons around hippocampal area, extremely vulnerable, and gradual neuronal loss is inevitable when the brain is exposed to insults. The fact that DJ-1 itself is subjected to cysteine and methionine oxidation  as well al cells . Therefo2O2 [Furthermore, DJ-1 is a non-traditional peroxiredoxin-like peroxidase , and enh2O2 .2O2 illustrates a new plate form that allows us to examine the role of DJ-1 involved in response to oxidative stress. Investigation of the function/dysfunction of DJ-1 in a whole vertebrate animal exposed to a stressful environment has a direct physiological relevance to human diseases. Therefore, exploring mechanisms of DJ-1 associated with PD and AD pathogenesis will provide insight into common pathways involved in both neurodegenerative diseases. Any newly identified pathways will offer novel drug targets and exciting opportunities for therapeutic intervention.Future studies are necessary to characterize the role of DJ-1 in PD and AD pathogenesis such as whether the DJ-1 protein we found in pyramidal neurons in AD hippocampus is an acidic isoform , basic iAD: Alzheimer's disease; A\u03b2: amyloid \u03b2-protein; DA: dopaminergic; hpf: hours post fertilization; KD: knock down; KO: knock out; MO: morpholino; MPTP: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; PD: Parkinson's disease; TH: tyrosine hydroxylase.The authors declare that they have no competing interests.SB and JS carried out the biochemical and immunohistochemical analyses, HL carried out zebrafish experiments, TY carried out cell culture experiments, MS, JS, MGS, CAL, and QL participated in the design of the study, SB and WX conceived of the study and draft the manuscript. All authors read and approved the final manuscript."}
{"text": "The appropriate control of mitotic entry and exit is reliant on a series of interlocking signaling events that coordinately drive the biological processes required for accurate cell division. Overlaid onto these signals that promote orchestrated cell division are checkpoints that ensure appropriate mitotic spindle formation, a lack of DNA damage, kinetochore attachment, and that each daughter cell has the appropriate complement of DNA. We recently discovered that AMP-activated protein kinase (AMPK) modulates the G2/M phase of cell cycle progression in part through its suppression of mammalian target of rapamycin (mTOR) signaling. AMPK directly phosphorylates the critical mTOR binding partner raptor inhibiting mTORC1 (mTOR-raptor rapamycin sensitive mTOR kinase complex 1). As mTOR has been previously tied to mitotic control, we examined further how raptor may contribute to this process.We have discovered that raptor becomes highly phosphorylated in cells in mitosis. Utilizing tandem mass spectrometry, we identified a number of novel phosphorylation sites in raptor, and using phospho-specific antibodies demonstrated that raptor becomes phosphorylated on phospho-serine/threonine-proline sites in mitosis. A combination of site-directed mutagenesis in a tagged raptor cDNA and analysis with a series of new phospho-specific antibodies generated against different sites in raptor revealed that Serine 696 and Threonine 706 represent two key sites in raptor phosphorylated in mitosis. We demonstrate that the mitotic cyclin-dependent kinase cdc2/CDK1 is the kinase responsible for phosphorylating these sites, and its mitotic partner Cyclin B efficiently coimmunoprecipitates with raptor in mitotic cells.This study demonstrates that the key mTOR binding partner raptor is directly phosphorylated during mitosis by cdc2. This reinforces previous studies suggesting that mTOR activity is highly regulated and important for mitotic progression, and points to a direct modulation of the mTORC1 complex during mitosis. The serine/threonine protein kinase mammalian target of rapamycin (mTOR) is a key mediator of the cellular response to nutrient status through its regulation of translation, ribosome biogenesis, mitochondrial metabolism, and autophagy The best-established substrates of mTORC1 demonstrate the importance of mTOR in translational control. mTOR phosphorylates S6K1 at T389 to enhance S6K1 activity, which amongst other things phosphorylates the S6 subunit of the ribosome to promote translation. mTOR also phosphorylates 4EBP1, causing its dissociation from its binding partner eIF4E, which is then free to associate with the cap-complex to promote cap-dependent translation The activity of mTORC1 is dependent on the small Ras-like GTPase, Rheb, whose GTP-loaded state is regulated by a GTPase-accelerating protein (GAP) complex composed of the TSC1 and TSC2 tumor suppressors. Inputs from a variety of pathways converge on the TSC1/2 complex to regulate mTORC1 signaling regulatory associated protein of TOR) is thought to act as the key mTORC1 scaffolding protein that binds mTOR substrates via the TOR signaling (TOS) motif, facilitating their phosphorylation by mTOR. A handful of recent studies have demonstrated the importance of phosphorylation of raptor on various sites in the regulation of mTOR signaling by pro- and anti-proliferative signals. Phosphorylation by Rsk at S721 as well as by mTOR at S863 have been shown to enhance mTORC1 activity In addition to the hub of signaling at TSC2, phosphorylation of components of mTORC1 have recently been shown to have important regulatory roles in mTOR signaling We have shown previously that under energy stress conditions, fewer cells proceed into G2/M and that this cell cycle arrest is dependent on AMPK phosphorylation of raptor and inhibition of mTORC1 activity. This suggested that perhaps mTOR signaling might play a role in mitosis, as suppression of mTOR blocks entry into G2/M and inappropriate activation of mTOR signaling drives cells into G2/M. In our investigations into the regulation of mTOR signaling in mitosis, we identified several sites in raptor phosphorylated by Cdc2 that may play a role in mitotic progression.Myc-raptor, AU1-mTOR, HA-GbL and Flag-PRAS40 originated in Dr. David Sabatini's Lab  and were obtained from Addgene.org . Ha-tagged 4ebp1 and S6K1 were obtained from Dr. John Blenis . Myc-raptor was subcloned into pENTR3C (Invitrogen), and serine to alanine point mutations were made using QuikChange II XL (Stratagene). Mutant alleles were then put into an FBneo DEST vector by LR reaction (Invitrogen). All constructs were fully sequence verified. Phospho-Plk1 T210 was from BD Pharmingen (#558400). Phospho-raptor  and Phospho-histone H3 antibodies were obtained from Millipore. Anti-raptor used for endogenous raptor immunoprecipitations was from Invitrogen (#42-4000). The 9E10 anti-myc antibody was used for immunoprecipitations (Roche). Antibodies against raptor (#2280), mTOR (#2983), GbL (#3274), PRAS40 (#2610), phospho-S6K T389 (#9234), pAurora A, B, C (T288/T232/T198) (#2914), Cyclin B1 (#4138), phospho-4EBP1 (T37/46) (#2855), phospho-4EBP1 (S65) (#9451), myc-tag (#2272), phospho-threonine-proline (#2321), and GST-tag (#2622) were from Cell Signaling Technologies.2. Cells were transfected with Lipofectamine 2000 (Invitrogen) as per manufacturer's instruction for 32\u201336 hours. Nocodazole (1 ug/mL) (SIGMA) or taxol (1 uM)  treatment was administered for 16\u201318 hours prior to lysis . Replacement of endogenous raptor with myc-tagged raptor was achieved by infecting Hela cells with a retrovirus expressing myc-wt or myc-S696/T706/S711AAA raptor in the FBneo vector, and selection in neomycin. These stables were subsequently infected with a lentivirus expressing a short-hairpin RNA that targets the 3\u2032 UTR of human raptor in the pLKO vector and selected in puromycin and distributed by Addgene (<http://www.addgene.org/pgvec1?f=c&identifier=1858&atqx=raptor&cmd=findpl>). A549 cells were synchronized in G1/S by double thymidine block as follows: 2 mM thymidine was added to the media for 14\u201316 hours, plates were washed twice with PBS, then complete thymidine-free media was added. Eight to ten hours later, 2 mM thymidine was added again for 14\u201316 hours, cells were washed twice with PBS, then released into thymidine-free media. 50 uM roscovitine was administered for 6 hours following 16 hours nocodazole treatment in A549 cells. Torin1 (50 nM)  was added for 1 h.Hela, A549 and HEK293T cells were grown in DMEM with 10% FBS at 37\u00b0 with 5% COFor immunoprecipitations, cells were washed with ice cold PBS and collected in lysis buffer 1  as per manufacturer's directions) for experiments in Anti-myc immunoprecipitations were performed on cell lysates from HEK293T cells transiently transfected with myc-raptor treated with or without nocodazole. After washing the beads twice in lysis buffer 1, they were washed twice in CIAP buffer  then incubated with 5 uL calf-intestinal alkaline phosphatase (CIAP) (NEB) with constant agitation at 37\u00b0C for 30 minutes.2, 0.1 mM Na3VO4, 5 mM b-glycerophosphate, 2 mM DTT). Immunoprecipitates were then incubated with 20 uL kinase reaction mix  with or without 175 ng recombinant Cdc2/cyclin B  at 30\u00b0 for 30 minutes with constant shaking. Reaction was quenched by addition of sample buffer to 1X and boiling at 95\u00b0 for 5 minutes.Anti-myc immunoprecipitations from HEK293T cells transiently transfected with myc-raptor for 16 hours followed by 12 hours of 2 uM hydroxyurea treatment were washed three times with lysis buffer 1, then three times with kinase buffer  in the data-dependent acquisition and positive ion mode at 300 nL/min. MS/MS spectra collected via collision induced dissociation in the ion trap were searched against the concatenated target and decoy (reversed) single entry Raptor and full Swiss-Prot protein databases using Sequest  with differential modifications for Ser/Thr/Tyr phosphorylation (+79.97) and the sample processing artifacts Met oxidation (+15.99), deamidation of Asn and Gln (+0.984) and Cys alkylation (+57.02). Phosphorylated and unphosphorylated peptide sequences were identified if they initially passed the following Sequest scoring thresholds against the target database: 1+ ions, Xcorr \u22652.0 Sf \u22650.4, P\u22655; 2+ ions, Xcorr \u22652.0, Sf \u22650.4, P\u22655; 3+ ions, Xcorr \u22652.60, Sf \u22650.4, P\u22655 against the target protein database. Passing MS/MS spectra were manually inspected to be sure that all b- and y- fragment ions aligned with the assigned sequence and modification sites. Determination of the exact sites of phosphorylation was aided using FuzzyIons and GraphMod and phosphorylation site maps were created using ProteinReport software . False discovery rates (FDR) of peptide hits (phosphorylated and unphosphorylated) were estimated below 1.5% based on reversed database hits.For all mass spectrometry (MS) experiments, myc-Raptor immunoprecipitates were separated using SDS-PAGE, the gel was stained with Coomassie blue, and the myc-Raptor band was excised. Samples were subjected to reduction with dithiothreitol, alkylation with iodoacetamide, and in-gel digestion with trypsin or chymotrypsin overnight at pH 8.3, followed by reversed-phase microcapillary/tandem mass spectrometry (LC/MS/MS). LC/MS/MS was performed using an Easy-nLC nanoflow HPLC (Proxeon Biosciences) with a self-packed 75 \u00b5m id x 15 cm CWe have shown previously that cells undergoing energy stress arrest in G2/M and that if they lack the ability to downregulate mTORC1 signaling during energy stress, they proceed inappropriately into mitosis www.phosphosite.org; In attempts to identify the residues of raptor responsible for the nocodazole-induced bandshift, microcapillary liquid-chromatography/tandem mass spectrometry (LC/MS/MS) was performed on raptor immunoprecipitated from cells with or without nocodazole treatment. We identified several novel phosphorylation sites from this analysis, including Ser696, Thr706, Ser738, Ser771 and Ser877 . Of thesNext we examined whether mutation of any of the identified serine/threonine-proline sites to alanine would alter the mobility shift induced in raptor upon nocodazole or taxol treatment. From this analysis, we discovered that an allele of raptor with mutation of Ser696 and Thr706 to alanine, showed reduced band-shifting . MutatioTo directly determine the residues of raptor up-regulated following nocodazole treatment, phospho-specific-antibodies against Ser696, Thr706, Ser877, and Ser863 were generated and verified as recognizing only wild-type myc-tagged raptor immunoprecipitated from HEK293T cells, but not raptor mutated at the specified phospho-acceptor residue . TreatmeHaving identified several residues of raptor phosphorylated in cells blocked in mitosis, we next sought to identify the upstream kinase for Ser696 and Thr706. Knowing the upstream kinase was active following nocodazole treatment, and was proline-directed, we decided to examine the mitotic CDK family member Cdc2. First we tested whether recombinant Cdc2-cyclin B kinase complexes were capable of in vitro phosphorylation of raptor immunoprecipitated from hydroxyurea treated HEK293T cells (and hence derived from cells where Cdc2 would be inactive) . Indeed To examine whether Phospho-Thr706 can be detected during natural mitotic progression and is not simply due to kinases activated by microtubule stress, we synchronized A549 cells using double thymidine block and endogenous raptor was immunoprecipitated at various timepoints following thymidine release and immunoblotted with the phospho-raptor Thr706 antibody . MitoticFinally, we examined whether we could detect and in vivo association between raptor and the cdc2/cyclin B kinase complex. Utilizing Hela cells stably expressing low levels of tagged raptor, raptor immunoprecipitates from cycling or taxol-arrested cells revealed the presence of endogenous cyclin B .mTORC1 is a multi-protein complex whose function requires proper association of all components It has been demonstrated that raptor acts as a scaffolding protein between mTOR and its substrates To confirm these results in a more physiological system, cell lines stably over-expressing a low level of myc-tagged raptor alleles with stable knockdown of endogenous raptor with short hairpin RNA that targets the 3\u2032 UTR of raptor How signaling pathways coupled to nutrient uptake and expenditure couple to the cell cycle machinery and proliferation control has been an area of increasing investigation. The mTORC1 signaling pathway is a critical integrator of environmental inputs into protein translation and cell growth. However, the precise role of mTORC1 signaling in mitotic progression remains enigmatic Our previous studies indicated the presence of G2/M metabolic checkpoint enforced by AMPK in a manner dependent on its ability to phosphorylate raptor and suppress mTORC1 activity. Cells expressing non-phosphorylatable alleles of raptor continued to progress through mitosis unabated unlike those expressing wild-type raptor, and ultimately displayed increased rates of apoptosis. Consistent with an AMPK/mTORC1 dependent checkpoint, AMPK\u03b12 and its upstream kinase LKB1 were isolated in an RNAi screen for modulators of G2/M in mammalian cells Previous studies also suggest that mTOR signaling plays a positive role in the progression through mitosis in a variety of species. In budding yeast, a temperature sensitive allele of raptor or rapamycin-treatment of cells both induce mitotic delay and a prolonged G2 We demonstrate here that the mitotic kinase cdc2 directly phosphorylates raptor during mitosis, though we have been unable to demonstrate the contribution those phosphorylations play to overall mitotic progression or mTORC1 signaling during mitosis in the tumor cell settings we have examined thus far. Importantly, our data suggests there may be additional cdc2 sites beyond Ser696, Thr706, and Ser711 in raptor and until these sites are fully identified, the phenotype of a fully cdc2 non-phosphorylatable raptor remains unknown. Nontheless, the cdc2 sites in raptor may be more critical for growth control in non-tumorigenic settings, which is an area requiring further investigation.One additional complicating factor is these analyses is the fact that cdc2 has been reported to directly phosphorylate both S6K1 A complication of much of the previous literature studying the effect of mTOR on G2/M progression utilizing rapamycin is that recent finding from several labs that rapamycin does not fully inhibit mTORC1 kinase activity. Kinase inhibitors directed at mTOR itself yield changes in mTORC1 signaling and growth arrest phenotypes more similar to RNAi for raptor Additional tools including phospho-specific antibodies which can work for immunolocalization may better reveal where the population of cdc2-phosphorylated raptor and 4ebp1 are during the different stages of mitosis. Understanding how AMPK activity and mTOR activity are controlled spatially and temporally during mitosis will undoubtedly lead to fundamental insights into how nutrients control cell division as well as to how protein translation is coupled to timely cell cycle exit during differentiation or stem cell renewal. A deeper understanding of how mTORC1 controls cell cycle progression is essential for use of targeted mTOR inhibitors in the treatment of cancer and many other mTOR-related pathologies Table S1All identified in vivo phosphorylation sites in raptor. Conservation is indicated and predicted kinases from Scansite are listed in black. Reported in vivo kinases are indicated in red.(0.76 MB TIF)Click here for additional data file."}
{"text": "We observed the growth of 2 sublines of leukaemia L1210 in histocompatible DBA2 mice given 10(3) cells i.p. and studied the protective effect of Corynebacterium parvum (CP). The growth of subline L1210-M was unaffected by pretreatment with CP or admixture with 10(5) peritoneal cells (PC) from CP-treated mice. In contrast, the growth of subline L1210-C was inhibited; CP pretreatment increased the proportion of long-term survivors (70% vs 20%) and admixture with CP-PC prolonged the survival time . In vitro experiments indicated that Sublines M and C were equally sensitive to cytostasis by CP-PC, as measured in a terminal labelling assay (greater than 90% inhibition of proliferation). However, subline C was much more sensitive to cytolysis (18h 125IUDR-release assay) by CP-PC; percentage specific release from L1210-C was at least 90%, whilst from L1210-M it was generally less than 25%. The differential susceptibility of the 2 sublines to cytolytic PC was maintained through 75 passages in culture. The effector cells were considered to be macrophages, because they were adherent, phagocytic, and sensitive to silica. Cytolysis was unrelated to endotoxin contamination, because it was not inhibited by polymyxin B, and was inhibited by pre-incubating PC in culture medium for 24 or 48 h before adding target cells. Thus the relevance of nonspecific macrophage-mediated cytotoxicity in vitro to tumour resistance in vivo may depend on the strength of the cytotoxic reaction."}
{"text": "Fifteen of the 31 animals infused with LPS and not treated with BN 52021, a PAF receptor antagonist, died within 30 min after the commencement of LPS infusion (non-survivors), while the other 16 survived the experimental period of 3 h, though in a state of shock (survivors). No alterations were observed in plasma concentrations of eicosanoids in the non-survivors. A significant, though transient, increase in eicosanoid concentrations occurred only in the survivors. Treatment with BN 52021  injected 5 min prior to LPS infusion, failed to exert any effect on the survival rate. However, pretreatment with BN 52021 prevented circulatory collapse in the survivors and reduced the concentration of cyclooxygenase enzyme products, without affecting LTB4 release. Exogenous administration of PAF (0.01 \u03bcg kg\u22121) caused hypotension and increased TXB2 levels although 6-keto PGF1\u03b1 and LTB4 concentrations were unchanged. The data suggest that prostanoid formation may be secondary to PAF release in circulatory collapse evoked by LPS infusion in survivors, and give further support to the suggestion that PAF prostanoid interaction is important during endotoxic shock. However, their role in early death seems to be negligible, indicating the importance of other mediators.The effects of platelet activating factor (PAF) on eicosanoid release during endotoxic shock was investigated in anaesthetized pigs receiving 5 \u03bcg kg"}
{"text": "Nipah virus targets human endothelial cells via NiV-F and NiV-G envelope glycoproteins, resulting in endothelial syncytia formation and vascular compromise. Endothelial cells respond to viral infection by releasing innate immune effectors, including galectins, which are secreted proteins that bind to specific glycan ligands on cell surface glycoproteins. We demonstrate that galectin-1 reduces NiV-F mediated fusion of endothelial cells, and that endogenous galectin-1 in endothelial cells is sufficient to inhibit syncytia formation. Galectin-1 regulates NiV-F mediated cell fusion at three distinct points, including retarding maturation of nascent NiV-F, reducing NiV-F lateral mobility on the plasma membrane, and directly inhibiting the conformational change in NiV-F required for triggering fusion. Characterization of the NiV-F N-glycome showed that the critical site for galectin-1 inhibition is rich in glycan structures known to bind galectin-1. These studies identify a unique set of mechanisms for regulating pathophysiology of NiV infection at the level of the target cell. in vivo, and demonstrate that endogenous galectin-1 made by endothelial cells contributes to limiting cell-cell fusion caused by NiV-F. As endothelial syncytia formation is one of the primary pathophysiologic events in Nipah virus infection, contributing to the hemorrhagic diathesis seen in infected patients, understanding the mechanism of endothelial cell fusion and the ability of galectin-1 to ameliorate cell fusion are critical for development of new approaches to mitigate these events.Nipah virus (NiV) is classified as a \u201cpriority pathogen\u201d by the NIH. NiV infection of humans results in multi-organ hemorrhage due to endothelial syncytia formation, and also causes fatal encephalitis in up to 70% of patients. As there are no effective vaccines or therapeutics for NiV, understanding the mechanism of endothelial damage by NiV is a critical goal. Our present work defines the interaction between galectin-1, an innate immune lectin that is secreted by human endothelial cells, with the fusion glycoprotein of NiV. We demonstrate that galectin-1 can block the function of the NiV-F protein via three distinct mechanisms, and thus reduce the ability of NiV-F to cause endothelial cell-cell fusion. Importantly, in this study, we use human endothelial cells, the primary target of Nipah virus  Nipah virus (NiV) is a lethal emerging virus that infects agricultural livestock and humans. In 1999\u20132000, NiV infection of agricultural workers in Malaysia and Singapore resulted in a 40% mortality rate, and subsequent outbreaks in Bangladesh resulted in an average case-fatality ratio greater than 70% Paramyxoviridae, is an enveloped virus with two viral envelope glycoproteins, NiV-G and NiV-F, that mediate viral entry NiV, a member of a new genus of 0, is initially expressed at the cell surface as a single glycosylated polypeptide precursor, but subsequently undergoes endocytosis and endosomal proteolytic cleavage by cathepsin L into F1 and F2 subunits that are disulfide linked to form the mature fusion protein NiV-F1/2The NiV-F fusion glycoprotein, NiV-Fin vitro and in vivo activation of human endothelial cells increased synthesis as well as secretion and cell surface localization of galectin-1 Infection of endothelial cells by viruses results in the release of innate immune effectors, including galectins, a family of mammalian lectins We have previously shown that recombinant human galectin-1 inhibits cell fusion and syncytia formation caused by NiV-F in vivo. Since endothelial cell syncytia formation is a pathognomic feature of NiV infection, we investigated the mechanisms involved in galectin-1 modulation of cell-cell fusion. We found that galectin-1 regulates cell fusion at three distinct points in the process; galectin-1 retains immature NiV-F0 on the cell surface to reduce production of the mature NiV-F fusion protein, galectin-1 reduces lateral movement of NiV-F on the plasma membrane that is required for cell-cell fusion, and galectin-1 directly inhibits the fusogenic activity of NiV-F by preventing fusion-peptide exposure and pre-hairpin intermediate (PHI) formation. The biological significance of our results is underscored by our demonstration that endogenous galectin-1 on endothelial cells is sufficient to reduce NiV-F mediated fusion. These studies identify a unique set of mechanisms for regulating the pathophysiology of NiV induced syncytia formation at the target cell level, and contribute to our understanding of the interaction between galectin-1 and glycoproteins of microbial pathogens.In the present study, we demonstrate that galectin-1 regulates NiV-F mediated fusion of endothelial cells and neural cells, the targets of NiV infection In vivo, endothelial cells and neuronal cells are the main targets of Nipah virus We previously found that galectin-1 inhibits syncytia formation in Vero cells mediated by NiV-F and NiV-G Nipah virus infection results in extensive damage to endothelial cells as a result of syncytia formation, culminating in multi-organ hemorrhage and death. During viral infection, endothelial cells become activated and release immune mediators, including galectin-1 Conversely, in order to determine if endogenous galectin-1, even on resting HUVECs, was sufficient to affect NiV-F and G mediated syncytia formation, we reduced expression of galectin-1 in HUVECs using lentiviral vectors expressing siRNAs targeted against galectin-1. A combination of three siRNAs reduced galectin-1 protein approximately 70% (data not shown), and reduced cell surface galectin-1 approximately two-fold . ReductiTo confirm that cell surface galectin-1 was responsible for the effect on syncytia formation, we added exogenous galectin-1 to HUVECs in which galectin-1 expression was decreased by siRNA. We observed the expected increase of cell surface galectin-1 , as wellGFP was expressed on transfected Vero cells  in the presence or absence of galectin-1  to total NiV-F protein. Addition of galectin-1 decreased NiV-F processing by approximately 50% at the 6 hour time point . The PHI then undergoes six-helix bundle formation, which is the conformational change that physically drives fusion of opposing membranes 0 maturation, contributes to the mechanism of galectin-1 mediated inhibition of NiV-F mediated cell fusion.To detect triggering, wild type CHO cells or CHO cells stably expressing ephrinB2 (CHOB2) were mixed with CHO cells transfected with NiV-F and G at 4\u00b0C for 1.5 hrs; NiV-G binding to ephrinB2 is an energy independent process. The biotinylated HR2 peptide was added to the cells in the presence or absence of galectin-1, and fusion was induced by incubation at 37\u00b0C for an additional 1.5 hours, because PHI formation is an energy dependent process. Binding of the HR2 peptide indicates that triggering has occurred. We observed no triggering of NiV-F at 4\u00b0C, regardless of the presence of galectin-1 . In the in vivo (F2\u2013F5) 0 and NiV-F1, glycomic screening was performed using MALDI-TOF mass spectrometry. The N-glycans were released by PNGase F and analyzed as their permethylated derivatives. The resulting spectra exhibit a series of singly charged sodiated molecular ions ([M+Na]+) to which putative structures are assigned based on the molecular compositions and knowledge of the N-glycan biosynthetic pathway. The profile for the complete propeptide, NiV-F0, can be seen in 0 include high mannose , complex  and hybrid structures . The complex and hybrid structures contain lactosamine  moieties that can be recognized by galectin-1. The MALDI-TOF mass spectrum of permethylated N-glycans from NiV-F1 is displayed in Supplementary 0 and NiV-F1 suggests that the glycosylation sites on the NiV-F2 subunit (F2 and F3 glycans) are modified with larger complex structures than those on NiV-F1 subunit (F4 and F5 glycans).The NiV-F fusion protein contains 5 consensus sites for N-glycosylation, labeled F1\u2013F5; four of these predicted sites have been found to be glycosylated NNTHDLVGDVR) was observed at an elution time of \u223c50 min (4+). Previous research has shown that alpha 2,6-linked sialic acid caps block galectin-1 binding while alpha 2,3 sialic acid caps do not . Treatment of the tryptic glycopeptides prior to the nano-LC ES-MS experiment with Sialidase S  revealed that both alpha 2,3 and alpha 2,6-linked sialic acid are present, with 2,3-linked sialic acid being the more abundant  This report defines several molecular mechanisms by which galectin-1 binding to NiV-F interferes with maturation and function of NiV-F to reduce cell fusion, and also demonstrates that endogenous endothelial galectin-1 can influence the extent of syncytia formation. Since syncytia formation is the pathognomonic hallmark of NiV infection, we predict that, 2 at 37\u00b0C. PK-13 porcine fibroblast cells and 293T cells were maintained in DMEM (Invitrogen) with 10% FBS (Hyclone) and 2mM Glutamax. BSR cells stably transfected with T7 polymerase were maintained in DMEM with 10% FBS (Hyclone), 2mM Glutamax, and 0.5mg/ml G418 (Sigma). U87 glioblastoma cells  were maintained in DMEM with 10% FBS (heat inactivated at 55\u00b0C for 30 min), 2mM Glutamax, and 50 units/ml penicillin/streptomycin. mVECs Vero cells and CHO cells (ATCC) were maintained in MEM alpha (Invitrogen) with 10% FBS (Hyclone) and 2mM Glutamax in 5%COE. coli and purified by affinity chromatography on lactosyl-Sepharose, as in Codon-optimized NiV-F and G plasmids tagged with AU1 were previously described GFP and HA-tagged NiV-G at 15ug per plasmid using Lipofectamine 2000 (Invitrogen). Cells were cultured overnight, lifted with 5mM EDTA (ethylenediaminetetraacetic acid) and overlayed in the absence or presence of galectin-1 onto ephrinB2 positive cells . After 2 hrs (Vero/U87) or 6 hrs (HUVEC/mVEC), cells were fixed with 2% paraformaldehyde (EMS). After 4\u2032,6\u2032-diamidino-2-phenylindole (DAPI) staining (Invitrogen), nuclei inside syncytia per \u00d7100 field were counted by fluorescence microscopy as previously described PK-13 cells were transfected with codon-optimized, AU1-tagged NiV-F, NiV-F3, or NiV-FHUVEC cells were incubated with or without 20\u00b5M galectin-1 for 30 min at 37\u00b0C. Cells were fixed in DTSSP (Thermo Scientific) at 0.2mg/ml for 10 min at room temperature, and quenched by addition of 100\u00b5l of 1M Tris pH 7.5 for 15 min at room temperature. Cells were washed with PBS and lifted with 5mM EDTA at 37\u00b0C for 10 min. Cells were stained with a rabbit galectin-1 antibody (Strategic) for 1 hr at 4\u00b0C. Cells were washed with PBS and stained with FITC-conjugated AffiniPure goat anti-rabbit IgG (H+L) antibody (Jackson ImmunoResearch) at 8\u00b5g/ml for 1 hour at 4\u00b0C. Cells were washed in PBS and resuspended in PBS with 1% BSA (Gemini BioProducts) for analysis by flow cytometry. Flow cytometric analysis of HUVEC cell surface galectin-1 was performed on a Becton-Dickinson FACScan, using CellQuest software (Becton-Dickinson).5 cells per well in a 6 well tissue culture dish (Corning). A single well of HUVECs was treated with each virus  in PBS with 1% heat inactivated FBS (Hyclone) and cells were spinoculated at 2000 rpm at 37\u00b0C for 2 hrs. Infected cells were grown in full media for 4 days and knockdown was assessed by western blot and flow cytometry.3 different siRNA constructs directed toward human galectin-1 mRNA in lentivectors (pSIH1-H1-copGFP plasmid) (System Biosciences) were packaged into VSV using pPACKH1 Lentivector Packaging Kit (System Bioscience). Lentivirus was produced in 293T cells; three different viruses corresponding to the 3 different siRNAs were isolated, as well as a virus containing only the GFP infection marker, and a virus containing siRNA to an irrelevant protein, CD43. HUVECs were plated at 1.4\u00d710GFP plasmid was performed in 35mm glass bottom culture dishes (MatTek) on a 37\u00b0C heated stage. Cells were treated with 20\u00b5M galectin-1 or buffer control for 10 min prior to photobleaching. Images were acquired on a confocal microscope (Leica SP2 1P-FCS) with a HCX PL APO 63.0\u00d71.40 oil objective and fully opened pinhole. Photobleaching of NiV-F-GFP was performed using 5 scans with the 488-nm laser at full power. Recovery data (six cells per time point from each of two independent experiments) was collected every 2.2 seconds for a total of 25 time points. Images were acquired with equivalent acquisition settings including pre-bleach, bleach, and post-bleach measurements. Bleaching and recovery were measured in a fixed area and compared to an area absent of fluorescence outside of the cell.Fluorescence Recovery After Photobleaching analysis of Vero cells transfected with NiV-F2, 1.25mM MgSO4, 5mM Na2HPO4, 20mM Hepes pH 7.4) and cell surface biotinylated using the EZ-Link sulfo-NHS-SS-Biotin (Pierce). Biotinylation was quenched in 20mM glycine and cells were washed again in KRPH buffer. Cells were incubated in media with or without galectin-1 or buffer control for the designated times at 37\u00b0C to allow endocytosis. After timepoints, cells were washed and remaining biotin cleaved twice with cleavage buffer  and quenched in 20mM glycine for 15 min. Cells were lysed in lysis buffer . Biotinylated NiV-F in cell lysates was quantified by ELISA using mouse anti-AU1 (1\u22361000) coated Reacti-Bind goat anti-mouse plates (Pierce) to capture AU1-tagged NiV-F, and detected with streptavidin-HRP (Biorad).PK-13 cells were transfected with NiV-F or NiV-F3. After overnight incubation, cells were washed twice with KRPH buffer  for 30 min, and then in chase (non-radioactive) media for 4 to 6 hrs, in the presence or absence of 20\u00b5M galectin-1. Cells were lysed in 200\u00b5l RIPA buffer . NiV-F was immunoprecipitated from cleared cell lysates using a combination of anti-NiV-F polysera 293T cells grown in 6-well plates were transfected with 0.25\u00b5g of NiV-F plasmid DNA and 1.75\u00b5g pcDNA3 per well. 24 hrs post transfection, cells were incubated in media lacking methionine and cysteine for 45 min followed by labeling with media containing Fusion-nonpermissive PK-13 target cells were transfected with codon optimized NiV-F, NiV-G, and a plasmid containing a T7 promoter driven luciferase at a 3\u22363\u22361 ratio with 30\u00b5g of total plasmid DNA and grown overnight. BSR cells stably transfected with a T7 polymerase (BSRT7) were lifted with 5mM EDTA at 37\u00b0C for 10 min. BSRT7 cells were co-cultured with transfected PK-13 cells for 6 hrs with or without galectin-1. After 6 hrs, the cells were lysed in 0.3% Triton-X 100 by two rounds of freeze/thaw at \u221280\u00b0C. Luciferase expression was quantified using a Luciferase assay system (Promega). Briefly, lysates were transferred to a 96 well opaque black plate, luciferase assay substrate was added, and light production was measured by luminometry (Turner Biosystems).PK-13 cells were transfected with NiV-F and simultaneously treated with chlorpromazine (Sigma) for 16 hrs. Cells were lysed in 50mM Tris-HCl (pH 7.4), 1% Nonidet P-40, 5mM EDTA, 150mM NaCl, 1mM PMSF, 10mg/ml aprotinin, 10mg/ml leupeptin, and 10mM sodium orthovanadate with scraping. Lysates were microfuged for 15 min at 10,000 rpm. Samples were denatured in NuPAGE reducing agent and NuPAGE Sample Buffer (Invitrogen) before loading. Lysates (10 \u00b5g) were separated on a 12% Bis-Tris gel (Invitrogen NuPAGE Electrophoresis System) and electroblotted onto nitrocellulose (Whatman). The membrane was blocked and probed as previously described NiV-F triggering was measured essentially as in Fusion kinetics were determined in a beta-lactamase reporter cell-cell fusion assay, as previously described 0 and NiV-F1 were destained using 100% acetonitrile, incubated with 10mM DTT for 30 min at 56\u00b0C, followed by 55 mM iodoacetic acid for 30 min at RT. Reduced and carboxymethylated NiV-F was digested with 0.5\u00b5g sequencing grade-modified trypsin  at 37\u00b0C for 14 hrs. Tryptic peptides and glycopeptides were extracted from the gel pieces by incubating with 0.1% trifluoroacetic acid (TFA) and 100% acetonitrile; the supernatant was pooled and reduced in volume on a rotary evaporator. For glycomic screening the supernatant was lyophilised before being dissolved in 200\u00b5l ammonium bicarbonate  and incubated with 5U of Peptide-N-glycosidase F (PNGase F)  for 24 hrs at 37\u00b0C to release the N-glycans. The reaction was terminated by lyophilisation. Glycans were separated from peptides by C18 Sep-Pak purification and permethylated as previously described Glycan analysis was performed on NiV-F protein pseudotyped onto VSV viral-like particles produced in 293T cells. Gel bands containing purified NiV-F+ using a 4800 MALDI-TOF/TOF  mass spectrometer as previously described MALDI-TOF MS and MS/MS data on permethylated N-glycan samples were acquired in positive ion mode [M+Na]Sample was dried, resuspended in 50\u00b5l of 50mM ammonium acetate (pH 5.5) and incubated with 10mU of Sialidase S at 37\u00b0C for 14 hrs. After digestion, NiV-F peptides and desialylated glycopeptides were desalted and separated using a C18-microtrap peptide cartridge . The sample was loaded directly onto the microtrap cartridge with a 25\u00b5l gastight syringe. The microtrap was first solvated with methanol, washed off with acetonitrile and conditioned with 0.1% TFA. The sample was loaded onto the column and washed with 0.1% TFA prior to eluting with 15\u00b5l 30 and 60% acetonitrile in 0.1% TFA, respectively. Eluted fractions were combined and dried down gently under nitrogen before online LC-ES-MS and MS/MS analysis.Figure S1A, Galectin-1 inhibits heterologous fusion in a dimer dependent manner. EphrinB2 positive cells stably expressing the T7 polymerase were added to a monolayer of ephrinB2 negative cells transfected with NiV-F, NiV-G and a luciferase construct with a T7 dependent promoter. Luciferase expression correlates with cell fusion. Data are shown as percent fusion based on the total fusion without any treatment (Lane 2). Lane 1 is a negative control and lane 3 is heterologous fusion with buffer alone. Lane 4, 30\u00b5M galectin-1. Lane 5, 10\u00b5M forced galectin-1 dimer (GG). Lane 6, 30\u00b5M monomeric galectin-1 mutant, N-Gal-1. B, Galectin inhibits heterologous fusion in a carbohydrate dependent manner. The galectin-1 effect of fusion inhibition was abrogated by addition of the cognate disaccharide lactose, but not by sucrose. In both panels, data are the mean + S.D. of a representative experiment performed in triplicate.Heterologous fusion is inhibited by galectin-1. Galectin-1 inhibits function of the mature fusion protein. (0.05 MB TIF)Click here for additional data file.Figure S21. Data were acquired in the positive ion mode and all molecular ions are [M+Na]+. Peaks labeled with * represent contaminating hexose polymers. Peak assignments are based on theoretical compositions together with knowledge of the biosynthetic pathways. Symbol nomenclature is that used employed by the Consortium for Functional Glycomics (CFG) for the representation of glycan structures. Key: Galactose (yellow circle), Mannose (green circle), GlcNAc (blue square), Fucose (red triangle), NeuAc, (purple diamond).MALDI-TOF mass spectrum of permethylated N-glycans from NiV-F(0.32 MB TIF)Click here for additional data file.Figure S3NQSLQQSK, observed as doubly, triply and quadruply charged molecular ion signals in the MS data summed between the ion retention times 51.8\u201352.9 min (data not shown). The m/z values in the table correspond to the smallest isotope in each cluster and the Mr values are calculated accordingly. Potential structures of the glycan compositions are given, deduced by taking into account prior glycomic experimental data and knowledge of the biosynthetic pathways. Key: Galactose (yellow circle), Mannose (green circle), GlcNAc (blue square), Fucose (red triangle), NeuAc, (purple diamond).The structure of the glycans found at the F5 glycosylation site. The table shows the glycan compositions of the glycopeptide, VDISSQISSM(0.65 MB TIF)Click here for additional data file.Figure S4NTTCPTAVLGNVIISLGK, observed as doubly, triply and quadruply charged molecular ion signals in the MS data summed between the ion retention times 84.7\u201386.8 min (data not shown). Key: Galactose (yellow circle), Mannose (green circle), GlcNAc (blue square), Fucose (red triangle), NeuAc, (purple diamond).The structure of the glycans found at glycosylation site, F4. The glycan compositions of the glycopeptide, AISQSGTLLMID(0.81 MB TIF)Click here for additional data file."}
{"text": "Cell-free Human T-cell Leukemia Virus type I (HTLV-I) virions are poorly infectious and cell-to-cell contact is often required to achieve infection. Other factors might thus importantly contribute in increasing infection by HTLV-I. Galectin-1 is a galactoside-binding lectin which is secreted by activated T lymphocytes. Several functions have been attributed to this protein including its capacity to increase cell-to-cell adhesion. Based on previous studies, we postulated that this protein could also accentuate HTLV-I infection.Herein, we demonstrate that galectin-1 expression and release are higher in HTLV-I-infected T cells in comparison to uninfected T cells. Furthermore, galectin-1 expression was activated in various cell lines expressing the wild type viral Tax protein while this induction was minimal upon expression of NF-\u03baB activation-defective TaxM22. Cotransfection of these Tax expression vectors with galectin-1 promoter-driven luciferase constructs confirmed that Tax upregulated galectin-1 promoter activity. However, a NF-\u03baB-independent mechanism was strongly favoured in this induction of galectin-1 expression as no activation of the promoter was apparent in Jurkat cells treated with known NF-\u03baB activators. Using HTLV-I envelope pseudotyped HIV-1 virions, galectin-1 was shown to increase infectivity. In addition, a co-culture assay with HTLV-I-infected cells also indicated an increase in cell fusion upon addition of galectin-1. This effect was not mediated by factors present in the supernatant of the HTLV-I-infected cells.These data suggest that HTLV-I Tax increases galectin-1 expression and that this modulation could play an important role in HTLV-I infection by stabilizing both cell-to-cell and virus-cell interactions. The 0.5 kb and 1.2 kb galectin-1 promoter fragments were cut out of pBSK with SacI and NdeI enzymes and ligated into pGL3-Basic  digested by SacI and SmaI.A PCR-based approach was used to insert the luciferase gene under the control of the galectin-1 promoter. Genomic DNA was isolated from 293T cells with the QIAamp DNA Blood Mini Kit . Two fragments of the galectin-1 promoter region (0.5 kb or 1.2 kb) were amplified from 200 ng of genomic DNA by PCR with the forward primers gal-0.5 kb (5'-GTTAAGTCAGTGGCCCTCTGCAG-3') or gal-1.2 kb (5'-CAGAGGAGATGTTAAGAGAGCAGAC-3') and the reverse primer gal-as1 (5'-CGCACCAGCTGTCAGAAGACTCC-3'). PCR amplifications were then performed in the presence of 0.2 mM dNTPs, 1 \u03bcM of each primer, 1 U of Vent polymerase  through 35 cycles . The PCR products were purified with the QIAquick PCR purification kit  and ligated into the pBluescript SK (pBSK) vector in SmaI. Positive clones were sequenced and compared to the human galectin-1 promoter sequence , Molt-4, CEM-T4, PM1, Sup T1, C8166-45, C91-PL, MJ, MT2 and S1T cell lines or from transfected 293T cells was extracted with the TRIzol reagent . Extracted RNA (5 \u03bcg) was then reverse transcripted with the M-MLV reverse transcriptase (1 U)  and oligo dT primers. Next, PCR amplification was performed on the resulting cDNA with primers act-s (5'-CGTGACATTAAGGAGAAGCTGTGC-3') and act-as (5'-TCTAGGAGGAGCAATGATCTTGAT-3') for \u03b2-actin mRNA; gal-s (5'-GACTCAATCATGGCTTGTGGTCTG-3') and gal-as (5'-GCTGATTTCAGTCAAAGGCCACAC-3') for galectin-1 mRNA; or tax-s (5'-ATGGCCCACTTCCCAGGGTTTGGAC-3') and tax-as (5'-TCAGACTTCTGTTTCGAGGAAATG-3') for Tax mRNA. PCR amplifications were performed in the presence of 0.2 mM dNTPs, 1 \u03bcM of each primer, 1 U Vent polymerase and 30 amplification cycles . The PCR products were then migrated on a 1.5% agarose gel.\u00ae Plus mini Kit  according to the manufacturer's instructions. Real-time RT-PCR reactions were then performed in the presence of each specific primer. Briefly, RNA (5 \u03bcg) was reverse transcripted with the M-MLV reverse transcriptase (1 U) (Invitrogen) and oligo dT primers. PCR reactions were then initiated in a final volume of 10 \u03bcl containing 1 \u03bcl of cDNA, 0.5 \u03bcM of each primer, and 1\u00d7 reaction mix, including Taq DNA polymerase, the reaction buffer, and SYBR green . All primer sequences were generated using the Light Cycler Probe Design Software 2.0  and checked for specificity using GenBank Blast analysis. The galectin-1 primers were the following: 5'-GACTCAATCATGGCTTGTGGTCTG-3' (reverse) and 5'-GCTGATTTCAGTCAAAGGCCACAC-3' (forward). In all PCR reactions, negative controls consisting of a RT-like reaction step with no added reverse transcriptase in addition to a blank sample were carried out and showed no PCR amplification (data not shown). Thermal cycling for quantification of both transcripts was initiated with a denaturation step of 95\u00b0C for 10 seconds, followed by 50 cycles . Amplification of the human HPRT-1 (Hypoxanthine Phosphoribosyl Transferase 1) cDNA with forward and reverse primers  was used as a reference gene for normalisation. To verify the amplification of each single product with its suitable melting temperature, and to provide an accurate quantification with the Rel Quant Software, dissociation curves were run for all reactions and amplified products were visualized by electrophoresis on a 1.5% agarose gel.RNA was first isolated from 293T transfected cells, by the RNeasy7) were transiently transfected by electroporation as previously described [Jurkat, CEM-T4 and SupT1 cells . Galectin-1 concentration was determined by an in house ELISA assay specific for galectin-1.A2.01, HSB-2, Jurkat (clone E6.1), Molt-4, PM1, CEM-T4, SupT1, C8166-45, C91-PL, MJ, MT2 and S1T cell lines were seeded at 5 \u00d7 105 cells) for 48 hours at 37\u00b0C before lysis. In certain experiments, 24 hours after transfection, TNF-\u03b1 was added at a concentration of 10 ng/ml. Luciferase activity was next measured as previously described [HIV-1-based viruses pseudotyped with the HTLV-I envelope protein were prepared as previously described . Brieflyescribed . Experim5) were then added to an equal number of transfected Jurkat cells in a flat-bottom 96-well plate. Galectin-1 was added in various concentrations (ranging from 0 to 4 \u03bcM) in the absence or presence of 50 mM lactose for 24 hours at 37\u00b0C before lysis and quantification of luciferase activity. As a control, transfected cells were similarly incubated with supernatant of C91-PL cells harvested after a 24 hour incubation at a concentration of 1 \u00d7 106 cells/ml and filtered through a 0.22 \u03bcM filter. Values are expressed as the average luciferase activity +/- standard deviation calculated from triplicates.Jurkat cells were transfected with pHTLV-Luc by electroporation as described above. HTLV-I-infected C91-PL cells  . HomoscePrevious studies have suggested that expression of various genes are positively modulated in HTLV-I-infected cells ,57. In oAs some of the tested HTLV-I-infected cells have been reported to only express the viral Tax protein, we then looked if Tax expression indeed could modulate galectin mRNA levels. 293T cells were transfected with either a vector containing a complete HTLV-I proviral genome (i.e. K30), or expression vectors coding for Tax WT or Tax mutants defective in their ability to activate transcription factors NF-\u03baB, SRF and/or CREB. Galectin-1 expression was then analyzed by RT-PCR. As shown in Figure Next, RT-PCR analyses were performed in a more representative context, i.e T cell lines. Hence, the wild-type Tax expression vector was transfected in CEM-T4 and SupT1 T cell lines and analysed by RT-PCR for galectin-1 expression. As denoted in Figure As the data suggest that HTLV-I Tax induces the expression of galectin-1 in non-T and T cell lines, it is likely that Tax plays a role in the modulation of galectin-1 mRNA levels in HTLV-I-infected cell lines.To determine whether the effect of Tax on galectin-1 expression resulted from direct activation of transcription from the galectin-1 promoter, two different luciferase-encoding vectors driven by the human galectin-1 promoter were constructed. Two fragments of 0.5 kbp and 1.2 kbp containing the transcription initiation site deduced from sequence homology with the mouse galectin-1 gene were derived from the human galectin-1 promoter region. Both fragments were cloned upstream of the luciferase reporter gene of the pGL3-Basic vector. Before determining the effect of Tax on these constructs, the Tax M22 expression vector was first tested in the context of Jurkat cells to see if it was specifically deficient in activating NF-\u03baB Figure . These rLower induction of the galectin-1 promoter by TaxM22, which is deficient for NF-\u03baB activation, raised the possibility that this transcription factor was crucial for Tax-mediated increase in galectin-1 expression. However, Jurkat cells transfected with the 1.2 kb galectin-1 promoter construct did not show higher luciferase activity upon stimulation with two known potent NF-\u03baB activating agents, PMA and TNF-\u03b1, thereby strongly suggesting that NF-\u03baB was not involved in the modulation of galectin-1 promoter activity by Tax Figure . As no kAs we have demonstrated that HTLV-I-infected cell lines express higher levels of galectin-1 mRNA, we next studied whether these cells produced more extracellular galectin-1. Figure Together, the data suggest that mRNA and secretion of galectin-1 were both upregulated in cells chronically infected with HTLV-I.As galectin-1 can stabilize cell-to-cell and cell-virus interactions by cross-linking different entities, we studied whether extracellular galectin-1 could facilitate HTLV-I infection. To initiate this study, Jurkat E6.1 cells were first infected with luciferase-expressing HIV virions pseudotyped with the HTLV-I gp46 envelope in the presence of various concentrations of purified galectin-1 (0\u20134 \u03bcM) for 48 hours; luciferase activity was then measured. The use of HTLV-I gp46-pseudotyped virions that can express luciferase allows us to detect a single round of infection and although different from wild-type HTLV-I virions, it should be representative of the type of interactions and fusogenic activities of gp46 occurring on the surface of HTLV-I virions upon infection. Infection of Jurkat E6.1 cells by the pseudotyped virions was increased by 1.6 fold in the presence of 2 \u03bcM of galectin-1, an increase which was statistically significant  Figure . LactoseA more physiological model was also used to study the impact of soluble galectin-1 on infection by HTLV-I pseudotyped virus. PBMCs isolated from a healthy donor were stimulated with IL-2 and PHA-L for 72 hours and, after washing, were then similarly treated upon infection by the HTLV-I gp46-pseudotyped virions. The infection of PBMCs by pseudotyped virions was increased by 1.8 fold in the presence of 4 \u03bcM of galectin-1 Figure . The posTo eliminate the possibility that galectin-1 was positively modulating LTR activity of the integrated proviral DNA of our gp46-pseudotyped virions, Jurkat cells were transfected with a vector containing the luciferase reporter gene under the control of the HIV-1 LTR, after which different concentrations of galectin-1 (0\u20134 \u03bcM) was added. Measurement of luciferase activity demonstrated that the presence of galectin-1 had no impact on the transcription levels dependent on the HIV-1 LTR (data not shown).Hence, these results show that extracellular galectin-1 increases infection of a T cell line and PBMCs by free HTLV-I gp46-pseudotyped viruses and that this increase relies on the binding of cell/virus surface carbohydrates by the galectin-1 CRD.To study whether galectin-1 can possibly facilitate cell fusion events, a co-culture system allowing a quantitative evaluation of cell fusion by luciferase assay was used . This ceThese results show that soluble galectin-1 can also increase cytoplasmic cell exchange likely occurring though gp46-dependent cell fusion events between an HTLV-I-infected cells and uninfected T cells, again being inhibited by the addition of lactose.HTLV-I is a poorly infectious virus and, in this regard, the presence of various molecules that facilitate infection may be important for viral transmission. Several studies have been conducted on the implication of adhesion molecules incorporated by retroviruses  and their positive impact on viral replication . SimilarIn this study, we have demonstrated that galectin-1 is more strongly expressed and secreted in chronically HTLV-I-infected T cell lines compared to uninfected T cells. These results agree with the study of Pise-Masison and colleagues, which showed through DNA microarray experiments that galectin-1 gene expression is upregulated in HTLV-I-transformed and immortalized cell lines . FurtherAs cell-free virus has very low infectivity, it is assumed that HTLV-I infection is mediated by the interaction between non-infected and infected cells, although recent evidence has demonstrated that cell-free virus can infect isolated dendritic cells -74. We hin vivo conditions are likely to differ from our cell culture settings. Previous studies have demonstrated that lymphoid organ tissues are sites where an important number of infected T lymphocytes are located [Although galectin-1 concentrations in our infection experiments were higher than the measured levels from the supernatant of infected cells,  located -77. Give located . MoreoveIn summary, our study demonstrates a bidirectional interaction between HTLV-I and galectin-1. The data demonstrated that expression of galectin-1 was increased in chronically HTLV-I-infected cells and that this modulation of galectin-1 expression was largely attributed to the viral transactivator Tax in NF-\u03baB- and CREB-independent manners. In addition, this study showed that HTLV-I-infected cells secrete galectin-1 at a higher level than the uninfected cells and that extracellular galectin-1 facilitates HTLV-I infection and promotes higher levels of gp46-dependent cell fusion. Given that our previous studies had demonstrated that HIV-1 is also enhanced in its infectivity by galectin-1 ,36, otheThe authors declare that they have no competing interests.SG carried all RT-PCR analyses, transfection experiments and infection and syncytium formation assay and has drafted the manuscript. IP has conducted the ELISA assay. MO has participated in the design of the study. AV has performed the real-time RT-PCR experiments and has helped in drafting the manuscript. MJT and SS have helped in drafting and finalizing the manuscript and have provided important input on the design of the study. BB conceived the study, participated in its coordination and helped in drafting and finalizing the manuscript."}
{"text": "Cell Titer 96\u00ae AQueous One Solution cell proliferation assay was used to investigate the cytotoxicity of this cationic copolymer. Second, siRNAs targeting IKK\u03b2 (IKK\u0392-siRNAs) were delivered into the HTFs using CS-g-(PEI-b-mPEG) as the vehicle. Real-time reverse transcription polymerase chain reaction (RT\u2013PCR) subsequently assessed the mRNA level of IKK\u03b2, and western blot assay was used to determine protein expression. After IKKB-siRNA transfection, Cell Titer 96\u00ae AQueous One Solution cell proliferation assay was used to evaluate the proliferation of HTFs.First, a novel cationic copolymer composed of low molecular weight, linear poly(ethyleneimine) [PEI] blocked with polyethylene glycol (PEG) and grafted onto a chitosan (CS) molecule was synthesized. CS-g-(PEI-b-mPEG)/siRNA complexes tended to decrease whereas their zeta potential tended to increase as the N/P ratio increased. The CS-g-(PEI-b-mPEG) copolymer showed good siRNA binding ability and high siRNA protection capacity. Furthermore, the copolymer presented remarkable transfection efficiency and showed much less cytotoxicity than 25\u00a0kDa PEI. IKKB-siRNAs were successfully delivered into HTFs using CS-g-(PEI-b-mPEG) as a vector. As a result, the expression of IKK\u03b2 was downregulated at both the mRNA and protein levels, and the activation of nuclear factor-\u03baB (NF-\u03baB) in the HTFs was subsequently inhibited. Most impressively, the proliferation of HTFs was also effectively suppressed through the blocking of the NF-\u03baB pathway.The diameter of the CS-g-(PEI-b-mPEG) is a promising candidate for siRNA delivery, featuring excellent biocompatibility, biodegradability, and transfection efficiency. The RNA interference (RNAi) strategy using cationic copolymers as siRNA carriers will be a safe and efficient anti-scarring method following glaucoma filtration surgery.All the results demonstrate that CS- RNA interference (RNAi) was originally recognized as an evolutionary conserved defense mechanism in higher eukaryotic cells, and this system can easily and effectively inhibit the expression of one specific gene . The RNAThe efficiency of RNAi mainly depends on the successful delivery of intact siRNA into mammalian cells. However, due to the low stability of siRNA against enzymatic degradation and low permeability across cell membranes, the efficacy of naked siRNA is insufficient. Therefore, it is necessary to develop efficient and convenient methods for siRNA delivery. Until now, viral delivery systems have been used as vectors for genes in many studies due to the advantage of high transfection efficacy, but the use of such delivery systems is limited by endogenous recombination and host immunity . MoreoveGlaucoma is an eye disease usually associated with increased intraocular pressure that leads to irreversible functional impairment of the optic nerve. Filtration surgery to enhance the drainage of aqueous humor is one of the most effective therapies for glaucoma , but theg-(PEI-b-mPEG), was synthesized. The properties of the CS-g-(PEI-b-mPEG)/siRNA complexes such as particle size, zeta potential, siRNA binding and protection capacity, transfection ability, and cytotoxicity were studied, and IKK\u0392-siRNAs were then delivered into human Tenon\u2019s capsule fibroblasts (HTFs) using CS-g-(PEI-b-mPEG) as the vehicle. The expression of IKK\u03b2 was detected at both the mRNA and protein levels after the transfection of IKK\u0392-siRNAs. We also investigated the activation of NF-\u03baB and the proliferation of HTFs after the RNA interference process targeting IKK\u03b2.In the study reported here, absorbable, low molecular weight PEI was blocked with polyethylene glycol monomethyl ether (mPEG) and grafted onto chitosan. As a result, a novel biodegradable copolymer, CS-2, 95% humidified atmosphere.HeLa  cells were obtained from the American Type Culture Collection  and were maintained in Dulbecco\u2019s modified Eagle\u2019s medium  containing 10% fetal bovine serum , 2\u00a0mM of L-glutamine, 100\u00a0IU/ml of penicillin, 100\u00a0\u03bcg/ml of streptomycin, and 25\u00a0\u03bcg/ml of amphotericin B  at 37\u00a0\u00b0C with 5% CO2, 95% humidified atmosphere in DMEM supplemented with 10% FBS, 2\u00a0mM of L-glutamine, 100\u00a0IU/ml of penicillin, 100\u00a0\u03bcg/ml of streptomycin, and 25\u00a0\u03bcg/ml of amphotericin B. Cells between passages 3 and 6 were used for the following experiments.Tissue explants of human Tenon\u2019s capsule were obtained from three male patients  who had undergone trauma or cataract surgery. Patients were informed of the nature and possible consequences of the tissue removal procedure, and written, informed consent was obtained. The tenets of the Declaration of Helsinki were followed, and approval by the Sun Yat-sen University Human Experimentation committee was granted. HTFs were cultured by a previously reported method  with som5 [Mw=3.50\u00d7105], which was measured by the viscosity method and the degree of deacetylation of chitosan was 88%, which was determined by proton nuclear magnetic resonance [1H NMR]), was purified by a solvent precipitation method. Polyethylene glycol monomethyl ether  was purchased from Sigma-Aldrich Chemie Gmbh . Linear PEI (Mn=600) and branched PEI  were obtained from Wako Pure Chemical Industries, Ltd. . CS-g-(PEI-b-mPEG) was synthesized by Jiang\u2019s method with some modification [b-mPEG, was synthesized by an imine reaction, and then the periodate ion, IO4-, was used to oxidize CS to produce dialdehyde. A novel, comb-like copolymer, CS-g-(PEI-b-mPEG), was synthesized by an imine reaction between the amino groups of PEI-b-mPEG and the aldehyde groups of periodate-oxidized CS. The resultant product was purified by dialysis against double deionized (DD) water with the use of Spectra/Pro2 membrane  for 72 h to remove the unreacted PEI and mPEG and then freeze-dried for another 24 h. A schematic illustration of the synthesis process is shown in g-(PEI-b-mPEG) was proved by 1H NMR and gel permeation chromatography (GPC).Chitosan,  and incubated for 5 min at room temperature, and the CS-g-(PEI-b-mPEG) copolymer was dissolved in serum-free DMEM at a stock concentration of 1\u00a0mg/ml. Subsequently, different concentrations of the CS-g-(PEI-b-mPEG) solution were added into dissolved siRNA to make complexes of various charge ratios. The charge ratio of CS-g-(PEI-b-mPEG) and siRNA was expressed as the molar ratio of the amine groups of the copolymer (representing positive units) to the phosphates of siRNA (representing negative units) called the N/P ratio. The mixture was gently vortexed for 10 s and incubated at room temperature for 30 min to allow the formation of CS-g-(PEI-b-mPEG)/siRNA complexes.IKK\u0392-siRNA, scrambled siRNA, and fluorescein isothiocyanate (FITC)-conjugated scrambled siRNA were all synthesized by Ribobio Co. Ltd. . Lyophilized siRNAs were dissolved in RNase-free Hg-(PEI-b-mPEG)/siRNA complexes with N/P ratios of 1, 3, 5, 10, and 20. The hydrodynamic diameter of the freshly prepared complexes was measured at 25\u00a0\u00b0C with a scattering angle of 90\u00b0 , and the zeta potential was determined by the standard capillary electrophoresis cell of Zetasizer Nano ZS at position 17.0 and at 25\u00a0\u00b0C. All the average values were performed with the data from three separate measurements.Dynamic light scattering (DLS) with a Zetasizer Nano ZS instrument  was used to measure the diameter and zeta potential of the CS-g-(PEI-b-mPEG) and siRNA was determined by 4% agarose (low melting point) gel electrophoresis [g-(PEI-b-mPEG) were considered as N/P ratio=0), 1, 3, 5, 10, and 20 as described above, and samples, each containing 0.133\u00a0\u03bcg (1\u00d710\u22122 nmol) of siRNAs, were loaded onto 4% agarose gel together with 1:6 dilution of the loading buffer. The electrophoresis was performed in TBE buffer  at 55 V for 1 h. To visualize the siRNA, the gel was immersed in 0.5\u00a0\u00b5g/ml of ethidium bromide solution (Sigma-Aldrich), and the fluorescence images were captured under ultraviolet (UV) illumination .The binding degree between CS-phoresis . The comg-(PEI-b-mPEG) to protect siRNA against enzymatic degradation was investigated according to a previously reported method with minor modifications [g-(PEI-b-mPEG)/siRNA complexes containing the same amount of siRNAs were prepared at an N/P ratio of 0 (naked siRNA), 1, 3, 5, 10, and 20. Subsequently, FBS was added as needed to achieve a final concentration of 10%. The mixtures were incubated at 37\u00a0\u00b0C, and at each determined time interval , a sample of each N/P ratio was removed and incubated at 70\u00a0\u00b0C for 5 min to inactivate the serum enzymes. Then, 5\u00a0\u00b5l of heparin (1000\u00a0IU/ml) was added to displace the siRNAs from the complexes before the mixtures were loaded onto a 15% polyacrylamide gel containing 7 M urea. Electrophoresis was performed in TBE buffer at 200 V for 1 h. Afterward, gels were stained in a 1:10,000 dilution of SYBR\u00ae Green II fluorescent RNA dye  for 40 min, and Bio-Capt version 10.0 software  was used to analyze the fluorescence intensity of each band. All experiments were performed in triplicate, and the fluorescence intensity of each band was compared with that of the non-FBS treated siRNAs (which served as the control) on the same gel.The ability of CS-ications . The CS-5 cells per well and incubated for 12 h or 24 h (reaching 60%\u201370% confluence). The culture media were then replaced with DMEM without serum or with antibiotics 2 h before transfection. The CS-g-(PEI-b-mPEG) and FITC-conjugated siRNA complexes were prepared as described above, and the N/P ratios were performed at 0 (naked FITC-conjugated siRNAs), 1, 3, 5, 10, and 20. A total volume of 2\u00a0ml of serum and antibiotics-free DMEM-containing complexes was added to each well, and the final concentration of siRNAs was 50 nM. After a 6 h incubation at 37\u00a0\u00b0C, the remaining media were discarded, and cells were trypsinized and resuspended in PBS at a density of 5\u00d7105 cells/ml for flow cytometry analysis. The transfection efficiency was calculated by measuring the percentage of FITC-labeled cells using a FACSAriaTM System .HeLa cells and HTFs were plated in six well plates with a density of 6\u00d710\u00ae AQueous One Solution cell proliferation assay  was used to evaluate cell viability [3 cells per well and incubated for 24 h (reaching 80% confluence) before the copolymers were added. Then, serum-supplied DMEM were replaced by 200\u00a0\u00b5l of serum and antibiotic-free DMEM that contained various concentrations  of CS-g-(PEI-b-mPEG) or 25\u00a0kDa PEI. The CS-g-(PEI-b-mPEG) or 25\u00a0kDa PEI/siRNA complexes containing 100 nM of siRNAs were prepared at an N/P ratio of 0 (only scrambled siRNAs), 1, 3, 5, 10, and 20, and their cytotoxicity was also evaluated. After 24 h incubation at 37\u00a0\u00b0C, the media were replaced with fresh serum and antibiotic-free DMEM that contained 20\u00a0\u03bcl of Cell Titer 96\u00ae AQueous One Solution Reagent (MTS). Finally, after 4 h of additional incubation, a micro-plate reader  measured the absorbance of each well at 570 nm. Cell viability was calculated according to the following equation: Cell Titer 96iability . HTFs we570(sample) represents the average absorbance of cells treated with media that contain different concentrations of cationic polymers or cationic polymers/siRNA complexes, and OD570(control) represents the average absorbance of cells treated only with an equal volume of serum-free DMEM.where ODIKK\u03b2 (IKK\u0392-siRNA) were derived from the coding sequence of the human IKK\u03b2 gene (GenBank NM_001556) and were designed using a siRNA Target Finder program. A BLAST search checked all the duplex sequences and target sequences of these siRNAs to preclude sequences with significant similarity to other genes in the human genome. The duplex sequences of IKKB-si1 were 5\u2032-CCG ACA UUG UGG ACU UAC AdT dT, dTd TGG CUG UAA CAC CUG AAU GU-5\u2032, and the duplex sequences of IKKB-si2 were 5\u2032-GCU UAG AUA CCU UCA UGA AdT dT, dTd TCG AAU CUA UGG AAG UAC UU-5\u2032. HTFs were plated in six well plates with a density of 6\u00d7105 cells per well and incubated for 12 h. Subsequently, the culture media were replaced with serum- and antibiotic-free DMEM 2 h before transfection. CS-g-(PEI-b-mPEG)/IKK\u0392-si1 and CS-g-(PEI-b-mPEG)/IKK\u0392-si2 complexes were prepared at an N/P ratio of 10 30 min before transfection, and cells were incubated with serum- and antibiotic-free DMEM that contained complexes corresponding to the determined final concentrations of IKK\u0392-si1 or IKK\u0392-si2  for 6 h. Then, the cells were maintained in serum-supplied DMEM for another 24 h or 48 h before the following assays were performed as described below. Non-transfected HTFs were regarded as the control, and cells were also transfected with 100 nM of scrambled siRNA.Two pairs of siRNA specifically targeting 5 to 2\u00d7105 HTFs 24 h after the transfection medium was removed using the RNeasy Micro Kit  according to the manufacturer\u2019s protocol. The yield and purity of the RNA were spectrophotometrically determined, and the cDNA were prepared using the ReverAidTM First Strand cDNA Synthesis Kit . A real-time reverse transcription polymerase chain reaction (RT\u2013PCR) procedure was conducted according to the manufacturer\u2019s protocol for the SYBR\u00ae Premix Ex TaqTM Kit . Reaction participants were assembled in a 96 well optical reaction plate , and each well contained SYBR\u00ae Premix Ex TaqTM (2X), 200 nM of forward primer, 200 nM of reverse primer, ROX Reference Dye (50X), and cDNA solution with a total volume of 20\u00a0\u03bcl. For IKK\u03b2, the forward primer was 5\u2032-TGT CAG TGG AAG CCC GGA TAG-3\u2032, and the reverse primer was 3\u2032-AGG TTA TGT GCT TCA GCC ACC AG-5\u2032. The mRNA level of glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was also measured in each sample as an internal control. The forward primer was 5\u2032-ATC ACC ATC TTC CAG GAG CGA-3\u2032, and the reverse primer was 3\u2032-CAG AAG TGG TGG TAC CTC TTC C-5\u2032. Reactions were performed under the following conditions: 10 min at 95\u00a0\u00b0C for the initial denaturation, 40 cycles of amplification (5 s at 95\u00a0\u00b0C), and annealing for 31 s at 60\u00a0\u00b0C, using the ABI Prism 7000 Sequence Detection System (Applied Biosystems). The threshold cycle (Ct) values were determined by ABI Prism 7000 Software (Applied Biosystems) and were normalized by subtracting the Ct GAPDH values. All experiments were performed in triplicate, and the relative amount of mRNA of each sample was calculated using the 2-\u0394Ct method in individual experiments [Total RNA was extracted from 1\u00d710eriments .Each group of HTFs was lysed in lysis buffer  48 h after the transfection procedure. An equal amount of protein (10\u00a0\u00b5g) was loaded on 12% sodium dodecyl sulfate-polyacrylamide gel, and electrophoresis was performed for 1 h. The proteins were then electrophoretically transferred to a polyvinylidene diflouride (PVDF) membrane  for probing with mouse monoclonal anti-IKK\u03b2  and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG . Blotting signals were detected by chemiluminescence reagents using an ECL kit  following the manufacturer\u2019s instructions. The \u03b2-actin protein amount of each sample was also measured as an internal control.5 cells per well and incubated for 24 h to allow adhesion. Then, 100 nM of IKK\u0392-siRNA or 100 nM of scrambled siRNA were transfected into HTFs as described above, and after another 24 h, the cells were stimulated with 20 ng/ml of tumor necrosis factor-\u03b1 (TNF-\u03b1) for 1 h. All the coverslips were taken out 24 h after the TNF-\u03b1 stimulation and were rinsed three times with PBS. The cells were then fixed by incubation with 4% paraformaldehyde solution at room temperature for 10 min followed by 10 min permeabilization by 0.2% Triton X-100 (Sigma-Aldrich). After blocking the nonspecific binding with goat serum for 30 min, all the samples were incubated with mouse monoclonal anti-p65 of NF-\u03baB  and FITC-conjugated goat anti-mouse IgG  at 37\u00a0\u00b0C for 1 h, both under light exclusion. The nuclei of the cells were counterstained with 2\u00a0\u00b5g/ml of DAPI  at room temperature for 10 min under light exclusion. A Zeiss LSM 510 confocal laser scanning device  was used to capture the inflorescence images. Cells not treated with either CS-g-(PEI-b-mPEG)/siRNA complexes or TNF-\u03b1 were considered the negative control, and cells treated with only 20 ng/ml of TNF-\u03b1 for 1 h were measured as the positive control.HTFs prepared for the confocal microscopy study were seeded onto preloaded glass coverslips (18\u00a0mm\u00d718\u00a0mm) in six well plates with a density of 6\u00d710\u00ae AQueous One Solution cell proliferation assay. After siRNA transfection, each group of HTFs was trypsinized and seeded in a 96 well plate with an initial density of 5\u00d7103 cells per well. Subsequently, cells were cultured in a serum-supplied medium for 72 h, and the absorbance of each sample corresponding to the cell number was measured.The proliferation of HTFs was measured using Cell Titer 96t-test or one-way analysis of variance (ANOVA). Probability (p) of less than 0.05 was considered significant.All data are presented as means\u00b1standard deviation (SD). The statistical analyses were conducted using SPSS version 13.0 for windows . Statistical analysis was performed using Student\u2019s q) was calculated by the following equation from the 1H NMR spectrum:CS proton signals appeared at 2.84 ppm (H-2) and 3.3\u22123.8 ppm  were 1.16\u00d7104 and 2.95\u00d7104, and the degree of grafted PEI-b-mPEG can be calculated by the following equation according to the data above:From the results of GPC , the molW,CS-CHO is the average molecular weight of repeat unit of CS-CHO.M\u2019g-(PEI-b-mPEG)/siRNA complexes ranged between 200 nm and 250 nm at the determined N/P ratios  and siRNA was assessed by visualizing the mobility of the CS-g-(PEI-b-mPEG)/siRNA complexes using electrophoresis retardation assay. As shown in g-(PEI-b-mPEG) was measured by incubating the CS-g-(PEI-b-mPEG)/siRNA complexes with 10% FBS for 2 h, 4 h, 8 h, 12 h, and 24 h. The remaining intact siRNA was visualized by polyacrylamide gel electrophoresis (PAGE), and the images of the gels are shown in The degree of compaction between CS-g-(PEI-b-mPEG) or 25\u00a0kDa PEI/siRNA complexes were added. As shown in g-(PEI-b-mPEG) and 25\u00a0kDa PEI increased as the N/P ratio increased. The transfection efficiency of CS-g-(PEI-b-mPEG) reached its peak (more than 60%) at the N/P ratio of 20 in both cell lines. However, it could not be calculated when 25\u00a0kDa PEI was used for transfection at the same N/P ratio because most cells had been killed. A tetrazolium-based viability assay, which was based on the bioreduction of the MTS reagent into formazan by living cells, was used to study the cytotoxicity of CS-g-(PEI-b-mPEG) and 25\u00a0kDa PEI. The pure CS-g-(PEI-b-mPEG) copolymer exhibited cell viability of more than 70% at concentrations of 1\u2013100\u00a0\u03bcg/ml, and the number of viable cells was significantly higher than those treated with pure 25\u00a0kDa PEI at concentrations of 10\u00a0\u03bcg/ml and above (g-(PEI-b-mPEG)/siRNA and 25\u00a0kDa PEI/siRNA complexes presented less toxicity after being compacted with siRNAs, and the CS-g-(PEI-b-mPEG)/siRNA complexes also performed decreasing cytotoxicity at all the determined N/P ratios compared with that of the 25\u00a0kDa PEI/siRNA complexes.Transfection efficiency was evaluated by measuring the percentage of HeLa cells or HTFs containing FITC-conjugated siRNA, using flowmetry 6 h after CS-nd above . Figure IKK\u03b2 mRNA (data not shown), so we used IKK\u0392-si1 as IKK\u0392-siRNA in the subsequent RNAi procedures. Real-time PCR assay revealed that mRNA transcription of IKK\u03b2 in the HTFs was suppressed in a dose-dependent manner 24 h after 5\u2013100 nM of IKK\u0392-siRNA were transfected  as shown in The RNAi process targeting Glaucoma filtration surgery often fails because of excessive scarring that occurs during the wound healing process. After filtration surgery, fibroblasts are activated by various cytokines and growth factors, eventually resulting in the closure of the drainage channel. Thus, preventing the hyperfunction of fibroblasts is an important strategy for minimizing subconjunctival scarring ,21. CurrIKK\u03b2 using a commercial transfection reagent, LipofectamineTM 2000 , as a siRNA-delivering vector. However, this cationic liposome compound cannot be used for in vivo investigation in humans [One goal of our study was to find new physiologic approaches to limiting excessive subconjunctival wound healing that are as effective as antimetabolic agents but have fewer adverse effects. NF-\u03baB is a member of the transcription factor family NF-\u03baB/Rel and was originally described as a necessary element for the transcription of the immunoglobulin \u03baL chain gene in mature B cells . NF-\u03baB hn humans .Therefore, another objective of our study was to design and synthesize new compounds that are non-toxic, non-immunogenic, degradable, and efficient for delivering siRNA into HTFs. Among non-viral nucleotide carriers currently under investigation, PEI is one kind of synthetic polymer with a high cationic charge density and a protonable amino group in every third position. PEI can condense and compact DNA into complexes, and the strong proton capacity of PEI allows it to deliver plasmid DNA and oligonucleotides into mammalian cells, both in vitro and in vivo . However1H NMR spectrum of the copolymer, respectively. CS proton absorption signals  also overlapped the PEI and mPEG proton signals (g-(PEI-b-mPEG) copolymer was successfully obtained. The molecular weight of CS-g-(PEI-b-mPEG) was 2.95\u00d7104, which was relatively larger than some reported PEI-alt-PEG copolymers [In light of these results, we speculated that a novel cationic copolymer combined with PEI, PEG, and CS could be synthesized as a vehicle for delivering siRNA into mammalian cells effectively and safely. In our research, we found that after the grafting reaction, characteristic absorption of PEI and mPEG appeared at 2.5\u22123.3 ppm and 3.5 ppm in the  signals . All of polymers  but smalpolymers .g-(PEI-b-mPEG)/siRNA complexes at five different N/P charge ratios and observed that the complexes represented particles with nanometer size (about 200 nm), which were much less than that of 25\u00a0kDa PEI. Furthermore, particle size tended to decrease as the N/P charge ratios of the CS-g-(PEI-b-mPEG)/siRNA complexes increased, indicating that the CS-g-(PEI-b-mPEG) copolymer can condense siRNA into a more compact structure, mainly owing to the net electrostatic repulsive forces between complexes.As indicated in previous reports, the size and shape of nanoparticles play an important role in the delivery process and greatly influence distribution in the body . It has g-(PEI-b-mPEG)/siRNA complexes is also a major factor influencing transfection efficiency. After the compaction between cationic copolymers and siRNA, the negative charge of siRNA is neutralized and the newly assembled nanoparticles may retain a partial positive surface charge to help siRNA pass through the cell membrane and escape the endolysosomes. However, the excessive positive charge of PEI homopolymers may subsequently lead to hyperpermeability of the membrane, resulting in cell death [g-(PEI-b-mPEG) and the negative charge was neutralized. But the zeta potential of the CS-g-(PEI-b-mPEG)/siRNA complexes at each N/P ratio that we measured was still lower than that of the 25\u00a0kDa PEI/siRNA complexes. The reason for this result is probably consistent with the reason Petersen et al. [The surface charge of the CS-ll death . The denn et al.  regarding-(PEI-b-mPEG) and siRNA can achieve more efficient delivering capacity. If the complexes are formed efficiently, all siRNAs are bound to the copolymers to form nanoparticles. Hence, the complexes become relatively large and remain immobile in the loading well with no bands of free siRNA apparent. We observed that the migration of siRNA was retarded to different degrees in accordance with the increasing N/P ratio. Complete retardation occurs at an N/P ratio of 10, which means the CS-g-(PEI-b-mPEG)/siRNA complexes are completely formed. The complete complexes of 600\u00a0kDa PEI and siRNA cannot be found even at an N/P ratio of 50 (data not shown), which indicates that the condensation ability of CS-g-(PEI-b-mPEG) is better than low molecular weight PEI. It was also detected that the band of siRNA at an N/P ratio of 20 demonstrated much lower fluorescence intensity than that of the band at the N/P ratio of 10. This decrease in fluorescence was also observed by other experiments executed on DNA bands [Condensation ability is one requirement for a siRNA carrier. An optimal binding degree between CS-NA bands ,45. The NA bands .g-(PEI-b-mPEG) we have synthesized has both PEG and CS elements and can provide efficient protection for siRNA against enzymatic degradation.The main hindrance to the use of RNAi as a therapeutic tool for human diseases is that the unprotected dsRNA or siRNA will be rapidly degraded by either nucleases in serum or the endosomal compartment of cells. The enzymatic degradation of siRNA is accompanied by a rapid decline in biological activity and therapeutic efficiency. Therefore, the potential of this technology as a clinical therapy method depends largely on the improvement of siRNA vectors\u2019 protection ability against enzymatic degradation. We found that after incubation in 10% FBS for 24 h, 64% of siRNA was protected from degradation at the N/P ratio of 20 whereas only 0.7% naked siRNA remained intact. We attributed these results to two factors. First, PEG not only has the reported ability to stabilize the structure of nanospheres, but PEG can also protect siRNA from being attacked by nucleases ,47. Secog-(PEI-b-mPEG) and 25\u00a0kDa PEI on the cell viability of HTFs. CS-g-(PEI-b-mPEG) showed much less cytotoxicity than 25\u00a0kDa PEI, which is consistent with what had been obtained by Kim et al. [g-(PEI-b-mPEG) copolymer did not exhibit significant cytotoxicity at any determined concentration. We hypothesize that the relatively low cytotoxicity of CS-g-(PEI-b-mPEG) could be explained from two aspects. First, the copolymer can be degraded into CS, PEG, and low molecular weight PEI units in cells, all of which can be easily eliminated by excretion pathways, thus making this copolymer relatively less toxic than 25\u00a0kDa PEI. Second, PEG reduces toxicity by substituting the amino groups of PEI, which are the main toxic moieties of the copolymer [g-(PEI-b-mPEG)/siRNA and 25\u00a0kDa PEI/siRNA complexes showed much lower cytotoxicity, which is due to the neutralization effect of the negative charge of siRNA on the positive charge of the pure polymers.Low toxicity is also a major requirement for an siRNA delivery system. The cytotoxicity of cationic copolymers is mainly caused by the aggregation of nanoparticles on the cell membrane, impairing its normal function. In addition, the excessive positive surface charge of nanoparticles may also interfere with critical intracellular processes of cells . It has m et al.  in testsopolymer . Furtherg-(PEI-b-mPEG)/siRNA complexes was assessed at various N/P ratios in HeLa cells and HTFs. This is mainly because the N/P ratio is directly related to the size, surface charge, compaction degree, and serum-resistant capacity of the CS-g-(PEI-b-mPEG)/siRNA complexes, all of which can affect delivery efficiency. At the N/P ratio of 20, CS-g-(PEI-b-mPEG) outperformed the highest transfection rate in both HeLa cells and HTFs, which can be explained by the appropriate particle size and surface charge as well as the excellent stability of the CS-g-(PEI-b-mPEG)/siRNA complexes. The transfection rate was a little lower than that of 25\u00a0kDa PEI at the same N/P ratio partly because of the shielding effect of mPEG on the positive charge of PEI. We also found that both CS-g-(PEI-b-mPEG) and 25\u00a0kDa PEI showed a lower transfection rate in HTFs than in HeLa cells, which may be attributed to a cell line dependency of the cationic polymer\u2019s delivery ability [g-(PEI-b-mPEG)/siRNA complexes, and as a result, the CS-g-(PEI-b-mPEG)/siRNA nanoparticles can offer a substantial gene silencing effect with minimal side effects. Moreover, many factors governing the transfection efficiency of cationic copolymers need to be investigated in future studies such as the presence of serum and the pH value of solution [The transfection efficiency of the CS- ability . From ousolution , and ligIKK\u03b2 gene was successfully compacted with CS-g-(PEI-b-mPEG) and effectively delivered into HTFs. Subsequently, both the mRNA and protein levels of IKK\u03b2 were suppressed, and the activation of NF-\u03baB was inhibited in turn. Finally, IKK\u0392-siRNA-mediated blocking of the NF-\u03baB pathway resulted in repression of the proliferation of HTFs, and cells transfected with IKK\u0392-siRNA showed growth inhibition up to 42%. All of these findings suggest that blocking the signaling pathway of NF-\u03baB could be an effective way to manipulate the scar formation process by downregulating the proliferation of HTFs. This novel method based on nanotechnology and RNAi could represent a remarkable anti-scarring therapeutic approach for glaucoma filtration surgery. Follow-up studies will focus on the in vivo application of CS-g-(PEI-b-mPEG)/IKK\u0392-siRNA complexes.A special siRNA targeting g-(PEI-b-mPEG). We found it to have powerful siRNA binding and protection ability, relatively high transfection efficiency, and low cytotoxicity, making CS-g-(PEI-b-mPEG) a suitable delivery vector for transfecting siRNA into cells. We observed that siRNA targeting IKK\u03b2 was successfully transfected into human Tenon\u2019s capsule fibroblasts in vitro, and RNAi processes against the expression of IKK\u03b2 can subsequently inhibit the activation of NF-\u03baB and in turn, the proliferation of HTFs. Our results indicate the potential for a safe and effective strategy for preventing scar formation after glaucoma filtration surgery.We have reported on the synthesis and characterization of a novel cationic copolymer, CS-"}
{"text": "Background: This study was aimed at evaluating advantages of distal splenorenal shunt (DSRS) with splenopancreatic and gastric disconnection (DSRS-SPGD) over DSRS with splenopancreatic disconnection (DSRS-SPD) and standard DSRS (S-DSRS).Methods: DSRS-SPGD, DSRS-SPD, and S-DSRS were performed on 62, 7, and 55 patients, respectively, from 1970 to 1992. Comparison was performed in the following aspects: (1) long-term results in ratio of rebleeding, survival rate, and quality of life and (2) portal hemodynamics evaluated by preoperative and postoperative angiography. Portal blood flow was assessed by the ratio of the diameter of portal vein (PV) to superior mesenteric vein (SMV), and shunt selectivity was evaluated by selectivity grade.Results: Incidence of rebleeding was significantly lower in patients who underwent DSRS-SPGD than in those who underwent S-DSRS (p< 0.05). Grade 0 and I performance status was better in patients who underwent DSRS-SPGD. Accumulated survival ratio for 5 and 7 years was 78.3% and 70.5% in patients who underwent DSRS-SPGD, 59.7% and 44.1% in patients who underwent S-DSRS, and 75% and 75% in patients who underwent DSRS-SPD. Hemodynamic evaluation showed significantly lower PV/SMV ratio and degree of change in PV/SMV ratio of patients who underwent S-DSRS and DSRS-SPD. Many patients who underwent S-DSRS and DSRS-SPD exhibited loss of shunt selectivity at grades II and III. In contrast, patients who underwent DSRS-SPGD maintained satisfactory PV/SMV ratio and selectivity grade.Conclusions: DSRS-SPGD clearly showed advantages in decrease of rebleeding and improvement of quality of life resulting from maintenance of shunt selectivity and portal blood flow."}
{"text": "N-acetyllactosamine-enriched glycoconjugates and sequence similarities in the carbohydrate recognition domain. Galectin-1, a member of this family, contributes to different events associated with cancer biology, including tumour transformation, cell cycle regulation, apoptosis, cell adhesion, migration and inflammation. In addition, recent evidence indicates that galectin-1 contributes to tumour evasion of immune responses. Given the increased interest of tumour biologists and clinical oncologists in this field and the potential use of galectins as novel targets for anticancer drugs, we summarise here recent advances about the role of galectin-1 in different events of tumour growth and metastasis.Galectins are a family of structurally related carbohydrate-binding proteins, which are defined by their affinity for poly- As they can bind to extracellular glycoconjugates, galectins might modulate the adhesion between adjacent cancer cells or between cancer cells and ECM. It has been shown that galectin-1 increases the adhesion of prostate and ovarian cancer cell lines to the ECM  and it is uncertain whether high levels of soluble protein can be achieved  the ECM .N-acetyllactosamine ligands, may determine T-cell susceptibility to galectin-1-induced cell death  and interferon-\u03b3 (IFN-\u03b3) by activated T cells, with no evidence of T-cell apoptosis  provides a stop signal for T-cell adhesion to ECM and abrogates the production of proinflammatory cytokines, such as tumour necrosis factor-\u03b2 (TGF-\u03b2), interleukin 10 (IL-10) and vascular endothelial growth factor (VEGF).Despite the existence of specific T lymphocytes recognising tumour cells, the impact of these cells in tumour growth has been so far elusive. In contrast, several mechanisms have been described that potentially contribute to tumour cell evasion of the immune response  and stimulated the generation of a tumour-specific T-cell response in vivo. Our observations support the idea that galectin-1 may contribute to immune privilege of tumours by modulating survival or polarisation of effector T cells, and suggest a potential molecular target for manipulation of T-cell apoptosis with potential implications in immunotherapy.The immunoregulatory effects of galectin-1 and the correlation between galectin-1 expression in cancer cells and the aggressiveness of these tumours prompted us to investigate the role of galectin-1 in tumor-immune escape. We hypothesised that tumour cells may impair T-cell effector functions through secretion of galectin-1 and that this mechanism may contribute in tilting the balance towards an immunosuppressive environment at the tumour site. By a combination of Given the contribution of galectin-1 to tumour growth and metastasis, it is predicted that inhibitors of galectin-1 will find their way into cancer clinical trials, leading to delays in tumour progression and improvements in overall survival. Challenges for the future will be to employ potent and selective small inhibitors of galectin-1 and, in fact, molecules with such properties have already been developed for galectin-1 or other galectins ("}
{"text": "GIMAP5 gene associate with autoimmune disorders. The BioBreeding diabetes-prone (BBDP) rat has a mutation in the Gimap5 gene that leads to spontaneous apoptosis of peripheral T cells by an unknown mechanism. Because Gimap5 localizes to the endoplasmic reticulum (ER), we hypothesized that absence of functional Gimap5 protein initiates T cell death through disruptions in ER homeostasis. We observed increases in ER stress-associated chaperones in T cells but not thymocytes or B cells from \u2212/\u2212Gimap5 BBDP rats. We then discovered that ER stress-induced apoptotic signaling through C/EBP-homologous protein (CHOP) occurs in \u2212/\u2212Gimap5 T cells. Knockdown of CHOP by siRNA protected \u2212/\u2212Gimap5 T cells from ER stress-induced apoptosis, thereby identifying a role for this cellular pathway in the T cell lymphopenia of the BBDP rat. These findings indicate a direct relationship between Gimap5 and the maintenance of ER homeostasis in the survival of T cells.Gimap5 (GTPase of the immunity-associated protein 5) has been linked to the regulation of T cell survival, and polymorphisms in the human  GIMAP5, has an important role in human immune modulation as a polyadenylation polymorphism in the human GIMAP5 gene increases systemic lupus erythematosus risk gimap5 null mice Gimap5 gene in vitro, and severe T cell lymphopenia in vivoin vitro recapitulates the natural apoptosis that occurs in T cells from the BBDP rat Gimap5 promotes T cell survival is not understood.The expression products of the GTPase of the immunity-associated gene family  have been implicated in the regulation of T cell survival through modulation of T cell receptor (TCR) signaling 2+) signaling regulation, vesicle trafficking, drug metabolism, and lipid biogenesis 2+ homeostasis Gimap5 has been reported to localize mainly to the endoplasmic reticulum (ER) Normally, stress within the ER triggers an adaptive cellular mechanism known as the unfolded protein response or ER stress response that attempts to return the cell to homeostasis chop (C/EBP-homologous protein) bcl-2 gene, thus downregulating antiapoptotic Bcl-2 protein and rendering cells sensitive to the proapoptotic effects of BH3-only proteins \u2212/\u2212Gimap5 T cells as evidenced by an increase in ER chaperone expression. We further show that initiation of ER stress-induced apoptotic signaling in \u2212/\u2212Gimap5 T cells is associated with an increase of CHOP protein. Knockdown of CHOP expression protects \u2212/\u2212Gimap5 T cells from ER stress-induced cell death, thus revealing an essential role for Gimap5 in the maintenance of ER homeostasis and T cell survival.Initiation of ER stress-induced apoptosis through ER stress response signaling involves transcriptional activation of the bZIP transcription factor \u2212/\u2212Gimap5 rats, we compared the expression of ER chaperone proteins in lymph node cells and thymocyte lysates from \u2212/\u2212Gimap5 BBDP and +/+Gimap5 BioBreeding diabetes-resistant (BBDR) rats. Western blot analyses revealed that GRP94, GRP78, and ER protein 72 (ERp72) levels were increased in lymphocytes from \u2212/\u2212Gimap5 BBDP rats when compared to that in +/+Gimap5 BBDR rats  as compared to Gimap5+/+ BBDR rats  in BBDP (69.1\u00b10.7%) vs BBDR rats  was significantly less than in the +/+Gimap5 BBDR rats , whereas B cell numbers were significantly increased . To determine the T cell-specific levels of ER stress response and ER stress-induced apoptotic signaling, we performed intracellular flow cytometry. As measured by the mean fluorescence intensity (MFI), both GRP78 and CHOP levels were higher in TCR+ lymphocytes from \u2212/\u2212Gimap5 BBDP rats than from +/Gimap5+ BBDR rats (\u2212CD45RA+ cells) exhibited no difference in GRP78 and CHOP expression between the two rat strains  was reduced to a much greater degree than was the CD4+ subset  . Absolute CD8+ T cell number in lymph node cells were 1.4\u00b10.1\u00d7106 in the BBDP rat vs 30.6\u00b14.5\u00d7106 in the BBDR, .We next examined ER stress response activation within peripheral CD4, n\u200a=\u200a4) . Absolut+ subset, we again analyzed GRP78 and CHOP by intracellular flow cytometry. We observed that GRP78 and CHOP expression was similar in both CD4+ and CD8+ T cells from the \u2212/\u2212Gimap5 BBDP rat, but both subsets of BBDP T cells had GRP78 and CHOP levels that were higher than their counterparts from the +/+Gimap5 BBDR rat . Flow cytometry demonstrated that the preponderance of CD4+ and CD8+ T cells from \u2212/\u2212Gimap5 BBDP rats still express CD90 on the cell surface, indicating that few T cells survive to the mature CD90\u2212 stage  and CD8+  RTEs and mature CD4+  and CD8+  T cells from the \u2212/\u2212Gimap5 BBDP rat that express CD25, a marker of activation (see + and CD8+ RTEs and mature T cells (CD90\u2212) that express CD25 have significantly increased GRP78 expression as compared to cells with the same phenotype in the BBDR rat , early apoptotic , and late apoptotic and necrotic   . As compuadrant) . In contuadrant) .\u2212 lymphocytes. In contrast to T cells, there were no statistical differences in the percentages of viable, early apoptotic, and late apoptotic TCR\u2212 lymphocytes between siCHOP and siControl transfected cells .The intracellular distribution of Gimap5 protein remains controversial, but recent research indicates localization to the ER Gimap5 which results in a truncated protein product \u2212/\u2212Gimap5 T cells. In either case, disruption of CHOP was effective in delaying apoptosis and preventing cell death, thus indicating the importance of CHOP in ER stress-associated T cell death signaling. Interestingly, overexpression of either wild type rat Gimap5 or the truncated BBDP rat Gimap5 in a rat T cell line is associated with enhanced apoptosis In the BBDP rat there is the frameshift mutation in \u2212/\u2212Gimap5 rats. It will be of interest to determine if the same mechanisms are responsible for the T cell lymphopenia and hepatic dysfunction observed in \u2212/\u2212gimap5 mice In conclusion, our findings suggest a role for ER stress in mediating the spontaneous apoptosis found in T cells from \u2212/\u2212Gimap5 BBDP and +/+Gimap5 BBDR rats were obtained from Biomedical Research Models . BBDP rats are T cell lymphopenic in both the CD4 and to an even greater extent in the CD8 compartments; BBDR rats have a normal peripheral lymphocyte phenotype \u2212/\u2212ART2a.Gimap5 rats were also developed by us by crossing WF  and BBDP rats. The intercross was followed by 8 backcrosses to WF before intercrossing to establish homozygosity for both the Iddm14lyp (Gimap5) loci on chromosome 4 and the ART2a locus \u2212/\u2212ART2a.Gimap5 rat bears no BB markers except in the regions of chromosome 4 bounded by D4Rat101-D4Rat58 and chromosome 1 bounded by D1Rat29 and D1Rat287, and it does not develop spontaneous diabetes (unpublished observations). Control WF.ART2a congenic rats were developed by us and differ from ordinary non-lymphopenic, non-diabetic WF animals in that they express the \u201ca\u201d rather than the \u201cb\u201d allotype of the ART2 T cell alloantigen on chromosome 1 ART2a are nondiabetic and homozygous for wild type Gimap5. All animals were housed in a viral antibody-free facility and maintained in accordance with the guidelines of the University of Massachusetts Medical School Institutional Animal Care and Use Committee and the Guide for the Care and Use of Laboratory Animals .Thymi and cervical and mesenteric lymph nodes were removed from BBDR and BBDP rats, processed aseptically, and extruded through mesh sieves. Single cell suspensions for flow cytometry were prepared as described below.Thymi, lymphocytes, or purified T cells were lysed Anti-rat CD8a-PE (clone Ox-8), FITC or PerCp-conjugated anti-rat TCR\u03b1\u03b2 (clone R73), anti-rat CD90-FITC (clone HIS51), Biotin-conjugated anti-rat CD25 (clone OX-39), and Streptavidin-conjugated APC-Cy7 mAbs were obtained from BD Biosciences . Purified GRP78 mAbs (clone 40) and isotype control Abs were also obtained from BD Biosciences. A Zenon Mouse IgG2a or IgG1 Labeling Kit, Alexa Fluor 647 , was used to label purified GRP78 or CHOP mAbs per the manufacturer's directions. Anti-rat CD4-Pacific Blue mAb and its corresponding isotype control Ab were obtained from Serotec . Anti-actin (clone C4) antibody was obtained from Chemicon International . Anti-ERp72 and anti-GRP94 were obtained from Calbiochem  and Stressgen , respectively. Cleaved capase-3 antibody was obtained from Cell Signaling Technology . Polyclonal antiserum to Gimap5 was generated by us as described Single cell suspensions from cervical and mesenteric lymph node cells were washed and suspended in PBS containing 1% fetal clone serum  and 0.1% sodium azide (Sigma-Aldrich). Samples were washed, incubated for 20 min with fluorescent mAbs to various cell-surface markers as described in 6 cells per well in 3 mL of RPMI medium (Sigma-Aldrich) containing 10% FBS (Hyclone), 1% Pen/Strep/Glut , and 0.1% \u03b2-mercaptoethanol (Gibco) at 37\u00b0C in the presence of 10 ng/mL PMA  and 100 ng/mL ionomycin . After 12 h, cells were resuspended in 100 \u00b5L of Nucleofector solution using human T cell Nucleofector kit  with 100 nM rat CHOP siRNA  or 100 nM control siRNA  and nucleofected using program U-014 in the Amaxa Nucleofector apparatus. Following nucleofection, T cells were plated in 3 mL complete media and harvested at 30 h for protein preparation and flow cytometry analysis.T cells from BBDP rats were purified as described To measure cellular apoptotic signaling, transfected T cells were harvested, washed twice with PBS, and reacted with PE-conjugated anti-annexin V and 7-amino-actinomycin D (7AAD) according to the manufacturer's directions (BD Pharmingen). At least 20,000 cells per sample were analyzed using a FACSCalibur (BD Biosciences) and FlowJo software.t-tests. Values of p<0.05 were considered statistically significant.Statistical analyses were performed with GraphPad Prism software . Parametric data are presented as the mean\u00b1the standard error of measurement (SEM) and were analyzed using two-tailed unpaired Figure S1\u2212/\u2212ART2a.Gimap5 rats that do not develop spontaneous diabetes exhibit enhanced ER stress response signaling. Representative analyses indicating the gating of TCR+ (A) and CD4+ or CD8+ (B) lymphocytes within congenic WF.\u2212/\u2212ART2a.Gimap5 (Type 31) and control congenic WF.+/+ART2a.Gimap (Type 20) rats. Representative flow dot plots depicting CD90 expression  and forward scattering  of lymphocytes within gated CD4+ and CD8+ T cell populations from Type 31 (C) or Type 20 (D) rats. Numbers represent the percentage of cells (\u00b1SEM of triplicate samples) in each gate shown. Intracellular GRP78 (E) and CHOP (F) expression in RTEs (CD90+) and mature T cells (CD90\u2212) from Type 31 (black line) and Type 20 rats (shaded region). Depicted in each histogram is the isotype control (dotted line). The MFI of GRP78 or CHOP protein expression is displayed in bar graphs with error bars representing the SEM of duplicate samples. Data shown are representative of two independent experiments .T cell populations from congenic WF.(0.94 MB TIF)Click here for additional data file."}
{"text": "The differential level and localization of galectin-3 protein were examined in the retinas of two-day-old pigs and six-month-old pigs.The retinas sampled from two-day-old and six-month-old pigs were analyzed by western blot and immunohistochemistry.western blot analysis detected galectin-3 in both age groups, although the levels were significantly higher in six-month-old pigs. Immunohistochemical staining showed that galectin-3 was localized in the retinas of both two-day-old pigs and six-month-old pigs; the galectin-3 immunostaining was more intense in the six-month-old pig retina, as shown in the western blot analysis. Galectin-3 was expressed in glial cells, particularly in glutamine synthetase-positive M\u00fcller cells and their processes, across all retina layers in both age groups; however, it was not found in ganglion cells of the ganglion cell layer or neuronal cells of the inner and outer nuclear cell layers in either age group.This is the first demonstration that galectin-3 is detected in the retinas of two-day-old pigs and that the expression in M\u00fcller cells increases with postnatal development. Galectin-3, which has a carbohydrate-recognition domain and an N-terminal domain rich in proline and glycine, is characterized by its unique structure among vertebrate galectins . FifteenThe retina is remote CNS tissue and is a model for studying CNS tissue development. The pig eye has been suggested as a novel model for human eye disease because the pig retina shares many similarities with the human retina -17. The The present study examined the expression and cellular localization of galectin-3 in the retinas of two-day-old and six-month-old pigs to evaluate the differential level and localization of galectin-3 during postnatal development in the pig retinas.2 inhalation. The anterior segment of the eyeball was removed, and the retinas were carefully dissected on ice. All the experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals in Jeju National University, Jeju, Korea.The eyes of six-month-old young adult pigs (n=5) were obtained immediately after butchering in a local slaughterhouse. Two-day-old pigs were obtained from a local farm (n=3). These were killed by CO2PO4, 1.4mM KH2PO4, pH 7.4) for 24 h. Chemicals for PBS were obtained from JUNSEI . Fixed tissues were dehydrated through a graded series of ethanol and embedded in tissue embedding medium . The paraffin-embedded retinal tissues were cut 5\u03bcm on a rotary microtome .For western blot analysis, retinal tissues were detached from the eyecups and kept in a deep freezer. For histology, the anterior segments of the eyes were dissected. The eyecups without anterior segments were fixed by immersion in 10% neutral-buffered formalin in phosphate-buffered saline . Mouse monoclonal anti-glial fibrillary acidic protein  was used to detect astrocytes while anti-glutamine synthetase  was employed to detect M\u00fcller cells [Approximately 1\u00a0mg/ml rat anti-galectin-3 monoclonal antibody was purified by affinity chromatography from the supernatants of hybridoma cells  for 2 h at 100 V. The residual binding sites on the membrane were blocked by incubation for 1 h with 5% nonfat milk in Tris-buffered saline (TBS), which was composed of 10\u00a0mM Tris-HCl, pH 7.4, and 150\u00a0mM NaCl. The membranes were then incubated for 2 h either with 1:5,000 rat monoclonal anti-galectin-3 or 1:20,000 mouse monoclonal anti-glutamine synthetase  for 2\u00a0h. The blots were washed three times in TBS containing 0.1% Tween-20 and probed with horseradish peroxidase-conjugated anti-rat IgG  for 1 h. The membrane blots were developed using an enhanced chemiluminescence reagent kit , according to the manufacturer\u2019s instructions.Western blot analysis of the pig retina was performed as reported previously, with minor modifications ,22. In b2) of each band was measured with a scanning laser densitometer  and was reported as the mean\u00b1SEM. The ratios of the density of the galectin-3 band to that of the \u03b2-actin band were compared using Molecular Analyst software (Bio-Rad). The results were analyzed statistically using one-way ANOVA (ANOVA) followed by the post hoc Student\u2013Newman\u2013Keuls t-test for multiple comparisons. In all cases, a p<0.05 was considered significant.After imaging, the membranes were stripped and reprobed using monoclonal anti-\u03b2-actin antibody as the primary antibody (Sigma-Aldrich). The optical density (OD/mmParaffin sections (5\u00a0\u03bcm) of retinas were deparaffinized in xylene, rehydrated in a series of decreasingly diluted solutions of ethanol and pretreated with 0.01 M citrate buffer (pH 6.0) in a microwave for 3 min. After hydration, the sections were treated with 0.3% hydrogen peroxide in distilled water for 20 min to block endogenous peroxidase activity. After three washes in PBS, the sections were exposed to 10% normal goat serum  and then incubated for 1 h at room temperature (RT) with primary antibodies, including 1:500 monoclonal rat anti-galectin-3. After three washes, the sections were incubated with the secondary antibody, 1:100 biotinylated rabbit anti-rat IgG (Vector), and then avidin-biotin peroxidase complexes were formed using an Elite kit (Vector). The peroxidase reaction was developed with a diaminobenzidine substrate kit (Vector). Before sections were mounted, they were counterstained with hematoxylin. As a negative control, the primary antiserum was omitted for a few test sections in each experiment, and no specific labeling of cell bodies or fibers was detected in these sections.2O, treated them with 10\u00a0mM CuSO4 in ammonium acetate buffer  for 20 min, then again dipped them in distilled H2O before returning them to PBS. The double immunofluorescence-stained specimens were examined under an FV500 laser confocal microscope .For double immunofluorescence, the sections were incubated in the following order: with 10% normal goat serum for 1 h at RT, with either mouse monoclonal anti-GFAP (Sigma-Aldrich) or mouse monoclonal anti-glutamine synthetase (Chemicon) for 1 h, and then with fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (Sigma-Aldrich) for 1 h at RT. Then, the sections were washed and incubated with rat anti-galectin-3 overnight at 4\u00a0\u00b0C, after which the sections were washed and incubated with tetramethylrhodamine isothiocyanate (TRITC)-labeled goat anti-rat IgG (Sigma-Aldrich). To reduce or eliminate lipofuscin autofluorescence, we washed the sections in PBS. Three times for 1 h at RT, dipped them briefly in distilled HWestern blot analysis was used to detect galectin-3  in the homogenates of retinas from two-day-old pigs and six-month-old pigs . CompareIn the retinas of two-day-old piglets, galectin-3 immunostaining was observed in glial processes in the innermost nerve fiber layer and the ganglion cell layer . It was A double-labeling experiment was performed to determine the cellular phenotype of galectin-3 expression in the pig retina. The results for six-month-old pig retinas are shown because the galectin-3 immunoreactivity was similar in both age groups. Galectin-3 was colocalized with glutamine synthetase, a marker for M\u00fcller cells , in the This is the first study to demonstrate that galectin-3 is expressed in the pig retina and that its expression increases with development. The expression of both galectin-3 and glutamine synthetase was more intense in the retinas of six-month-old pigs than in those of two-day-old pigs. This suggests that galectin-3 is detected in the retinas of postnatal pigs, and that the increased expression of galectin-3 in the adult retina is correlated with retinal development with aging. The functional roles of increased galectin-3 during retinal development are not clear. It is possible that galectin-3 plays a role in cellular protection, because the interaction of galectin-3 with a glycoconjugate on the cell surface could increase cell viability and anti-apoptotic activity .A previous study has shown that the pig retina is mature one week before birth, with the exception of the photoreceptor segments, which are still differentiating . This fiUehara et al.  detected"}
{"text": "However, its in vivo application was greatly limited due to its high cytotoxicity and short duration of gene expression. To improve its biocompatibility and transfection efficiency, PEI has been modified with PEG, folic acid, and chloroquine in order to improve biocompatibility and enhance targeting.Polyethyleneimine (PEI), a cationic polymer, is one of the successful and widely used vectors for non-viral gene transfection g-PEI was obtained by Michael addition reaction with GMA-PCFC-GMA and polyethyleneimine . The prepared PCFC-g-PEI was characterized by 1H-NMR, SEC-MALLS. Meanwhile, DNA condensation, DNase I protection, the particle size and zeta potential of PCFC-g-PEI/DNA complexes were also determined. According to the results of flow cytometry and MTT assay, the synthesized PCFC-g-PEI, with considerable transfection efficiency, had obviously lower cytotoxicity against 293 T and A549 cell lines compared with that of PEI 25 kD.Poly(\u03b5-caprolactone)-Pluronic-Poly(\u03b5-caprolactone) (PCFC) was synthesized by ring-opening polymerization, and PCFC-in vitro transfection study indicated that PCFC-g-PEI copolymer prepared in this paper was a novel gene delivery system with lower cytotoxicity and considerable transfection efficiency compared with commercial PEI (25 kD).The cytotoxicity and  Gene therapy is being studied world-widely during the past 20 years. In almost all of experiments and clinical treatments, gene therapy requires delivering therapeutic gene into target cells to correct gene defects and achieve the purpose of treating diseases by using delivery carriers. People have never stopped pursuing more safe and efficient vector for gene delivery in gene therapy ,2. Gene in vitro transfection efficiency and enhance the transgene expression in vivo /[pDNA] N/P ratios and shortly vortexed. After 10 min incubation at room temperature, 10 \u03bcl complex solutions were analyzed by 1% agarose gel electrophoresis . In the part of protection and release assay of DNA, PCFC-g-PEI/DNA complexes were analyzed using atomic force microscopy (AFM). The complex solution was prepared by mixing 2 \u03bcg of plasmid DNA with polymer solution at N/P ratio 7. The complex solution was incubated at room temperature for 30 min and diluted in 1 ml distilled water, and then the complex solution was placed on mica surface and dried at temperature. Imaging was carried out using noncontact mode, and complexes sizes were determined by measuring the diameters of the complexes.The morphology and size of the PCFC-2 and passage every 2\u20133 days. The cells (1 \u00d7 105 per well) were plated on 6-well plated for 24 h before transfection. Immediately before the initiation of transfection experiments, the medium was removed from each well and washed once with DMEM without serum and antibiotic and treated with fresh medium with a serial dilution of PCFC-g-PEI (25 kD). PEI/DNA complex was performed as control. Luciferase gene was monitored 24 h later by using Flow Cytometry (FCM).For in vitro transfection, 293 T and A549 cells were cultured in DMEM medium containing Gln supplemented with 10% heated-inactivated fetal bovine serum and antibiotics . Cells were grown at 37\u00b0C in humidified air containing 5% COg-PEI was determined by MTT analysis and propidium iodide (PI) staining and flow cytometry.The cell cytotoxicity of the PCFC-4 (293 T) and 2 \u00d7 104 (A549) cells/well in 0.1 ml growth medium and incubated overnight, and then added 0.1 ml fresh DMEM growth medium containing a series of concentrations of PCFC-g-PEI to each well. Untreated cells in growth media were used as a control. Cell were incubated for 24 h and then followed by addition of 20 \u03bcl of 3--2, 5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml). After further incubation for 4 hours, the MTT solution (0.5 mg/ml) was carefully removed from each well, and 150 \u03bcl DMSO was added to dissolve the MTT formazan crystals. The absorbance was recorded at 570 nm by an ELISA microplate reader (Bio-Rad). The cell viability (%) was related to the control wells containing untreated cells with fresh cell culture medium and was calculated according to the following:In the part of MTT assay, Cells were seeded in 96-well plates at a density of 1 \u00d7 10All dates are presented as the mean of there measurements (\u00b1 SD).5 (293 T) cells/well in 2 ml growth medium and incubated overnight at 37\u00b0C under 5% CO2 until the confluency reached 50~60%, and then changed the medium with 2 ml fresh DMEM growth medium containing various concentrations of PCFC-g-PEI to each well. Untreated cells in growth media were used as a control. Cell were incubated for 24 h and then collected for analysis. Survival (%) = 1 - apoptosis (%).In the part of propidium iodide (PI) staining and flow cytometry, cells were seeded in 6-well plates at a density of 2 \u00d7 10PEI: polyethyleneimine; PCFC: poly (\u03b5-caprolactone)-pluronic- poly(\u03b5-caprolactone); F105: poly (ethylene glycol)-poly (propylene glycol)-poly (ethylene glycol); GMA: glycidyl methacrylate 97%; DMEM: Dulbecco's Modified Eagle's Medium; MTT: 3--2, 5-diphenyltetrazolium bromide; DMSO: dimethyl sulfoxide; MW: molecular weight.The authors declare that they have no competing interests.QZY, WYQ and ZX designed the experiments. And the research funds were supported by QZY and WYQ. QZY and LF corrected the manuscript. SS and GQF carried out experiments, analyzed the data, and wrote the manuscript; GQF and FSZ participated in the synthesis of the PCFC-g-PEI copolymer. GCY and DHX analyzed data and revised the manuscript. KB and WXH participated in the MTT cytotoxicity study.All authors read and approved the final manuscript."}
{"text": "Although ErbB receptors have been implicated in the progression of prostate cancer, little is known about proteins that may mediate their interactions with the androgen receptor (AR). Ebp1, a protein cloned via its association with the ErbB3 receptor, binds the AR and inhibits androgen-regulated transactivation of wild-type AR in COS cells. As the complement of coregulators in different cells are important for AR activity, we determined the effect of Ebp1 on AR function in prostate cancer cell lines. In addition, we examined the regulation of Ebp1 function by the ErbB3/4 ligand heregulin (HRG). In this study, we demonstrate, using several natural AR-regulated promoters, that Ebp1 repressed transcriptional activation of wild-type AR in prostate cancer cell lines. Downregulation of Ebp1 expression in LNCaP cells using siRNA resulted in activation of AR in the absence of androgen. Ebp1 associated with ErbB3 in LNCaP cells in the absence of HRG, but HRG induced the dissociation of Ebp1 from ErbB3. In contrast, HRG treatment enhanced both the association of Ebp1 with AR and also the ability of Ebp1 to repress AR transactivation. These studies suggest that Ebp1 is an AR corepressor whose biological activity can be regulated by the ErbB3 ligand, HRG. Prostate cancer is the second most prevalent cancer among men in the United States and ranks second to lung cancer in terms of annual mortality . Microarin vitro and in animal models  family of receptors and their ligands in regulating AR activity during prostate cancer progression is currently a focus of intense investigation. This receptor family includes four members: EGFR (ErbB1), ErbB2 , ErbB3 (Her3) and ErbB4 (Her4). All EGFR family members contain an extracellular ligand binding domain, a transmembrane region important in regulating receptor activity, and a cytoplasmic tyrosine kinase domain. ErbB3 lacks tyrosine kinase activity due to amino-acid substitutions in the conserved kinase domain . ErbB rein vitro and in vivo to stimulate growth of prostate cancer cells. For example, in vitro AR is activated in a ligand independent manner by EGF  .All cell lines except PC-3 AR were obtained from the American Type Culture Collection . PC-3 AR cells (ebp1 expression construct has been previous described (The PSA reporter luciferase construct was a gift from Dr Martin Gleave and contains \u2212630/+12 of the 5\u2032 PSA flanking region. The Probasin (\u2212285/+32) luciferase reporter and the pSG5-hAR expression construct were gifts of Dr O Janne. The MMTV-luciferase plasmid was obtained from Dr Joseph Fondell . The ebp\u22121 of HRG \u03b21  for the indicated times. Cell lysates were prepared and immunoprecipitated as described previously (M HEPES (pH 7.5), 1\u2009mM EDTA, 150\u2009mM NaCl, 1% Triton X-100 and Complete\u2122 protease inhibitor. Protein concentrations were measured using a detergent compatible kit . Cell lysates were precleared with Protein A/Protein G agarose and immunoprecipitated for 4\u2009h at 4\u00b0C with 2\u2009\u03bcg of a monoclonal antibody directed against ErbB3  and 20\u2009\u03bcl packed Protein A/G agarose beads. The immunoprecipitates were washed and resuspended in Laemmli sample buffer. Proteins were resolved by SDS\u2013PAGE. After electrophoresis, the proteins were transferred onto Immobilin-P membranes, and immunoblotted as described  for 24\u2009h. Cells were then stimulated with or without HRG \u03b21  for 1\u2009h. Cell lysates were immunoprecipitated as described above using the polyclonal antibody to Ebp1. Western blot analysis was performed using a monoclonal antibody to AR (Santa Cruz) or the Ebp1 antibody.To measure ErbB3\u2013Ebp1 interactions, LNCaP cells were incubated overnight in serum-free RPMI-1640 media. Where indicated, cells were treated with 20\u2009ng\u2009ml4) were plated in 12-well plates in complete media. When cells reached 50\u201360% confluence, they were transfected using the Fugene-6 Reagent  according to the manufacturer's instructions. Cells were transfected with 0.5\u2009\u03bcg of the indicated reporter plasmids, 0.5\u2009\u03bcg of pSG5-hAR (where specified), and 0.5\u2009\u03bcg of pcDNA3 or wild-type ebp1 expression plasmids and 5\u2009ng of the TK-Renilla plasmid  as an internal control. Complete medium was replaced 24\u2009h after transfection with phenol red free RPMI 1640 with CSS with or without R1881 (10\u22128\u2009M) (Cells (5 \u00d7 10(10\u22128\u2009M) . LuciferM final concentration of annealed oligonucledotides using Lipfectamine 2000 according to the manufacturer's instructions. The Ebp1 siRNA sequences corresponded to the coding regions beginning at nucleotides 476 and 995 (Genbank accession number U87954). The targets sequences were AAGCGACCAGGAUUAUAUUCU and AAGUGAGGUGGAAAGGCGUUU respectively. These sequences do not match any other human genomic sequences as determined by BLAST analysis using the NCBI Website. Scrambled oligonucleotides of these sequences were used as negative controls. The next day, cells were transfected with an expression construct for wild-type AR and the MMTV-luciferase and TK plasmids using Fugene-6.The siRNA oligonucleotides were purchased from Dharmacon Research Inc . COS-7 cells were cultured in 12-well plates until 60% confluent. Cells in 1\u2009ml of antibiotic-free culture media were transfected with 60\u2009nt-test. Significance was established at P\u2a7d0.05.Results were analysed using a two-tailed Students2DS promoter in COS cells transfected with wild-type AR, and the PSA promoter in LNCaP cells that harbor a mutant AR . As expected, R1881 stimulated luciferase activity four- to five-fold in DU145 and PC-3 AR cells  with the ectopic expression of ebp1  3.5-fold increase in the luciferase activity of the MMTV promoter in the absence of androgen. No such stimulation was observed in cells lacking AR. R1881 stimulation of the reporter plasmid was decreased by inhibition of Ebp1 expression, but this change was not significant at the P\u2a7d0.05 level  for 0, 15, 60 and 120\u2009min and 24\u2009h. Cell lysates were immunoprecipitated with antibody to ErbB3 as described. Ebp1 was found in ErbB3 immunoprecipitates of untreated cells  overnight. Cells were then treated with 20\u2009ng\u2009ml\u22121 of HRG \u03b21 for 1\u2009h, a time when we could not detect Ebp1 in ErbB3 immunoprecipitates. Cell lysates were immunoprecipitated with the Ebp1 antibody. Western blot analysis of the immunoprecipitates indicated that HRG treatment enhanced the interaction of Ebp1 with AR  reduced AR luciferase activity 55%. Maximal inhibition of 90% was observed at 0.5\u2009\u03bcg of the ebp1 plasmid. This was more than the 80% inhibition previously observed (\u22121), previously demonstrated to increase association of Ebp1 and AR, significantly (P\u2a7d0.05) enhanced Ebp1-mediated repression at low (0.1 and 0.2\u2009\u03bcg) amounts of the Ebp1 plasmid (HRG enhances Ebp1 transcriptional repression. We reasoned that if HRG could change the association of Ebp1 with AR, it could affect Ebp1 induced repression of AR transactivation. LNCaP cells were transiently transfected with the MMTV luciferase reporter plasmid and limiting amounts of an observed  and prob plasmid .We have previously established that Ebp1, a protein cloned in our laboratory via its interactions with the ErbB3 receptor, inhibits AR-mediated transcription and growth of the AR positive LNCaP cell line (2 luciferase reporter in COS cells and the PSA luciferase reporter in LNCaP cells (2 reporter was more potent in COS-7 than HeLa cells. This variability has been attributed to the complement of transcription factors and coregulators in different cell types. Therefore, we examined AR transactivation of MMTV-luc in two androgen-independent prostate cancer cell lines, PC3 and DU145, that had been transfected with wild-type AR. Ebp1 inhibited AR-regulated transcription in these androgen-independent cells. Similarly, Cyclin D1 inhibits AR transactivation across a wide variety of both prostate and nonprostate derived cell lines (ebp1 overexpression completely inhibited AR activity in DU145 and PC-3 AR transfected cells, ebp1 was unable to completely suppress the response to R1881 in LNCaP cells. This discrepancy may have been due to different expression levels of AR in the DU145 and PC-3 cells lines as compared to LNCaP cells, the fact the AR receptor is mutated in LNCaP cells, or to different transfection efficiencies of the ebp1 plasmid among the three cell lines.This study first demonstrated that Ebp1 inhibition of AR transactivation was neither promoter nor cell type specific. We had previously demonstrated that Ebp1 inhibits AR transactivation of the artificial AREStudies using siRNA demonstrated that inhibition of endogenous Ebp1 expression resulted in increased activity of an androgen regulated reporter construct in the absence of androgens. No such effect was observed in cells not expressing the AR. Thus, the increase in promoter activity in the absence of androgens was mediated via the AR. This finding suggests that Ebp1 may play a role in inhibition of AR signalling in the presence of no or extremely low levels of androgens. Ebp1 has the ability to bind DNA  and histin vivo.Although Ebp1 was shown to be associated with ErbB3 in breast cancer cells (in vivo. However, the efficiency of the Ebp1\u2009:\u2009AR interaction was relatively low in the absence of HRG. HRG treatment of LNCaP cells for 1\u2009h enhanced the association of Ebp1 with AR in LNCaP cells. The basis of the increased association of Ebp1 with AR after HRG treatment is not known. We have found that HRG increases phosphorylation of Ebp1 in breast cancer cells (We then determined the effects of HRG on Ebp1 function. HRG treatment resulted in dissociation of Ebp1 from the ErbB3 receptor in LNCaP cells. The present studies also demonstrate that HRG regulated the interaction of Ebp1 with the AR receptor. First, we demonstrated that endogenous Ebp1 associated with endogenous AR The fact that HRG enhances the binding of Ebp1 to AR suggests that in the absence of HRG, Ebp1 may not optimally affect AR function. Indeed, HRG potentiated the ability of limiting amounts of Ebp1 to inhibit AR promoter activity. HRG has been previously shown to inhibit growth of AR+ but not AR\u2212 prostate cancer cell lines (In summary, Ebp1 is a potent corepressor of AR with broad specificity. Ebp1 maintains its corepressor activity independent of cell type and promoter examined. Thus, Ebp1 joins a small but growing group of AR corepressors ("}
{"text": "Only the patients with malignant or undeterminate lesions underwent surgery. Most lesions (86%) diagnosed as malignant by cytology or after surgery were positive for galectin-3. The majority of lesions (94%) classified as benign by cytology or after surgery was negative for galectin-3. The positive and negative predictive values were 83 and 95%, respectively. When focusing on the undeterminate lesions, the sensitivity and specificity were 75 and 90%, respectively, while the positive and negative predictive values were 82 and 87%, respectively. The specificity and the positive predictive value were higher (100%) when considering the percentage of stained cells. Altogether these results show that galectin-3 constitutes a useful marker in the diagnosis of thyroid lesions classified as undeterminate by conventional cytology.Fine-needle aspiration cytology, which is well established to be accurate for the diagnosis of thyroid cancer, may be inconclusive for the follicular thyroid neoplasms. As galectin-3 was suggested to be a marker of malignant thyrocytes, we investigated whether this protein might be helpful in the diagnosis of aspirates classified as undeterminate by cytology. After establishing an easy processing of aspirates for galectin-3 immunodetection, a series of aspirates categorised as benign ( Thyroid nodules are very frequent in the population and their diagnosis by fine-needle aspiration cytology has been well established to be highly accurate to discriminate malignant from benign lesions  for routine cytological diagnosis, while at least two smears were realised for subsequent galectin-3 immunocytochemistry.The prospective analysis concerned the three types of cytological samples, that is the benign, the malignant and the samples classified as undeterminate. The term undeterminate meant that no definitive cytological diagnosis was possible. During the period of investigation, more than 1500 fine-needle aspirations of thyroid nodules were performed. As expected, most of these samples were undoubtedly benign at cytological diagnosis. After having observed that galectin-3 was always negative in our first series of benign cases, we then did not systematically analysed all the benign lesions for galectin-3 but focused on lesions which although unambiguously benign were highly cellular.n=135) consisted of 63 benign, 17 malignant and 55 undeterminate lesions. In four cases of malignant lesions, the analysed material was lymph nodes instead of thyroid tissue as no thyroid nodule was seen by echography. The cytological diagnosis of these lesions was unambiguously papillary thyroid carcinoma.The samples subsequently analysed for galectin-3 (n=114).Indication for surgery was based only on clinical and MGG cytological findings without taking into account the results of galectin-3 immunodetection. Consequently, only the patients with lesions diagnosed as malignant or undeterminate by cytology were supposed to be referred to surgery. Among the 55 patients whose lesions were classified as undeterminate, 34 underwent surgery because of the clinical context. The remaining 21 patients were carefully followed-up or were not operated on by the time we sent this manuscript. Therefore, analysis of galectin-3 results was performed for the lesions diagnosed as benign or malignant by cytology and the subset of undeterminate lesions for which histological diagnosis was available . Samples were aspirated, put in CytoLyt then centrifuged on slide and tested for galectin-3. Samples were also spread on slides and analysed for galectin-3 after air-drying only.To define the optimal time between aspiration of samples and galectin-3 detection, we tested the human papillary thyroid carcinoma BCPAP cells. These cells were incubated in CytoLyt for different times, then centrifuged on slides and tested for galectin-3. They were also centrifuged on slides without prior incubation in CytoLyt, dried on air for different times and then tested for galectin-3.Cells on slides were fixed in acetone at 4\u00b0C for 10\u2009min followed by 10% formalin at room temperature for 10\u2009min. After blockage of nonspecific binding sites with 30% normal human AB serum, cells were incubated overnight at 4\u00b0C with anti-human galectin-3 NCL-GAL3 mouse monoclonal antibody  diluted 1\u2009:\u2009100. Cells were then incubated with EnVision-peroxydase detection kit as recommended by the manufacturer . Enzymatic activity was visualised with 3,3\u2032-diaminobenzidine (Dako). Slides were then washed, counterstained with haematoxylin and mounted in aqueous medium. For each experiment, the human papillary thyroid carcinoma BCPAP cell line was used as positive control. For each sample, a negative control was realised, which consisted of substitution of the primary antibody by an isotype-matched mouse nonimmune IgG1. Positivity for galectin-3 was assessed by two independent investigators taking into account the percentage of cells exhibiting staining in the cytoplasm and/or at the plasma membrane. The positive cases were classified+when staining was observed in less than 20% cells, ++ for staining in 20\u201350% cells and +++ for staining in more than 50% cells.Sensitivity, specificity, positive and negative predictive values of galectin-3 immunodiagnosis were calculated as follows. Sensitivity was defined as the ratio of the number of carcinomas that were galectin-3 positive to the total number of carcinomas. Specificity was defined as the ratio of the number of benign lesions, which were galectin-3 negative to the total number of benign lesions. The positive predictive value was calculated as the ratio of the number of galectin-3 positive carcinomas to the total number of galectin-3 positive lesions. The negative predictive value was calculated as the ratio of the number of galectin-3 negative benign lesions to the total number of galectin-3 negative lesions.We found that detection of galectin-3 was possible for aspirated samples put in CytoLyt. This transport medium allowed detection of the protein for samples that have been in CytoLyt as long as 48\u2009h. To examine whether the delay between fine-needle aspiration and galectin-3 immunodetection could be longer than 48\u2009h, we tested the human papillary thyroid carcinoma BCPAP cell line for galectin-3 after incubation in CytoLyt for different times (4\u2009h\u20137 days). It was clearly shown that galectin-3 labelling decreased with time to be almost absent after 7 days . Consequn=63), malignant (n=17) or undeterminate (n=34) was prospectively analysed for galectin-3. Typical examples of galectin-3 labelling using NCL-GAL3 mouse monoclonal antibody are shown in n=15), cytoplasmic staining was associated with plasma membrane staining. No nuclear staining was seen.A series of 114 fine-needle aspirates processed as reported above and categorised as benign , most lesions  were positive for galectin-3 , the majority of benign lesions (94%) was negative for galectin-3. Concerning the five positive lesions, the percentage of labelled cells was less than 50% in all samples except one.Taking into account all the lesions classified as benign either by cytology or after surgery  while the negative predictive value was similar (93%); however, the sensitivity was lower (79%).When focusing the analysis of galectin-3 results on undeterminate lesions, galectin-3 was detected in most malignant lesions and absent in the majority of benign lesions . The senSince the first large series of Most of the published studies concern retrospective analyses made on histological specimens or paraffin-embedded cell blocks. They do not evaluate the interest of galectin-3 as a marker of malignancy in the subset of lesions for which no diagnosis is possible by cytology. The present work was a prospective study and focused on samples classified as underterminate by cytology, which are the samples of concern.First of all, we optimised a galectin-3 immunocytochemical method for fine-needle aspiration thyroid samples. We show here that galectin-3 immunodetection is possible in routine medical practice especially as an office procedure. The processing of the specimens is easy as only air-dried smears are required. This procedure is shorter and less expensive than imunohistochemistry performed on paraffin-embedded cell blocks, which is the technique most often reported for fine-needle aspiration samples  at the cell surface has been previously reported  for the specificity and the negative predictive value. When focusing on undeterminate lesions, the specificity and the negative predictive value were also the highest values and were almost equal to 90% . The facThe absence of galectin-3 detection in thyroid carcinomas and the presence of galectin-3 in benign thyroid lesions have been previously reported by others (An interesting finding of the present study is that when galectin-3 labelling was present in benign cases, the percentage of galectin-3 positive cells was lower than in malignant cases. When considering samples to be positive if they contained more than 50% stained cells, the specificity and the positive predictive value were higher than without considering the percentage of stained cells . No majoConsidering the malignant cases negative for galectin-3, other potentially interesting markers such as HBME1 or cytokeratin 19 (In conclusion, galectin-3 immunodetection in fine-needle aspiration thyroid samples is easy and possible in routine medical practice. This marker is useful in the diagnosis of thyroid lesions classified as undeterminate by conventional cytology, especially if semiquantitative results, that is to say the percentage of positive cells, are taking into account. Galectin-3 allows one to identify the subset of undeterminate lesions with poor risk of malignancy and consequently the subgroup of patients who, if in accordance with the clinics, may be carefully followed-up instead of being referred to surgery."}
{"text": "Lentiviral vectors are well suited for gene therapy because they can mediate long-term expression in both dividing and nondividing cells. However, lentiviral vectors seem less suitable for liver gene therapy because systemically administered lentiviral vectors are preferentially sequestered by liver macrophages. This results in a reduction of available virus and might also increase the immune response to the vector and vector products.Reduction of macrophage sequestration is therefore essential for efficient lentiviral liver gene therapy.Autographa californica GP64 and the hepatocyte specific Sendai Virus envelope proteins. Lentiviral vectors were produced with either wild type GP64, Sendai-GP64, or both wild type GP64 and Sendai-GP64 and tested in vitro and in vivo for hepatocyte and macrophage gene transfer.Fusions were made of Sendai-GP64 pseudotyped vectors showed specific gene transfer to HepG2 hepatoma cells, with no detectable transduction of HeLa cervical carcinoma cells, and a decreased affinity for RAW mouse macrophages. Co-expression of wild type GP64 and Sendai-GP64 resulted in improved viral titers while retaining increased affinity for HepG2 cells.In vivo, the Sendai-GP64 vectors also showed decreased transduction of murine liver macrophages.in vitro and in vivo with GP64/Sendai chimeric envelope proteins.We demonstrate reduced macrophage transduction  These pin vitro ,5. In coansduced -8. We haansduced . Althougansduced  it wouldin vitro [in vivo [Autographica californica multiple nuclear polyhedrosisvirus, GP64, is also able to efficiently pseudotype lentiviral vectors [in vivo gene transfer of lentiviral vectors pseudotyped with either VSVg or GP64 showed comparable transduction profiles in murine livers [in vivo.Lentiviral vectors are commonly pseudotyped with VSVg which generates stable virions capable of transducing a broad range of cells both in vitro  and in v[in vivo ,11. Howe vectors . GP64 ps vectors . A compae livers . Thus, ae livers ,15, pseuPlasmodium berghei circumsporozoite protein [The engineering of retroviral envelope proteins for retargeting represent a challenge as modifications to viral envelope proteins often results in a significant reduction in viral titers -18. GP64 protein , avidin  protein , and gp1 protein . Lentivi protein . We have protein .in vivo studies. We constructed a Sendai-GP64 fusion protein and investigated the tropism of lentiviral vectors pseudotyped with this envelope protein for hepatocytes and macrophages in vitro and in vivo.The Sendai Virus Fusion (SV-F) protein utilizes a hepatocyte specific receptor for viral entry . Both mu0, which is cleaved by a cellular protease to a F1 and F2 chain [The Sendai Virus Fusion protein (SV-F) is expressed as an inactive precursor protein FF2 chain ,30  directed against GP64 gave the expected band for the wild type GP64 pseudotyped lentiviral vectors Figure  lane 1, Lentiviral vectors expressing GFP from the PGK promoter were produced with wtGP64, Sendai-GP64, or Sendai-spGP64 viral envelope proteins. Viral titers were determined on both HeLa  and HepG2 (a liver hepatoma cell line) cells. Lentiviral vectors pseudotyped with GP64 can efficiently transduce both HeLa and HepG2 cells, while both Sendai-GP64 and Sendai-spGP64 pseudotyped lentiviral vectors were only able to transduce HepG2 cells. Thus, both chimeric envelope vectors displayed a higher affinity for HepG2 cells as compared to wtGP64 Table . Viral tin vivo use. Therefore, to increase viral titers, lentiviral vectors were produced with wtGP64 and either Sendai-GP64 or Sendai-spGP64 envelope proteins. The ratio of wtGP64 to Sendai-GP64 or Sendai-spGP64 plasmid used during virus production were optimised to yield lentiviral vectors that had high titers on HepG2 cells while retaining a reduced affinity for HeLa cells. The specificities of viruses produced with different ratio's of wild type GP64 and Sendai-GP64 are shown in table The titers of lentiviral vectors with either the Sendai-GP64 or Sendai-spGP64 envelope alone were too low for in vivo.We have previously shown that Kupffer cells (liver macrophages) are the predominant cell type transduced within the liver . Therefo8 HepG2 transducing units, of GP64 , Sendai-GP64/wtGP64 , or Sendai-spGP64/wtGP64  pseudotyped lentiviral vectors. One week following viral injections, the mice were sacrificed and tissues were fixed in vivo. Liver sections were prepared from the left and medial lobes and GFP expression was directly observed using fluorescence microscopy. In liver sections of mice injected with wtGP64 lentiviral vectors, the majority of transduced liver cells were nonparenchymal cells  in the amount of transduced nonparenchymal liver cells in mice injected with Sendai-GP64/wtGP64 lentiviral vectors as compared to wtGP64 Table . Sendai-Our observation that Sendai-GP64/wtGP64 pseudotyped lentiviral vectors have a reduced affinity for RAW macrophages in vitro is thus confirmed by the lower transduction of liver macrophages in vivo.To validate the microscopy data, PCR amplification specific for integrated lentiviral vectors was performed on genomic DNA isolated from the liver. In the Sendai-GP64/wtGP64 and Sendai-spGP64/wtGP64 injected animals a weaker band is observed in liver genomic DNA, validating the results from the counting of GFP expressing cells in liver sections  by western blot. This was surprising because the Sendai-GP64 construct contains the full length GP64 cDNA with exclusion of the signal peptide.Lentiviral vectors produced without a viral envelope protein lack the ability to bind and fuse to target cells and are not capable of gene transfer in HepG2 cells under our experimental conditions . Thus, a functional envelope protein must be incorporated in the Sendai-GP64 pseudotyped virions. The most likely explanation for this discrepancy is that different posttranslational processing of Sendai-GP64 results in disruption of epitopes that are recognised by the antibody on wild type GP64.Sendai-GP64 uses the Sendai virus signal peptide, when we constructed a Sendai-GP64 fusion protein that uses the GP64 signal peptide we were able to detect low levels of Sendai-spGP64 on western blot Figure  lane 3 sin vivo, Sendai-GP64/wtGP64 lentiviral vectors exhibited a significant reduction of gene transfer to Kupffer cells  for rs Table . Mice rels Table  and thisThe titers of Sendai-GP64 pseudotyped lentiviral vectors are low and must be improved to be suitable for practical use. Inserting the Sendai fragment into a different site of GP64 or using a directed evolution approach might result in new and improved hybrid viral envelopes.Hepatocyte specific gene transfer using GP64 pseudotyped Feline Immunodeficient Virus (FIV) derived lentiviral vectors has been described . This hein vivo gene transfer through manipulations to the GP64 envelope protein. Further improvements in GP64 fusion proteins allowing for higher levels of expression may eventually lead to hybrid envelope proteins with complete retargeting without the need to co-express wild type GP64 envelope protein.In this study we have shown that it is possible to redirect The Sendai Virus Fusion cDNA was kindly provided by Dr. Allen Portner  in a mammalian expression vector. The GP6MCSGP64for 5'GGTACCATGGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGCA-3'GP64midRev 5'-TAGATGCTGTTGTTGTAGC-3'.The resulting PCR product was ligated into the pCR2.1 TOPO vector and sequenced. The GP64 coding sequence containing the MCS was released by a KpnI and SacII digest and subcloned into a KpnI and SacII digest of the pCDNA 3.1 GP64 to create pCDNA3.1 MCSGP64. The Sendai Virus F2 coding sequence was amplified with the following primers ClaISVF2f 5'-ATCGATATGACAGCATATATCCAGAGATC-3'ClaISVF2r 5'-ATCGATTCTCGACTGGGGAGCACCGGCAT-3'The resulting product was verified by sequencing and cloned into the ClaI site of MCSGP64 to create pCDNA 3.1 Sendai spGP64.Concentrated viral supernatants of GP64, Sendai-GP64/wtGP64, Sendai spGP64, and Sendai spGP64/wtGP64 pseudotyped lentiviral vectors were run on 10% SDS-PAGE and blotted onto nitrocellulose using the Bio-Rad Miniprotean III system. An antibody directed against a C terminal epitope in the GP64 protein, AcV5 (eBioscience 14-6995), was used at a 1:1000 dilution. A 1:1000 dilution of Goat anti Mouse HRP (Bio-Rad 170-6516) was used as a secondary antibody on all blots. Detection of reactive bands on western blots was performed using the Lumi-Light western Blot Substrate (Roche 12 015 200 001) and blots were analyzed using a LumiImager F1 and LumiAnalyst 3.1 software (Roche).2. RAW mouse macrophages were grown in standard RPMI media supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 100 U/ml penicillin, and 100 \u03bcg/ml streptomycin at 37\u00b0C in 10% CO2HEK293T, HeLa, and HepG2 cells were grown in standard DMEM media supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 100 U/ml penicillin, and 100 \u03bcg/ml streptomycin at 37\u00b0C in 10% COLentiviral vectors with the phosphoglycerate kinase promoter driving eGFP expression were produced as described earlier . Briefly8 transducing units/ml and p24 levels ranged from 4-30 \u03bcg/ml.Viral particles were measured using a commercial ELISA kit for the Gag p24 protein (Perkin Elmer NEK050). HepG2 titers for the concentrated lentiviral vectors ranged from 1.5 - 3.2 \u00d7 10ad libitum on standard laboratory chow. All animal experiments were performed in accordance with the Animal Ethical Committee guidelines at the Academic Medical Center of Amsterdam.Wild-type FVB male mice ages 6-10 weeks were used in all studies and were fed 2O, 7 ml/kg). Under deep anesthesia, the peritoneal cavity was opened and the mice were injected intraportally with identical amounts of infectious virions, the equivalent of 0.5 \u00d7 108 HepG2 transducing units, on day 0. The amount of HIV p24 injected was 6.3 \u03bcg for GP64, (0.25 ml of 2.0*108 TU/ml n = 5), 21.3 \u03bcg for Sendai-GP64/wtGP64, (0.35 ml of 1.5*108TU/ml) n = 7), and 4.6 \u03bcg for Sendai-spGP64/wtGP64,  n = 4. The peritoneal cavity was sutured and the animals received the analgesic Temgesic  subcutaneously following recovering from FFM.Mice were anesthetized with an intraperitoneal injection of FFM mix , followed by 20 ml of 2% formaldehyde in PBS. Following perfusion, the liver and spleen were removed and further fixed for 4 hours in 4% formaldehyde in PBS at room temperature. The fixed tissues were then transferred to 30% sucrose solution and incubated overnight at 4\u00b0C, snap frozen in liquid nitrogen and stored at -80\u00b0C the following day.On day 7, the mice were killed by Cryosections were made from both the left and medial lobes. The tissue was embedded in Tissue-Tek OCT (Bayer) and sections (6 \u03bcm) were applied to poly lysine coated glass slides and enclosed in Vectashield mounting media (Vector Laboratories).Liver sections were prepared as described above and frozen without mounting media. Following thawing at room temperature sections were washed three times 5 minutes each in PBS and blocked with 10% Normal Goat Serum in PBS/0.05% Tween-20 for one hour. Kupffer cells were stained with a rat anti mouse F4/80 antigen (1:20 Serotec) for one hour. Slides were washed three times 5 minutes each in PBS/0.05% Tween-20 and incubated with a goat anti rat Texas Red conjugated antibody  for one hour. Following three washing steps of 5 minutes each, sections were embedded in Vectashield mounting media containing DAPI. Images were captured at (400\u00d7) magnification using a fluorescent microscope (Leica DMRA2).GFP positive cells were counted in sections made from the left and median lobes using a fluorescent microscope (Leica DMRA2). All sections/slides were prepared and coded independent of the counter. Identification of parenchymal and nonparenchymal cells was made based on morphology as described before .2 was estimated by counting amount of hepatocytes present in one field at (400\u00d7). Data are reported as number of GFP expressing cells per square millimeter.Per animal, one section from the left lobe and median lobe were counted for GFP positive hepatocytes at (200\u00d7). Three fields (200\u00d7) per section were counted for GFP positive nonparenchymal liver cells. Images of the counted sections were captured and the surface area of sections was calculated using Leica FW4000 software. The number of total hepatocytes per mmStatistical analysis was performed using SPSS 11.0 software using the Mann-Whitney U test. Values were determined to be significantly different with p < 0.05.Genomic DNA was isolated from snap frozen liver and spleen tissue using Dneasy tissue kit (Qiagen) according to manufacturers instructions. The following primer pairs were used to generate a 274 bp product: HIV-U3 forward primer 5'-CTGGAAGGGCTAATTCACTC-3' and HIV PSI reverse primer 5'-GGTTTCCCTTTCGCTTTCAG-3'. This primer pair is designed to specifically amplify integrated provirus and thus reduce contamination from amplification of the transfer plasmid. Additionally primers directed against GAPDH were used as a template loading control GAPDH forward primer 5'-CAATCACCATCTTCCAGGAG-3' and GAPDH reverse primer 5'-TGCCCACAGCCTTGGCAGC-3'. 100 ng of total DNA was used per PCR reaction using the following conditions: 95\u00b0C for 5 minutes, followed by 33 cycles of 95\u00b0C for 30 seconds, 55\u00b0C for 30 seconds, and 72\u00b0C for 30 seconds with a fill in at 72\u00b0C for 10 minutes. Negative control samples were taken from animals that had not been injected with virus.DMM and JS conceived the study.DMM, NPVT, JKH and JS designed and performed experiments.DMM, RPJOE and JS analyzed the data.DMM and JS wrote the manuscript.All authors read and approved the manuscript."}
{"text": "RNA inhibition by siRNAs is a frequently used approach to identify genes required for specific biological processes. However RNAi screening using siRNAs is hampered by non-specific or off target effects of the siRNAs, making it difficult to separate genuine hits from false positives. It is thought that many of the off-target effects seen in RNAi experiments are due to siRNAs acting as microRNAs (miRNAs), causing a reduction in gene expression of unintended targets via matches to the 6 or 7 nt 'seed' sequence. We have conducted a careful examination of off-target effects during an siRNA screen for novel regulators of the TRAIL apoptosis induction pathway(s).We identified 3 hexamers and 3 heptamer seed sequences that appeared multiple times in the top twenty siRNAs in the TRAIL apoptosis screen. Using a novel statistical enrichment approach, we systematically identified a further 17 hexamer and 13 heptamer seed sequences enriched in high scoring siRNAs. The presence of one of these seeds sequences (which could explain 6 of 8 confirmed off-target effects) is sufficient to elicit a phenotype. Three of these seed sequences appear in the human miRNAs miR-26a, miR-145 and miR-384. Transfection of mimics of these miRNAs protects several cell types from TRAIL-induced cell death.We have demonstrated a role for miR-26a, miR-145 and miR-26a in TRAIL-induced apoptosis. Further these results show that RNAi screening enriches for siRNAs with relevant off-target effects. Some of these effects can be identified by the over-representation of certain seed sequences in high-scoring siRNAs and we demonstrate the usefulness of such systematic analysis of enriched seed sequences. TNF-related apoptosis inducing ligand (TRAIL) induces apoptosis in many transformed cell types but not in most normal cell types ,2. This TRAIL stimulates apoptosis by binding to one of two receptors, TNFRSF10A and TNFRSF10B ,5. This Investigations into the mechanisms that regulate sensitivity of cells to TRAIL have implicated many factors and pathways. Regulation of the TRAIL receptors, at the level of expression, localisation to the cell surface and the O-glycosylation of the proteins, partially, but not fully correlates with sensitivity -11. LeveGenome scale gene knock-down screens using RNA interference (RNAi) are an increasingly popular method for finding genes associated with cellular phenotypes. Indeed two screens for genes involved in TRAIL-induced apoptosis have been undertaken ,21. DespOff-target effects in RNAi screens occur where short interfering RNAs (siRNAs) directly affect the expression of genes other than the one that they are designed to target. Micro-array experiments have shown that an siRNA can affect the mRNA levels of many genes ,23. Theret al found that their top three hits scored well due to off-target effects. They observed that two of these three siRNAs shared the same 7 nt seed sequence. Searching a database of 3' UTRs, they found that the Bcl-2 family member Mcl-1 contained matches to both the 7 nt seed sequences seen in their top three siRNAs. They hypothesised that screening enriches for siRNAs with off-target effects and that this will lead to enrichment of certain seed sequence in high scoring siRNAs [Such off-target effects have been shown to cause problems in siRNA based screens. In a screen for genes which sensitize normally resistant cells to a Bcl-2 inhibitor, Lin g siRNAs .Until now, such effects in siRNA screens have only been described as post-hoc explanations for already identified off-target effects, generally restricted to the seeds of the top few siRNAs from a hit list. To the best of our knowledge, systematic analyses of the effects of seed sequences on siRNA screen results have yet to be reported. Therefore, here we report a screen for regulators of the TRAIL-induced apoptosis pathway. After rigorous confirmation of a set of hits, we investigated the off-target effects in our results. We show both that a set of seed sequences is over-represented in our potential hit siRNAs and that a second, overlapping set of seed sequences is enriched in high scoring siRNAs in general and that the presence of one of these seed sequences is sufficient to render an siRNA active in our screen. This effect was used to identify three species of miRNA that are regulators of the TRAIL induced apoptosis pathway.BID, CASP3, CASP8, DIABLO and TNFRSF10A, Figure In order to confirm that our assay is capable of identifying novel genes in the TRAIL-induced apoptosis pathway we selected 18 genes previously implicated in the pathway, including several genes identified in a previous screen, in addition to genes central to the apoptosis pathway . We measWe next screened a library of 12,190 siRNAs, targeting the 6,095 genes of the druggable genome, excluding kinase and phosphatase genes (which were screened separately), in duplicate, for novel genes in the TRAIL-induced cell death pathway , we were able to confirm that the effect of siRNAs targeting these genes was due to on-target effects by these criteria, therefore implicating these genes as genuine regulators of TRAIL-induced apoptosis. In the case of PDE11A we were unable to detect expression in any sample (possibly due to very low wild-type expression levels), but included the gene in our hit list since we found three siRNAs targeting PDE11A that have a significant effect on Caspase-3/7 levels. Kinase and phosphatase genes were investigated in a separate screen, but we were unable to confirm any hits (data not shown).In five cases , the opposite of the phenotype shown here [The function of product of own here . How thiDuring the confirmation of our screening results we encountered a large number of off-target effects - siRNAs which caused a phenotypic effect that was independent of their effect of the transcript level of the intended target. It is also worth noting that in several cases we identified genes where knock-down by two siRNAs induced TRAIL resistance, while a third siRNA did not, despite reducing the mRNA levels further, suggesting that the effect of both of the first two siRNAs were due to off-target effects  and that the off-target effects were due to matches to these sequences . To examet al's hypothesis that screening itself enriches for siRNAs with particular seed sequences. From here on we use 'enriched seed' to refer to both those seeds identified by GSEA and those that appear multiple times in the 16 confirmed siRNAs.Restricting our examination of seed sequences to the top 20 siRNAs is arbitrary. The Gene Set Enrichment Analysis (GSEA) algorithm tests for the enrichment of a set of items within a larger ranked list of such items . In ordeSince siRNAs with these seeds have a tendency to score highly, it is possible that they are scoring highly because they contain these seed-sequences rather than because the intended target is involved in TRAIL-induced apoptosis. To test if the presence of an enriched seed alone could alter the sensitivity of cells to TRAIL induced apoptosis, we transfected cells with either an siRNA targeting Luciferase (siGL2), or anti-luciferase siRNAs where the seed sequence (nucleotides 2-7) was replaced with either the sequence ACTTGA (siGL2+seed) or a version of the same sequence with two bases exchanged (ATCTGA - siGL2+mutseed). ACTTGA appears in the seed position of 3 of the 16 confirmed siRNAs, and was the second most enriched seed sequenced identified by GSEA. Cells transfected with the siRNA containing the mutated seed have a very similar sensitivity to TRAIL-induced cell death to that of cells transfected with the unaltered anti-Luciferase siRNA . In each of these cases we had found a second siRNA targeting the gene that also had a significant effect on TRAIL-induced apoptosis. However, in the case of TEGT that other siRNA (which was the second siRNA used in the screen) also contained one of the enriched seed sequences. Given the amount of evidence for the involvement of MYC in the TRAIL pathway from the literature, it is unlikely that siRNAs targeted against MYC exert their effect solely though off-target effects [In total 9 of the 16 siRNAs with a confirmed effect on Caspase-3/7 actiavation contain a seed from one of these two sets of sequences, including six of the top 7 siRNAs. This includes two siRNAs targeting genes that had been selected as confirmed hits  have one of the enriched seed sequences. In total the effects of the 12 of the 16 (75%) siRNAs which reproducibly reduced the sensitivity of cells to TRAIL-induced cell death could be attributed to either the targeting of a hit gene or the seed sequence of the siRNA. We cannot say that all the genes targeted by an siRNA containing a seed are definitely not involved in TRAIL-induced apoptosis, just that at least part of their effect is likely to be due to off-target effects. Even so the majority of siRNAs in the top 20 appear to owe at least part of their activity to off-target effects. Such findings suggest that screening enriches for siRNAs with off-target effects and that a high scoring siRNA in this assay is more likely to exert its effect through an off-target effect than by affecting the intended target. Thus off-target effects are probably more widespread than is generally recognised.TEGT in this study). We recommend that hits should be confirmed using at least two, and ideally three or more siRNAs not used in the screen, and whose seeds have been checked.The usual method for distinguishing true hits from RNAi screens from off-targets is to require that two independent siRNAs targeting the same gene have the same phenotype . HoweverFinally, we note that not only can seed sequences lead to a substantial number of false positives in RNAi screens, but can also mask true hits and thus increase false negative rates. In the TRAIL-killing screen described here, we tested for the enrichment of genes previously associated with the TRAIL pathway. We identified 27 genes that had previously been associated with the TRAIL induced apoptosis pathway and knockdown of which might be expected to decrease sensitivity to TRAIL-induced cell death. siRNAs against 12 of these were present in our library . We applied GSEA's pre-ranked analysis to test for enrichment of this gene set in the results from our screen. We found no significant trend, suggesting that we had failed to pick up most of the previous known genes involved in TRAIL killing  = 1.64, P = 0.097). To determine if this was due to a real effect being hidden by the off-target effects, we removed any siRNA containing an enriched seed sequence from our data and reanalysed the screening data. The ranking of siRNAs under this regime is available in Additional File Transfecting siRNAs to knock-down target genes is equivalent to over-expressing miRNAs of the same sequence as the siRNA. If many of the siRNAs that score well in our screen are exerting their effect through miRNA-like effects determined by a set of common seed sequences we reasoned that we might be able identify miRNAs with the same seed sequences and this might be an indication that these miRNAs are involved in regulating TRAIL-induced apoptosis. We searched a set of seed sequences found in human miRNAs downloaded from the miRBase database (version 10.0). We identified three miRNAs whose seed sequences were the same as those identified above Table .One of these miRNAs (miR-145) has previously been implicated in the regulation of TRAIL induced apoptosis . miRNA-2Caenorhabditis elegans miRNA used as a negative control. In two of the three cases (miR-26a and miR-145) this difference was still significant after correction for multiple testing. To test if the involvement of these miRNAs was specific to HeLa cells or extends to other cell types, we transfected DU145 (prostate carcinoma), HCT-116 and SW480  cells with the same miRNA mimics. The effects of the miRNA mimics were similar in SW480 and DU145 cells to HeLa cells, while in HCT-116 the effects were significant only in the case of the mimic of miR-126a  not used in the original screen, and do not contain seed sequences found in high scoring siRNAs from the screen.Where as previously off-target events have been regarded as unfortunate anomalies (which can in some circumstances be driven by miRNA-like targeting through seed sequences), our findings provides support for the hypothesis of Lin Removing siRNAs containing enriched seed sequences allowed us to show that siRNAs targeting genes known to be involved in the TRAIL induced apoptosis pathway were enriched in high-scoring siRNAs. This suggests that identifying enriched seed sequences and removing siRNAs containing them from analysis in the future will aid with such investigations.One obvious approach to combating such off-target effects would be to exclude siRNA with common seed sequences at the design stage . While this may exclude siRNAs with the largest number of off-target effects , seeds from endogenous miRNAs are not necessarily the ones that are most common in 3' UTRs. While siRNAs containing the seeds of endogenous miRNAs may have fewer targets, their targets are likely to have some degree of functional relation, and are therefore more likely to have a strong functional effect on the cell. Excluding siRNAs containing the top 10% of 6 mer seed sequence by frequency would have removed 6 of the 17 seed sequences we found to be enriched, but none of the seed sequences we identified that are found in endogenous miRNAs (data not shown). Excluding so many seed sequences also greatly reduces the design space for siRNAs and will result is more siRNAs sharing the same seed sequences .Finally we used the enriched seed sequences to identify miRNAs that may be involved in TRAIL-induced apoptosis, identifying miRNAs miR-26a, miR-145 and miR-384 as affecting TRAIL-induced cell death in a range of cell types. Further work will be needed to examine if these miRNAs have an endogenous role in regulating the TRAIL-induced apoptosis pathway. This analysis allows additional information to be gathered from the results of RNAi screening and turns potentially confounding off-target effects into a new source of information for the process being studied.miRNAs present an attractive candidate for controllers of sensitivity to TRAIL-induced apoptosis as they can control many genes simultaneously, allowing those changes necessary to transform cells to be linked to changes sensitizing them to TRAIL-induced apoptosis.HeLa cells were obtained from ATCC (#CCL-2) and were maintained in Modified Eagle's medium (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum, 2 mM L-Glutamine, 1\u00d7 Non essential amino acids, penicillin and streptomycin. SW480, HCT116 and DU145 cells were a kind gift from Prof. Mike Stratton. DU145 cells were maintained in the same media as HeLa cells. SW480 cells were maintained in Leibovitz's L-15 Medium (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum, 2 mM L-Glutamine, penicillin and streptomycin. HCT116 cells were maintained in McCoy's 5a (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum, 2 mM L-Glutamine, penicillin and streptomycin.Individual siRNAs were obtained from either Invitrogen, Qiagen, Ambion or Dharmacon. Sequences and suppliers of siRNAs is listed in additional file Cells were transfected with 2.5 pmol siRNA in 96-well plates or 12.5 pmol siRNA in 24-well plates using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions for each cell type.For HeLa cells, 3,000 cells were seeded into the well of a 96 well optilux plate (BD Bioscience), in antibiotic free media. 24 hours later cells were transfected with siRNA. After a further 48 hours the number of cells present was measured by incubating for 3 hours with 10% alamarBlue reagent  before reading flourescence  using a fluorescent plate reader . Cells were treated with 0.5 \u03bcg/ml recombinant TRAIL  in serum-free media for 20 hours and number of cells present was reanalysed as above.BID and DIABLO as positive controls, two duplicates of an siRNA targeting siKIF11 as a transfection control, and four wells containing three different negative controls . The siRNAs were transfected into HeLa cells and the effect on TRAIL induced measured as described above. The screen was performed in duplicate. Plate were quality controlled by measuring the dynamic range between positive control transfected wells and negative control transfected wells, plates where the positive control was not twice the negative control were repeated.12,190 siRNAs from the Qiagen druggable genome library v2 were arrayed into 96-wells plates along with two duplicates of the siRNAs targeting Caspase-8, Data analysis was performed using the cellHTS package in R/Bioconductor . BrieflyThe minimum of the two scores for each siRNA was selected to represent that siRNA. See cellHTS report in supplementary information for analysis script.For each gene targeted by an siRNA in the top 20 scoring siRNAs, both siRNAs in the library were retested in triplicate. Where only one siRNA targeting a gene had a significant effect a further two siRNAs were obtained. siRNAs were tested for their effect on Caspase-3/7 activity. 3,000 cells were seeded in optilux plates and transfected with siRNA as described above. 48 hours after transfection cells were incubated with 0.5 \u03bcg/ml recombinant TRAIL in serum free media for 6 hours and the level of Caspase-3/7 measured using the Caspase-glo 3/7 kit (Promega) according to manufacturer's instructions.To measure the effect of siRNAs on mRNA levels, 15,000 cells were transfected with 12.5 pmol siRNA using 0.6 \u03bcl Lipofectamine 2000 and after 48 hours RNA prepared using the SV Total RNA isolated kit (Promega), and cDNA prepared using Superscript II (Invitrogen). SYBR green qPCR was performed using qPCR MasterMix (Eurogentec) with primers designed to amplify the transcript of interest or ACTB or GAPDH. All primers were tested to measure amplification efficiency. See additional file To test the significance of observing the same seed sequence in multiple siRNA from the top 20 siRNAs, the seed sequence of all siRNAs in the library were extracted. Samples of twenty seed sequences were selected at random, and the number of times seed sequences appeared counted. This was repeated 5,000 times for both hexamer and heptamer seed sequences and the number of times any seed sequence appeared more than one was counted.To use GSEA to detect enriched seed sequences, \"gene-sets\" were built containing the each of the siRNAs containing at particular seed sequence. The GSEA desktop application's pre-ranked analysis option was used to test if these sets were enriched in high-scoring siRNAs. This was repeated for both hexamer and heptamer seed sequences.GSEA: Gene Set Enrichment Analysis; miRNA: microRNA; RNAi: RNA interference; siRNA: small interfering RNA; TRAIL: TNF related apoptosis inducing ligand.IMS was involved in the conception, design and interpretation of the work, carried out all experimental work, screening data analysis, identification of seed sequences and wrote the manuscript. AJE was involved in the interpretation of the data, the analysis of the enriched seed sequences and editing the manuscript. AGF and ID were involved in the conception, design and interpretation of the work and editing the manuscript. The final manuscript has been reviewed and approved by all authors.Complete screen results (screen_results.zip). Complete results from the siRNA, presented as a mini-website as produced by the cellHTS softwareClick here for fileSupplementary figures (supplementary_figures.pdf). Figures S1 and S2 containing detailed results from confirmation experiments for all 16 genes targeted by siRNAs from the screen which reproducibly reduce sensitivity to TRAIL-induced cell death.Click here for fileRanking of siRNAs after removal of siRNAs with enriched seed sequences (no_enriched_seeds.csv). Ranking of siRNAs used in the screen according to their score, after any siRNA containing an enriched seed had been removed and data reanalysed.Click here for fileSequences of siRNAs used (siRNAs.csv). List of sequences, suppliers and catalogue numbers for non-library siRNAs.Click here for fileSequences of qRT-PCR primers (primers.csv). List of primer sequences used along with product lengths and amplification efficiency for each pair.Click here for file"}
{"text": "The mechanisms and components that regulate macropinocytosis are poorly understood. Here we have investigated the role of sorting nexin 5 (SNX5) in the regulation of macropinocytic activity.P and PtdInsP2 through its PX domain, was recruited to regions on the plasma membrane containing EGF receptor or positive for PtdInsP2 as detected with the PH domain of TAPP1. Treatment with AG1478, an EGF receptor specific tyrosine kinase inhibitor, prevented the recruitment of SNX5 to the cytosolic face of the plasma membrane and inhibited the formation of macropinosomes in response to EGF treatment.SNX5 is abundantly expressed in macrophages, cells very active in macropinocytosis, and is recruited onto newly-formed macropinosomes. LPS treatment of bone marrow-derived macrophages resulted in a 2.5 fold decrease in macropinosome formation that correlates with a reduction in the levels of SNX5. To investigate the relationship between SNX5 levels and macropinocytic activity we examined the formation of macropinosomes in HEK-FlpIn cells stably expressing GFP-SNX5. Constitutive macropinocytosis was increased ~2 fold in HEK-GFP-SNX5 cells compared with parental HEK-FlpIn cells. Furthermore, EGF stimulation resulted in a significant increase in macropinocytosis and there was also a 2.0 fold increase in the generation of macropinosomes in HEK-GFP-SNX5 cells compared with parental HEK-FlpIn cells. SNX5, which interacts specifically with PtdIns(3)Based on these data, we propose that SNX5 requires the generation of phosphoinositides for recruitment to the plasma membrane and, moreover, influences the level of macropinocytic activity. Macropinocytosis is an endocytic process that enables cells to internalize large amounts of solutes from the external environment. Macropinosomes are generated from the base of actin-mediated membrane ruffling when the lamellipodia folds back onto itself thereby forming very large endocytic structures. Macropinosomes are heterogeneous in size and generally considered to be > 0.2 \u03bcm in diameter ,2, a sizSalmonella and Shigella to gain entry into host cells [Macropinocytosis is important in a range of physiological processes. For example, macropinocytosis has a role in the down-regulation of signalling from the plasma membrane  and, becst cells .P2 [P2 [P3 [P, is implicated in the membrane trafficking of the endosomal system.Despite the physiological relevance of macropinocytosis, the molecular basis for the regulated formation and maturation of macropinosomes is very poorly understood. Macropinosome formation in a range of cell types has been shown to be phosphoinositide-3 kinase dependent  and unliP2 , PtdInsP2 [Sorting nexins are a large family of proteins characterised by the presence of a phox (PX) domain at the amino terminus. The modestly conserved PX domain is a sequence of 70 to 120 residues that has been shown to bind to various phosphoinositides hence the PX domain confers phosphoinositide specificity to the protein . SortingsP2  and SNX5sP2 . After EsP2 , charactsP2 . Our presP2 . Here, w\u00ae 488, goat anti-mouse IgG Alexa Fluor\u00ae 568, goat anti-mouse IgG Alexa Fluor\u00ae 647, biotinylated EGF complexed to Alexa Fluor\u00ae 555 streptavidin and Texas-Red-X Phalloidin were purchased from Molecular Probes . Horse-radish peroxidase conjugated rabbit anti-mouse and swine anti-rabbit immunoglobulins were from Dako . Full length human EGF-R was cloned into the XbaI sites of pCI-neo. The PH domain of TAPP1 (aa 95\u2013400) was from Dr. S. Dowler .Rabbit anti-mouse SNX5 was raised against a synthetic peptide corresponding to the N-terminal 35 residues of mouse SNX5, with an additional Cys on the C-terminus, and affinity purified on a column of peptide conjugated to SulfoLink Coupling Gel . Monoclonal mouse antibodies to human EEA1 were from BD Transduction Laboratories . Mouse monoclonal anti-human EGF receptor (EGF-R) antibody (clone 528) has been described . MonocloHEK-FlpIn  and HEK-GFP-SNX5 stable cells were generated, cultured and transfected as previously described . PrimaryCell monolayers were cultured for various time periods in the presence of 100 \u03bcg/ml dextran  conjugated to tetramethylrhodamine (TR-dextran) . The cells were then washed with media at 4\u00b0C and fixed in 4% PFA. Images were captured using an LSM 510 Meta confocal microscope and quantified for macropinosomes using an automated image analysis pipeline in ImageJ 1.37v (NIH). The 'Substract Background' functionality was executed, and images thresholded to a binary image. Dextran-positive structures at least 0.5 \u03bcm in diameter were quantified through the 'Analyze Particles' feature.For analysis of macropinosomes using endosomal markers, cell monolayers were washed twice using PBS, serum-starved for 16\u201324 h at 37\u00b0C and stimulated with EGF (100 ng/ml)  at 37\u00b0C for 10 min. Cells were then washed twice in PBS, fixed in 4% PFA and stained using mouse anti-human EEA1 followed by goat anti-mouse Alexa Fluor 568. Macropinosomes were identified based on their size (>1 \u03bcm) [HEK-GFP-SNX5 cells, transiently transfected with pCI-neo-EGF-R for 24 h, were serum-starved for 16\u201324 h at 37\u00b0C. Cells were washed twice using ice-cold PBS and incubated with 100 ng/ml Alexa Fluor 555 conjugated-EGF  in serum-free media for 10 min on ice. Excess EGF was removed by washing the cells three times in ice-cold PBS. Cells were resuspended in ice-cold serum-free media (in the absence and presence of drugs) and the cells were then incubated at 37\u00b0C for the indicated duration to allow EGF internalization. Cells were then fixed and processed for immunofluorescence analysis.Cell monolayers were washed twice with PBS and serum-starved for 16\u201324 h at 37\u00b0C. Cells were treated with 100 nM AG1478  (from a 10 mM stock in DMSO) for 15 min at 37\u00b0C. EGF (100 ng/ml)  was then added to the cells in the presence or absence of AG1478 at 37\u00b0C for the indicated durations. Cells were then washed twice with PBS and processed for immunofluorescence.Cell monolayers grown on poly-L-lysine coated coverslips were washed twice in PBS and fixed in 4% PFA for 15 min. Cells were processed for immunofluorescence as previously described  and examLate endosomes and lysosomes of cells were labelled with fluorescently-conjugated dextran as described previously . BrieflyProteins were resolved on 10% SDS-polyacrylamide gels and transferred onto Immobilon-P PVDF membranes  according to the manufacturer's instructions and immunoblotting performed as described . SNX5 wat-test, two-tailed.Data were analysed by an unpaired Student's We have previously shown that GFP-SNX5 is associated with macropinosomes in HEK-FlpIn cells . The queTo directly explore the role of SNX5 in macropinocytosis we have used HEK-FlpIn cells which stably express SNX5-GFP. This cell line was the previously described HEK-FlpIn cell line transfected with pcDNA5/FRT-EGFPSNX5, referred to as HEK-GFP-SNX5 . HEK-GFPNext we investigated if the elevated level of SNX5 in HEK-GFP-SNX5 cells modulated the level of macropinocytosis. To estimate changes in macropinocytosis, newly-formed macropinosomes were labelled using a 5 min pulse of the fluid phase marker dextran . Only dextran-positive-structures >0.5 \u03bcm in diameter were scored as macropinosomes, and this size-based exclusion will minimise any contribution from changes in pinocytosis kinetics. Untreated serum-starved HEK-GFP-SNX5 cells showed a 1.6 fold increase (p < 0.02) in constitutive macropinocytosis compared with parental HEK-FlpIn cells Fig . PreviouWe then determined the impact of the elevated level of SNX5 on macropinocytosis after EGF stimulation. After a 5 minute EGF stimulation of serum-starved cells, HEK-GFP-SNX5 cells exhibited a 2.0 fold increase in the number of macropinosomes compared to HEK-FlpIn cells (p < 0.005), utilizing the Dextran-uptake assay Fig . These dNext we investigated the relationship between EGF-R signalling and macropinocytosis in the stable HEK-GFP-SNX5 cells using AG1478, an EGF-R specific tyrosine kinase inhibitor that prevents EGF-R activation . SignifiTo determine if the elevated macropinocytic activity induced by increased levels of SNX5 in HEK-GFP-SNX5 cells can support the internalization of EGF-R, we transfected HEK-GFP-SNX5 cells with EGF-R to increase the numbers of receptors for detection by immunofluorescence. Transfected HEK-GFP-SNX5 cells were incubated with Alexa555-conjugated EGF on ice, then the cells washed and incubated at 37\u00b0C to allow internalization of surface bound ligand-receptor complexes. As previously reported , SNX5 anUpon EGF-R activation, SNX5 is recruited to the plasma membrane and the newly-formed macropinosomes  and is cNext we investigated if SNX5 recruited to the plasma membrane after EGF stimulation can influence the rate of formation of macropinosomes. To determine the spatial relationship between plasma membrane recruitment and the location of EGF-R, serum-starved HEK-GFP-SNX5 cells were treated with EGF for 3 min and non-permeabilised cells stained with anti-EGF-R antibodies. Although the staining intensity of the endogenous cell surface EGF-R was weak, the receptor was detected in the ruffling edges of the cell and showed a co-localization with GFP-SNX5 (not shown). To enhance the sensitivity, this experiment was repeated with transfected HEK-GFP-SNX5 cells expressing elevated levels of EGF-R Fig. . GFP-SNXP3 and its breakdown product, PtdInsP2. We have shown that the PX domain of SNX5 binds to both PtdIns(3)P as well as PtdInsP2. To determine the relationship of PtdInsP2 generated from activated EGF-R and the plasma membrane recruitment of SNX5, we have used the PtdInsP2-specific probe, mCherry-TAPP1-PH domain [P2 at the plasma membrane. HEK-GFP-SNX5 cells were transfected with mCherry-TAPP1-PH domain, then the cells serum-starved and treated with EGF for 5 min. mCherry-TAPP1-PH was located on the plasma membrane of EGF-stimulated cells, but not non-stimulated cells, and showed co-localization with GFP-SNX5, demonstrating that SNX5 was recruited to regions of the plasma membrane rich in PtdInsP2 after EGF stimulation H domain , to deteion Fig. . Signifiion Fig. . Qualitaion Fig. . The resThe mechanisms that drive macropinocytosis are poorly defined. Our previous studies showed that SNX5 associates with newly-formed macropinosomes following EGF stimulation . Given tP and PtdInsP2. [P and PtdInsP2, also based on liposome binding assays [P2. Cell signalling is essential for the recruitment of SNX5 to the cytosolic face of the plasma membrane, as AG1478 inhibited the movement of SNX5 to the plasma membrane, presumably due to the lack of PtdInsP3 and its breakdown product PtdInsP2.. However, AG1478 does not prevent EGF-R internalization via the clathrin-dependent pathway (unpublished observations), indicating, at least in this system that receptor dimerization is sufficient for clathrin-mediated endocytosis, and consistent with previous findings [The PX domain of SNX5 has the capacity to bind both PtdIns(3)P2. . The PI g assays . The plafindings .Given the association of EGF signalling and the behaviour of SNX5, it is formally possible that SNX5 is modulating the EGF-R signalling cascade and thereby influencing macropinocytosis indirectly. However, our data argues for a direct role of SNX5 in enhancing the early events of macropinocytosis rather than potentiating EGF-R signalling. Firstly, constitutive macropinocytosis in the absence of EGF stimulation is increased >2 fold in HEK-GFP-SNX5 cells compared with parental HEK-FlpIn cells. Secondly, the kinetics of macropinosome maturation and the rate of EGF-R degradation is similar in parental and HEK-GFP-SNX5 cells following EGF stimulation, indicating SNX5 is promoting the early events driving the biogenesis of macropinosomes, but does not influence the rate of maturation and delivery to lysosomes.in vitro and in vivo. As SNX5 has a coiled-coil C-terminal and a predicted BAR domain, it is likely that it exists as a dimer. We have previously demonstrated that SNX5 does not form a homodimer but can associate with SNX1 and that association of SNX5 with endosomes appears to be dependent on the formation of SNX5/SNX1 heterodimers [A number of the SNXs can form homodimers and heterodimers rodimers . SNX5 isrodimers . TherefoP arising from the hydrolysis of PtdInsP2. The BAR domain of SNX5, in a complex with other sorting nexins, has the potential to distort the limiting membrane of the macropinosome into extensive tubular elements that subsequently separate from the macropinosome and traffic in a microtubule-dependent manner to perinuclear endosomes. As the tubular structures depart from the macropinosome there is a reduction in the surface area of the macropinosome, which matures into a Rab7-positive structure and eventually fuses with late endosomes/lysosomes. The identification of machinery that regulates this process now provides the ability to directly assess the biological role of macropinocytosis in a range of physiological settings.Based on our published data ,25 and tM-CSF: macrophage colony-stimulating factor; EGF: epidermal growth factor; SNX5: sorting nexin 5; TR-dextran: dextran conjugated to tetramethylrhodamine; GFP: green fluorescent protein; BMMs: bone marrow-derived macrophages; LPS: lipopolysaccharide; HEK-GFP-SNX5: HEK293 cells stably expressing SNX5-GFP; PtdIns: phosphoinositides; PX: phox domain; PFA: paraformaldehydeJPL generated the anti-mouse SNX5 antibodies and carried out the macropinosome analysis and inhibition assays. JTHW performed the dextran uptake and the computational quantitation of macropinosome formation. MCK carried out the macrophage analyses and macropinosome maturation assays. RDT participated in the design and co-ordination of the study and helped to draft the paper. PAG participated in the design and co-ordination of the study and drafted the paper. All authors read and approved the final manuscript."}
{"text": "Because of their lipophilicity, persistent organic pollutants (POPs) cross the human placenta, possibly affecting central nervous system development. Most POPs are known aryl hydrocarbon receptor (AhR) ligands and activators of AhR signaling. Therefore, AhR activation has been suggested to cause developmental neurotoxicity (DNT).in vitro systems to determine whether AhR-activation is the underlying mechanism for reported DNT of POPs in humans.We studied the effects of AhR ligands on basic processes of brain development in two comparative a)pyrene [B(a)P], and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)] and an antagonist [3\u2032-methoxy-4\u2032-nitroflavone (MNF)] on neurosphere development. Moreover, we analyzed expression of AhR and genes involved in AhR signaling.We employed neurosphere cultures based on human neural progenitor cells (hNPCs) and wild-type and AhR-deficient mouse NPCs (mNPCs) and studied the effects of different AhR agonists [3-methylcholanthrene (3-MC), benzo(In contrast to wild-type mNPCs, hNPCs and AhR-deficient mNPCs were insensitive to AhR agonism or antagonism. Although AhR modulation attenuated wild-type mNPC proliferation and migration, hNPCs and AhR-deficient mNPCs remained unaffected. Results also suggest that species-specific differences resulted from nonfunctional AhR signaling in hNPCs.Our findings suggest that in contrast to wild-type mNPCs, hNPCs were protected against polycyclic aromatic hydrocarbon\u2013induced DNT because of an absence of AhR. This difference may contribute to species-specific differences in sensitivity to POPs. Because of their lipophilicity, POPs cross the human placenta, exposing the fetus to the contaminant body burden of the mother. This may result in adverse health outcomes, including effects on central nervous system (CNS) development  and vertebrate  species in which dioxins and related compounds cause morphological abnormalities of the brain or deficits in cognition and/or behavior (Persistent organic pollutants (POPs) bioaccumulate through the food chain and may cause adverse effects on human health and the environment. Main substance classes are polycyclic aromatic hydrocarbons (PAHs), such as 3-methylcholanthrene (3-MC) and benzo. These three-dimensional cell systems mirror basic processes of fetal brain development such as proliferation, migration, differentiation, and apoptosis. Moreover, they detect developmental neurotoxicants in vitro  was kindly provided by G. Vielhaber . Methylmercury chloride (MeHgCl) was obtained from Riedel-de Ha\u00ebn , and TCDD was purchased from LGC Standards . All additional chemicals used (unless otherwise noted) were purchased from Sigma-Aldrich  and were of the highest purity available.hNPCs used in this study were purchased from Lonza Verviers SPRL . Data presented in this study are based on experiments conducted on hNPCs obtained from a single male at gestational week 16. Similar results were obtained based on hNPCs from a second male at gestational week 18. For mouse neurosphere cultures, brains of wild-type and AhR-knockout (KO) C57/BL6 mice  were removed at embryonic day (E) 15.5 (E15.5) to E17.5 and transferred to phosphate-buffered saline. Age of the embryos was determined according to the staging criteria of Theiler, in which E16 correspond to Theiler stage 24 . Brains 2 incubator at 37\u00b0C in suspension culture. Differentiation was initiated by growth factor withdrawal in differentiation medium  and plating onto poly-d-lysine (PDL)/laminin\u2013coated chamber slides.Both hNPCs and mNPCs were cultured in proliferation medium  in a humidified 92.5% air/7.5% COWe measured cell viability using a lactate dehydrogenase (LDH) assay  according to the manufacturer\u2019s instructions. Briefly, supernatants of treated cells from the migration, mRNA expression, and proliferation assessments were collected at the respective time points and incubated 2:1 with the CytoTox-One reagent for 4 hr prior to detection of fluorescence . Complete lysis of cells with the included lysis buffer for 2 hr at room temperature served as a positive control.Proliferation was assessed with a combination of CellTiter-Blue Assay (Promega), which measures mitochondrial reductase activity, and microscopic determination of sphere diameter as described previously by . We analACTB (hACTB), hAhR, hAhR repressor (hAhRR), human cytochrome P450 1A1 (hCYP1A1), and hCYP1B1 were described by hARNT, forward (F), CCCTAGTCTCACCAATCGTGGAT; reverse (R), GTAGCTGTTGCTCTGATCTCCCAG; hC-MYC, F, ACCACCAGCAGCGACTCTGA; R, TCCAGCAGAAGGTGATCCAGACT ; mouse Actb (msActb), F, CTACAATGAGCTGCGTGTGG; R, TAGCTCTTCTCCAGGGAGGA ; msAhR, F, GACAGTTTTCCGGCTTCTTG; R, CGCTTCTGTAAATGCTCTCGT ; msArnt, F, TGCCTCATCTGGTACTGCTG; R, GAACATGCTGCTCACTGGAA ; msAhRR, F, GTTGGATCCTGTAGGGAGCA; R, AGACCAGAGGCTCACGCTTA ; msCyp1a1, F, GGCCACTTTGACCCTTACAA; R, CAGGTAACGGAGGACAGGAA ; msCyp1b1, F, ACATGAGTTTCAGTTATGGCC; R, TTCCATTCACTGCTGAGAGC ; msc-myc, F, TGTCCATTCAAGCAGACG; R, GCATTTTAATTCCAGCGCATAG . Expression levels were normalized to the expression of \u03b2-actin. We evaluated gene expression using the cycle threshold (Ct) value from each sample. Calculations are based on the \u0394\u0394Ct method  as the solvent control. After indicated time points, RNA was prepared with the Absolutely RNA Microprep Kit  according to the manufacturer\u2019s instructions. Real-time reverse-transcriptase PCR (RT-PCR) was performed using LightCycler instrumentation  with QuantiTect SYBR green PCR Master Mix  as previously described . Conditit method . For detProteins were isolated from hNPC or HepG2 human hepatocellular liver carcinoma cells as described by t-test for two-group comparisons (treatment vs. control). Significance was set at p < 0.05 , and Student\u2019s p < 0.05 .Cells were exposed to the AhR agonists 3-MC , B(a)P , TCDD , or the AhR antagonist MNF . We treated hNPCs and mNPCs for 6, 12, 24, or 48 hr (differentiation conditions). hNPCs were also treated for up to 14 days and mNPCs were treated for up to 7 days under proliferation conditions. Exposure times for cytotoxicity assays thereby correspond to the duration of treatments in the proliferation, migration, and gene expression assays. We chose concentrations based on known AhR activation/antagonism in other cell types. None of the exposures induced cytotoxicity (LDH release) in hNPCs or mNPCs .We monitored proliferation of mNPCs over only 7 days because of a size-restricted halt in sphere growth beyond that time. In contrast to the hNPCs, we observed significant inhibition of mNPC proliferation after 7 days of exposure to 1 \u03bcM MNF. Although control spheres and 3-MC\u2013 and TCDD-exposed spheres grew from an average diameter of 386 \u03bcm \u00b1 23 \u03bcm to 551 \u03bcm \u00b1 85 \u03bcm, MNF-exposed spheres remained at 405 \u03bcm \u00b1 78 \u03bcm after 7 days. This was due to AhR inhibition, because proliferation of AhR-deficient neurospheres was not affected by MNF treatment . EffectsNext, we investigated whether 3-MC, B(a)P, TCDD, or MNF influences hNPC and mNPC migration. We exposed differentiating neurospheres to 1 and 10 \u03bcM 3-MC, 10 \u03bcM B(a)P, 1 nM TCDD, 0.1 \u03bcM MNF, or 1 \u03bcM MNF for 48 hr; 1 \u03bcM MeHgCl served as a positive control for inhibition of migration . IndepenIn contrast to the results in hNPCs, AhR activation reduced migration distance in wild-type mNPCs by 16% \u00b1 5% (1 \u03bcM 3-MC), 21% \u00b1 13% (10 \u03bcM 3-MC), and 32% \u00b1 10% [10 \u03bcM B(a)P] compared with solvent controls, whereas migration was comparable with controls after exposure to the AhR antagonist MNF . This efAhR and ARNT mRNA expression after exposure to these compounds in hNPCs and mNPCs under proliferating and differentiating conditions. AhR and ARNT mRNAs were expressed at very low copy numbers in hNPCs  and higher copy numbers in mNPCs  ]. Expression of the AhR target genes AhRR, CYP1A1, CYP1B1, and c-myc was not significantly induced by 10 \u03bcM 3-MC after 6, 12, 24, and 48 hr of differentiation in hNPCs P, and MNF did not influence hNPC viability, proliferation, or migration but did modulate proliferation or migration of mNPCs, we determined ctively) . In addiin hNPCs . We obtaectively . Althougcontrols , inset.Comparison of mRNA expression levels between hNPCs and mNPCs showed that genes belonging to the AhR machinery and AhR-dependent genes were generally expressed in higher copy numbers/1,000 copies \u03b2-actin in mNPCs than in hNPCs . Lack ofex vivo cultures from rodents. Such primary cultures are regarded as superior to tumor-derived cells. However, species-specific differences limit their application. One example of how rodent primary cells can indeed misclassify hazards for humans is provided by this study, which shows mouse-derived primary cells to be more susceptible to AhR modulation than their human counterparts. With regard to chemical testing, it is critical to be aware of such differences in order to avoid over- or underestimating hazards that chemicals pose to humans, and thereby protect human health and allow industry production and development of chemicals at the same time.The development of cell-based, nonanimal testing strategies for hazard assessment of chemicals is currently one of the most important tasks in toxicological research. In this regard, it is most important to choose appropriate model systems that are truly predictive for humans . Human tSpecifically, in this study we discovered that proliferation of hNPCs was not affected by AhR agonists  or the AhR antagonist MNF , whereasIn contrast to hNPCs, proliferation of mNPCs was completely blocked by MNF . Reinersin vivo study in which prenatal exposure to the AhR ligand 7,12-dimethylbenz[a]anthracene disrupted cerebellar cytoarchitecture in rats , and hAhR protein was not detectable by Western blot; consequently, only mNPCs expressed quantifiable amounts of Cyp1a1 and responded to 3-MC treatment with a time-related induction of Cyp1a1 and Cyp1b1 mRNA  found in people of African descent were under suspicion to affect the expression of single genes such as CYP1A1, it is widely accepted that none of the AhR polymorphisms described so far is of any functional consequence regarding the overall outcome of AhR response  or the stimulator PMA (phorbol 12-myristate 13-acetate) causes inhibition and stimulation of hNPC migration, respectively (in vivo and in vitro (How can the epidemiological evidence for POP-related DNT in humans be explained if the AhR is not involved in chemically induced DNT? ectively , it is uin vitro . Becausein vitro , this mein vitro . HoweverIn summary, we show that, in contrast to mNPCs, hNPCs are protected against PAH-induced DNT and that this difference may be explained by the absence of AhR in hNPCs. An accumulating body of evidence now indicates that human AhR signaling is less operative than AhR function in most laboratory animals. This knowledge should be taken into account for risk assessment of TCDD and related xenobiotics in humans."}
{"text": "About 90% of these lesions are benign and a reliable approach to their preoperative characterization is necessary. Unfortunately conventional thyroid scintigraphy does not allow the distinction among benign and malignant thyroid proliferations but it provides only functional information  and galectin-3 knockout tumors were used as targets in different experiments in vivo. 38 mice with tumor mass of about 1 gm were injected in the tail vein with 100 \u00b5Ci of 99mTc-labeled mAb to galectin-3 . Tumor images were acquired at 1 hr, 3 hrs, 6 hrs, 9 hrs and 24 hrs post injection by using the mini-gamma camera.The galectin-3 based thyroid immuno-scintigraphy uses as radiotracer a specific Results from different consecutive experiments show an optimal visualization of thyroid cancer xenografts between 6 and 9 hours from injection of the radiotracer. Galectin-3 negative tumors were not detected at all. At 6 hrs post-injection galectin-3 expressing tumors were correctly visualized, while the whole-body activity had essentially cleared.In vivo imaging of thyroid cancer may allow a better selection of patients referred to surgery. The possibility to apply this method for imaging and treatment of other galectin-3 expressing tumors is also discussed.These results demonstrate the possibility to distinguish preoperatively benign from malignant thyroid nodules by using a specific galectin-3 radio-immunotargeting.  The high prevalence of benign thyroid nodules in adult population makes the preoperative detection of thyroid cancer comparable to \u2018looking for a needle in a haystack\u2019. The prevalence of thyroid nodules increases with age, average 4\u20137% for the U.S.A. adult population hot nodules), the large majority of thyroid proliferations that fail to concentrate iodide (cold nodules) are biologically benign The expression of Sodium Iodide Symporter (NIS) on the membrane of the thyroid cells allows the thyroid gland to concentrate iodide from the serum. NIS-mediated iodide uptake is required for the subsequent organification and oxidation steps, which are key events for the production of thyroid hormones. This peculiar property of the gland supports conventional thyroid scintigraphy, which uses radioiodine in defining the thyroid gland in both physiological and pathological states via specific cDNA transfection generates a transformed phenotype, blocking the apoptotic program, a feature that favors the development of cancer in vivo and ex vivo experimental models of thyroid cancer we show the possibility to obtain a reliable thyroid cancer imaging in vivo by targeting the galectin-3 lectin molecule. This diagnostic approach may be also used for imaging different galectin-3 expressing tumors in vivo.Normally thyroid cells do not express galectin-3. A forced expression of galectin-3 in vivo and provides an useful model for setting experiments of galectin-3 immunotargeting with and without galectin-3 mRNA interference. Cells were cultured in standard conditions at 37\u00b0C and 5% CO2 atmosphere in RPMI-1640 medium supplemented with 2 mM glutamine, 10% FCS, penicillin and streptomycin .Thyroid carcinoma cell lines ARO, kindly provided by Dr. Silvia Soddu  was previously described CAACAGGAGAGTCATTGTTTTCAAGAGAAACAATGACTCTCCTGTTGTTTTTGGAAA-3\u20325\u2032-GATCCCC; CAACAGGAGAGT-CATTGTTTCTCTTGAAAACAATGACTCTCCTGTTGGGG-3\u20325\u2032-AGCTTTTCCAAAAA  ; ACCTTACATGTGTAAAGGTTTCAAGAGAACCTTTACACATGTAA-GGTTTTTTGGAAA-3\u2032GATCCCC ; and ACCTTAC-ATGTG TAAAGGTTCTCTTGAAACCTTTACACATGTAAGGTGGG-3\u20325\u2032-AGCTTTTCCAAAAA .For galectin-3 mRNA interference three different sequences were identified and tested as reported previously In the experiment shown in Down-regulation of Galectin-3 expression was checked in western blot analysis at different time points (12\u201372 hrs after transfection and tumour cells injection in mice).A purified horseradish-peroxidase conjugated (HRP-conjugated) rat monoclonal antibody to galectin-3  was used in immunohisto-cytochemistry according to the manufacturer's instructions as previously reported Total cell extracts (TCEs) were obtained using a lysis buffer composed by: Tris HCl 50 mM, NaCl 150 mM, Tween 20 1%, PMSF 1 mM and 1 tablet of complete protein inhibitor cocktail (Roche). An aliquot of TCE (30\u201370 \u00b5g) was separated in 10% SDS-PAGE, then blotted onto nitrocellulose membrane (BIO-RAD). The following antibodies were used in immunoblotting: a purified rat mAb to galectin-3 , a mouse mAb anti-\u03b1-tubulin  and HRP-conjugated anti-mouse IgG and anti-rat IgG specific antisera (Sigma). Immunoreactivity was detected by using chemo-luminescence analysis . The molecular species resolved in western blotting were finally analyzed by densitometry, using a dedicate software .Results are expressed as relative densitometry unit (rdu) after normalization with densitometry values of the band obtained for \u03b1-tubulin.(nu/nu) mice  were used for establishing thyroid cancer xenografts in vivo. Mice were kept in cages of 4 animals each with water and food ad libitum. Galectin-3 expressing and highly tumorigenic poorly differentiated follicular thyroid carcinoma cell line (ARO) and the derived galectin-3 knockout ARO cells  were considered for these experiments.Pathogen-free 4\u20135-week-old nude 6 to 107 cells /0.2 ml saline solution, depending by the experiment. Injection of the cells was performed by using a standard insulin needle.Wild-type and interfered ARO cells were maintained in standard culture conditions as aforementioned, detached from tissue culture plates with trypsin 0,05%-EDTA 0,02% (Gibco), washed in sterile PBS and injected subcutaneously into nude mice at a concentration ranging from 7\u00d710No anesthesia was necessary. Fifty animals were used in three different sets of experiments for establishing tumor xenografs. Mice were examined three times a week for signs of measurable tumor growth.in vivo imaging experiments when tumor weight was around 0.5\u20131 gm. To determine the in vivo expression of galectin-3 in tumor xenografts, some of the tumors were surgically excised and used for galectin-3 expression analysis as reported above. This work was performed according to the specific guidelines provided by the Italian Ministry of Public Health for the animal experimentation. This study has been approved by the Institutional Ethical Committee for animal experimentation at the National Cancer Institute Regina Elena of Rome. The animal facility at the NCI of Rome is certified by the Italian Ministry of Public Health.Mice were selected for 99mTcO4\u2212 freshly eluted from (99Mo/99mTc) generator . Labeling efficiency (LE) was assessed by using Instant Thin Layer Chromatography  with 0.9% NaCl as mobile phase.Affinity purified and highly concentrated (5 mg/ml) monoclonal antibody to human Galectin-3  was radio labeled by using the method previously reported ).The strips were analyzed by a computerized mini-radio scanner . LE, was >95% with a final specific activity of 70 \u00b5Ci/\u00b5g (99mTc for labeling (range 250.000\u22361 to 4.500.000\u22361).In order to optimize the efficiency of antibody labeling several experiments were performed varying the molar ratio 2-mercaptoethanol/mAb (range: 1.000\u22361 to 4.000\u22361) and the ratio mAb / 99mTc gave the highest LE of 99mTc-anti-Galectin-3 and were used for all further experiments .The reduction of disulfide bridges at a molar ratio of 2145\u22361 (2-mercaptoethanol /mAb) and a molar ratio of 1,500,000\u22361 for Ab/).Specific stability studies were performed incubating fresh radio labeled antibody in saline or human plasma at 37\u00b0 C for 24 hrs and evaluating the radiopharmaceutical purity by ITLC-SG at different time points . The stability in saline and plasma was high during the first 6 hours  with a slight decrease at 24 h  Position Sensitive Photo Multiplier Tube (PSPMT), charge readout electronics and a data acquisition system.The High Resolution gamma Camera (HRC) , shown in 2. The crystal dimensions are 2.05\u00d72.05\u00d75.0 mm3 and each crystal is covered by100 \u00b5m white reflective epoxy on his five blind surfaces. The crystal-collimator structure is coupled to the PSPMT via optical grease.The patented parallel hole collimator, already described 3 with an active area of 49.0\u00d749.0 mm2. The photocathode is bi-alkali and the multiplication system, composed by 12 metal channel dynodes, provides a gain of 3\u00d7106 @ \u22121000 V.The H8500 PSPMT has an external size of 52.0\u00d752.0\u00d718.0 mmThe multiplied charge is collected by an array of 8\u00d78 anodes.3) front-end electronics, and the signals are sampled with a dedicated compact USB ADC board. The acquisition system provides 4 channels at 20 M Samples/sec. Data acquisition and processing is performed on a Linux Embedded System equipped with ARM CPU PXA255 with 10\u2033 touch screen. The system control and data processing software are proprietary applications developed in C++ language. The system allows performing a real-time acquisition with a refresh time of 0.5 sec. The system is conceived to be a battery operated portable device; as a consequence the detector head weights about 2 kg while the overall weight is about 4.5 kg.The read-out is a miniaturized (52.0\u00d752.0\u00d75.0 mm99mTc) over the whole FOV. The sensitivity is 210 cps/MBq and the uniformity is \u00b15% while it provides 2.2 mm intrinsic spatial resolution suitable for our imaging experiments in vivo with tumour xenografted mice, and ex-vivo with surgical specimens derived from human patients.The HRC energy resolution is about 20% FWHM @ 140 keV  in saline solution with 1% HSA in presence or absence of 100 \u00b5g of unlabelled anti-Gal-3 antibodyAs a proof of concept for imaging differentiated thyroid cancer in human, we performed 99mTc-labeled mAb to galectin-3 in vivo, six animals bearing galectin-3 positive carcinoma xenografts  were considered in a preliminary experiment.In order to evaluate the binding specificity of a 99mTc-labeled mAb to galectin-3 . Images were acquired at 1 hr, 3 hrs, 6 hrs, 9 hrs and 24 hrs post-injection by using the mini-gamma camera. Galectin-3 immunotargeting of ARO tumors was highly efficient in xenografted mice. A central area of tumor necrosis  with impaired binding of the radiotracer was correctly depicted in one of the instances . Preliminary experiments with different galectin-3 positive tumors including melanomas, lymphoma and breast carcinomas were also considered for this purpose with overlapping results (data not shown). As expected, the majority of galectin-3 radio labeled antibody was concentrated in the liver according to the clearance of exogenous mAbs from the blood ). In order to optimize the imaging capture and to demonstrate the binding specificity of the galectin-3 mAb a larger in vivo experiment (repeated in triplicate) was considered.Mice with tumor mass of about 1 gm were injected in the tail vein (i.v.) with 100 \u00b5Ci of 6 cells/0.2 ml saline solution/mouse; the second group of mice was transplanted with galectin-3 knockout ARO cells , obtained by using a specific galectin-3 RNA interference (iRNA) The experiment included 12 xenografted mice, two groups of six animals each. The first group was transplanted with galectin-3 positive ARO cells at concentration of 5\u20138\u00d7107cells/0.2 ml saline solution/mouse, in order to promote a rapid tumor growth in vivo in about 4 days.ARO-Gal3 negative cells were injected subcutaneously at concentration of 10in vivo in absence of puromycine as selective antibiotic. Galectin-3 down-regulation in stable interfered ARO cells was checked in western blot at different time points (12\u201372 hrs). After 4 days from cell injection all the mice developed a visible subcutaneous tumor with a median diameter size of 0.5 cm. The animals were then injected in the tail vein with 100 \u00b5Ci of 99mTc-labeled mAb to galectin-3 (30 \u00b5g protein) and whole body images were acquired at 1 hr, 3 hrs, 6 hrs, 9 hrs and 24 hrs by using the high-resolution gamma camera.This was required for maintaining an efficient down-regulation of galectin-3 expression in stable interfered ARO cells, growing + xenografts was obtained between 6 and 9 hours from injection of the radiotracer, whereas galectin-3 negative tumors were not detected at all  over the implanted tumor and over the counter lateral muscle taken as background. As expected the optimal visualization of the ARO-Gal-399mTc-labeled mAb to galectin-3 (30 \u00b5g protein) and 5 groups of 4 animals each were sacrificed at 3 hrs, 6 hrs, 9 hrs, 12 hrs and 24 hrs post-injection, respectively.In a different set of experiments, 20 ARO xenografted mice were injected with 100 \u00b5Ci of in vivo bio-distribution of radio labeled galectin-3 mAb expressed as percentage of injected dose per gram of tissue (%ID/g), showed a rapid blood clearance of the radiopharmaceutical within 3 hours from injection. Most of the radioactivity was detected in the liver and kidneys indicating a prompt clearance of the tracer via the hepatic and urinary tract . The ry tract table 1.99mTc-labelled mAb increased from 3 to 9 hrs post-injection. At 6 hrs post-injection the target tumors were clearly visible while the whole-body activity had essentially cleared (and ).As expected the tumor uptake of the galectin-3 specific ex-vivo. To this aim a fresh cervical lymph node surgically excised from a patient bearing a papillary thyroid carcinoma metastasis , was used as target for studying the binding efficiency of the Gal-3 specific radiotracer.Although translation of these findings in the clinical setting will require the use of humanized mAbs linked to different radionuclides and more extensive preclinical studies, we attempted to simulate a galectin-3-based imaging of human thyroid cancer 99mTc-mAb to Galectin-3 (0.1 \u00b5g protein) and 1% human serum albumin, in presence or absence of 100 \u00b5g of unlabelled (cold) anti-galectin-3 mAb (displacement assay).Immediately after surgical removal the lymph node was cut in half through the cancer lesion and was incubated at 37\u00b0 C for 3 hrs in 50 ml saline solution containing 2 \u00b5Ci of After extensive washing in saline solution a comparative imaging of the two tissue preparations was performed. Results of this experiment are shown in The mini-gamma camera promptly detected the thyroid cancer metastasis (panel A), whereas a scanty tumor uptake of the radiotracer was visible in the control, due to the displacement effect of the cold mAb in excess (panel B).in vivo by using a galectin-3 specific radio-immunoscintigraphy. The use of galectin-3 radiotracer for detection of thyroid cancer in vivo is supported by a solid molecular rationale Altogether these results suggest the possibility to detect thyroid cancer and other galectin-3 expressing tumors 186Re, 177Lu or 90Y, 64Cu, 67Cu). A galectin-3 \u2018radiation targeted therapy\u2019 delivers the radiation dose specifically to the galectin-3 positive tumor with limited exposure of normal tissues. Penetration of beta- rays in living tissues is of several millimeters and the therapeutic effect may be obtained also in cancer cells that do not take up directly the radiopharmaceutical (cross-fire effect). This approach could be useful for both detection and treatment of micro papillary thyroid carcinomas , which are currently undetectable preoperatively.Combining galectin-3 imaging with thyroid FNA-cytology, in fact, may allow to distinguishing preoperatively benign from malignant thyroid proliferations with high efficiency. As a consequence many unnecessary thyroidectomies could be avoided and the clinical use of conventional thyroid scintigraphy with radio iodide, which only provides functional information on specific thyroid conditions, could be restricted to more selected clinical questions. Further studies which use humanized galectin-3 specific mAbs conjugated to different radionuclides will be necessary to confirm and validate these findings. If the proposed diagnostic approach will prove successful a targeted radio-ablation of galectin-3 expressing tumors might also be explored by using galectin-3 specific mAbs conjugated to different radio compounds  strips at different time points. The graph shows retention of technetium ranging between 100% and 85% during the first six hours (around 360 minutes) with a slight decrease from 6 to 24 hours (upper panel). The activity for radiolabel mAb anti galectin-3 has been assessed in a titration experiment. The best mAb/Tc ratio has been calculated by varying the activity of 99mTc added to a stable volume of reduced antibody. The labelling efficiency (LE) was evaluated by ITLC-SG. The optimal mAb/Tc ratio found was 1.200.000/1 corresponding to 30\u201340 mCi of activity and a labelling efficiency up to 95%. An activity exceeding this value did not increase the LE (lower panel B).(8.52 MB DOC)Click here for additional data file.Figure S2Tumor imaging in vivo by using 99mTc-labelled mAb to Galectin-3 and a high-resolution portable mini gamma camera. A) The high-resolution portable mini gamma camera used in this study. B) Image captured by the high-resolution gamma camera in a mouse bearing the galectin-3 positive thyroid carcinoma xenograft ARO, after 6 hrs from i.v. injection of 100 \u00b5Ci of 99mTc-labelled mAb to Galectin-3. The tumor confirmed at histology was 1.2 cm in diameter and showed a large central necrotic area corresponding to the lacuna that failed to fix the radiotracer (arrow).(10.39 MB DOC)Click here for additional data file."}
{"text": "Sir,P=0.05 level.I read with interest the article of In our opinion, the role of CD1 family molecules in antitumour immune responses, and in particular of CD1a, should be more debated, since its expression was recently described not only in monocyte-derived dendritic cells, but also in nonmesenchymal cytotypes, that is, epithelial cells (We recently described the immunoexpression of CD1a by metaplastic cells in a large series of Barrett's metaplasia, both gastric- and intestinal-type (Based on all these observations, we strongly recommend further studies on the antitumour role of CD1a and its potential role during immuno-surveillance, not only in invasive cancers but also during the carcinogenetic steps."}
{"text": "Recent reports indicate the existence of breast cancer cells expressing very high levels of the Arylhydrocarbon receptor (AhR), a ubiquitous intracellular receptor best known for mediating toxic action of dioxin and related pollutants. Positive correlation between the degree of AhR overexpression and states of increasing transformation of mammary epithelial cells appears to occur in the absence of any exogenous AhR ligands. These observations have raised many questions such as why and how AhR is overexpressed in breast cancer and its physiological roles in the progression to advanced carcinogenic transformation. To address those questions, we hypothesized that AhR overexpression occurs in cells experiencing deficiencies in normally required estrogen receptor (ER) signaling, and the basic role of AhR in such cases is to guide the affected cells to develop orchestrated cellular changes aimed at substituting the normal functions of ER. At the same time, the AhR serves as the mediator of the cell survival program in the absence of ER signaling.We subjected two lines of Michigan Cancer Foundation (MCF) mammary epithelial cells to 3 different types ER interacting agents for a number of passages and followed the changes in the expression of AhR mRNA. The resulting sublines were analyzed for phenotypical changes and unique molecular characteristics.MCF10AT1 cells continuously exposed to 17-beta-estradiol (E2) developed sub-lines that show AhR overexpression with the characteristic phenotype of increased proliferation, and distinct resistance to apoptosis. When these chemically selected cell lines were treated with a specific AhR antagonist, 3-methoxy-4-nitroflavone (MNF), both of the above abnormal cellular characteristics disappeared, indicating the pivotal role of AhR in expressing those cellular phenotypes. The most prominent molecular characteristics of these AhR overexpressing MCF cells were found to be overexpression of ErbB2 and COX-2. Furthermore, we could demonstrate that suppression of AhR functions through anti-AhR siRNA or MNF causes the recovery of ERalpha functions.One of the main causes for AhR overexpression in these MCF breast cancer cells appears to be the loss of ERalpha functions. This phenomenon is likely to be based on the mutually antagonistic relationship between ER and AhR. The arylhydrocarbon receptor (AhR), a ubiquitous basic Helix-Loop-Helix (bHLH) receptor expressed in various tissues in vertebrate species, is best known for its role in mediating the toxic actions of dioxin. On the molecular level it is known that: (a) dioxin binds to AhR, which exists in cytosol as a complex with a number of chaperone proteins, (b) the resulting dioxin-bound AhR migrates into nucleus where it forms a dimer with ARNT, another bHLH protein, (c) it is this dimer, which binds to the dioxin response element (DRE) on the promoters of the dioxin target genes, and (d) thereby causes induction of a number of detoxification enzymes. Tremendous efforts have been made in the past 25 years in elucidating the intricate molecular mechanisms through which this receptor accomplishes its tasks of inducing a number of detoxification enzymes and related proteins, particularly in the liver upon biding of dioxin and related environmental pollutants -3.in vivo in rats ATP (4000 Ci/mmol) was purchased from ICN . TCDD (>99.9% purity) was originally obtained from Dow Chemicals Co. 17-\u03b2-Estradiol (E2), and 4-OH-Tamoxifen (Tam) were obtained from Sigma-Aldrich Chemical Co. . \u03b2-hexachlorocyclohexane (\u03b2-HCH) was purchased from Chem Service , Parthenolide, Resveratrol, and AG879 were obtained from Calibiochem . 3xERE-TATA-luciferase cDNA was a kind gift from D. McDonnell  was a kind gift from Dr. Josef Abel Human recombinant EGF, serum and other media supplies were obtained from Gibco BRL . ATP (Amersham Life Sciences) and T4 polynucleotide kinase  according to the standard methods. DNA-protein-binding reactions were carried out in a total volume of 20 \u03bcl containing 15 \u03bcg of nuclear protein, 40,000 cpm of DNA oligonucleotide, 25 mM Tris buffer, pH 7.5, 50 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 0.5 mM dithiolthreitol, 5% glycerol, and 1 \u03bcg of poly (dI-dC). Supershift analysis was performed by adding 2 \u03bcg of monoclonal ARNT, polyclonal RelB (Active Motif), or polyclonal AhR  antibodies to the reaction mixtures. Competition experiments were performed in the presence of a 100-fold molar excess of unlabeled DNA fragments. The samples were incubated at room temperature for 20 min. Protein-DNA complexes were resolved on a 5% non-denaturating polyacrylamide gel and visualized by exposure of the dehydrated gels to x-ray films. In all cases each EMSA test was repeated more than two times to ascertain the reproducibility of the overall pattern of nuclear protein binding to the labeled oligonucleotides.Nuclear extracts were isolated from MCF10AT1 cells as described by to Dennler et al . In brie\u00ae, West Pico  as recommended by the manufacturer. For quantitative analysis, respective bands were quantified using a ChemiImager\u2122 4400 .A polyclonal anti-human AhR (SC-5579), a polyclonal antibody against human ACTIN (SC-1616), a horseradish peroxidase conjugated secondary antibody, and pre-stained standard markers (SC-2361) were obtained from Santa Cruz Biotechnology . Whole cell lysates (30 \u03bcg) were separated on a 10% SDS-polyacrylamide gel and blotted onto a PVDF membrane . The antigen-antibody complexes were visualized using the chemiluminescence substrate SuperSignal4/well). After 24 hrs, cells were washed once with PBS, and 1.6 ml of fresh serum/phenol red free growth medium was added before transfection complexes were applied drop by drop to the cells. Cells were transiently transfected for 16 hrs by using 10 \u03bcl per well Effectene  with 0.5 \u03bcg per well of respective luciferase reporter constructs of the 3 xERE-TATA promoter according to the manufacturer's instructions. The serum and phenol-red free media was then refreshed. After an additional 24 h incubation period, the cells were washed twice with PBS and lysed with 300 \u03bcl of passive lysis buffer. Luciferase activities were measured with the Luciferase Reporter Assay System  using a luminometer . Relative light units were normalized to protein concentration, using a Bradford dye assay (Bio-Rad). Experiments were repeated three times and three wells of cells were analyzed per experiment.For transient transfection experiments, cells were plated in 6-well culture plates  for 100 seconds and incubated at 37\u00b0C for 4 hrs. All media except for 200 \u03bcl was removed from each plate. Afterwards, 2 \u03bcl CaCl2(20 mM), 2 \u03bcl annexin V-fluorescein isothiocyanate  and 2 \u03bcl of propidium iodide (PI) solution (50 \u03bcg/ml) were added directly to each plate. The cells were gently mixed and incubated for 10 minutes at room temperature in the dark. Apoptotic cells were counted directly by using the fluorescence microscope . In each experiment, ten representative fields were counted for apoptosis assay. Both annexin V-positive and annexin V-PI-double-positive cells were considered to be apoptotic.Cells were seeded at 1 \u00d7 10t test at the significant level of P < 0.05.All quantitative experiments were repeated a minimum of three times and results are expressed as means \u00b1 standard deviations. Data were evaluated statistically by one-way ANOVA followed by Student's 2, 10 nM 4-hydroxy-tamoxifen, or 1 \u03bcM \u03b2-hexachlorohexane (\u03b2-HCH), an estrogenic pesticide, throughout a number of passages under our standard culture conditions using \"selection medium\" which was phenol red-free and contained heat-inactivated serum (2.5%) [2 associated tyrosine kinase, and 3-methoxy-4-nitroflavone (MNF), a specific antagonist to the Ah receptor (AhR) on those cells  or by \u03b2-HCH  of AhR overexpression in mammary epithelial cells, we began this project by exposing MCF10AT1 cells to three estrogen receptor interacting chemicals, 1 nM Em 2.5%) . After 2.5% . Aft2. Fortunately we have already conducted a similar experiments on MCF-7 cells which had been selected by the same set of agents utilizing essentially identical procedures for 35 generations [2-selected lines of MCF10AT1 and MCF-7  and \u03b2-HCH. A parallel assay on CYP1A1 expression, which is being used here as a marker for the functional activation of AhR, indicated that, while E2-selected ones (i.e. P35E and P20E for MCF-7 and MCF10AT1) still showed the highest expression among all sub-lines within each MCF cell group, \u03b2-HCH selected cells (as compared to \"mock\" selected control cells) exhibit also relatively higher expressions of the ratio of CYP1A1/AhR than Tam-selected ones. This set of data indicated that the level of induction of AhR is not exactly identical to that of CYP1A1, implying that the functional activation of AhR may be governed by a different set of cellular conditions or factors than its mRNA induction. Nevertheless, in both cases, E2-selected cell lines showed clearly the highest levels of AhR and CYP1A1 mRNA expressions among all selected lines. The observation that E2-selection in both MCF10AT1 and MCF-7 cell lines resulted in AhR overexpression and an increased proliferation indicates that estrogen signaling suppression might play a dominant role in these processes. In addition, these observations indicate some growth factor signaling such as that mediated by ErbB2 or their downstream signaling cascades are also likely to play important roles as well. As for the status of the estrogen receptor (ER), these two E2-selected cell lines show some different characteristics  was found to show a drastically low mRNA level of ER\u03b1, but E2-selected MCF10AT1 line (i.e. P20E) did not show such a decrease in the mRNA expression of ER\u03b1 as compared to the matched \"mock\"-selected control cell line (designated as P20C) (not shown). However, P20E MCF10AT1 cells showed no detectable level of expression of either progesterone receptor (PR) as in the case of P35E . Of great interest to this study was the differential upregulation of AhR and ErbB2 in cell lines selected by E2, 4-OH-tamoxifen and \u03b2-HCH respectively. The differences among them might represent different routes through which MCF10AT1 cells could be affected by these chemicals to develop transformation. An interim conclusion we have reached from this follow-up study are: (a) E2 selection resulted in the greatest up-regulation of AhR mRNA expression, (b) \u03b2-HCH, on the other hand, greatly increases mostly ErbB2 mRNA expression, and (c) 4-OH-tamoxifen produces an intermediate type of cells showing modest increases in the expression of both of these markers. These findings support our notion that AhR overexpression is a likely result of alteration of the status of the estrogen receptor as a result of exposure to excess E2 or to 4-OH-tamoxifen.In the case of ErbB20E and P20C cells. The results summarized in Table 20E cells both in the presence and the absence of exogenous heregulin (HRG). In addition, the anti-inflammatory agent parthenolide was also quite effective in suppressing proliferation. Resveratrol, which has both AhR antagonist [20E cells. To confirm the role of AhR on cell proliferation further, we have tested the effectiveness of two siRNA preparations -irradiation on cells maintained under a modestly serum-deprived culture conditions (i.e. 24 hrs serum deprivation)   Figure . This UVeviously , but mos) Figure . Each of20E and P20C cells both in the presence and the absence of MNF to gain insight to the differential contribution of AhR in expressing each of these marker expressions between these two cell lines. The results  expression was higher under fresh serum conditions than in serum starved conditions. On the other hand, the effects of serum or MNF on PI3K were not significant. This set of experiments established that the contributions of AhR to the expression of those selected markers are greatly affected by the condition of serum in culture medium. It appears at the same time, there are at least 2 different types of types of markers: (a) those expression is higher under fresh serum conditions (e.g. TGF-\u03b1 and HRG), and (b) those favor serum starved conditions (CYP1A1 and TGF\u03b21). The AhR dependency of those mRNA expressions, as judged by the blocking action of MNF, is mostly confined to P20E compared to P20C (except in the case of CYP1A1 and AhR under serum starved conditions), and is more noticeable under the condition where the given mRNA expression is high  than the conditions promoting low expression.At this stage we have decided to investigate the contributions of the overexpressed AhR on the expression of several diagnostic markers under both fresh serum (3 hrs after the medium change with fresh serum) and serum starved (72 hrs after the last medium change with serum). For this purpose we conducted additional qRT-PCR studies on the expression of selected mRNA markers in Pts Table  showed t20E cells under fresh serum conditions only. The results summarized in Table 20E cells were NOX-2 (NADPH oxidase 2), and NFkB. Two anti-inflammatory agents, NS389 (a COX-2 inhibitor) and quercetin  were used to assess the extent of their participation in causing the cellular state of inflammation. The result showed that, as expected, these two agents are reasonably effective in suppressing the expression of NF\u03baB. In addition, they generally reduced the expression of other markers to roughly the similar extents as those achieved by MNF. These findings support the rationale of selecting these mRNAs as the markers for inflammation. They also indicated that the expression of these markers are definitely higher in P20E than in P20C, and that, judging by the suppressive effect of MNF, AhR contributes to their increase expression to certain extent.One of the characteristic functions of AhR is to mediate the action of dioxin to induce cellular inflammatory responses . Prelimi20C and P20E cells under fresh serum (6 hrs after medium change with fresh serum) and serum starved (72 hrs after the last serum change/24 hours since last media change) conditions. In addition, as a positive control, the effect of TCDD (10 nM) was also determined under these conditions to confirm the presence of the AhR:ARNT-DRE complex. The results in Figure 20E cells than those prepared from \"mock-selected\" P20C cells. This observation indicates that these DRE binding proteins (likely including AhR) are functionally active in terms of their DRE binding even without the presence of the exogenously added ligand under this test condition. Thus, in this system, overexpressed AhR confers P20E cells the additional influence of functionally active AhR over that is found in P20C. Interestingly the effect of TCDD appears to be more pronounce in cells under serum starved conditions, while the extent of protein binding to the DRE sequence in the absence of TCDD is actually higher in serum fresh conditions than starved conditions. This finding suggests that under fresh serum conditions the level of constitutively activated AhR function in P20E, even in the absence of exogenously added ligands, is already very high (i.e. higher than that is found in P20C exposed to 10 nM of TCDD). To test the specificity of AhR functionality, gel-shift (i.e. supershift) assays were performed onP20C and P20E cells under fresh serum conditions  reporter plasmid transfection approach. The result  or that against ARNT (a required dimerization partner for the AhR target gene activation) clearly caused up-regulation of the luciferase expression, indicating that AhR and its dimer with ARNT work antagonistic to the nuclear transcription factors (likely including the ER) binding to ERE as positive regulators.In view of the lack of the difference in the level of expression of ER\u03b1 protein between these two cell lines, we hypothesized that the actual difference may be in the function of ER\u03b1 itself. To test this hypothesis, we assessed the levels of estrogen response element (ERE)-mediated gene expression in Pt Figure  clearly 20E) as well as in MCF-7(P35E) cells, E2 was the most effective agent, among tested in terms of eliciting AhR overexpression, and (b) E2 selection resulted in transformed cells with a phenotypic expression of the increased cell proliferation in both cell lines. The above finding suggests that the estrogen receptor (ER) is likely involved in this process of AhR up-regulation at least in these cell lines under our test conditions. In the case of MCF-7 cells we found the mRNA expression of ER\u03b1 itself in E2-selected cells (P35E) is totally suppressed. On the other hand in the case of E2-selected MCF10AT1 cells (P20E) the extent of down-regulation of expression of ER\u03b1 mRNA, in comparison to P20C cells, was not relatively modest. Instead we found that the level of mRNA expressions of progesterone receptor (PR) and PS2, both estrogen receptor element (ERE) controlled proteins, were very low, indicating possibly that the function of the ER\u03b1 is impaired in P20E as a result of its overexpression of AhR. In this regard, the results of ERE-Luciferase (ERE-Luc) assays . In other words, even the remaining AhR still expressed in P20E cells is powerful enough to keep the expression of the ERE-target genes suppressed. An alternate possibility is that there is another factor other than AhR which makes the functional activation of ERE less effective in P20E cells than in P20C. The third possibility, which is even less likely, is that the transfection efficiency of these cells with the ERE-Luc plasmid was compromised due to molecular differences between the two sublines. Nevertheless, the main conclusion derived from these experiments that the functions of ER\u03b1 and ERE are reduced in P20E cells in comparison to P20C is still firm, clearly supporting our conclusion.Our main strategy for the current study has been first to identify the most likely cause for these MCF breast cancer cells to overexpress AhR by checking the effectiveness of three estrogenic agents in stimulating the expression of AhR for a number of passages, and second to identify phenotypic signs of transformation along the process of selecting those cells by these agents. This approach has yielded two major tangible results: (a) in our main study cell lines, MCF10AT1 , we decided to study MCF10AT1 as our main cellular model in examining this phenomenon of AhR overexpression in more detail. In this regard, the most noticeable finding of the current study has been that AhR overexpression through E2-selection is accompanied with increased cell proliferation in both MCF cells lines. This observation merits special attention, since increased cell proliferation is clearly one of the major phenotypic expressions of advanced transformation of mammary epithelial cells. The most significant pieces of evidence procured for the critical contribution of AhR in helping P20E cells to express the above transformation characteristics were first, the effectiveness of MNF, a specific blocker of AhR and second, that of siRNA against AhR in effectively suppressing cell proliferation of P20E cells. Thus, by this approach we could satisfactorily meet the second objective of this project to unequivocally show, at least in one case, that AhR indeed contributes significantly to the progression of transformation of mammary epithelial cells. To support the above diagnosis of the influence of AhR on progression of cellular transformation, we have further conducted the apoptosis resistance study, which clearly showed that AhR overexpression is intimately associated with the phenotypic expression of apoptosis resistance in P20E cells.The second major objective has been to find the effect of the overexpressed AhR on the increased expression of at least one phenotype indicating the AhR-dependent progression to more advanced state of transformation. It must be noted that MCF-7 Pferation . These cferation . Since m20E and P20C, on the other hand (Table 20E cells is still based on this circumstantial evidence only, and therefore this subject still remains to be resolved in the future.The third topic needing discussion is the relationship between AhR overexpression in these cells and their inflammatory status. The extent of contribution AhR on the expression of these inflammation markers was assessed by the effectiveness of MNF in reducing the mRNA expression of those markers Table . However20E cells are functionally active even without exogenous ligands (e.g. see Figure One final topic needing a brief discussion is how the elevated AhR in MCF cells becomes functionally activated even without addition of exogenous ligands. It must be pointed out that we avoided the use of typical ligands such as TCDD throughout this study (except in Figure 2-selection causes induction of AhR overexpression in two MCF breast cancer cell lines, and that such a phenomenon is accompanied with increased cell proliferation that is significantly dependent on the presence of AhR. The evidence suggests that the basic cause for up-regulation of AhR by E2-selection is related to the E2-induced down-regulation of either expression of ER\u03b1 as in the case of MCF-7 cells, or the loss of the function of estrogen responsiveness in MCF10AT1 cells.We could clearly establish in the current study that E2: 17-\u03b2-estradiol; ERE: Estrogen Response Element; HRG: heregulin; MCF: Michigan Cancer Foundation; MNF: 3-methoxy-4-nitroflavone; qRT-PCR: quantitative-Real-Time \u2013 Polymerize Chain Reaction; TCDD: 2,3,7,8-Tetrachlorodibenzo-p-Dioxin.AhR: Arylhydrocarbon Receptor; ARNT: Arylhydrocarbon nuclear transferase; DRE: dioxin response element; EMSA: Electrophoretic Mobility Shift Assay; ER: estrogen receptor; EThe authors declare that they have no competing interests.This study was conceived jointly by both PSW and FM. PSW was responsible for experimental design and completion of all laboratory work unless noted contained in this article. EMSA data Figure  was compThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/234/prepub"}
{"text": "Liver microsomes of the rat contain a group of hydroxylating enzymes which are coupled to a greater or lesser degree to the electron flow system. In our studies, enzymes believed to be directly associated with the electron flow chain of NADPH, ferricyanide reduction, cytochrome c, cytochrome P-450 and substrate hydroxylation have been observed in livers obtained from normal, tumor-bearing and whole body irradiated rats as well as in Morris hepatoma 7777 and dimethyl-amino-biphenyl induced breast tumors.5 were decreased in the tumor-bearing animal.A significant difference appeared to exist in the activity of NADPH oxidase, NADP-ferricyanide reductase and benzopyrene hydroxylase when normal liver was compared with the liver obtained from a breast-tumor-bearing animal. Both cytochrome P-450 and cytochrome bTissue distribution of benzopyrene hydroxylase in normal, lactating and tumor-bearing Wistar rats has been studied.With the exception of NADPH oxidase, the activities of NADP-cytochrome c reductase, NADPH-ferricyanide reductase, benzopyrene hydroxylase and P-450 were markedly different in liver from Morris hepatoma 7777-bearing Buffalo rat when this was compared with homologous tissue obtained from normal Buffalo rat.Whole-body irradiated animals showed increased P-450 and NADPH oxidase activity in liver as a function of irradiation and there further appeared to be a correlation with decreased ferricyanide reductase activity."}
{"text": "We appreciate the helpful comments by Dr. Rogers but with all due respect there are a number of problematic issues with his remarks on our most recent publication . Firstlyet. al, 2011[et. al, 2012 (n\u2009=\u2009349) because it is different project and time setting. Pethlert project was run after Insawang project. Not all participants in Insawang project were recruited into Pethlert project. Though the participants were the same group, some participants did not meet the requirements of Pethlert project such as unavailable during study period, did not return the informed consent, the levels of daily alcoholic drinking were exceeded the criteria of non-alcoholic fatty liver. Therefore, the number of Pethlert project is less than Insawang project.1) The number of participants (n\u2009=\u2009315) in Pethlert  al, 2011 is not t2) Commercial MSG is always available and is not expensive for villagers to obtain it. Normally, only one person preparing food for family and that is the key person for MSG consumption in the family. We gave enough information to participants including key persons about the use and the objective of MSG measurement. Participants knew that it doesn\u2019t matter how much the MSG left in the provided box, it will belong to them after 10-day of study. Therefore, it is unlikely that individuals use more MSG than usual because it is free.3) Nowadays, it becomes a nuclear family in Thailand, including the area of study. Some families do not have children below 10\u00a0years old; however, some families have one or two children. Families usually prepare a special meal for young children by avoiding chili, MSG, salty or any spicy ingredients. Thus, it is not suitable to divide the MSG consumption in each family by number of all family members which may include infant, toddler, or pre-school children. Therefore, we excluded children under 10 for more reasonable calculation of individuals MSG consumption.4) The association of the median and percentage values of the five criteria of ATP III individually and MSG intake were not observed in our study. This is probably due to the small number in sample size. However, when combined the metabolic disorders as a cluster, the association was found. Every 1-g of MSG intake significantly increased the risk of having metabolic syndrome with the odds ratio of 1.14. In other word, the estimated risk of having metabolic syndrome increased 1.14 fold for each gram of daily MSG consumption. If a person consumed MSG 5\u00a0g/day the estimated risk of having metabolic syndrome would be increased 5.7 fold. Therefore, it shall not classify as very week association.5) It is barely to find non-MSG users in the area of study. Moreover, it is hard to identify a person with non-MSG user because if he/she eats out or buys food from retailer or restaurant; generally he/she cannot avoid MSG exposure. Therefore, non-MSG users were not included in our study.Finally, we note that none of the investigators in our paper has any industrial or personal disclosure.We submit that MSG poses a host risk in susceptible individuals and that further data is needed to define those at risk."}
{"text": "Our aim was to determine whether individuals with asthma and elevated circulating eosinophils express signs of different regulatory immune mechanisms compared with asthmatics with low blood eosinophils and non-asthmatic control subjects. In addition, determine the relationship between eosinophilia and circulating Th cell subsets.The immune process driving eosinophilic and non-eosinophilic asthma is likely driven by different subsets of T helper (Th) cells. Recently, in vitro stimulation with anti-CD3/anti-CD28 there was a significant increase of single expressing GATA-3+ and co-expressing T-bet+GATA-3+ cells in the EOS high asthmatics in comparison with control subjects. In addition, T-bet\u2212GATA-3+ROR\u03b3t+FOXP3+ were decreased in comparison to the EOS low asthmatics. Finally, in a group of control subjects we found that the majority of proliferating Th cells (CD4+CD25+Ki67+) expressed three or four transcription factors.Participants were selected from a random epidemiological cohort, the West Sweden Asthma Study. Immunophenotypes of fresh peripheral blood cells obtained from stable asthmatics, with and without elevated eosinophilic inflammation (EOS high and EOS low respectively) and control subjects, were determined by flow cytometry. No differences in the number of Th1 (T-bet), Th2 (GATA-3), Th17 (ROR\u03b3t) or Treg (FOXP3) cells were observed between the groups when analysing each subset separately. However, in all groups, each of the Th subsets showed expression of additional canonical transcription factors T-bet, GATA-3, ROR\u03b3t and FOXP3. Furthermore, by in vivo.The ability of human Th cells to express several regulatory transcription factors suggests that these cells may display plasticity  Asthma is a heterogeneous disease; patients express different phenotypes and have differences in severity, natural history, and response to treatment in vitro studies to suggest that Th cell subsets are not irreversibly differentiated, but can exhibit plasticity by changing transcription factor expression or by expressing multiple transcription factors In addition to the well characterised T regulatory (Tregs) cells and T helper (Th) cells, such as Th1 and Th2, new effector cells, including Th17, Th9 and Th22 have been identified in the last few years Our hypothesis was that patients with a specific asthma endotype could be distinguished by the immunological profile of their circulating Th cells. Therefore, we compared the absolute numbers of circulating Th cells expressing the transcription factors, T-bet, GATA-3, ROR\u03b3t and FOXP3, in two groups of asthmatics. All participants, both asthmatics and healthy subjects, were selected from an epidemiologically based asthma cohort study, the West Sweden Asthma Study. The asthmatics displayed similar clinical disease profiles, but with distinct differences in the number of circulating eosinophils, and were compared to healthy subjects.1 reversibility greater than 12%. The skin prick test (SPT) was performed using a standard panel of 11 inhalant allergens composed of birch, mugwort, timothy, horse, dog, cat, cockroach, Cladosporium, Alternaria, Dermatophagoides farinae and D. pteronyssinus . The SPT test was considered positive with a wheal and flare reaction \u22653mm for at least one allergen. Asthmatics were considered to have high numbers of eosinophils if blood eosinophils were \u22650.3\u00d7109/L and low eosinophils if values were \u22640.2\u00d7109/L. Control subjects did not report asthma symptoms, were non-reactive to methacholine or non-reversible, were SPT negative and had a low number of blood eosinophils. All participants were non-smokers.Study participants were selected from questionnaire respondents in the West Sweden Asthma Study (aged 16\u201375 years) who attended a detailed clinical examination at the Krefting Research Centre, Gothenburg, Sweden and for whom clinical data was available (Visit 1) i.e. NSAIDs). The time period separating Visit 1 and Visit 2 ranged between 3 months to 2 years.The study population consisted of 11 asthmatics with high blood eosinophils (EOS high group), 12 asthmatics with low blood eosinophils (EOS low group) and 9 non-asthmatic healthy controls (control group). Participants were recruited in two separate blocks either during winter time (December to February) or during spring time (April to early June). During a clinical visit (Visit 2) blood samples, nasal lavage (NAL) and induced sputum were collected in addition to spirometry and fractional exhaled nitric oxide (FeNO) measurements were taken. During four weeks prior to Visit 2, none of the subjects had received any vaccination, changed their asthma medication, had any worsening of asthma symptoms, reported any symptoms of infection/cold, had any surgery, had any antibiotics, had any new medication, or had any anti-inflammatory medication .Peripheral whole blood cells were stained for flow cytometry within 1 hour of sampling. The total cell count was obtained using Trucount\u2122 tubes  together with antibodies (Ab) detecting CD45/CD3/CD4 or CD45/CD3/CD4/CD14/CD19 according to manufacturer\u2019s protocol. Additionally, the following Ab panels were used: a) CD4/CD25/T-bet/GATA-3/ROR\u03b3t/FOXP3 with or without CD3, b) CD45RO/CD45RA/CD3/T cell receptor (TCR)\u03b1\u03b2/TCR\u03b3\u03b4/CD4/CD8, c) CD45/CD56/CD16/CD19/CD14, d) CD4/CD25/Ki-67/T-bet/GATA-3/ROR\u03b3t and e) CD4/CD25/Ki-67/T-bet/ROR\u03b3t/FOXP3. All monoclonal antibodies were purchased from BD Biosciences, eBioscience or Invitrogen  were isolated by density centrifugation using Ficoll-Paque\u2122  and cultured in serum-free AIM-V\u00ae + AlbuMAX\u00ae medium  alone or in plates pre-coated with anti-CD3/anti-CD28 antibodies  for 48 hours, before flow cytometry staining with antibody panel A (see above). Cell viability was analysed using 7AAD exclusion in the forward scatter-side scatter (FSC-SSC) gate. Cell viability was >96% (range 96.3\u201399.1%) in cells harvested from medium alone and >88% (range 88.4\u201395.8%) in cells harvested from anti-CD3/anti-CD28 coated wells.i.e. controls containing all markers except the one of interest were used to set gates  and data were analyzed with FlowJo software . Gating of transcription factors and surface markers were determined using control samples by the Fluorescence Minus One (FMO) approach et gates .Cells from induced sputum and NAL were stained with May-Gr\u00fcnwald and Giemsa  and counted using a Zeiss Axioplan microscope  and stained with the following combinations: a) T-bet/GATA-3, b) FOXP3/GATA-3, c) T-bet/ROR\u03b3t and d) FOXP3/ROR\u03b3t. The detection signal was enhanced using fluorochrome-conjugated secondary antibodies . CytospiData were tested for adherence to a normal distribution with the Kolmogorov-Smirnov test . If a normal distribution of sample means could be assumed, unpaired test or paired t-test was used; otherwise the Kruskal-Wallis test followed by the Mann-Whitney U test were applied. Values in tables and graphs are mean\u00b1SEM, except in scatter plot graphs where median values are given. Correlations were performed using Pearson correlation test. Values of p<0.05 were considered statistically significant.Clinical characteristics and standard hospital laboratory measurements were similar between the study groups, except for a higher number of eosinophils in the blood in the EOS high group compared with the EOS low and control groups p<0.001; . No diff+CD25+ cells and the expression of the transcription factors T-bet, GATA-3, ROR\u03b3t and FOXP3 was analysed in the groups. The total number of CD4+CD25+ T cells did not differ between the groups , T-bet/ROR\u03b3t (ex vivo), FOXP3/GATA-3 (ex vivo) and FOXP3/ROR\u03b3t (ex vivo).To confirm the flow cytometry data of co-expression of transcription factors in CD4t/GATA-3 , ex vivoet/ROR\u03b3t , ex vivo3/GATA-3 , ex vivoP3/ROR\u03b3t , ex vivoin vitro stimulation of the cells could change the co-expression pattern of transcription factors, PBMCs taken from all groups during winter time were cultured with a combination of anti-CD3 and anti-CD28 antibodies. After 48 hours, cells were harvested and stained for co-expression of T-bet, GATA-3, ROR\u03b3t and FOXP3. The number of cells expressing multiple and single transcription factors was expressed as a percentage of the total CD4+ T cell count and the effect of stimulation compared with medium alone. A sub analysis showed that most Th subsets increased after stimulation compared to medium alone but not all , T-bet/ROR\u03b3t (in vitro), and FOXP3/GATA-3 (in vitro) and FOXP3/ROR\u03b3t (in vitro) in CD4+ cells both from stimulated cells as well as in medium alone treated cells. However, in the medium alone treated samples, co-expressing cells were fewer overall than in the stimulated samples.To determine if  not all . Single um alone . Three sow group . Non-spe+CD25+ cells in Panel D and 7.44% of CD4+CD25+ cells in Panel E comprise of Ki-67+ cells  between any cell subset and any of the clinical parameters was single expressing GATA-3+ cells versus FEV1 reversibility. In addition, two more GATA-3 subsets, T-bet+GATA-3+ and T-bet+GATA-3+FOXP3+, showed correlation to FEV1 reversibility -17+ cells expressing ROR\u03b3t still showed suppressive function in vitro+IL-17+IL-13+IL-4+ cells co-expressed ROR\u03b3t and GATA-3 after local or systemic immunization with inflammatory dendritic cells Sub-analysis of the T-bet, GATA-3, FOXP3, and ROR\u03b3t cell populations, enabled up to 15 different populations to be defined. These populations expressed single transcription factors or up to four transcription factors, arguing for the presence of Th cell plasticity in humans as has been earlier proposed from animal models or +CD25high cells that expressed FOXP3 and did not address the co-expression with others transcription factors The only subset that was different after sub-analysis was single FOXP3 cells, which was increased only in EOS high asthmatics compared to controls. Increased Tregs in asthmatics has previously been shown in vitro, a substantial increase in the number of Th cells expressing multiple transcription factors was observed. Moreover, only a small percentage of stimulated cells were found to express a single transcription factor. This strongly argues that circulating Th cells, expressing a master regulatory transcription factor such as GATA-3 also have the capacity to express additional transcription factors upon further stimulation. The question remains unanswered, of whether Th cells that co-express multiple transcription factors are undergoing lineage commitment, or whether an already committed cell can express multiple master transcription factors  showing CD4+CD25+ cells gated for T-bet (Th1), GATA-3 (Th2), ROR\u03b3t (Th17) and FOXP3 (Treg). One individual from each group is presented in the top three rows. In the final row, the fluorescence minus one (FMO) control used for analyses is shown.(TIF)Click here for additional data file.Figure S2Technical controls for confocal microscopy. Z sectioning is not performed on the following samples. Micrographs of ex vivo samples: 1) Only DAPI staining; 2) DAPI/mIgG1isotype control (IC)/Goat anti-mouse IgG-AF555; 3) DAPI/ratIgG2a IC/Goat anti-rat IgG-AF488; 4) DAPI/ratIgG2b IC/Goat anti-rat IgG-AF488; 5) DAPI/No primary antibody/Goat anti-mouse IgG-AF555/Goat anti-rat IgG-AF488; 6) DAPI/mouse anti-human FOXP3/Goat anti-mouse IgG-AF555; 7) DAPI/mouse anti-human T-bet/Goat anti-mouse IgG-AF555; 8) DAPI/Rat anti-human GATA-3/Goat anti-rat IgG-AF488; 9) DAPI/Rat anti-human ROR\u03b3t/Goat anti-rat IgG-AF488; Micrographs of in vitro samples: 10) DAPI/mIgG1IC/Goat anti-mouse IgG-AF555 ; 11) DAPI/mIgG1IC/Goat anti-mouse IgG-AF555 (stimulated); 12) DAPI/ratIgG2a IC/Goat anti-rat IgG-AF488 (medium); 13) DAPI/ratIgG2a IC/Goat anti-rat IgG-AF488 (stim.); 14) DAPI/ratIgG2b IC/Goat anti-rat IgG-AF488 (medium); 15) DAPI/ratIgG2b IC/Goat anti-rat IgG-AF488 (stim.); 16) DAPI/No primary antibody/Goat anti-mouse IgG-AF555/Goat anti-rat IgG-AF488 (medium); 17) DAPI/No primary antibody/Goat anti-mouse IgG-AF555/Goat anti-rat IgG-AF488 (stim.); 18) DAPI/mouse anti-human FOXP3/Goat anti-mouse IgG-AF555 (medium); 19) DAPI/mouse anti-human FOXP3/Goat anti-mouse IgG-AF555 (stim.); 20) DAPI/mouse anti-human T-bet/Goat anti-mouse IgG-AF555 (medium); 21) DAPI/mouse anti-human T-bet/Goat anti-mouse IgG-AF555 (stim.); 22) DAPI/Rat anti-human GATA-3/Goat anti-rat IgG-AF488 (medium); 23) DAPI/Rat anti-human GATA-3/Goat anti-rat IgG-AF488 (stim.); 24) DAPI/Rat anti-human ROR\u03b3t/Goat anti-rat IgG-AF488 (medium); 25) DAPI/Rat anti-human ROR\u03b3t/Goat anti-rat IgG-AF488 (stim.).(TIF)Click here for additional data file.Table S1Experimental laboratory data.(DOCX)Click here for additional data file.Table S2Fold change expression of in vitro transcription factors.(DOCX)Click here for additional data file.Table S3Antibodies used in the study.(DOC)Click here for additional data file.Methods S1Sputum induction and processing.(DOC)Click here for additional data file."}
{"text": "The recurrence rate of periocular nodular basal cell carcinoma (PNBCC) following treatment with imiquimod (IMQ) has not yet been established. Previous studies did not include histological follow-up. The aim of this analysis was to evaluate the efficacy of topical immunotherapy with 5% IMQ cream for the treatment of PNBCC.Study design: A prospective, non-randomized, and uncontrolled longitudinal case series study. No participants were blinded. Punch biopsy confirmed PNBCC patients were included at the Ophthalmology Clinic of S\u00e3o Paulo University Medicine School Hospital (from 2008 to 2012). Patients were treated with 5% IMQ cream once a day, 5\u00a0days per week, for 8\u201316 weeks. Standard lesion photographic documentation was done during the study. Three months after treatment ended, an image-guided biopsy was performed. Patients were followed at 6-month intervals and annually for control biopsies. Main outcome measures were clinical and histological clearance rates. Data were analysed by frequency distribution for qualitative group characteristics and central tendency measures for quantitative data.Twenty-four patients met the inclusion criteria, 19 of whom remained until the end of treatment. The histological clearance rate was 89.5% and 84.2%, respectively, at 3 and 39.5\u00a0months. The 3-year histological clearance rate was 81.8% (9/11) for lesions >10\u00a0mm, and 100% (8/8) for lesions <10\u00a0mm. Three patients did not tolerate the side effects of the medication and left the study. Two patients were excluded for treatment interruption related to comorbidities.Our results indicated that 5% IMQ cream was a useful alternative treatment for NBBCC, especially for lesions <10\u00a0mm. IMQ also showed a significant neoadjuvant effect on lesions >10\u00a0mm.NCT 00803907.ClinicalTrial.gov Registration Dec 3, 2008: # The incidence of basal cell carcinoma (BCC), the most common human neoplasm, has increased significantly worldwide over the past few years ,2. More BCC is the main cause of required reconstructive surgery in the periocular region. For facial BCC, Mohs surgery is considered the method with the best chance of cure, with 5-year recurrence rates of up to 6.5% [For cases in which surgery is not possible , topical immunotherapy may be an alternative. Imiquimod (IMQ), an immune modulator, acts by stimulating innate and adaptive immunity and by inducing apoptosis in tumour cells . The ideIMQ use, as an alternative treatment for periocular BCC, was suggested using results from a small case series with an almost 100% reported cure rate -11. HoweThe purpose of the present study was therefore to evaluate clinically and histologically the effects of 5% topical IMQ cream on PNBCC by evaluating for residual tumour rate and recurrence.This was an interventional prospective, non-randomized, and uncontrolled longitudinal case series study, conducted between 2008 and 2012. The study followed the tenets of the Declaration of Helsinki, and was approved by the University of S\u00e3o Paulo Medical School Hospital Institutional Review Board Ethics Committee. All participants gave their informed consent. The ClinicalTrial.gov number was NCT00803907.Patients with periocular biopsy diagnosed as NBCC were included in this study. We limited eyelid margin lesions up to 20\u00a0mm, and medial canthus lesions up to 30\u00a0mm (largest diameter), with no infiltrating deeper tissues on palpation. All lesions had not had prior treatment. Recurrent BCC lesions and patients with clinical signs of orbit invasion were excluded. Uncooperative patients with no caregiver assistance to correctly apply the medication were also excluded.http://www.nss.gov.au/nss/home.nsf/). All patients were submitted to IMQ cream treatment. No participants were blinded.Main outcome measures were clinical and histological clearance rates. To detect a histological tumour clearance rate of 50% at 3\u00a0months, with a 5% significance level and 95% confidence, a sample size of 22 patients was necessary, given an anticipated dropout rate of 10%  was applied once each day at bedtime. To ensure patient safety, we instructed patients and caregivers (or relatives) to use lubricating gel in the conjunctival sac before IMQ cream application. We stressed the correct medication application, using a swab, and taking care to keep the border of the eyelid away from the eye. The cream remained in contact with the tumour for 8 to 10\u00a0hours. In the morning, the periocular area was washed with neutral liquid soap. In cases of accidental contact with the ocular surface and conjunctiva, the patient was instructed to wash abundantly with saline solution and apply lubricating eye gel.Artificial tears were prescribed and provided free of charge to the patients, for application every 6\u00a0hours during the day. IMQ was used once each day, 5\u00a0days a week, for a minimum of 8\u00a0weeks and a maximum of 16\u00a0weeks. Within this period, treatment was discontinued once the lesion became undetectable by slit lamp examination and palpation.During the treatment period, patients were followed biweekly and information was collected through questionnaires, slit lamp examinations, visual acuity testing, photography, and measurement of lesions, using Image J software (version 1.42) .Baseline measurements were obtained from photographs taken after the initial biopsy so that the amount of tissue removed would not influence the results. The final measurements were based on photographs taken 3\u00a0months (12\u00a0weeks) after treatment end.We used 2-mm trephine for all biopsies. An image-guided biopsy of the region was performed 3\u00a0months (12\u00a0weeks) after treatment. Patients with clinical or histological findings of residual lesions were referred for surgical excision and reconstruction. Patients were followed at 6-month intervals, with annual control biopsies.Data were analysed by frequency distribution for qualitative group characteristics and central tendency measures for quantitative data.Throughout the study, 24 patients met the inclusion criteria, 19 of whom remained until the end of treatment. Patients were recruited until December 2012 when the required sample size was obtained. Three patients did not tolerate the side effects of the medication and left the study. One patient suffered an ischemic cerebrovascular accident, and one patient died during the treatment period. Both cases were associated with previous diseases and high surgical risk  interrupted treatment for 2\u00a0weeks because of intense local inflammation associated with systemic symptoms. This patient was also the only patient who experienced tumour recurrence, as confirmed by biopsy 2\u00a0years after treatment , followed by keratitis (84%), foreign body sensation (79%), lacrimation (58%), low visual acuity (53%), and ectropion (37%). Treatment consisted of frequent lubrication with eye drops. All patients presented with some degree of skin reaction such as hyperaemia, crusting, ulceration, and bleeding during treatment. No medication was prescribed except for cold compresses. No side effects were permanent and all were resolved after the end of treatment.The current investigation confirmed several previous studies reporting favourable results with IMQ ,13 and sPrevious PNBCC studies reported treatments lasting 6\u00a0weeks, at seven applications per week and with 71% efficacy, and 50\u201359% efficacy with three applications ,16. HoweIn the present study, 57.9% (11/19) of the patients had lesions >10\u00a0mm. Interestingly, the 3-year histological clearance rate was 81.8% (9/11) for lesions >10\u00a0mm, and 100% (8/8) for lesions <10\u00a0mm. Eigentler et al. obtained the best results in smaller lesions , and observed that the larger the tumour, the less efficacious the medication and the longer the required treatment [Thus, a treatment duration of 6\u00a0weeks was reported to be a negative prognostic factor in the treatment of periocular lesions larger than 10\u00a0mm . This fiOnly two of our patients had partial tumour clearance. Both had lesions larger than 10\u00a0mm, and in both cases the medication had a neoadjuvant effect, significantly reducing tumour size and thereby facilitating surgery  measured 13.5\u00a0mm. Adding a 2-mm safety margin on each side, an area equivalent to half the eyelid (17.5\u00a0mm), would have required reconstruction of the eyelid. After treatment with 5% IMQ cream, the diameter was reduced to 4.2\u00a0mm. Including the safety margin, the area to be reconstructed (8.2\u00a0mm) was less than one third the size of the eyelid. In this patient the safety margins were free and the lesion was submitted to pentagonal excision, cantholysis, and closure.Lesion 8  was reduced from 27.2\u00a0mm to 7.6\u00a0mm. Thus, instead of performing a complex surgery with glabellar flap rotation and advancement, the patient was submitted to simple excision and direct closure of the tumour-free surgical margins.The patient with lesion 12 interrupted the treatment for 2\u00a0weeks because of intense local inflammation mimicking preseptal cellulitis, but systemic symptoms were also observed, especially diarrhoea. The interruption may have influenced the evolution because this was the only patient with recurrence of BCC  .Despite longer treatment, our patients had only minor ocular symptoms  and no permanent eye damage was observed. Cannon et al., in a retrospective study, described conjunctivitis and eye burning sensation as the most common symptoms during treatment of periocular lesions, despite the fact that only three in a sample of 47 patients had periocular BCC, and IMQ was administered three times per week for 4\u20136 weeks . All symThe main limitation of the present study was the lack of a comparative group . Regarding generalization to other cases, our cases consisted of primary PNBCC lesions without signs of deep infiltration or orbit invasion, therefore it was a limited group of patients.Although surgical excision remains the gold standard for PNBCC and is associated with the highest cure rates , in the The recurrence rate of periocular nodular basal cell carcinoma (BCC) following treatment with IMQ was low. The 3-year histological clearance rate was 100% (8/8) for lesions <10\u00a0mm and 81.8% (9/11) for lesions >10\u00a0mm. Importantly, IMQ had significant neoadjuvant effects on PNBCC lesions >10\u00a0mm."}
{"text": "Myogenic differentiation, which occurs during muscle development, is a highly ordered process that can be regulated by E2F transcription factors. Available data show that E2F3b, but not E2F3a, is upregulated and required for myogenic differentiation. However, the regulation of E2F3b expression in myogenic differentiation is not well understood. To investigate whether E2Fb expression is controlled by miRNAs, we used bioinformatics to combine the database of microRNAs downregulated during myogenesis and those predicted to target E2F3. This identified miR-17 and miR-20a as miRNAs potentially involved in E2F3 regulation. We found that miR-17-92 controls the expression of E2F3b in C2C12 cells during myogenic differentiation. Moreover, we confirmed that miR-20a regulates the expression of E2F3b proteins in vivo using a muscle regeneration model. Skeletal muscle differentiation occurs during muscle growth and regeneration ,2. This MicroRNAs (miRNAs) are 21~23-nucleotide, noncoding RNA molecules involved in post-transcriptional regulation through targeting mRNAs to inhibit its expression . In the To validate the antibody for the detection of E2F3a and E2F3b, we transducted pLVX-E2F3a and pLVX-E2F3b, respectively, into C2C12 cells and measured their protein levels by western blotting. As shown in To confirm a role for E2F3 in myoblast differentiation, we constructed the sh-E2F3 lentiviral vector and verified its efficiency by real-time PCR  and westIncreasing evidence suggests that microRNAs (miRNAs) play a critical role in regulating myogenesis. Because E2F3b is upregulated during C2C12 cell myogenesis, miRNAs directly targeting E2F3b would be expected to be downregulated. We therefore analysed the expression profiles of 720 miRNAs in myogenesis. To investigate E2F3b and miR-20a in vivo, we constructed a muscle regeneration model by injecting cardiotoxin (CTX) into the tibialis anterior muscles of mice to mimic myogenesis in vivo . HematoxWe further injected adenovirus vectors expressing miR-20a (Ad-miR-20a) or control (Ad-miR-Ctrl) into the tibialis anterior muscles of mice 10 days before CTX-injury. Our study shows that E2F3b is indispensable in myogenic differentiation, and suggests for the first time that E2F3b is regulated by miR-17 and miR-20a during C2C12 cell myogenesis. More importantly, we report that E2F3b and miR-20a levels are negatively correlated in a muscle regeneration model and that miR-20a overexpression inhibits the expression of E2F3b in vivo and delays muscle differentiation.We revealed that miR-17-92 regulates E2F3b during myogenesis, and thus promotes muscle differentiation in vivo. However, other miRNAs can also target E2F3. Our screening of miRNAs that target E2F3 and are downregulated in myogenic differentiation also identified miR-15a, miR-490, miR-128, miR-106a, and let-7. Previous studies have shown that miR-128 targets E2F3 and inhibits cell proliferation in glioma . AdditioIn this study, we were unable to construct separate shRNA vectors for E2F3a and E2F3b because of the limited difference in base sequences between E2F3a and E2F3b, although some researchers have previously used E2F3a- and E2F3b-specific knockouts to explore their functions . In our E2F3 reversibly regulates the expression of miR-17-92. The existence of an autoregulatory feedback loop between E2F factors and miRNAs from the miR-17-92 cluster has been proposed . Woods e2 at 37 \u00b0C. HEK293A and 293T cells were cultured in DMEM with 10% FBS.C2C12, HEK293A, and HEK293T cells were purchased from the American Type Culture Collection . C2C12 cells were maintained in Dulbecco\u2019s modified Eagle medium  supplemented with 10% fetal bovine serum  until they reached 80\u201390% confluence. At this point, myogenic differentiation was induced by changing the culture medium to DMEM with 2% horse serum  in a humidified incubator with 5% COAll the protocols were approved by the Animal Ethical and Welfare Committee of Shenzhen University . The male C57BL/6 mice  were used to generate a mouse regeneration model by injecting cardiotoxin (CTX), as described previously . AdenoviTotal RNA was extracted from cultured C2C12 cells or tibialis anterior muscles using RNAiso Reagent  according to the manufacturer\u2019s instructions, and quantified using the NanoDrop2000c Spectrophotometer . miRNAqRT-PCR was performed using the S-Poly(T) Plus method with SNORNA234 as the mouse miRNA control  ,18. SYBREcoRI/XhoI restriction sites. Empty vector was used as overexpression control. Plasmid vectors containing shRNA targeting E2F3 (sh-E2F3) or a nonspecific control (sh-Ctrl) were constructed based on pLVX-hU6. shRNA sequences containing BsmBI restriction site were synthesized using primers listed in To construct overexpression plasmids, the open reading frame of mouse E2F3a was synthesized by Viewsolid Biotech  and E2F3b was amplified from C2C12 myoblast cDNA using the primer listed in EcoRI/XhoI restriction sites of the miRGlo vector .To construct the E2F3 3\u2032UTR luciferase reporter plasmid, the E2F3 3\u2032UTR was amplified from mouse genomic DNA using the primers listed in Lentiviral vectors overexpressing miR-17, miR-20a, and miR-17-92 and adenoviral vectors (Ad-miR-20a and Ad-miR-NC) were constructed as described previously .The transfection of plasmids into C2C12 cells and E2F3 3\u2032UTR luciferase assays were performed as previously described . PlasmidTotal protein isolation was performed as previously described . We collCellular immunostaining was carried out using previously reported protocols with slight modifications . Brieflyt-test with STATGRAPHICS (Centurion XVI.I) software . A p-value of <0.05 was considered statistically significant.All results are expressed as the mean of at least three triplicates for each treatment. Pairwise comparisons were performed using a two-tailed Student\u2019s In conclusion, this study focused on the association between E2F3b and myogenic differentiation, and showed that the miR-17-92/E2f3b axis has an important regulatory role in C2C12 myogenesis and the muscle regeneration model. Our results contribute to the understanding of E2F3b function in myogenesis, and the fundamental mechanism of expression regulation by miR-17-92 in myogenic differentiation."}
{"text": "Spiroplasma-induced embryonic male lethality in Drosophila melanogaster. Transcriptomic analysis reveals that many genes related to DNA damage and apoptosis are up-regulated specifically in infected male embryos. Detailed genetic and cytological analyses demonstrate that male-killing Spiroplasma causes DNA damage on the male X chromosome interacting with the male-specific lethal (MSL) complex. The damaged male X chromosome exhibits a chromatin bridge during mitosis, and bridge breakage triggers sex-specific abnormal apoptosis via p53-dependent pathways. Notably, the MSL complex is not only necessary but also sufficient for this cytotoxic process. These results highlight symbiont's sophisticated strategy to target host's sex chromosome and recruit host's molecular cascades toward massive apoptosis in a sex-specific manner.Some symbiotic bacteria are capable of interfering with host reproduction in selfish ways. How such bacteria can manipulate host's sex-related mechanisms is of fundamental interest encompassing cell, developmental and evolutionary biology. Here, we uncover the molecular and cellular mechanisms underlying  Symbiotic bacteria are able to interfere with host reproduction in ways that are detrimental to the host organism. Here the authors show that Spiroplasma induces DNA damage on the male X chromosome in Drosophila, causing sex-specific apoptosis. The process, mechanism and origin of sex determination have been focal topics in genetics, cell biology, developmental biology and evolutionary biology12Drosophila melanogaster, a female-specific developmental switch gene, Sex lethal (Sxl), counts autosome/sex chromosome ratio in an early developmental stage to establish the choice between male and female alternative developmental pathways at the cellular level. Downstream of Sxl, a cascade of regulatory genes branches into several major pathways, which respectively control sexual differentiation of the soma and neural cells, development of the germ line, and dosage compensation for equalizing X chromosomal transcript levels between males with XY chromosomes and females with XX chromosomesroX1 and roX2), which concentrates on the single male X chromosome and up-regulates its transcriptional level approximately twofoldIn the fruit fly Drosophila species, are commonly associated with symbiotic bacteria6Wolbachia, Spiroplasma, Cardinium and Arsenophonus cause striking reproductive phenotypes such as cytoplasmic incompatibility, male-killing, parthenogenesis and feminization, whereby these symbionts drive their own infection to spread into their host populations in selfish ways8Diverse insects and other animals, including Spiroplasma of Drosophila species, msl mutant hosts fail to express male-killing252627Ostrinia moths, male-killing Wolbachia was reported to suppress host's masculinizing gene expression, thereby disturbing dosage compensation in male embryosHow these microbes interfere with host's reproduction and development is of fundamental interest, but the mechanisms have been poorly understood9111213141517181921Drosophila in combination with sophisticated cytological, molecular and genomic techniques, we demonstrate a number of previously unrecognized molecular and cellular aspects of Spiroplasma-induced male-killing, which provide an integrative understanding of mechanisms underlying the symbiont's reproductive manipulation at the molecular, chromosomal, cellular and organismal levels.In this study, by making use of ample genetic tools and resources available for Spiroplasma-infected and uninfected Drosophila embryos of both sexes at stage 10\u201311 when infection-associated male-specific abnormal apoptosis startsSxl gene, Sxl-Pe-EGFP, which expresses GFP only in females  and upd2 are ligands in the JAK-STAT  pathway, which are involved in host's survival upon intestinal-bacterial infection3031GstE5, GstE9, Drsl5 and proPO45), which may reflect the general effects of Spiroplasma infection on host's physiology. Strikingly, no genes constituting the Toll and Imd (Immune deficiency) pathways were assigned to this cluster, which is in accordance with previous observations that Spiroplasma infection does not induce host's innate immune responses by evading host's recognition, presumably due to the absence of cell wall3334Sxl-Pe-EGFP transgene worked well  revealed that p53 was strongly activated in infected male embryos , two types of signals were detected: strong signals covering the whole nucleus  with compromised MSL complex function in comparison with a maternal mutant  with the functional MSL complex. When these fly strains were infected with Spiroplasma, DNA damage and abnormal apoptosis in male embryos were attenuated under the msl3-deficient maternal\u2013zygotic mutant genotype  suppresses toxicity of this transgene due to reduced amounts of ectopic MSL complexmsl1L60/+ heterozygotes , cells are arrested at G2 phase during the rest of embryogenesis, thereby resulting in embryos with fewer and larger cellsstg do not undergo cell division after the formation of the MSL complex, which is required for Spiroplasma-induced DNA damage. Therefore, using stg mutant embryos, we can genetically dissect whether bridge breakage in the male X chromosome has a causative role for the chromosome-specific DNA damage induced by Spiroplasma.In an attempt to gain further insight into the relationship between DNA damage, chromosomal breakage and abnormal apoptosis, we genetically blocked cell division during embryogenesis. String (Stg), a CDC25 homologue of Spiroplasma-infected male embryos mutant for stg, abnormal apoptosis was significantly suppressed in comparison with control embryos  may underlie Spiroplasma-induced neural defects cannot be excluded.Abnormal apoptosis in restored , in comp embryos , but the embryos , which whenotype . These rSpiroplasma-induced male-killing during Drosophila's embryogenesis, which include: (i) a large number of genes related to DNA damage and apoptosis are up-regulated specifically in Spiroplasma-infected male embryos  Sp complex ; (iii) t complex ; (iv) thpoptosis ; (v) bripoptosis ; and  Spiroplasma is enriched extracellularly in Drosophila hostsSpiroplasma-infected male embryos (this study) and (iii) mosaic and gynandromorph analyses reveal specific killing of male cells even when male cells and female cells coexist in the same embryos26Spiroplasma-produced factors, so-called effectors or toxins, may be involved in the process. Some bacterial toxins, such as colibactin of Escherichia coli, typhoid toxin of Salmonella typhi and cytolethal distending toxins of various Gram-negative bacteria, are known to cause DNA crosslinking and induce double-strand breaks in eukaryotic cells, though probably not specific to sex chromosomes59Spiroplasma genome encodes specific prophagesSpiroplasma-infected Drosophila hosts62Hamiltonella defensa produces a phage-encoded toxin, thereby protecting its aphid host against parasitoid waspsSpiroplasma-associated Drosophila species65Spiroplasma may act on the host cells to induce some eukaryotic factors that interact with and damage the MSL-bound X chromosome. Future studies should focus on these possibilities.It remains unknown how Spiroplasma-induced male-killing ; a male-killing Wolbachia suppresses host's masculinizing gene expression and thereby disturbs dosage compensation of the male Z chromosome in Ostrinia mothsWolbachia induces defective chromatin remodelling and subsequent abnormal mitotic spindle formation in the male embryos of Drosophila bifasciataArsenophonus inhibits formation of maternal centrosomes required for early male development in Nasonia vitripennisOstrinia's Wolbachia is of particular interest in comparison with the Drosophila's Spiroplasma in that: (i) the entirely different symbiotic bacteria, Wolbachia (\u03b1-Proteobacteria) and Spiroplasma (Mollicutes), cause similar male-killing phenotypes in the entirely different insect hosts, Drosophila  and Ostrinia ; (ii) both symbiotic bacteria interact with host's dosage compensation mechanisms for inducing male-killing; (iii) however, while Wolbachia disturbs the dosage compensation of the male Z chromosome in Ostrinia, Spiroplasma scarcely affects the dosage compensation of the male X chromosome in Drosophila; and (iv) Wolbachia's male-killing in Ostrinia is due to dosage compensation defects, whereas Spiroplasma's male-killing in Drosophila is caused by bridge breakage of the male X chromosome and subsequent p53-mediated massive apoptosis.In theory, any male-specific essential molecular, cellular and/or structural aspects of host organisms can potentially be exploited by symbiotic microorganisms to induce male-killingSpiroplasma-induced male-killing, which encompass molecular, chromosomal, cellular and organismal levels. By accumulating such in-depth knowledge for different host\u2013symbiont systems, we will be able to gain insights into the diversity and commonality of symbiont's strategies for interfering with host's sex-related cellular mechanisms, which should lead to a promising avenue for broadening the frontier of cell biology towards the realm of evolutionary biology and ecology.In this study, we provide an integrative picture as to what mechanisms underlie Drosophila Stock Center (Indiana University), the Drosophila Genetic Resource Center (Kyoto Institute of Technology) and several Drosophila researchers. RNA-seq libraries of Spiroplasma-infected and uninfected embryos were constructed by TruSeq RNA Sample Preparation Kit (Illumina) and sequenced by HiSeq 2000/2500 (Illumina). Short reads were aligned to the reference genome sequence of D. melanogaster provided by University of California, Santa Cruz   for at least three libraries were subjected to identification of differentially expressed genes (Fly stocks used in this study were obtained from the Bloomington lease 5) . Of all ed genes . Immunofhttp://www.ddbj.nig.ac.jp) Sequence Read Archive with the accession numbers PRJDB4469/DRA004268/SAMD00044983-SAMD00044986 (Nucleotide sequence data that support the findings of this study have been deposited in the DNA Data Bank of Japan (DDBJ: 00044986 . All othAccession codes: Nucleotide sequence data have been deposited in the DNA Data Bank of Japan (DDBJ: http://www.ddbj.nig.ac.jp) Sequence Read Archive with the accession numbers PRJDB4469/DRA004268/SAMD00044983-SAMD00044986 .Supplementary Figures 1-5, Supplementary Methods and Supplementary ReferencesCluster analysis and gene annotation of selected differentially expressed genes. Gene sets identified in the cluster analysis  are summarized with their Flybase IDs and gene annotations (sheet 1). In sheets 2-7, red color highlights remarkably enriched GO terms .Summary of RNA-seq datasets and mapping results. The number of total reads obtained from each RNA-seq library. Mapped reads, aligned pairs to the D. melanogaster reference genome sequence  and their percentages are also summarized with their accession numbers in the DNA Data Bank of Japan (DDBJ).Transcriptional changes in Spiroplasma-infected and uninfected embryos. Summary of edgeR differential expression analysis. In sheet 1, gene names and normalized read count  are indicated. Results of significance tests are also shown . In sheet 2, gene names and their locus (chromosome) are indicated with log2-transformed fold-change (logFC), average of log2-transformed counts per million reads (logCPM), P-value, and false discovery rate (FDR)."}
{"text": "The questionnaire was answered by 47 paediatric oncologists from 15 countries. iCHG progressing during first line therapy with carboplatin-vincristine would be considered for treatment with alternative chemotherapy by 17 (36%) and with surgery plus chemotherapy by 27 respondents (58%). Components suggested for second line were vinblastine (62%), cisplatin (34%) and cyclophosphamide (26%). For third line therapy bevacizumab (BVZ) was considered as suitable by respondents in 53% (often with irinotecan 40%) and vinblastine by 34% respectively. Experience with BVZ in CHG is shown by 53% of respondents regarding at least 95 patients (median treated 1\u20135 patients per respondent at any age) with a median BVZ administration over 12\u00a0months. Effectiveness was reported varying between stable disease and regression while complications were rarely stated . BVZ would be available to 85% of respondents as therapeutic option for iCHG patients. Multiple anti-neoplastic drug regimens are applied for progressive iCHG, partly considered in combination with surgery if safely feasible. BVZ is commonly used at a satisfactory level in third line, mainly combined with irinotecan.Treatment of infant hypothalamic chiasmatic glioma (iCHG) is challenging, about 30% of the children progress during chemotherapy. Despite subsequent treatments the 5\u00a0year overall-survival rate is only 70%. This study investigates treatment strategies currently applied for progressive iCHG. A web-based questionnaire was sent out to the members of the SIOPE Brain Tumour Group asking for current second and third line strategies at progression The online version of this article (doi:10.1007/s11060-017-2630-6) contains supplementary material, which is available to authorized users. Low-grade gliomas (LGG) are the most common brain tumours in childhood, accounting for approximately 35% during the first year of life and up to 50% in older children . The chiThe present survey was conducted following intense discussions among the SIOPE LGG working group on possible treatment strategies for infants with progressive CHG. The survey therefore aimed at evaluating treatment strategies currently adopted for progressive iCHG, i.e. progressive tumour in children diagnosed during the first year of life. Following primary reports on the efficacy of bevacizumab (BVZ) in patients with LGG \u201323, and http://www.thesistools.de . Per definition, tumours were considered as infant CHG if diagnosed during the first year of life. Treatment at progression or at relapse after the end of intial therapy (independent of the age at relapse) was addressed in the present survey. The survey took around 15\u00a0min to fill in and consisted of questions regarding treatment strategies, drugs applied for systemic therapy and experience with bevacizumab in CHG patients. Additional questions were asked on characteristics of the participating medical specialist: profession, country of origin, years of clinical experience, yearly amount of children treated with a brain tumour and the subgroups of LGG, CHG as well as iCHG specifically. As the survey aimed at assessing general treatment strategies, it did not collect data on patient characteristics .A web-based questionnaire on experiences and preferences on relapse treatment for iCHG (during or following first line treatment with carboplatin/vincristine) was created at The invitation to participate in the survey with a directly accessible link was sent to specialists in the field of paediatric neuro-oncology consisting of the 220 members of the multidisciplinary SIOPE Brain Tumour Group via email in February 2014 and repeated after 3\u00a0weeks.The questionnaire was answered by 47 paediatric oncologists from 15 countries . Two neuro-surgeons were omitted from the analysis as they indicated not to be involved in the decision on systemic treatment approaches. The professional experience of the respondents was reflected by the fact that 85% worked in a clinic with >\u200920 new brain tumour patients per year. Their years of experience in neuro-oncology were as follows: <5\u00a0years n\u2009=\u20095, 5\u201310\u00a0years n\u2009=\u20098, 10\u201320\u00a0years n\u2009=\u200918, >\u200920\u00a0years n\u2009=\u200915 and missing n\u2009=\u20091. 81% treated 1\u20136 patients with newly diagnosed CHG yearly, 19% seven or more patients per year. The reported rate of iCHG was low, during a 5\u00a0year period 57% of respondents cared for 1\u20133, 23% for 4\u20136, while 20% for more than six patients with iCHG.Considering the high rate of patients progressing after chemotherapy, the survey asked on the opinion of prolonging first line chemotherapy (see Table\u00a0during first line therapy with carboplatin - vincristine would be treated with different chemotherapy by 17 (36%) and with surgery plus chemotherapy by 27 respondents (58%). Vinblastine was selected as single chemotherapeutic agent in 62% followed by cisplatin (34%) and cyclophosphamide (26%) in multi-agent combinations.Therapeutic strategies adopted and systemic therapies administered at progression in patients with iCHG are summarised in Table\u00a0after the end of combined carboplatin\u2014vincristine chemotherapy 54% of respondents would favour vinblastine monotherapy while about 44% would choose a platinum derivative, 35% vincristine and 20% cyclophosphamide, mostly in combination therapy. In addition to systemic therapy 38% of respondents would consider a neurosurgical option (if safely feasible) in combination with further chemotherapy.In case of progression In third line respondents would use BVZ in 53%, in 19/25 (76%) combined with irinotecan. Vinblastine is considered by 34%.The actual experiences in application of BVZ are listed in Table\u00a0Radiotherapy was not considered an option in second and third line therapy  and exhibits a poor overall survival of 70% \u20136. Due tAccording to the current recommendations of the SIOPE LGG group, carboplatin and vincristine are mostly administered over a period of 18 months in first line therapy, but a third of responding experts would consider prolongation of first line treatment to ameliorate PFS.The present survey underlines that systemic therapies are considered the mainstay of relapse therapy in iCHG. Even if neurosurgery is (re-)considered, subsequent systemic therapy approaches are deemed necessary to sustain a possible tumour reduction achieved by neurosurgery. Accordingly none of the respondents would select a stand-alone neurosurgical approach at first tumour progression and 6% at second progression.Radiotherapy was not considered an option in second and third line therapy by respondents of this survey. The vast majority would even only consider radiotherapy after failure of multiple lines of systemic therapy. This reasoning will probably be based on the possible devastating side effects of cranial radiotherapy in small children , 11. AlsThe survey revealed that a wide variety of anti-neoplastic agents are applied in subsequent therapy lines.At first progression vinblastine is chosen most often as 2nd line treatment, 62% for progression during carboplatin-vincristine and 54% for progression after the end first line treatment. The excellent tolerability and efficacy of vinblastine in LGG has been documented earlier and its efficacy was also reported in young children with iCHG and those with diencephalic syndrome, either alone or in combination with carboplatin , 24, 25.A wide variety of drugs is used in case of progression during and/or after first line chemotherapy. We could not define specific subgroups of professionals for instance by nationality and/or years of experience, who provided specific alternative chemotherapy regimens. Only the application of cisplatin in combination with etoposide was reported by Italian neuro-oncologists as published by Massimino et al. , 28 AlthThe antiangiogenic agent BVZ, a monoclonal antibody targeting vascular endothelial growth factor is approved for oncologic treatment in adults and was consecutively applied in a variety of paediatric CNS malignancies. In childhood LGG several studies demonstrated benefit of BVZ, specifically in patients with CHG. Packer et al. were the first to report clinical and radiologic responses in ten cases with multiple relapsed LGG with a combination of two-weekly BVZ and irinotecan . Kalra eIndeed application of BVZ for progressive iCHG seems to be a hopeful strategy as shown in the experiences of 53% of our respondents reflecting experience in at least 95 patients. The previously published results of BVZ in LGG incited us to investigate the current practice of BVZ application in progressive CHG in the clinical practice of paediatric neuro-oncology. The results of the survey suggest that while vinblastine is widely applied in second line, BVZ was indicated as most prevalent choice in third line therapy with a majority of clinical responses despite multiple progressions of their LGG.BVZ is not approved for the use in children with LGG and expensive compared to conventional chemotherapy. Considering its effectiveness in LGG , 21 and Following the increasing understanding of molecular pathways involved in LGG pathogenesis , a novelSince a majority of patients with LGG become long term survivors, more insight is needed in the late outcome by gathering data in a common registry . This isOur survey provides insights in the opinions of a broad group of experienced paediatric neuro-oncologists and reflects clinical practice from many different countries in the choices made in treatment of progressive iCHG. The information regarding BVZ in clinical practice refers to at least 95 patients, extending the information on the use of BVZ, so far limited to reports published on 25 CHG patients treated with BVZ. Due to the nature of an online survey there was the possibility that multiple respondents from one treatment centre may have answered the questionnaire. Indeed, two IP-addresses were used by two respondents each. All four could be identified as independent respondents; one of them was neurosurgeon and left out from analysis (see above). Only 47/220 persons invited via email have responded to the survey, maybe distorting the results. As the mailing list of SIOPE also included neurologists, radiotherapists, neurosurgeons, neuro-pathologists, psychologists, endocrinologists, statisticians, basic scientists and ophthalmologists who were not addressed by the present survey, the percentage of paediatric neuro-oncologists responding is much higher than suggested by this number.The efficacy of other targeted drugs, such as specification of MEK inhibitors were not implicated in our survey yet. The survey allowed however to name alternative drugs and the application of a MEK inhibitor was indicated only twice by the respondents. The group of MEK inhibitors deserves specific attention in a possible follow-up survey in the future.Although clinical response to BVZ is reported by the majority of respondents our survey did not extrapolate on the responses in vision and the differences between children with or without neurofibromatosis type 1.Multiple different drug regimens are applied for progressive iCHG. Also in case of a neurosurgical approach subsequent anti-neoplastic treatment is widely applied. The application of targeted drugs emerges as novel treatment strategy. While vinblastine is the most common drug used in second line treatment, BVZ is often used in third line, mostly in combination with irinotecan. Prospective data on the efficacy of BVZ in LGG are needed and should include the infant population. Whereas the present findings cannot replace the lack of prospective trials for this small group of patients with progressive iCHG, they clearly reflect current strategies applied by an international community of paediatric neuro-oncologists. Still, treatment decisions have to be made on a patient per patient basis by an experienced interdisciplinary paediatric neuro-oncology team as depicted by the wide variety of possible therapeutic strategies. We advocate an international registry for children with (i)CHG to prospectively gather information on the multiple progressions and subsequent treatment strategies.Below is the link to the electronic supplementary material.Supplementary material 1 (PDF 1278 KB)"}
{"text": "Despite the remarkable progress that has been made to reduce global malaria mortality by 29% in the past 5 years, malaria is still a serious global health problem. Inadequate diagnostics is one of the major obstacles in fighting the disease. An automated system for malaria diagnosis can help to make malaria screening faster and more reliable. We present an automated system to detect and segment red blood cells (RBCs) and identify infected cells in Wright\u2013Giemsa stained thin blood smears. Specifically, using image analysis and machine learning techniques, we process digital images of thin blood smears to determine the parasitemia in each smear. We use a cell extraction method to segment RBCs, in particular overlapping cells. We show that a combination of RGB color and texture features outperforms other features. We evaluate our method on microscopic blood smear images from human and mouse and show that it outperforms other techniques. For human cells, we measure an absolute error of 1.18% between the true and the automatic parasite counts. For mouse cells, our automatic counts correlate well with expert and flow cytometry counts. This makes our system the first one to work for both human and mouse. Parasite-infected red blood cells (RBCs) lead to symptoms, such as fever, malaise, seizures, and coma, in severe cases. Fast and reliable diagnosis and early treatment of malaria is one of the most effective ways of fighting the disease, together with better treatments and mosquito control.,,\u2013\u2013Although both thick and thin blood smears are commonly used to quantify malaria parasitemia, many of the computer-assisted malaria screening tools currently available rely on thin blood smears.We present an end-to-end automated detection system for identifying and quantifying malaria parasites  in thin blood smears of both human and mouse. The main difference between human and mouse malaria parasites is that in mice, all the stages of the parasite can be seen in the peripheral blood, whereas in humans, the mature stages, such as trophozoites and schizonts, are mostly sequestered. Another difference is that P. falciparum has elongated, banana-shaped gametocytes and takes around 10 to 12 days until complete maturation, whereas the gametocytes in mouse are round and maturate faster. This makes our software robust to different visual patterns of parasite stages. In resource-limited settings, where research labs have no access to flow cytometry or other cell counting means, our software can help expedite research experiments on mice models, taking the manual cell counting load from researchers. Moreover, flow cytometry is too expensive for field-use and requires a technical person to prepare, acquire, and analyze samples.Our automated malaria parasite detection system consists of four main steps, as illustrated in We develop an efficient RBC detection and segmentation technique that uses a multiscale Laplacian of Gaussian (LoG) cell detection method as input to an active contours-based segmentation scheme named coupled edge profile active contours (C-EPAC) to accurately detect and segment individual RBCs and highly overlapping cells with varying annular and disk-like morphologies and textural variations . Ersoy eThen, we use a combination of color and texture features to characterize segmented RBCs. We develop an offline feature evaluation framework using manually annotated cells to select the most discriminative features, reduce feature dimensionality, and improve classification performance . The feaFinally, we use a linear support vector machine (SVM) to classify infected and uninfected cells because of its simplicity, efficiency, and easy translation to a smartphone . We alsoThe main contributions of this work are summarized as follows: \u2022The fusion of LoG filter with C-EPAC enables us to efficiently detect and segment individual RBCs, including highly overlapping cells with varying annular and disk-like morphologies and textural variations. We achieve a superior cell detection F1 score of 94.5% and 95% for human and mouse respectively, including a better performance in splitting touching or overlapping cells. We compute Jaccard indices of 92.5% for human cells and 81% for mouse cells.\u2022We use a combination of low-level complementary features to encode both color and texture information of RBCs. Features are selected through an offline evaluation framework to optimize the classification performance using manually annotated cells.\u2022We are the first to present a robust system for both human and mouse blood smears, including evaluation of the overall system performance in terms of precision, recall, accuracy, and F1 score. For human, we measure an average absolute error of 1.18% between the true and the automatic parasite counts. For mouse, we are the first to compare automatic cell counts with flow cytometry counts, measuring a high correlation.\u2022On average, our system can process about We organize the remainder of the paper as follows: Sec.\u00a02We use blood slide images for both human and mouse provided by the National Institute of Allergy and Infectious Diseases (NIAID) to evaluate our system. All experiments are approved by the NIAID Animal Care and Use Committee (NIAID ACUC). The approved Animal Study Proposal (Identification Number LIG-1E) adheres to the regulations of the Animal Welfare Regulations and Public Health Service Policy on Human Care and Use of Laboratory Animals.2.12.1.1in vitro in the conditioned media comprising of RPMI 1640. The culture was maintained in a mixed gas environment with 5% Whole blood from Interstate Blood Bank was processed to remove all the white blood cells by passing it through SEPACELL R-500 II leukocyte reduction filter from Fenwall. The processed blood was used to culture Plasmodium falciparum 2.1.2C57BL/6 female mice (7 to 10 weeks old) were obtained from The Jackson Laboratories. Mice were infected with PbA by injecting i.p. 2.1.3Peripheral blood parasitemia was determined by flow cytometry using a modification of a previously described method.In the following sections, we will refer to the acquired slide images and annotations as the human-NIAID and mouse-NIAID datasets since the human and mouse blood slides have been provided by NIAID.2.2Blood slide images were acquired with the Zeiss Axio Imager, an upright research microscope platform, using a magnification of Cells were manually annotated by an expert as either infected or uninfected, using our Firefly online annotation tool [We evaluate the performance of features and classifiers on 70 human-NIAID images  with the most popular methods including: (i)\u00a0Otsu-thresholding combined with morphology operations (Otsu-M),3.2.1The accuracy of cell segmentation relies on the performance of the cell detection algorithm in detecting individual and touching cells. Therefore, we first evaluate the performance of the LoG-based cell detection algorithm and compare it to cell detection results of Otsu-M and Chan\u2013Vese active contour methods. otations . TherefoTo combine the precision and recall performance of the detection algorithm and report the overall performance, 3.2.2We compute the region-based Jaccard indexJaccard index is one of the most popular segmentation evaluation metrics that measures the similarity between a computed segmentation mask 4Once the cells have been detected and segmented from the whole image, in the next step, we extract all segmented cells and characterize them by their color and texture information to distinguish infected cells from normal cells within a learning framework. We have studied different features for describing normal and abnormal cells, and evaluated their performance using SVM and ANN classifiers to select the most discriminative feature set. We evaluated the performance on both SVM and ANN to show that the best feature set outperforms other features independent from the classifier used. In feature evaluation experiments, we used ground truth annotations to extract cells and decouple the performance of features and classifier from our automatic segmentation results. The color feature set includes YCbCr, normalized green channel from RGB color model (NG), a combination of three discriminative normalized channels from different color models: To select the most discriminative feature set, we measure precision, recall, accuracy, and F1 score of SVM and ANN classifiers using the described features in TP is the number of cells that are truly classified as infected and TN is the number of cells that are truly identified as normal cells. FP and FN report the number of cells that are being misclassified.5In the last step of our processing pipeline, we use a SVM classifier with a linear kernel, a two-layer ANN feedforward network with a sigmoid transfer function in the hidden layer, and a softmax transfer function in the output layer to classify cells into two classes: infected and uninfected. We evaluate the system pipeline performance on a set of 14 thin blood slides, each containing 5 images, from human-NIAID dataset  using a 10-fold cross-validation scheme to train and test the classifiers. In each fold, 63 images are used for training and 7 images are used for testing.To quantify the malaria infection, we compute the infection ratio as follows: 6To evaluate our system systematically, we monitored the malaria infections of two mice identified as 2805 and 2808, during a course of several days. We compared the counts of human experts with the automatic counts provided by our system. In addition, we compared our counts with automatic counts produced by flow cytometry and with the counts of a layperson, who received a brief introduction into the art of cell counting by expert slide readers. 7We have developed an image analysis system that can automatically quantify a malaria infection in digitized images of thin blood slides. The system\u2019s image processing pipeline consists of three major steps: cell segmentation, feature computation, and classification into infected and uninfected cells. The most challenging task of the pipeline is the segmentation phase, which needs to be fast and accurate in splitting any clumped cells to avoid miscounting and misclassification in the last stage of the pipeline. We use a combination of multiscale LoG filter and C-EPAC level-set scheme to detect and segment cells, which is capable of identifying individual cells in a clumped cell cluster of touching cells and outperforms other methods. For feature computation, we use a combination of NRGB and JAMBP texture features. The color feature picks up the typical color of stained parasites and the texture feature detects cell texture information including the cytoplasm of parasites. This feature combination works well in our experiments and helps to avoid FPs due to staining artifacts. In the classification step, we evaluate the linear SVM and ANN classifiers performance on human and mouse slides. The ANN classifier achieves F1 score of 90% in correctly identifying infected cells on human-NIAID dataset. We measure an average absolute error of 1.18% between the true and the automatic parasite counts for human. For mouse cells, our automatic counts correlate well with expert and flow cytometry counts, making this the first system that works well for both human and mouse. Compared to human counting, our system is much faster and can process"}
{"text": "Their biological profile was also inspected in vitro on the HL-60 cell line using different flow cytometric techniques . The compounds exhibited a profound inhibitory effect on topoisomerase activity (e.g. compound 22 inhibited type I topoisomerase at 1\u2009\u00b5M concentration). The treatment of HL-60 cells with the studied compounds showed inhibition of cell growth especially with hybrids containing thiourea (14\u201317) and urea moieties (21 and 22). Moreover, treatment of human dermal fibroblasts with the studied compounds did not indicate significant cytotoxicity. The observed results suggest beneficial selectivity of the heterodimers as potential drugs to target cancer cells.A combination of biochemical, biophysical and biological techniques was used to study calf thymus DNA interaction with newly synthesized 7-MEOTA-tacrine thiourea  In the next step, 1 was treated with phosphorus oxychloride to give a quantitative yield of 9-chloro-7-methoxy-1,2,3,4-tetrahydroacridine 2,2 with appropriate 1,\u03c9-diamines in the presence of phenol then provided the desired intermediates N-alkane-1,\u03c9-diamines 3\u20138 (71\u201393%). 1,2,3,4-Tetrahydroacridin-10H-9-one 9 was formed directly from the neat reaction of cyclohexanone with N-methylanthranilate (65%). Chlorination of 9 was carried out by refluxing with phosphorus oxychloride to obtain 9-chloro-1,2,3,4-tetrahydroacridine 10 in quantitative yield. 9-Isothiocyanato-1,2,3,4-tetrahydroacridine 11 was obtained by refluxing 10 in the dark with silver thiocyanate in anhydrous toluene12\u201317 were formed by reaction of the two synthons 11 and diamines 3\u20138 (65\u201378%). The oxo-analogs were obtained using 2,4,6-trimethylbenzonitrile N-oxide to afford 7-MEOTA-THA ureas . Structural determination and signal assignments of thiourea hybrids 12\u201317 and urea hybrids 18\u201323 were accomplished by application of the usual combination of 1H and 13C\u00a0NMR spectra. Unequivocal assignments were performed by homo- and hetero-correlated two-dimensional NMR experiments . The infrared spectrum was obtained only for molecule 11 to observe isothiocyanate group vibrations.12\u201322, their influence on the catalytic activity of Topo I/II, their ability to affect cell cycle distribution, and their effect on the mitochondrial membrane potential (MMP) and the metabolic activity and viability of the HL-60 cell line. The results acquired from these in vitro studies should enhance understanding of the effects pertinent for drugs targeting cancer. The urea heterodimer 23 was not tested due to its low solubility.In this work, we have studied DNA binding of novel THA-7-MEOTA dimers 12\u201322, we prefer to use multiple assays that reflect real physiological/pathological changes in more detail and on single cell level . It is generally known that most of the chemotherapeutic agents exert their cytotoxic effect either by induction of cancer cell apoptosis or by cell cycle arrest at a specific pointm) followed by release of pro-apoptotic molecules into the cytoplasm, which leads to programed cell death12\u201322 affect mitochondrial physiological processes, HL-60 cells were treated with the studied compounds for 24, 48 and 72\u2009h and labeled with TMRE. In general, mitochondria with normal MMP retain the dye, resulting in strong fluorescence. Compounds inducing a collapse in MMP allow flow of the dye from mitochondria to cytoplasm leading to depolarization of the mitochondrial membrane and fluorescence decrease. The results from MMP analysis clearly show that 14\u201317 and 21 at 15\u00a0\u00b5M and 22 at 5\u00a0\u00b5M were able to evoke MMP dissipation in more than approximately 60% of cells after 24\u2009h treatment and caused cell death with an efficiency between 80 and 100% at 15\u00a0\u00b5M for urea analogs and 25\u00a0\u00b5M for thioureas after 24, 48 and 72\u2009h . A simultaneous analysis of viability (staining with PI) and the activity of cellular metabolism showed a very similar trend to acquired changes in MMP analysis identifying the effectivity of compounds 14\u201317 and 21, 22 to kill cancer cells  and 22 (at 5\u00a0\u00b5M) having five and six methylenes in the linker being found to exert the most cytotoxic profile. The higher cytotoxic effect presumably reflects easier cell membrane penetration. Interestingly, the cytotoxic effect against HL-60 also correlated well with the ability to inhibit activity of topoisomerases. It is known that inhibitors of Topo I, such as camptothecin, exhibit cell cycle arrest induced apoptosisFor biological effect analysis of novel compounds and 72\u2009h . Their eand 72\u2009h . The other cells . IC50 frFigure 2.14\u201317 (5\u201325\u2009\u03bcM), ureas 20\u201322 (1\u201315\u2009\u03bcM) and THA (5\u201310\u2009\u03bcM) on changes in A: MMP and B: viability in HL-60 cells. Cells were analyzed 24, 48 and 72\u2009h after treatment with studied compounds. The results were calculated as mean\u2009\u00b1\u2009SD from three independent experiments. Statistical significance p\u2009<\u2009.05 (*), .01 (**), and .001 (***) for the particular experimental group compared to untreated control (C).Effect of 7-MEOTA-THA thioureas 12\u201322 was also determined on cultured human dermal fibroblasts by measuring MMP. As shown in Supplementary Figure S1, all the studied compounds were less toxic to non-cancer cells compared to cancer cells at given concentrations after 72\u2009h treatment, which underlies their advantage in development of anticancer drugs.The cytotoxicity of 12\u201322 to impair cell proliferation, flow cytometry analysis of the cell cycle distribution was hence used. Based on the results from MMP dissipation and viability analyzes, HL-60 cells were treated with different concentrations of 12\u201317 (5\u201325\u2009\u00b5M) and 18\u201322 (1\u201315\u2009\u00b5M) for 24, 48 and 72\u2009h. After 48\u2009h incubation, results for urea derivatives 21 (15\u2009\u00b5M) and 22 (10\u2009\u00b5M) clearly demonstrated a significant accumulation of cells in G1 phase ). In comparison, thiourea analogs 14\u201317 revealed a concentration effect ). These compounds significantly altered cell cycle progression, inducing block of the cell cycle in S phase after just 24\u2009h treatment at 25\u2009\u00b5M concentration. THA and acridine were used as controls. Despite the relatively high concentration of THA, it did not exert any effect in this experiment ).In order to address the effect of compounds 12\u201322 was analyzed on the model of A549 adherent cancer cells and human dermal fibroblasts by a simple approach. After 24\u2009h incubation with the derivatives, the cells were washed in order to dispose of unbound compounds, so that only compounds that were able to permeate into the cells could be visualized. The fluorescence of each sample was examined in each channel but images were captured using only two channels: (1) blue excitation range [BP excitation filter 450\u2013490\u2009nm (cube I3) and LP suppression filter 515\u2009nm]\u2014when heterodimers were present in the samples they exhibited positivity only in this channel; (0) brightfield mode was also applied in order to capture the cells themselves, visualizing single cells regardless of fluorescence of the studied compounds. According to the signal in channel 1 (I3 filter cube), compounds 14\u201317 (5\u00a0\u00b5M) showed abundant accumulation after 24\u2009h incubation and a strong fluorescence signal in the A549 cells. All these heterodimers were visible as dark spots even in brightfield mode  whereas urea heterodimers 18, 19 did not (data not shown). It was also observed that ureas 20\u201322 accumulated neither in A549 cells nor in fibroblasts , it is important to consider whether they are also able to inhibit some of the cell nucleus enzymes involved in DNA operations, and which alter its topology through decatenation and relaxation of supercoiled DNA, as for example Topo I/II. Moreover, Topo I/II are also employed in other cell functions, such as replication, transcription, recombination and chromosomal segregationGiven that the studied 7-MEOTA-THA thio-/urea hybrids 12\u201322 on the catalytic activity of Topo I by measuring the Topo I-mediated relaxation of supercoiled plasmid pUC19. Due to significant and dose-dependent inhibition of Topo I catalytic activity all the compounds under study reduced the amount of relaxed DNA, while simultaneously increasing the amount of supercoiled DNA. 7-MEOTA-THA thioureas 12\u201317 inhibited the catalytic activity of Topo I at 60\u2009\u00b5M . Compounds 14\u201317 were able to inhibit the catalytic relaxation ability of Topo I on pUC19 already at 5\u2009\u00b5M, and hence further testing was carried out at concentrations of 1\u201310\u2009\u00b5M . The most effective from this subset was compound 17 due to strong inhibition at 1\u2009\u00b5M . Intriguingly, compound 22 was effective at 1\u2009\u00b5M concentration , inhibit ATP binding (e.g. novobiocin), or stabilize the noncovalent DNA-Topo II complex . Topo II poisons are able to stabilize the covalent DNA-Topo II cleavage complex and are clinically used for their antitumor activity 12\u201322 to affect the decatenation of catenated kinetoplast DNA (kDNA) from the insect trypanosome Crithidia fasciculata by Topo II was examined . ATP-dependent decatenation assay is a specific assay for detection of compounds with potential Topo II inhibition activity. Topo II-targeted compounds are able to interact with (at least) one step of the topoisomerase catalytic cycle. The decatenation of kDNA by Topo II generates different products  which move easily into the agarose gel compared with the larger-sized catenated kDNA12\u201322 at 5\u2009\u00b5M compared to 200\u2009\u00b5M etoposide, 100\u2009\u00b5M ellipticine and 100\u2009\u00b5M mAMSA (Topo II poisons/inhibitors used as standards). All the compounds revealed the same pattern of inhibition of catalytic activity of Topo II at 50 and 100\u2009\u00b5M concentrations. Vispe et\u00a0al.The ability of mAMSA) are able to stabilize the DNA-Topo II complex and thus form linear DNA due to the simultaneous cleavage of both strands of double-stranded DNA. Plasmid DNA pHOT1 (the DNA substrate) used in the cleavage assay contains a single high affinity Topo II cleavage site12\u201322 . These results indicated that 12\u201322 are characterized with Topo II catalytic inhibition, but not as Topo II poisons. Topo II poisons were found to be important for activating secondary leukemias involving certain chromosomal translocations. On the other hand, Topo II catalytic inhibitors are able to change the cytotoxic effect of poisons and overcome multidrug resistance,,Topo II poisons . The observed changes suggested that studied compounds 12\u201322 are able to interact with ctDNA, although from the small bathochromic shifts we can rather point out to groove binding or electrostatic interaction, rather than intercalation. The DNA-binding characteristics of the studied 7-MEOTA-THA thio-/ureas 12\u201322 are summarized in K of the studied compounds in complex with ctDNA ranged between 0.5 and 8.0\u2009\u00d7\u2009106\u00a0M\u22121 and were comparable with the measured K of acridine and greater than the literature-cited K for acridin-3,6-diyl dithiourea hydrochlorides (2.9\u20137.6\u2009\u00d7\u2009105\u00a0M\u22121)5\u2009M\u22121)5\u2009M\u22121)4\u2013106\u00a0M\u22121 and they are usually lower than binding constants typical for groove binders (range from 105 to 109\u00a0M\u22121).Several binding modes have been identified between native and/or synthetic double-stranded DNA (dsDNA) and low molecular-weight compounds acting as chemotherapeutic agents or gene regulators. The non-covalent DNA interactions are represented mainly by intercalation between the base pairs of dsDNA; and binding to minor/major grooves of dsDNA, stabilized by a mix of electrostatic, hydrophobic, hydrogen-bonding interactions or outside random bindingmT). DNA denaturation is usually measured spectrophotometrically at the temperature-dependent excitation point of 260\u2009nm. In this work, mT of ctDNA was found to be 68\u2009\u00b0C whereas in the presence of 7-MEOTA-THA thioureas 12\u201316 slightly increased (\u0394mT was 1\u20132\u2009\u00b0C). In the presence of 7-MEOTA-THA ureas 18\u201322, no increase of mT of ctDNA was observed, except for compound 22 which exhibited a profound increase of mT of more than 10\u2009\u00b0C. Thermal characterization of the studied compounds 12\u201322 and the first derivative of ctDNA denaturation curves in the presence of the studied compounds are shown in Supplementary Figure S7. Usually, ligands which could bind to DNA through intercalation significantly increase mT of DNA, and \u0394 mT is typically around 5\u20138\u2009\u00b0C, due to stabilization of dsDNA. Groove binding and electrostatic binding ligands produce mostly negligible effects on mT of DNAmT (0.9\u2009\u00b0C) in melting temperature analysis with ctDNA for resmethrin characterizes this compound as a groove binder. Results from our study indicated that only compound 22 could possibly bind strongly to ctDNA in intercalative mode, but it is not excluded that 7-MEOTA thio-/ureas 12\u201321 are able to insert between the planar bases of ctDNA.DsDNA tertiary structure is stabilized via hydrogen bonds and base stacking interactions. When a solution of dsDNA is exposed to extreme heat, the double helix dissociates to the single-stranded form (known as denaturated DNA). This leads to disruption of intermolecular forces and hydrogen bonding interactions between the DNA base pairs12\u201322 with ctDNA was accomplished using steady-state fluorescence measurements. Fluorescence spectra of studied heterodimers at fixed concentration with increasing concentration of ctDNA showed a progressive quenching in the fluorescence intensity which was directly proportional to the ctDNA concentration. Representative results are displayed in 17 and 22) and suggest interaction between the compounds and ctDNA. Data from these fluorescence quenching experiments were also used for determination of SVKthat provides a measure of the quenching ability of ctDNA. The inserted graphs in 0/F versus [Q]. These plots are characterized by an intercept of one on the y-axis and the slopes are equal to SVK, as summarized in A more sensitive evaluation of the interaction of studied 7-MEOTA-THA thio-/ureas SVK (by increasing the temperature random collision is more probable). On the other hand, increased temperature goes hand in hand with decreased complex stability and thus the static quenching constant is lower,SVK values it is clear that ctDNA can quench fluorescence of the studied compounds as a static quencher. To further confirm the quenching process qk was calculated; this indicates the accessibility of a fluorophore to a quencher, or the efficiency of quenching. Calculated qk are listed in 11\u00a0M\u22121\u00a0s\u22121 at different temperatures. The limiting diffusion rate constant of biomolecules in the case of dynamic quenching was found to be 2.00\u2009\u00d7\u20091010\u00a0M\u22121\u00a0s\u22121. However, there is no limit for static quenching,qk were higher than the limiting diffusion rate constant, it is suggested that the quenching process in this study was static rather than dynamic.Fluorescence quenching is observed in two processes, as dynamic or static quenching. Static quenching is based on the fact that the fluorophore and added quencher form a stable non-fluorescent complex in the ground state which promptly goes back to the ground state without photon emission after light absorption. For dynamic  quenching, quencher diffusion to the fluorophore is typical during the lifetime of an excited state and the rate of this quenching is dependent upon temperature, viscosity and diffusion. The decrease of fluorescence in the case of dynamic quenching is due to random collision between the fluorophore and quencherbK of the forming complex between 7-MEOTA-THA thio-/urea hybrids and ctDNA. The calculated bK and n are recorded in \u0394H, \u0394S and \u0394G. Values of all thermodynamic parameters are summarized in \u0394G are characteristic of a favorable and spontaneous binding reaction. Positive values of both \u0394S and \u0394H are typical for hydrophobic interaction, while negative values of both can be regarded as indicating van der Waals forces and hydrogen bonds. However, positive values of \u0394H and negative values of \u0394S describe electrostatic interaction between ionic species in an aqueous solution,12\u201322 and ctDNA was spontaneous due to negative \u0394G values at all three temperatures, and the positive values of \u0394H and \u0394S showed that hydrophobic interactions play a central role in the binding of the studied 7-MEOTA-THA thio-/ureas 12\u201322 with ctDNA. Based on the negative \u0394H and \u0394S for 16 and 20, we can assume that interaction in these ligand-ctDNA complexes is mediated by van der Waals forces  can be deduced structure information about the relative conformation between the DNA axis and the ligand. Circular dichroism (CD) is another powerful tool to gain insight into the structural determinants characterizing such complexes. Whereas LD can be used to monitor the angles between DNA-base transition states relative to the axis orientation which are identical with the helix axis in flow or electric field-oriented DNA, the induced CD of the same transition could provide information about molecular orientation relative to the surrounding nucleobases//\u2212A\u22a5, where A//and A\u22a5 are absorbance values measured with the light plane polarized parallel and perpendicular, respectively, to the oriented ctDNA in this study. The orientation of measured ctDNA in the absence and in the presence of the studied 7-MEOTA-THA thio-/ureas 12\u201322 was obtained by flow using a cuvette cell. Representative spectra are shown in 12\u201322 interact with DNA and become oriented after anchoring to DNA. The negative values of these LD signals are consistent with perpendicular orientations of the chromophoric molecules 12\u201322 relative to the DNA helix axis as expected for intercalative binding mode12\u201322 indicating either lengthening and/or an increase in rigidity of double-helical DNA, which can usually be related to unwinding due to intercalation,LD is defined as LD\u2009=\u2009ASupplementary data .All chemicals and reagents purchased were of reagent grade and used without further purification. The applied material and cell lines are listed in \u22121\u00a0cm\u22121. The purity of ctDNA was identified by monitoring the value A260/A280. Stock solutions of tested 7-MEOTA-THA thio-/ureas 12\u201322 were prepared in DMSO (stock concentration of samples was 30\u2009mM). Further dilutions were prepared in the appropriate aqueous buffer.CtDNA was dissolved in TE buffer (Tris\u2013EDTA) overnight at 4\u2009\u00b0C to completely solubilize. The concentration of ctDNA was determined from its absorbance at 260\u2009nm using extinction coefficient \u03b5\u2009=\u20096600\u00a0M6 per well and changes in the total cell number, metabolic activity, MMP, cell cycle distribution and cell death were analyzed at 24, 48 and 72\u2009h after treatment with the studied 7-MEOTA-THA thio-/ureas 12\u201322, as described previously,4) were seeded into a 12-well plate  and treated with the studied 7-MEOTA-THA thio-/ureas 12\u201322 for 72\u2009h, and changes in MMP were analyzed.For the flow cytometry analysis, HL-60 cells were seeded in six-well plates  at 1\u2009\u00d7\u200910Immunophenotype characterization of human fibroblasts. Isolated dermal fibroblasts were characterized using flow cytometry. After dissociation with trypsin\u2013EDTA , the cells were washed twice with PBS  supplemented with 2% (v/v) FBS. Aliquots of 2.0\u2009\u00d7\u2009105\u00a0cells were incubated with mouse anti-human CD90/FITC, CD105/PE, CD73/APC, CD26/PE, and with a cocktail of hematopoietic markers: CD14-/CD20-/CD34-/CD45/PerCP  for 10\u2009min, washed with 1\u20132\u2009mL of PBS and centrifuged at 3000g for 10\u2009min. The resuspended cell pellet was analyzed in a Becton Dickinson FACSCalibur using CellQuest software (Becton Dickinson).Cell cycle distribution. HL-60 cells were treated with various concentrations of the studied seven MEOTA-THA thio-/ureas  for 24, 48 and 72\u2009h. Untreated cells were also included in this test for comparison. The method used to perform the experiment has been published previouslym).Analysis of MMP  for 24, 48 and 72\u2009h (for fibroblasts only 72\u2009h). The method used to perform the experiment has been published according to a previously described protocol,Analysis of metabolic activity and viability. Analysis of metabolic activity and viability of HL-60 cells was performed using fluorescein diacetate  and PI double-staining. HL-60 cells were treated with various concentrations of the studied 7-MEOTA-THA thio-/ureas  for 24, 48 and 72\u2009h and subsequently harvested by centrifugation, washed with HBSS and stained with FDA (100\u2009ng\u00a0mL\u22121) in HBSS buffer for 20\u2009min in darkness at RT. Prior to measurements, cells were stained with PI (1\u2009\u00b5g\u00a0cm\u22123) and analyzed using a BD FACSCalibur flow cytometer. Fluorescence of FDA was detected via a 530/30\u2009nm band pass filter (FL-1) and PI via a 670\u2009nm long-pass filter (FL-3). Results were analyzed using FlowJo software (TreeStar Inc.).t-test and results were considered significant if p<.05*, p<.01** and p<.001***.Results were presented as the mean\u2009\u00b1\u2009SD (standard deviation) of at least three independent experiments. Statistical significance was determined by Student\u2019s 3\u00a0per well) were seeded onto microscopy glass slides with mounted 12-well silicone chamber  and left to settle for 24\u2009h. They were then treated with the studied 7-MEOTA-THA thio-/ureas 12\u201322 (5\u00a0\u00b5M) or with the medium alone (control group) for 24\u2009h and washed with pre-warmed PBS in order to remove the unbound fraction. Intracellular accumulation of studied heterodimers in A549 cells was evaluated by fluorescence microscope Leica DMI6000B  using two channels as stated in Supplementary Table S1. Every sample was captured using the same settings for HCX PL APO CS 10.0\u2009\u00d7\u20090.40\u2009DRY UV objective. Results were analyzed using Leica Application Suite Lite (LAS AF Lite) software. Each presented image represents a single sample and consists of separated images from a channel and their mutual overlap.A549 cells (6\u2009\u00d7\u2009104 per well) were seeded into a 12-well plate, left to settle for 24\u2009h and treated with the studied 7-MEOTA-THA thio-/ureas 12\u201322  or with the medium alone (control group). After 24\u2009h of incubation with the studied derivatives, the cells were analyzed with an inverted fluorescence microscope Leica DMi3000B (Leica Microsystems).Fibroblasts . The gel was photographed under UV and gel images were obtained using a photogel documentation system .The influence of the studied 7-MEOTA-THA thio-/urea hybrids on the catalytic activity of Topo I was identified according to a previously described protocol12\u201322: 5, 50 and 100\u00a0\u00b5M) was incubated for 45\u2009min at 37\u2009\u00b0C. The method used to perform the experiment has been published previously,Freshly prepared 5\u00d7 complete assay buffer for Topo II decatenation containing 0.16\u2009\u00b5g catenated kinetoplast DNA (kDNA) and 2\u2009U of human Topo II\u03b1 in the absence or presence of the studied 7-MEOTA-THA thio-/ureas (12\u201322: 10 and 100\u00a0\u00b5M) at 37\u2009\u00b0C for 30\u2009min. The method used to perform the experiment has been published previously,DNA cleavage reactions were carried out in a 20\u2009\u00b5L final volume containing freshly prepared 5\u00d7 complete assay buffer, 0.2\u2009\u00b5g supercoiled pHOT-1 and 5U human Topo II\u03b1. Reactions were incubated in the absence or in the presence of the studied 7-MEOTA-THA thio-/ureas (12\u201317: 49\u00a0\u00b5M) and ureas  in the absence or in the presence of an increasing concentration of ctDNA (0\u20131.24\u00a0\u00b5M) were recorded in the wavelength range 230\u2013450\u2009nm.UV\u2013vis spectroscopic analyses were realized in 10\u2009mM Tris\u2013HCl buffer . UV\u2013vis absorption titration spectra were measured on a Varian Cary 100 spectrophotometer in a 100-QS quartz cuvette with optic length 1\u2009cm. UV\u2013Vis spectra of newly developed 7-MEOTA-THA thioureas (b) types:f+Cb) and \u03b5f and \u03b5b are the appropriate extinction coefficients C, where CDNA is the total DNA concentrationK of the derivative-ctDNA complexes using a Scatchard plot in the form r/Cf , the McGhee and von Hippel equation (Equation (3)The absorbance A measured at any wavelength indicates both the free (Af) and DNA-bound . The temperature was increased at a rate of 1\u2009\u00b0C\u00a0min\u22121 over the range 40\u201390\u2009\u00b0C. The absorbance was measured at 260\u2009nm for ctDNA alone (concentration of ctDNA in measurements with 12\u201317: 93.2\u00a0\u00b5M and with 18\u201322: 0.32\u00a0\u00b5M) and for ctDNA in complex with the studied derivatives (concentration of 12\u201317: 37.5\u00a0\u00b5M and 18\u201322: 50\u00a0\u00b5M). The thermal melting points  were determined as the maxima of the first derivative plots of the melting curves.DNA melting temperature measurements were performed in a quartz cuvette (1\u2009cm path length) on a Varian Cary 100 spectrophotometer equipped with a heating multiple cell block apparatus. Measurements were realized in BPE buffer  containing a constant concentration of the studied derivative (12\u201322: 5\u00a0\u00b5M), and to which were added equivalent increased amounts of ctDNA (0\u2013280\u00a0\u00b5M). The steady state fluorescence measurements were performed at three different temperatures  for the evaluation of various thermodynamic parameters important in the detection of complex formation between DNA and 7-MEOTA-THA heterodimers.Fluorescence spectra of the studied 7-MEOTA-THA thio-/ureas were recorded in a quartz cuvette (1\u2009cm path length) on a Varian Cary Eclipse spectrofluorimeter. The widths of both the excitation and emission slit were set at 10\u2009nm. The excitation wavelengths were 340\u2009nm for compounds SVK) by applying the equation (Equation (4)0 is the fluorescence intensity of the studied compound alone, F is the fluorescence intensity of the studied 7-MEOTA-THA thio-/urea in the presence of ctDNA as a quencher and [Q] is the molar concentration of ctDNA. To further confirm the quenching process were calculated biomolecular quenching constants kq using the equation  of the forming complex between 7-MEOTA-THA thio-/urea hybrids and ctDNA:b and n were calculated at three different temperatures from double logarithm regression curves of log(F0\u2212F)/F versus log[Q] and they were obtained from intercept and slope, respectively.The modified Stern\u2013Volmer equation (Equation (6)\u22121\u00a0mol\u22121. \u0394H and \u0394S were determined as the slope and intercept respectively of the van\u2019t Hoff plot (log\u00a0Kb against 1/T). The \u0394G values at three different concentrations were calculated using equation (The van\u2019t Hoff equation  was usedequation 96:(8)\u0394G12\u201322: 0.3\u2009mM) were recorded in 10\u2009mM Tris\u2013HCl buffer  in the wavelength range of 200\u2013500\u2009nm. The results are presented as the mean of at least three repeated measurements and obtained data were transferred to Grafit 7.0  for analysis.Spectral measurements of CD were realized using a J-810 Jasco spectropolarimeter in a quartz cuvette with optic length 1\u2009mm. CD spectra of ctDNA (7.46\u00a0\u00b5M) in the absence or in the presence of the newly developed 7-MEOTA-THA thio-/urea hybrids (12\u201322: 0\u20130.1\u2009mM) were recorded in 10\u2009mM Tris\u2013HCl buffer  in the wavelength range of 200\u2013500\u2009nm. The baseline (10\u2009mM Tris\u2013HCl) was also recorded for each measurement. The results are presented as the mean of at least three independent measurements and obtained data were transferred to Grafit 7.0 (Erithacus Software) for analysis.Flow LD spectra were measured using a Jasco J-720 spectropolarimeter in a flow Couette cell adapted for LD measurements. The flow cell includes a fixed outer cylinder and a solid rotating quartz inner cylinder. These two cylinders are separated with a 0.5\u2009mm gap . LD spectra of ctDNA (310\u00a0\u00b5M) in the absence or in the presence of the newly synthesized 7-MEOTA-THA thio-/urea derivatives . Column chromatography was performed at normal pressure on silica gel 100 . Elemental analysis was measured on a Perkin-Elmer CHN Analyzer 2400 Series II apparatus . Mass spectra were recorded using combined high-performance liquid chromatography (HPLC) and mass spectrometry (MS). The HP1100 HPLC system was obtained from Agilent Technologies . It consisted of vacuum degasser G1322A, quaternary pump G1311A, autosampler G1313A and quadrupole mass spectrometer MSD1456 VL equipped with electrospray ionization source. Nitrogen for MS was supplied by a Whatman 75\u2013720 nitrogen generator. Data were collected in positive ion mode with an ESI probe voltage of 4000\u00a0V. The pressure of nebulizer gas was set to 35\u00a0psig. Drying gas temperature was operated at 335\u2009\u00b0C and flow at 13\u2009L/min. 1H\u00a0NMR and 13C\u00a0NMR spectra were recorded on a Varian Mercury Plus 400 spectrometer operating at 400 and 100\u2009MHz, respectively, in deuterochloroform  or hexadeuterodimethylsulfoxide  using tetramethylsilane (TMS) as internal reference (=0\u2009ppm for both nuclei). Chemical shifts are reported in parts per million  relative to TMS. The assignment of chemical shifts is based on standard NMR experiments . Uncalibrated purity was ascertained by LC\u2009\u2212\u2009UV using a reverse phase C18 chromatographic column. All of the biologically tested compounds exhibited purity 96\u2009\u2212\u200999% at wavelength 254\u2009nm. Melting points were measured on a micro heating stage PHMK 05  and were uncorrected.7-MEOTA was prepared at the University of Defense  by the previously described method3\u20138 (1.7\u2009mmol) and 11  were added to 20\u2009ml of dichloromethane and stirred for 48\u2009h at room temperature (RT). The mixture was concentrated under reduced pressure to give the crude product. Purification was performed by flash chromatography  to give 12\u201317 as a yellow solid. In a further step, the appropriate 7-MEOTA-THA product containing the thiourea moiety  was stirred in dry dichloromethane (25\u2009ml) with 2,4,6-trimethylbenzonitrile N-oxide  for 48\u2009h. The resulting mixture was subsequently evaporated under reduced pressure and purified by flash chromatography using CHCl3/MeOH (9:1) as eluent to yield 18\u201323 as white solids.Intermediates 1-ethyl)-3-thiourea12. Yellow solid : m.p.=142.1\u2013143.2\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.83 , 2.63 and 2.88 , 2.95 and 3.05 , 3.87 , 3.60 and 3.66 , 7.33 , 7.20 , 7.27 , 7.56 , 7.74 , 7.82 , 7.90 , 6.80 ; 13C\u00a0NMR (CDCl3) \u03b4 21.8, 22.0, 22.2, 22.4 , 24.6 and 25.3 , 32.2 and 33.6 , 42.5 and 46.8 , 55.7 (OCH3), 101.9 (C-8), 116.2 (C-9a), 119.6 (C-8a), 121.6 (C-6), 122.6 (C-8\u2032\u2032), 124.2 (C-8a\u2032\u2032), 126.5 (C-7\u2032\u2032), 128.8 , 129.1 (C-9a\u2032\u2032), 129.3 (C-6\u2032\u2032), 139.8 (C-9\u2032\u2032), 143.2 (C-10a), 147.2 (C-10a\u2032\u2032), 150.2 (C-9), 156.2 , 160.5 (C-4a\u2032\u2032), 181.5 (C\u2009=\u2009S); ESI-MS: m/z 512.2 [M]+ ; Anal. Calcd. for C30H33N5OS: C, 70.42; H, 6.50; N, 13.69; S, 6.27. Found: C, 70.37; H, 6.81; N, 13.78; S, 6.05.1-propyl)-3-thiourea13. Yellow solid : m.p.=106.3\u2013107.5\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.81 , 2.50 and 2.70 , 2.94 , 3.24 and 3.48 , 3.85 , 5.65 , 7.17 , 7.33 , 7.51 , 7.81 , 7.83 , 7.94 ; 13C\u00a0NMR (CDCl3) \u03b4 22.0, 22.2, 22.4, 22.6 , 24.8 and 25.3 , 30.6 (C-2\u2032), 33.6 , 43.3 and 42.3 , 55.7 (OCH3), 101.5 (C-8), 116.4 (C-9a), 120.6 (C-8a), 121.6 (C-6), 122.6 (C-8\u2032\u2032), 124.4 (C-8a\u2032\u2032), 126.3 (C-7\u2032\u2032), 128.5 , 129.1 , 139.0 (C-9\u2032\u2032), 143.0 (C-10a), 147.0 (C-10a\u2032\u2032), 150.5 (C-9), 156.3 , 160.3 (C-4a\u2032\u2032), 181.5 (C\u2009=\u2009S); ESI-MS: m/z 526.2 [M]+ ; Anal. Calcd. for C31H35N5OS: C, 70.82; H, 6.71; N, 13.32; S, 6.10. Found: C, 70.65; H, 6.67; N, 13.45; S, 6.01.1-butyl)-3-thiourea14. Yellow solid : m.p.=95.6\u201396.4\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.64 , 1.85 , 2.64 and 2.87 , 2.98 and 3.04 , 3.43 and 3.64 , 3.87 , 5.46 , 7.17 , 7.20 , 7.40 , 7.60 , 7.81 , 7.83 , 7.94 ; 13C\u00a0NMR (CDCl3) \u03b4 22.2, 22.4, 22.6, 22.8 , 24.7 and 25.3 , 26.5 and 28.6 , 32.8 and 33.8 , 44.8 and 48.1 , 55.6 (OCH3), 101.7 (C-8), 117.0 (C-9a), 120.7 (C-8a), 120.9 (C-6), 122.5 (C-8\u2032\u2032), 124.1 (C-8a\u2032\u2032), 126.7 (C-7\u2032\u2032), 128.8 , 129.1 (C-9a\u2032\u2032), 129.4 (C-6\u2032\u2032), 139.0 (C-9\u2032\u2032), 142.5 (C-10a), 147.3 (C-10a\u2032\u2032), 150.3 (C-9), 156.2 , 160.6 (C-4a\u2032\u2032), 181.4 (C=S); ESI-MS: m/z 540.2 [M]+ ; Anal. Calcd. for C32H37N5OS: C, 71.21; H, 6.91; N, 12.98; S, 5.94. Found: C, 71.19; H, 6.55; N, 13.26; S, 5.80.1-pentyl)-3-thiourea15. Yellow solid : m.p.=93.2\u201394.1\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.43 , 1.59 and 1.71 , 1.83 , 2.63 , 2.95 , 3.57 , 3.87 , 7.18 , 7.27 , 7.33 , 7.54 , 7.82 , 7.90 ; 13C\u00a0NMR (CDCl3) \u03b4 21.8, 22.2, 22.5, , 24.0 (C-3\u2032), 24.6 and 25.3 , 28.6 and 30.9 , 31.4 and 33.8 , 44.8 and 48.3 , 55.7 (OCH3), 102.3 (C-8), 117.0 (C-9a), 119.6 (C-8a), 121.6 (C-6), 122.6 (C-8\u2032\u2032), 124.3 (C-8a\u2032\u2032), 126.4 (C-7\u2032\u2032), 128.6 and 128.7 , 129.2 , 139.8 (C-9\u2032\u2032), 143.5 (C-10a), 147.1 (C-10a\u2032\u2032), 151.8 (C-9), 156.3 , 160.4 (C-4a\u2032\u2032), 181.5 (C\u2009=\u2009S); ESI-MS: m/z 554.3 [M]+ ; Anal. Calcd. for C33H39N5OS: C, 71.57; H, 7.10; N, 12.65; S, 5.79. Found: C, 71.23; H, 6.95; N, 12.88; S, 5.93.1-hexyl)-3-thiourea16. Yellow solid : m.p.=74.2\u201374.8\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.25 and 1.36 , 1.50 and 1.61 , 1.89 , 2.65 and 2.88 , 2.97 and 3.07 , 3.44 and 3.58 , 3.88 , 7.20 , 7.27 , 7.41 , 7.59 , 7.82 , 7.94 ; 13C\u00a0NMR (CDCl3) \u03b4 22.2, 22.3, 22.5, 22.7 , 24.6 and 25.3 , 26.3 and 26.4 , 28.8 and 31.4 , 32.6 and 33.8 , 45.1 and 48.6 , 55.5 (OCH3), 102.0 (C-8), 116.1 (C-9a), 120.4 (C-8a), 120.8 (C-6), 122.5 (C-8\u2032\u2032),124.2 (C-8a\u2032\u2032), 126.5 (C-7\u2032\u2032), 128.3 (C-5), 128.7 (C-5\u2032\u2032), 129.0 (C-9a\u2032\u2032), 129.3 (C-6\u2032\u2032), 138.2 (C-9\u2032\u2032), 142.0 (C-10a), 147.3 (C-10a\u2032\u2032), 150.7 (C-9), 156.0 (C-7), 154.8 (C-4a), 160.5 (C-4a\u2032\u2032), 181.2 (C\u2009=\u2009S); ESI-MS: m/z 568.3 [M]+ ; Anal. Calcd. for C33H39N5OS: C, 71.57; H, 7.10; N, 12.65; S, 5.79. Found: C, 71.23; H, 6.95; N, 12.88; S, 5.93.1-heptyl)-3-thiourea17. Yellow solid : m.p.=80.8\u201381.9\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.32 , 1.43 and 1.63 , 1.85 , 2.64 and 2.90 , 2.97 and 3.10 , 3.52 , 3.88 , 7.20 , 7.27 , 7.40 , 7.58 , 7.84 , 7.94 ; 13C\u00a0NMR (CDCl3) \u03b4 22.0, 22.2, 22.3, 22.6 , 24.5 and 25.3 , 26.5 (C-4\u2032), 28.6 and 28.7 , 30.3 and 31.3 , 31.7 and 33.9 , 45.2 and 48.6 , 55.6 (OCH3), 102.3 (C-8), 115.5 (C-9a), 120.0 (C-8a), 121.4 (C-6), 122.6 (C-8\u2032\u2032), 124.8 (C-8a\u2032\u2032), 126.4 (C-7\u2032\u2032), 128.7 , 129.2 , 139.7 (C-9\u2032\u2032), 145.2 (C-10a), 147.3 (C-10a\u2032\u2032), 151.3 (C-9), 156.2 , 160.5 (C-4a\u2032\u2032), 181.3 (C\u2009=\u2009S); ESI-MS: m/z 582.3 [M]+ ; Anal. Calcd. for C35H43N5OS: C, 72.25; H, 7.45; N, 12.04; S, 5.51. Found: C, 72.43; H, 7.58; N, 12.12; S, 5.43.1-ethyl)-3-urea18. White solid : m.p.=103.7\u2013104.8\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b41.70 , 2.66 and 2.81 , 3.0 , 3.66 and 3.93 , 3.85 , 7.20 , 7.26 , 7.31 , 7.42 , 7.83 , 7.91 , 8.0 , 9.05 ; 13C\u00a0NMR (CDCl3) \u03b4 22.2, 22.4, 22.5, 22.6 , 25.4 , 28.4 and 33.8 , 40.1 and 51.5 , 55.2 (OCH3), 102.1 (C-8), 116.5 (C-9a), 119.8 (C-8a), 121.1 (C-6), 123.2 (C-8\u2032\u2032), 125.3 (C-7\u2032\u2032), 124.5 (C-8a\u2032\u2032), 127.2 (C-5), 128.0 (C-5\u2032\u2032), 128.3 (C-6\u2032\u2032), 128.7 (C-9a\u2032\u2032), 139.9 (C-9\u2032\u2032), 146.6 , 150.0 (C-9), 155.4 (C-4a), 156.3 (C-7), 157.1 (C=O), 159.5 (C-4a\u2032\u2032); ESI-MS: m/z 496.2 [M]+ ; Anal. Calcd. for C30H33N5O2: C, 72.70; H, 6.71; N, 14.13. Found: C, 72.43; H, 6.35; N, 13.69.1-propyl)-3-urea19. White solid : m.p.=104.5\u2013105.4\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.72 , 2.56 and 2.77 , 2.84 and 2.95 , 3.34 and 3.50 , 3.85 , 6.01 , 7.20 , 7.26 , 7.30 , 7.43 , 7.70 , 7.82 , 8.35 ; 13C\u00a0NMR (CDCl3) \u03b4 22.4, 22.6 , 25.3 , 31.2 (C-2\u2032), 32.1 and 33.8 , 36.7 and 44.0 , 55.4 (OCH3), 101.5 (C-8), 114.6 (C-9a), 119.9 (C-8a), 122.0 (C-6), 122.9 (C-8\u2032\u2032), 124.6 (C-8a\u2032\u2032), 125.3 (C-7\u2032\u2032), 127.3 (C-5), 128.2 (C-5\u2032\u2032), 128.4 , 139.8 (C-9\u2032\u2032), 146.8 , 152.1 (C-9), 153.3 (C-4a), 156.1 (C-7), 157.6 (C=O), 159.7 (C-4a\u2032\u2032); ESI-MS: m/z 510.2 [M]+ ; Anal. Calcd. for C31H35N5O2: C, 73.06; H, 6.92; N, 13.74. Found: C, 73.42; H, 6.86; N, 13.95.1-butyl)-3-urea20. White solid : m.p.=69.2\u201369.8\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.70 , 1.80 , 2.57 and 2.80 , 2.90 and 3.0 , 3.40 and 3.50 , 3.85 , 4.50 , 6.15 , 7.20 , 7.26 , 7.30 , 7.43 , 7.75 , 7.84 ; 13C\u00a0NMR (CDCl3) \u03b4 22.1, 22.4, 22.5, 22.6 , 24.6 and 25.3 , 27.5 and 28.5 , 32.0 and 33.8 , 39.5 and 48.1 , 55.5 (OCH3), 102.1 (C-8), 115.6 (C-9a), 120.1 (C-8a), 121.1 (C-6), 122.7 (C-8\u2032\u2032), 124.4 (C-8a\u2032\u2032), 125.4 (C-7\u2032\u2032), 127.4 (C-9a\u2032\u2032), 128.2 (C-5), 128.5 , 139.5 (C-9\u2032\u2032), 146.8 , 151.1 (C-9), 154.2 (C-4a), 156.1 (C-7), 156.4 (C=O), 159.7 (C-4a\u2032\u2032); ESI-MS: m/z 524.3 [M]+ ; Anal. Calcd for C32H37N5O2: C, 73.39; H, 7.12; N, 13.37. Found: C, 73.68; H, 7.34; N, 13.48.1-pentyl)-3-urea21. White solid : m.p.=114.2\u2013114.9\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.43 , 1.55 and 1.66 , 1.80 , 2.56 and 2.73 , 2.98 and 3.02 , 3.30 , 3.85 , 5.62 , 7.20 , 7.26 , 7.27 , 7.43 , 7.67 , 7.77 , 7.82 , 7.84 ; 13C\u00a0NMR (CDCl3) \u03b4 22.9, 23.1 , 24.8 (C-3\u2032), 24.7 and 25.4 , 29.0 and 33.4 , 30.7 and 31.2 , 40.4 and 48.5 , 56.4 (OCH3), 102.2 (C-8), 115.7 (C-9a), 120.3 (C-8a), 121.0 (C-6), 122.8 (C-8\u2032\u2032), 124.5 (C-8a\u2032\u2032), 125.3 (C-7\u2032\u2032), 127.3 (C-5), 127.8 (C-9a\u2032\u2032), 128.2 (C-5\u2032\u2032), 128.5 (C-6\u2032\u2032), 139.2 (C-9\u2032\u2032), 143.5 (C-10a), 145.8 (C-10a\u2032\u2032), 150.5 (C-9), 154.9 (C-4a), 156.1 (C-7), 156.3 (C=O), 160.1 (C-4a\u2032\u2032); ESI-MS: m/z 538.3 [M]+ ; Anal. Calcd for C33H39N5O2: C, 73.71; H, 7.31; N, 13.02. Found: C, 73.39; H, 7.35; N, 13.33.1-hexyl)-3-urea22. White solid : m.p.=91.4\u201392.1\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.32 , 1.57 , 1.80 , 2.57 and 2.77 , 2.90 and 2.97 , 3.10 and 3.40 , 3.85 , 4.52 , 5.82 , 7.15 , 7.23 , 7.43 , 7.68 , 7.74 , 7.82 ; 13C-NMR (CDCl3) \u03b4 22.1, 22.4, 22.7 , 24.6 and 25.3 , 26.2 , 29.9 and 31.3 , 32.1 and 33.8 , 39.8 and 48.2 , 55.6 (OCH3), 102.2 (C-8), 115.5 (C-9a), 120.1 (C-8a), 121.1 (C-6), 122.8 (C-8\u2032\u2032), 124.5 (C-8a\u2032\u2032), 125.4 (C-7\u2032\u2032), 127.4 (C-9a\u2032\u2032), 127.5 (C-5), 128.2 (C-5\u2032\u2032), 128.5 (C-6\u2032\u2032), 139.6 (C-9\u2032\u2032), 140.5 (C-10a), 146.8 (C-10a\u2032\u2032), 151.2 (C-9), 154.2 (C-4a), 156.1 (C-7), 156.4 (C=O), 159.7 (C-4a\u2032\u2032); ESI-MS: m/z 552.3 [M]+ ; Anal. Calcd for C34H41N5O2: C, 74.02; H, 7.49; N, 12.69. Found: C, 74.48; H, 7.15; N, 12.88.1-heptyl)-3-urea23. White solid : m.p.=66.4\u201367.4\u2009\u00b0C; 1H\u00a0NMR (CDCl3) \u03b4 1.25 , 1.58 and 1.74 , 1.80 , 2.62 and 2.77 , 2.93 and 3.0 , 3.08 , 3.41 , 3.86 , 5.62 , 7.18 , 7.26 , 7.46 , 7.57 , 7.77 , 7.83 ; 13C\u00a0NMR (CDCl3) \u03b4 22.3, 22.4, 22.6, 22.7 , 24.5 and 25.3 , 26.6 (C-4\u2032), 28.6 and 28.8 , 30.3 and 31.3 , 32.4 and 33.8 , 40.0 and 48.6 , 55.5 (OCH3), 102.1 (C-8), 115.8 (C-9a), 120.3 (C-8a), 120.9 (C-6), 122.8 (C-8\u2032\u2032), 124.5 (C-8a\u2032\u2032), 125.4 (C-7\u2032\u2032), 127.4 (C-5), 128.1 (C-9a\u2032\u2032), 128.5 , 139.5 (C-9\u2032\u2032), 141.1 (C-10a), 146.8 (C-10a\u2032\u2032), 150.9 (C-9), 154.6 (C-4a), 156.0 (C-7), 156.3 (C=O), 159.7 (C-4a\u2032\u2032); ESI-MS: m/z 566.3 [M]+ ; Anal. Calcd for C35H43N5O2: C, 74.30; H, 7.66; N, 12.38. Found: C, 74.55; H, 7.95; N, 12.36.12\u201322 combining the two fragments via a linker of varying length and containing either urea or thiourea moieties. In conclusion, extensive comparative biochemical, biophysical and biological measurements consistently indicated that 12\u201322 acted as DNA-binders and inhibitors of Topo I/II, and were able to affect the MMP and viability of HL-60 cells and suppress selectively cancer cell proliferation.In this study, we developed novel 7-MEOTA-THA heterodimers 6\u00a0M\u22121. The obtained K for the heterodimers complexed with ctDNA were higher than K for THA (K\u2009=\u20093.8\u2009\u00d7\u2009104\u00a0M\u22121) and 7-MEOTA (K\u2009=\u20097.9\u2009\u00d7\u2009104\u00a0M\u22121) complexed with ctDNA, and moreover were comparable with K for the acridine\u2013ctDNA complex (K\u2009=\u20094.5\u2009\u00d7\u2009106\u00a0M\u22121). Data from fluorescence quenching experiments clearly demonstrated that ctDNA can quench fluorescence of the studied heterodimers, by static quenching. The latter correlates well with decreasing KSV values and increasing temperatures and was further confirmed by obtained values of kq (4.77\u201310.69\u2009\u00d7\u20091011\u00a0M\u22121\u00a0s\u22121) which were higher than the limiting diffusion rate constant for dynamic quenching. Thermodynamic parameters  indicated that hydrophobic interactions play the key role in the binding of novel compounds to ctDNA, except in the case of heterodimers 16 and 20 which revealed a different pattern of negative \u0394H and \u0394S, pointing to van der Waals associations with ctDNA. The existence of LD signals also demonstrated that 12\u201322 interact with DNA and become oriented after attachment to DNA.In summary, spectroscopic data proved that linking of THA and 7-MEOTA with an alkyl linker containing thio-/urea moieties positively influenced the DNA interaction power. From UV\u2013vis absorption spectroscopic titration were calculated DNA-binding constants K\u2009=\u20090.5\u20138.0\u2009\u00d7\u20091017 and urea hybrid 22 can be highlighted as the most potent. The studied heterodimers 14\u201317 and 21, 22 were able to evoke MMP dissipation after 24\u2009h treatment and caused cell death with an efficiency between 80 and 100%. In addition, thioureas 14\u201317 significantly altered cell cycle progression and induced block of the cell cycle in S phase, and ureas 21, 22 demonstrated an increase of cells in G1 phase.Based on all the obtained biological positive outcomes, 7-MEOTA-THA thio-/ureas can be considered as interesting and potential drug candidates as anticancer agents. This assertion is supported by the fact that they are able to affect cancer cell lines, whereas they remained unattached in healthy non-cancer fibroblasts at the tested concentration. The more effective heterodimers are those which contain longer alkyl chains. The higher antiproliferative effect of the more lipophilic agents containing either pentyl or hexyl chains could be ascribed to better cell membrane penetration. In this regard, thiourea hybrid We believe that our study can contribute towards further development of novel, more potent and highly selective antiproliferative agents with intercalating properties."}
{"text": "Adult-onset Still\u2019s disease (AOSD) is a rare inflammatory condition characterized by fever, rash, and arthritis. Because of its rarity, clinical trials are inherently small and often uncontrolled. Our objective was to develop recommendations for the use of interleukin (IL)-1 inhibitors in the management of patients with AOSD, based on the best evidence and expert opinion.A panel of 10 experts (9 rheumatologists and 1 pediatrician) was established. The first step was dedicated to a comprehensive literature review and development of statements. Two separate literature searches were performed on the MEDLINE (Pubmed), EMBASE, and BIOSIS databases through April 2018 to identify (1) differences and similarities between AOSD and pediatric Still\u2019s disease (systemic juvenile idiopathic arthritis [SJIA]) and (2) the efficacy and safety of IL-1 inhibitors in AOSD treatment. In the second step, the statements were submitted in a Delphi process to a panel of 67 rheumatologists. Consensus threshold was set at 66%: positive, >\u200966% of voters selected scores 3 to 5; negative, >\u200966% of voters selected scores 1 or 2. In the third step, the voting results were analyzed, and the statements were finalized.Eleven statements were developed. Forty-six of 67 rheumatologists (72%) participated in the Delphi process. A positive consensus was reached after the first round of voting and was full (>\u200995%) on the majority of statements. A large consensus was achieved in considering AOSD and SJIA as the same disease. The use of anti-IL-1 therapies in refractory patients was considered quite safe and effective both as the first and as a subsequent line of biologic treatment, especially in systemic patients. Because of the lack of head-to-head comparisons, a different profile of efficacy among IL-1 inhibitors could not be established. There was a large consensus that failure of the first IL-1 inhibitor does not preclude response to another one. The lack of studies comparing early versus late treatment did not allow to draw conclusions; however, data from SJIA suggest a better response in early treatment.The Delphi method was used to develop recommendations that we hope will help clinicians in the management of patients with AOSD refractory to conventional therapies. Still\u2019s disease is a rare systemic inflammatory disorder that can develop both in adults and children and is characterized by a wide spectrum of manifestations, including a typical triad of symptoms: daily spiking fever, polyarthritis, and a characteristic salmon-colored skin rash . Still\u2019sThe pathophysiology of Still\u2019s disease is largely unknown, but recent advances have identified interleukin (IL)-1\u03b2 as a crucial inflammatory mediator , 11. BotTo date, there are no guidelines for the management of Still\u2019s disease, and the treatment of this condition is mostly empirical and challenging for many clinicians. Because of the rarity of the disease, very few clinical studies are available. Specifically, there is only one randomized controlled trial (RCT) on the use of anakinra in patients with AOSD , and datA panel composed of 9 Italian rheumatologists and 1 pediatrician expert in pediatric rheumatology (scientific board of the project) were chosen based on their clinical experience and expertise in the treatment of Still\u2019s disease  comprehensive literature review and writing of statements; (ii) evaluation of statements by a panel of rheumatologists, who were asked to express their agreement or disagreement on each statement; and (iii) assessment of voting results and finalization of the statements.The first step involved two meetings. The first meeting was held in Milan on April 3, 2018, and was attended by the scientific board and by 4 additional rheumatologists , who were responsible for the search and selection of the literature (bibliographic board). The aim of this meeting was to design the strategy of the literature search. During the second meeting, held on September 10, 2018, the bibliographic board presented the results of the literature search. Based on the results of the literature review, 11 statements were drafted. The level of evidence (range 1\u20135) and the grade of recommendation (range A\u2013D) were assigned to each statement according to the Oxford Centre for Evidence-Based Medicine .In the second step of the consensus process (the Delphi portion), the statements were circulated electronically to a panel of 67 rheumatologists from 31 Italian rheumatology centers; since AOSD is a rare disease requiring specialist management, these rheumatologists were all members of the Working Group of Systemic Autoinflammatory Diseases of the Societ\u00e0 Italiana Reumatologia  and were from all areas of Italy . No start date for the literature search was defined, but the end date was April 20, 2018.First, a systematic literature review was performed to identify reports describing the similarities and differences of SJIA and AOSD. A search strategy was developed using Mesh (or Emtree) terms and free-text words identifying AOSD and SJIA  efficacy and safety of IL-1 inhibitors in general, (2) comparative efficacy and safety of different IL-1 inhibitors, (3) comparison of early versus late treatment with IL-1 inhibitors, and (4) relative efficacy of IL-1 inhibitors in patients with a systemic versus chronic articular pattern of AOSD. Each clinical question was phrased according to the Patient, Intervention, Control, Outcomes (PICO) strategy for study selection. The main database searches were complemented by a manual search of proceedings from the European League Against Rheumatism (EULAR) and American College of Rheumatology (ACR) congresses of the previous 2\u00a0years (2016 and 2017) and also by scrutinizing the reference lists of included articles. A search strategy was developed using Mesh (or Emtree) terms and free-text words identifying AOSD, along with potential terms for anti-IL-1 agents  are shown in Table\u00a0A total of 49 rheumatologists out of the 67 invited by the scientific board participated in the Delphi process (72% participation rate). The threshold for positive consensus (>\u200966% agreement) was reached on each statement during the first round of voting, and no additional Delphi rounds were required. Consensus exceeded 95% for the majority of statements.Statement 1.1. Adult Onset Still\u2019s Disease (AOSD) and Systemic Juvenile Idiopathic Arthritis (SJIA) show substantial similarities in terms of clinical manifestations [3b], laboratory features [3b], response to treatment [3b] and, possibly, genetic background . . [Grade B]Statement 2.2. In AOSD, treatment with IL-1 Inhibitors is effective on different clinical and laboratory parameters and displays a significant steroid-sparing effect in most patients [2a]. Therapeutic response is rapid and sustained over time. [Grade B]Statement 2.3. IL-1 inhibitors are effective in the treatment of AOSD-related Macrophage Activation Syndrome (MAS) , althougStatement 2.4. IL-1 Inhibitors have an overall satisfactory safety profile in AOSD [2b]. Among adverse events, infections have been reported [2b]. Treatment with anakinra has been associated with frequent injection-site reactions [2b] and occasionally severe cases of hepatotoxicity, reversible after treatment withdrawal . . [Grade B]Early use (soon after disease onset) of IL-1 inhibitors in AOSD has not been explored yet. Direct comparisons of early versus late initiation of treatment with IL-1 inhibitors are also not available. The evidence from studies in SJIA suggests that early treatment with anti-IL-1 therapy is associated with a better response and that IL-1 inhibitors may be a valuable option in the first-line disease setting , 143\u2013145Statement 5.1. Some data suggest that IL-1 inhibitors may be more effective on systemic rather than chronic articular manifestations of AOSD [2b]. [Grade C]n\u2009=\u200915) compared to 38.4% of patients with the chronic articular pattern (n\u2009=\u200913) [n\u2009=\u200912) compared to 37.5% of patients with articular disease (n\u2009=\u20098) [To date, there is no study specifically aimed at comparing the effects of anti-IL-1 therapy on systemic versus articular manifestations of AOSD. However, indirect evidence suggests that anti-IL-1 agents may be more effective at relieving systemic disease , 70, 77.(n\u2009=\u200913) . A much  (n\u2009=\u20098) , 146\u2013148A large body of evidence supports the similarity between AOSD and SJIA. Furthermore, both conditions respond to agents that inhibit IL-1\u03b2 by distinct mechanisms, which confirm the pivotal role of IL-1\u03b2 in the pathogenesis of these conditions.The likely differences in pharmacokinetics and pharmacogenetics between AOSD and SJIA do not allow us to extrapolate information on the effectiveness and safety profile of IL-1 inhibitors from SJIA to AOSD. This is the main reason why we decided to perform this systematic review of the literature specifically on AOSD. The aim of this study was to clearly collect and summarize all of the available evidence supporting the use of IL-1 inhibitors specifically in patients with AOSD, for which information is scarce compared with SJIA. While studies on the pharmacokinetics of anakinra  or canakMost of the data on the efficacy and safety of IL-1 blockers in AOSD describe the use of anakinra, and the evidence from RCTs is limited to one small study investigating this medication . NeverthWe used a modified Delphi process to develop the reported consensus statements. This technique has the advantage of being able to systematically synthesize the knowledge and opinions of a large group of individuals with diverse expertise and from different geographic locations, thereby limiting the potential for a small group of experts from one area to dominate  Appendi. By collmaking the best use of available information [Our study is not without limitations. We set a relatively low threshold for consensus (>\u200966%) , althougormation . Howeverormation , while dormation , 76, 77.ormation .Although the evidence of the overall efficacy of anti-IL1 agents in patients with AOSD, especially in those with the systemic form of the disease, is quite convincing, the effectiveness of these medications on articular involvement should be further explored. For this reason, the results of the ongoing RCT with canakinumab (NCT02204293) in patients with AOSD and active joint involvement are eagerly awaited.Data on anakinra in patients with AOSD are mainly based on retrospective observational studies. Following the only existing RCT of anakinra in patients with AOSD, the results of which were published in 2012 ; a new RAlthough adequately powered RCTs on the use of IL-1 inhibitors in AOSD are lacking, the literature is consistent in demonstrating a beneficial effect of these agents, with a high proportion of patients achieving rapid and sustained remission of systemic symptoms and normalization of inflammatory markers. Given the absence of a strong evidence base for the use of IL-1 inhibitors in AOSD, a robust and careful Delphi process was undertaken to develop consensus recommendations on the use of these agents, which we hope will assist physicians in the rational prescribing of these agents for patients affected by this condition.Additional file 1: Table S1. Search strategy\u2020 to identify articles describing similarities and differences between SJIA and AOSD. Table S2. Search strategy\u2020 to identify articles describing the efficacy and safety of IL-1 blockade in AOSD. Table S3. Case reports (with \u22645 patients) describing the use of anti-IL-1 therapy in patients with AOSD."}
{"text": "Fecal incontinence is a socially and emotionally destructive condition that has a negative impact on personal image, self-confidence, and quality of life. Acupuncture is commonly used to treat chronic conditions, including fecal incontinence. However, no relevant systematic review or meta-analysis has been designed to evaluate the effects of acupuncture on fecal incontinence.We will identify relevant randomized controlled trials (RCTs) from the Cochrane Library, Medline, Embase, PubMed, Springer, Web of Science, China National Knowledge Infrastructure, VIP Chinese Science and Technology Journals Database, Wanfang database, and clinical trial registration center from their inception to February 28, 2019. The primary outcome measures will be clinical effective rate, functional outcomes, and quality of life. Data that meets the inclusion criteria will be extracted and analyzed using RevMan V.5.3 software. Two reviewers will evaluate the studies using the Cochrane Collaboration risk of bias tool. Publication bias will be assessed by funnel plots, Egger test, and Begg test using the Stata software. Acupoints characteristics will be analyzed by Traditional Chinese Medicine inheritance support system.This study will analyze the clinical effective rate, functional outcomes, quality of life, daily average number of fecal incontinence, and effective prescriptions of acupuncture for patients with fecal incontinence.Our findings will provide evidence for the effectiveness and potential treatment prescriptions of acupuncture for patients with fecal incontinence.PROSPERO CRD42019119680. It has been confirmed in numerous studies that fecal incontinence affects personal image and self-confidence, and even leads to social isolation, resulting in a significant impact on quality of life.,4 Previous studies have also shown that obstetric trauma and irritable bowel syndrome are common risk factors for fecal incontinence.,6 Currently, management or treatment measures for fecal incontinence include bowel routines, changing dietary habits, biofeedback training, electrostimulation, and surgical interventions, as well as supportive care measures such as pads, deodorants, and protective ointments.,8 However, only 46% of patients who underwent surgery for prolapse reported continence improvement at 38.9 months of follow-up, while those who underwent an operative procedure other than ventral rectopexy were similar to nonoperated patients. Therefore, a growing number of people are seeking conservative therapies, including dietary changes, antidiarrheal medications, bulking agents, enemas, and biofeedback,,11 as well as complementary and alternative therapy.Fecal incontinence is characterized by the impaired ability to control stool or gas to allow evacuation at a socially acceptable time and location, Compared with sham acupuncture, acupuncture at the lumbosacral region is effective for women suffering from stress urinary incontinence; the similar but slightly different clinical outcomes can be seen in nerve stimulation, which may also have an impact on functional outcomes or quality of life of patients with fecal incontinence. In recent years, the number of clinical trials involving acupuncture treatment of fecal incontinence has increased significantly,17; however, the clinical efficacy and potential treatment prescriptions of acupuncture for fecal incontinence remain unclear, prompting us to further explore its efficacy and effective prescription. In this study, we will investigate current evidence associated with the effectiveness and safety of acupuncture for fecal incontinence, which will help clinicians use it in clinical practice better.As a kind of complementary and alternative therapy, acupuncture is often used to treat chronic functional diseases, and its application in fecal incontinence has gradually spread in recent years.22.1We will collect articles of randomized controlled trials (RCTs) that evaluated the clinical effective rate, functional outcomes, quality of life, daily average number of fecal incontinence, or side effects of acupuncture on fecal incontinence for systematic review and meta-analysis. RCTs, observational studies, case series, and case\u2013control studies will be included for data mining. Observational studies, case series, case\u2013control studies, animal experiments, qualitative studies, proceedings, conferences, comments, and review articles will be excluded in the meta-analysis. There will be no restrictions regarding the race, region of the studies, gender, and age of patients.2.2 Participants with urinary and fecal incontinence will be excluded.Participants who are diagnosed with fecal incontinence will be included. Fecal incontinence should be confirmed according to the 1999 consensus standard of the American Association of Colorectal Surgeons.2.3Participants in the intervention group are those undergoing acupuncture, including electroacupuncture therapy, acupuncture alone, laser acupuncture, and warm acupuncture. There will not be any restrictions on age and original countries of the participants. Control group intervention could be no treatment, sham or placebo acupuncture, electrical stimulation, etc. The other treatments between intervention group and control group should be the same.2.4 The criteria of quality of life according to the Fecal Incontinence Quality of Life Scale was developed by Rockwood et al, including thoughts about lifestyle, depression/self-perception, coping/behavior, and embarrassment. The Fecal Incontinence Quality of Life Scale measures impairment caused by fecal incontinence or fear of fecal incontinence, ranging from 1 (most of the time) to 4 (none of the time).The primary outcomes will include clinical effective rate, functional outcomes, quality of life. Functional outcomes will be calculated on the basis of the Wexner score.The secondary outcomes will be daily average number of fecal incontinence, adverse events, and discontinuations due to adverse events.2.5www.controlled-trials.com; Clinical Trials: www.ClinicalTrials.gov; and Chinese Clinical Trial Registry: www.chictr.org.cn/index.aspx.An electronic search will be conducted. We will identify relevant studies from The Cochrane Library, Medline (Ovid), Embase, PubMed, Springer, Web of Science, China National Knowledge Infrastructure, VIP Chinese Science and Technology Journals Database, Wanfang database from their inception to February 28, 2019. The search term will consist of 3 parts: intervention method, disease, and study type: (\u201celectroacupuncture therapy\u201d or \u201cacupuncture\u201d or \u201claser acupuncture\u201d or \u201cwarm acupuncture\u201d or \u201celectroacupuncture\u201d or \u201cacupuncture therapy\u201d or \u201claser acupuncture therapy\u201d or \u201cwarm acupuncture therapy\u201d) and  and  and (\u201cblind\u201d). The details of the PubMed and Wanfang database search strategies are provided in Tables 2.6http://www.inoteexpress.com/aegean/). Duplicate citations from different databases will be identified and excluded. Two reviewers (Lin HX and Hu GJ) will independently screen the titles and abstracts of citations to delete irrelevant studies, and then examine the full-text reports, identify potential studies, and assess eligibility of studies for inclusion. Any disagreement will be resolved on the eligibility of studies through discussion and consensus or, if necessary, with the help of a third partner (Chen YJ). We will record details of the excluded studies and the reasons for exclusion. The selection process will be showed in a PRISMA flow chart (http://www.prisma-statement.org/)  with experience in the field will guide the search. All retrieved results will be imported into NoteExpress 3.2.0 (Available at: g/) Fig. . Two rev2.7We will obtain the missing data or additional information by contacting the study authors via email or telephone if possible. Otherwise, we will analyze the available information and conduct sensitivity analysis to explore the potential impact of insufficient information on the results of the meta-analysis.2.8Two review authors  will independently evaluate each included study and will follow the domain-based evaluation as developed by the Cochrane Handbook for Systematic Reviews of Interventions. They will assess the following domains: Randomization sequence generation, allocation concealment, blinding of outcome assessors, incomplete outcome data, selective outcome reporting, other sources of bias. Each domain will be divided into 3 categories: low, unclear, and high.2.9https://community.cochrane.org/help/tools-and-software/revman-5) provided by The Cochrane Collaboration. A meta-analysis using random or fixed effects models will be conducted to summarize the data. Continuous data will be pooled and presented as mean differences or standardized mean difference with their 95% CI. Dichotomous data will be pooled and expressed as risk ratio with their 95% CI. Statistical heterogeneity will be investigated using the Chi-square test and I2 values. We will interpret it using the following criteria: I2 values of 25% are considered low levels of heterogeneity, 50% indicated moderate levels, and 75% indicated high levels. As low or moderate heterogeneity suggests little variability among these studies, the data will be analyzed in a fixed-effects model. When significant heterogeneity occurs among the studies , a random-effect model will be performed to analyze the data, as well as meta-regression will be adopted to investigate the potential sources of heterogeneity.Effect sizes with their 95% confidence intervals (95% CIs) will be extracted. We will analyze the data using RevMan software (Version 5.3) .3 It is a socially and emotionally destructive disease that has a negative impact on quality of life of suffers. In the United States, the 4-year incidence of fecal incontinence among the community residents over 65 years old is 17%. And the prevalence increases with age, affecting 16.16% of adults over the age of 70. At the same time, previous studies have confirmed that advancing age, pelvic floor dysfunction, parity, stool form disturbance, urinary incontinence, and multiple chronic diseases are potential pathophysiological mechanisms of fecal incontinence.\u201332 At present, the treatment of fecal incontinence vary from medical methods, including biofeedback to various surgical interventions, but the results are still unsatisfactory.,34 A number of patients with fecal incontinence attempt to use complementary and alternative therapy, including acupuncture.Fecal incontinence is an embarrassing condition involving unintentional loss of solid or liquid feces.,35 It is confirmed that acupuncture could relieve pain and regulate peripheral circulation, which is beneficial for bladder dysfunction and even gastrointestinal dysfunction. Besides, electroacupuncture stimulation combined with bone marrow mesenchymal stem cell transplantation can effectively repair the impaired anal sphincters. Therefore, acupuncture is gradually being applied to the treatment of fecal incontinence. To the best of our knowledge, even though acupuncture is often used for fecal incontinence, there is no planned or published systematic review of the effectiveness and safety of acupuncture for fecal incontinence. The purpose of this study is to evaluate the effect of acupuncture on clinical effective rate, functional outcomes, quality of life, daily average number of fecal incontinence, adverse events, and discontinuations events in patients with fecal incontinence. In particular, we will analyze specific acupuncture prescriptions that are used in fecal incontinence by Traditional Chinese Medicine Inheritance Support System. Herein, this study will be the first to assess the clinical efficacy and effective prescriptions of acupuncture for patients with fecal incontinence, and may benefit practitioners in the fields of complementary and alternative therapies.Adequate anorectal sensation combined with pelvic floor muscle strength helps maintain fecal continence.4Ethics approval is not required due to this work is carried out on published data. We aimed to explore the clinical effective rate, functional outcomes, quality of life, daily average number of fecal incontinence, as well as effective prescriptions of acupuncture for patients with fecal incontinence. In the end, the results will be submitted to a peer-reviewed journal.Lin HX and Wang XT had the original idea of this work and drafted the protocol. Hu GJ and Zhang ZQ designed the search strategies. Chen YJ proposed some advice for the design and revision. Lin CN designed the flow chart. All authors critically revised the draft and approved the final manuscript.Conceptualization: Haixiong Lin, Xiaotong Wang.Data curation: Zhiqing Zhang, Guijuan Hu, Xiaotong Wang.Formal analysis: Haixiong Lin, Xiaotong Wang.Funding acquisition: Yongjun Chen.Methodology: Guijuan Hu, Chunni Lin.Project administration: Xiaotong Wang, Yongjun Chen.Resources: Haixiong Lin, Zhiqing Zhang, Guijuan Hu, Xiaotong Wang.Software: Xiaotong Wang, Chunni Lin.Supervision: Yongjun Chen.Validation: Haixiong Lin, Xiaotong Wang.Visualization: Yongjun Chen.Writing \u2013 original draft: Haixiong Lin, Xiaotong Wang.Writing \u2013 review & editing: Zhiqing Zhang, Guijuan Hu, Yongjun Chen.Haixiong Lin orcid: 0000-0002-9939-7698."}
{"text": "The higher MCLR dose increased expression of genes involved in fibrosis and inflammation in the control and HFHC groups. These data suggest MCLR toxicity in the context of preexisting NASH may drive the liver to a more severe phenotype that resembles burnt-out NASH.Microcystin-LR (MCLR) is a hepatotoxic cyanotoxin reported to cause a phenotype similar to nonalcoholic steatohepatitis (NASH). NASH is a common progressive liver disease that advances in severity due to exogenous stressors such as poor diet and toxicant exposure. Our objective was to determine how sub-chronic MCLR toxicity affects preexisting diet-induced NASH. Sprague-Dawley rats were fed one of three diets for 10 weeks: control, methionine and choline deficient (MCD), or high fat/high cholesterol (HFHC). After six weeks of diet, animals received vehicle, 10 \u00b5g/kg, or 30 \u00b5g/kg MCLR via intraperitoneal injection every other day for the final 4 weeks. Incidence and severity scoring of histopathology endpoints suggested that MCLR toxicity drove NASH to a less fatty and more fibrotic state. In general, expression of genes involved in  Photoautotrophic cyanobacteria are increasingly prevalent and persistent in the environment as a result of anthropogenic activity and global warming ,2. CyanoMultiple epidemiological and exposure studies have linked MCLR with liver damage. For example, an association between MCLR exposure and serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) was reported in a Chinese fisherman population exposed to TDI levels of MCLR (2.2\u20133.9 \u00b5g/day) . In addiThe most common chronic liver disease in the United States is nonalcoholic fatty liver disease (NAFLD), and the worldwide prevalence of NAFLD is estimated to be ~25% . NALFD iA potential role of microcystins in NALFD development and progression has been previously suggested. Recently, a correlation between algal blooms and county level incidences of NAFLD in the United States was reported using a novel satellite imaging technique . In addiThe interaction between preexisting NASH with MCLR toxicity was determined using common dietary models of NASH and a common sub-chronic MCLR treatment design  ,37,38,39Final body, liver, and spleen weights are shown in Plasma ALT is a potential biomarker for MCLR-induced liver toxicity and NALFD ,46,47,48An analysis of plasma insulin and glucose levels revealed similarities between the control and HFHC groups in response to MCLR exposure  . It has Slco1b2 mRNA expression were observed  and inhibiting its activity ,66. In oPP2A/C-bound MCLR can be measured by western blot using an MCLR specific antibody . As expede novo lipogenesis, fatty acid oxidation, and export of lipids [The progression of NASH to a more severe pathophysiological phenotype is characterized by the loss of steatosis and an increase in inflammation and fibrosis . In our f lipids .de novo lipogenesis are shown in Cd36 in rodent models can exacerbate steatosis potentially due to increased de novo lipogenesis and decreased very low lipoprotein (VLDL) secretion [Cd36 expression in the HFHC group  catalyzes the rate-limiting step in the conversion of saturated fatty acids to mono-unsaturated fatty acids. Total or liver specific knockout of fibrosis ,75. Scd ol group D, suggesde novo lipogenesis, and ACC1 inhibition is currently being explored as a target for NAFLD treatment by reducing steatosis [Acc1 in the control group, and 30 \u00b5g/kg MCLR decreased Acc1 gene expression in the MCD group (Acc1 may play a role in the modulation of steatosis after MCLR exposure. Acetyl CoA carboxylase-1 (ACC1) is another integral enzyme in teatosis . Both MCCD group E, suggesde novo lipogenesis [Srebp1 and there was a significant difference between the control 30 \u00b5g/kg group and the HFHC 30 \u00b5g/kg group  and carbohydrate regulatory element-binding protein (ChREBP) are two key transcription factors involved in regulating the genes involved in ogenesis ,77,78. Tkg group B. In cont groups C. Liver-exposure . CollectAcadl) and acetyl-CoA acyltransferase-2 (Acaa2) (Acadm), hydroxyacyl-CoA dehydrogenase (Hadh), acyl-CoA oxidase-1 (Acox1), carnitine palmitoyltransferase-1A (Cpt1), and carnitine palmitoyltransferase-2 (Cpt2)  A,G. Acco2 (Cpt2) B\u2013G. MCLRol group B,C. ThesGpat) is the rate-limiting enzyme, and diaclyglycerol O-acyltransferase 2 (Dgat2) catalyzes the final step [Gpat and Dgat2 expression (Gpat or Dgat2 prevents steatosis in mouse models [Mttp) gene is involved in producing lipoproteins responsible for lipid export from hepatocytes. Mttp expression increased after MCLR exposure  after MCLR exposure, whereas the HFHC group exhibited changes in interleukin-6 (IL-6) interleukin-1\u03b2 (IL-1\u03b2), interleukin-10 (IL-10), and chemokine C-X-C motif ligand 2 (CxCl2)  . In cont to NASH . The reaTgf\u03b2), collagen type 1 alpha 1 chain (Col1a1), cellular communication network factor 2 (Ccn2), and smooth muscle actin alpha 2 (Acta2) gene expression in the control and HFHC groups  ,50,93,94Three diets were utilized in this study: a control diet , an MCD diet (Dyets Inc. Cat. 518810), and a HFHC diet . These diets were selected based on their strengths and weaknesses in recapitulating features of clinical NASH. The control diet produces a healthy phenotype, while the MCD and HFHC diets are established dietary models used to produce a NASH phenotype. The two NASH diets have their respective strengths and weaknesses. The MCD diet replicates NASH liver pathology and is reported as a good model to study NAFLD progression because it causes steatosis, inflammation, oxidative stress, and fibrosis in a short period of time (less than 6 weeks) ,97,98,99The MCLR exposure scenario  is commonly utilized to study sub-chronic MCLR toxicity and was selected to isolate hepatic exposure and toxicity mechanisms from those occurring in the gastrointestinal tract ,39,40,41g for 5 min at 4 \u00b0C and plasma was removed and stored at \u221280 \u00b0C until further analysis. Animals were housed in metabolic cages starting 24 h prior to, and 24 h after, the first and last MCLR doses (48-h housing duration each time). Twenty-four hours after the final MCLR injection, animals were euthanized by carbon-dioxide asphyxiation and tissues were collected. Portions of tissues were formalin fixed for histopathological scoring or snap frozen for total RNA isolation or protein isolation.Animals were divided into three groups (n = 18 per group) and fed one of the diets listed above for 6 weeks, at which point each diet group was further divided into three treatment groups (n = 6 per group): vehicle , 10 \u00b5g/kg MCLR, or 30 \u00b5g/kg MCLR . The aniChrebp), Sterol regulatory element-binding protein 1 (Srebp1), Acetyl CoA Carboxylase 1 (Acc1), stearoyl CoA desaturase (Scd), Cluster of differentiation 36 (Cd36), Transforming growth factor \u03b2 (Tgf\u03b2), Collagen type 1 alpha 1 (Col1a1), Cellular communication network-2 (Ccn2), Actin, alpha 2, smooth muscle, aorta (Acta2), C-X-C motif chemokine ligand 2 (Cxcl2), Tumor necrosis factor-\u03b1 (Tnf-\u03b1), Interleukin -6 (IL6), Interleukin 1-Beta (IL1B), Interleukin 10 (IL10), C-X-C motif chemokine ligand 1 (Cxcl1), acyl-CoA dehydrogenase long chain (Acadl), acyl-CoA oxidase-1 (Acox1), carnitine palmitoyltransferase-1A (Cpt1) and carnitine palmitoyltransferase-2 (Cpt2) and acetyl-CoA acyltransferase-2 (Acaa2), Acyl-CoA dehydrogenase medium chain (Acadm) and hydroxyacyl-CoA dehydrogenase (Hadh), Glycerol-3-phosphate acyltransferase (Gpat), Diaclyglycerol O-acyltransferase 2 (Dgat2), Microsomal triglyceride transfer protein (Mttp), Ubiquitin C (Ubc), Glyceraldehyde-3-phosphate dehydrogenase (Gapdh), and Beta-2 microglobulin (\u03b22M). Primers for Slco1b2 was purchased from Integrated DNA Technologies (IDT) . The expression for the genes of interest were normalized to the average expression of three housekeeping genes . Total RNA was extracted from rat liver using TRIzol reagent  according to the manufacturer\u2019s protocol. RNA concentrations were determined using a nano-drop, and RNA integrity was confirmed by agarose gel electrophoresis. iScript cDNA synthesis kit (Bio-Rad) was used for cDNA synthesis from total RNA, and SYBR green master mix  was used for real time quantitative PCR analysis as per the manufacturer\u2019s protocol. Primers  were purFormalin fixed liver tissues were paraffin embedded, stained with hematoxylin and eosin (H&E), and analyzed by a board-certified veterinary pathologist. Stained sections were incidence and severity scored using an established rodent NASH system  with endg at 4 \u00b0C for 1 h. Supernatants were collected, avoiding the lipid layer. Protein concentrations were determined using the Pierce BCA Protein Quantification Assay kit  according to the manufacturer\u2019s protocol. Approximately 50 mg of liver tissue was homogenized with a handheld homogenizer in 1 mL of NP40 lysis buffer with protease inhibitors. The homogenized samples were agitated at 4 \u00b0C for 2 h followed by centrifugation at 10,000\u00d7 Tissue lysates (20 \u00b5g/well) were prepared in Laemmli sample buffer with 2.5% BME and heated at 37 \u00b0C for 30 min. Protein was transferred from the gel to polyvinylidene fluoride (PVDF) membrane using the Trans-Blot Turbo Transfer System at 25 V and 1.0 A for 30 min. Following transfer, the membranes were imaged under UV to capture Stain-Free image used for protein normalization. The blots were then blocked with 5% non-fat dry milk in Tris-base buffered saline-Tween 20 (TBS-T) for 1 h at room temperature, then incubated with primary antibody overnight at 4 \u00b0C. Membranes were probed for OATP1B2  and MCLR . The blots were incubated with secondary antibody in 5% non-fat dry milk in TBS-T for 1 h at room temperature. Densitometry was performed using Image Lab . Proteins of interest were normalized to total protein as captured by Stain-Free image. Total protein normalization is a commonly accepted technique for protein densitometry analysis instead of the single-protein loading control .All results are represented as mean \u00b1 SEM. All data, except the histopathological data, were analyzed by two-way ANOVA statistical analysis with diet and dose constituting the main two factors. A Dunnett multiple comparison post-test was performed to determine statistical differences between different treatment groups. Histopathological data were rank ordered before statistical analysis. All analyses were carried out using GraphPad Prism software. ."}
{"text": "Adhesion strength of the cartilage gels were significantly higher compared to alginate gel, with the 2-wk group showing a near 20-fold higher strength . The in vivo remodeling process analysis of the 2 wk cultured gels showed increased cartilage repair characteristics and stiffness over time, with higher integration-failure stress compared to osteochondral autograft controls at 4 weeks (p\u2009<\u20090.01). In the nonhuman primate investigation, cartilage repair scores were significantly better in the gel group compared to defects alone after 24 weeks (p\u2009<\u20090.001). Cell distribution analysis at 24 weeks showed that human cells remained within the transplanted defects only. A self-assembled, FCPC-based cartilage gel showed chondrogenic repair potential as well as adhesive properties, beneficial for cartilage repair.The aim of this study was to develop a fetal cartilage-derived progenitor cell (FCPC) based cartilage gel through self-assembly for cartilage repair surgery, with clinically useful properties including adhesiveness, plasticity, and continued chondrogenic remodeling after transplantation. Characterization of the gels according to  Despite its sound concept, few TEC products have reached clinical trials1. Significant hurdles towards translation include limit in size, poor integration, and suboptimal microstructural biomimicry of native cartilage2. Scaffolds which are commonly used in TECs often make the construct relatively rigid and fixed in geometry. Such constructs often necessitate additional fixation and substantial debridement of the defect, often resulting in gap formation, damage to normal host tissue, and overall, increasing the difficulty of the surgical procedure3.Tissue-engineered cartilage (TEC) constructs aim to improve current cell therapy for articular cartilage defects such as autologous chondrocyte implantation by direct transplantation of engineered cartilage tissue. Expected benefits include direct cartilage formation by prefabricated hyaline cartilage-like tissue containing viable cells, theoretically providing better resistance towards the knee\u2019s highly loaded environment5. Despite reports of its feasibility and effectiveness, scaffold-free TECs must overcome certain limitations for successful clinical translation. First, a highly proliferative allogenic cell source is preferred, as scaffold-free engineering requires a relatively large number of cells, often difficult to obtain with autologous cells7. Secondly, scaffold-free TECs undergo considerable remodeling in vivo. Transplanted tissue should therefore predictably differentiate and remodel into hyaline cartilage with minimal dedifferentiation or cell loss2. Thirdly, TECs should adhere immediately to the defect site to obviate the need for additional fixation. Overall, current scaffold-free TECs utilizing chondrocytes and mesenchymal stem cells (MSC) have yet to provide a comprehensive answer to these limitations5.Scaffold-free engineering is an alternative approach that improves some previous limitations of TECs. Its relative plasticity enables them to be applied directly over the defects, minimizing gap formation and improving integration9. Furthermore, we have previously reported a scaffold-free, self-assembly method using passaged chondrocytes10. Secondly, we aimed to optimize the cartilage gel\u2019s plastic and adhesive features that would lead to a fixation-free, seamless fit of the cartilage gel into the defect. Finally, we sought to analyze cartilage repair efficacy, remodeling process, and cell distribution of the cartilage gel after transplanation in a nude mouse model and a non-human primate cartilage defect model in vivo.In efforts to overcome these limitations, we first aimed to develop an engineered cartilage construct utilizing fetal cartilage progenitor cells (FCPC) via scaffold-free, self-assembly engineering. According to our previous work, FCPCs boast a high proliferative capacity through late passages and higher chondrogenic capacity compared to adult chondrocytes and bone marrow derived-mesenchymal stem cells (bmMSC)9.Characterization of FCPCs used in this study revealed surface marker expression similar to MSCs  were analyzed, with 8 week osteochondral autologous transplantation (OATS) blocks and NC serving as controls. Overall, cartilage gels showed continued differentiation after in vivo transplantation, expressing increased hyaline-like cartilage qualities over the 12 week time period, with 8-week samples showing lacuna formation  model (n\u2009=\u200910 mice/group) to evaluate ion Fig.\u00a0. Cellulaion Fig.\u00a0. Total cion Fig.\u00a0. Stiffneion Fig.\u00a0. Cartilaion Fig.\u00a0. O\u2019Driscion Fig.\u00a011.Figure11.Cartilage gels were transplanted in full-thickness cartilage defects of non-human primate knee joints . Cartilage gels were transplanted on the left knee joint (transplanted knee), within three defects made in the trochlea, medial, and lateral condyle cartilages of the femur. Empty, full thickness defects made in the right knee joint (control knee) served as controls. MRIs were taken at POD 8, 16, and 24 wks to follow the healing process, and animals were euthanized at POD 24 wks for tissue harvest. All defects in the transplanted knees remained filled through the 24 wk follow-up period Fig.\u00a0. At POD Cell distribution of the gels after 24 weeks showed transplanted cells remaining within the defect. RT-PCR of human specific ALU sequences showed human ALU expression in the repaired cartilage of the transplanted knee Fig.\u00a0. Human A12. All defect sites were absent from CD45 expression as shown in the IHC figures of the defects  count, blood C-reactive protein (CRP) levels, synovial histology, and transplantation site IHC. On gross examination, no wound problems were noted in all animals on all observation time points. Postoperative knee circumference of the transplanted knees returned to baseline levels (\u0394\u2009<\u20093\u2009mm) in all animals by 4 weeks Fig.\u00a0. WBC anacts Fig.\u00a0. Overall1. Chondrosphere\u00ae  a cartilage tissue aggregate product using autologous chondrocytes, have shown some improvement in clinical scores13. Revaflex\u2122 , a neocartilage product based on allogeneic juvenile chondrocytes, is relatively large (2.2\u20132.5\u2009cm diameter) and stiff compared to other scaffold-free TECs requiring tailoring and fixation during implantation. A Phase I/II trial showed 67% of patients to have \u2018normal to nearly normal\u2019 cartilage repair one year postoperatively, without any adverse immune response potentially associated with allogeneic cells14. Despite early clinical success, we still have little scientific evidence regarding the optimal cell source, therapeutic mode of action, and optimal biomechanical properties for clinical translation. Our study challenged these issues by first utilizing a highly proliferative and chondrogenic cell source and secondly by optimizing clinically relevant biomechanical properties in vitro. Finally, the therapeutic mode of action was investigated through remodeling process and cell distribution analyses, showing that the construct remains within the transplanted defect in the long run, successfully remodeling into hyaline-like cartilage in vivo.Several scaffold-free TECs have reached clinical trial stages with promising early results, with at least two products available on the market7. With intention to treat by a single procedure, a highly proliferative allogeneic stem cells with chondrogenic capacity is desirable. FCPCs are easy to isolate and expand, resulting in high yields (6.5\u2009\u00b1\u20090.95 \u00d7 107 cells/ 1\u2009g tissue)9. Secondly, they possess stem cell characteristics of self-renewal, multilineage differentiation, and immune-modulation, with the potential to be a safe allogeneic cell source18. Thirdly, cartilage tissue formation ability of FCPCs are better than chondrocytes or MSCs, even without the use of exogenous growth factors. Previous studies of FCPCs have shown larger cartilage tissue formation with more GAG production compared to chondrocytes or bmMSCs20. Most importantly, tissue engineering with FCPCs may translate numerous regenerative benefits of fetal tissues. Fetal tissue responds to injury in a fundamentally different manner than adult tissue, resulting in a rapid, scar-less healing in many dense connective tissues22. This enhanced healing potential is intrinsic to the fetal tissue itself rather than the fetal environment, as the healing potential carries over into an adult host after transplantation21. Our findings support previously published FCPC characteristics, where FCPCs dependably differentiated towards cartilage without the use of growth factors and continued ECM production  in high-glucose DMEM containing 1% FBS at 37\u2009\u00b0C under 5% CO2. After 12\u2009h, the released cells were centrifuged at 1700 rpm for 10\u2009min, washed twice, and cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin G, and 100\u2009\u03bcg/ml streptomycin at a density of 8 \u00d7 103 cells/cm2. When cells reached 80% confluence, the 0.5% Trypsin-EDTA of 10X to 1 \u00d7  were used to detach the cells, which replated by the same way as above. Cells were expanded for two passages with culture medium changed every 3 days. All donor cells showed no significant difference in terms of morphology, proliferation, surface marker, senescence, and chondrogenesis as previously published9. Passage 2 cells were used for this study from all groups during in vitro experiments, and M GA11 wks cells were used for in vivo investigations.All protocols involving human tissue were performed under the approval of Institutional Review Board of Ajou University School of Medicine (AJIRB-MED-SMP-10-268). Human fetal cartilage tissues were harvested from four abortus within 24\u2009hours following elective termination  after informed consent from respective guardians. Cells were isolated from the femoral head cartilage and expanded using a previously published protocolCells at passage 2 were analyzed for expression of stem cell related surface markers by flow cytometry. Briefly, cells in the suspension were incubated with anti-CD29-PE .555443), anti-CD34-FITC , anti-CD45-PE , anti-CD73-FITC , anti-CD90-FITC , anti-CD105-FITC , anti-SOX2-PE   and anti-OCT3/4-APC   for 40\u2009min at 4\u2009\u00b0C. Stained cells were determined by BD FACSCanto II flow cytometer  and analyzed using Flowing software . The adipogenic medium consisted of \u03b1-MEM supplemented 10% FBS, 1\u2009\u00b5M dexamethasone, 10\u2009\u03bcg/ml insulin, 0.5\u2009mM isobutyl-methylxanthine, and 0.1\u2009mM indomethacin . After 3 weeks of differentiation, cells were stained with Alizarin red S and Oil red O  to observe the degree of mineralization and the lipid droplets, respectively. For chondrogenic differentiation, 3 \u00d7 105 cells at passage 2 were centrifuged at 500 \u00d7 g for 5\u2009min, and the cell pellet was cultured in a chondrogenic medium. The chondrogenic medium consisted of DMEM supplemented with 100\u2009nM dexamethasone, 50\u2009\u03bcg/ml ascorbate-2 phosphate, ITS supplement, 40\u2009\u03bcg/ml proline, 1.25\u2009mg/ml bovine serum albumin, 100\u2009\u03bcg/ml sodium pyruvate . After 3 weeks of induction, the samples were fixed with 4% formaldehyde and embedded in paraffin wax. Sections with a thickness of 4 \u03bcm were prepared and stained with Safranin O  to observe the sulfated glycosaminoglycans.For osteogenic and adipogenic differentiation, cells at passage 2 were plated in 6-well plates at densities of 2 \u00d7 10We also examined the proliferation ability and phenotype of the FCPCs according to passage time. The doubling time of FCPCs was determined from passage 1 to passage 15 (n\u2009=\u20094). Cells were subcultured at 80% confluence. The doubling time was calculted using the following formula: DT\u2009=\u2009(T1\u2009\u2212\u2009T0)log2/(logN1\u2009\u2212\u2009logN0), where T1\u2009\u2212\u2009T0\u2009=\u2009the culture period in days, N0\u2009=\u2009the plating cell number, and N1\u2009=\u2009the harvesting cell number. Accumulated cells numbers were calculated with passages or days.10. Briefly, FCPCs were cultured in a high-density monolayer (at 2 \u00d7 105 cells/cm2) with DMEM supplemented with 100\u2009nM dexamethasone, 50\u2009\u03bcg/ml ascorbate-2 phosphate, ITS supplement, 40\u2009\u03bcg/ml proline, 1.25\u2009mg/ml bovine serum albumin, 100\u2009\u03bcg/ml sodium pyruvate. They were cultured until full confluency two dimensionally when cells spontaneously formed a thin membrane. Subsequently, the medium was removed and 1X Trypsin-EDTA was added and incubated for less than 5\u2009min at 37\u2009\u00b0C. When the membrane was peeled off from the plate, the enzyme was immediately removed and the membrane was carefully isolated using a wide-bore pipette and moved individually to a 50\u2009ml tube filled with 10\u2009ml of defined medium without exogenous growth factors . Each tube was centrifuged at 100 \u00d7 g for 20\u2009min to consolidate the membrane into a pellet-type construct. The constructs were incubated for 16\u2009h at 37\u2009\u00b0C and then transferred to a 6-well culture plate for extended culture for 1, 2, or 3 weeks in a 37\u2009\u00b0C humidified atmosphere of 95% air and 5% CO2. The culture medium (5\u2009ml) was changed every 3 days.Cartilage gels were fabricated using a previously published protocol43.After macroscopic examination, volume of the cartilage gels was measured using micro-CT . Scanning protocols are outlined in the Supporting Information TextFor histological analysis, cartilage gels were fixed in 4% formalin for 3 days and processed for tissue sectioning. Tissue sections of 4\u2009\u00b5m in thickness were made and stained with hematoxylin-eosin (H&E), Safranin-O, and immuno-histochemical (IHC) analysis for type I collagen , type II collagen , type X collagen  using the DAB method.44. Briefly, the assay was prepared via two steps: (i) The colour reagent was prepared by dissolving 16\u2009mg dimethylmethylene blue in 1\u2009l water containing 3.04\u2009g glycine, 2.37\u2009g NaCl and 95\u2009ml 0.1\u2009M HCl, to give solution at pH 3.0 . (ii) The papain-digested GAG sample prepared as above was taken, and measured by reference to a standard calibration curve. The result was analyzed by Magellan v.6.4. software and Tecan microplate reader . For total collagen content analysis, samples were measured by chloramine-T hydroxyproline assay45. Souluble peptides and proteins in each standard and tissue sample were hydrolyzed to individual amino acids by adding 500\u2009\u03bcl of 4\u2009N sodium hydroxide (NaOH) and incubating at 121\u2009\u00b0C and 15\u2009psi above atmospheric pressure for 20\u2009min (using an autoclave). Samples were allowed to cool to room temperature and then neutralized with 500\u2009\u03bcl of 4\u2009N HCl. Hydroxyproline amino acids were converted to pyrolle-2-carboxylate by oxidation via addition of 0.625\u2009mL of 0.05\u2009M chloramine-T in 74% v/v H2O, 26% v/v 2-propanol, 0.629\u2009M NaOH, 0.140\u2009M citric acid (monohydrate), 0.453\u2009M sodium acetate (anhydrous), and 0.112\u2009M acetic acid , followed by incubation at room temperature for 20\u2009min. Finally, 0.625\u2009mL of 15% w/v DMAB (1\u2009M) in 2-propanol plus concentrated acid (a.k.a. Ehrlich\u2019s solution) was added to each sample and vortexed immediately to facilitate mixing. Samples were incubated at 65\u2009\u00b0C for 20\u2009min and then rapidly cooled by immersion in room temperature water to stop chromophore development.For water content analysis, tissue samples were weighed (wet weight), freeze dried, and weighed again (dry weight). For glycosaminoglycans (GAG) content and DNA content analysis, samples were freeze-dried and digested with papain-digestion solution . For papain digestion, the sample in 1\u2009ml papain-digestion solution was incubated at 60\u2009\u00b0C for overnight. The total GAG content was spectrophotometrically measured by using the 1, 9-dimethylmethylene blue colorimetric assay. Chondroitin sulfate sodium salt from shark cartilage  was also used as a standardGenetic markers were analyzed with real-time polymerase chain reaction for 1, 2, and 3 wk cultured cartilage gels, with FCPCs and mature cartilage tissue used as controls. All adult human cartilage and osteochondral tissue were harvested from morphologically normal (ICRS grade 0) lateral condyle osteochondral tissue obtained during joint replacement surgery. Protocols and primer information are outlined in Supporting Information and Supplemental Table\u00a047. The spreadability of cartilage gel was determined by pressing the tissue construct between top and bottom plates covered by paper, then 500\u2009g standardized weigth was put on the upper plate and left for about 5\u2009minutes, as previously described49. Diameters of spread circles were measured in mm and were taken as comparative value for spreadability. Adhesive strength of cartilage gels after transplantation into the human cartilage defect osteochondral blocks was measured using a push-out test as in previously described52. Briefly, The adhesive strength was evaluated as the forces at ultimate failure per unit of the interfacial area and determined using 5\u2009mm in diameter of cylindrical-shaped indenter in an Universal Testing Machine fitted with a 5N maximum load cell. Alginate gels (2%) were fabricated using previously published methods and used for controls during adhesion strength testing47. All in vitro characterization analyses were done 5 times each.Biomechanical analysis of cartilage gels was done by measuring the aggregate modulus, spreadability, and adhesive strength. For aggregate modulus, tissues were subjected to an unconfined compression test using Universal Testing Machine . Each sample was placed on a bottom plate of the machine, and compressed at a speed of 1\u2009mm/min. The machine was stopped automatically after moving a programmed length between the top and bottom plate53. Osteochondral blocks were sampled at 2, 4, 8, and 12 weeks after transplantation and analyzed as described above. Histological images were scored for cartilage repair using O\u2019Driscoll cartilage repair scoring system by two separate pathologists not involved in this study54. For cartilage-to-cartilage integration analysis, a human cartilage cylinder construct model was used as previously described55. Briefly, cartilage gels were implanted in the cylinder constructs and OATS was used as controls. Cylinder constructs were then subcutaneously transplanted into the back of nude mice (n\u2009=\u20097 for each group). The cartilage-to-cartilage integration was evaluated by safranin-O stain and mechanical test for integration strength using using a push-out test as in previously described55. A custom 2\u2009mm in diameter of cylindrical-shaped indenter affixed to a Universal Testing Machine  pushed the cartilage repair out of the cartilage annulus (1\u2009mm/min) while recording load. Failure stress (integration strength) was calculated as the quotient of the load at failure and the interface area.Full thickness cartilage defects of 3\u2009mm diameter were made on 5\u2009mm diameter human osteochondral blocks obtained from joint replacement surgery. Lateral femoral condyles blocks without gross cartilage wear were used. NCs were used as normal controls, obtained from lateral femoral condyles of fresh frozen cadavers without knee joint pathology. The 2-WCG gels were transplanted on the defects using a syringe without additional fixation. OATS was performed on osteochondral blocks as controls. Briefly, 3\u2009mm diameter osteochondral defects were made with a matching size biopsy punch. The osteochondral block was gently reinserted into the defect similar to the OATS procedure using a plastic impactor . Osteochondral blocks were then transplanted subcutaneously into the back of nude mice , after institutional approval of Institutional Animal Care and Use Committee of Ajou University (IACUC No. 2014-0072)Macaca fascicularis) aged 54 to 69 months weighting 4\u20135.5\u2009kg were used for this study. Procedures for anesthesia and surgery for femoral chondral defects on both knees followed a previously published protocol and outlined in the Supporting Information Text56. Postoperative knee circumference was measured preoperatively, and at postoperative wk 1, 2, 4, 8, 16, and 24. Intravenous blood was drawn for WBC count and C-reactive protein quantification preoperatively, and during postoperative wk 1, 4, 16, and 24. MRI was performed on each knee at postoperative wk 8, 16, and 24. MRI protocols are outlined in the Supporting Information Text. At 24 wks, all animals were euthanized for further analysis. Vital organs  and relevant knee tissue  were harvested and prepared for cell distribution RT-PCR. Chondral defects were prepared for further histological analysis and resultant histological results were further analyzed using O-Driscoll cartilage repair scores by 2 separate pathologists twice that did not participate in this study11. Synovial tissue of each knee harvested from anterior fat pads were also prepared for histological analysis and subsequent chronic synovitis grading in the same fashion12. For cell distribution analysis, PCR for human alu sequences was performed to confirm the presence of transplanted cartilage gels in recipient NHP organs. Total DNA of organ samples was extracted with a QIAamp DNA Mini Kit , according to the manufacturer\u2019s instructions. The primers used were Human Alu F: 5\u2032-GTAAGAGTTCCGTAACAGAGCT-3\u2032, Human Alu R: 5\u2032-CCCCACCCTAGGAGAACTTCTCTTT-3\u2032, NHP gapdh F: 5\u2032-CGGATTTGGTCGTATTGGG-3\u2032 and NHP gapdh R: 5\u2032-GGGATCTCGCTCCTGGAAG-3\u2032. Samples were incubated at 94\u2009\u00b0C for 2\u2009min and then amplified for 25 cycles of denaturation for 30\u2009s at 94\u2009\u00b0C, annealing for 30\u2009s at 56\u2009\u00b0C, and extension for 59\u2009s at 72\u2009\u00b0C. The PCR products were analyzed by resolution on a 1.5% (w/v)57. Cell tracking within the chondral defects were also performed using human anti-nuclei antibody MAB1281, clone 235-1  immunohistochemistry. Human anti-nuclei antibody (+) cells were counted and compared in 5 histological sections 20 \u03bcm apart for each defect. The transplantation site (cartilage defects) was also evaluated for CD45 expression, with IHC using anti-CD 45 antibody .All protocols involving nonhuman primates (NHP) use were approved by Institutional Animal Care and Use Committee of Seoul National University (SNU-13-0251). All experiments were performed in accordance with relevant guidelines and regulations. A total of five skeletally mature male NHPs . Non-parametrical tests were used throughout this study. The test is used as a non-parametric alternative of the independent two-sample t-test (Mann-Whitney) or multiple comparison . Data are expressed as a mean \u00b1 standard deviation. P-values less than 0.05 were considered statistically significantSupporting Information.Supplemental online video 1.Supplemental online video 2."}
{"text": "SNCAIP, which encodes the Synphilin-1 protein, was expressed in Saccharomyces cerevisiae and Schizosaccharomyces pombe yeast strains devoid of enzymes Glo1, Glo2, and Gre3. Presented data shows that lack of Glo2 and Gre3 activity in S. cerevisiae increases the formation of large Synphilin-1 inclusions. This correlates with enhanced oxidative stress levels and an inhibitory effect on exponential growth, which is most likely caused by deregulation of autophagic degradation capacity, due to excessive Synphilin-1 aggresome build-up. These findings illustrate the detrimental impact of increased oxidation and glycation on Synphilin-1 inclusion formation. Similarly, polar-localised inclusions were observed in wild-type S. pombe cells and strains deleted for either +glo1 or +glo2. Contrary to S. cerevisiae, however, no growth defects were observed upon expression of SNCAIP. Altogether, our findings show the relevance of yeasts, especially S. cerevisiae, as complementary models to unravel mechanisms contributing to Synphilin-1 pathology in the context of neurodegenerative diseases.Synphilin-1 has previously been identified as an interaction partner of \u03b1-Synuclein (\u03b1Syn), a primary constituent of neurodegenerative disease-linked Lewy bodies. In this study, the repercussions of a disrupted glyoxalase system and aldose reductase function on Synphilin-1 inclusion formation characteristics and cell growth were investigated. To this end, either fluorescent dsRed-tagged or non-tagged human  SNCAIP) gene, which is expressed in a variety of tissues and enriched in the brain.Lewy body inclusions and Lewy neurites are important hallmarks of neurodegenerative diseases such as Parkinson\u2019s disease (PD) and Lewy body dementia. They consist primarily of \u03b1-Synuclein (\u03b1Syn) aggregates and occur in different neuronal cell populations including dopaminergic neurons . In addiSNCAIP were studied in a variety of model organisms, including mice models [SNCAIP in wild-type (wt) S. cerevisiae strain resulted in the formation of SY1-containing inclusions, starting with the formation of foci at endomembranes and lipid droplets. B\u00fcttner et al. speculated that the interaction with lipid rafts could facilitate dimerisation and self-assembly of SY1 [SNCAIP expression reduced survival and triggered apoptosis and necrotic cell death in a Sir2 dependent manner, most likely due to excessive aggresome build-up during growth and consequential deregulation of autophagic processes. In a co-expression model, SY1 aggravated \u03b1Syn aggregation, which was correlated with enhanced \u03b1Syn phosphorylation on Ser129 [SY1 is predominantly expressed in neurons and present at presynaptic nerve terminals , and it e models ,9,10,11,e models , neuroble models , and yeae models . Expressy of SY1 . In expoy of SY1  of said n Ser129 .glo1+) from the fission yeast Schizosaccharomyces pombe shares 50% amino acid sequence identity with the Saccharomyces cerevisiae Glo1 [S. cerevisiae has two isoforms of the structural genes for glyoxalase II, GLO2 and GLO4. Expression of GLO2 occurs both in glucose and glycerol media, while GLO4 is expressed only in glycerol medium [S. pombe glo2+ gene has not yet been experimentally validated [S. cerevisiae, S. pombe does not possess a Gre3 ortholog. Aldose reductases such as Yak3/YakC have been identified in S. pombe, but none of these have reported MGO-detoxifying activity [Glycation has primarily been studied in the context of diabetes mellitus, in which dysregulation of glucose metabolism results in the eventual formation of advanced glycation end-products (AGEs) via the non-enzymatic Maillard reaction ,17. Thesiae Glo1 . S. cerel medium . The idealidated . Contraractivity ,31.The observation of AGEs in Lewy bodies in cases of incidental Lewy body disease suggested that AGEs might trigger Lewy body formation in individuals that are considered pre-PD patients . In addiS. cerevisiae deficient in the GLO1, GLO2, and GRE3 genes and S. pombe strain deficient in glo1+ and glo2+.In this research article, we add to the findings described above by assessing the repercussions of a disrupted glyoxalase system and aldose reductase Gre3 activity on SY1 inclusion formation and SY1-mediated growth effects. To this end, we employed a genetic approach by analysing glo1\u2206, glo2\u2206, and gre3\u2206 S. cerevisiae strains transformed with either an empty vector (EV) or a plasmid expressing native SNCAIP were subjected to growth analysis. These results revealed that both wt and glo1\u2206 cells containing the EV grow equally well  \u00b10.8, glo2\u2206 and gre3\u2206 strains only reached an ODmax of \u00b10.6  could e W303 in , SNCAIP analysis C left. TWhile Glo1 converts the spontaneously formed MGO-glutathione complex into S-D-lactoylglutathione, Glo2 is responsible for the conversion of S-D-lactoylglutathione into glutathione and D-lactate. As such, Glo2 recycles the cytoplasmic pool of glutathione. Cytoplasmically generated glutathione can either remain in the cytosol or be relocated into the mitochondria via active transport. The mitochondrial pool of glutathione is considered the major redox system in numerous processes, such as the preservation of sulfhydryl groups of mitochondrial proteins in the appropriate redox state and protecting mitochondrial DNA and membrane integrity against ROS-induced oxidative stress. Disruption of cytoplasmic Glo2 activity results in S-D-lactoylglutathione accumulation and consecutively keep glutathione trapped in the cytosol. This can then lead to decreased glutathione availability in the mitochondria, disrupting the glutathione-dependent antioxidant enzyme system ,37.SNCAIP-expressing glo2\u2206 cells is associated with increased SY1 oxidation. The impact of SNCAIP expression on growth was also assessed in wt, glo1\u2206, and glo2\u2206 fission yeast strains. S. pombe does not possess a GRE3 homolog and glyoxalase 2 activity of the proposed S. pombe GLO2 homolog, glo2+, has yet to be established [S. cerevisiae, no growth differences between EV-expressing strains, nor a SNCAIP expression-dependent inhibitory effect on growth was observed in any strain examined  in daughter cells is minimal  ,40.glo1\u2206 cells on the one hand, and glo2\u2206 and gre3\u2206 cells, on the other hand, prompted verification of the SY1 protein level via Western blot analysis. To this end, we subjected whole-cell extracts of wt, glo1\u2206, glo2\u2206, and gre3\u2206 S. cerevisiae, and wt, glo1\u2206, and glo2\u2206 S. pombe strains to Western blot analysis using an anti-SY1 antibody. Our analysis confirmed that glo2\u2206 and gre3\u2206 S. cerevisiae strains displayed a reduced SY1 protein content in comparison to wt and glo1\u2206 strains .S. cerevisiae, we did not detect differences in SY1 protein level between the S. pombe strains , juxta/intranuclear quality control compartment (JUNQ/INQ), and insoluble protein deposit (IPOD) were identified in proteins ,45. Whilradation .glo1\u2206, glo2\u2206, and gre3\u2206 cells, dsRed-SY1 inclusions were distantly located. In contrast, inclusions in the majority of wt cells displayed perinuclear localisation , which can be used as a measure of the extent of superoxide and hydrogen peroxide formation in cells. Surprisingly, both the base level, i.e., upon expressing an empty plasmid, and the SY1-associated oxidative stress level detected in glo2\u2206 and gre3\u2206 cells were lower than the corresponding values detected in wt and glo1\u2206 cells. Contrary to wt and glo1\u2206 cells in which SNCAIP expression reduced or did not affect the percentage of positive cells, respectively, glo2\u2206 and gre3\u2206 strains showed a strong increase in the percentage of DHE-positive cells upon expression of SNCAIP when compared with the control  and reduced (glo2\u2206 and gre3\u2206) growth upon SNCAIP expression. Moreover, co-localisation of dsRed-SY1 inclusions and actin cables was visible in actively dividing wt and gre3\u2206 cells, pointing towards retrograde transport of inclusions via actin cables to the mother cell. In addition, in both wt and gre3\u2206 cells, inclusions were flanked by actin patches, but not to the extent as described previously [During exponential growth, localisation of dsRed-SY1 inclusions adjacent to actin cables was visible in cells which displayed both normal  displayed Glo3 activity and conferred MGO resistance in a glo1\u2206 strain [S. cerevisiae, we did not observe growth defects in an SY1-expressing glo1\u2206 strain. This points towards a dominant role of Hsp31-mediated Glo3 activity in detoxifying MGO. As mentioned in the introduction, the glyoxalase 2 activity of the proposed S. pombe Glo2 homolog has yet to be shown [We conducted a comparative study to assess any potential repercussions of a disrupted methylglyoxalase system on the growth of the fission yeast n of MGO . Neverth\u2206 strain . Similarbe shown .glo2\u2206 cells in comparison to wt cells indicates a lack of glyoxalase 2 functionality of Glo2. Alternatively, disruption of Glo2 activity might be compensated for by the mitochondrial thioredoxin system, which was shown to act as a back-up system for glutathione-mediated antioxidant activity in fission yeast [SNCAIP.The absence of an SY1-associated growth phenotype and similar levels and intracellular distribution of SY1 inclusions in on yeast . InteresS. cerevisiae, the observed inclusions in S. pombe did not show signs of fusion or retrograde transport via actin cables to facilitate asymmetric distribution into one of the two daughter cells. These findings were in line with the lack of observed SY1-associated growth defect.This points towards the involvement of a transport mechanism actively regulating the intracellular localisation of these inclusions. In fission yeast, polarity factors, deposited at the plasma membrane by microtubule-mediated transport, recruit protein complexes  involved in actin cable assembly . These aS. cerevisiae strains were grown in 3 mL minimal medium, containing glucose  and yeast nitrogen base without amino acids and ammonium sulphate  at 30 \u00b0C. Supplements were ammonium sulphate  and complete supplement mixture drop-out depleted for uracil . Cells were grown for 48 h after the time point of inoculation and subsequently subjected to the appropriate analysis. The wt and deletion strains glo1::kanMx, glo2::kanMx, and gre3::kanMx were BY4741 MATa, his3\u22061 leu2\u22060 met15\u22060 ura3\u22060. All strains were haploid. SNCAIPWT and dsRed-SNCAIPWT were expressed from a multicopy episomal plasmid (pYX212 backbone with URA3 marker) using the triosephosphate isomerase (TPI) promoter. The cDNA encoding synphilin-1 was isolated from a hippocampal cDNA library via PCR amplification using the primers CATGCCATGGAAGCCCCTGAATACC and CCGCTCGAGTTATGCTGCCTTATTCTTTCC that included, respectively, a NcoI and XhoI restriction site for cloning into the pYX212 plasmid, which allows expression from the constitutive TPI1 promoter [promoter .S. pombe cell cultures were grown in Edinburgh Minimal Medium [S. pombe strain used in the study was h90ura4.D18. The deletion strains glo1::kanMX6 and glo2::kanMX6 were h+ade6-M210/M216 ura4-D18 leu1-32 (Bioneer S. pombe deletion mutant library [SNCAIPWT was cloned in the pINT plasmid backbone [ura4 marker) [leu1 locus, strains simultaneously acquire uracil prototrophy and leucine auxotrophy.l Medium  (Formedi library ). All stbackbone  (ura4 ma marker)  and expr marker) . ExpressS. cerevisiae and S. pombe strains were first grown as described in 2.1, after which the cells were inoculated at an optical density of 600 nm of 0.1 in either a 96-well (S. cerevisiae) or 24-well (S. pombe) plate  for subsequent growth in a Multiskan GO microplate spectrophotometer (Thermo Scientific). Plates were shaken at 400 rpm and optical density was measured at 600 nm every 30 min. For spot assays, serial dilutions of S. cerevisiae and S. pombe precultures  were spotted onto the appropriate solid minimal medium (see 2.1). Two to four days after spotting, colonies appeared and plate scans were made. Growth profiles are based on three clones per strain.S. cerevisiae strains were grown in a 96-well plate as described in 2.1. Accumulation of ROS was analysed based on the superoxide-driven conversion of non-fluorescent dihydroethidium (DHE) to fluorescent ethidium. The DHE assay was carried out as described in the guidelines (ThermoFisher) and quantified using flow cytometry . A two-way ANOVA test  was carried out using GraphPad Prism 8.3.0 .S. cerevisiae were analysed by standard fluorescence microscopy using a Leica DM4000B . To assess differences between strains in inclusion characteristics, a comparative analysis based on at least 800 cells originating from three clones per strain was performed. Only fluorescence positive cells were considered for the comparative analysis of the number and size of inclusions between strains. Statistical analysis  was carried out using GraphPad Prism 8.3.0.SY1 inclusion formation and effects on cytoskeletal architecture in TM Blue CMAC dye (Thermo Fisher) according to the manufacturer\u2019s guidelines.Cell nuclei were stained using DAPI (Thermo Fisher). To this end, cells were fixed in 37% formaldehyde for 1 h at room temperature, after which the cells were washed twice in PBS. Nuclei were subsequently stained in 1:3 DAPI/PBS for 1 h in the dark. Cell vacuoles were stained using CellTrackerTM 488 phalloidin (Thermo Fisher) and conducted as recommended in the kit\u2019s guidelines.Finally, cells were washed trice in PBS and subjected to microscopic analysis. Quantifications are based on the localisation of 100 inclusions in around 50 cells of one clone per strain, grown until the mid-late exponential phase. Due to limitations in the number of independent cell countings, no statistics were performed for the inclusion localisation experiment. The actin staining was performed using Alexa FluorS. cerevisiae whole-cell extracts were prepared according to Vandebroek et al [S. pombe whole-cell extracts were prepared according to Hagan et al. [ek et al , while Sn et al. . Proteinp-value of 0.05) was conducted to assess differences in anti-SY1 antibody immunoreactivity between strains. Standard deviations are based on densitometric data, as determined by Fiji Software (v1.52i), of three clones per strain.A one-way ANOVA test  inverted microscope. Cell fixation, permeabilisation, and antibody application steps were performed according to the protocol described in , omittinS. cerevisiae and S. pombe. We found that lack of Glo2 and Gre3 activity in S. cerevisiae affected both SY1 inclusion number and growth ability. Increased SY1 inclusion formation correlated with enhanced oxidative stress levels and an inhibitory effect on growth, most likely caused by deregulated autophagic degradation due to excess aggresome build-up. These findings illustrate the severe repercussions of enhanced oxidation and glycation on SY1 inclusion formation.In this study, we investigated the impact of a functionally disrupted glyoxalase system and aldose reductase activity on SY1 inclusion characteristics and cell growth in the yeasts glo1\u2206 gre3\u2206 could help unravel the connection between both MGO detoxification pathways.Future endeavours could focus on co-expressing SY1 and \u03b1Syn to shed more light on their interplay in conditions characterised by increased protein glycation and oxidation. Moreover, the use of double mutants such as SNCAIP expression did not seem to reach a sufficiently high level to impair the growth of any of the tested strains. In addition, our data do not provide any indications that the fission yeast homolog of GLO2, glo2+, carries out glyoxalase 2 activity. Combined, our findings illustrate the relevance of yeasts, especially S. cerevisiae, as complementary model organisms to unravel mechanisms contributing to SY1 protein pathology in the context of neurodegenerative diseases.Finally, while we clearly detected inclusion formation in our fission yeast model, the level of incited stress upon"}
{"text": "Severe hypercholesterolemia  affects over 30\u00a0million people worldwide. In this study, we validated a new polygenic risk score (PRS) for LDL\u2010C.Summary statistics from the Global Lipid Genome Consortium and genotype data from two large populations were used.p\u00a0=\u00a010\u201341). After risk categorization, the risk of having HC was higher in the high\u2010 versus low\u2010risk group . Compared to a 12\u2010SNP LDL\u2010C raising score (currently used in the United Kingdom), the PRS explained more LDL\u2010C variability (8% vs. 6%). Among Finns with severe HC, 53% (66/124) versus 44% (55/124) were classified as high risk by the PRS and LDL\u2010C raising score, respectively. Moreover, 54% of individuals with severe HC defined as low risk by the LDL\u2010C raising score were reclassified to intermediate or high risk by the new PRS.A 36\u2010SNP PRS was generated using data for 2,197 white Americans. In a replication cohort of 4,787 Finns, the PRS was strongly associated with the LDL\u2010C trait and explained 8% of its variability  affects over 30\u00a0million people worldwide. In this study, we generated a new polygenic risk score (PRS) for LDL\u2010C in 2,197 white Americans and validated our results in a replication cohort of 4,787 Finns. This new PRS explains 30% more LDL\u2010C variability (8% vs. 6%) and has a better predictive role in identifying HC of polygenic origin compared to existing methods. PRSs have been used to identify patients at risk of several conditions, including cardiovascular , followed by validation on a second cohort of European Finnish individuals. We also compared the performance of the new PRS against the 12\u2010SNP LDL\u2010C raising score by Talmud et al.   approved the study. Protocols for the eMERGE network were approved by the Institutional Review Boards (IRBs) at the institutions where participants were recruited; all included participants provided written informed consent prior to inclusion in the study.2.2A study cohort of 2,764 white American individuals was obtained from The Electronic Medical Records and Genomics network   and the allele dosage carried by the individual  according to the formula:The PRS of an individual p\u00a0<\u00a01\u00a0\u00d7\u00a010\u22123) were retrieved from the Global Lipid Genetics Consortium (GLGC). This initial set of SNPs was reduced by performing linkage disequilibrium (LD) pruning, thus retaining only the most significant SNPs in each LD block. Different LD thresholds (r2 between 0.1 and 0.8) were tested  and evaluated by PRSice to identify the best PRS, that is, the one that maximizes the explained phenotypic variance in the white American cohort. At each p\u2010value threshold, the PRS was incorporated in a linear regression model to explain the LDL\u2010C continuous trait, while adjusting for the following covariates: age, gender, BMI, and ancestry differences captured by the first two components from multidimensional scaling. From each regression model, an incremental R2 was computed by PRSice and plotted against the p\u2010value threshold. This R2 is reported as the difference between the R2 of the full regression model (LDL\u2010C\u223cPRS\u00a0+\u00a0covariates) and the R2 of the null model (LDL\u2010C\u223ccovariates). The best PRS was the one achieving the highest R2.Sets of SNPs were defined over a range of 2.42 of the models compared. These R2 values were calculated following the same approach described for PRSice : The phenotype was categorized in severe HC (LDL\u2010C\u00a0>\u00a04.9\u00a0mmol/L), intermediate HC (3.0\u00a0\u2264\u00a0LDL\u2010C\u00a0\u2264\u00a04.9\u00a0mmol/L), and normal LDL\u2010C levels (LDL\u2010C\u00a0<\u00a03.0\u00a0mmol/L), and the classification accuracy of the scores was assessed by receiver operating characteristic (ROC) curves. We used the DeLong test to compare AUCs from different PRSs.The PRS was categorized using the deciles of the distribution: low\u2010risk (decile third and below), intermediate risk , high\u2010risk category (deciles seventh and above). This mirrors the score categorization used in the SNP LDL\u2010C raising score by Talmud et al. , thus alThe distribution of subjects with severe HC was analyzed across PRS categories. We compared the percentage of patients with severe HC in the low\u2010risk PRS category.The PRS was assessed using the following statistical approaches:The list of genes , and GenBank (RefSeq) identifiers) included in the PRS is presented in Table 3A cohort of 2,197 white American individuals was used to construct the PRS for the LDL\u2010C trait. The clinical and biochemical characteristics of the individuals included in the study are presented in Table\u00a0p\u00a0<\u00a01\u00a0\u00d7\u00a010\u22123) were analyzed by the PRSice algorithm. In a regression model  in a multiple regression analysis, which adjusts for covariates.A total of 8,224 SNPs . Individuals in the high category had a significantly higher risk of severe HC relative to individuals in the low category .After score categorization Table\u00a0, median 3.1Northern Finland Birth Cohort 1966 (NFBC), whose clinical and biochemical data are presented in Table\u00a0p\u00a0=\u00a010\u201363; RR\u00a0=\u00a04.8 (CI: 2.6\u20138.9), p\u00a0=\u00a010\u20137).The new PRS was applied to a cohort of 4,787 Finnish individuals from the 3.2p\u00a0=\u00a0.12 DeLong\u00a0test) and Finnish populations  and was able to explain 30% more of trait variance (8% vs. 6% in the American population and 8% vs. 6% in the Finnish population).We compared the results obtained with our new PRS to those obtained using the SNP LDL\u2010C raising score of Talmud et al.  estimateAfterwards, the categorized PRS and SNP LDL\u2010C raising score were compared. In the white American cohort, 45% (230/506) versus 42% (213/506) of individuals with normal level LDL\u2010C (<3\u00a0mmo/L) were classified in the low\u2010risk category, and 50% (53/107) versus. 46% (49/107) individuals with severe HC were classified in the high\u2010risk category using the PRS and SNP raising score, respectively.SD 0.2 versus. 60\u00a0yrs, SD 11.5 in the Americans), with a healthier lipid profile , thus confirming a trend toward a better performance of PRS versus SNP raising score in the replication cohort.In the Finnish cohort, which is a younger cohort compared to the Americans  and 42% of severe HC cases in the Finnish cohort .3.3LDLR, APOB, or PCSK9 (approximately 40% of patients who undergo genetic testing for FH)  are also present in the SNP LDL\u2010C raising score (see Table\u00a0\u20104) and lipoprotein processes (p\u00a0=\u00a07\u00a0\u00d7\u00a010\u22124). No enrichment was found in KEGG metabolic pathways annotation, which suggests that multiple metabolic pathways may be implicated in the development of severe HC of polygenic origin.The 36 SNPs in the new PRS map to 23 genes Table , six of \u03b52, \u03b53, and \u03b54 haplotype. However, these two SNP are in LD (LD\u00a0>\u00a00.35 between rs7412 and rs7254892 in TOMM40 and between rs429358 and rs4420638 in APOC4) in both American and Finnish populations , which define the APOE p\u00a0<\u00a01\u00a0\u00d7\u00a010\u22128. Eight genes  were associated with coronary artery disease, five with diabetes mellitus type 2  and three with Alzheimer's disease  (see Table APOB and ABO) were reportedly associated with cancer  and three genes  with Stroke  with variants reported for these traits). The list of pleiotropic SNPs is as follows: association with coronary artery disease , stroke , diabetes mellitus type 2 , and Alzheimer's disease .As severe HC is often associated with other cardiovascular risk factors and the degree of aggressive lipid lowering treatment is dictated by the patient overall cardiovascular risk, we assessed the pleiotropic nature of the 23 genes in the new PRS by examining their association with other traits in the GWAS catalog, using a cutoff for association 4p\u2010value threshold\u00a0<\u00a010\u20133 and demonstrated that it is robustly associated with the LDL\u2010C trait in two independent populations of white European ancestry from the United States of America and Finland. Compared to the existing 12\u2010SNP LDL\u2010C raising score , the new PRS was able to explain 30% more of LDL\u2010C trait variability and to identify a polygenic risk component, therefore, reclassifying several patients otherwise deemed as low risk for hypercholesterolemia of polygenic origin. The PRS for LDL\u2010C can have several applications in clinical practice including i) identifying patients with a clinical diagnosis of FH who are at high likelihood of HC of polygenic origin, and ii) inclusion into algorithms for the early stratification of patients at risk of HC and other comorbidities, both cardiovascular and Alzheimer's disease, for early life style modifications.We constructed a new PRS for LDL\u2010C from an initial set of thousands of SNPs at GWAS The SNP LDL\u2010C raising score by Talmud et al. , and thep\u2010value\u00a0<\u00a05\u00a0\u00d7\u00a010\u22128), the field is now migrating toward the use of genome\u2010wide polygenic scores consisting of thousands of SNPs with higher p\u2010values  of SNPs at GWAS significant level (In this study, we used an unbiased method for selecting the most informative SNPs associated with LDL\u2010C from an initial set of over 8,000 SNPs, to construct a polygenic score for LDL\u2010C. Although the AUC for PRS was only marginally better compared to that of LDL\u2010C SNP score, the PRS was better in classifying patients into low or high risk compared to the LDL\u2010C SNP score method. However, this was just a trend possibly because of the small number of patients with severe HC in our two cohorts.The 23 genes harboring the 36 SNPs selected for the PRS show enrichment in Gene Ontology terms related to lipid metabolism, thus further confirming the validity of the selection process. Pathways analysis did not show any enrichment, which suggests that small defects in multiple metabolic pathways may be involved in hypercholesterolemia of polygenic origin.We are still far from understanding the genetic causes of FH, a condition associated with a 20\u2010fold increased risk of CHD compared to the general population (Nordestgaard et al., We found that many of the genes\u00a0included in the PRS have pleiotropic effects. We and others have noted that gene pleiotropy is common in genes implicated in both rare (Ittisoponpisan, Alhuzimi, Sternberg, & David, An important limitation of our study is the small number of patients with severe HC in the two cohorts. Future work will involve applying the PRS in FH patient cohorts and, in particular, to FH/M\u2010 patients. Moreover, it will be important to evaluate the correlation between polygenic risk for HC, as defined by the PRS, to the risk of cardiovascular events.In conclusion, we developed a polygenic biomarker based on 36 SNPs that is able to identify patients at an increased risk of HC and associated comorbidities as a result of their genetic makeup.The authors declare that there is no conflict of interest.AD and LGL conceptualized the study and contributed to the first draft of the manuscript. LGL performed the molecular analyses. AD contributed to the bioinformatic analyses. AD, CH, and MJS contributed to interpretation of bioinformatic data. All authors critically reviewed the manuscript.SupinfoClick here for additional data file."}
{"text": "The relative lengths of the rearfoot talus and calcaneus normalized to the foot length also correlated significantly with the sprint performance . Furthermore, the relative height of the calcaneus, but not the talus, normalized to body height correlated significantly with sprint performance . Additionally, the relative calcaneus height correlated significantly with the foot arch height index , and the foot arch height index correlated significantly with sprint performance . These findings suggest that the taller calcaneus may be a key morphological factor for achieving superior sprint performance, potentially via modeling the longer forefoot and rearfoot bones and functional foot morphology in sprinters.This study examined the relationships between the foot bone morphologies and sprint performance in sprinters. Foot images in 56 male sprinters obtained using magnetic resonance imaging. The relative lengths of the forefoot bones of the big and second toes, which were calculated as total lengths of the forefoot bones for each toe normalized to the foot length, correlated significantly with personal best 100-m sprint time ( Dowson et al.3 reported that greater plantar flexor isokinetic torque correlated with superior sprint performance in athletes, including sprinters. In general, the magnitude of joint torque is primarily determined by the agonist muscle size5; therefore, greater plantar flexor muscle may be related to superior sprint performance in sprinters. Despite the fact that the relationship between the plantar flexor muscle size and sprint performance in sprinters has been inconsistently remained among the results of previous studies10, we and others reported the absence of this relationship10. Therefore, sprinters may have other morphologies than muscle size related to increase in plantar flexor torque while sprinting.Superior sprint performance is achieved using gross torques of the lower limb joints, including the hip, knee, and ankle. Of these components, greater ankle plantar flexor torque plays an important role in increasing ground reaction forces and shortening contact time during the stance phases while sprinting14. This result suggests that the longer forefoot bones may be an essential characteristic for successful sprinters. Furthermore, using computer simulation, Lee and Piazza12 determined that a longer forefoot contributes to the production of greater plantar flexor torque during the push-off phase while sprinting. Given their findings, we demonstrated that longer forefoot bones correlated with better sprint performance in sprinters14. Therefore, the forefoot bone length is an important morphological factor of sprint performance in sprinters.We and others previously demonstrated that the forefoot bones were longer in sprinters than in non-sprinters11 determined that the plantar flexor moment arm (MA) dimension  was shorter in sprinters than in non-sprinters. Raichlen et al.15 reported a positive correlation between the plantar flexor MA and the calcaneus length. Considering these findings, shorter rearfoot bones, especially the calcaneus, may be a required characteristic for achieving superior sprinter performance in sprinters. Nevertheless, Baxter and Piazza16 determined that greater plantar flexor MA correlated with higher plantar flexor isometric and isokinetic torques. Their result is consistent with the results of the knee joint in previous studies18. Because of the close relationship between plantar flexor torque and sprint performance3, a shorter calcaneus may be a disadvantage in producing greater plantar flexor torque and achieving superior sprint performance. Therefore, the first hypothesis of the present study was that longer, rather than shorter, rearfoot bones, especially the calcaneus, would be related to better sprint performance in sprinters.When having the longer forefoot bones, shorter rearfoot bones may be required for modeling the foot, because of a balance between lengths of the forefoot and rearfoot bones. In fact, Baxter et al.14. Based on the results of our previous studies, the second hypothesis of the present study was that, when having a taller rearfoot bones, especially the calcaneus, it would be required for modeling longer forefoot and rearfoot bones and would be related to better sprint performance in sprinters.We previously reported that, although the lengths of the forefoot bones were longer in sprinters than in non-sprinters, the lengths of the mid-foot bones  did not differ between the two groups; therefore, we concluded that the mid-foot bones do not display specific modeling for sprinters21. Hence, the foot arch height may play an important role in producing higher plantar flexor torque because of increased MTP joint torque using the stored energy during push-off in the stance phase21. Morita et al.22 reported that the foot arch height correlated with 50-m sprint time in children. Despite these findings, to the best of our knowledge, no study has examined the relationship between foot arch height and sprint performance in adults, including sprinters. The foot arch height is often associated with the foot length; however, this relationship is inconsistent among the findings of the previous studies24. Nevertheless, a study by Morita et al.22 did not find a correlation between foot length and sprint performance in children. Furthermore, several previous studies reported that the foot length did not differ between faster and slower groups of adult sprinters25. Based on these previous findings, the foot arch height may relate to sprint performance independently of the foot length; in other words, the foot arch height may be a specific morphology for determining sprint performance among the foot characteristics. If there is a correlation between foot arch height and sprint performance in adult sprinters, it may be due to a taller calcaneus, which could contribute to modeling a higher foot arch height, potentially because of increased navicular height. Therefore, the third hypothesis of the present study was that taller calcaneus would be related to higher foot arch height, and that the higher foot arch height would be related to better sprint performance in sprinters.Previous studies reported that the foot arch height may help utilize the elastic energy stored by the metatarsophalangeal (MTP) joint during the stance phase while sprintingTo test these hypotheses, we first compared the lengths and heights of the forefoot and rearfoot bones and foot arch height between faster and slower sprinters who had been divided based on their personal best times in a 100-m sprint race, which is due to understand the foot morphological characteristics in sprinters having superior sprint performance. Thereafter, we examined the relationship between these foot morphologies and sprint performance in sprinters.13. The personal best 100-m sprint time of faster sprinters ranged from 10.21 to 11.18\u00a0s . The personal best 100-m sprint time of slower sprinters ranged from 11.19 to 11.90\u00a0s . The participants were informed of the experimental procedures and provided written consent to participate in the study. None of the participants had contraindications to magnetic resonance imaging. All participants were informed of the experimental procedures and provided written consent to participate in the study. The study was approved by the Ethics Committee of Ritsumeikan University (BKC-IRB-2016-047) and conducted according to the Declaration of Helsinki.Fifty-six well-trained male sprinters  participated in this study. All sprinters were involved in regular sprint training and competition. Their best personal times in a 100-m sprint ranged from 10.21 to 11.90\u00a0s . In order to understand the foot characteristics in sprinters having superior sprint performance, sprinters were divided into two groups, one consisting of faster sprinters (n\u2009=\u200928) and one consisting of slower groups (n\u2009=\u200928), based on the personal best 100-m sprint time, as in our previous studyLength of the right foot of participants was measured in millimeters as the maximum distance from the heel to the end of the big and second toes. The highest value in both toes was considered the maximum foot length, and this length was used to normalize the lengths of the forefoot and rearfoot bones.The scans of the right foot of participants were performed using a 1.5-T magnetic resonance system . The participants were positioned supine on the scanner bed, with both knees fully extended. The subject\u2019s right ankle was carefully set at a neutral position . The foot scans were acquired using a 4-channel foot ankle coil. Three-dimensional isotopic T1-weighted images were obtained with a repetition time of 11.3\u00a0s, echo time of 5.1\u00a0ms, slice thickness of 1.2\u00a0mm, field of view of 28\u00a0cm, and matrix size of 256\u2009\u00d7\u2009256\u00a0pixels. The analyses of the foot morphological variables were conducted using image analysis software . All foot morphological variables were measured twice by a single examiner, and the two values were averaged.14. The coefficient of variations of the two measurements for the forefoot bone lengths of the big and second toes in all participants were: 1.6\u2009\u00b1\u20091.2, 1.4\u2009\u00b1\u20091.2, and 0.7\u2009\u00b1\u20090.5%, respectively, for the distal phalanx, proximal phalanx, and metatarsal of the big toe; 1.8\u2009\u00b1\u20091.5, 1.7\u2009\u00b1\u20091.3, 1.7\u2009\u00b1\u20091.3, and 0.6\u2009\u00b1\u20090.5%, respectively, for the distal phalanx, middle phalanx, proximal phalanx, and metatarsal of the second toe. The intraclass correlation coefficient (ICC) of the two measurements for each bone length ranged from 0.937 to 0.992. The reproducibility of these forefoot bone measurements has been reported in our previous studies14. The calculated forefoot bone lengths of the big and second toes were totaled to assess overall forefoot bone length for each toe. The total forefoot bones for each toe were normalized to the maximal foot length and used for analyses of this study.Representative magnetic resonance imaging scans for measuring the foot morphological variables bones are shown in Fig.\u00a0The lengths and heights of the talus and calcaneus were measured as maximal distances between the cortexes at the distal and proximal ends. The coefficient of variations of the two measurements for the lengths and height of the talus and calcaneus in all participants were: 0.5\u2009\u00b1\u20090.4 for the talus length, 0.4\u2009\u00b1\u20090.2% for the calcaneus length, 0.6\u2009\u00b1\u20090.6 for the talus height, and 0.6\u2009\u00b1\u20090.4% for the calcaneus height. The intraclass correlation coefficient of the two measurements for the lengths and heights of each bone ranged from 0.989 to 0.996. The lengths and heights of the talus and calcaneus were normalized to the maximal foot length and body height, respectively, and these relative values were also used for analyses in this study.22. The foot arch height index was also used for analyses in this study.MRI-measured foot arch height at non-weight bearing was measured as the minimum vertical distance between the navicular and the line connecting the thenar eminence to the bottom of the heel. The coefficient of variation of the two measurements for the foot arch height in all participants was 0.5\u2009\u00b1\u20090.4%. The intraclass correlation coefficient of the two measurements for the foot arch height was 0.997. The foot arch height was normalized to the maximal foot length , which represented the foot arch height indext-testing. The Cohen\u2019s d effect size using the pooled SD was calculated to determine the magnitudes of differences in the measured variables between the two groups. This effect size were interpreted as small (0.20\u20130.49), medium (0.50\u20130.79) and large (>\u20090.80)26. Relationships between the foot bone morphological variables and personal best 100-m sprint time in sprinters was examined using the Pearson\u2019s product-moment correlation coefficient. The statistical significance level was defined at P\u2009<\u20090.05. All statistical analyses were conducted using IBM SPSS software .The data are presented as the mean\u2009\u00b1\u2009SD. Comparisons of measured variables between faster and slower groups of sprinters were performed using an unpaired P\u2009=\u20090.009), with medium effect size (d\u2009=\u20090.73). The maximum foot length was also significantly higher in slower group than in faster group (P\u2009=\u20090.017), with medium effect size (d\u2009=\u20090.66).Physical characteristics and foot morphological variables between faster and slower groups of sprinters are listed in Table P\u2009<\u20090.001), with large effect size (d\u2009=\u20091.20).With regard to absolute lengths and heights of the foot bones, the total lengths of the forefoot bones of the big and second toes did not differ significantly between faster and slower groups of sprinters Table . MoreovePs\u2009<\u20090.05), with medium and large effect size . Moreover, the relative length of the calcaneus but not the talus was significantly higher in faster group than in slower group (P\u2009=\u20090.018), with medium effect size (d\u2009=\u20090.65). Furthermore, the relative calcaneus height was significantly higher in faster group than in slower group (P\u2009<\u20090.001), with large effect size (d\u2009=\u20091.22).Comparisons of the relative lengths and heights of the foot bones between faster and slower groups of sprinters are presented in Fig.\u00a0r\u2009=\u2009\u2009\u2212\u20090.293 and\u2009\u2212\u20090.459, both Ps\u2009<\u20090.05). Similarly, the relative lengths of the talus and calcaneus correlated significantly with personal best 100-m sprint time . There was no significant correlations between the relative talus height and personal best 100-m sprint time . In contrast, the relative calcaneus height correlated significantly with personal best 100-m sprint time .Relationships of the relative lengths and heights of the forefoot and rearfoot bones with sprint performance in sprinters are presented in Fig.\u00a0r\u2009=\u2009\u2009\u2212\u20090.413, P\u2009=\u20090.002). Although there was no significant correlation between the relative calcaneus height and the relative forefoot length of the big toe, the relative calcaneus height correlated significantly with the relative forefoot length of the second toe . Similarly, the relative calcaneus height correlated significantly with the lengths of the talus and calcaneus .Correlation coefficients between the relative rearfoot bone heights and the relative foot bone lengths in sprinters are shown in Table Ps\u2009\u2264\u20090.001), with large effect size . Although there was no significant correlation between the talus height and foot arch height , the calcaneus height correlated significantly with the foot arch height . Such a significant correlation was also observed between the relative calcaneus height and foot arch height index . Additionally, the foot arch height correlated significantly with personal best 100-m sprint time . Similarly, a significant correlation was observed between the foot arch height index and personal best 100-m sprint time .Relationships of the foot arch height index with the calcaneus height and sprint performance in sprinters are presented in Fig.\u00a0We found that the lengths of the forefoot and rearfoot bones correlated with personal best 100-m sprint time in sprinters. Moreover, the height of the calcaneus, but not that of the talus, correlated with the sprint performance. Furthermore, the calcaneus height correlated with the forefoot and rearfoot bone lengths. Additionally, the calcaneus height correlated with the foot arch height, and the foot arch height correlated with sprint performance. These findings suggest that a taller calcaneus may play an important role in modeling longer forefoot and rearfoot bones and higher foot arch height and archiving better sprint performance in sprinters.14; therefore, with an increase in sample size, the present finding further clarify the result of our previous studies. Using computer simulation, Lee and Piazza12 reported that a longer forefoot contributes to the production of greater plantar flexor torque during the push-off phase while sprinting. Additionally, van Werkhoven and Piazza27 determined that a longer hallux correlated with higher jump height in a single-joint jump task, possibly due to increased push-off strength. Jump performance is a major physical performance factor for predicting sprint performance in sprinters29. The findings of the present and previous studies suggest that the longer forefoot bones are advantageous morphologies for superior performance of sprinters, potentially because of increases in MTP flexor  and plantar flexor torques during sprinting.We previously reported that longer forefoot bones correlated with better sprint performance in sprinters27, they reported that longer heel length, in addition to hallux length, correlated with higher single-joint jump height. Their results suggest that both longer forefoot and rearfoot bones can coexist in the foot and may additively contribute to superior sprint performance. To the best of our knowledge, the present study is the first to determine the relationship between the rearfoot bone lengths and athletic performance, including sprinting.Our first hypothesis was that the longer rearfoot bones would be related to superior sprint performance in sprinters. In this study, we found that the calcaneus, but not the talus, was longer in faster group than in slower group of sprinters. Furthermore, longer calcaneus and talus bones correlated with better sprint performance in sprinters. These findings suggest that the lengths of the rearfoot bones, especially the calcaneus, in addition to the forefoot bones may be related to superior sprint performance in sprinters. In a study by van Werkhoven and PiazzaOur second hypothesis was that the taller calcaneus would be required for modeling the favorable foot bone morphologies  and would be related to superior sprint performance. In this study, we found that the calcaneus height was higher in faster group than in slower group of sprinters. Moreover, a taller calcaneus correlated with better sprint performance in sprinters. Furthermore, the taller calcaneus correlated with the longer forefoot and rearfoot bones. These findings support our hypothesis prior to the present study. To the best of our knowledge, the present study is also the first to determine the relationship between the calcaneus height and athletic performance, including sprinting.21. Morita et al.22 reported a positive correlation between foot arch height and sprint performance in children. Despite these findings, to the best of our knowledge, no study has examined this relationship in adults, including sprinters, prior to the present study. Therefore, this is the first study to determine a positive relationship between foot arch height and sprint performance in adult sprinters. In addition, although the foot arch height is often associated with the foot length in non-sprinters24, the present study determined no correlation between foot arch height and foot length  in sprinters . Furthermore, a trend against negative correlation was observed between maximal foot length and sprint performance . Therefore, a higher foot arch height may be related to better sprint performance independently of the foot length in sprinters. Taken together, we suggest that a taller calcaneus may help achieve superior sprint performance, potentially by modeling the functional foot morphology  in addition to the longer forefoot and rearfoot bones.Our third hypothesis was that a taller calcaneus would be related to a higher foot arch height. We also hypothesized that the higher foot arch height would be related to superior sprint performance. In this study, we found that the foot arch height was higher in faster group than in slower group of sprinters. Furthermore, the higher foot arch height correlated with better sprint performance in sprinters. Previous studies reported that the foot arch height may contribute to increasing the MTP joint and plantar flexor torques during the push-off phase while sprinting31. The results of this study showed that although there were no correlations of absolute and relative heights of the talus with the foot arch height and its index, absolute and relative heights of the calcaneus correlated positively with the foot arch height and its index. Using radiographs Agoada and Kramer30 reported that in the course of weight-bearing, a taller calcaneus may be related to a higher foot arch height by showing a positive correlation of the ratio of the height relative to the length of the calcaneus with the foot arch height. In an additional analysis conducted in the present study, we similarly obtained a positive correlation of the ratio of the height to the length of the calcaneus with the foot arch height when non-weight-bearing . By contrast, in a study by Agoada and Kramer30, all variables, including the ratio of the height to the length, related to the height of the talus did not correlate with the foot arch height. Furthermore, the result of additional analysis in the present study showed a negative correlation of the ratio of the height to the length of the talus with the foot arch height , suggesting that a taller talus may be a negative morphological factor for modeling a higher foot arch height. As an explanation of these findings of the present and previous studies, the high arch of the foot is related to an increase in the calcaneal inclination angle , which may contribute to modeling a taller calcaneus31. Contrary to this, the low arch of the foot is related to an increase in the calcaneal-first metatarsal angle , which may contribute to modeling a taller talus31. Therefore, a taller calcaneus due to increased calcaneal inclination angle may be a positive factor for a higher foot arch height, whereas a taller talus due to increased calcaneal-first metatarsal angle may be a negative factor for a higher foot arch height. In summary, the height of the calcaneus, but not the talus, may play an important role in increasing the foot arch height.The calcaneus and talus are known to be pivotal bones for foot arch formation32, the calcaneus may be more sensitive to acquired factors  than other foot bones such as the forefoot bones33. Based on the findings of the present and previous studies, successful sprinters are characterized by greater calcaneus, whereas successful endurance runners may be characterized by smaller calcaneus35, suggesting that the calcaneus morphology may be favorably modeled throughout long-term specific training. Further longitudinal studies are needed to follow-up the growth and development of the foot bones in junior athletes, including sprinters and endurance runners.This study has several limitations. First, although we recruited only Japanese male sprinters, it remains unclear whether the present findings can be generalized to other racial and ethnic groups or to female sprinters. Further studies are needed to determine the relationship between the foot morphological variables and sprint performance in sprinters of different races and sex. Second, although we measured the foot arch height when non-weight bearing because of a technical limitation of magnetic resonance imaging, the foot arch height at weight-bearing may be a more important parameter for predicting sprint performance than that at non-weight bearing. This is potentially due to a general form during human movements. Further studies are needed to determine the relationship between the foot arch height when weight-bearing and sprint performance. Third, although we determined that the foot bone morphologies were different between faster and slower groups of sprinters based on personal best 100-m sprint time, it is unclear whether these differences are derived from genetic and/or long-term training effects. Nevertheless, although the forefoot bones may be determined mainly by genetic factors31, an increase in the foot arch height may become the important target of regular training for enhancing sprint performance in sprinters. This is because the foot arch height can be increased by short foot exercise training38. Mulligan and Cook37 reported that the short foot exercise training increased the foot arch height when weight bearing in healthy young adults. Therefore, further studies are needed to examine the effect of short foot exercise training on the foot arch height and sprint performance in sprinters.In a perspective, it would be generally difficult to remodel the length and height of the foot bones in adult humans. Nevertheless, an increase in calcaneal inclination angle may contribute to increasing the calcaneus height based on an analysis method of this study; this implies that the calcaneal inclination angle may have potential as an important morphological parameter of sprint performance in sprinters. Based on a positive correlation between calcaneal inclination angle and foot arch heightIn conclusion, we suggest that the taller calcaneus may be a key morphological factor for achieving superior sprint performance, potentially via modeling the longer forefoot and rearfoot bones and higher foot arch height. These findings could enhance our understanding of the importance of the foot morphology on athletic performance in athletes.The datasets used for this study are available from the corresponding author on reasonable request."}
{"text": "Malus doumeri leaf flavonoids (MDLF) were used as the research object to observe their in vitro antioxidant stress ability. Hydrogen peroxide (H2O2) was used to induce oxidative stress in 293\u2009T cells.In this study, MTT, flow cytometry, and qPCR were used to verify the effect of MDLF.2O2. It was also observed that MDLF could significantly increase the levels of catalase (CAT), superoxide dismutase (SOD), glutathione (GSH), and glutathione peroxidase (GSH-Px) and reduce the level of malondialdehyde (MDA). The results of quantitative polymerase chain reaction (qPCR) showed that MDLF could significantly up-regulate the mRNA expression levels of CAT, SOD, GSH, GSH-Px, B-cell lymphoma-2 (Bcl-2) and downregulate the expression levels of B-cell lymphoma-2 associated x protein (Bax), tumor necrosis factor-alpha (TNF-\u03b1), and nuclear factor kappa-B (NF-\u03baB) in oxidative stress-injured cells. The HPLC analysis showed that MDLF contained hyperin, isoquercetin, quercitrin, hesperidin, myricetin, baicalin and quercetin.In vitro cell experiments showed that at a concentration of 0\u2013160\u2009\u03bcg/mL, MDLF did not affect the normal proliferation of human embryonic kidney 293\u2009T cells (HEK 293\u2009T cells), and MDLF had no cytotoxic effect in this concentration range. It was found that MDLF could maintain the survival of HEK 293\u2009T cells (82.6%) at a high concentration (160\u2009\u03bcg/mL). Morphological observation also found that MDLF can inhibit the cell structure imperfection caused by H2O2 in 293\u2009T cells. Therefore, MDLF is a type of natural substance with good anti-oxidant effect, and it has the potential to interfere with many diseases.From the experimental results, it was observed that MDLF has a strong anti-oxidation ability in vitro, and it can interfere with the oxidative stress damage caused by H It increases the expression of the apoptotic gene, but it decreases the expression of the anti-apoptotic protein, leading to normal cell apoptosis and pathological changes in the body [The production of oxidative stress is due to the excessive production of free radicals and the release of a large number of reactive oxygen species (ROS) and other oxidizing substances after the body is injured by endogenous or exogenous factors. However, the ability of the body to resist oxidation is decreased and the accumulation of ROS cannot be inhibited, which leads to a imbalance between the ability of oxidation and anti-oxidation. The oxidation reaction of the body is far beyond the ability of antioxidant clearance. Excessive ROS caused by oxidative stress can stimulate cells to initiate lipid peroxidation reaction, which can damage cell function and structure , 2. The the body . When inthe body . Oxidatithe body .The body balance is disrupted after oxidative stress, and this causes many diseases. Under the stimulation by external adverse factors, the level of skin internal oxidation rises, resulting in the metabolic imbalance of the oxidation system, which directly or indirectly leads to the occurrence of some skin diseases, such as skin photoaging, skin tumors, pigmented diseases, and wound healing and repair . StudiesMalus doumeri is a Rosaceae family plant, whose fruit is consumed. The leaves are also used to a certain extent. Firstly, they are processed into drinks such as tea; secondly, they are used as folk drugs to prevent diarrhea; thirdly, they have antiseptic and bacteriostatic effects, and they are often mixed with other foods and drugs as natural preservatives [Malus that are beneficial to human health; among them, the vitamin C content reaches 177.75\u2009mg/g [Malus doumeri is about 5%, and the content of flavonoids in general tea is only 1\u20132% of the total polyphenols, while that in the leaves of Malus doumeri is more than 60%. After rough processing, the yield of total flavonoids in the dry leaves of Malus doumeri can be more than 3%, which shows that the content of flavonoids in the leaves of Malus doumeri is high [At present, many plants have been found to have antioxidant effects, which mainly arise from flavonoids, saponins, polysaccharides, and organic acids , 13. Antrvatives . Studies.75\u2009mg/g ; in addi.75\u2009mg/g . The con is high .Malus doumeri. However, with an increasing number of drinks and health products processed from the leaves of Malus doumeri, its biological activity and mechanism need to be studied further. In this study, the components of flavonoids in the leaves of Malus doumeri leaf (MDLF) were analyzed, and the effect of MDLF on oxidative stress injury induced by hydrogen peroxide (H2O2) in human embryonic kidney 293\u2009T cells was studied for the first time, which is the theoretical basis for further utilization of MDLF accumulation.Because of the limited area of application and cognition, there are few researches on Malus doumeri leaves  were crushed and sieved. A voucher specimen is deposited at the herbarium of the Chongqing University of Education under the number CCICFF-201902. Professor Xin Zhao authenticated the sample. Then 200\u2009g of these leaves were weighed and placed in a beaker precisely and 70% ethanol was added according to the liquid to material ratio of 20:1; then they were placed in a 60\u2009\u00b0C water bath for 3\u2009h and the liquid was extracted for standby, passing through FL-3 macroporous resin. The liquid passing through the resin was evaporated to dryness through a rotary evaporator, and the extracted MDLF was obtained [After the dried 4 cells/mL suspension; then 200\u2009\u03bcL cell suspension was inoculated into a 96 well cell culture plate and cultured at 37\u2009\u00b0C for 24\u2009h until cells were attached to the wall. Then the culture medium was discarded, and 200\u2009\u03bcL new des medium containing 0\u2013200\u2009\u03bcg/mL MDLF was added for 48\u2009h. Then the medium in the 96 well culture plate was discarded, and the deme medium containing 5\u2009mg/mL MTT  was added for continuous culture for 4\u2009h. The medium was discarded again, dimethyl sulfoxide  of 200\u2009\u03bcL was added, and the reaction was carried out for 30\u2009min without light and vibration. Finally, the optical density (OD) value of each hole was measured at 494\u2009nm , and the cell survival rate  after the MDLF treatment was calculated / As)\u2009\u00d7\u2009100%, where Ar: OD value of MDLF treated cells; As: OD value of normal cells) to observe the toxic effect of MDLF in 293\u2009T cells [After being resuscitated, HEK 293\u2009T cells  were inoculated in the deme medium containing 10% fetal bovine serum and 1% penicillin streptomycin double antibody. Then the cells were cultured in a carbon dioxide incubator  for 48\u2009h and digested with 0.25% trypsin. Further, 293\u2009T cells were counted and made into a 1\u2009\u00d7\u200910\u2009T cells .2O2 was added and cultured for 4\u2009h to induce a cell oxidative damage model. After that, the medium was discarded again, the deme medium with concentration of 0\u2013200\u2009\u03bcg/mL MDLF was added to culture for 48\u2009h, and then the OD value of each cell was measured at 494\u2009nm according to the cytotoxicity experiment of MDLF on HEK 293\u2009T cells and the inhibition effect of MDLF on oxidative damage induced by H2O2 in HEK 293\u2009T cells was observed by calculating the survival rate of cells after oxidative damage prevention by each concentration of MDLF [Cells were resuscitated and cultured according to the experimental operation in the cytotoxicity experiment of MDLF on HEK 293\u2009T cells. Cells were made into a cell suspension and cultured in 96 well plates. Cells were attached to the wall and then discarded. Further, 200\u2009\u03bcL of deme medium containing 0.3\u2009mmol/L H of MDLF .According to the effect of MDLF on the oxidative damage of HEK 293\u2009T cells induced by hydrogen peroxide, the cells were cultured, induced oxidative damage and treated with MDLF for 48\u2009h. The morphology of cells in each group was observed under the microscope .2O2 in HEK 293\u2009T cells, the cells were cultured and treated with MDLF for 48\u2009h; then the cells were fixed, and apoptosis was detected by flow cytometry after staining  [According to the experimental operation of MDLF on oxidative damage induced by HCA, USA) .2O2 in HEK 293\u2009T cells, the cells were cultured and treated with MDLF for 48\u2009h. Then the MDA, SOD, GSH, GSH-Px, and CAT levels in cells of each group were measured according to the kit instructions  [According to the experimental operation of MDLF on oxidative damage induced by H, China) .2O2 in HEK 293\u2009T cells by MDLF, cells in each group were used to extract total RNA of cells by Trizol reagent (Solarbio Life Sciences). Further, 1\u2009\u03bcL of oligo (DT) 18 primer  and 1.0\u2009\u03bcL of total RNA (1.0\u2009\u03bcg/\u03bcL) were added to 10.0\u2009\u03bcL of nuclease free water and heated in PCR for 5\u2009min (65\u2009\u00b0C). Then, 4.0\u2009\u03bcL of 5\u2009\u00d7\u2009reaction buffer, 1.0\u2009\u03bcL of ribolock RNase inhibitor (20\u2009U), 2.0\u2009\u03bcL of 10\u2009mM dNTP mix, and 1.0\u2009\u03bcL of reversible reverse transcription (200\u2009U/\u03bcL) were added to the above reaction system solution for cDNA transcription . Then, 1\u2009\u03bcL 10.0\u2009\u03bcM upstream primer and 1\u2009\u03bcL 10.0\u2009\u03bcM downstream primer , gradient elution mobile phase C was acetonitrile; mobile phase B was 0.5% glacial acetic acid aqueous solution; flow rate was 0.5\u2009mL/min, column temperature was 35\u2009\u00b0C; detection wavelength was 360\u2009nm; and injection volume was 10\u2009\u03bcL. Then the content of MDLF was calculated by the external standard peak area method according to the HPLC method , and the formula was as follows: Where: Mc is the content of flavonoids in the sample, mg/g; C1 is the concentration of the standard, mg/ml; Ar is the peak area of the standard; A1 is the peak area of the sample; C is the concentration of the original solution of the sample, 0.0025\u2009g/mL.P\u2009<\u20090.05. The analysis method was Duncan\u2019s multiple range test single factor analysis of variance (ANOVA).All experiments were carried out three times in parallel. The mean\u2009\u00b1\u2009standard deviation (SD) was used to express the results. SAS9.1 statistical software was used to analyze the significant differences between groups of data at the level of When HEK 293\u2009T cells were treated with MDLF at concentrations of 20, 40, 60, 80, 100, 120, 140, 160, 180, and 200\u2009\u03bcg/mL, compared with HEK 293\u2009T cells that were not treated with MDLF, MDLF at concentrations of 20\u2013160\u2009\u03bcg/mL did not significantly affect the proliferation of HEK 293\u2009T cells, and the survival rate of HEK 293\u2009T cells in this concentration range was more than 95% , while the SOD, GSH, GSH-Px, and CAT levels were significantly lower  pathway, endoplasmic reticulum stress, NF-\u03baB, and Bcl-2 family . In the Oxidative stress and inflammation promote each other. Research shows that TNF-\u03b1 can enhance the expression of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase and inhibit the expression of SOD, which leads to an oxidative stress reaction. However, inhibiting the expression of TNF-\u03b1 can effectively inhibit the oxidative stress reaction . NF-\u03baB iHypericin, isoquercetin, quercitrin, hesperidin, myricetin, baicalin, and quercetin are commonly found flavonoids in plants, and all of them have strong antioxidant activity \u201342. HypeIn this study, the results showed that MDLF could protect HEK 293\u2009T cells from oxidative stress by regulating oxidation, apoptosis, and inflammation. MDLF contains active flavonoid substances, which make it play these roles. This study preliminarily verified the effect of MDLF, but its antioxidative effect and mechanism in vivo still need to be studied further. In the future, an in-depth study is needed to assess the role of MDLF in the intervention for various diseases through its antioxidant effect."}
{"text": "Implant-associated infections remain a tremendous challenge, and all efforts should be taken to improve the prevention and treatment of this entity. A critical factor in the establishment of implant-associated infections is the colonization of the implant surface and subsequent biofilm formation by bacteria or fungi in the context of the \u201crace for the surface\u201d Antimicrobial coatings technologies offer the option of local protection of the implant surface against the above-mentioned implant colonization and biofilm formation of microorganisms. Despite tremendous research in this field, there are currently only a few clinically available implants with antimicrobial coatings on the market In the narrow sense, implant coatings include technologies with direct modification of the actual implant surface , which can directly be used by surgeons in the operating room. These technologies mainly consist of systems that release agents with antimicrobial activity such as silver, gentamicin and povidone-iodine. These compounds are attached directly to the implant surface during the manufacturing process by orthopaedic device companies clinicaltrials.gov).Implant coatings are different from surface treatment of implants by surgeons. In the latter, the surgeons apply a compound directly to the metallic surface of the implant immediately prior to implantation. Hydrogels or other antimicrobial drug delivery systems, such as antibiotic-loaded calcium sulfates and calcium phosphates, belong in this category Most experimental coatings involve antibiotics or antimicrobial compounds that have been tested in the laboratory setting. Novel compounds include CZ-01127 that allow elution of high antibiotic concentrations Regarding direct coating technologies, passive modification of the implant surface design with modification of its morphology or hydrophilic/hydrophobic properties is another theoretical approach to prevent bacterial adhesion and improve the implant's robustness against infection, but none of these technologies have reached market approval yet in vitro data for orthopedic devices, there is still a lack of human clinical data Current regulatory requirements are challenging for the market approval of antimicrobial coated implants in the orthopaedic field Clinical safety of all currently available technologies has been demonstrated. There is growing evidence to reduce infection rates by direct coatings, mainly for certain antibiotics, silver and povidone iodine. However, these data have been mainly derived from case series or cohort studies on megaendoprostheses in orthopaedic oncology and complex revision cases with an elevated (re)infection risk, but not from prospective randomized controlled trials. Alternative \u201cindirect\u201d coatings,  have not been officially approved as implant coatings. Future technologies, such as covalently bonded antibiotics or silicone-based coatings, are on the horizon but will have to undergo complex regulatory approval processes before their official clinical use.In conclusion, the given clinical safety of the currently available coatings justifies the use of antimicrobial coated implants in \u201chigh risk\u201d cases, but individual risk benefit analysis should be performed for each single patient. The orthopaedic community, industry and regulatory agencies are urged to pave the way for further and sound clinical evaluation regarding clinical efficacy of antimicrobial coated implants in randomized controlled clinical trials."}
{"text": "Cognitive problems, especially disturbances in episodic memory, and hippocampal sclerosis are common in temporal lobe epilepsy (TLE), but little is known about the relationship of hippocampal morphology with memory. We aimed to relate hippocampal surface\u2010shape patterns to verbal and visual learning.We analyzed hippocampal surface shapes on high\u2010resolution magnetic resonance images and the Adult Memory and Information Processing Battery in 145 unilateral refractory TLE patients undergoing epilepsy surgery, a validation set of 55 unilateral refractory TLE patients, and 39 age\u2010 and sex\u2010matched healthy volunteers.p\u2009<\u20090.001). Verbal learning was more impaired the greater the atrophy of the left superolateral hippocampal head. In contrast, visual memory was worse with greater bilateral inferomedial hippocampal atrophy. Postsurgical verbal memory decline was more common in LTLE than in RTLE , whereas there were no differences in postsurgical visual memory decline between those groups. Preoperative atrophy of the left hippocampal tail predicted postsurgical verbal memory decline.Both left TLE (LTLE) and right TLE (RTLE) patients had lower verbal  and visual learning  scores than healthy controls (verbal 58\u2009\u00b1\u20098, visual 39\u2009\u00b1\u20096; ANN NEUROL 2020;88:170\u2013182Memory deficits in TLE are associated with specific morphological alterations of the hippocampus, which could help stratify TLE patients into those at high versus low risk of presurgical or postsurgical memory deficits. This knowledge could improve planning and prognosis of selective epilepsy surgery and neuropsychological counseling in TLE. ANN NEUROL 2020  Temporal lobe epilepsy (TLE) is the most frequent form of chronic focal epilepsy in adults, with up to 70% of TLE patients suffering from declarative memory problems.First, how strongly are memory functions lateralized in TLE? The traditional material\u2010specific model states that verbal deficits are usually observed in epilepsy affecting the dominant  hemisphere,Second, why do some patients with TLE have memory impairments whereas others do not? Most cognitive difficulties are already detectable at or even before the onset of seizures, suggesting an important role of the underlying structural and cellular pathology.Lastly, is there a subregionally specific contribution of the hippocampus to verbal and visual memory formation? Various quantitative histology studies have assessed neuronal cell counts on hippocampal specimens obtained during temporal lobe resections but produced conflicting findings Table .10, 11, Histological neuronal cell counts have 2 major limitations. Histopathology only evaluates tissue from a limited number of slices of the hippocampus, restricting the method's ability to make spatial inferences on the location of the findings. Additionally, the contralateral hippocampus cannot be investigated.To overcome some of these limitations, we analyzed alterations of hippocampal morphology using noninvasive surface shape analysis on high\u2010resolution MRI,We identified consecutive TLE patients undergoing epilepsy surgery at the National Hospital for Neurology and Neurosurgery  and 39 age\u2010 and sex\u2010matched healthy volunteers. The details of our ongoing epilepsy cohort study have been described previously.In addition, we included a validation set of 55 independent unilateral refractory TLE patients  evaluated at NHNN and meeting the criteria described above.The standard ATLR consisted of the removal of the temporal pole and opening of the temporal horn, followed by en bloc resection of the hippocampus with a posterior resection margin at the midbrainstem level. Typically, the anterior\u2013posterior extent of the temporal lobe resection as measured from the temporal pole to the posterior margin of resection is 30% and 35% of the distance from the temporal pole to the occipital pole after left and right ATLR, respectively. Only the anterior part of the hippocampus is resected during this procedure, and parts of the body and the tail remain as a postsurgical remnant.p = 0.41) and in 24 patients in the validation cohort . List and Design learning was used for memory assessment.Verbal and visual memory was assessed preoperatively and 1\u2009year postoperatively using the Adult Memory and Information Processing Battery (AMIPB).z scores. Significant memory decline was defined as decline below the 90% reliable change index (RCI) as described previously.Change in neuropsychological performance 1\u2009year after epilepsy surgery was measured as the difference in pre\u2010 and postsurgical memory MRI data for the development cohort were collected between September 2005 and August 2012 on a 3T Signa HDx Scanner  at the Epilepsy Society. A coronal T1\u2010weighted 3\u2010dimensional (3D) fast spoiled gradient echo with repetition time (TR)/echo time (TE)/inversion time (TI) = 6.6/2.8/450\u2009milliseconds, matrix = 256\u2009\u00d7\u2009256\u2009\u00d7\u2009178, field of view (FOV) =\u200924\u2009\u00d7\u2009240\u2009\u00d7\u2009196mm, voxel size = 0.9375\u2009\u00d7 0.9375\u2009\u00d7 1.1mm was acquired in all subjects.In the validation cohort, subjects underwent imaging on a 3T GE Discovery MR750. A 3D T1\u2010weighted inversion\u2010recovery fast spoiled gradient recalled echo  was acquired in all validation subjects.http://niftyweb.cs.ucl.ac.uk/program.php?p=HIPPOSEG) to automatically extract the initial hippocampal masks.First, we used HipposegTo assess intrarater variability of this combined manual\u2010automated approach, one blinded rater manually corrected Hipposeg segmentation in randomly selected 10 TLE patients on two different occasions 3\u2009months apart and compared the resulting masks using Dice coefficients.Hippocampal volumes were corrected for total intracranial volume (TIV) as described previously.3D surface meshes were extracted from binary hippocampal segmentations and parameterized with a spherical harmonics point distribution model (SPHARM\u2010PDM).To enhance the interpretation of hippocampal surface maps, several groups have defined heuristic boundaries between hippocampal subregions.http://www.math.mcgill.ca/keith/surfstat/). Two independent variables  were analyzed in 3 groups .We statistically compared pointwise displacement values on hippocampal surfaces using fixed\u2010effect linear models implemented in SurfStat . The outcome parameter used was the change in p\u2009<\u20090.05.We report findings corrected for multiple comparisons using random field theory for nonisotropic images on a cluster level,The effect size is shown on T\u2010value maps. A higher T value (blue color) signifies a positive correlation, that is, the association between a regional inward deformation (atrophy) and lower memory performance. A negative T value represents a negative correlation, that is, the association of outward deformations (hypertrophy) with lower memory performance.We also aimed to determine the prognostic value of the significant shape patterns. On an individual level, we determined the predictive value of deformations in these clusters using the area under the receiver operating characteristics curve (AUC). On a group level, we divided patients into those with or without significant inward deviations . We compared poor presurgical performance and the risk of poor postsurgical memory performance between these imaging\u2010based patient subgroups using logistic regression and provide bootstrapped confidence intervals (CIs) to improve generalizability. In addition, we used logistic regression and calculated the AUC to determine the association of hippocampal shape patterns with memory performance in the validation cohort.t test for independent samples. We correlated hippocampal volumes with neuropsychological scores using the Pearson correlation coefficientDemographic data and volumetric findings are reported as n (%) or mean\u2009\u00b1\u2009standard deviation. We compared hippocampal volumes between groups with the t = \u22121,337, p = 0.183) or sex . Detailed participant characteristics are displayed in Table We included 76 patients with LTLE , 69 patients with RTLE , and 39 controls . There were no between\u2010group differences in age  and visual  memory scores than healthy controls  and visual  delayed recall scores than healthy controls , but RTLE patients had lower visual memory scores than LTLE patients .Both RTLE and LTLE patients had lower verbal . There were no significant changes in visual memory after left or right ATLR.Postsurgical (1\u2009year) verbal memory decline was more common after left compared to right temporal lobe removal  and RTLE (t = \u22126.467) patients compared to controls .The ipsilateral hippocampus was significantly smaller in both LTLE  and greater right hippocampal volume with better visual memory  before surgery .For all TLE patients, a greater left hippocampal volume weakly correlated with better verbal memory . Although significant, these correlation coefficients (r\u2009<\u20090.30) only suggest a weak linear relationship between overall hippocampal volume and neuropsychological performance.The presurgical volume of the left hippocampus predicted postsurgical change in verbal memory for all patients with TLE . Atrophy here was a significant predictor of poor verbal memory , and this association remained significant when controlling for presence of HS (p = 0.009). This pattern was, however, not predictive of poor visual memory performance .Patients with (n = 55) compared to those without (n = 90) significant atrophy in the left superolateral hippocampal head see Fig A had a 2p = 0.003).In the validation cohort, patients with (n = 13) compared to those without (n = 42) significant atrophy in the left superolateral hippocampal head had a 3.3\u2010fold  higher risk of poor verbal memory with an AUC of 0.74 (p\u2009<\u20090.001). The magnitude of this atrophy was an individual predictor of poor visual memory , and it remained significant after controlling for HS (p = 0.002). This pattern was not predictive of poor verbal memory .Patients with (n = 33) as opposed to those without n = 112) significant atrophy of the bilateral inferomedial hippocampal surface . This pattern was predictive at an individual level  but was not significant when controlling for HS . There were no shape abnormalities predictive of visual memory decline.Eighteen of the 55 patients who underwent left ATLR had an atrophic left hippocampal tail see Fig A. This pp = 0.04).In the validation cohort, patients with (n = 3) compared to those without (n = 21) significant atrophy of the left hippocampal tail had a 2.1\u2010fold  higher risk of postsurgical verbal memory decline with an AUC of 0.74 . Thus, hippocampal shape patterns predictive of poor visual memory need to be interpreted with caution, and validation in a larger cohort is warranted. Our analysis was restricted to the hippocampal surface, and hippocampal subfields hidden in depth (CA4) could not be explored. We provided heuristic subfield boundaries on our hippocampal figures, but these approximations need to be interpreted with caution. A limitation inherent to all studies in refractory TLE patients undergoing epilepsy surgery is that patients are treated with antiepileptic drugs and the influence of medication on cognition cannot be eliminated.Not all morphological results found in the combined epilepsy group translated to the LTLE and RTLE subgroups. Some of these differences can be attributed to a reduced power to detect significant results in a smaller group of subjects. Several effects and trends seen on T\u2010value maps in these subgroups implicate regions similar to those found in the overall patient group. Similar trends compared to the overall group were observed in relation to verbal and visual memory in LTLE see Fig C, D and Hippocampal surface\u2010shape analysis can demonstrate hippocampal morphology and its impact on cognitive function, which is not captured by global volume measurements. Our results suggest a subregionally specific representation of memory functions in the hippocampus, which will be relevant in view of recently developed highly selective surgical procedures .T.S.P., S.B., P.J.T., M.K.S., S.B.V., M.T., J.S.D., M.J.K., and M.G. contributed to the conception and design of the study; T.S.P., C.C.\u2010L., I.C., J.d.T., J.L.B., L.C., G.P.W., S.B.V., J.S.D., M.J.K., and M.G. contributed to the acquisition and analysis of data; T.S.P., C.C., I.C.\u2010L., M.J.K., and M.G. contributed to drafting the text and preparing the figures.Nothing to report.TABLE S1. Review of Quantitative Histology Studies Analyzing the Association of Hippocampal Subfield Neuronal Counts and Verbal/Visual MemoryTABLE S2. Association of Pathology with Presurgical Memory PerformanceTABLE S3. Association of Atypical Language Lateralization with Pre\u2010 and Postsurgical Memory Scores in LTLEClick here for additional data file."}
{"text": "In this work, we present a procedure for synthesizing [16]andS4 in 45% yield , together with a selection of strategies for preparing bifunctional derivatives. An ester-linked N-hydroxysuccimide ester , an ether-linked isothiocyanate  and an azide derivative were prepared. In addition, a new route to a carbon-carbon linked carboxylic acid functionalized derivative is presented. Finally, a general method for conjugating the NHS and NCS derivatives to a polar peptide (octreotide) is presented, by dissolution in water:acetonitrile (1:1), buffered to pH 9.4 using borate. The reported compounds will be readily applicable in radiopharmaceutical chemistry, by facilitating the labeling of a range of molecules, including peptides, with relevant soft radiometal ions.The field of targeted radionuclide therapy is rapidly growing, highlighting the need for wider radionuclide availability. Soft Lewis acid ions, such as radioisotopes of platinum, rhodium and palladium, are particularly underdeveloped. This is due in part to a lack of compatible bifunctional chelators. These allow for the practical bioconjugation to targeting vectors, in turn enabling radiolabeling. The [16]andS While oneS4-ol) . This coribution ,30. To hhelators B, bottom4 was initially reported by Meadow and Reid in 1934, who identified the difficulty of the formation of rings containing more than 12 members  [4-diol and [16]aneS4-ol, was disclosed later, using a multistep approach to prepare the asymmetric analogues of [16]aneS4 [The synthesis of [16]aneSditions) . As ment16]aneS4 ,29. This16]aneS4 . While t4-ol 7, using a method adapted from Lyczko and Li aneS4-ol 7 .On this backdrop, several different strategies were considered, accounting for synthetic practicality and compound stability. To broaden the application of the new macrocyclic chelator derivatives, three different linker types were prepared B, bottomo and Li ,29, and o and Li ,32. Stareld 76%, . Transfo4-ol 7 in hand, we began the construction of the functional conjugation sites . Ester-linked chelators could have a potentially faster catabolism in vivo, which has been recognized as enabling a faster radionuclide clearance, which is potentially desirable for long-lived therapeutic radionuclides aneS4-ol 7 was decorated with N-Boc-3-aminopropyl methane sulfonate to give the N-protected intermediate 11 (78% yield). This compound was then deprotected under acidic conditions and transformed into the corresponding isothiocyanate via consecutive reaction of the amine with N,N\u2032-thiocarbonyldiimidazole under alkaline conditions (see SM for more details). Via this route, isothiocyanate 13 was obtained in a relative straightforward fashion . Notably, the amino intermediate 12 was also transformed directly into the corresponding azido compound 23 using a diazo transfer reagent (75% yield). Azides are extremely useful due to their practical bioconjugation via azide\u2013alkyne cycloadditions under various conditions in vitro and in vivo [With macrocycle [16]aneSon sites . Previouy Lyczko . In ordenuclides . The car in vivo .4-isothiocyanate 13 proved to be sufficient to be a versatile synthetic framework for alternative strategies. While the overall yield of [16]aneS4-ol 7 could be improved further by using the suggestions from Meadow, Reid and Ochrymowycz (vide infra) aneS4-ol 7, directly into the corresponding [16]aneS4-isothiocyanate 13 (4-ol 7 with 3-bromo propaneisothiocyanate or 4-(bromomethyl) phenyl-isothiocyanate, resulted in only trace amounts of desired products.The route towards [16]aneSe infra) ,32, we qvailable , and com2CO3 in DMF for several days at 45 \u00b0C. This gave 1,11-diiodo-4,8-dithiaundecane 6 in good yield . At this point we wanted to evaluate whether we could use dihydrolipoic acid (DHLA) as the 1,3-dithio coupling partner in the final macrocyclization. DHLA can be prepared quantitatively from \u03b1-lipoic acid under mild reducing conditions; NaBH4, NaHCO3 in H2O (see SI for details) aneS4-ol 7, macrocyclization with DHLA to form 22 appears to be an attractive gateway to functionalizable derivatives. Further attempts to improve the yield of this step were unsuccessful, and it was observed that 1,11-diiodo-4,8-dithiaundecane 6 was unstable and could not be stored for several days, even under inert atmosphere (argon) at \u221220 \u00b0C (see SM for more details and discussion). Based on these observations, we hypothesized that 6 rapidly decomposes due to the presence of iodide, via a reversed sulfonylation degradation pathway or via polymerization. The instability of these compounds was also attributed to external factors such as light and heat, including the presence of heavy halogens (such as iodine), which was also observed by Meadow and Reid aneS4-NCS 13, [16]aneS4-N323, we elected 9 and 13, to be conjugated to octreotide, as a proof-of-concept for further conjugation studies. Octreotide is a mimic of natural somatostatin, which is a growth hormone-inhibiting hormone, which regulates the endocrine system, affecting neurotransmission and cell proliferation aneS4-NHS and the [16]aneS4-NCS were successfully conjugated to octreotide, a mimic of natural somatostatin, as an initial proof-of-concept for further bio-conjugation studies.In conclusion, a number of novel bifunctional chelators were synthetically prepared for application in soft radiometal theranostics. The chelator, a [16]aneS"}
{"text": "Intimate partner violence (IPV) during pregnancy has negative health impacts on the woman and the fetus. There is a lack of evidence supporting effective interventions to prevent IPV during pregnancy. This user-involvement study was conducted to get feedback on a culturally sensitive, tablet intervention containing questions about violence and safety-behaviors and a video promoting safety behaviors. This resulted in important feedback on the intervention content. Our findings show that women are in favor of disclosing IPV via a tablet. They suggested ways to address barriers for disclosure, such as safeguarding anonymity and creating a trustful relationship with the midwife. Intimate partner violence is considered a serious social and public health problem, with one in three women having experienced physical and/or sexual violence by an intimate partner some time during their life . PregnanA recent meta-analysis of IPV during pregnancy, which included 92 studies from 23 countries, reported that the prevalence of physical, sexual, and emotional abuse was 13.8%, 8.0%, and 28.4%, respectively . In NorwViolence during pregnancy is associated with adverse complications, such as premature contractions, miscarriage, premature birth, still birth, and low birth weight . In addiAntenatal care is considered a \u201cwindow of opportunity\u201d to address IPV because women are in regular contact with health professionals throughout the pregnancy . PregnanRecommended interventions for IPV in primary care settings involve questions about violence, safety-planning strategies, and help-seeking strategies . The eviScreening for IPV in antenatal care might increase identification of violence . NorwegiMobile health technology  such as mobile phones, tablets, and other wireless computing devices have the potential to overcome some of the barriers regarding face-to-face interventions . The tecThe Safe Pregnancy study is a randomized controlled trial (RCT) to test the effectiveness of a tablet-based, culturally adapted intervention in antenatal care aiming to promote safety behaviors and prevent IPV among pregnant Norwegian, Pakistani, and Somali women . The RCTA modified version of the Abuse Assessment Screen (AAS), a five-item screening tool for violence in pregnancy, is part of the baseline questionnaire . Women wThe intervention video lasts for 7 min and consists of storytelling combined with digital content, including pictures, images, sound, and video, focusing on information about the definition and types of IPV, the cycle of abuse, IPV during pregnancy and the health consequences, help-seeking strategies, and safety-promoting behaviors. According to The Safe Pregnancy study is a culturally sensitive intervention aiming to promote safety behaviors during pregnancy. The intervention materials have been professionally translated into Norwegian, English, Urdu, and Somali. With help from the current user-involvement study (UIS), the intervention has been culturally adapted by involving women with Norwegian, Pakistani, and Somali backgrounds in the development process.The UIS presented in this article was an iterative development process that engaged users in conceptualization, design, and final production of the tablet-based intervention . User inThe recruitment of participants took place over 9 months in south eastern Norway starting in May 2017. Participant inclusion criteria for individual interviews were largely identical to those in the Safe Pregnancy study to facilitate similarities in the two study populations . Norwegin = 3), India (n = 1), and Iran (n = 1), were skilled professionals reporting high education levels, and were community workers, social workers, and teachers.Sixteen women were recruited for individual interviews. The women\u2019s ages ranged from 22-47 years. The study had a qualitative, explorative design to gain a deeper insight into perceptions about a culturally sensitive intervention. Individual and focus group interviews were conducted by the first author, either at the woman\u2019s home, shelter, or in a private room at the university. The interviews followed a semi-structured guide and the main themes were as follows: (a) perceptions of the questions about violence and safety behaviors; (b) perceptions of what information a video about violence and safety behaviors should contain; and (c) perceptions of the draft video. Two pilot interviews were conducted to test the effectiveness of the interview guide and minor changes  were undertaken. The two interviews are included in the data. All of the interviews lasted between 45 and 90 min, were audiotaped and transcribed verbatim.The analysis of the interviews was guided by a thematic analysis strategy . In searThe Regional Committee for Medical and Health Research Ethics (REC) approved the study (ref.nr: 2017/358) and the interviews followed the Helsinki Protocol  and ethiperceptions of questions about IPV and safety behaviors illustrates whether participants perceive the questions as relevant and easy to understand linguistically. However, the questions are sensitive and may prevent disclosure of IPV. Facilitators and barriers to disclose IPV via a tablet elucidated several aspects that participants thought were important for women to feel safe when disclosing violence. The importance of anonymity emerged as an essential prerequisite for disclosing violence. From the analysis of the participants\u2019 perceptions of a video about violence and safety behaviors two main themes emerged. One, perceptions of the information in the video about IPV and safety behaviors, describes the importance of focusing on information about different forms of violence, safety-promoting behaviors, and help-seeking strategies. Second, perceptions of the tools used in the video about IPV and safety behaviors illuminates the desire for the tools to be perceived as stress reducing, helpful, and promoting the safety behaviors to be remembered.. . . that you start with the mild and then it may be easier to be brave to answer honestly . . . maybe I would start with milder forms of violence like \u201cfollowed me, harassed me, told me I was crazy, stupid, or not good enough.\u201d (Participant 5)The first theme illustrates how women perceived the questions about IPV and safety behaviors. All participants said that the questions about violence and safety behaviors were easy to understand; however, they perceived the questions to be sensitive. A Norwegian woman suggested changing the order of the questions about violence. She emphasized that all of the questions are sensitive but that it might be easier for study participants to disclose IPV if the first questions address milder forms of violence:A lot of this has happened to me. . . . I received help at a crisis shelter because I called the police. I had a code on my phone . . . with the neighbor. (Participant 3)Although the women identified the questions as sensitive, they said that the questions were relevant. Independent of their ethnic backgrounds, women revealed experiences with the acts of violence and the use of safety behaviors mentioned in the questionnaire:Based on participants\u2019 feedback, we changed the order of the questions about violence, addressing milder forms of violence first. The women pointed out that the new order of the questions about violence was appropriate and that it could possibly facilitate disclosure of IPV.. . . it (the answers) has to be anonymous . . . if you answer and know that the people at the health center can find out . . . but if your husband cannot see the answers, you may give honest answers. (Participant 2)The women were asked what would encourage them to disclose experiences with IPV via a tablet. The importance of anonymity was the most common subtheme in this theme. Independent of ethnicity and former experiences of IPV, women highlighted information about anonymity as a prerequisite for disclosure. A common statement from the women was:. . . it is difficult to answer . . . the questions are sensitive. Therefore it is important that you give information about anonymity at the start . . . and again before the questions about violence and safety behaviors. (Participant 10)Some of the women emphasized the importance of repeating information about anonymity in the different sections of the questionnaire. A Somalian woman stated the following:. . . is it anonymous? Why does she (the midwife) ask me? Does she (the midwife) know something? (Participant 15)Despite information about anonymity, women with an immigrant background particularly expressed doubts regarding the trustworthiness of the information about anonymity. A woman originating from Pakistan expressed her skepticism in the following:. . . the questions about violence and safety behaviors cannot be answered honestly. She must know that she is anonymous to answer honestly and you must create trust first through the midwife. (Participant 6)For women with an immigrant background, the assurance that their answers will be handled confidentially did not seem to be enough to disclose experiences of violence. In addition to written information about anonymity in the questionnaire, the women stated that oral information about anonymity from a midwife they trust might facilitate disclosure:. . . yes, definitely, because you are not writing your name, you are not scared. You can say: \u201cNo, I\u2019m not that person who answered this.\u201d (Participant 16)Despite the common skepticism regarding trust in anonymity, another woman from Pakistan outlined that the use of the tablet could promote this trust:. . . then (living in a violent relationship), I would not have dared to answer the questions about violence honestly. If you feel that it does not have any consequences, you might answer honestly and it would be liberating and helpful. (Participant 2)While all women suggested important facilitators for IPV disclosure, they also highlighted potential barriers. All the women in our study emphasized that it would be easier to answer questions about violence and safety behaviors honestly, if their disclosure would not lead to serious consequences. A Norwegian woman with a history of IPV stated:. . . and it is this talk about honor: \u201cwhat would people say about me?,\u201d \u201cwhat would people think about what I say?\u201d and \u201cwhat would happen to my children?\u201d (Participant 15)Independent of ethnicity, a common fear was that a violent partner would get to know about their disclosure and that it would expose the women and their children to further harm. In addition, some women expressed fear of shame as a barrier for revealing a violent relationship. Women with an immigrant background described a more complex situation addressing culturally sensitive aspects:The Somalian women expressed the difficulties for women from their culture to disclose violence as they fear that Child Welfare Services would take their children away from them.. . . if you ask someone while sitting in front of them, then she will definitely not (answer) but alone, she can (answer). (Participant 16)All of the participants stated that being in a room alone while answering the questions could promote disclosure of violence. A common statement described by a woman originating from Pakistan was:However, the participants expressed that the questions about IPV and safety behaviors could cause emotional distress. Most participants said that the information about encouraging women to speak with their midwife if they have any concerns after filling out the questionnaire was important to promote safety.Due to participant feedback, information about anonymity was given at the start of the questionnaire and repeated before the questions about IPV and safety behaviors. In accordance with the Safe Pregnancy study guidelines, women were alone while filling out the questionnaire.. . . it should not solely be about those who need to go to the emergency room. It should include psychological violence as well. (Participant 5)Before seeing the draft video, participants provided varying advice on what information a video about safety behaviors should contain. Irrespective of ethnicity and experiences of violence, all participants emphasized that the video should contain information about different forms of violence. A common statement expressed by a woman originating from Norway was:. . . it\u2019s important that the girls know what violence is and that they do not feel that they are alone in being controlled, isolated, being the slave for the in-laws and being exposed to physical and psychological violence. (Participant 6)Most women from immigrant backgrounds said that violence is accepted in their culture and that different forms of psychological violence are interpreted as normal behavior. They highlighted the importance of informing participants about what violence is, that violence is illegal in Norway, and that women suffering violence are victims. A Pakistani woman with a history of IPV said:. . . I don\u2019t pay attention, because this does not apply to me. It is this to be partly isolated, partly deprived of the opportunity to spend your money and such. . . . Such things had been helpful to shed light on. (Participant 2)After seeing the draft video, the women said that the information about physical violence was relevant and good. However, women with a history of psychological violence stated that the information was inadequate and failed to address women who only experienced psychological abuse:. . . why would I need a passport? I\u2019m not going anywhere. So you can think that this is not about you, but somebody else. (Participant 5)Another woman originating from Norway shared this opinion. In addition, she pointed out the challenge of providing culturally sensitive information about safety behaviors that all women suffering violence can relate to:. . . I wanted to know a little more about what could happen to the child when living in a violent relationship. You hope that when the child comes then it will be better and that the family is gathered and . . . that is what makes it so difficult to leave the partner . . . but you also want to put the children first . . . it might be easier to ask for help then. (Participant 3)Some women expressed that they missed information regarding how living in a violent environment could potentially affect their children. A woman explained that information facilitating awareness about the abnormality of violence could make it easier for women to disclose violence and ask for help:. . . I think that the most important safety behavior would be that you dared to talk to someone. Few women will be able to get out (leave the violent partner) alone without help. (Participant 5)The participants highlighted information about what women exposed to violence can do to promote their safety. They presented a variety of suggestions, such as getting hold of their passport, hiding money, and making plans if they have to leave. Most women, independent of ethnicity and experiences of violence, stated that the most important safety behavior would be to talk to someone they trust. A woman originating from Norway outlined why:They need information about where to get help. If you were born and raised here, you know your rights. But is it one who comes from abroad and is completely unknown, has no family, no chance to get out, it is very difficult. (Participant 7)The participants outlined the importance for women living in a violent relationship to receive information about where to get help. They expressed common suggestions such as having websites and phone numbers for the police and shelters. Women with immigrant backgrounds described a more complex situation:Resulting from participants\u2019 feedback, the video was expanded to include more information about psychological abuse and potential consequences for children living in a violent environment.The voice (the narrator) was clear and to the point. She (the narrator) spoke calmly and the music was comfortable, as comfortable as possible in relation to that message (sensitive) . . . I think it was nice that there was music . . . it reduces the . . .  . . . it (the music) makes the information about a sensitive topic less sensitive. (Participant 11)This theme concerns how women perceived the tools used in the video. All women emphasized that the sound, including the background music and the narrator\u2019s voice, was perceived as calming, thus reducing emotional distress. A Norwegian woman expressed this common experience as follows:. . . the soothing music in the background, it makes you think and consider (about the violent situation). (Participant 15)The clear, calm voice and soft music made it easy to concentrate and receive the message. A Pakistani woman elaborated on this feedback:. . . I like that you use pictures with different people . . . not everyone looks the same. Everyone is not Norwegian, blonde with blue eyes. I can see myself, a woman with a scarf on her head holding money in her hand. I think: \u201cshe is smart\u201d and I can do the same (hide some money). (Participant 8)The majority of the participants experienced the pictures in the video as informative and easy to understand and relate to. They highlighted that the pictures illustrated different forms of violence and the safety behaviors were perceived as relevant and helpful. In addition, the participants emphasized that the pictures about safety behaviors illustrated by women with different ethnic backgrounds might facilitate identification across cultural differences. A Somalian woman gave important feedback on this aspect:. . . I did not quite understand the picture illustrating psychological violence. I think that it does not belong here. I think about how I can illustrate it, and it is not easy to say. It is difficult to find images of psychological violence and hence understand what psychological violence is. (Participant 3)Although most of the pictures were informative and easy to understand, the pictures illustrating psychological violence were perceived as confusing. A Norwegian woman with a history of IPV explained the challenge of illustrating psychological violence:. . . I think it is easier to pay attention when you see pictures . . . that there are no real people, because then it might be easier to relate it (the information) to themselves. . . . I think that it (pictures) might give more room for reflection and thoughts . . . and that it does not go too fast, because they (abused women) can get very occupied in their own experiences and then you will not pay attention to what is happening. (Participant 11)Some women with different ethnic backgrounds, including professional participants from one focus group, suggested using a film with actors instead of static pictures in the video. Despite divergent opinions, most women stated that pictures, to a larger extent than film, can help abused women to identify with the sensitive information in the video. They stated that pictures promoted a quiet atmosphere that reduced emotional distress, and as a result, abused women would be more likely to remember the information in the video. A woman of Norwegian origin communicated common experiences related to the advantage of using a digital narrative with pictures instead of film:Due to the sensitive topic, the women acknowledged that study participants experiencing IPV might suffer emotional distress when watching the video. Hence, they said that it was important to repeat information about safety behaviors at the end of the video.. . . the narrator repeated several times the safety behaviors, and I believe that it is important. The video may cause many thoughts and then you may not hear what is said the first time. (Participant 11)Based on the findings from this study, a short film illustrating psychological violence was included in the video. All other pictures and illustrations were kept. The focus group participants said that the adjusted film illustrated psychological violence well.This study provided important insights to develop a culturally sensitive intervention to promote the prevention of IPV. Our findings show that women are in favor of disclosing IPV via a tablet. They expressed various suggestions about how to address barriers for disclosure, such as safeguarding anonymity and creating a trustful relationship with the midwife.Women in this study were positive about answering questions on violence via a tablet at a MCHC. This is in line with results from prior studies documenting that use of electronic devices may eliminate many of the barriers associated with face-to-face screening . In a stHowever, the majority of women in our study with immigrant backgrounds said that they did not trust the tablet to safeguard their anonymity. Similar to Chang et al. (2012), they were uncertain who would be getting the information from their IPV disclosure on the tablet. This is in line with a qualitative study of Somali-born refugees in Sweden which revealed that questions about violence were met with hesitance . A key fPrevious research has revealed that women do not always disclose experiences of IPV and the prevalence may be underreported . DespiteWomen in our study believed that the safety-promoting video might prevent IPV. However, they asked for more information about psychological violence. Similar to findings in a study by Qualitative and quantitative studies among abused women from different ethnicities have found that concerns for their children can be an important incentive to seeking help . Women iEmotional reactions regarding the sensitive content of the tools used in the video seemed to be unavoidable. Women in our study acknowledged that the video would potentially trigger painful memories, and they expressed important views on the different tools aiming to minimize their emotional impact and ensure abused women\u2019s well-being. Similar to the findings in a qualitative study aiming to modify an internet-based safety decision aid to a New Zealand context , we faciOur study has limitations. Due to a qualitative study design aiming to gain a deeper understanding about a phenomenon, the study sample is too small to draw conclusions about a broader population of women . However"}
{"text": "BackgroundTotal knee replacement (TKR) is an artificial joint surgical procedure that replaces the damaged articular surfaces of the knee joint. Despite several studies on the efficacy of intra-articular and intravenous Tranexamic acid (TX) use in reducing blood loss following TKR, the route of TXA administration is still an ongoing topic of debate. Our study aimed to compare total knee replacement efficacy  of intra-articular and intravenous tranexamic acid administration.Material and Methods\u00a0A Prospective study was conducted at the Department of Orthopedics, Shifa International Hospital, Islamabad. The study duration was six months (August 2020 to February 2021). A sample size of 60 patients was calculated using the WHO calculator. Patients were selected through non-probability consecutive sampling. Patients were randomly divided into two groups; Group A was given intraarticular TXA, while group B was given intra-venous TXA following total knee replacement. Patients were followed for 48 hours. Data were analyzed using SPSS version 24. An Independent T-test was applied, and a P value\u22640.05 was considered significant.ResultsA total of 60 patients were included in the study. There were 20 (33.3%) male and female 40 (66.7%). The mean age of patients was 64.4\u00b110.8SD. Post-operative hemoglobin level in group A was 11.09\u00b10.39SD, and in group B was 9.93\u00b11.73SD (p=0.03). Postoperatively, the mean HCT level in group A was 30.53\u00b14.26SD and group B 26.88\u00b15.48SD (p=0.01).ConclusionIntra-articular administration of TXA is more effective than intravenous administration in controlling postoperative blood loss following total knee replacement. Total knee replacement (TKR) is an artificial joint surgical procedure that replaces the damaged knee joint\u00a0. The priKnee replacement prostheses are divided into three major types . Non constrained prosthesis is associated with providing stability to the prosthesis with patients' muscles and ligaments. Semi-constrained is associated with providing stability to the knee without relying on the muscles and ligaments of the patient. At the same time, a constrained prosthesis is used in patients in whom muscles and ligaments cannot provide any stability\u00a0. TKR canTranexamic acid (TXA) is a synthetic anti-fibrinolytic agent associated with inhibiting the activation of plasminogen to plasmin. TXA at high concentration can also directly inhibit plasmin activity. The process decreases proteolytic action on fibrinogen and fibrin monomers, ultimately preventing clot stabilization. The use of TXA intravenously in TKR is a common practice. Literature reported the use of TKR in the following forms: 1. A pre-operative dose before tourniquet inflation; 2. An intra-operative dose before deflation of the tourniquet; 3. Post-operative dose 3 hours after surgery; 4. Various permutations combining these three dosesIntravenous use of TXA is associated with a wide distribution of the drug in intra and extracellular compartments\u00a0. Intra-aWe found limited literature on the comparison of intra articular and intravenous use of TXA in TKR in Pakistan. The literature available on this topic is not enough to reach any conclusion in the settings of Pakistan. This study was done to cover knowledge gaps regarding the efficacy of tranexamic acid administration routes. So, the present study aims to compare efficacy  of intra-articular and intravenous tranexamic acid administration in total knee replacement.A prospective study was conducted at the Department of Orthopedics, Shifa International Hospital, Islamabad. A sample size of 56 was calculated (rounded off to 60), 30 patients in each group using a WHO calculator with \u00b51=254, \u00b52=210, SD=60, 95% confidence level, 5% significance level, and 80% power of study\u00a0[Data analysisData analysis was done with SPSS version 24. Descriptive statistics include the presentation of mean\u00b1standard deviation, frequency, and percentages. Inferential statistics will include an independent t-test, and P-value \u22640.05 was considered as a statistically significant finding.A total of 60 patients were included in the study. There were 20 33.3%) male and female 40(66.7%) patients. The mean age of patients was 64.4\u00b110.8SD. There were 10(16.7%) patients in the age group 40-50 years and 50(83.3%) in the age group >50 years. There were two interventional groups; group A 30 (5-%), and group B, 30(50%) patients. Pre-operative hemoglobin level in group A was 12.62\u00b11.14SD and in Group B 12.53\u00b11.41SD (p= 0.780). The post-operative hemoglobin level in group A was 11.09\u00b10.39SD, and group B was 9.93\u00b11.73SD (p=0.03), as shown in table\u00a03.3% maleTotal knee replacement is a cost-effective treatment modality for advanced degenerative arthritis of the knee\u00a0. The majIn our study, the intra-articular route showed less blood loss in hemoglobin and hematocrit levels and less hospital stay (p<0.05) than intravenous administration of TXA. Huang et al. reported that intra articular and intravenous routes effectively reduce blood loss after TKR\u00a0. HoweverSome studies also supported the postulation that TXA showed a more effective therapeutic effect after proteolysis of plasmin dissolved prematurely fibrin clot. TXA showed a more effective response at the active bleeding site of the wound than within blood vessels\u00a0. MoreoveOur study did not find any significant difference in complications in both groups. However, Wang et al. promptly reported that the intravenous route is associated with more complications, including surgical site infection and bleeding\u00a0. Moskal Strength: To the best of our knowledge, it is a unique study in our local setup. It is challenging to conduct these studies as very few centers perform TKR in such numbers.Limitation: Small sample size and conduction of study at a single center limits generalization of results.Intraarticular administration of TXA is more effective than intravenous administration in controlling postoperative blood loss following total knee replacement. Our study did not find any significant difference in complication after intra-articular and intravenous administration of TXA. More detailed, multicenter clinical trials are required to understand the efficacy and cost of treatment in-depth."}
{"text": "Apart from the gelation rate, the use ofCu2+ led to the rapid realization of gel characteristics.The results here provide strategies for process engineering, ultimatelyto determine the phase-transition rates. In addition, a microfluidicswitch was successfully operated based on a better understanding ofthe reversible crosslinking of the chitosan hydrogel. Rapid gelationwas required to close the channel, and a quick switchover was achievedby a dissolution enhancement strategy. As a result, factors that regulatedthe rates of gelation or dissolution were found to be useful to operatethe fluidic switch.The importanceof chitosan has been strongly emphasized in literature because thisnatural polymer could not only remove heavy metal ions in water butalso have the potential for recyclability. However, reversible phasetransition and its dynamics, which are highlighting areas of a recycleprocess, have not been studied sufficiently. Here, we present dynamicstudies of the dissolution as well as the gelation of a physicallycrosslinked chitosan hydrogel. Specifically, a one-dimensional gelgrowth system and an acetate buffer solution were prepared for theprecise analysis of the dominant factors affecting a phase transition.The dissolution rate was found to be regulated by three major factorsof the pH level, Cu This indicates that chitosan is certainlyattractive because this natural polymer could reduce the environmentalconcern as well.Chitosan is a polysaccharideobtained fromthe deacetylation of chitin.16 This is mainlydue to water solubility changes determined by the pH level. In detail,chitosan polymers become soluble, accompanying the protonation ofNH2 below pH 6.3 and start to form a gel due to the deprotonationof NH3+ above pH 6.3.17 Similarly, coordination bonds between chitosan andtransition-metal ions are also related to the pH levels of the solutions.For example, the chitosan/Cu2+ hydrogel was obtained abovepH 6.3, while the chitosan polymer was soluble in aqueous solutionsat the pH level below 6.3  was also investigatedcompared to Cu2+. At the end of the study, a microfluidicswitch was operated based on the reversible crosslinking of the chitosan/Cu2+ hydrogel.Here, we have conducted dynamic studies ofthe dissolution as well as the gelation of physically crosslinkedchitosan/metal-ion complexes. Among metal ions, Cu22.12+ hydrogel formation rate was analyzed through a one-dimensionalgelation system. A glass mold filled with the chitosan/Cu2+ solution and a clotting bath in which NaOH was dissolved were bothprepared. The chitosan/Cu2+ solution started to form agel as soon as the glass mold was immersed in the clotting bath. Asdescribed in 2+ hydrogel was finallyobtained. Then, a one-dimensional grown part was verified using therheological characterization. The values of the storage modulus werealways higher than those of the loss modulus regardless of Cu2+, which indicated that the hydrogel was successfully fabricated. Besides, the gelation processwas visual because Cu2+ dissolved in the chitosan polymersolution took part in the gelation through coordination bonding betweenNH2 and Cu2+ considering the color change fromlight blue (chitosan/Cu2+ solution) to deep blue (chitosan/Cu2+ hydrogel). The origin of different colors is that NH2 caused more splitting of the d-orbital of Cu2+ than water (H2O), as the N atoms in NH2 weremore electropositive than the O atoms in H2O. As a result,the chitosan/Cu2+ hydrogel absorbed higher energy correspondingto yellow light, the complementary color of deep blue.29Asshownin 3+ is deprotonated toNH2 on aqueous surfaces under alkaline conditions. Therefore,the rate of deprotonation from NH3+ to NH2 should be a major factor affecting the chitosan hydrogelformation outcome. As shown in \u2013 through the grown hydrogel layer in order to deprotonate NH3+ at the sol/gel interface. The 2 wt % NaOH aqueoussolution required more than 72 h until gelation was fully completeowing to the low diffusion rate of OH\u2013. Apparently,the chitosan gel growth rate strongly depended on the concentrationof NaOH. From a similar point of view, we predicted that a small amountof acetic acid in chitosan solution could also be supportive in orderto promote the gel growth. According to the previous work reportedby Dobashi et al., a large amount of acetic acid in the chitosan solutioninterrupted the chitosan gel growth due to a delay in the deprotonationof NH3+ at the sol/gel interface.20For the chitosan polymers, they are able to become a physicallycrosslinked gel when NH2+ (Cu2+/NH2 =0.0\u20130.5) on the gel formation rate with the same concentrationof NaOH was mostly negligible  also grew at a speed identical to that of a pure chitosan hydrogelin the 20 wt % NaOH aqueous solution. Moreover, we investigated thegelation behavior with different metal ions  incorporated withthe chitosan polymer . In brief,the chitosan/metal-ion gel  growthrate was undoubtedly accelerated when the concentration of NaOH becamehigh. For example, the chitosan/Fe3+ hydrogel grew fasterin 10 wt % NaOH aqueous solution compared to 5 wt % NaOH aqueous solution.However, each chitosan/metal-ion hydrogel grew at a different rate,which followed the order of Fe3+ \u2248 Cu2+ > Mn2+ \u2248 Ca2+. This was probablycaused by the change of affinity of NH2 to metal ions.According the previous report, ethylenediamine favored Fe3+ and Cu2+ rather than Mn2+ and Ca2+.27 This probably resulted in byproductssuch as Mn(OH)2 and Ca(OH)2, which interruptedthe diffusion of OH\u2013. As explained by Nie et al.,Ca(OH)2 precipitation within the chitosan hydrogel wasclearly observed.19 The result indicatedthat the strong affinity of NH2 to Cu2+ encouragedthe growth of the chitosan/Cu2+ hydrogel.On the other hand, the influence of theconcentration of Cugligible 2c,d. Thi2+ complexes  with sequential drops of aqueousNaOH solutions (0\u201310 wt %) were measured  than the pure chitosan hydrogel(Cu2+/NH2 = 0.0) could be other evidence ofthe strong crosslinking through coordination bonding .Next, theviscosity changes of the chitosan/Cumeasured 3. As shomeasured 3d,e. Eve complex3c tended complex3b when t\u2013 was the dominant driving force of thephysical gelation of chitosan/Cu2+ regardless of the concentrationof Cu2+. However, the Cu2+ within the chitosanpolymers accelerated the gaining of gel characteristics.In conclusion, the higher diffusionrate of OH2.22+ hydrogels withvarious compositions (Cu2+/NH2 = 0.0\u20130.5)were prepared using the 10 wt % NaOH aqueoussolution with the one-dimensional gelation system. That is to say,the hydrogels obtained from the gelation test were applied to thedissolution test as the concept of the recyclable process. Then, factorsthat disintegrate a physically crosslinked chitosan/Cu2+ hydrogel were analyzed using 1.0 M acetate buffer solution systemwith pH levels from 3.8 to 5.6 accompanied by mechanical stirring.30 Besides, the viscositywas measured using a rotary viscometer in order to analyze the dissolutionquantitatively. In detail, 1.0 g of the chitosan hydrogel was immersedin 10 mL of the buffer solution whose initial viscosity was 3.5 \u00b10.7 mPa s. After that, the viscosity of the solution in which thechitosan polymer disintegrated gradually increased until the hydrogelwas completely dissolved. Then, the viscosity uniformly convergedat 9.4 \u00b1 1.0 mPa s because the final concentration of the chitosanpolymer was equal. Therefore, the convergence of the viscosity withoutany residual chitosan/Cu2+ hydrogel indicated the completedissolution. Here, t90 was consideredas the dissolution time. As shown in t90 was definedas the time to reach 90% of the converging value after Weibull fitting.Even though the heterogeneous regions should exist during dissolution,we reported the viscosity measured in the solution representatively.Before the dissolution test, chitosan/Custirring4a. This 2 to NH3+ should be a majorfactor affecting the chitosan hydrogel dissolution outcome. As shownin 2+ hydrogel due to the acetate buffersolution.2+ hydrogel were discovered.The chitosan/Cu2+ hydrogel dissolved slowly as the concentrationof Cu2+ increased. Moreover, Cu2+ led to a lowermaximum pH level, at which point the chitosan/Cu2+ hydrogelwas completely disintegrated. For example, the chitosan/Cu2+ hydrogel  remained swollenat pH levels ranging from 5.2 to 5.6, where the pure chitosan hydrogelcould be perfectly soluble . For example, 2,2\u2032-bipyridine is insoluble in water andcyanide ions are weakly acidic with a pKa of 9.2. Here, NaNO2 was used as the source of NO2\u2013, and its high solubility in water wasreadily confirmed, more than 50 g/100 mL. As expected, NO2\u2013 dissociated from NaNO2 enhanced thedissolution of the chitosan/Cu2+ hydrogel, and it is shownin 2\u2013 (NO2\u2013/Cu2+ = 0\u201390) were utilized at the same pH level.In addition, the maximum pH level at which a fully disintegrated solutionwas obtained tended to be elevated when NO2\u2013 was applied. For example, the chitosan/Cu2+ hydrogel(Cu2+/NH2 = 0.2) could be completely dissolvedat pH levels ranging from 5.0 to 5.6 when NO2\u2013 was utilized (NO2\u2013/Cu2+ =9\u201390), while it remained swollen at a pH level above 5.0 withoutNO2\u2013 (NO2\u2013/Cu2+ = 0). The strong effect of NO2\u2013 was investigated when other metal ions  were utilized instead of Cu2+ (Table S3). For example, it took at most50 min to dissolve the chitosan/Fe3+ hydrogel (Fe3+/NH2 = 0.2) at pH 5 with NO2\u2013 (NO2\u2013/Mn2+ = 90), whilethe same hydrogel was completely disintegrated after 450 min at pH5 without NO2\u2013. However, it was especiallynotable that metal ions apparently affected the dissolution rate ofthe chitosan/metal-ion hydrogels, probably due to the different affinityof NH2 to metal ions.27 For example,the chitosan/Ca2+ hydrogel tended to be dissolved fasterthan others, and this was probably because of the weak affinity ofNH2 to Ca2+ caused by the absence of the d-orbital.19Next, two additional key factors which regulate thedissolution rate of the chitosan/Cu soluble 5a. This 2\u2013 did not work when the pure chitosanhydrogel was dissolved (Cu2+/NH2 = 0.0). Forexample, a converging time at pH 5 was not significantly affectedby NO2\u2013 , as shown in 2\u2013 (NO2\u2013/Cu2+ = 9) shortens the converging time of the viscosity whenchitosan/Cu2+ was dissolved  aqueous solution was greenish,whereas the Cu2+/NH2 (ethylenediamine) aqueoussolution was bluish. However, the dissolution of the chitosan/Cu2+ hydrogel was not expected at a pH level above 6.3, evenwith NO2\u2013, mainly because chitosan polymerscould not become hydrated unless protonation occurred.Interestingly,NOissolved 4c,d. Fig2+ hydrogel was intended to be dissolved at a pH below 5.6.Cu2+, which contributed to stronger crosslinking, led toa slower dissolution, while NO2\u2013, whichtended to attract Cu2+, accelerated the dissolution processdramatically. Particularly, NO2\u2013 couldhelp the chitosan/Cu2+ hydrogel dissolve faster comparedto the pure chitosan hydrogel.In conclusion,two other factors can clearly be involved when the chitosan/Cu2.32+ hydrogel. Figure S5 shows the simple construction of thefluidic switch system which was operated via the reversible crosslinkingof chitosan/Cu2+ complexes.A fluidicswitch for water flow regulation was operated by means of the reversiblecrosslinking of the chitosan/Cu2+ solution (Cu2+/NH2 = 0.2) and a 10 wt % NaOH aqueous solution were injected simultaneouslyat a rate of 20 mL/min from opposite directions perpendicular to thewater flow line. A blue gel then successfully formed despite the continualsupply of water  started to flow alongthe detour route in 5 s .47 The final dimensionsof the channel were set to 300 \u03bcm \u00d7 50 \u03bcm (width\u00d7 depth), and an initial water flow check was implemented beforethe switch test  started to flow along the detour routein 5 s  apparentlyaffected the dissolution as well as the gelation, a phase transitionof the chitosan/metal-ion hydrogel was similarly controlled by thefactors such as NaOH, pH, and NO2\u2013. Finally,a fluidic switch was operated via the reversible crosslinking of chitosan/Cu2+ hydrogels. The gel which formed at a high concentrationof OH\u2013 blocked the water flow perfectly. This gelcould not be removed until an acidic aqueous solution was injected.Furthermore, NO2\u2013 dissolved in an acidaqueous solution shortened the operating time from closed to open.Moreover, a switch system could be successfully applied to a microfluidicchannel as well. We expect that a controllable microfluidic devicecould be potentially applied to various fields such as hemostaticsystems and trace metal analysis. Besides, this study provides a betterunderstanding of the reversible crosslinking of the chitosan/metal-ionhydrogel and helps with the preparation of comprehensive strategiesfor the recycle process.In summary,dominant factors which influence the rates of the reversible crosslinkingof chitosan/Cu44.13COOH aqueous solution), and the degree of deacetylationis 75\u201385%. Acetic acid (CH3COOH), sodium acetate(CH3COONa), sodium hydroxide (NaOH), copper chloride (CuCl2), manganese chloride (MnCl2), iron chloride (FeCl3), calcium chloride (CaCl2), and sodium nitrite(NaNO2) were purchased from Daejung Chemical and MetalsCo., Ltd. and were of analytical reagent grade.Chitosan  was used as a rawhydrogelmaterial. The average viscosity of chitosan is 500 cp . Each solutionwas added to a glass mold before being immersed in a clotting bath.Clotting baths were prepared by dissolving various amounts of NaOHpellets in deionized water, with the final concentrations held inthe range of 2\u201320 wt %. The growth of the chitosan/Cu2+ hydrogel was started when the chitosan/Cu2+ solutionwas immersed into the NaOH clotting bath. Each of the glass molds(2.5 mL of chitosan/Cu2+ solution) should be immersed inat least 500 mL of the NaOH aqueous solution in order to ensure uniformgelation. The chitosan/Cu2+ hydrogel growth rate was calculatedaccording to the gel thickness, which was measured every hour. Thecolor change from light blue (chitosan/Cu2+ solution) todeep blue (chitosan/Cu2+ hydrogel) was observed when thegelation proceeded.Chitosansolution was prepared by dissolving chitosan powder in 2 vol % ofa CH4.32+ solution  were prepared using the method describedin 2+ solution was added to a glass mold,and a spindle which was connected to a rotary viscometer  was dipped into the solution. The viscosity of the complexwas recorded by adding an aqueous solution of NaOH with a speed of0.3 mL/min.The NaOH aqueous solution (2\u201310wt %) as well as the chitosan/Cu4.42+ hydrogels were prepared usingthe method described in 2+ hydrogels wererinsed with deionized water repeatedly and stabilized in a deionizedwater bath for 24 h before the dissolution test. 1.0 M acetate buffersolutions with pH levels ranging from 3.8 to 5.6 were prepared inorder to clarify the effect of the pH on the dissolution speed ofthe chitosan/Cu2+ hydrogel. The relative concentrationsof CH3COOH and CH3COONa at each pH level werecalculated with the Henderson\u2013Hasselbalch equation .The prepared buffer solutions were checked with a pH meter . Then, various amounts of NaNO2 powderwere added with different molar ratios between NO2\u2013 and Cu2+ (NO2\u2013/Cu2+ = 0\u201390). The prepared chitosan/Cu2+ hydrogels were immersed in buffer solutions with a stirring speedof 300 rpm at room temperature. Every 1.0 g of the chitosan/Cu2+ hydrogel should be immersed in 10 mL of the buffer solutionunder each condition. In order to confirm the complete disintegrationquantitatively, the viscosity of the environmental buffer solutionwas measured using a rotary viscometer. The viscosity gradually increasedas the chitosan hydrogel disintegrated into the buffer solution. Finally,the complete dissolution was determined when the viscosity becameconstant without any residual chitosan/Cu2+ hydrogel. Here, t90, the time to reach 90% of the convergingvalue after Weibull fitting, was considered as the dissolution time.Chitosan/Cu4.52+ solution and NaOH solution.To close the water line, 0.02 g/mL of the chitosan/Cu2+ solution (Cu2+/NH2 = 0.2) and NaOH  aqueous solutions were simultaneously injected. The injectionrate for both syringes was fixed at 20 mL/min. The water flow ratewas calculated according to the amount of water which flowed in anoperating interval. To reopen the water line, a CH3COOH/NO2\u2013  aqueoussolution was used. A Y-shaped bypass was connected to make a staticflow of CH3COOH/NO2\u2013 solutionnear the blocking gel. 20 mL/min was used as an injection speed ofCH3COOH/NO2\u2013 solution.A cross-shaped fluidictest tube was assembled with transparentpolypropylene tubes and a four-way connector. Both tubes and the connectorare capable of operating in aqueous solutions ranging from the acidicto basic pH level. The inner radius of the four-way connector was1 mm. Water flowed through a vertical line at a rate of 30 mL/min.Other tubes perpendicular to the water flow line were connected tosyringes with chitosan/Cu4.62) wereapplied to the PDMS/glass device for 48 h. The microfluidic switchingtest was operated under similar conditions in 2+ solution  and flow rate (150 \u03bcL/min).A seven-hole microfluidicchannel was fabricated by patterningPDMS  on glass. The patterned PDMS was developedby a facile photolithography technique in order to control the channelstructure. The final dimensions of the microfluidic channel were fixedat 300 \u03bcm \u00d7 50 \u03bcm (width \u00d7 depth). Permanentbonding between PDMS and the glass was obtained via a plasma bondingstep after rinsing these surfaces with an acetone/ethanol solution.Additional heat (60 \u00b0C) and pressure (6500 N/m"}
{"text": "O centen\u00e1rio ECG ainda \u00e9 uma excelente ferramenta para avaliar a atividade el\u00e9trica card\u00edaca. Ao longo das \u00faltimas d\u00e9cadas, o ECG tem sido renovado para acompanhar a evolu\u00e7\u00e3o em outras \u00e1reas do conhecimento, como gen\u00e9tica, biologia molecular e eletrofisiologia.Nossa experi\u00eancia tem demonstrado que, entre o grande arsenal diagn\u00f3stico dispon\u00edvel para investiga\u00e7\u00e3o de cardiopatias, o eletrocardiograma, ferramenta simples, pr\u00e1tica, remota e r\u00e1pida, \u00e9 capaz de monitorar com precis\u00e3o a extens\u00e3o e a gravidade do acometimento card\u00edaco em diversos cen\u00e1rios.O intervalo QT e suas varia\u00e7\u00f5es, muitas d\u00e9cadas ap\u00f3s ter sido descrito pela primeira vez, ainda mant\u00eam par\u00e2metros relevantes para indicar se um paciente tem risco de apresentar eventos cardiol\u00f3gicos graves e \u00e0s vezes fatais.Em 1856, o primeiro paciente com a s\u00edndrome do QT longo foi descrito por Meissner. Embora sua origem gen\u00e9tica tenha sido estabelecida em 1901, foi somente em 1991 que Keating demonstrou pela primeira vez a associa\u00e7\u00e3o de pacientes com s\u00edndrome do QT longo e a muta\u00e7\u00e3o do bra\u00e7o curto do cromossomo 11. Bazzet, em 1920, descreveu sua f\u00f3rmula para a corre\u00e7\u00e3o da frequ\u00eancia card\u00edaca do intervalo QT.O surgimento da pandemia da COVID-19 em mar\u00e7o de 2020 mostrou uma doen\u00e7a inicialmente com sintomas respirat\u00f3rios, mas com poss\u00edvel envolvimento de v\u00e1rios outros \u00f3rg\u00e3os devido \u00e0 sua resposta inflamat\u00f3ria bastante agressiva.Aproveitando a experi\u00eancia no tratamento das repercuss\u00f5es card\u00edacas da COVID-19, os especialistas analisaram os achados eletrocardiogr\u00e1ficos durante o per\u00edodo da infec\u00e7\u00e3o.No estudo feito por.. et al.,O grupo de estudo de 120 pacientes, 90 dos quais infectados com COVID-19 e 30 controles saud\u00e1veis pareados por idade e sexo, foi dividido em quatro grupos: I \u2014 controles saud\u00e1veis e pacientes com COVID-19: II \u2014 sem pneumonia, III \u2014 com pneumonia leve e IV \u2014 com pneumonia grave. Os resultados mostraram que um em cada cinco pacientes com COVID-19 apresentou les\u00e3o mioc\u00e1rdica.O estudo mostrou que nos casos de pneumonia grave existem claras altera\u00e7\u00f5es da repolariza\u00e7\u00e3o ventricular. Apesar de valores de QT praticamente normais, a an\u00e1lise dos par\u00e2metros estudados demonstrou aumento da dispers\u00e3o da repolariza\u00e7\u00e3o transmural, que \u00e9 a etiologia usual das arritmias graves.As causas mais frequentes de mortalidade card\u00edaca em pacientes com COVID-19 foram eventos arr\u00edtmicos. Os tipos de arritmia foram diversos, com muitos aspectos relevantes. O mecanismo das arritmias n\u00e3o p\u00f4de ser caracterizado, mas a literatura relata a presen\u00e7a de fen\u00f4menos arr\u00edtmicos em 27,8% e de taquicardia ventricular/fibrila\u00e7\u00e3o ventricular (TV/FV) em 5,9% dos 187 pacientes estudados por Guo et al.O mecanismo mais importante das arritmias ventriculares relatado em pacientes com COVID-19 \u00e9 semelhante ao das arritmias encontradas em pacientes com miocardite aguda. A an\u00e1lise das repercuss\u00f5es da miocardite aguda em outros estudos mostrou aumento dos intervalos QT, QTc e Tpe e das raz\u00f5es Tpe/QT e Tpe/QTc.No estudo discutido aqui, todas essas medidas aumentaram claramente com a gravidade da doen\u00e7a, como visto nos pacientes com COVID-19 e pneumonia grave.Confirmando relatos de maior frequ\u00eancia de arritmias em pacientes com n\u00edveis aumentados de troponina, o aumento nos n\u00edveis de troponina I de alta sensibilidade mostrou uma rela\u00e7\u00e3o positiva e efetiva com as medidas dos par\u00e2metros QT.Em um relat\u00f3rio recenteDano card\u00edaco (isquemia ou miocardite)ArritmiasNovo in\u00edcio ou agravamento de insufici\u00eancia card\u00edaca preexistenteDoen\u00e7a tromboemb\u00f3licaAltera\u00e7\u00f5es card\u00edacas induzidas por tratamento m\u00e9dicoOs autores afirmam que \u201co envolvimento card\u00edaco em pacientes com COVID-19 se reflete em altera\u00e7\u00f5es de ECG como altera\u00e7\u00f5es de ST-T, prolongamento de QT, dist\u00farbios de condu\u00e7\u00e3o e arritmias ventriculares\u201d. Assim, \u201cos pacientes com sintomas card\u00edacos e anormalidades no ECG devem ser avaliados cuidadosamente para diagnosticar a COVID-19 \u2014 complica\u00e7\u00f5es card\u00edacas relacionadas, como miocardite, isquemia mioc\u00e1rdica ou arritmias graves\u201d. Nesta pandemia, devemos manter essas suspeitas cl\u00ednicas mesmo para pacientes que apresentam sintomas ou sinais discretos. N\u00e3o h\u00e1 d\u00favida de que a presen\u00e7a de doen\u00e7as cardiovasculares piora o progn\u00f3stico do processo. O v\u00edrus n\u00e3o pode ser considerado a causa de todas as complica\u00e7\u00f5es cardiovasculares, mas pode piorar ou revelar condi\u00e7\u00f5es subjacentes prec\u00e1rias.No artigo aqui discutidoA presen\u00e7a de arritmias gerais  e malignas  tamb\u00e9m suscitou maior preocupa\u00e7\u00e3o em casos com comprometimento mioc\u00e1rdico mais grave do que leve.A compara\u00e7\u00e3o do estudo de Haseeb et al., A presen\u00e7a de altera\u00e7\u00f5es isqu\u00eamicas, prolongamento do intervalo QT, dist\u00farbios de condu\u00e7\u00e3o el\u00e9trica e arritmias no ECG podem ser um grande sinal de alerta para orientar a conduta em caso de comprometimento cardiol\u00f3gico. The centennial ECG is still an excellent tool to assess electrical activity of the heart. ECG has been renovated over the last decades to keep pace with evolution in other areas of knowledge, such as genetics, molecular biology and electrophysiology.Our experience has demonstrated that, among the large diagnostic arsenal available to investigate heart diseases, the electrocardiogram, this simple, practical, remote and quick tool, is capable of accurately monitoring the extent and severity of cardiac involvement in various scenarios.QT interval and its variations, many decades after being first reported, still holds relevant parameters to indicate whether a patient is at risk for severe and sometimes fatal cardiological events.In 1856, the first patient with long QT syndrome was reported by Meissner. Although its genetic origin was established in 1901, it was only in 1991 that Keating first demonstrated the association of patients with long QT syndrome and short arm mutation of chromosome 11. Bazzet, in 1920, reported his formula for heart rate correction of the QT interval.The emergence of the COVID-19 pandemic in March 2020 showed a disease initially with respiratory symptoms, but with the possible involvement of several other organs due to its very aggressive inflammatory response.Taking advantage of their experience with treating the COVID-19 cardiac repercussions, experts analyzed electrocardiographic findings during the period of infection.Arquivos Brasileiros de Cardiologia, the authors examined the alterations of QT, QTc and Tpe (Ppeak-Tend) intervals, and the Tpe/QT and Tpe/QTc ratios, all of which are parameters of ventricular repolarization.In the study by Koc et al.The study group of 120 patients, 90 of whom infected with COVID-19, and 30 age-and-sex-matched healthy controls, was divided into four groups: I \u2014 healthy controls and COVID-19 patients: II \u2014 without pneumonia, III \u2014 with mild pneumonia, and IV \u2014 with severe pneumonia. Results showed that one out of five patients with COVID-19 had myocardial damage.The study showed that in cases with severe pneumonia there are clear ventricular repolarization alterations. In spite of practically normal QT values, analysis of the parameters studied demonstrated increased dispersion of transmural repolarization, which is the usual etiology of severe arrhythmias.The most frequent causes of cardiac mortality in patients with COVID-19 were arrhythmic events. The types of arrhythmia were diverse, with many relevant aspects. The mechanism of arrhythmias could not be characterized, but the literature reports the presence of arrhythmic phenomena in 27.8%, and of ventricular tachycardia /ventricular fibrillation (VT/VF) in 5.9% among the 187 patients studied by Guo et al.The most important mechanism of ventricular arrhythmias reported in patients with COVID-19 is similar to that of arrhythmias found in patients with acute myocarditis. The analysis of acute myocarditis repercussions in other studies showed increased QT, QTc and Tpe intervals, and Tpe/QT and Tpe/QTc ratios.In the study discussed here, all these measures clearly increased with disease severity, as seen in the COVID-19 patients with severe pneumonia.Confirming reports of higher frequency of arrhythmias in patients with increased troponin levels, increase in high-sensitivity troponin I levels showed a positive and effective relationship with the measures of QT parameters.In a recent report,Cardiac damage (ischemia or myocarditis)ArrhythmiasNew-onset or worsening of preexisting heart failureThromboembolic diseaseCardiac abnormalities induced by medical treatmentThe authors state that \u201ccardiac involvement in COVID-19 patients is reflected in ECG alterations as ST-T alterations, QT prolongation, conduction disorders and ventricular arrhythmias.\u201d Thus, \u201cpatients with cardiac symptoms and ECG abnormalities must be carefully assessed in order to diagnose COVID-19-related cardiac complications, such as myocarditis, myocardial ischemia or severe arrhythmias.\u201dIn this pandemic, we must maintain these clinical suspicions even for patients who present with discrete symptoms or signs. There is no doubt that the presence of cardiovascular disease worsens the prognosis of the process. The virus cannot be considered as the cause of all cardiovascular complications, but it can worsen or reveal precarious underlying conditions.In the article discussed here,The presence of general (16.7%) and malignant (11.5%) arrhythmias also raised greater concern in conditions with a more severe myocardial involvement than with mild involvement.Arquivos Brasileiros de CardiologiaComparison of the study by Haseeb et al.The presence of ischemic alterations, QT prolongation, electrical conduction disorders and arrhythmias in the ECG can be a big warning sign to guide management in case of cardiological involvement."}
{"text": "Branta canadensis) has been growing in residential and recreational areas, public concerns on potential acquisition of zoonotic pathogens from Canada geese and their faecal deposits have been increasing.As a population of non\u2010migratory Canada geese  demonstrated resistance to \u22651 antimicrobial agent.The targeted zoonotic pathogens were not identified by the faecal examinations performed. Of the 32 E. coli infections are potentially a public health concern although the prevalence was low in this study. Further, larger scale surveys are recommended.Targeted zoonotic pathogens were not detected among the examined resident Canada geese in North\u2010Central Oklahoma. The findings of multiple\u2010antimicrobial resistant  At eachAt each sampling visit, Canada geese were directly monitored for the moment of defecation for up to 2 h. Immediately after defecation by a goose was observed, a whole portion of freshly voided faeces was collected. When faeces was watery, a plastic disposable spoon was utilised. Although multiple samplings from the same goose at visit were avoided, identification or tracking of individual geese was not conducted in this study. The number of faecal samples collected per visit varied from four to 24 samples due to variable number of geese present at each site during the sampling. Individual faecal samples were stored separately in a plastic bag, and all samples were kept at 4\u00b0C until examinations.2.2Cryptosporidium spp. and other parasitic infections  was performed on each sample to detect the evidence of Soulsby, . In addi2.3Several faecal samples were removed from bacterial evaluations due to improper sample handling; thus, a total of 180 faecal samples were grouped into 36 pools and cultured for bacterial growth. Pools were made up of four (11 pools), five (14 pools) or six (11 pools) individual faecal samples recovered from the same location on the same day. All cultures were performed within 24\u00a0h of sample collections.2 environment. Cultures were monitored for bacterial growth for 2 days. A direct culture method was followed for Campylobacter spp. culture as this method has been evaluated and found to be useful for Campylobacter spp. enumeration  of pooled faecal sample was added into Tetrathionate Broth Base, Hajna (90\u00a0ml)  with 4% iodine . The mixture was incubated at 42\u00b0C for 2 days. After approximately 24\u00a0h of incubation, the broth mixture was streaked onto Xylose Lysine Tergitol\u20104 (XLT\u20104) and Brilliant Green (BG) agars . The XLT\u20104 and BG agars were then incubated at 37\u00b0C for 24\u00a0h. The culture plates were observed for characteristic colonies of Salmonella spp. After 48\u00a0h of incubation, a second sample from the tetrathionate broth mixture was plated onto XLT\u20104 and BG agars, incubated and observed for a characteristic growth of Salmonella spp. In addition to the targeted bacteria, any bacterial colonies observed were identified using a MALDI\u2010TOF Mass Spectrometer  following manufacturer's recommendations and recorded for data analysis.Aerobic culture was performed using 5% sheep blood agar and MacConkey agar  at 37\u00b0C in 5% CO2.4Escherichia coli isolates recovered from the 36 sample pools, using the Kirby Bauer Disk Diffusion method , Cryptosporidium spp. , Giardia spp.  and Salmonella spp. , were not identified in the faecal samples examined , Strongyloides spp. eggs , cestode eggs  and schistosome eggs . Coccidia, ascarid and strongylid infections were observed in all three counties, whereas cestode and Strongyloides spp. infections were identified in Payne and Oklahoma counties. Capillaria spp. and schistosome infections were found only in Oklahoma county and Payne county, respectively. Of 153 faecal samples that contained coccidian oocysts, one sample obtained from the L\u20107 in Oklahoma City, Oklahoma county demonstrated Isospora spp. oocysts  demonstrated resistance to at least one antimicrobial agent. A total of 13 isolates  were resistant to one antimicrobial agent; 12 isolates were resistant to azithromycin and one isolate was resistant to tetracycline. Three isolates  were resistant to two antimicrobial agents belonging to different classes  and one isolate  recovered from the L\u20103 in Stillwater, Payne county was resistant to five antimicrobial agents, including azithromycin, amoxicillin\u2010clavulanate, ampicillin, chloramphenicol and tetracycline. Many E. coli isolates  showed resistance to azithromycin  were detected in one of the faecal sample pools from location L\u201011. The detection of yeast in low frequency from faeces of Canada geese as well as other avian species has been reported  transmitted by Canada geese and the freshwater snail, Gyraulus parvus, has been reported in Colorado Springs, Colorado . Anserobilharzia brantae adults are found in the blood vessels of Canada geese and produce eggs that are passed into the faeces  in 2019, our data in the current study did not consider seasonal or yearly differences. Additionally, one time faecal examination may not be sufficient to determine the prevalence of microorganisms in Canada geese due to intermittent shedding of Giardia spp. cysts  because animals were not directly or indirectly handled. All faecal samples were collected from the ground in the public areas.https://publons.com/publon/10.1002/vms3.791The peer review history for this article is available at"}
{"text": "Oral squamous cell carcinoma (OSCC) is one of the malignant tumors with a poor prognosis. Periodontitis , their related genes (Hub genes), transcription factors (TFs), signaling pathways, enrichment functions, and compounds, and searching for genetic commonalities.The miRNAs expression datasets of OSCC and PD were searched from the GEO database. The miRNA and related crosstalk mechanism between OSCC and PD was obtained through a series of analyses.ZNF460, FBN1, CDK6, BTG2, and CBX6, while the most important dysregulation TF includes HIF1A, TP53, E2F1, MYCN, and JUN. 5-fluorouracil, Ginsenoside, Rh2, and Formaldehyde are the most correlated compounds. Enrichment analysis revealed cancer-related pathways and so on.hsa-mir-497, hsa-mir-224, hsa-mir-210, hsa-mir-29c, hsa-mir-486-5p, and hsa-mir-31are the top miRNA nodes in Co-DEmiRNA-Target networks. The most significant candidate miRNA dysregulation genes are The comprehensive analysis reveals the interacting genetic and molecular mechanism between OSCC and PD, linking both and providing a foundation for future basic and clinical research.The online version contains supplementary material available at 10.1186/s12903-022-02704-2. Oral squamous cell carcinoma (OSCC) is one of the most common head and neck malignant tumors, with a high incidence of 350,000 new cases and 170,000 deaths , drinkinThere is a convincing correlation between inflammation and the occurrence and development of many cancers \u201311. The MicroRNA (miRNAs) are small RNAs that play vital roles in regulating gene expression. miRNAs regulate cellular physiological processes by regulating expression and play a crucial role in mediating diseases . The molThis study aimed to comprehensively analyze differentially expressed miRNAs (DEmiRNAs) in OSCC and PD to identify candidate CO-DEmiRNAs, their associated hub genes, signaling pathways and related compounds. Thereby promoting the understanding of the shared molecular mechanisms between closely related tumors and non-neoplastic diseases. And providing a theoretical basis for driving future basic research and clinical practice.In more than 20\u00a0years of clinical work by our group, we found that almost all patients with OSCC suffer from periodontitis while burdening the tumor. Based on our previous translational studies on inflammation-precancerous lesion cancer, we sought to explore whether the presence of crucial genetic molecules could serve as a connecting key for PD and OSCC. Recent studies have revealed numerous noncoding RNAs (ncRNAs) roles in cancer and various diseases, highlighting the biological significance of these previously \u201cneglected\u201d RNA species. In particular, microRNAs (miRNAs) are involved in many biological processes that affect cell homeostasis. MiRNAs are considered post-transcriptional gene regulators that can achieve translational repression, mRNA degradation, and gene silencing and play a significant role in gene expression. We sought to explore and determine whether there are co-expressed key miRNAs and transcription factors present in PD and OSCC by bioinformatics methods, thus providing a solid basis for our subsequent target findings. This helps us in a series of studies in stomatitis-cancer transformation. We promote an understanding of the shared molecular mechanisms between closely related tumors and non-neoplastic diseases. We provide a theoretical basis for future basic research and clinical practice.https://www.ncbi.nlm.nih.gov/geo/). Only one OSCC miRNA dataset GSE45238 was identified for analysis . For the miRNA expression dataset for PD, we chose the most numerous GSE54710 . All experiments were performed further with relevant guidelines and regulations.Download the miRNA expression datasets of OSCC and PD from the GEO database Table  (https:/https://www.r-project.org/). The data were corrected using the \u201cComBat\u201d method in the R package \u201cSVA.\u201d The R package \u201cLimma\u201d was then used to identify miRNAs significantly differentially expressed in OSCC and PD cases and controls. miRNA  are regarded as \u201cDEmiRNA\u201d and used for analysis. Furthermore, LogFC\u2009>\u20090.5 is overexpressed and LogFC\u2009<\u20090.5 is low expressed.The microarray and expression data were downloaded using the R package \u201cGEOquery\u201d  as Co-DEmiRNAs and excluded Shared DEmiRNAs with different expression trends .https://www.mirnet.ca/). For the Co-DEmiRNA-Gene network, target genes were selected from 3 packages (TarBase v8.0), miRTarBase v8.0 (http://mirtarbase.mbc.nctu.edu.tw/php/index.php), and miRecords (http://c1.accurascience.com/miRecords). Due to poor stability, \u201cSteiner Forest Network\u201d cannot achieve the most stable link on the premise of ensuring the correlation. Instead, \u201cMinimum Network\u201d was chosen, which reduces the network complexity and retains key features that demonstrate network connectivity. It is computed using the critical nodes of all elements. To build the \u201cMinimum Network\u201d, the shortest paths between the nodes are determined, and any nodes not on the shortest path are removed.The co-DEmiRNA target network was constructed using miRNet 2.0 , TransmiR v2.0 (http://www.cuilab.cn/transmir) to download the corresponding transcription factors (TF) of Co-DEmiRNAs, extracted the corresponding TFs, and constructed a Co-DEmiRNA-TF Network using a similar method. The Co-DEmiRNA-TF networks were further subjected to functional enrichment analysis using the KEGG pathway, Reactome pathway, and GO.We used multiple databases such as miRbase (http://ctdbase.org/), miRbase (https://www.mirbase.org/), SM2miR (http://bioinfo.hrbmu.edu.cn/SM2miR/) and PharmacomIR.Search for small-molecule compounds with a high correlation with Co-DEmiRNAs. Build the Co-DEmiRNA-compound network based on data from CTD datasets  HNSC (Head and Neck Squamous Cell Carcinoma) project were selected for verification, and the corresponding data without clinical information were discarded. Samples belonging to oral cancer sites  were retained in clinical information, and samples from nonoral cancer sites  were excluded. The miRNA-seq data in RPM (Reads per Million mapped reads) format was converted to log2, and 373 samples were obtained . To calculate the area under the curve, the area value under the ROC curve should be between 0.5 and 1. The closer the AUC is to 1, the better the diagnostic effect.Other databases were used to verify the diagnostic efficacy of the best Co-DEmiRNA as a diagnostic marker. The miRNA-seq data of the level 3 BCGSC miRNA Profiling in the TCGA , the comparison was between the cases of OSCC (tumor specimens of OSCC patients) and normal cases (adjacent nontumor epithelium). After correction, 858 miRNAs were retained, and 208 OSCC-related significant DEmiRNAs were identified. In periodontitis data GSE54710), the comparison was the case of periodontitis  and standard samples . In contrast, PD dataset analysis retained 1368 miRNAs and identified 54 significant PD-related DEmiRNAs . A Co-DEmiRNA-Compound minimum network was constructed, consisting of 9 compounds and 11 miRNAs with 23 edges  and Fusobacterium nucleatum (F. nucleatum), have played an essential role in oral cancer occurrence [The miRNA is an essential intermediate hub of host physiological and pathophysiological activities . We knowcurrence , which rOur current study explored the epigenetic mechanism of CO-DEmiRNA mediated the association between OSCC and PD by screening and identifying Co-DEmiRNA common in the two diseases. The network architecture was applied to determine DEmiRNA-related hub genes and TF, which could be used as the linkage mechanism of differential expression and further function of DEmiRNA. In addition, functional enrichment analysis was conducted on them to determine key pathways, molecular functions, and cell components. In addition, the small molecule compounds associated with Co-DEmiRNA were analyzed, and the key junction compounds between OSCC and PD were explored. The key Co-DEmiRNAs identified in this study may provide more effective guidance in the future study of inflammation-cancer transformation.Most DEmiRNAs had the same expression trend in the two diseases, which further revealed the similar immune mechanism of the host oral microenvironment against inflammation or cancer, perhaps a common pattern of miRNA dysregulation in pro-inflammatory and pro-cancer responses. Co-DEmiRNAs with the highest degree included hsa-mir-224, hsa-mir-210, hsa-mir-31(overexpressed), and hsa-mir-497, hsa-mir-29c, hsa-mir-486(which were low expressed). They are all broadly involved in inflammation, cancer, and host immune responses.hsa-mir-224 is considered an early diagnostic marker of cancer . hsa-mirZNF460, FBN1, CDK6, BTG2, and CBX6, which may be the essential hub genes/mediators between OSCC and PD. ZNF460 (zinc finger protein 460) is involved in the regulation of multiple cancer processes by JAK2/STAT3 pathway [FBN1 (fibrinin-1) is a common extracellular matrix encoding gene [FBN1 inhibits TGF-\u03b2 1-mediated expression of Periosteum, thereby inhibiting collagen fiber production. In addition, FBN1 also plays an important role in the Wnt/\u03b2-catenin signaling pathway that regulates cancer cell migration [CDK6 (cyclin-dependent kinase 6), as one of the proto-oncogenes driving tumors, has become a key target of various cancer therapies [CDK6 also inhibits the proliferation of periodontal ligament cells (PDLCs) by regulating the cell cycle in periodontitis [BTG2 (B cell translocation gene 2) has long been recognized as a tumor suppressor gene in various cellular processes [BTG2 inhibits cancer migration, invasion, EMT and, glycolysis [CBX6 (chromobox protein 6) accelerates EMT in head and neck squamous cell carcinoma [Our study revealed that dysregulation of associated gene expression mediated by noncoding RNA represented by miRNA might be the key mechanism linking PD to OSCC or other cancers. The genes with the highest degree in the Co-DEmiRNA-Gene network include  pathway , and its pathway , 40. FBNing gene , and inaing gene , a uniquigration . CDK6  can promote gingival tissue aging and hypoxia stress  and incrFunctional enrichment analysis of Co-DEmiRNA-Gene, Hub genes and TF networks showed that many cancer-related KEGG/Reactome pathways are enriched, supporting previous findings that PD is a significant risk factor for OSCC . Ras protein signal transduction and the functional enrichment of transcription factor binding in GO analysis are very obvious. These play a crucial role in inflammation, immunosuppression, and antitumor immunity \u201369.In this study, the compounds most closely related to Co-DEmiRNA of the two diseases were also analyzed. 5-fluorouracil(5-FU), Ginsenoside, Rh2, and Formaldehyde are the small molecule compounds with the strongest correlation with Co-DEmiRNA. miRNAs reduce the resistance of oral squamous cell carcinoma cells to 5-fluorouracil . At the This study investigated the epigenetic mechanism linked between OSCC and PD, including multiple aspects, such as DEmiRNA, Co-DEmiRNA, Hub gene, TF, and even related compounds. The main limitation is the lack of further experimental data to validate these candidate key linking mechanisms. The datasets used in this study were from a single database, which may limit the accuracy of the results. Future-related research using diverse composite data is critical and necessary. Another point is that other noncoding RNAs, such as lncRNAs, circRNAs, and sncRNAs, may also play an important role in the pathogenic mechanism of OSCC and PD, which were not investigated in this study. Therefore, future studies may further investigate other noncoding RNAs as linkage mechanisms. Future studies should aim to validate the further link between Co-DEmiRNA Hub genes, TF pathway, and compound, these key parts between OSCC and PD, using clinical studies, in vitro and in vivo experiments, etc. In addition, since this association may be bidirectional, it is necessary to comprehensively study the biological mechanisms involved, which will also provide a basis for us to explain the inflammation-cancer transformation further.ZNF460, FBN1, CDK6, BTG2, CBX6) and TFs . It highlighted the most DEmiRNA-related small molecule compounds . These findings provide a theoretical basis to guide future experimental research.Comprehensive analysis of Co-DEmiRNAs in OSCC and PD revealed key genetic molecular mechanisms Table , includiAdditional file 1. Table S1a. Differentially Expressed miRNA in Oral Squamous Cell Carcinoma (GSE45238). Table S1b. Differentially expressed miRNA in Periodontitis (GSE54710). Table S2a. Co-DEmiRNA-Gene Minimum Network. Table S2b. KEGG Pathway Enrichment Analysis of Co-DEmiRNA-Gene Network. Table S2c. Reactome Pathway Enrichment Analysis of Co-DEmiRNA-Gene Network. Table S2d. Gene Ontology-Biological Process Enrichment Analysis of Co-DEmiRNA-Gene Network. Table S2e. Gene Ontology-Molecular Functions Enrichment Analysis of Co-DEmiRNA-Gene Network. Table S2f. Gene Ontology-Cellular Component Enrichment Analysis of Co-DEmiRNA-Gene Network. Table S3. The Transcription Factors of 11 Co-DEmiRNA. Table S4a. Co-DEmiRNA-TF Minimum Network. Table S4b. KEGG Pathway Enrichment Analysis of Co-DEmiRNA-TF Network. Table S4c. Reactome Pathway Enrichment Analysis of Co-DEmiRNA-TF Network. Table S4d. Gene Ontology-Biological Process Enrichment Analysis of Co-DEmiRNA-TF Network. Table S4e. Gene Ontology-Molecular Functions Enrichment Analysis of Co-DEmiRNA-TF Network. Table S4f. Gene Ontology-Cellular Component Enrichment Analysis of Co-DEmiRNA-TF Network. Table S5. Co-DEmiRNA-Compound Minimum Network."}
{"text": "Household food purchasing decision is a complex process influenced by factors such as marketing, cost, children food preference and parental choices. Most food products targeted toward children are unhealthy and are aggressively marketed to increase desirability among parents and children making healthier food selection even harder. The warning label (WL) is identified as a simple front-of-package labeling format that assist consumers to easily identify unhealthy foods and reduce their purchasing. This was a qualitative study that aimed to investigate the perceived effect of the warning label (WL) on parental food purchasing and drivers of food selection among parents. The study was conducted in a mainly rural part of South Africa, in Limpopo Province. Data were collected from 44 adult participants, all parents with children aged below 16 years selected using the snowball sampling method. Seven focus groups diversified according to age, literacy, income and urbanicity were utilized for data collection. Using a focus group discussion guide, parents were shown images of six products  superimposed with the WL and questions asked were based on those images. Thematic analysis revealed that although some parents felt undeterred by the WL, some felt they would alter their food purchasing in the presence of the WL. Other parents felt they would reduce the frequency or the amount purchased or completely stop purchasing labeled products for their children. Motives behind perceived behavior modification included children's health being perceived as a priority and labeled products being viewed as unhealthy. Factors such as pressure from children, taste, poor nutrition knowledge and affordability seemed to influence parental food selection. These findings have important policy implications by providing evidence to policymakers that the WL may alter parental food purchasing and also provide insight into drivers of food selection among South African parents. Non-communicable diseases account for more than 51% of all deaths in South Africa . The linUnhealthy diets are one of the major modifiable risk factors responsible for NCDs , 4. CurrAlthough mostly experienced later in life evidence suggests that diet-related NCDs start early in childhood and adolescence  ChildhooParents are primary household food purchasers and although influenced by other external factors such as time constraints , pressurInternational organizations recommend provision of nutritional information as a strategy to assist consumers identify healthier food options , 21. EviExisting research reveals that in the presence of the WL, an example of an interpretive FOPL, consumers are better able to understand the nutrient quality of food and select healthier food options , 26. WL Two conceptual framework models were adapted to explain pathways through which the WL influences purchasing decisions and to secondly explain drivers of food selection  31, 32), 3231, 3Warning labels have been reported to positively impact consumer behavior by shifting the desire away from unhealthy products , 43. AnoA previous study evaluating the opinion of South African adult consumers on WLs revealed that consumers found the labels attention-grabbing, easy to understand and effective in warning against unhealthy food . FindingThe latter study did not however investigate the perceived effect of the WL on parental food purchasing. Parents seem to select food differently for their children , 17 and We collected data from seven focus groups consisting of 44 participants residing in Limpopo Province, South Africa. All participants were parents with children below the age of 16 years. Focus groups varied according to age (18\u201329 years and 30\u201350 years), income (low and middle-high), literacy level (low literacy and literate) and urban or rural residency .Low income was defined as an income below or equal to R1600.00 (approximately 94 USD) and income above R1600.00 was categorized as middle-high. Low literacy was defined as educational attainment at or below Grade 6 and a participant with Grade 7 and above was considered literate. The purpose of diversifying the groups was to capture potential differences in perceptions according to different ages, educational and socioeconomic status and urbanicity. The sample consisted of parents primarily responsible for either purchasing or preparing food within the households and having children below the age of 16 years. MB, one of the researchers, recruited participants both face-to-face and telephonically through the snowball sampling method. Ethical approval was obtained from Biomedical Research Ethics Committee of the University of the Western Cape. The materials and methods followed in this study are presented according to the Consolidated Criteria for Reporting Qualitative Research (COREQ) .Discussions were based on 2D images of mock-up products  superimposed with the WL (referred to as labeled products in this study) . The nutAll discussions were conducted by MB using a focus group discussion guide  developeBefore the commencement of the study, the moderator explained the aim of the study which was to explore the views of the participants on the images to be displayed during discussions. Once the purpose of the study was explained, participants were then requested to sign the focus group confidentiality binding form. Participants were shown different images and responded to questions based on those images. The images were first rotated within the focus group to ensure each participant had a closer view of the images together with all the graphics. Participants were requested to view the images in silence. Once all participants had viewed the images, the moderator presented the images again, one at a time, without providing any explanation, to ensure all participants were aware of all the images. Once completed, the moderator started the discussions with one image, chosen at random, and led the discussions until all responses were pointing to the warning label and not the product. Once participants' focus was on the warning label, the moderator then continued to ask questions based on the focus group discussion guide. Focus group discussions lasted between 40 min to 45 min and were conducted until data saturation was reached was for the questions. Discussions were held in Sepedi, the language that participants understood. MB moderated the discussions transcribed the recordings verbatim and translated the data to English.The researchers developed a focus group discussion guide that was used during focus group discussions. The guide was based on the adapted conceptual framework , 32 Fig which suData were analyzed following inductive thematic analysis . AlthougTrustworthiness of the study was ensured throughout the study process , 48. To We extracted six themes with several subthemes from the data.WL cautions against nutrients in excess, WL promotes informedfood choices and WL reminds of health consequences.During discussions all parents were requested to share their views about the WL and the responses ranged from: There is too much fat and too much salt in that package\u201d . Another parent said: \u201cAnd this is high in salt. This tells you that this product contains too much salt\u201d . This implies that some parents were able to correctly understand the message conveyed by the WL.A number of parents' remarked that the WL alerts them to nutrients that are contained in excessive amounts, to which one parent said: \u201c. This is what one parent said: \u201cAs a parent, I will be the one going to the shops then I will know which products to buy for my child. I will first check the label and then know how my child will be eating. I will be aware of what I am feeding him \u201d. Another parent added: \u201cSo if we have inherited diseases in the family and we are diagnosed with certain diseases or hypertension in the family, I'm going to check the label first. If the label says this product contains too much fat or too much sugar I'm going to stop buying it .\u201dOne other view from some of the parents was that the WL would enable them to make informed food choicesBut if you think carefully, you will remember that eating too much sugar and too much salt causes diseases and then you will not buy them\u201d . \u201cI cannot buy a product that will make me sick at the end .\u201dFrom the discussions it was evident that the presence of the WL made a number of parents think about the health consequences related to overconsumption of the labeled products. \u201cIt will scare us\u201d . Another parent in the same group added: \u201cWe will no longer buy as usual, we will start to be afraid\u201d . In response to the question, another parent said: \u201cI will be scared\u201d  s:When asked how they would react if the WL was implemented and put on products in the supermarkets, the perceived emotional reaction from several parents was fear as illustrated by these responses: \u201creduce the amountand frequency of purchasing, stop buying labeled products, continue buying labeledproducts and switch to a different product.Parents were asked about their perceived reaction if products they usually purchased for their children would contain a WL. The following subthemes emerged: It's not going to be easy to buy products with labels for them\u201d  ' indicating some discomfort in buying products should they contain the WL in future. One parent said: \u201cThis label is going to be helpful as we will be able to see that we actually were not feeding our children well and things would have to change . Even myself that's what I normally buy for my kids. So starting today I'm going to start paying attention to what I buy for them .It was evident that the WL affected a number of parents as noted by quotes such as: \u201cBecause mostly what we saw in those pictures is what we normally put in their (children) lunchboxes, which means we are going to cut' .\u201d Another parent said: \u201cLet me give an example, like with crisps, there are those that come in strips of seven individual packets. I will buy one strip of seven small packets for my child and a big packet for myself, not for my child\u201d . Similarly another parent offered: \u201cFirstly maybe I'm going to buy the smaller amount of the pack. So I'm not going to buy the big bag\u201d . This implied that parents viewed smaller packets of labeled products as better than the big ones.Although some parents felt they would continue buying labeled products, others felt they would reduce the amount and frequency of buying and consuming such products. One parent said: \u201cYa from my side I will completely stop. I'm not going to compromise the life of my children because of the nice time for only a short term\u201d . Another parent added: \u201cI will not buy them for my children. We also want them to grow well. If we do not want fat and salt for ourselves, we also do not want it for them\u201d .When asked how the labels would affect food selection for their children, one parent said: \u201cI will continue buying products with labels\u201d . Another parent added: \u201cPersonally, I will buy the one with a warning label. A child will not eat one without the label as it will not be containing sugar\u201d . This implied that parents were willing to accommodate their children's food preferences.Some parents acknowledged they would continue purchasing labeled products especially when shopping with their children. \u201cOne parents said: \u201cI will check for other products without the warning signs\u201d . When asked what they would pack for children's lunch if they stopped buying labeled products parents in the current study said they would pack non-labeled products, fruit and water. One parent said: \u201cWe will pack the one without the warning label\u201d . Another parent said this in response: \u201cFruit, they are the healthy option. They do not have any negative consequences\u201d . When asked what would happen if the child does not enjoy the non-labeled product one parent said: \u201cThey will get used to it\u201d .Other parents' opinion was that they would instead consider other alternatives to labeled products. health as a priority and labeled products viewed as unhealthy.Some parents further offered their reasons for intention to modify purchasing behavior that included: A number of parents alluded to the importance of children being healthy from a young age: \u201cBecause children should also be healthy from childhood. We should take care of them while they are still small and not only start giving them healthy food when they are older. He should get used to them from an early childhood\u201d .: \u201cMy child's health is a priority. My child's health cannot be compared to any amount\u201d .When asked what they would do should unlabelled products be more expensive, some parents maintained that they would still not buy labeled products for their children. One parent remarkedParents viewed products containing high amounts of nutrients of concern as unhealthy and that seemed to serve as motivation for intention to modify purchasing behavior. There was a general concern about the poor nutritional value of the labeled products. One parent said: \u201cFood high in fat is unhealthy. They can cause diseases\u201d . In addition, another parent said: as you can see, crisps contain salt and; fat is also written there (pointing at the pack). in the body they will just create a mess. We need to be selective with the type of snacks we eat, (choose) healthy ones .pressureexerted by children, taste, poor nutrition knowledge and affordability. Regarding pressureexerted by children one parent said: \u201cMost of the time we go with them and it's not easy. Because that kid will scream in the shop like you stole him whereas he is yours. even if you agree at home that you are not going to cry for these and that. .\u201d Another parent felt taste play a role: \u201cA child will not eat one without the label .\u201d Another parent said: \u201cLite ones do not taste nice. Children are controlled by sugary stuff, even us. It will stay in the fridge for a long time\u201d .During discussions, drivers of food selection mentioned by parents included: Poor nutrition knowledge also emerged as one of the reasons for food selection. One of the parents believed that children are not at health risks due to their young age: \u201cI don't think these will affect children that much. Because they are still young they might not get very sick . On the other hand other parents viewed food high in sugar as harmless.\u201d \u201cI don't think there is anything wrong with food high in sugar. For example if cereals are high in sugar, I can eat them with milk and then add no additional sugar\u201d . Another parent said: \u201cIt is not possible to drink a hot drink (referring to fizzy drink). But you will not even feel its sweetness when it is cold, you just drink, no problem at all\u201d . This implied there were compensatory measures one could take to balance the amount of sugar in food.affordability. One parent said: \u201cI will buy labeled products if unlabelled products are more expensive\u201d . Another one said: \u201cWe give them whatever is available. If it's a month where you managed to buy cheaper ones that's what they will take to school, if you managed to buy expensive ones, that's what they will carry\u201d .Other parents felt compelled to purchase certain foods due to Once a week \u2014 because some of the products are needed in our bodies, even salt must not be a lot, but it is needed. Even sugar and alcohol. Not too much alcohol but just a little bit. We have to balance it like that\u201d . Another parent said: \u201cSo we still need snacks but not too often or every day\u201d and when asked how often this parent said: \u201cMaybe three times a week\u201d .When asked how frequently they felt labeled products should be consumed, their responses ranged from one to three times per week. One parent said: \u201cOne parent said: \u201cIt's only adults and literate people who will be able to read the label. Children and the illiterate will not be able to read it\u201d . Another parent added: \u201cThey cannot understand what is happening there\u201d . Right, it will take time because they will not understand. Children are just a children, they will not understand what is happening. But in future, that thing will build up .As a possible determinant of food selection, parents were asked whether they thought children would understand the WL or not. Parents were divided, with some believing the label would be confusing for children. Strategies to maximize WL effectiveness: Following were parents' recommendations to improve awareness of the WL: parental education of children at home, education ofchildren at school and education through mass media.parental education of children at home one parent said: \u201cBut the best thing it will need us as parents or whoever is staying with the child to educate them\u201d . Another parent held a similar view: Like if she buys the product and comes home with it, we can inform her that she can eat it but it has negative consequences' .Regarding Because if I keep on buying, my children will think these products are okay. If these products are not available at home, sometimes they might not have money to buy them\u201d .Other parents also emphasized the importance of modeling healthy eating habits at home. One parent said: \u201ceducation of children byteachers at school would be better. Their view was that children were more receptive to teachers than their parents. One parent said: \u201cWhen you tell children not to buy biscuits or other stuff they sometimes think that you just don't want them to eat biscuits, but if they are taught about the label at school\u2026. Sometimes children become moody when you tell them to do school work, but when they are at school they listen and do what teachers instruct them to do. So, if schools could be the ones promoting the label, teach them that such products are not good, they do this to the body\u2026 they would be hearing that in their classrooms and they listen to their teachers\u201d .On the other hand some parents were of the opinion that education through mass media. Parents recommended several avenues such as health education at the clinics, broadcasting over the radio and TV and address by the Ministry of Health. Some parents likened the implementation of the WL with the introduction of face masks for prevention of the spread of the Corona Virus. One parent said: \u201cBut the issue about whether children would understand the label or not, if this could be addressed nationally, by the Minister of Health for example, and it's broadcasted live, same as when the president warns us to be careful, it will not be difficult, just like with masks, we are used to then now. It will not be difficult\u201d .Another strategy that emerged during discussions is This study revealed that a number of parents felt the WL would discourage selection of labeled products for their children. Motives for perceived behavior modification were child health being viewed as a priority and labeled products being viewed as unhealthy. In addition the current study revealed diverse drivers of food selection that included pressure exerted by children, taste, poor nutrition knowledge and affordability.Some parents in the current study felt the WL enabled them to identify products that were high in nutrients of concern. This finding is supported by other experimental studies where the WL performed better in assisting consumers identify products with high amounts of risk nutrients , 52. TheThe WL seemed to have made a number of parents think about the negative health effects of indulging in products bearing the WL. Some parents indicated that the presence of the WL would trigger feelings of fear toward products bearing the label. Similar reactions of fear evoked by the WL and thinking about health harms have previously been reported . WLs flaRegarding the perceived effect of the WL, although some parents felt they would continue purchasing labeled products, should the WL be implemented, others felt they would alter their purchasing behavior. A number of parents felt they would reduce the amount and frequency of purchasing labeled products, others felt they would stop purchasing labeled products while some planned to switch to other alternatives. One of the goals of the WL is to discourage purchasing of unhealthy products  and pareParents could imagine using the WLs to help guide purchases for children's lunches. This remark was made upon the realization that products shown during the discussions were those they usually include in their children's lunchboxes. Nathan et al.  found thEnablers of the WL in this study included health being viewed as a priority and labeled products being viewed as unhealthy. Health and nutrition were also previously reported as motivators for parental food choices . ParentsPoor nutrition knowledge surfaced as one of the influencers of parental food selection. One view held by parents was that sugar does not pose any health problems for younger children. Others felt that sweetened beverages if taken cold would not have any health repercussions as they lose their sweetness when chilled. Such misconceptions could potentially fuel excess sweetened beverage consumption and obesity among children. Any implementation of WL regulations should therefore be linked to strong health education campaigns to improve label understanding and broader nutrition knowledge. This calls for the need to strengthen nutrition literacy initiatives by the health sector, academia and other non-governmental organizations.Affordability was mentioned as another factor generally affecting parental food selection similar to findings in other studies , 24. LowRegarding parental perception on label understanding, a number of parents felt the WL would be meaningless to children. Parents recommended strategies to improve its effectiveness and that included education of children at home, education of children at school, education through mass media and demonstration of healthy eating habits at home. Similar strategies have previously been recommended , 62 and The strength of this study is that discussions were based on a variety of products commonly classified as unhealthy  and those usually perceived as healthy . Another strength was that all parents had children below the age of 16 years and were suitable to give views as parents. Understanding parental view on the effect of the WL is an important policy consideration as parents play an important role in shaping children's eating habits. The limitation of this study is that data were collected in only one Province and the results may not be generalizable to the entire population. However, the focus groups were diversified to capture opinions from diverse groups to improve the richness of the data. Another limitation inherent in qualitative studies is that focus group discussions can be easily swayed by one vocal group member. Quantitative studies with a representative sample size could be conducted to understand the widespread perceptions of parents in South Africa. This study was experimental and may not translate directly into actual purchasing behavior. The actual effect can only be determined once WLs are implemented. A potential bias for this type of study is demand effects. To deal with this effect, participants were invited to participate freely and were informed that there were no correct or incorrect responses. Additionally participants were only informed that the study was about their perceptions of the images (pictures) to be displayed during the discussions.Based on our results parents believed they would reduce the quantity and frequency of consuming labeled products, stop purchasing labeled products and switch to non-labeled products. Some parents felt they would continue purchasing labeled products. Motives to switch to non-labeled products included health being a priority and labeled products being perceived as unhealthy. Drivers of food selection included pressure exerted by children, taste, poor knowledge and affordability. This study provides more clarity on factors influencing food selection by parents and how policy efforts may influence purchasing behavior of South African parents. These results strengthen the importance of implementing WLs in South Africa to benefit children health.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Biomedical Research Ethics Committee; University of the Western Cape. The patients/participants provided their written informed consent to participate in this study.MB, LT, and RS conceptualized the study and contributed to the study design. MB collected and analyzed the data and drafted the original manuscript. RS acquired funding for the study and supervised the project. LT and RS reviewed and edited the manuscript. All authors contributed to the article and approved the submitted version.This study was received from Bloomberg Philanthropies, Subcontract # 5108311 with the University of the Western Cape.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "COVID-19 is a fast-spreading pandemic that is caused by SARS-CoV-2 viral pathogen. Combination therapy of the antiviral favipiravir and the anticoagulant apixaban is one of the efficient treatment regimens. Therefore, development of novel and sensitive methods for simultaneous analysis of such combination is highly advantageous. Herein, two eco-friendly, simple, rapid, and cost-effective spectrofluorometric methods were evolved for the estimation of favipiravir and apixaban in pharmaceutical and biological matrices. Method I was based on analysis of favipiravir and apixaban by the first-order derivative of the conventional fluorescence spectra obtained after excitation at 300\u00a0nm, where favipiravir and apixaban were detected at 468.8 and 432.0\u00a0nm, respectively. Method II relied on dual scan synchronous spectrofluorometry, in which favipiravir was determined at 364\u00a0nm using \u0394\u03bb\u2009=\u200960\u00a0nm while apixaban was analyzed at 274\u00a0nm using \u0394\u03bb\u2009=\u2009200\u00a0nm. Method optimization was performed for selecting the optimum conditions at which maximum sensitivity and selectivity were obtained. This report is the first one that describes simultaneous analysis of favipiravir and apixaban by synchronous spectrofluorometry. The developed methods were successfully applied to evaluate favipiravir and apixaban in spiked human plasma and in pharmaceutical dosages with high %recoveries and low RSD. The disease is caused by novel infectious positive single-stranded RNA (SARS\u2010CoV\u20102) virus, and it is usually accompanied by multiple atypical pneumonia. Moreover, it shows several other symptoms such as cough, fever, fatigue, diarrhea and progressing to acute respiratory distress syndrome (ARDS). COVID-19 patients may also report neurological symptoms, including dizziness, hypogeusia headache, myalgia, ataxia, hyposmia, and seizures2.COVID-19 pandemic emerged in Wuhan, China at the end of 2019. Up to date, more than 6 million people have lost their lives because of this epidemic out of approximately 492 million who were primarily infected worldwide3. Among these effective antivirals is favipiravir (FAV) which was recently used for treatment of COVID-19 in some countries.Notwithstanding, COVID-19 treatment protocols are still under investigation and may differ from a country to another relying to severity and spread factors, however, the main treatment guidelines are followed. Because of the high reproductive number of SARS-CoV-2, antivirals were tested for efficacy to control or even stop the viral transmission. Antivirals that inhibit reverse transcription are among the most potent agents available to combat the SARS-CoV-2 infection4.Favipiravir is a nucleoside analogue (purine base) that is converted intracellularly to the active form, FAV-ribofuranosyl-5B-triphosphate by phosphoribosylation process. It inhibits RNA-dependent RNA polymerase (a core enzyme in SARS-CoV-2 replication process) selectively and potently in SARS-CoV-2. FAV was the antiviral of choice for the current study as it showed rapid viral clearance in comparison to ritonavir and lopinavir in addition to superior rate of recovery compared to umifenovir. Additionally, FAV is incorporated recently in COVID-19 treatment protocols in some countries such as India5, elevated D-dimer levels and prothrombotic parameters. Then, anticoagulants were included as prophylactic treatment in patients with high D-dimer values to reduce venous thromboembolism rate or mortality. Reported clinical trials assured the claim by significantly decreasing mortality upon using anticoagulant therapy among COVID-19 protocol6. Different anticoagulants were tested for decreasing mortality, enoxaparin and heparin therapeutic doses have not shown to downside mortality rates while apixaban (APX) prophylaxis and therapeutic doses have done. Then, APX was the preferred anticoagulant regimen6.The mortality rate increased in COVID-19 patients who suffered from multi-organ dysfunction accompanying ARDSH-pyrazine-3-carboxamide and 1-(4-methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1-yl)phenyl]-4,5-dihydropyrazolopyridine-3-carboxamide, respectively.Favipiravir and apixaban Fig.\u00a0 have the7, two conventional spectrofluorometric methods9, electrochemical methods12, and HPLC methods13 were reported. On the other hand, spectrophotometric17, spectrofluorometric18, electrochemical19, and HPLC24 methods were reported for the assay of APX. As discussed, antivirals besides anticoagulants are co-administered during COVID-19 treatment in mild to severe cases of infection. The analytical study of such coadministration besides few reported spectrofluorimetric techniques were the motivation to develop this work. It is noteworthy that this study is the first to be performed targeting simultaneous determination of FAV and APX followed by application to human biological samples.The literature was screened for analytical procedures that were applied for determination of FAV and APX. For FAV, a spectrophotometric methodBased on the native fluorescence of FAV and APX, trials for separation of FAV and APX\u2019s overlapped spectra were performed. Then, the two current methods were developed and applied to local market tablets having FAV or APX as the main active ingredient besides determination of both drugs simultaneously in human plasma samples.All spectrofluorometric measurements were performed by an Agilent\u00ae Cary Eclipse spectrofluorometer to which a xenon flash lamp is equipped. A smoothing factor of 20, a 5\u00a0nm slit width, and an applied voltage of 800\u00a0V were used during all experimental trials. Relative fluorescence intensities (RFI) of the estimated analytes were measured using excitation wavelength of 300\u00a0nm in method (I) and dual scan in method (II), where in first scan FAV was determined using \u0394\u03bb of 60\u00a0nm and calibrated at 364\u00a0nm and in the second scan \u0394\u03bb of 200 was set to detect APX and then calibration was performed at 274\u00a0nm.Favipiravir raw material was kindly supplied by EIPICO pharmaceutical company, Egypt. Avipiravir\u00ae tablets  were supplied by EVA Pharma Company, Cairo, Egypt. Apixaban raw material was supplied by Multi Apex company, Egypt. Artixiban\u00ae commercial tablets, labelled to contain 2.5\u00a0mg APX per tablet, were purchased from a local pharmacy.HPLC grade iso-propanol, acetonitrile, ethanol, methanol, and n-propanol were all obtained from Sigma-Aldrich, Egypt. Analytical grade of surfactants: tween 80, sodium dodecyl sulfate, and carboxymethyl cellulose were supplied by laboratories of faculty of pharmacy, Mansoura University, Egypt.The frozen plasma samples were supplied by Hospitals of Mansoura University, Dakahleya, Egypt. All experiments were performed according to the Institutional Ethics Approval of the relevant University Committee.\u22121 of both drugs, were prepared by accurately weighing 10\u00a0mg of the raw materials, quantitatively transferring each powder to a 100\u00a0mL volumetric flask, and completing the volume to 100\u00a0mL using ethanol, followed by a 10-min sonication process.Stock solutions, having the concentration of 100\u00a0\u03bcg\u00a0mLSets of 10.0\u00a0mL volumetric flasks were arranged, to which aliquots of FAV or APX or both (as in synthetic mixture) were transferred. All flasks were completed to 10.0\u00a0mL using distilled water and mixed well. Against blank distilled water, RFI of flasks were measured setting excitation wavelength of 300\u00a0nm. The recorded emission spectra were converted to their first order derivatives using filter size of 20 and interval of 5. FAV was measured at 468.8\u00a0nm which represented a clear zero crossing point for APX, meanwhile, APX measurements were recorded at 432\u00a0nm, that was a clear zero crossing point for FAV. Then, calibration curves were attained by plotting \u2206F of each flask against its corresponding concentration.\u22121) were transferred. Flasks were completed with distilled water to the mark and mixed well. RFI of flasks were recorded at \u0394\u03bb\u2009=\u200960\u00a0nm and calibrated at 364\u00a0nm against blank. Calibration curves were attained by plotting \u2206F of each flask against its corresponding concentration.FAV calibration curves. A set of 10.0\u00a0mL volumetric flasks were arranged, to which aliquots of a diluted stock  and (II), respectively. The nominal contents were calculated using corresponding regression equations or already plotted calibration graphs for each method.The donated plasma was kept frozen at \u2212\u00a05\u00a0\u00b0C then gently thawed in a water bath at 37\u00a0\u00b0C before using. Into a set of 6 centrifugation tubes, 15-mL each, 1\u00a0mL of thawed human plasma was transferred to each tube, followed by spiking with elevating concentrations of FAV and APX, simultaneously. The 6-tubed set examined a one-minute vortex mixing and after that, completed to 5\u00a0mL with ethanol that allowed one step precipitation of plasma proteins. The vortexed set examined a 20-min 5500 rotations per minute centrifugation to efficiently separate the precipitated plasma proteins while maintaining FAV and APX in the supernatant layer. Then, supernatants were filtered by 0.2\u00a0\u00b5m disc filters to remove possible suspended particles. A specified volume (1.0\u00a0mL) of the supernatant solutions, containing FAV and APX, was transferred to a series of 10.0\u00a0mL volumetric flasks, then the procedures under \u201cFAV-APX\u00a0synthetic mixtures\u201d section were followed and the %recoveries were measured.Plasma application was licensed by Research Ethics Committee, Faculty of Pharmacy, Mansoura University (Code number: 2022-128). The Research Ethics Committee, Faculty of Pharmacy, Mansoura University (Code number 2022-128), waived the need for informed consent to be obtained. Also, all experiments followed the guidelines and regulations by Research Ethics Committee, Faculty of Pharmacy, Mansoura University.COVID-19 or corona disease is still attacking all countries worldwide with variable strengths. Treatment protocols passed through several updates and are still under study and optimization by clinical researchers. Then, we had the eager to develop the presented methods which manifested the selectivity and sensitivity of spectrofluorometric technique. Our methods estimated the recently approved COVID-19 antiviral FAV and co-administered APX anticoagulant in their dosage forms. Additionally, both drugs were determined simultaneously in human plasma samples, and this would be further applied in forensic medicine and clinical studies.18. Upon spectrofluorometric scanning of FAV and APX, a complete overlap was observed as represented in Fig.\u00a0Spectrofluorometry was the technique of choice as it is featured by high sensitivity, selectivity, simplicity, and low cost. This technique allowed utilization of reported conventional fluorescence spectra of the analytes in questionex of 323\u00a0nm and 248\u00a0nm, respectively, an overlap was observed hindering simultaneous measurement of the analytes in question Fig.\u00a026. In conventional spectrofluorometry, recording emission at excitation of 300\u00a0nm allowed detection of FAV and APX simultaneously at 468.8\u00a0nm and 432\u00a0nm, respectively after implementing first order derivatization as in Fig.\u00a0Following conventional emission of FAV and APX at their reported \u03bb28.SFS is advantaged by simplicity and sharpness of peaks when compared to conventional spectra. Beside minimization of complex matrix interference, high selectivity is guaranteed by synchronous technique, then plasma applications are more simple\u22121) and APX (1.0\u00a0\u00b5g\u00a0mL\u22121) were used for the following three parameters. Conventional spectrofluorometry was adopted to adjust optimum conditions using emission 432\u00a0nm after 323\u00a0nm excitation for FAV samples and emission at 475\u00a0nm after 280\u00a0nm excitation for APX samples.Spectrofluorometry is characterized by high sensitivity, then study conditions were cautiously examined. Where constant concentrations of FAV , FAV: \u0394F\u2009=\u2009\u2212\u00a02.79 \u2212\u00a00.48C, APX: \u0394F\u2009=\u20090.53\u2009+\u200930.1C , and method (II) FAV: \u0394F\u2009=\u20091.10\u2009+\u200965.29 C, APX: \u0394F\u2009=\u20097.88\u2009+\u2009313.22 C, where C: drug concentration and \u0394F : relative fluorescence intensity.Following ICH guidelinesa is the standard deviation of intercept. Table r) of 0.9999 for both drugs assured linearity of methods for both drugs in the selected range of analysis.Detection and quantitation limits values were both calculated by data obtained in calibration graphs following using the reported equations: LOD\u2009=\u2009mentclass2pt{minimmentclass2pt{minimt-test and variance ratio F-test when compared to comparison procedures. Obtained data and analysis values are expressed in Table Accuracy of the proposed spectrofluorometric procedures could be expressed by accepted values of Student \u221219. Additionally, the reported comparison method for APX analysis relied on conventional spectrofluorometric measurement at 450\u00a0nm following excitation at 284\u00a0nm using distilled water with linearity range of 0.2\u20136.0\u00a0\u03bcg\u00a0mL\u2212118. The present SFS method is superior in sensitivity for FAV (1\u201314\u00a0ng\u00a0mL\u22121) and APX (0.1\u20132.0\u00a0\u03bcg\u00a0mL\u22121).FAV comparison method was based on direct analysis at 436\u00a0nm in Britton-Robinson buffer of pH 4 after excitation at 323\u00a0nm with linearity range of 20\u2013350\u00a0ng\u00a0mLTable max in each individual scan. The methods were applied successfully to assay the analytes of interest in their pharmaceutical dosages. Additionally, FAV and APX were analyzed in human plasma with % mean recoveries of 98.54% and 101.76% in conventional spectrofluorometric method and 98.63% and 99.95% in dual scan synchronous spectrofluorometry for FAV and APX, respectively.Two rapid, simple, direct, green, and sensitive spectrofluorometric methods were evolved for the simultaneous analysis of COVID-19 medication regimen FAV and APX in different matrices. The assay methods utilized both conventional and dual scan synchronous fluorescence spectroscopy in order to assay each analyte in presence of the other one without any interference. Dual scan technique has overcome the sensitivity and selectivity problems by measuring each analyte at its \u03bb"}
{"text": "New-onset atrial fibrillation (NOAF) complicating with ST-elevated myocardial infarction (STEMI) patients following percutaneous coronary intervention (PCI) is associated with worse prognosis. The systemic inflammatory response index (SIRI), serves as a novel inflammatory indicator, is found to be predictive of adverse outcomes. The aim of this study is to explore the association between NOAF and SIRI.A retrospective data included 616 STEMI participants treated with PCI in our cardiology department had been analyzed in present investigation, of which being divided into a NOAF or sinus rhythm (SR) group based on the presence or absence of atrial fibrillation. The predictive role of SIRI for in detecting NOAF had been evaluated by the logistic regression analyses and receiver operating characteristic (ROC) curve. Additionally, long-term all-cause mortality between both groups was compared using the Kaplan\u2013Meier test.P\u2009=\u20090.001). In the ROC curve analysis, SIRI with a cut-off value of 4.86 was calculated to predict NOAF, with 4.86, with a sensitivity of 80.85% and a specificity of 75.57%, respectively (area under the curve (AUC)\u2009=\u20090.826, P < 0.001). Furthermore, pairwise compassion of ROC curves displayed the superiority of SIRI in the prediction of NOAF in comparison with that of neutrophil/lymphocyte or monocyte/lymphocyte (P\u00a0< 0.05). In addition, the participants in NOAF group had a significantly higher incidence of all-cause death compared to those in SR group after a median of 40-month follow-up .NOAF during hospitalization developed in 7.6% of PCI-treated individuals. After multivariate regression analyses, SIRI remains to be an independently predictor of NOAF (odds ratio 1.782, 95% confidence interval 1.675\u20131.906, SIRI can independently predict NOAF in patients with STEMI after PCI, with being positively correlated to worsened outcomes. New-onset atrial fibrillation (NOAF) is one of the most common arrhythmic complications in the setting of ST-elevated myocardial infarction (STEMI) following percutaneous coronary intervention (PCI), with a reported incidence ranging from 3.0 to 13.7% . Thus, iInflammatory response and immune system cells, such as monocyte, neutrophil and lymphocyte, have been implicated in the initiation and development of atrial fibrillation (AF) \u201310. FurtA total of consecutive STEMI participants admitted to the Department of Cardiology between February 2016 and December 2021 had been recruited in this retrospective study. All STEMI patients aged over 18 years were treated invasively within the first 24\u00a0h after symptoms onset. Exclusion criteria contained individuals with previously paroxysmal/non-paroxysmal AF, history of PCI, heart valve disease, inflammatory-related diseases, hematological diseases, malignancy, chronic obstructive pulmonary disease, hyperthyroidism or hypothyroidism, and severe hepatic or renal dysfunction. Finally, the study cohort was comprised of 616 eligible participants  or hypertension, drinking or smoking status, were obtained from a questionnaire by trained doctors. Routine blood analyses, such as, the levels of neutrophil counts, lymphocyte counts, monocyte counts, were performed before PCI and measured with an automated blood count analyzer . Biochemical markers, including glucose, triglyceride, total cholesterol, high-density lipoprotein cholesterol (HDL-c), low-density lipoprotein cholesterol (LDL-c), creatinine, creatine kinase (CK), and albumin were additionally analyzed for all patients after fasting for overnight by using an automated chemistry analyzer . The value of NLR and MLR was defined as the counts of neutrophil and monocyte to the counts of lymphocyte, respectively. SIRI was calculated as follows, (N \u00d7\u00a0M)/L, where N, M, and L was presented as the counts of neutrophil, monocyte, and lymphocyte, respectively . Body maThe treatment of PCI was performed for all STEMI patients according to the contemporary guidelines . The degAll STEMI patients treated with PCI were monitored by telemetry electrocardiogram (ECG) during hospitalization at the coronary unit. Subsequently, any suspected symptom of arrhythmia was assessed by a 12-lead ECG at the ward. AF was defined as irregular RR intervals with the absence of discrete P waves, complicating by fibrillatory waves. NOAF was identified as the occurrence of an AF episode lasting 30\u00a0s during hospital period. A total of 40 NOAF patients had been treated with either electrical or chemical cardioversion, of note, amiodarone intravenously is regarded as the pharmacologic treatment of AF. Ventricular tachycardia (VT) was presented as any VT event lasting\u2009\u2265\u200916 consecutive beats with a rate more than 125 beat/min .The primary adverse outcomes during hospitalization were comprised of cerebrovascular events, pulmonary edema, cardiogenic shock, VT, mortality. The long-term endpoint with respect to all-cause death was collected from medical records or obtained by telephonic interviews. Participants were followed-up from the enrollment to June 15, 2022.P < 0.05), were used to determine the independent predictors of NOAF. Receiver operating characteristic (ROC) curve and area under the curve (AUC) were generated to define the predictability of potential factors. The comparison of ROC curves for different risk factors was conducted by the DeLong method. Kaplan\u2013Meier curves were performed to estimate time-to-event data, while the comparison of different groups was evaluated using a log-rank test. All data were analyzed by IBM SPSS 23.0, with P < 0.05 of statistical significance.Kolmogorov\u2013Smirnov test was performed to evaluate the distribution patterns of the continuous variables. Continuous data were defined as mean\u2009\u00b1\u2009standard deviation or median (interquartile range) based on whether variables are normally distributed or not, whereas the categorical variables were expressed as numbers (percentages). The comparison of parametric variables was conducted by the Student\u2019s t or Mann\u2013Whitney U-test, as appropriate, while non-parametric data was compared using the Chi-squared or Fisher\u2019s exact test. Multivariable logistic regression analyses, which incorporated potential risk factors originated from univariable regression analysis . Further multivariate analyses demonstrated that the values of SIRI, albumin, glucose and eGFR were the independent predictors of NOAF in STEMI treated with PCI  experienced all-cause death after hospital discharge. Kaplan\u2013Meier analysis showed that the all-cause mortality in NOAF group is significantly higher than that in SR group -6, IL-1\u03b2, tumor necrosis factor (TNF)-\u03b1, thus leading to both structure and electrical atrial remodeling, which can provide the occurrence of AF with necessary substance \u201337. AddiSeveral clinical implications have been stated according to the present results. First, SRI is a relatively common and easily obtained biomarker in clinical practice. Further, it might be beneficial for clinicians to efficiently identify the patients with high risk of NOAF by using the pre-procedural SIRI, thus providing them with better individualized treatment and care. Additionally, our results may broaden current understanding of underlying pathological mechanisms for the NOAF in STEMI patients, thus implying new targets for the prevention of NOAF.There are several limitations in our study. First, it is a single-center study based solely on Chinese individuals, thus limiting the generality of the present result. Second, due to the nature of retrospective analysis and limited samples, the result is inherently subject to selection bias and only provide an association between SIRI and NOAF instead of causality. Third, Several inflammatory indicators, such as, CRP, interleukins, were not assessed. Additionally, the level of SIRI was evaluated on admission for one-time and the fluctuation of SIRI had not been measured during hospitalization. Future large-scale prospective investigation is thus necessary to validate our result.In conclusion, SIRI is independently associated with NOAF in STEMI patients treated with PCI, with NOAF patients experiencing higher risks of in-hospital complications and long-term all-cause death as compared to those with SR."}
{"text": "Although comorbidity of major depressive disorder (MDD) and chronic pain (CP) has been well-studied, their association with pain catastrophizing is largely elusive. This study aimed to investigate the potential effects of pain catastrophizing in patients with a comorbidity.n = 45; depression group: patients with depression without chronic pain, n = 47; and healthy controls: n = 48). The Hamilton Depression Rating Scale (HAMD)-24 and Hamilton Anxiety Rating Scale (HAMA)-14 were used by professional psychiatrists to evaluate the severity of depression and anxiety. Beck Depression Inventory-II (BDI-II) and Beck Anxiety Inventory (BAI) were conducted by patients' self-report to assess the symptom severity. The pain intensity numerical rating scale (PI-NRS) was used to assess the pain intensity. Pain Catastrophizing Scale (PCS) and Pain Anxiety Symptoms Scale (PASS) were used to estimate pain-related negative thinking.In total, 140 participants were included in this study and divided into three groups according to the Diagnostic and Statistical Manual of Mental Disorders and the International Association for the study of pain . A stepwise regression analysis further demonstrated that the total PCS score, high monthly income level, and BDI score had positive impacts on PASS (P < 0.05). We also found that the total BDI score, disease course \u22651 year, and pain intensity had positive effects on PCS (P < 0.05), whereas years of education (\u2264 12 years) had a negative effect on PCS (P = 0.012). In all, we have clearly demonstrated that PCS and PASS could serve as potentially predictive factors in patients suffering from comorbidity of MDD and CP.The results showed that PASS and PCS scores were significantly different among the three groups. Particularly, the scores in the comorbidity group were the highest. The Pearson correlation analysis revealed a positive correlation between PCS  and the severity of depression symptoms, anxiety symptoms, and pain intensity (Our results suggested that the pain-related catastrophic thinking and anxiety were more severe in the comorbidity group than in MDD-only group and healthy group. Pain-related catastrophizing thoughts and anxiety may have potentially effects on the comorbidity of depression and chronic pain. Empirical research has shown a strong correlation between major depressive disorder (MDD) and chronic pain (CP). Epidemiological studies have explored that the average prevalence of pain in MDD is as high as 65%, and the average prevalence of MDD in patients with CP is 52% , 2; the Psychosocial factors, such as pain-related anxiety and catastrophic thoughts, are critical determinants of differences in the development of MDD or CP , 13. PaiFrom a clinical perspective, the majority of studies addressing the relationship between MDD and CP have limitations . First, n = 45), depression group , and control group . The International Association for the Study of Pain (IASP) defines the CP as an unpleasant sensory and emotional experience, when it lasts or recurs for longer than 3 months  between January 2019 and July 2021. According to trial standards, two professional doctors used the Mini-International Neuropsychiatric Interview (MINI) 6.0.0. to evaluate all participants. A total of 162 participants were initially evaluated, among which 12 participants could not complete the scale assessment and 10 individuals refused to sign the informed consent. Hence, 22 subjects who did not meet the experimental criteria were excluded from this experiment, and the remaining 140 participants were included. Ultimately, 140 participants were included in this study and divided into the following three groups according to the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), namely, comorbidity group  fulfillment of the DSM-5 criteria and IASP for patients with depression and CP by two independent experienced psychiatrists; (2) aged between 16 and 60 years; (3) CP is not caused by physical trauma injury or serious somatic disease or inflammatory disease; (4) pain intensity numerical rating scale (PI-NRS) \u22653. The inclusion criteria for the depression group were as follows: (1) fulfillment of the DSM-5 criteria for depression by two independent experienced psychiatrists; (2) aged between 16 and 60 years; and (3) PI-NRS <3. All the participants did not have any of the following exclusion criteria: (1) history of craniocerebral trauma or somatic trauma; (2) history of severe inflammatory diseases, neurological diseases, or tumor-related diseases; (3) history of alcohol or other substance use or other mental disorders; (4) history of diabetes, hypertension, and endocrine disease; (5) pregnant or lactating women; and (6) administration of electroconvulsive therapy without convulsions 3 months before enrollment.MINI 6.0.0, which is a concise diagnostic interview for psychiatric disorders used by psychiatrists in the United States and Europe, was used to verify the preliminary clinical diagnosis. All patients underwent MINI to confirm the clinical diagnoses of MDD with CP and MDD without CP .A self-reported questionnaire was used to collect information concerning age, gender, marital status, income status, employment status, educational level attained, duration of disease course, and health service accessibility.Hamilton Depression Rating Scale-24 (HDRS-24) is the most commonly used depression scale worldwide because it has a high specificity to assess the severity of depression symptoms. The Cronbach's \u03b1 score of HAMD-24 is 0.88, and the \u03ba-score is 0.92. The HAMD-24 score may be used to define clinically relevant symptom levels as follows: <8 = no depression, 8\u201319 = mild depression, 20\u201334 = moderate depression and \u226535 = severe depression  and excellent criterion validity (\u03ba = 0.94) compared with other depression measures .Beck Anxiety Inventory is a 21-item self-report instrument that assesses the grade of anxiety symptoms. Each item is rated from 0 to 3 with general guidelines; its total score ranges from 0 to 63, and higher scores indicate more severe anxiety symptoms. BAI has excellent internal consistency  and good discriminant validity for anxiety disorders .Pain Catastrophizing Scale is a 13-item self-report instrument that assesses catastrophizing in the context of actual or anticipated pain. PCS measures catastrophizing as a multifaceted construct with three subscales, namely, rumination, magnification, and helplessness. PCS estimates how individuals respond to painful circumstances and indicates the degree to which they experience each thought or feeling when experiencing pain. Each item is rated from 0  to 4  with general guidelines, its total score ranges from 0 to 52, and higher scores indicate more serious pain-related thoughts .Pain Anxiety Symptom Scale was translated into the Chinese version by Xiao-Yi Zhou. Chinese PASS is a 20-item questionnaire that comprises four subscales, namely, cognitive anxiety, escape/avoidance, fearful appraisal, and physiological anxiety. All items were rated on a scale ranging from 0  to 5 . Its total score ranges from 0 to 100, and higher scores indicate more severe pain-related anxiety.Pain intensity numerical rating scale is a self-report questionnaire that assesses pain intensity and demonstrates strong construct validity and stability. In consideration of its simplicity and easy operation, it is widely used in the evaluation of clinical CP disease. This scale frequently measured on an 11-point pain intensity PI-NRS, where 0 indicates no pain and 10 indicates worst possible pain .t-test, chi-squared test, and ANOVA were performed to compare the differences in continuous or categorical parameters among the three groups. Symptoms related to pain anxiety and pain catastrophizing were analyzed by repeated-measure ANOVA and Tukey post-hoc analyses. Pearson product-moment correlation coefficients were calculated to examine the relationships between severe degree of depression, pain, or anxiety and pain catastrophizing thoughts. A stepwise regression analysis was conducted to analyze the confirmatory factor analysis. P < 0.05 was considered statistically significant. Finally, the mediation analysis was performed to further test whether the relationship between the potentially risk factors and depressive symptoms was mediated by pain-related anxiety and pain catastrophizing thoughts. This analysis was carried out by quantifying the direct and indirect relationships among the independent variables, mediator , and dependent variable . In the mediation models, all paths were reported as unstandardized ordinary least squares regression coefficients. A significance analysis was based on 5,000 bootstrap realizations, and a significant indirect effect was indicated when the bootstrap 95% confidence interval (CI) was not zero.Statistical Package for the Social Sciences version 22.0  was used to analyze the data. The P > 0.05). Psychometric properties and the clinical characteristics of depression and anxiety also showed no differences between the comorbidity and depression groups. However, pain intensity was more severe in the comorbidity group compared with the depression group (P = 0.025).The demographic data, anxiety psychometric properties, and clinical characteristics of the three groups are shown in F = 21.29, P < 0.001; F = 26.62, P < 0.001; F = 14.46, P < 0.001, respectively). The comorbidity group had significantly higher total PASS scores, fear of pain score, and physiological anxiety score  than the MDD and healthy groups. The three factors in the PCS scale, namely, magnification, rumination, and helplessness, were also assessed. Total PCS score, magnification score, rumination score, and helplessness score were significantly different among the three groups . Together, these results . Meanwhile, self-reported anxiety symptoms had positive correlations with fear of pain, physiological anxiety, and total PASS score . Interestingly, from the perspective of professional psychiatrists, depression symptoms only had a positive relationship with physiologic anxiety , and somatic anxiety symptoms had a positive relationship with fear of pain . In addition, we found that the course of disease positively correlated with fear of pain and the total PASS score . On the contrary, we discovered that years of education and monthly income negatively correlated with fear of pain . Except for the above, we also found the pain intensity had positive related to the fear of pain and physiologic anxiety .Remarkable correlations were found between the components of pain-related anxiety and depression symptoms. Specifically, self-reported depression symptoms had positive correlations with fear of pain, physiologic anxiety, and total PASS score . Similar to the previous results, self-reported anxiety symptoms had positive correlations with the helplessness, magnification, rumination, and total PCS scores . In addition, depression symptoms were also positively associated with the helplessness score, magnification score, rumination score, and total PCS score . Psychological anxiety and somatic anxiety had positive relations with the helplessness score . Furthermore, the pain intensity also had a strong correlation with helplessness, magnification, rumination, and total of PCS scores . Above-mentioned results are shown in We evaluated the relationship between pain catastrophizing thoughts and depression symptoms. Self-reported depression symptoms had positive correlations with the helplessness score, magnification score, rumination score, and total PCS score , whereas a significant negative impact was found between men and PASS score . Furthermore, the regression model accounted for 53.1% of the variation in total PCS scores. A positive effect was explored between PCS with total BDI score, disease course \u2265 1 year, and pain intensity , and a negative relationship was found between education >12 years and PCS score . Finally, an examination of the mediator pathways revealed the indirect role of pain-related anxiety, pain catastrophizing thoughts, and pain intensity in depression symptom. Boot strapping results indicated that the indirect effect was significant (P < 0.05). The 95% CI did not contain zero, confirming the significant mediating effect of pain-related anxiety and pain catastrophizing thoughts for depression symptoms prediction , Hospital Project of Hefei Fourth People's Hospital (Grant Number: 2019023), Fund Project of Anhui Medical University (Grant Number: 2019xkj206), Shanghai Key Laboratory of Psychotic Disorders Open Grant (Grant Number: 13dz2260500), Natural Science Research Projects in Anhui Universities (Grant Number: KJ2020A0218), Applied Medicine Research Project of Hefei Health Committee (Grant Number: Hwk2020zd0016), Applied Medicine Research Project of Anhui Health Committee (Grant Number: AHWJ2021a036), and Natural Science Foundation of Minhang District (Grant Number: 2020MHZ063). The funding sources had no involvement in the study design, collection, analysis, and writing of this article and publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The handling editor declared a past collaboration with one of the author's, CZ.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Hepatitis E virus (HEV) infection is the most common cause of acute viral hepatitis worldwide. Hepatitis E is usually asymptomatic and self-limiting but it can become chronic in immunocompromised patients and is associated with increased fulminant hepatic failure and mortality rates in pregnant women. HEV genome encodes three proteins including the ORF2 protein that is the viral capsid protein. Interestingly, HEV produces 3 isoforms of the ORF2 capsid protein which are partitioned in different subcellular compartments and perform distinct functions in the HEV lifecycle. Notably, the infectious ORF2 (ORF2i) protein is the structural component of virions, whereas the genome-free secreted and glycosylated ORF2 proteins likely act as a humoral immune decoy. Here, by using a series of ORF2 capsid protein mutants expressed in the infectious genotype 3 p6 HEV strain as well as chimeras between ORF2 and the CD4 glycoprotein, we demonstrated how an Arginine-Rich Motif (ARM) located in the ORF2 N-terminal region controls the fate and functions of ORF2 isoforms. We showed that the ARM controls ORF2 nuclear translocation likely to promote regulation of host antiviral responses. This motif also regulates the dual topology and functionality of ORF2 signal peptide, leading to the production of either cytosolic infectious ORF2i or reticular non-infectious glycosylated ORF2 forms. It serves as maturation site of glycosylated ORF2 by furin, and promotes ORF2-host cell membrane interactions. The identification of ORF2 ARM as a unique central regulator of the HEV lifecycle uncovers how viruses settle strategies to condense their genetic information and hijack cellular processes. Hepatitis E virus (HEV) is the major cause of acute viral hepatitis worldwide. Although infection with HEV is usually self-resolving, it can cause up to 30% mortality in pregnant women in the third trimester. There is no specific treatment nor universal vaccine to fight against HEV. In our study, we focused on the HEV ORF2 capsid protein which is produced as different forms that perform distinct functions in the HEV lifecycle. The infectious ORF2i form is the structural component of virions, while the other forms likely act as an immune decoy. Herein, we deciphered the molecular determinants of ORF2 multifunctionality. We identified an Arginine-Rich Motif (ARM) located in the ORF2 N-terminal region that controls the subcellular localization, the fate and functions of ORF2 forms. It also promotes ORF2-host cell interactions. Our observations highlight the ORF2 ARM as a unique central regulator of ORF2 addressing that finely controls the HEV lifecycle. Hepatitis E virus (HEV) is the most common cause of acute viral hepatitis worldwide and is an emerging problem in industrialized countries. This virus causes about 20 million infections annually . While Het al. in naturally infected human hepatocytes  A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Alexander Ploss, Ph.D.Guest EditorPLOS PathogensGuangxiang LuoSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogens <span style=\"font-family: \"Noto Sans\", sans-serif; font-size: 12px;\"> orcid.org/0000-0002-7699-2064 </span> ***********************Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1:\u00a0The life cycle of HEV is poorly understood due to lack of robust cell culture model. ORF2 is the viral capsid protein, which could package viral genome and mediate viral entry by engagement with the putative cellular receptor. Interestingly, ORF2 has multiple forms and they play different roles in HEV life cycle. In this manuscript, Hervouet et al constructed a panel of ORF2 mutants in Arginine-Rich Motif (ARM) to delineate the function of ARM motif in regulating ORF2s subcellular localization and host antiviral response. ARM regulates the production of different forms of ORF2 and serves as maturation site of glycosylated ORF2. This study could further deep our understanding of HEV life cycle and its interaction with cell host, however, this manuscript is not well organized, not necessarily long and the experiments are not well-control, other explanations or conclusions can be drawn. In addition, the authors performed lots of experiments by electroporation of viral RNA, instead of viral infection, which could potentially lead to some artifacts of the observation. The specific comments could be found as below.Reviewer #2:\u00a0In their manuscript entitled \u201cAn Arginine-Rich Motif in the ORF2 Capsid Protein Regulates the Hepatitis E Virus Lifecycle and Interactions with the Host Cell\u201d Hervouet et al. use an HEV cell culture model to elucidate the role of ARM on multiple steps of HEV propagation.Utilizing a series of ORF2 mutants expressed either in the p6 HEV strain or as ORF2 capsid protein they delineate a crucial role of the ARM as functional nuclear localization signal which seems to be important for viral production. With the help of specific inhibitors and co-localization studies, the authors identified a CRM1-dependent egress from the nucleus and 3 important nuclear export signals within the ORF2 protein.The main body of the manuscript focusses on the maturation and addressing of ORF2. The authors found evidence for a role of a furin-dependent secretion pathway in the maturation process. With the generation and evaluation of additional mutants including the signal and/or the encoding sequence of CD4 by state-of the art techniques the authors delineate a tight interplay of the ARM with the respective signal peptide for addressing, topology and egress of the capsid proteins. Bringing this data set together the authors finally delineate a model for the generation of the infectious or non-infectious forms of the HEV particles.The manuscript is well written, the experiments are appropriate and on a technically high level. Following on the previous reports from the group this manuscript sheds light into the so far under investigated HEV life-cycle and the generation of the different capsid forms.Overall, this manuscript describes several novelties in the field and sets the ground for several future scientific perspectives concerning HEV.**********Part II \u2013 Major Issues: Key Experiments Required for Acceptanceabsolutely required to validate study conclusions.Please use this section to detail the key new experiments or modifications of existing experiments that should be Generally, there should be no more than 3 such required experiments or major modifications for a \"Major Revision\" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend \"Reject\".Reviewer #1:\u00a01) P6 L114 why the authors choose electroporation of viral RNA genome to observe the ORF2 localization, instead of viral infection? A large amount of viral RNA delivered into the cells by electroporation could produce lots of ORF2, which is not an appropriate model to observe ORF2 localization.2) The authors constructed series of ARM mutants to observe the alterations of ORF2 mutants localization to demonstrate ARM\u2019s NLS function. Also they engineered the mutations accordingly to demonstrate the critical role of ORF2 nuclei localization in HEV life cycle . It has been well known that ORF2 is also responsible to package viral genome to form infectious particles, and it is very possible that the ARM mutation impaired ORF2 function to package viral genome, which is not related to its NLS function. I suspect these mutations affect ORF2 fold or interaction with genomic RNA to cause the phenotype.3) In addition, the authors also need to check the total ORF2 amount in Fig 2C, excluding the possibility that the mutations in ARM affect ORF2 stability. The cellular markers in the WB were required to make sure the quality of isolation of each fraction. For example, there is not nuclei maker (histone protein) in the nuclei extract, which is very important.4) Data presented in Figure 2D show the ORF2 mutants produce less infectious viral particles than WT. As the ORF2 and ORF3 are overlapped, in ORF2 mutants, the amino acid of ORF3 also changed, therefore, more data should be presented to exclude the possibility that this phenotype is caused by ORF3 mutation.5) The authors used multiple inhibitors to block the interested pathway and then analyze the phenotype , and always have the concerns about the specificity of the phenotype in the manuscript. More solid data should be used to support the conclusions.Reviewer #2:\u00a0I have the following major comments.Major:All experiments have been performed with the (sub-)genotype Kernow p6. As the authors also stated in their introduction, several other (sub-)genotypes exist with marked differences in their clinical presentation. Therefore, this study would largely benefit from expanding the range of viruses used. In this regard it would be helpful toI) show by phylogenetic analysis of for example published strains the abundance of ARM as well as NESII) show a similar nuclear pattern for a different GT3 subgenotype as well as another genotype (the published data so far only investigated GT3 infections).The main body of the manuscript is focussing on virus addressing. Some parts are comparable little studied and therefore do not allow as strong statements as have been made in the manuscript. This in particular is the case for the following:I) Page 7, Lines 140-143: \u201cIn addition, high molecular weight formsof ORF2intra in the soluble fraction as well as an increase of ORF2g/c secretion were observed , suggesting a higher translocation into the secretory pathway associated to an improved functionality of ORF2 SP\u201dThis statement seems only to be true for 3R/3A and 5R/5A, not for the 2R/2A construct. The authors should either repeat the experiments to identify significant results or be gentle with the description.II) Page 7, Lines 166-168:\u201dIntracellular titers were alsolowered in SP mutants , indicating that the ORF2 SP likely plays an important role in the assembly of infectious particles.\u201dThe intracellular HEV RNA is already significantly lower for the SP mutants intracellularly and therefore argue for a reduced replication. Overall, this figure would benefit from a positive control (such as ribavirin) and possibly a time-course to ensure a decent measuring window.III) Page 8, Lines 177-179 \u201cInterestingly, ORF2 and Importin-\u03b11 co-localized in the nucleus of infected cells with a Pearson correlation coefficient (PCC) of 0.670, and the mutation of arginine residues drastically reduced this colocalization. Taken together, our results indicate that ORF2 colocalizes with Importin-\u03b11 thanks to its ARM that serves as a functional NLS.\u201dThis seems to be only a moderate co-localization. More work needs to be done to support this assumption such as performing IP experiments to reveal direct interaction.IV) Page 13, Lines 203-207: \u201cAltogether our results suggest that the ORF2 ARM, which notably regulates ORF2 nuclear translocation, is a pivotal viral determinant for the modulation of host pathways and, especially, genes of the NF-\u03baB-induced signalling upon infection. Further studies will be required to define precisely the impact of this HEV-driven host regulation on immune cell responses.\u201dAlthough it seems to be an interesting observation, I agree that the displayed data is too preliminary and should be left out or expanded significantly . Additionally, the time-course of viral replication might be significantly affected depending on whether the construct enters the nucleus or not. Therefore, the analysis at one specific time-point (18h) is difficult to compare. Additionally, mutant delORF3 has not been investigated in the previous experiments in terms of translocation to the nucleus.V) Fig 7/8. Have the authors analysed an additional SP from a different source in terms of its phenotype?**********Part III \u2013 Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1:\u00a01) Fig 1, it is required to present the nuclei staining results.2) Fig 2D needs RdRp inactive (GAD) control.3) P9 L187 whether overexpression of ORF2 can cause similar results on NF-kB-related signaling.4) P10 L230 The phenotype is not consistent among these three mutants, suggesting that there is nothing to do with nuclear localization.5) P13 L287-L289 The localization of ORF2 is also dynamic like infection condition? If not, OE system cannot reflect true functional ORF2 in infection condition.6) Figure 2C. Tubulin of \u0394SP1 is much less than the others, indicating the quality of \u0394SP1 soluble extract is not good.7) Figure 4A and 4D-F. At What time points post-electroporation are the cells treated with inhibitors? Some related descriptions should be added to the legend.Reviewer #2:\u00a0Overall, the study would benefit from additional controls and more detailed analysis in particular in the first part.1) Supplement Figure 6: Please provide data with addition of a positive/cytotoxic control.2) Page 7 Lines 151-155: he PSG/3R mutant showeda marked nuclear localization  but was impaired inORF2g/c secretion , as observed for the SP deletion mutants,indicating that the addition of arginine residues strengthens the NLS function of ARMbut inhibits the functionality of ORF2 SP.To underline this point it would be interesting to perform an additional time-kinetic  to understand and learn where the ORF2 dose eventually reside and if it is retained in the nucleus for a longer period of time.3) Page 14, Lines 231-234, \u201cOf note, intracellular replication wasnot altered by NES mutations , indicating that the loss of infectious particleassembly is due to the differential subcellular localization of the mutants and not to areplication defect.\u201dThis seems counterintuitive. Please provide appropriate replication inhibitor control of the assay. Additionally, this would also benefit from a time-kinetic analysis.4) In line 114 page 6: Titel: \u201cphase of infection\u201d: This is not correct, as the cells were transfected. Therefore, the term replication would be more appropiate.5) Fig 5C convincingly shows that nuclear ORF2 is present in the WT construct. However, for Fig5B this is difficult to judge by eye. In Fig. 2C the nuclear signal is displayed as nuclear fluorescent intensity. However, in the following figures this is delineated as nuclear/cyto intensitiy ratio, which makes a comparison difficult. Please harmonize the display of these results.**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at  19 Apr 2022AttachmentReviewers comments PPATHOGENS-D-21-01762-R1.docxSubmitted filename: Click here for additional data file. 10 Jun 2022Dear Dr. Cocquerel,Thank you very much for submitting your manuscript \"An Arginine-Rich Motif in the ORF2 Capsid Protein Regulates the Hepatitis E Virus Lifecycle and Interactions with the Host Cell\" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a revised version that takes into account the reviewers' comments. We would like you to focus on the major points raised by reviewer 1.Your study is of considerable interest but these remaining points need to be addressed before we can make a final decision on your submission..When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Alexander Ploss, Ph.D.Guest EditorPLOS PathogensGuangxiang LuoSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogens <span style=\"font-family: \"Noto Sans\", sans-serif; font-size: 12px;\"> orcid.org/0000-0002-7699-2064 </span> ***********************Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1:\u00a0The authors added new data in revised manuscript, but the following concerns are still not been addressed.Reviewer #2:\u00a0In their manuscript entitled \u201cAn Arginine-Rich Motif in the ORF2 Capsid Protein Regulates the Hepatitis E Virus Lifecycle and Interactions with the Host Cell\u201d Hervouet et al. use an HEV cell culture model to elucidate the role of ARM on multiple steps of HEV propagation. Utilizing a series of ORF2 mutants expressed either in the p6 HEV strain or as ORF2 capsid protein they delineate a crucial role of the ARM as functional nuclear localization signal which seems to be important for viral production. With the help of specific inhibitors and co- localization studies, the authors identified a CRM1-dependent egress from the nucleus and 3 important nuclear export signals within the ORF2 protein. The main body of the manuscript focusses on the maturation and addressing of ORF2. The authors found evidence for a role of a furin-dependent secretion pathway in the maturation process. With the generation and evaluation of additional mutants including the signal and/or the encoding sequence of CD4 by state-of the art techniques the authors delineate a tight interplay of the ARM with the respective signal peptide for addressing, topology and egress of the capsid proteins. Bringing this data set together the authors finally delineate a model for the generation of the infectious or non-infectious forms of the HEV particles.The manuscript is well written, the experiments are appropriate and on a technically high level. Following on the previous reports from the group this manuscript sheds light into the so far under investigated HEV life-cycle and the generation of the different capsid forms.Overall, this manuscript describes several novelties in the field and sets the ground for several future scientific perspectives concerning HEV.**********Part II \u2013 Major Issues: Key Experiments Required for Acceptanceabsolutely required to validate study conclusions.Please use this section to detail the key new experiments or modifications of existing experiments that should be Generally, there should be no more than 3 such required experiments or major modifications for a \"Major Revision\" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend \"Reject\".Reviewer #1:\u00a01) Subcellular localization of ORF2 does not change obviously during infection condition  compared with electroporation , suggesting that it may be an artifact in electroporation condition due to ORF2 overexpression.2) Fig 2D, there are multiple rounds of infection already, so the phenotype could be due the alterations of ORF3. This concern is not been addressed. According to the result in S7 Fig, the direct conclusion is that deletion of ORF3 don\u2019t impair ORF2 nuclear localization. Our question is how to ensure that the fewer infectious particles produced is indeed caused by ARM mutation rather than ORF3 mutation (ORF2 and ORF3 ORFs are largely overlapped)? To answer this question, I think the possible strategies are as follows: (1) When generating ARM mutation to impair ORF2 nuclear localization in the contents of genomic sequence, please make sure the ORF3 amino acids unchanged. (2) utilize the trans-complementation system to uncouple the expression of ORF2 and ORF3 protein, then investigate the ARM mutation on virus production.3) From the total extract panel in new Fig 2, it is obvious that ORF2 stability is dramatically impaired of \u0394SP1, but the authors didn\u2019t mention it in response.Firstly, in S7 Fig, a WB result is required to show that the deletion of ORF3 is successful. More importantly, this assay  can\u2019t answer our question.Reviewer #2:\u00a0This reviewer feels, that all questions have been adequately adressed by the authors in this revision.**********Part III \u2013 Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1:\u00a01) Please check primers to construct 5R/5A mutation. It seems to be wrong.Reviewer #2:\u00a0This reviewer feels, that all questions have been adequately adressed by the authors in this revision.**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at  15 Jul 2022AttachmentPLoS-Patho-R2-Comments.pdfSubmitted filename: Click here for additional data file. 6 Aug 2022Dear Pr Cocquerel,We are pleased to inform you that your manuscript 'An Arginine-Rich Motif in the ORF2 Capsid Protein Regulates the Hepatitis E Virus Lifecycle and Interactions with the Host Cell' has been provisionally accepted for publication in PLOS Pathogens.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Alexander Ploss, Ph.D.Guest EditorPLOS PathogensGuangxiang LuoSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogens <span style=\"font-family: \"Noto Sans\", sans-serif; font-size: 12px;\"> orcid.org/0000-0002-7699-2064 </span> ***********************************************************Reviewer Comments :Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1:\u00a0The authors performed additional experiments to address reviewers questions. Most of the concerns and questions have been addressed.**********Part II \u2013 Major Issues: Key Experiments Required for Acceptanceabsolutely required to validate study conclusions.Please use this section to detail the key new experiments or modifications of existing experiments that should be Generally, there should be no more than 3 such required experiments or major modifications for a \"Major Revision\" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend \"Reject\".Reviewer #1:\u00a0(No Response)**********Part III \u2013 Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1:\u00a0(No Response)**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158X\u200bMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064"}
{"text": "In this retrospective cohort study, we examined whether the concentration of indoor PM2.5 affected pregnancy outcomes. Additionally, we evaluated biomarkers of pregnancy-related complications caused by fine dust. We collected clinical information and data based on residential addresses from the Air Korea database to assess PM2.5 exposure levels. As a multicenter prospective cohort study, we measured the indoor PM2.5 concentration and inflammatory and oxidative stress markers. The PM2.5 concentration of the low-birth-weight (LBW) delivery group was 27.21 \u03bcg/m3, which was significantly higher than that of the normal-birth-weight (NBW) group (26.23 \u03bcg/m3) (p = 0.02). When the newborns were divided by sex, the PM2.5 concentration of the LBW group was 27.89 \u03bcg/m3 in male infants, which was significantly higher than that of the NBW group (26.26 \u03bcg/m3) (p = 0.01). In the prospective study, 8-hydroxy-2-deoxyguanosine significantly increased in the high-concentration group ; in the high-concentration group, the rates of preterm birth (PTB) and small size for gestational age significantly increased . This study showed an association between PM2.5, oxidative stress, and fetal growth, with the PTB group being more vulnerable.Particulate matter 2.5 (PM Low birth weight , small for gestational age , and preterm birth  are complications of pregnancy that directly affect the prognosis of newborns ,5,6,7. T2.5, particles with an aerodynamic diameter of \u22642.5 \u03bcm), one of the major air pollutants, has been reported to be associated with various adverse pregnancy outcomes [2.5 and LBW, PTB, and SGA infants have been reported [2.5 and pregnancy outcomes [Particulate matter (PM) 2.5  modeling system. PM2.5, from CMAQ modeling data, was estimated using meteorological research and forecasting models comprising three overlapping weather data sources at 3, 9, and 27 km for a specific time period. PM2.5 exposure levels during pregnancy were determined based on residential address . For each address, daily PM2.5 concentrations were matched to each individual according to their delivery date. Each individual\u2019s outdoor air quality data were collected for each pregnancy trimester, extending to data from the week of delivery. PM2.5 data were collected from 2009 to 2015, depending on the pregnancy period of the study participants. The first study was a hospital-based retrospective cohort study of 1880 pregnant women who delivered live babies between 2010 and 2015 at the Ewha Womans University Mokdong Hospital (EUMC 2020-07-043). We collected information on maternal age; body mass index (BMI); gestational age at birth (GAB); neonatal sex; weight and height at birth; appearance, pulse, grimace, activity, and respiration (APGAR) score; and place of residence at the time of delivery. The Air Korea database was used for PMt-test (We stratified the groups by birth weight and height and performed Student\u2019s t-test a. LBW waA multicenter prospective cohort study of air pollution in pregnant women (APPO) was conducted to investigate the effects of PM on mothers and fetuses by recruiting > 1200 participants between January 2021 and December 2023 in seven university hospitals across Korea. Each hospital was located in a metropolitan area, an industrial complex, or a mountainous area. The participants were singleton pregnant women with no underlying diseases before 28 weeks of gestation. In the second study, 333 women who had delivered were selected as participants b. We colThis study was approved by the Ethical Research Committee of Ewha Womans University Mokdong Hospital (EUMC 2021-04-032), Yonsei University Severance Hospital (4-2021-0414), Kangwon National University Hospital (KNUH-B-2021-04-012-008), Keimyung University Dongsan Medical Center (2021-04-073), Korea University Guro Hospital (2021GR0233), Ewha Womans University Seoul Hospital (2021-04-022), and Ulsan University Hospital (2022-04-020). All participants provided written informed consent.2.5 concentration was measured by placing a fine dust meter at breathing height in the living room of a pregnant woman\u2019s house. An AirGuard K  instrument was used for measurements using the sensor-based method. The indoor PM2.5 was measured online at 1-min intervals. The measured indoor PM2.5 data were stored in an indoor air quality monitoring platform (IAQ Station) using Long-Term Evolution. Measurements were performed for at least 1 week, and the measured concentration values were recorded in real time using the Internet of Things and Information and Communication Technology. For indoor PM2.5, after removing outliers, the average value of measurements for each trimester of pregnancy was derived, and the average of the two or three trimesters was defined as PM2.5. The participants were divided according to the PM2.5 exposure level as follows: <10 \u00b5g/m3 (low PM2.5 group) and \u226510 \u00b5g/m3 (high PM2.5 group) concentration groups, which are the World Health Organization\u2019s annual limit standard concentrations .The indoor PM2.5 concentrations were collected from a nearby urban atmospheric measurement network based on the residential addresses of the study participants. The Urban Air Monitoring Station data used in this study were obtained from the Air Korea database (https://www.airkorea.or.kr/web (accessed on 1 May 2021)) of the Korean Ministry of the Environment. Outdoor PMWe collected 5 mL maternal venous blood and 15 mL urine. Blood and urine samples were collected at regular follow-up visits. Whole blood samples collected in ethylenediaminetetraacetic acid tubes were transferred to cryotubes, and urine was stored in one cryotube. Samples were transferred to the institution  on the same day as collection under refrigeration to prevent deterioration (\u221280 \u00b0C). The oxidative stress markers 8-hydroxy-2-deoxyguanosine (8-OHdG) and malondialdehyde (MDA) were measured in urine samples collected during the second trimester of pregnancy. The collected urine samples were transported directly to the laboratory and stored at \u221280 \u00b0C before processing. The urine samples were filtered with a 0.2-\u00b5m filter  for the assay and diluted at 1:20 to measure the concentration of 8-OHdG using enzyme-linked immunosorbent assay (ELISA) kits . The concentration of MDA in urine was measured using an MDA ELISA kit . Among the inflammatory markers, the WBC count was measured using an XN-9000  according to the manufacturer\u2019s protocol, from the participant\u2019s whole blood sample, through an automated complete blood cell count. The hs-CRP level was measured using a particle-enhanced immunoturbidimetric assay according to the manufacturer\u2019s protocol using a Cobas 8000 C702 analyzer . t-test or Mann\u2013Whitney U test. Logistic regression model was used to estimate the associations between LBW and PM2.5 exposure (1 \u03bcg/m3) in each trimester with adjustment for covariates . Statistical significance was defined as p < 0.05. All statistical analyses were performed using the Statistical Package for the Social Sciences . Clinical characteristics were analyzed according to continuous variables (age and BMI) and categorical variables . Pregnancy outcomes were analyzed according to continuous  and categorical variables . Pregnancy complications were defined using the following criteria  and analyzed as categorical variables. Oxidative stress (8-OHdG and MDA) and inflammatory markers (hs-CRP and WBC count) were analyzed as continuous variables. Categorical variables were expressed as frequencies (percentages) and analyzed using chi-square and Fisher\u2019s exact tests. Continuous variables were expressed as means \u00b1 standard deviations (SDs) and were compared using the p < 0.01); however, there were no significant differences in maternal age, pre-pregnancy BMI, and neonatal sex , but there was no significant difference in female infants  and 311 had LBW. The two groups showed significant differences in GAB, birth weight, height, and APGAR scores  and preterm low birth weight (PLBW) groups showed significant differences between the first and second trimesters, respectively , with more significant differences in the male group  of 1.06   a. The cop = 0.02, r2 = 0.010)   b. There = 0.010) . There w= 0.010) . The mea = 0.01) .2.5 and LBW was confirmed through a retrospective cohort study, and its effect was found to be more pronounced in the male and PTB groups. Furthermore, a multicenter prospective cohort study revealed the relationship between PM2.5 and birth height, SGA, and PTB by measuring the actual indoor PM2.5. The oxidative stress marker 8-OHdG, which was used to explore the pathogenesis of these pregnancy complications and identify biomarkers, showed a positive correlation with PM2.5. In this study, the association between PM2.5 and fetal growth and PTB [2.5 affects fetal growth, the effects of oxidative stress, placental inflammation or dysfunction, endothelial dysfunction, and blood coagulation have been reported [2.5 measurement. Our results are similar to those of previous studies that showed an association between PM and PTB ,28,29,30reported ,19. The reported ,32. Manyreported ,11,13, w2.5 remains controversial [2.5, especially in male infants. To understand the sex differences, it is necessary to understand the biological mechanisms underlying PM2.5 [2.5 actually affects fetal growth to continuously recruit participants in the future. Several studies have shown that male fetuses are vulnerable to intrauterine growth restriction ,33 and Poversial ,16,33, tng PM2.5 . Male feng PM2.5 . Anotherng PM2.5 , which ang PM2.5 ,38. The 2.5 and environmental pollutants and oxidative stress, this study showed a relationship between PM2.5 and 8-OHdG levels [2.5 exposure. In particular, urine samples have the advantage that they can be collected from patients non-invasively, and since 8-OHdG shows high stability in urine, it can be used as a biomarker [Similar to previous studies showing the relationships between PMG levels . In brieG levels . The resiomarker . By veriiomarker . PM not iomarker ,43. 2.5 measurements were performed in the residences of pregnant women for at least 1 week, and it is thought that this can give causality to the biological mechanism of any relationship between PM2.5 and a disease. The results of this study, using correlation analysis between indoor and outdoor PM2.5, explain that outdoor conditions significantly affect indoor air quality; however, the correlation can be explained by only 18.7% influence. This indicates that the indoor air quality can be affected by various human activities, including smoking and cooking [2.5 increases in preparation for actual outdoor PM2.5. We plan to conduct further research on active intervention measures to prevent pregnancy complications. Most existing studies have estimated fine dust exposure concentrations based on differences in air quality by region and location ,11,28,44 cooking ,17, ther2.5 concentrations between Cohorts I and II, either because of the air pollution reduction effect owing to the COVID-19 lockdown [In this study, there was a difference in PMlockdown  or becau2.5 concentrations. It was also the first study to measure oxidative stress and develop fine dust exposure evaluation indicators in pregnant women with actual indoor PM2.5 measurement.To our knowledge, this was the first study to examine the relationship between fine dust and fetal growth in pregnant Korean women with continuously measured indoor PMThe strength of this study was that it was a prospective multicenter cohort study that investigated the maternal and fetal health effects of PM on pregnancy in patients from various regions of South Korea. Compared with a previous study that measured only outdoor data, it was more reasonable to confirm the causal relationship between fine dust and pregnancy complications through fine dust concentrations measured using individual indoor air quality values. 1.0, and their health effects; however, this study focused on PM2.5 and did not analyze other air pollutants.However, this study had several limitations. Although we measured the indoor fine dust concentrations of the participants for at least 1 week, there was a limitation in that the cumulative concentration during the entire pregnancy could not be calculated. Moreover, other stressful conditions that may affect pregnancy complications, including alcohol abuse and infection, were not considered. Recent, various studies have reported on air pollutants, including PM2.5 and 8-OHdG was observed, but no correlation with actual complications was found. Therefore, in the future, we will recruit more participants and make efforts to calculate the cumulative concentrations of fine dust in pregnant women and evaluate the biological mechanisms of 8-OHdG as a biomarker. Moreover, various stressful conditions that can be confounding variables in pregnancy outcomes should be included, and the impact of other air pollutants should be considered during the analysis.A correlation between PM2.5 and LBW through a retrospective cohort study, and its effect was found to be more pronounced in the male and PTB groups. Furthermore, through a multicenter prospective cohort study, we determined the relationships between PM2.5 and birth height, SGA, and PTB by measuring the actual indoor PM2.5. The oxidative stress marker showed a positive correlation with PM2.5, suggesting its potential as a biomarker for PM2.5 exposure. However, further research on the actual mechanisms of action, efficacy, and relevance to pregnancy outcomes is needed. Furthermore, we will continue to identify interventions to lower indoor PM levels.This study confirmed the association between PM"}
{"text": "Glossina species from Cameroon, Chad and Nigeria.Tsetse flies are cyclical vectors of African trypanosomiasis. They have established symbiotic associations with different bacteria, which influence certain aspects of their physiology. The vector competence of tsetse flies for different trypanosome species is highly variable and is suggested to be affected by various factors, amongst which are bacterial endosymbionts. Symbiotic interactions may provide an avenue for the disease control. The current study provided the prevalence of 3 tsetse symbionts in Sodalis glossinidius, Spiroplasma sp and Wolbachia using specific primers. A total of 848 tsetse samples were analysed: Glossina morsitans submorsitans (47.52%), Glossina palpalis palpalis (37.26%), Glossina fuscipes fuscipes (9.08%) and Glossina tachinoides (6.13%). Only 95 (11.20%) were infected with at least one of the 3 symbionts. Among the infected, 6 (6.31%) were carrying mixed infection (Wolbachia and Spiroplasma). The overall symbiont prevalence was 0.88%, 3.66% and 11.00% respectively, for Sodalis, Spiroplasma and Wolbachia. Prevalence varied between countries and tsetse species. No Spiroplasma was detected in samples from Cameroon and no Sodalis was found in samples from Nigeria.Tsetse flies were collected from five different locations and dissected. DNA was extracted and polymerase chain reaction PCR was used to detect the presence of Spiroplasma in tsetse in Chad and Nigeria. These findings provide useful information to the repertoire of bacterial flora of tsetse flies and incite to more investigations to understand their implication in the vector competence of tsetse flies.The present study revealed for the first time, the presence of infection by  Trypanosoma. The disease exists in two forms: The human African trypanosomiasis or sleeping sickness and the animal African trypanosomiasis. In humans, the disease is caused by two subspecies of Trypanosoma brucei: Trypanosoma brucei rhodesiense responsible for the acute form of the disease in eastern and southern Africa, while Trypanosoma brucei gambiense is responsible for the chronic form of the disease in western and central Africa [2 are still at risk of T.b. gambiense infection [Trypanosoma congolense, Trypanosoma vivax, Trypanosoma simiae, Trypanosoma uniforme, Trypanosoma godfreyi, Trypanosoma brucei brucei and Trypanosoma grayi. They cause pathogenic infections in cattle, sheep, goats, pigs, dogs, camels and horses [Trypanosomiasis is one of the major endemic diseases in sub-Saharan Africa. It is caused by trypanosomes, an extracellular flagellated protozoan parasite of the genus l Africa . Approxinfection . The anid horses -5. The dPalpalis, the savannah Morsitans and the forest Fusca [Trypanosomes are cyclically transmitted between different vertebrate hosts by tsetse flies (Diptera: Glossinidae). Thirty-one species and subspecies of tsetse flies have been described. They can be grouped into three groups or subgenera based on common characteristics and morphology due to bio-ecological and genetic similarities: the riverine st Fusca , 7. Theyst Fusca .Tsetse gut harbours a diversity of bacteria acquired from the environment or maternally transmitted . PreviouWigglesworthia glossinidia, Sodalis glossinidius, Wolbachia sp, and Spiroplasma sp that was recently established as the fourth tsetse symbiont in G. fuscipes fuscipes, G. tachinoides, and G. palpalis palpalis [Tsetse flies have established long-term associations with four vertically transmitted endosymbiotic bacteria including palpalis . They shWiggleworthia glossinidia, the primary and obligate endosymbiont. It resides intracellularly within the bacteriome in the anterior midgut and also found extracellularly in milk gland of the fly [Wiggleworthia glossinidia provides dietary supplements absent from the fly\u2019s vertebrate blood-restricted diet, supports larval development and contributes to maturation of the adult immune system [All tsetse flies house  the fly . Wigglewe system , 14.Wolbachia endosymbionts are obligatory intracellular bacteria belonging to the Order Rickettsiales. Wolbachia infects a broad range of arthropod and filarial nematode species and is probably the most prevalent endosymbiont found in insect germlines [Wolbachia, 17 supergroups (A to Q) are currently recognized based on sequences of the five conserved genes fbpA, coxA, ftsZ, gatB, coxA, and hcpA and the amino acid sequences of the four hypervariable regions of the Wsp protein [ermlines . Within  protein , 15. The protein .Wolbachia resides mainly in reproductive tissues and is maternally transmitted from generation to generation by trans-ovarian transmission. They are also transferred horizontally among arthropods. Wolbachia infection in the tsetse host results in a variety of reproductive abnormalities such as parthenogenesis, male killing, feminization and cytoplasmic incompatibility [In tsetse, tibility -18.Wolbachia infection status: when an infected male mates with an uninfected female or a female infected with a different strain of the bacterium [Glossina morsitans has been associated with the induction of cytoplasmic incompatibility [Cytoplasmic incompatibility results in embryonic mortality in the progeny derived from matings between insects with different acterium . The pretibility . This efWolbachia infections limited mosquito-transmitted pathogens including dengue virus, chikungunya virus, Plasmodium parasites, yellow fever virus, Zika virus and filarial nematodes [Some studies have shown that ematodes -22.Sodalis glossinidius. It is a gramnegative organism belonging to the Enterobacteriaceae family. It is widely spread in numerous tissues of the fly  and can be found both intracellularly and extracellularly [Sodalis genome consists of one circular chromosome of 4.17 Mbp, three extrachromosomal plasmids designated pSG1, pSG2, and pSG3, as well as a phage, \u0424SG1. However, its genome sequence shows reduced coding capacity with a large number of pseudogenes [Sodalis glossinidius can be transmitted maternally via haemolymph, milk gland secretions, and horizontally during mating [The tsetse\u2019s secondary and facultative symbiont is the commensal llularly . The Sodudogenes . Sodalisg mating , 25. In g mating .Spiroplasma belongs to the Mollicutes class, and the Tenericutes phylum. Spiroplasma are found abundantly in insects either in the gut or haemolymph where they have developed a large variety of interactions with the host that can be classified as commensal, pathogenic or mutualist [The genus utualist .Spiroplasma confers protection against pathogens e.g Drosophila neotestacea from a nematode [Drosophila hydei against a parasitoid wasp Leptopilina heterotoma [Spiroplasma [It has been shown that nematode , the peanematode  and Drosterotoma . Howeverroplasma .Spiroplasma has been established as a new class of tsetse symbiont in G. fuscipes fuscipes, G. tachinoides, and G. palpalis palpalis. The interactions between Spiroplasma and Glossina seem to be beneficial because of its ability to extend lifespan and reduce the vector competence for Trypanosoma [Recently, panosoma , 30.Current control measures against trypanosomiasis are mainly based on chemotherapy. In the absence of effective vaccine and to address the limitations associated with chemotherapy, disruption of trypanosomes transmission through vector control is crucial. Transmission of pathogens by vector depends on its vector competence, which can be affected by several factors, including vector endosymbionts . Due to Sodalis, Spiroplasma and Wolbachia in wild population of tsetse flies from Cameroon, Nigeria and Chad.The present study aims to investigate the presence of Glossina morsitans submorsitans: 403 (47.52%); Glossina palpalis palpalis: 316 (37.26%); Glossina fuscipes fuscipes: 77 (9.08%); Glossina tachinoides: 52 (6.13%)). For this study, 848 tsetse fly samples from three countries  were used. They belonged to four Glossina species (Wolbachia-Spiroplasma)Out of 848 flies, 95 (11.20%) were infected with at least one of the 3 endosymbionts. Among the infected, 6 (6.31%) were carrying mixed infection , Chad (259) and Nigeria (270) using a Sodalis Hemolysin gene-based PCR. The Sodalis infection rates were 2.01% in Cameroon, 1.16% in Chad and 0.0% in Nigeria  with other tic tree  showed tSpiroplasma using a 16S rRNA-based PCR approach with wspecF/wspecR primers. Only 31 samples were positive (3.66%). The prevalence varied significantly (p = 0.00) between countries , Chad (423) and Nigeria (270) were used for the molecular detection of ountries . SpiroplSpiroplasma 16S rRNA partial gene sequences found in NCBI database. The Maximum Likelihood phylogenetic tree (The sequence of our amplicons showed a high identity (> 99%) with other tic tree  showed tWolbachia with a 16S rRNA-based PCR approach using the wspecF/wspecR set of primers. The samples were collected in 3 countries . The results of the screening  between the three countries. The Wolbachia prevalence in Cameroon, Chad and Nigeria was 9.68%, 7.00% and 14.07% respectively.A total of 582 tsetse samples (gut or abdomen) were screened for the presence of creening  showed tWolbachia 16S rRNA partial gene sequences found in NCBI database. The Maximum Likelihood phylogenetic tree (The sequence of our amplicons showed a high identity (> 99%) with other tic tree  showed tOQ448931 to OQ448937 and OQ458709 to OQ458712.All 16S rRNA and hemolysin gene sequences generated in this study have been deposited into GenBank under accession numbers G. tachinoides flies that were not infected by S. glossinidius  in G.p. palpalis (6.35%) and G. tachinoides (5.77%) compared to G.m. submorsitans (1.49) and G.f. fuscipes (2.60%). For Wolbachia, the prevalence was significantly lower (p = 0.005) in G.m. submorsitans (4.79%) compared to other fly species.All the 4 species were found to be infected at different rates by the three symbiotic bacteria except sinidius . There wWolbachia infection was significantly related (p = 0.017) to G. tachinoides.When the collection site is considered , there was no significant difference in symbiont prevalence among the three tsetse species in Lac Iro. However, in Yankari collection site, the Owing to their restricted source of meal, the vertebrate blood, tsetse flies are highly dependent on their microbial flora which provide them with complementary nutrients . SymbiotSodalis, Spiroplasma and Wolbachia) were detected in 11.20% of the tsetse samples examined with varying prevalence within countries, collection sites and tsetse species. This overall symbiont infection rate is lower compared to that of other previous studies [In this study, tsetse symbiotic bacteria  was lower than the 9.0% previously reported in the same area [G.p. palpalis while the previous study screened G. tachinoides and G. m. submorsitans. Up to date in Nigeria, there is no published data on S. glossinidius prevalence in tsetse flies.The overall ountries . Howeverame area . The preame area . The varame area . MoreoveS. glossinidius has been suspected to be involved in vector competence of tsetse fly. But the confirmation is still under debate. Numerous reports showed a positive association between Sodalis and trypanosome establishment in the midgut possibly through lectin-inhibitory activity involving the production of N-acetyl glucosamine [Sodalis and that of Trypanosome [The presence of cosamine , 38, 40.panosome -37.Spiroplasma general infection rate of 3.66% obtained in the present study is much lower than 17.17% and 44.5% reported respectively in Burkina Faso for G. tachinoides and in Uganda for G. f. fuscipes [G. f. fuscipes [Spiroplasma in tsetse flies in Africa. Up to date, there is no existing data on tsetse Spiroplasma prevalence in the 3 countries where our samples were collected.The fuscipes , 41. Thefuscipes . The preSpiroplasma is known to induce reproductive abnormalities and pathogen protective phenotypes in various arthropods hosts [Spiroplasma with trypanosome infection was found in G. f. fuscipes, indicating that Spiroplasma infections may have an important effect in fly\u2019s resistance to infection with trypanosomes [G. f. fuscipes, it was discovered that Spiroplasma infection induced changes in sex\u2013biased gene expression in the reproductive tissues, adepletion in the availability of nutrients in pregnant females resulting in delayed larval development, and compromised sperm fitness. These findings indicate that Spiroplasma could be exploited for reducing tsetse population size and therefore, the disease transmission [ds hosts . A negatanosomes , 42. In Wolbachia global prevalence of 11.00% and countries prevalence  gene. The comparison of results generated by 16S rRNA and wsp primers by [Wolbachia infection in tsetse flies in Nigeria.The evalence  obtainedectively . In Cameectively , 38. Theimers by  did not Wolbachia has received increased interest in recent years because of its high rates of distribution in a wide range of arthropods and nematodes, its unique effects on host physiology and its potential in disease control. Concerning trypanosomiasis, there is no confirmed implication of Wolbachia in tsetse vector competence. Investigations on the tripartite association between tsetse fly, Wolbachia and trypanosomes reported contrasting results. When in G. f. fuscipes, it was found a negative association between Wolbachia and trypanosome [Wolbachia; some experimental studies did not find an association between the presence of Wolbachia and the ability of tsetse flies to harbor trypanosomes [panosome  suggestianosomes , 37, 43.Spiroplasma was found to infect the 4 Glossina species, but with a low infection on G.m. submorsitans and G.f. fuscipes. On the contrary, the investigations by [Spiroplasma infection only in palpalis group and nothing in the morsitans and fusca groups attributing this result to their frequent infection with Wolbachia which may have led to the development of competitive exclusion with Spiroplasma. Wolbachia was detected in all the 4 species with varying prevalence within species. This variation agrees with findings from similar studies on tsetse symbionts. In the present study, G. tachinoides was found to be more infected with Wolbachia than the 3 other tsetse species. Sodalis was not found in G. tachinoides. However, Sodalis is found to be infecting G. tachinoides in other studies [tions by  found Sp studies , 36.Spiroplasma in tsetse in Chad and Nigeria. The infection rates of Sodalis, Spiroplasma and Wolbachia varied between countries and collection sites probably because of environmental factors. Few tsetse flies harboured symbiont co-infections. These findings provide useful information to the repertoire of bacterial flora of tsetse flies and incite to more investigations to understand the implication of these symbiotic bacteria in the vector competence of tsetse flies. More data could help the development of environmentally friendly methods for both tsetse and trypanosomiasis control.The present study revealed for the first time, the presence of infection by Tsetse flies used in this study were collected from three countries: Cameroon, Chad, Nigeria .In Cameroon flies were trapped in Dodeo (Latitude 7\u00b0 27.994\u2019 N and Longitude 12\u00b0 04.101\u2032 E) located in the \u201cFaro et D\u00e9o\u201d division of the Adamawa region. The village is close to the Cameroon-Nigeria Border. The vegetation is predominantly characterized by gallery forest along rivers and the climate type is of Sudano-Sahelian with two seasons: A rainy season from May to October and a dry season from November to April. This area has a dense hydrographic network and offers pastures for livestock , 36.In Chad, flies were collected in Maro and Lake Iro areas, all situated in the Moyen-Chari province in southern Chad. The area has a climate of Sudano-Sahelian type with two seasons of equal duration. A rainy season from May to October and a dry season from November to April. Lac Iro is situated between the Latitude 9\u00b059\u2019 N and Longitude 19\u00b026\u2032 E, along the Salamat River. The vegetation is dominated by floodplains and dense forests containing shrubs. The area is considered as a buffer zone of the Zakouma national park where domestic and wild animals can meet . Maro  are regular [In Nigeria, flies were collected in Yankari and in Ija-Gwari. Yankari Game Reserve (9\u00b045.240\u2019N and 10\u00b030.448E) is situated in the south-central part of Bauchi State in the North-East of the country. It covers an area of 2244 km regular .Biconical traps were used for this study. They were set up in various tsetse fly-favourable biotopes at distances of at least 100 m intervals. Tsetse flies were collected once a day and transported in cool boxes to the base camp. The collected flies were identified using morphological identification keys , 48, numFlies were dissected in a drop of sterile saline solution as described by , 46. TheWings were stored dry for geometric morphometrics. Legs, proboscis and salivary glands were preserved in nucleic acid preservation agent  in 1.5 mL cryotubes. Gut tissue was homogenised in 200 \u03bcL of 50 mM Tris-Cl, pH 9.0, using four 2.38 mm metal beads . Fifty microliters of the homogenate were added to 500 \u03bcL of NAPA.Most of the flies from Chad were dead. For this reason, after the removal of wings, legs and proboscis, the entire abdomen was transferred in ethanol.DNA was extracted from homogenised gut tissue in NAPA with the DNeasy Blood and Tissue Kit  according to the manufacturer\u2019s instructions with slight adjustments (100 \u03bcL of homogenate were used for purification and 100 \u03bcL elution buffer were used at elution step).For the dead flies from Chad, DNA was extracted from the abdomen using 5% Chelex-100 Resin . Briefly, the abdomen was transferred from ethanol to a new 1.5 mL centrifuge tube and allowed to dry. The abdomen was then crushed using the micro-pipette tips. Thereafter, 100 \u03bcL of chelex 5% solution were added. The mixture was vortexed and incubated at 56\u00b0 C for 30 min in a Thermomixer. After this incubation, the mixture was vortexed and incubated for an additional 5 min at 95\u00b0 C. The mixture was then mixed thoroughly before brief centrifugation at 7000 rpm for 1 min and stored at \u221220\u00b0C.Wolbachia was carried out by amplifying a 438 bp fragment of the 16S rRNA gene with the 16S W-Spec primers (The detection of  primers  designedPCR amplifications were performed in 20 \u03bcL reaction mixture containing 1 X DreamTaq buffer (10X), 150 \u03bcM dNTPs, 0.2 \u03bcM of each primer, 0.5 U of Dream Taq polymerase and 2 \u03bcl of template DNA. The cycling condition was as described by. It started by 95\u00b0C for 5 min followed by 35 cycles of 95\u00b0C for 30 s, 30 s at 54\u00b0C, 1 min at 72\u00b0C and a final extension step of 72\u00b0C for 10 min. After amplification, the PCR products were analyzed by electrophoresis on a 1.5% agarose gel containing Stain-G and visualized under UV light.S. glossinidius was determined by PCR with Hem primers . Five microliters were visualised on 1.5% agarose gel for confirmation of the amplification. The remaining 45 \u03bcL PCR products were separated on 2% agarose gel. The amplicons bands were extracted and purified using GeneJET Gel Extraction Kit (Thermo Scientific) according to manufacturer instructions. The purified amplicons were sent for sanger sequencing to a commercial company .Obtained sequences were manually checked and edited using Geneious Pro version 5.5.9 software. The Basic Local Alignment Search Tool (BLASTn) from National Center for Biotechnology Information (NCBI) was used to confirmed the identity of the amplicons and to determine the closest related sequences in the GenBank.Wolbachia and Spiroplasma, then Hasegawa-Kishino-Yano model [Sodalis as determined by the MEGA model finder tool with 1000 bootstraps replicates.Sample sequences and reference sequences obtained from NCBI were aligned using MUSCLE alignment tool with its default setting implemented in MEGAX  which wano model  for Soda2) was used to compare symbiont prevalences between countries and collection sites. The differences were considered significant when the p-values were lower than 0.05. Statistical tests were performed using SPSS for Windows, version 20.Endosymbionts hosted by tsetse flies were expressed in percentage as symbiont prevalence. The Pearson\u2019s chi-square test (\u03c7"}
{"text": "This dataset focuses on NLP tasks, as a model that serves and delivers a satisfactory response to a user's query. We obtained data from a well- known dataset known as \u201cThe Ubuntu Dialogue Corpus\u201d for the purpose of constructing our dataset. Which consists of about one million multi-turn conversations containing around seven million utterances and one hundred million words. We derived a context for each dialogueID from these lengthy Ubuntu Dialogue Corpus conversations. We have generated a number of questions and answers based on these contexts. All of these questions and answers are contained within the context. This dataset includes 9364 contexts, 36,438 question-answer pairs. In addition to academic research, the dataset may be used for activities such as constructing this QA for another language, deep learning, language interpretation, reading comprehension, and open-domain question answering. We present the data in raw format; it has been open sourced and publicly available at  Specifications Table\u2022This is a dataset for question answering that is created using the chat logs or conversation histories of users. It is unique because it is the only dataset that uses user dialogues.\u2022The dataset is a valuable resource for training and testing chatbots and chat analysis algorithms in NLP research and related fields, as well as for improving the performance of conversational AI systems in businesses.\u2022The dataset can also be used by students to learn and practice NLP approaches, and by anyone interested in NLP and AI to explore various techniques.\u2022By modifying this dataset, it can be utilized for the development of language models in other languages, such as 'Bengali,' as well as in other domains.\u2022This dataset also can be used in Reading Comprehension tasks. To understand the contexts and find the answers based on questions.1Our dataset is derived from a popular dataset, The Ubuntu Dialogue Corpus is composed of about one million talks extracted from the Ubuntu chat logs, which were used to acquire technical help for a variety of Ubuntu-related issues 2A chatbot is a robot that responds with relevant responses to customer questions. Chat analysis is the process of evaluating a conversation or collecting relevant information, as well as monitoring the behaviour or sentiment of users. A valuable question-response dataset is required for the development of a chatbot and a chat analysis model. In light of this, we have derived a QA dataset from a primary dataset, The Ubuntu Dialogue Corpus. This Ubuntu Dialogue Corpus dataset only covers multi-turn conversations between people Our created dataset is available in a data repository at mendeley data and there is a folder called Dataset. In this Dataset folder there are four different files. These four files are test_data.csv, test_data_json_file.json, train_data.csv, train_data_json_file.json.Our dataset is shown to be represented in two different data formats, the first of which is data formatted in CSV, and the second of which is data formatted in JSON, as seen in figure-01. The Train section of each of these files has a total of 29,150 question-answer pairs and a total of 7323 context pairs. The Test section files contain the question-answer pairs and context. There are a total of 7288 question-answer pairs and a total of 2041 contexts in the Test section The names of the columns with brief explanations of their contents of the CSV files of the dataset are found in table-01. The names of these columns are dialogueID, which is the unique identifier of the conversation, Context, which contains the overall conversation that has been contributed by multiple users, QuestionID, which is the unique identifier for both Questions and Answers, Answer start, and Answer end, which are the starting and ending indexes of the Answer for the Question.In our dataset 3The source of the raw data that we collect is the \"Ubuntu Dialogue Corpus,\" which consists of almost one million conversations between more than one person extracted from the Ubuntu chat logs and used to receive technical support for various Ubuntu-related problems 3.1We are testing our datasets in Hugging Face transformers pre-trained model fine tuning using pytorch with two different models Bidirectional Encoder Representations from Transformers (BERT) Our dataset is trained using two different transformer-based models derived from Hugging Face. The metrics that they use for evaluation are presented in Sabbir Hosen: Software, Validation, Data curation, Investigation, Writing \u2013 original draft, Visualization. Jannatul Ferdous Eva: Validation, Data curation, Investigation, Writing \u2013 original draft, Visualization. Ayman Hasib: Validation, Data curation, Investigation, Writing \u2013 original draft, Visualization. Aloke Kumar Saha: Supervision, Writing \u2013 review & editing, Project administration. M.F. Mridha: Supervision, Writing \u2013 review & editing, Project administration. Anwar Hussen Wadud: Writing \u2013 review & editing.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
{"text": "The resulting radiolabeled mAb ([177Lu]Lu-CHX-A\u2033-DTPA-7F5) was characterized both in vitro and in vivo. It showed a high radiochemical purity (>95%) and stability. The labelling did not affect its binding capability. Biodistribution studies showed a high specific tumor uptake compared to most non-targeted tissues in mice bearing PSCA-positive tumors. Accordingly, SPECT/CT images revealed a high tumor-to-background ratios from 16 h to 7 days after administration of [177Lu]Lu-CHX-A\u2033-DTPA-7F5. Consequently, [177Lu]Lu-CHX-A\u2033-DTPA-7F5 represents a promising candidate for imaging and in the future also for radioimmunotherapy.Prostate specific membrane antigen (PSMA) is an excellent target for imaging and treatment of prostate carcinoma (PCa). Unfortunately, not all PCa cells express PSMA. Therefore, alternative theranostic targets are required. The membrane protein prostate stem cell antigen (PSCA) is highly overexpressed in most primary prostate carcinoma (PCa) cells and in metastatic and hormone refractory tumor cells. Moreover, PSCA expression positively correlates with tumor progression. Therefore, it represents a potential alternative theranostic target suitable for imaging and/or radioimmunotherapy. In order to support this working hypothesis, we conjugated our previously described anti-PSCA monoclonal antibody (mAb) 7F5 with the bifunctional chelator CHX-A\u2033-DTPA and subsequently radiolabeled it with the theranostic radionuclide  However, each of these techniques has its limitations Lu-CHX-A\u2033-DTPA-7F5, we determined its in vitro properties and biodistribution in mice. Moreover, we performed single photon emission computed tomography (SPECT)/CT. According to the presented data, [177Lu]Lu-CHX-A\u2033-DTPA-7F5 represents a promising candidate for imaging and radioimmunotherapy of PCa.In the present study, we conjugated the previously described full size murine anti-PSCA-specific IgG1 mAb 7F5  with theAfter purification of the anti-PSCA mAb 7F5 from hybridoma supernatant by protein A affinity chromatography, dialyzed elution fractions were analyzed by SDS-PAGE A. As expD value of 10.5 \u00b1 4.0 nM . As positive cytotoxic control served a treatment with Triton X-100 (2.5%). Viability was estimated using the MTS assay as described under 177Lu-labeling, p-SCN-Bn-CHX-A\u2033-DTPA was used to couple the chelating moiety CHX-A\u2033-DTPA to primary amino groups of the anti-PSCA mAb 7F5 via its isothiocyanate functional group. MALDI-ToF-MS analyses and HPLC-SEC profiles indicated a successful conjugation of the chelator to the anti-PSCA mAb 7F5. MALDI-ToF-MS analysis of untagged and CHX-A\u2033-DTPA-tagged mAb 7F5 showed comparable MS profiles  resulting from excess p-SCN-Bn-CHX-DTPA from the coupling reaction was readily removed by the following centrifugation steps. Finally, a radio-HPLC-SEC was used to detect radiolabeled mAb-aggregates or fragments and to determine the radiochemical purity (RCP). The HPLC profiles of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 showed a main peak at a retention time of around 11 min before and after three spin filtration steps while [177Lu]Lu-CHX-A\u2033-DTPA eluted around 16 min . The uptake increased 32.4% and 44.8% after 24 h and 48 h, respectively  suggests an initial hepatobiliary and renal elimination route at equal parts  of blood reached 6.6 , liver, and spleen decreased over time, uptake of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 significantly increased in PC3-P  and PSCA-negative PC3 cells (PC3). In contrast to another previously reported anti-PSCA mAb (1G8) Lu-CHX-A\u2033-DTPA-7F5. The data measured in PBS, cell media and human serum suggest a high stability of [177Lu]Lu-CHX-A\u2033-DTPA-7F5. These data are in line with other 177Lu-labeled Abs conjugated with the CHX-A\u2033-DTPA moiety Lu-CHX-A\u2033-DTPA-7F5 was slightly decreased. This could be caused by the random coupling of the chelating moieties in case coupling happened in the antigen-binding region. Still the remaining functional portion of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 is in the range of other CHX-A\u2033-DTPA-mAb-conjugates labeled with 177Lu [177Lu]Lu-CHX-A\u2033-DTPA-7F5 does not destroy its high binding affinity with a KD of about 30 nM. Most important, there was only a specific binding to PSCA-overexpressing PC3 cells but no binding to PSCA-negative PC3 cells as measured by flow cytometry and finally supported by the SPECT imaging mouse data. Although there was a slight loss of affinity compared to the unlabeled anti-PSCA mAb 7F5, the remaining binding affinity is just in the range that is considered to be favorable for tumor-targeting IgG antibodies since very high binding affinities of radioimmunoconjugates  might be associated with low penetration efficiency and limited diffusion rate into tumors due to the so-called binding site barrier effect, which can reduce the therapeutic efficiency LuCl3  was purchased from ITM . Radiolabeling of CHX-A\u2033-DTPA-7F5 with 177Lu was achieved by mixing about 50 MBq of the radionuclide solution with the same volume of 0.05 M HEPES  to obtain a pH between 5 and 6. Then, the solution was added to 1 nmol of CHX-A\u2033-DTPA-7F5 conjugate and allowed to react for 60 min at 37 \u00b0C. An amount of 1 nmol CHX-A\u2033-DTPA was added in order to complex free 177Lu for 10 min at 23 \u00b0C. The reaction mixture was then separated via spin filtration with a 30 kDa MWCO Amicon Ultra-0.5 mL centrifugal filter (Merck).Non-carrier added [177Lu in the [177Lu]Lu-CHX-A\u2033-DTPA-7F5 preparation was determined by using instant thin layer chromatography (iTLC) with a silica gel-impregnated glass fiber support and a mobile phase of 10 g/L DTPA in H2O  and autoradiographic analysis . Radiochemical purity was determined using SEC-HPLC with a TSKgel SuperSW mAb HR column  and 0.2 M sodium phosphate buffer  as mobile phase at 0.8 mL/min flow. HPLC was performed using a Knauer HPLC-System  with a Ramona detector  for radioactivity flow monitoring.Residual free 177Lu]Lu-CHX-A\u2033-DTPA-7F5 or [177Lu]Lu-p-SCN-CHX-A\u2033-DTPA was mixed 1:10 with PBS, cell medium, or human serum and maintained at 37 \u00b0C. After 1, 24, and 48 h, samples were mixed 1:10 with protein A binding buffer and thereafter absorbed on a pre-equilibrated protein A affinity column. Released radioactive constituents were compared with the bound activity that was then eluted from the column. Ab integrity was further determined using SDS-PAGE  with subsequent autoradiography  and silver staining  of the gel.Approximately 100 kBq of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 was assessed using the method of Lindmo et al. [177Lu]Lu-CHX-A\u2033-DTPA-7F5 for 2 h at 37 \u00b0C, filtered through glass fiber filters , and finally treated with 0.3% polyethylenimine for 90 min using a cell harvester . After washing with ice-cold PBS, the radioactivity accompanied with the cells harvested on individual filter punches was measured using an automatic gamma counter  together with standards containing the total activity. Data were plotted as reciprocal of the cell concentration (X axis) against the quotient of totally applied and bound radiolabeled mAb (Y axis) and fitted with linear regression using the nonlinear regression analysis software GraphPad Prism 8 . The Y intercept value gave the reciprocal of the IRF (%).The immunoreactive fraction (IRF) of Lu-CHX-A\u2033-DTPA-7F5  for 0 h (5 min), 1, 4, 24, and 48 h at 37 \u00b0C, respectively. Adjacent samples received 0.5 to 1 \u00b5M of cold anti-PSCA mAb 7F5 1 h before radioligand application to obtain the non-specific binding. After each time interval, the incubation medium was removed, and the cells were washed three times with ice-cold PBS (containing Mg2+ and Ca2+). Surface-bound activity was stripped with 4 \u00b0C-cold acid-wash buffer  for 5 min. Cytosolic activity was determined after treatment with cell lysis buffer (1% SDS in 0.1 M NaOH) for 30 min at 23 \u00b0C. Cell surface and cytosolic activities were measured separately in a gamma counter.Cells were incubated with [177Lu]Lu-CHX-A\u2033-DTPA-7F5 (0.5 to 70 nM) for 2 h at 37 \u00b0C. Free Ab was removed by washing three times with ice-cold PBS (containing Mg2+ and Ca2+). The cells were detached from the culture dish by incubation with cell lysis buffer for 30 min at 23 \u00b0C. Activity of the cell suspensions was measured in a gamma counter. Specific binding was calculated and normalized to the protein content of the individual samples measured using bicinchoninic acid assay at 562 nm  with a spectral multimode well-plate reader . Data were fitted with the saturation binding model and the KD value was calculated using the nonlinear regression analysis software GraphPad Prism 8.After treating a part of the cell samples with an excess of cold anti-PSCA mAb 7F5 (0.5 \u00b5M) for 1 h to obtain the non-specific binding, all cell samples of a plate were incubated with eight concentrations of Lu-CHX-A\u2033-DTPA-7F5 (molar activity 47 GBq/\u00b5mol) was evaluated in male NMRI nude mice bearing a PC3-P tumor on their flank. An amount of 0.28 \u00b1 0.02 MBq  of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 was administered into tumor-bearing mice via tail vein injection. Organ distribution of [177Lu]Lu-CHX-A\u2033-DTPA-7F5 was measured 1 h and 48 h after injection . The mice were sacrificed under deep anesthesia by heart puncture and cervical dislocation; organs and tissues of interest were excised and weighted. The [177Lu]Lu-CHX-A\u2033-DTPA-7F5 uptake was measured in comparison to three reference samples in a gamma counter and high activity values in a cross calibrated dose counter. The decay corrected activity concentration in organs and tissues was expressed as percent injected dose per g tissue (%ID/g) and standardized uptake value (SUV = (activity in the organ/weight of the organ)/). Accumulated activity counts (%ID) were measured in all fully extractable organs. Intestine and stomach were measured with content (w.c.), and urine plus feces activity was calculated as the difference between the activity recovery and the injected activity.Biodistribution of [177Lu]Lu-CHX-A\u2033-DTPA-7F5  was injected into a lateral tail vain of female NMRI nude mice bearing both PC3 and PC3-P tumors on their flanks under general desflurane anesthesia (10% desfluran in a 30% oxygen/air mixture). SPECT/CT studies were performed between 1 and 144 h after [177Lu]Lu-CHX-A\u2033-DTPA-7F5 injection . Imaging data were presented as maximum intensity projection (MIP). Anatomical reference images were captured before SPECT acquisition using CT-subsystem of the nanoSPECT/CT scanner. Imaging data were reconstructed by Tera-TomoTM 3D SPECT iterative reconstruction (Mediso) using CT images for attenuation correction. The images were prepared using ROVER  and illustrated as MIP.Lu-CHX-A\u2033-DTPA-7F5 via the excretory organs. Due to low, if any, uptake in non-targeted tissues, the 177Lu labeled Ab might be effective in visualizing and treatment, especially of metastases. The stable surface binding of the radiolabeled anti-PSCA antibody 7F5 and its specific accumulation at PSCA-positive tumor sites is favorable for application of the anti-PSCA antibody 7F5 and its radiolabeled derivates for imaging, immunotherapies, endoradionuclide therapies, and combinations thereof.The anti-PSCA mAb 7F5 can be successfully radiolabeled with"}
{"text": "Festuca arundinacea, to year-round warming (+3 \u00b0C) and cool-season drought  in a factorial field experiment to test the hypotheses that: (i) drought and warming increase carbon allocation belowground and shift root traits towards greater resource acquisition and (ii) increased belowground carbon reserves support post-drought aboveground recovery. Drought and warming reduced plant production and biomass allocation belowground. Drought increased specific root length and reduced root diameter in warmed plots but increased root starch concentrations under ambient temperature. Higher diameter and soluble sugar concentrations of roots and starch storage in crowns explained aboveground production under climate extremes. However, the lack of association between post-drought aboveground biomass and belowground carbon and nitrogen reserves contrasted with our predictions. These findings demonstrate that root trait plasticity and belowground carbon reserves play a key role in aboveground production during climate stress, helping predict pasture responses and inform management decisions under future climates.Sustaining grassland production in a changing climate requires an understanding of plant adaptation strategies, including trait plasticity under warmer and drier conditions. However, our knowledge to date disproportionately relies on aboveground responses, despite the importance of belowground traits in maintaining aboveground growth, especially in grazed systems. We subjected a perennial pasture grass,  Drought and warming can reduce forage production by altering belowground carbon allocation. However, a trade-off between belowground production and root trait plasticity can offset negative effects on aboveground plant productivity. Global climate models predict an increase in mean surface temperature ranging from 2.6 \u00b0C to 4.8 \u00b0C by the end of this century, along with an increase in the intensity and frequency of drought conditions . EmpiricfBNPP; belowground net primary production to total plant production ratio)  and nitrogen (N) to root and crown storage. In grasses, the crown is the tissue that joins the roots with the shoots, bears shoot meristems and stores carbon (C) and N reserves . These bAn increase in the intensity and frequency of drought in a future climate is predicted to reduce natural and managed grassland production in many ecoregions by negatively affecting plant physiological functioning . HoweverWarming can limit plant performance either directly by determining the rate of photosynthesis and respiration  and year-round warming (ambient +3 \u00b0C) using a factorial field manipulation experiment, PAstures and Climate Extremes (PACE), at Western Sydney University, Australia. We hypothesized the following. (H1) Both drought and warming reduce plant production (above- and belowground) and standing root biomass while increasing the relative allocation of biomass belowground (fBNPP and RMF). (H2) Fine root traits exhibit plasticity in response to drought and warming, with increasing SRL and decreasing RTD and mean root diameter, reflecting a shift towards more acquisitive trait values that may reduce the effects of climate extremes by promoting soil resource acquisition. (H3) Drought increases and warming decreases belowground storage (NSCs and N), with consequences for post-drought recovery of aboveground productivity. During drought, the senescence of shoots and reallocation of C and N reserves to crowns and roots is expected; however, higher maintenance costs with warming are expected to reduce belowground C storage.A large proportion of temperate grasslands occur in areas that experience temperatures well above their thermal optima for productivity, such that rising temperatures may significantly reduce their growth . In addiThis study was conducted from the austral winter in June 2019 to the autumn of March 2020 at the PACE (PAstures and Climate Extremes) field facility on the Hawkesbury campus of Western Sydney University in Richmond, New South Wales, Australia . This site receives a mean annual rainfall of 806 \u00b1 37 (SE) mm with a large inter-annual variability ranging from 500 mm to 1400 mm over the past 30 years . Summer (December\u2013February) is typically the wettest season, and winter (June\u2013August) is generally the driest. Climate models predict a decrease in cool-season (winter and spring) rainfall under most scenarios, along with an increase in the frequency and severity of drought throughout south-eastern Australia . The meaThe PACE experimental facility consists of six polytunnel shelters constructed from galvanized steel frames and covered with a single layer of polyethylene 180 \u03bcm plastic  to intercept all ambient rainfall. Each shelter is 48 m long \u00d7 8 m wide \u00d7 4.6 m in height, oriented along a SW\u2013NE axis with the open ends facing the direction of the prevailing wind. In addition, the long sides of the shelter are open to a height of 1.5 m to allow free airflow that minimizes shelter effects on microclimate. Each shelter has eight plots (4 m \u00d7 4 m) that are further subdivided into four subplots (2 m \u00d7 2 m each) with different pasture species growing at the subplot level. In each shelter, plots were assigned to drought and warming treatments in a factorial design, which allowed us to evaluate interactions between co-occurring climate treatments and root trait plasticity responses to these treatments by comparing them with control. Plots were established during 2017\u20132018 from seed. This study reports data from the 2019 cool-season drought and the following recovery period. Before sward establishment, the surface soil in each shelter was rotary tilled to a depth of 12 cm to homogenize the upper soil profile. Root barriers  were installed to a depth of 90 cm around all 4 \u00d7 4 m plots to ensure hydrological isolation between treatments. The 2 \u00d7 2 m subplots were separated by a 30 cm deep root barrier  to minimize root intrusion among pasture types. Furthermore, there was a buffer area of 1 m between each plot and 0.5 m between subplots, which included pavers aboveground to enable plot access.3 pasture grass F. arundinacea (Quantum II MaxP cultivar). Festuca arundinacea is native to large regions of Europe, temperate Asia, and North Africa . The following 6 month summer and autumn period represents the post-drought recovery period when all plots received the control irrigation amount. The 60% reduction in the amount of cool-season rainfall represents the upper end of climate model drought predictions for south-eastern Australia at the end of the century under RCP8.5 . We collThe warming treatment  comprised a year-round +3 \u00b0C increase in canopy temperature relative to ambient temperature (aT). Warming was achieved using a heating array that included eight 1000 W ceramic heaters  installed 1.4 m above the ground surface in each heated 4 \u00d7 4 m plot . ExperimEach shelter had data loggers which recorded the real-time environmental conditions under each climate treatment. Time Domain Reflectometers  and soil temperature probes  recorded soil volumetric water content (0\u201315 cm depth) and soil temperature (at 0\u20135 cm), respectively, at 15 min intervals. Air temperature (Series RHP-2O3B) and relative humidity  sensors mounted in force-ventilated radiation shields were installed at 0.6 m height inside and outside shelters to record air temperature and relative humidity, respectively, every 5 min. Quantum sensors  installed inside (3 m height) and outside (6 m height) the shelter recorded photosynthetically active radiation (PAR) at 5 min intervals.\u20132 per 6 months). The harvest method mimics the cell-grazing technique, a form of rotational grazing. During cell-grazing, small paddocks are intensively grazed, followed by a long recovery period , and weighed. The timing of harvests was based on grazing recommendations from the pasture industry, harvesting at the peak of vegetative growth at ~30 cm height (y period . The smaAboveground biomass recovery following the 6 month drought (which ended on 30 November 2019) was measured in mid-March 2020. Post-drought aboveground vegetation was harvested 5 cm above the soil surface, in the same way as harvests during the cool-season drought period. This harvest captured 3.5 months of growth during the summer, where all plots received control precipitation amounts under both warming and ambient temperature. We excluded data from one of the six replicate shelters from aboveground biomass recovery analyses due to the destruction of this shelter during a severe storm at the end of November 2019.\u20132 per 6 months) for each soil depth. However, our open ingrowth cores did not capture root crowns due to their small size. Here we show belowground production data for 0\u201320 cm after summing the two depths. We chose to sample roots at a depth of 0\u201320 cm since the majority (>80%) of root biomass occurred at this depth in our study.BNPP was measured during the 6 month cool-season drought using open ingrowth cores ; root and crown data are presented separately.Standing root biomass was sampled at the end of the 6 month cool-season drought period, in November 2019, at two depths (0\u201310 cm and 10\u201320 cm) using a 5cm diameter soil auger; here we present summed data for 0\u201320 cm depth. Four randomly located soil cores were collected from each replicate plot and pooled to make a composite sample. Root samples were processed as described above. At the same time, root crowns were sampled in a 30 cm \u00d7 30 cm area in a similar position in all fBNPP was calculated as the ratio of belowground net primary production to total plant net primary production.The The RMF was calculated as the fraction of plant biomass allocated to roots.f\u00a0BNPP and RMF do not include crown biomass.\u20131) was calculated as the ratio of root length to root dry mass, and RTD (g cm\u20133) as the root dry mass to the root volume ratio.Washed fine root samples from ingrowth cores were scanned using an Epson Perfection 4990 scanner at 800 DPI  within 24 h of sampling. Scanned images were analysed using Winrhizo\u2122 software  to determine root length, diameter and volume. Scanned root samples were oven-dried (at 70 \u00b0C for 3 d) and weighed. SRL  in plant roots produced during the cool-season drought and in crowns sampled at the end of drought were measured using methanol:chloroform:water extraction and a colorimetric phenol\u2013sulfuric acid assay . In brie\u20132). All statistical analyses were performed using R 4.2.2  function from the \u2018car\u2019 package  in relation to belowground traits.All biomass and productivity data were scaled to dry mass per unit ground area , warming (\u20139%), and their combination (\u201351%), relative to control . SimilarfBNPP although there were no significant interactions between treatments  ; Table 1Here, we addressed a knowledge gap relating to belowground trait plasticity responses to future warmer, drier climates and their relationships to aboveground production using a factorial field experiment. The effects of drought and warming on above- and belowground biomass production and the fraction of biomass allocated to belowground were negative, independent, and thus additive. However, the combined effects of drought and warming resulted in a shift in root trait values towards more acquisitive combinations, notably higher SRL, lower mean diameter and higher N concentrations. Greater mean root diameter and higher root soluble sugar and crown starch concentrations were predictors of plant aboveground production during drought and warming. However, in contrast to our expectations, there were no relationships between post-drought aboveground biomass and pre-existing belowground NSC and N reserves.F. arundinacea. However, the greater drought sensitivity of BNPP relative to ANPP observed in our study supports findings from grassland studies elsewhere . The possible explanations for this response may be an overall reduction in C fixation under warming, and thus a decrease in available C to allocate belowground or increased C loss via belowground maintenance respiration . The observed root trait plasticity, such as an increase in SRL or reduction in mean root diameter, might be due to increased root branching or an increase in the production of first-order roots rich in N driven by lower SWC in the combined drought and warming treatment compared with the warmed (eT\u2013C) plots  plots  (OuimettC) plots . The lacC) plots .F. arundinacea  and higher root N to support metabolic activity might reduce the requirement for C investment in belowground production. Again, the lower root diameter in plots with lower belowground production supports our alternative hypothesis that reduced plant development in the combined drought and warming treatment was the key reason for observed differences in root traits.F. arundinacea , there were no relationships between post-drought aboveground biomass and plot-level crown biomass or crown NSC and N reserves. In addition, these findings were also in contrast to other studies, which have shown the importance of belowground C and N storage in post-drought recovery  mixed plant communities.In conclusion, our findings highlight the sensitivity of The following supplementary data are available at Fig. S1. Climate treatments and environmental conditions under each climate treatment during the experimental period.Table S1. Summary statistics for post-drought recovery biomass from Wilcoxon signed rank test.erad021_suppl_supplementary_fig_S1_table_S1Click here for additional data file."