{"text": "The Arg-Gly-Asp (RGD) cell adhesion sequence occurs in several extracellular matrix molecules known to interact with integrin cell-surface receptors. Recently published crystal structures of the extracellular regions of two integrins in complex with peptides containing or mimicking the RGD sequence have identified the Arg and Asp residues as key specificity determinants for integrin recognition, through hydrogen bonding and metal coordination interactions. The central Gly residue also appears to be in close contact with the integrin surface in these structures.When hydrogen atoms are modelled on the central Gly residue with standard stereochemistry, the interaction between this residue and a carbonyl group in the integrin surface shows all the hallmarks of C\u03b1-H\u00b7\u00b7\u00b7O=C hydrogen bonding, as seen in the collagen triple helix and in many crystal structures of small organic molecules. Moreover, molecular dynamic simulations of the docking of RGD-containing fragments on integrin surfaces support the occurrence of these interactions. There appears to be an array of four weak and conventional hydrogen bonds lining up the RGD residues with main chain carbonyl groups in the integrin surface.The occurrence of weak C\u03b1-H\u00b7\u00b7\u00b7O=C hydrogen bonds in the RGD-integrin interaction highlights the importance of the conserved Gly residue in the RGD motif and its contribution to integrin-ligand binding specificity. Our analysis shows how weak hydrogen bonds may also play important biological roles by contributing to the specificity of macromolecular recognition. The Arg-Gly-Asp (RGD) sequence is one of the most easily recognised motifs in molecular biology . DiscovecRGD) [As a consequence of their role in so many fundamental processes, integrin defects have been implicated in many common diseases, from cancer to pathogen invasion. An ability to block a particular integrin-ligand interaction may be a possible route to the control of certain pathological states, hence it is not surprising that some integrins have become attractive targets for drug design. Understanding the molecular bases of the interaction of integrins with their ligands is therefore essential for effective protein-based design of inhibitors or activators of their function. A milestone was reached in 2002 with the determination of the crystal structure of the extracellular segment of \u03b1V\u03b23 integrin in complex with a cyclic peptide containing the prototypical RGD sequence . In thatcRGD) .cRGD-\u03b1V\u03b23 structure and in the structures of \u03b1IIb\u03b23 in complex with ligand-mimetics . Both H\u03b1 atoms from the collagen Gly residues are in hydrogen bonding position (C\u03b1\u2013H\u03b1\u00b7\u00b7\u00b7O > 90\u00b0), and their C\u03b1-H\u03b1\u00b7\u00b7\u00b7O=C hydrogen bonds adopt a three-centred and bifurcated configuration . Positional errors inevitable at that resolution may affect the precision of the fitting of the cRGD and EFB peptides and the accuracy of the hydrogen bonding geometries for both weak and strong hydrogen bonds. For example, a close look at the salt-bridge interactions between the Arg guanidinium group from the cRGD peptide and two Asp side chains on the \u03b1V integrin surface (Asp150 and Asp218), shows less than \"ideal\" hydrogen bonding orientation, especially for Asp150 (not shown). Yet, the accumulated knowledge of hydrogen bonding geometries in high-resolution crystal structures and their significant variability leaves no doubt about the existence of these strong hydrogen bonds and their contribution to the specificity of binding.An obvious 2 hydrogen bond from ab initio quantum calculations [cRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 structures respectively, even though the accuracy of the values shown in Table cRGD and EFB peptides and the main chain carbonyl group from Arg216 in the integrin surface bear all the characteristics of C\u03b1-H\u03b1\u00b7\u00b7\u00b7O=C hydrogen bonding. This observation is consistent with the exceptionally high frequency of intermolecular Gly-C\u03b1-H\u00b7\u00b7\u00b7O=C hydrogen bonds recently reported in high resolution crystal structures of protein-ligand complexes [A similar level of confidence can be achieved for the Gly-C\u03b1-H\u03b1\u00b7\u00b7\u00b7O=C hydrogen bond by analysing the metrics of equivalent interactions in high-resolution crystal structures of small organic and organometallic molecules. Figure ulations . Figure omplexes .cRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 crystal structures), forming one or two C\u03b1-H\u00b7\u00b7\u00b7O hydrogen bonds that complement the main metal-coordination and salt-bridge interactions from the Asp and Arg side chains.A simple molecular docking analysis further supports the occurrence of Gly-C\u03b1-H\u00b7\u00b7\u00b7O=C hydrogen bonds between RGD-containing ligands and integrin binding sites. In a first set of calculations, an RGD tripeptide was docked into the binding sites of both \u03b1V\u03b23 and \u03b1IIb\u03b23 integrins using constrained molecular dynamics (MD). Two constraints were imposed in the docking calculations: the carboxyl group from the Asp residue had to complete the metal coordination on the \u03b23 subunit, and the Arg side chain had to form a salt bridge with appropriate Asp residues in the \u03b1V and \u03b1IIb subunits (see Methods), as observed in the crystal structures of \u03b1V\u03b23 and \u03b1IIb\u03b23 with different ligand-mimetics. Ten slightly different RGD models were obtained from the NMR structures of the adhesion domain of fibronectin , and wercRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 complexes? A quantitative analysis of C-H\u00b7\u00b7\u00b7O hydrogen bonding at protein-protein interfaces has shown that they have an important contribution to the association and stability of protein complexes, accounting for about one third of the total hydrogen bonding interaction energy [How important are these weak C-H\u00b7\u00b7\u00b7O hydrogen bonds in stabilising the n energy . In factn energy .N-terminal to the conventional N-H\u00b7\u00b7\u00b7O=C hydrogen bond in \u03b2-sheets [N-terminal to the one carrying the N-H donor group, and both share the same C = O group as acceptor, an arrangement sometimes referred as \"bifurcated\" hydrogen bond [N-terminal to the one carrying the N-H donor group is Gly, with one or two H\u03b1 from Gly being in hydrogen bonding position. The bifurcated hydrogen bond scenario also occurs in the cRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 structures, where the N-H group from the Asp residue in the RGD peptide donates a hydrogen bond to the main chain carbonyl group from Arg216 of \u03b23. This hydrogen bond has very bad geometry in the cRGD-\u03b1V\u03b23 structure , but looks better in the EFB-\u03b1IIb\u03b23 structure . These deviations from ideal hydrogen bonding geometry might be consequence of the resolution of the crystal structures, but all the MD docking simulations described above result in N-H\u00b7\u00b7\u00b7O=C hydrogen bonds that are slightly longer  and slightly less linear  than the average hydrogen bonds between peptide groups in protein secondary structures. Automatic computational docking calculations of known integrin ligands on structural models of \u03b1V\u03b23 and \u03b1V\u03b25 consistently predict this N-H\u00b7\u00b7\u00b7O=C hydrogen bond to occur whenever an N-H group is present in the proximity of the carboxylate moiety [The recurrent appearance of some weak hydrogen bonding topologies in many structures of proteins and at protein-protein interfaces also reinforces the notion that they have a significant contribution to macromolecular stability. The most common occurrence of C-H\u00b7\u00b7\u00b7O hydrogen bonds in protein structures is a widespread C\u03b1-H\u00b7\u00b7\u00b7O=C hydrogen bond \u03b2-sheets ,17 and i\u03b2-sheets . In thisgen bond ,27. Thise moiety ,36. Had cRGD and EFB peptides and the \u03b1V\u03b23 and \u03b1IIb\u03b23 surfaces suggests an additional candidate for classification as C-H\u00b7\u00b7\u00b7O=C hydrogen bond, between the C\u03b2-H\u03b2 group from the Asp residue of the cRGD and EFB peptides and the main chain C = O group from Asn215 in the \u03b23 subunit. This weak hydrogen bond is adjacent to the stronger, conventional hydrogen bond between the main chain N-H group from Asn215 and O\u03b42 from the Asp residue in the RGD motif. Thus, a total of four hydrogen bonds, weak and conventional, aligns the bottom of the cRGD and EFB peptides against the integrin surfaces , PDB accession code 1L5G [cRGD or EFB were also maintained. Hydrogen atoms were built with standard stereochemistry for the cRGD and EFB peptides and for the integrin RGD-binding sites as defined above, using the program REDUCE [The following crystal structure coordinates were downloaded from the Protein Data Bank : \u03b1V\u03b23 inode 1L5G ; \u03b1IIb\u03b23 ode 1L5G ; \u03b1IIb\u03b23 ode 1L5G ; \u03b1IIb\u03b23 m REDUCE . For thecRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 structures for guidance. Then each docked model was pulled away to about 10 \u00c5 from the integrin surfaces, and was docked back into the integrin binding site via molecular dynamics (MD) simulations using the program CNS [cRGD-\u03b1V\u03b23 and EFB-\u03b1IIb\u03b23 structures. The side chain of the Asp residue group was restrained to coordinate the bound metal ion in the RGD-binding sites and to receive a hydrogen bond from the amide group of Asn215, in the \u03b23 subunit. The side chain of the Arg residue was restrained to form hydrogen bonds with residues Asp150 and Asp218 on the \u03b1V subunit or residue Asp224 on the \u03b1IIb subunit. Additional restraints were imposed in the MD simulations with the VTGRGDSPAS peptide: the ring of Pro172 was restrained to hydrophobic contact with the side chain of Lys125, in the \u03b23 subunit, and the C\u03b1 atoms of the N- and C-terminal residues in the peptide model were restrained not to separate more than 5 \u00c5 from each other. The coordinates of the integrin binding sites were kept fixed in all the simulations, and only the peptides were allowed to refine by restrained MD and energy minimisation. All molecular models were analysed with the program CHAIN [For the molecular docking calculations, conformational models for RGD and VTGRGDSPAS peptides were obtained from the NMR structures of the adhesion domain in fibronectin . Ten congram CNS . Five siam CHAIN  in a SilA survey in the Cambridge Structural Database  July 20.cRGD, cyclic pentapeptide with sequence Arg-Gly-Asp-D-Phe-N(Me)-Val; EFB, eptifibatide; PDB, Protein Data Bank; CSD, Cambridge Structural Database; MD, molecular dynamics.ECM, extracellular matrix; RGD, Arg-Gly-Asp sequence; J.B. conceived the study and carried out the analysis of the structural data and molecular docking calculations. Both authors participated in the design, coordination and writing of the manuscript. Both authors read and approved the final manuscript."}
{"text": "The structure involves hydrogen bonded layers with apertures stacked along the  Hydrogen bonded organic structures have emerged to become an important area of research because of the wide variety of fascinating structural features as well as properties exhibited by them. Of the many interesting hydrogen bonded systems, those formed by cyanuric acid and melamine are specially interesting. Thus, cyanuric acid forms hydrogen bonded adducts with melamine,  4,4'-bipRod-shaped crystals of the 1:1 molecular complex of melamine and uracil were obtained by the slow evaporation of an equimolar solution of the two compounds in methanol at room temperature. The crystal data was collected on a Bruker-Nonius diffractometer with Kappa geometry attached with an APEX-II CCD detector. The intensity data were processed using SAINT  softwarea and b axes. Such an arrangement of the chains gives rise to an aperture structure as shown in a and b directions. We show one perspective in a-direction. It is interesting to note that melamine engages in hydrogen bonding utilizing all the donor-acceptor sites, much the same way it does in the cyanuric acid adduct. [The crystal structure determination gave the asymmetric unit as shown in  adduct.  However,In conclusion, we have illustrated the molecular recognition process of melamine with nucleobase uracil. We have also established the presence of channels, in the three-dimensional supramolecularly hydrogen-bonded structure of this adduct.File 1The data provided represent the structural and refinement details of the melamine-uracil crystal."}
{"text": "Trimethoprim  is an antifolate drug. It selectively inhibits the bacterial dihydrofolate reductase (DHFR) enzyme.1) and trimethoprim-hydrogen adipate (2), one of the N atoms of the pyrimidine ring is protonated and it interacts with the deprotonated carboxylate oxygens through a pair of nearly parallel N-H...O hydrogen bonds to form a fork-like interaction. In the compound 1, the pyrimidine moieties of the TMP cations are centrosymmetrically paired through a pair of N-H...N hydrogen bonds involving 4-amino group and the N (N3) atom of the pyrimidine rings to form a 8-membered hydrogen bonded ring [R22(8)]. The 4-amino group of one TMP moiety and 2-amino group of another TMP moiety (both moieties are members of a base pair) are bridged by the carbonyl oxygen of the phthalate moiety through N-H...O hydrogen bonds forming 8-membered hydrogen-bonded ring [R22(8)]. The characteristic hydrogen-bonded rings observed in the structure aggregate into a supramolecular ladder consisting of a pair of chains, each of which is built up of alternate TMP and hydrogen phthalate ions. In the compound 2, two TMP cations and two hydrogen adipate anions are arranged about an inversion center so that the complementary DDAA  arrays of quadruple hydrogen-bonding patterns are formed. The head-to-tail arrangement of the hydrogen adipate ions leads to a hydrogen-bonded supramolecular chain. From crystal engineering point of view, it is interesting to note that the compound 1 has a hydrogen-bonded network remarkably identical with its aliphatic analogue, trimethoprim hydrogen maleate. Similarly the compound 2, resembles its homolog trimethoprim hydrogen glutarate.In the crystal structures of trimethoprim (TMP)-hydrogen phthalate (In the crystal structure of trimethoprim hydrogen phthalate, the hydrogen-bonded network is remarkably identical with its aliphatic analogue, trimethoprim hydrogen maleate. Similarly in the crystal structure of trimethoprim hydrogen adipate the hydrogen bonded network resembles its homolog trimethoprim hydrogen glutarate. Non-covalent interactions are the essential tool for both crystal engineering and supramolecular chemistry \u20134. SupraThe hydrogen-bonding networks in the crystal structures of TMP/pyrimethamine salts of various dicarboxylic acids have been investigated in our laboratory ,21. Rece1 & 2 is shown in 1  and 2 (trimethoprim hydrogen adipate)see  one of tpate)see  hydrogen1 (22(8)] [21(4)]  . The ato (22(8)] , trimeth (22(8)] , pyrimet (22(8)]  etc,. Th (22(8)] . The one [21(4)] .2 \u00b0 and 119.6(2)\u00b0 respectively, the corresponding angle in the neutral trimethoprim(TMP) molecule [1 and 2 the dihedral angles between the plane of the pyrimidine and phenyl rings are 74.0(7)\u00b0 and 88.8\u00b0 respectively. These values are closer to the crystal structures of TMP-sulfate trihydrate [The internal angles at N1 (C2-N1-C6) in the protonated pyrimidine ring of the compounds molecule  being 11ihydrate  (75.8(9)ihydrate  (89.1(1)gauche-gauche-trans (ggt) and the gauche-trans-trans (gtt) forms, respectively. Of the 46 adipic acid fragments present in the Cambridge Crystallographic Data Base [ggt conformation [gtt form [syn orientation so that they can fasten the 2- and 4-amino groups of the TMP molecule. The disorder, on the other hand, might result from incompatible dimensions between the adipic acid and the two amino groups of the TMP molecule. Much better fit between the 2- and 4-amino groups of the TMP molecule on one side, and aliphatic dicarboxylic acid on the other side is achieved in the case of glutaric acid [The major (77%) and minor (23%) components in the disordered hydrogen adipate molecule adopt quite unusual bent carbon chain conformations: the ata Base  there isormation  and two gtt form \u201335. The ric acid . This is1 and 2 the corresponding torsion angles adopt the values -161.4(1) and 63.5\u00b0, and 69.1(2) and 36.5(3)\u00b0, respectively. Hence the observed TMP conformations match the two most densely populated conformations observed in other crystal structures containing the TMP moieties.The TMP molecule can be regarded as having a rigid frame, built on the methyl group, on which the substituted phenyl and pyrimidine six-membered rings are free to rotate. An arbitrary conformation of this molecule can be described by the torsion angles of the two rings to the frame. We define these torsion angles as C4-C5-C7-C8 and C5-C7-C8-C9, i.e. with respect to one of the rings the other can rotate around the C5-C7 or around the C7-C8. 1, the ionized and non-ionized carboxyl groups are inclined at an angles of 6.0(1)\u00b0 and 9.0(1)\u00b0 respectively to the plane of the phenyl ring. The bond angles of C19-C17-O4, C19-C17-O5 in the carboxyl group are 119.1(2)\u00b0 and 120.7(17)\u00b0 respectively. The similar angles at the carboxylate group C20-C18-O6 and C20-C18-O7 are 120.4(2)\u00b0 and 117.4(2)\u00b0 respectively. These values are comparable with the crystal structure of pyrimethamine hydrogen phthalate [2, the bond angles at carboxylate group, C18-C17-O5 and C18-C17-O4 are 120.1(2)\u00b0 and 116.5(2)\u00b0 respectively, whereas the angle at the carboxyl group C21-C22-O6, C21-C22-O7 are 123.1(2)\u00b0 and 113.1(2)\u00b0 respectively.In the compound hthalate . In the 2 is further stabilized by two C-H...\u03c0 interactions [The crystal structure of compound ractions  [C16-H16File 1the CIF informationFile 2experimental details"}
{"text": "The limited fossil fuel prompts the prospecting of various unconventional energy sources to take over the traditional fossil fuel energy source. In this respect the use of hydrogen gas is an attractive alternate source. Attributed by its numerous advantages including those of environmentally clean, efficiency and renew ability, hydrogen gas is considered to be one of the most desired alternate. Cyanobacteria are highly promising microorganism for hydrogen production. In comparison to the traditional ways of hydrogen production , Cyanobacterial hydrogen production is commercially viable. This review highlights the basic biology of cynobacterial hydrogen production, strains involved, large-scale hydrogen production and its future prospects. While integrating the existing knowledge and technology, much future improvement and progress is to be done before hydrogen is accepted as a commercial primary energy source. Its advantages as fuel are numerous: it is eco-friendly, efficient, renewable, and during its production and utilization no COenerated . By the Gloeocapsa alpicola under sulphur starvation shows increased hydrogen production [Arthrospira (Spirulina platensis) can produce hydrogen (1 \u03bcmole H2/12 hr/mg cell dry weight) in complete anaerobic and dark condition [Anabaena cylindrica, produces hydrogen and oxygen gas simultaneously in an argon atmosphere for 30 days in light limited condition [Cycas revoluta  and Zamia furfuracea showed a significant in vivo hydrogen uptake [Anabaena sp. is able to produce significant amount of hydrogen. Among them nitrogen-starved cells of Anabaena cylindrica produces highest amount of hydrogen (30 ml of H2/lit culture/hour). Hydrogenase-deficient cyanobacteria Nostoc punctiforme NHM5 when incubated under high light for a long time, until the culture was depleted of CO2 shows increase in hydrogen production [Cyanobacteria form a large and diverse group of oxygenic photoautotrophic prokaryotes, many of which have the ability to produce hydrogen Table . Hydrogeoduction . Arthrosondition . Anotherondition . Symbiotn uptake . Anabaenoduction .Nitrogenase and it is found in the heterocysts of filamentous cyanobacteria when they grow under nitrogen limiting conditions. Hydrogen is produced as a byproduct of fixation of nitrogen into ammonia. The reaction consumes ATP and has the general form:Cyanobacteria are photoautotrophic microorganisms -23 that nifD and nifK, \u03b1 and \u03b2 respectively) and the other is dinitrogenase reductase . Dinitrogenase is a \u03b12\u03b22 heterotetramer, having molecular weight of about 220 to 240 kDa respectively, breaks apart the atoms of nitrogen. Dinitrogenase reductase is a homodimer of about 60 to 70 kDa and plays the specific role of mediating the transfer of electrons from the external electron donor (a ferredoxin or a flavodoxin) to the dinitrogenase [A Nitrogenase enzyme consists of two parts:one is dinitrogenase  [hoxFUYH) and it can either take up or produce hydrogen. Uptake hydrogenase enzymes are found in the thylakoid membrane of heterocysts from filamentous cyanobacteria, where it transfers the electrons from hydrogen for the reduction of oxygen via the respiratory chain in a reaction known as oxyhydrogenation or Knallgas reaction. The enzyme consists of two subunits. The hupL-coded protein is responsible for the up taking hydrogen and the smaller subunit that is coded by hupS looks after the reduction affair. The hydrogen formed is usually re oxidized by an uptake hydrogenase via a Knallgas reaction and hence there is no net H2 production in strains with uptake hydrogenases under ambient conditions. So it is counterproductive when the goal is to produce hydrogen on a commercial scale. The reaction catalyzed by the uptake hydrogenase takes the following form:The other hydrogen-metabolizing/producing enzymes in cyanobacteria are y hupSL) , has thebidirectional or reversible hydrogenase, is poorly understood and thought to control ion levels in the organism. Reversible hydrogenase is associated with the cytoplasmic membrane and likely functions as an electron acceptor from both NADH and H2 [+ reducing type consisting of a hydrogenase dimmer coded by hoxYH gene. Maturation of reversible hydrogenases requires the action of several auxillary proteins collectively termed as hyp  [The biological role of H and H2 . The revH and H2 ,35. Molend hypB) . Unlike Hydrogen photo evolution catalyzed by nitrogenases or hydrogenases can only function under anaerobic conditions due to their extreme sensitivity to oxygen. Since oxygen is a byproduct of photosynthesis, organisms have developed the following spatial and temporal strategies to protect the enzyme from inactivation by oxygen, these are:(a) Heterocyst-containing cyanobacteria physically separate oxygen evolution from nitrogenase activity by segregating oxygenic photosynthetic activity in vegetative cells and nitrogenase activity in heterocystis with reduced oxygen-permeability  and(b) Non-heterocystous cyanobacteria separate oxygen-evolution from nitrogenase activity by performing these functions during light and dark periods respectively .Important parameters for hydrogen production: Efficiency of hydrogen production depends on several factors or parameters that are more critical when hydrogen production is aimed at a large scale.Various parameters influence hydrogen production in different ways, a few selected parameters are presented with examples:A. Environmental conditions: Several environmental conditions such as light, temperature, salinity, nutrient availability, gaseous atmosphere play a role in hydrogen production. Requirement of different cyanobacterial species are different for optimum hydrogen production.Arthrospira platensis) produces hydrogen under anaerobic conditions, both in the dark and in the light [Synechococcus PCC7942 occurs under in the dark under anaerobic condition [Spirulina platensis can produce hydrogen optimally at 32\u00b0C in complete anaerobic and dark condition [Anabaena variabilis ATCC 29413 and in its mutant PK84 [Anabaena variabilis PK84 with air containing 2% CO2 was stimulated by light [Nostoc muscorum is catalyzed by nitrogenase more hydrogen is produced in this strain in the light than in the dark [Anabaena cylindrica, produces hydrogen under an argon atmosphere for 30 days in light limited (luminous intensity 6.0 W/m-2) and 18 days under elevated light (luminous intensity 32 W/m-2) [Anabaena cylindrica for a prolonged period under light limited condition occurs in the absence of exogenous nitrogen [2 to 60 W/m2 [I) Light: Although most cyanobacterial species preferentially absorb red light near 680 nm , light rhe light  but sevehe light . Hydrogeondition . Spiruliondition . The higthe dark . Anabaen2 W/m-2) . Continunitrogen . The effnitrogen . Nitroge 60 W/m2 .Nostoc cultured at 22\u00b0C showed higher rates of hydrogen production than at 32\u00b0C [Nostoc muscorum SPU004 showed optimum hydrogen production at 40\u00b0C [Anabaena variabilis SPU 003 on the other hand show optimum hydrogen production at 30\u00b0C [II) Temperature: The optimum temperature for hydrogen production for most cyanobacterial species is between 30\u201340\u00b0C and varies from species to species of cyanobacteria. For example,  at 32\u00b0C , while N at 40\u00b0C . Anabaen at 30\u00b0C .+ ions from within the cells or prevention of Na+ influx [III) Salinity: Salinity does effect hydrogen production by cyanobacteria . In gene+ influx .Anabaena variabilis SPU003 is highly sensitive to Co, Cu, Mn, Zn, Ni, Fe ions and shows no hydrogen production at concentrations below 10 mM for these ions [Anabaena cylindrica grown with 5.0 mg of Ferric ions per liter produce hydrogen at a rate about twice that of culture with 0.5 mg of Ferric ions per liter [IV) Micronutrients: Trace elements such as cobalt (Co), copper (Cu), molyblednum (Mo), zinc (Zn), and nickel (Ni) effects hydrogen production . Many ofese ions . A cultuer liter .V) Carbon source: Carbon sources are also known to influence the hydrogen production considerably by influencing nitrogenase activity . PresencAnabaena variabilis SPU003 and Anabaena cylindrical [Anabaena cylindrical ammonium addition (0.2 mM NH4+) at a given time point eventually suppresses hydrogen production, but periodic addition of lower amounts (0.1 mM ammonium chloride) do not inhibit hydrogen evolution [Anabaena cylindrica culture, oxygen production gets dominated with the incremental addition of ammonium chloride (from 0.1 mM to 0.5 mM) [VI) Nitrogen source: Several inorganic nitrogenous compound influence hydrogen production rates in many ways. Nitrite, nitrate and ammonia have been reported to inhibit nitrogenase in indrical ,46. Geneindrical . Althougvolution  while otvolution . In Anab 0.5 mM) . The hyd 0.5 mM) .VII) Molecular nitrogen: Molecular nitrogen is a competitive inhibitor for hydrogen production and removal of molecular nitrogen if often very necessary for hydrogen production. Hydrogen production may be considerably inhibited in presence of molecular nitrogen .VIII) Effect of oxygen on hydrogen production: Due to their extreme sensitivity to oxygen, hydrogen photo evolution catalyzed by nitrogenases or hydrogenases can function only under anaerobic conditions  As oxygeGloeocapsa alpicola and Synechocystis PCC 6803). It is possible to inhibit the oxygenic photosynthesis and enhance hydrogen production by incubating the cynobacteria in nutrients that lack sulfur [IX) Effect of sulfur on hydrogen production: Sulfur starvation enhances the rate of hydrogen production in several cyanobacterial species  Effect of Methane: Increased hydrogen production (up to four times) is observed in lination .B. Intrinsic factors affecting hydrogen production: There are several intrinsic factors such as genetic components or sensitive proteins in cyanobacteria that may affect hydrogen production.I) Presence of uptake hydrogenase and decreased hydrogen yield: The net hydrogen yield is affected in strains containing uptake hydrogenase. Much of the produced hydrogen is lost due to the activity of the uptake hydrogenase . KnockinII) Sensitivity of hydrogenase and nitrogenase to molecular oxygen: The molecular oxygen acts as an inhibitor for hydrogenase and nitrogenase. However, innovative technical interdisciplinary solutions, as described below, are now available to reduce or eliminate presence of molecular oxygen and increase yield of hydrogen .a) With the advances in nanotechnology it has become possible to build semi-permeable membranes around the organisms. An example is a membrane that discriminates by size with an active transport system . NanotechydS and hydL from Thiocapsa roseopersicina into sensitive organisms may help reducing the oxygen sensitivity [b) Problem to oxygen sensitivity can also be addressed by using sulfur stress phenomenon to down-regulate photosynthesis as described before. This creates the anaerobic conditions required for hydrogen production. This problem may also be addressed by engineering the native hydrogenase. Engineering oxygen-tolerant hydrogenase genes, for example, sitivity . An exprsitivity .2 fixation [hetR . Recombinant strains can be created with HetR protein harboring vectors that may allow with variable and controllable heterocyst frequency [III) Heterocystous cyanobacteria are more efficient to produce hydrogen than cyanobacteria with vegetative cells ,51. Thesrequency .Bioreactors are essential for large-scale production of hydrogen. Since light is an essential parameter for cyanobacterial growth so all such bioreactors must be transparent and hence are called photobioreactors ,55. All Several types of bioreactors have been used for hydrogen production. These can be mainly divided into three types of photobioreactors (PBRs): vertical column reactor, tubular type and flat panel photobioreactor. A reactor for photobiological hydrogen production must meet several conditions:1) Photobioreactor should be an enclosed system so that the produced hydrogen may be collected without any loss.2) The reactor design must allow sterilization with convenience and ease.3) To maximize the area of incident light  photobioreactor design should provide high surface to volume ratio.Rhodobactor sp. [(a) Vertical column reactor (air-lift loop reactor and bubble column): Such PBRs consists of a transparent column usually made up of high quality glass and surrounded by a water jacket that while allowing maintenance of the temperature with circulating water allows adequate entry of light. Reactor top has provision for medium inlet and outlets for the gases such as argon and for the hydrogen. Fresh medium is added from a reservoir from above the PBR ,58. Micrctor sp. ,57,58. T2. Alternately red light emitting diode (LED peaking at 665 nm) is used as the light source on one side [(b) Flat panel Photobioreactor: A typical flat-panel PBR consists of a stainless-steel frame and three polycarbonate panels . The reaone side . A membrone side . The pro(c) Tubular photobioreactors: Tubular PBRs consists of long transparent tubes with diameters ranging from 3 to 6 cm, and lengths ranging from 10 to 100 m . The culCyanobacterial hydrogen production is poised to be a very useful commodity provided various effective utilization of the produced hydrogen is devised. There are various applications where the process of biological hydrogen production by cyanobacteria can be well utilized. The examples can be included from food and chemical industries, which employ the process of hydrogenation to produce derivatives that are used as food additives, commodities, and fine chemicals:5 and C4 polyols can be obtained from cheap C6 carbohydrates by oxidative decarbonylation followed by hydrogenation. These polyols blends are useful for the manufacture of polyesters or alkyl resins employed in the manufacture of paints. Sorbitol is another important polyol produced from hydrogenation of glucose, which is used industrially in a variety of physical and chemical processes, . Derivatives are also used in protecting coatings, plasticizers, emulsifiers and detergents.(a) Hydrogenation of cheap carbohydrates into high valued derivatives: High value-added C(b) Hydrogenation of fatty acids: Hydrogenation of fatty acids is used to manufacture margarines, shortenings, and shortening oils. The hydrogenation of oils converts liquid oils into hard fats by adding hydrogen to the fat molecule. Oils can be hydrogenated to varying degrees, depending on the hardness. These fats are desirable for its melting point, allowing for high temperature cooking and frying. Hydrogenation involves the artificial saturation of unsaturated bond(s) present in fatty acids. In the process fatty acids are put under pressure, using hydrogen gas at temperatures of 120\u2013210\u00b0C (248\u2013410\u00b0F) in the presence of a metal catalyst   for six All these process requires the rigorous hydrogenation. If hydrogen produced by cyanobacteria is very economical in comparison to the traditional large-scale hydrogen production. Cyanobacterial hydrogen produced in a photobioreactor can easily be directed to separate compartments containing the substrate for hydrogenation and specific catalysts. Provisions of external heating as well as purifying the products from different contaminants  may be easily provided as well. Hydrogen generated in near vicinity in PBRs will reduce requirement for transport and hazards associated with transport. Apart from hydrogenation, hydrogen is combustible so it can be well applied as a substitute for conventional fuel or may be used in fuel cells to generate electricity.2 in combustion, liberates large amounts of energy per unit weight in combustion, easily converted to electricity, and is an inexhaustible resource. Biological hydrogen production has several advantages over other conventional hydrogen production processes. It requires the use of a simple photobioreactor akin to a transparent closed box, with low energy requirements and it is very cost effective. Electrochemical hydrogen production via solar battery-based water splitting requires the use of solar batteries with high-energy requirements. Low conversion efficiencies of biological systems can be compensated for, by low energy requirements and reduced initial investment costs. The most appealing aspect of the biological hydrogen production is the source of hydrogen, which is nothing but water. With the existing knowledge of bioengineering it possible to obtain sufficient amount of hydrogen that on combustion will liberate energy and therefore could act as a substitute of coal in several operations [3) is much lower compared to that produced by photovoltaic splitting of water ($170/m3) [Hydrogen gas is seen, as a future energy carrier by virtue of the fact that it does not evolve the \"greenhouse gas\" COerations . Reporte$170/m3) . Though 2 Carbon dioxide; ATP Adenosine triphosphate; NOx Nitrogen oxides; Mo Molybdenum; Fe Iron; V Vanadium; PBR Photo bioreactor; H2 Hydrogen; O2 Oxygen; N2 Nitrogen; NADP Nicotinamide Adenine di nucleotide Phosphate; Ni Nickel; Co Cobalt; Cu Copper; Zn Zinc; Mn Manganese; Na+ Sodium ion; CH4 Methane; C4 Four carbon compounds; C5 Five carbon compounds; C6 Six-carbon compounds.ADP Adenosine di-phosphate; CODD and DD collected and read the papers and prepared a rough skeleton of manuscript. SC co-directed and supervised the work. SKB directed and prepared the final manuscript."}
{"text": "An important element in homology modeling is the use of rotamers to parameterize the sidechain conformation. Despite the many libraries of sidechain rotamers that have been developed, a number of rotamers have been overlooked, due to the fact that they involve hydrogen atoms.We identify new, well-populated rotamers that involve the hydroxyl-hydrogen atoms of Ser, Thr and Tyr, and the sulfhydryl-hydrogen atom of Cys, using high-resolution crystal structures (<1.2 \u00c5). Although there were refinement artifacts in these structures, comparison with the electron-density maps allowed the placement of hydrogen atoms involved in hydrogen bonds. The \u03c72 rotamers in Ser, Thr and Cys are consistent with tetrahedral bonding, while the \u03c73 rotamers in Tyr are consistent with trigonal-planar bonding. Similar rotamers are found in hydrogen atoms that were computationally placed with the Reduce program from the Richardson lab.Knowledge of these new rotamers will improve the evaluation of hydrogen-bonding networks in protein structures. One important conformational parameter of a protein structure is the sidechain \u03c7 torsion angle . In crysDue to the difficulty in placing hydrogen atoms in protein electron density maps, it has long been customary to omit hydrogen atoms in reporting the crystal structure of a protein. However, Richardson and co-workers showed that positions of hydrogen atoms in high-resolution crystal structures can be confidently projected from the topology of the heavy atoms . The proOne of the reasons why the projection of hydrogen atoms works so well is that the positions of most of the sidechain hydrogen atoms are stereo-chemically restricted. For example, the H\u03b2 atom of Val can only adopt one tetrahedral-bonding position off the C\u03b2 position given that 3 other C atoms are also bound to C\u03b2. For other hydrogen atoms, symmetry between equivalent methyl-hydrogen atoms results in similar restrictions. For example, in Val, the three equivalent H\u03b31 atoms bound to C\u03b31 saturate the three available tetrahedral-bonding positions at C\u03b31. Nevertheless, there exist four types of sidechain hydrogen atoms in which there is ambiguity in projecting their positions. For instance, in Ser, there are three different ways to place the H\u03b3 atom onto the tetrahedral-bonding positions of the O\u03b3 atom. This freedom is also found in the hydroxyl-hydrogen atoms of Thr and Tyr, and in the sulfhydryl-hydrogen in Cys.As the positions of most of the sidechain hydrogen atoms are so restricted, little attention has been paid to their conformation in crystal structures. However, given the growing number of structures containing hydrogen atoms in the data bank, it has become practical to revisit the question of sidechain hydrogen rotamers for the four classes of ambiguous sidechain hydrogen atoms. The positions of these sidechain hydrogen atoms should be parameterized by \u03c7 torsion angles, and we would like to know if these angles display rotameric preferences. Here, we study the distributions of these \u03c7 torsion angles in three data-sets: (1) high-resolution X-ray structures that contains explicit hydrogen atoms, (2) neutron diffraction structures and (3) structures with computationally-placed hydrogen positions.1AHO, 1DY5, 1JM1, 1M40, 1RW1, 2AXW, 2FDN, 1BXO, 1EUW, 1KQP, 1MUW, 1TT8, 2BF9, 2FFY, 1C75, 1F94, 1L9L, 1O7J, 1UCS, 2CAL, 2H5C, 1CEX, 1GQV, 1LS1, 1RB9, 2AWK, 2ERL.For the first part of the analysis, we use high-resolution X-ray structures that have explicit hydrogen atoms in the Ser, Thr, Tyr and Cys residues. As such, the data-set consists of structures found in the RCSB.ORG website  with resWe first generate the \u03c7-angle distributions of the hydrogen atom positions directly from the coordinates reported in the high-resolution structures Figure . Hydroge0-Fc maps for the hydrogen atoms of the 27 structures in this data-set and discovered that no electron density was observable for any of these hydrogen atoms at normal contour levels of the maps  where the hydrogen atom positions have been carefully refined against the chemistry of nearby atoms.In many cases with high-resolution structures, the hydrogen atoms are not actually refined, but are instead placed automatically. As such their positions can be unreliable. To check this, we carefully inspected the 2FGiven the absence of agreement with the other distributions (below), and incompatibilities with tetrahedral-bonding and trigonal-planar bonding, it must be concluded that in Ser, the two rotamers at \u03c72 = -120\u00b0 Figure  and \u03c72 =0-Fc electron density for the hydroxyl-hydrogen atoms is too weak to be observed at contour levels that are typically used. However, in these high-resolution structures, even at a contour level of \u03c3 = 0, there are regions of the 2F0-Fc map that result in well-defined contours of the molecule. Given that heavy atoms can be clearly distinguished in these maps, in regions where the map is well defined, the position of hydrogen atoms can be determined from density between the donor and acceptor atoms of a hydrogen bond , provided by the Richardson lab , where mIn the structures with Reduce-placed hydrogen atoms, we found an artifact in the surface hydrogen atoms. As there are few neighboring contacts on the surface to help determine the position of hydrogen atoms, many surface hydrogen atoms remain at the default value, resulting in a pronounced peak at 180\u00b0 (data not shown). This peak can be removed if we eliminate surface residues. Furthermore, as the Reduce algorithm uses steric contacts to optimize hydrogen positions, we need to use well-packed hydrogen atoms. Consequently, we only consider buried interior hydrogen atoms, defined as atoms with > 8 neighboring atoms, where a neighboring atom is defined if it is within 3.5 \u00c5 of another atom. We also filter out residues with alternate conformations and atoms where the B-factor > 40. There were hydrogen atoms from 5768 Ser, 5932 Thr, 3645 Tyr and 660 Cys residues in 480 structures. The large size of this data set gives the most reliable statistics.The \u03c7-angle distributions and rotamers were calculated from the Reduce-placed hydrogen atoms Figure . In the Given the robust performance of Reduce, we investigated the position of sulfhydryl-hydrogen atoms in the set of structures provided by the Richardson lab. The hydrogen atoms are considered only if there are no other Cys residues within 4.5 \u00c5 of the SG atom of the Cys in order to avoid disulfide-bonded Cystines. The position of the sulfhydryl-hydrogen in Cys is determined by the \u03c72 = C\u03b1-C\u03b2-S\u03b3-H\u03b3 angle. The Cys \u03c72 distribution show a dominant rotamer at \u03c72 = 181\u00b0 (Figure Data was collected from PDB structures using in-house Python scripts. The distributions in Figure Based on experimental data, we find that certain sidechain torsion angles involving hydrogen atoms have strongly preferred orientations and should thus be considered rotameric. Although there were serious artifacts found in the reported coordinates of high-resolution X-ray structures, reliable hydrogen atom positions could be directly derived from the electron-density maps of hydrogen-bonded hydrogen atoms. The \u03c7-angle distributions of these hydrogen-bonded hydrogen atoms match the distribution of hydrogen atoms that were computationally placed by the program Reduce .BKH carried out the study and drafted the manuscript. DAA provided support and guidance. This work was supported by the Howard Hughes Medical Institute.Manually-fitted hydrogen atoms in high resolution structures. In these high-resolution X-ray structures, the hydroxyl hydrogen atoms were removed if there is no corresponding electron density but if there is sufficient electron density due to hydrogen-bonding, the hydrogen atom position were fitted manually.Click here for fileList of hydroxyl-hydrogen \u03c7 rotamers in high-resolution PDB files. List of the residues used to calculate the hydroxyl-hydrogen \u03c7-angle rotamers in Ser, Thr and Tyr. Data-sets provided for both the manually-placed hydrogen atoms in the high-resolution structures, and the Reduce-placed hydrogen atoms in the Richardson data-set.Click here for file"}
{"text": "A method for rapid model building of \u03b2-sheets at moderate resolution is presented. \u03b2 atoms along the strand averaged over all repeats present in the strand. The \u03b2-strands obtained are then assembled into a single atomic model of the \u03b2-sheet regions. The method was tested on a set of 42 experimental electron-density maps at resolutions ranging from 1.5 to 3.8\u2005\u00c5. The \u03b2-\u00adsheet regions were nearly completely built in all but two cases, the exceptions being one structure at 2.5\u2005\u00c5 resolution in which a third of the residues in \u03b2-sheets were built and a structure at 3.8\u2005\u00c5 in which under 10% were built. The overall average r.m.s.d. of main-chain atoms in the residues built using this method compared with refined models of the structures was 1.5\u2005\u00c5.A method for rapidly building \u03b2-sheets into electron-density maps is presented. \u03b2-Strands are identified as tubes of high density adjacent to and nearly parallel to other tubes of density. The alignment and direction of each strand are identified from the pattern of high density corresponding to carbonyl and C O .One way to look for a specific feature in a map is to use an FFT-based convolution search  Identification of the location of sheets based on the presence of nearly parallel tubes of density.\u03b2 atoms along the strand averaged over all repeats present in the strand.(ii) Identification of \u03b2-strand alignment and direction using the pattern of high density corresponding to carbonyl and C(iii) Assembly of \u03b2-strands into a single model.The result of this process is a model of the \u03b2-sheet portions of the structure. It can be used as a starting point for further model building and map interpretation in combination with a model of the \u03b1-helical portions of the structure. The steps carried out are described in detail below.Our approach for modeling the \u03b2-sheets in an electron-density map of a protein focuses on speed by examining the map for characteristic features of these structures. The method consists of three steps.2.1.a) illustrates a model of an antiparallel \u03b2-sheet and corresponding density at a resolution of 2.5\u2005\u00c5. The first step in our procedure for building \u03b2-sheets is the identification of where strands are located in the electron-density map. At moderate resolution (2.5\u20134\u2005\u00c5) the polypeptide backbone resembles a tube of density and for \u03b2-strands the tubes have only a small amount of curvature. In \u03b2-sheets these strands are arranged in a nearly parallel or antiparallel fashion, with a small  inclination between adjacent strands. To simplify the identification of strands in a map and to make it as rapid as possible, a pair of strands in a \u03b2-sheet is therefore initially considered to consist of two tubes of density that are nearly parallel and that are separated by approximately 4.5\u2005\u00c5 at their closest approach. In this analysis, tubes of density are identified, then pairs of nearly parallel tubes are found and finally the tubes are extended into density, allowing curvature of the tubes.Fig. 1b). All pairs of points that are connected by high density are then identified. The criteria for two points being connected are that (i) the density \u03c1 sampled along the line connecting the points has a value of at least \u03c1max \u00d7 cut1, where \u03c1max is the higher of the densities at the two end points and cut1 typically has a value of 0.5, and (ii) that the mean density \u03c1mean along the line is at least \u03c1max \u00d7 cut2, where the typical value of cut2 is 0.75. These pairs of connected points and the lines connecting them represent the locations and directions of tubes of density that might be \u03b2-strands.Tubes of density are found in the electron-density map by finding points along ridgelines of high density. Firstly, a set of points in the map that are on ridgelines of high density and are separated typically by 2\u2005\u00c5 are identified . The cosine of the angle between the two tubes of density is typically required to be at least 0.5. The distance between the tubes of density is typically required to be 4.5 \u00b1 2.0\u2005\u00c5 at their closest approach. These tubes representing high\u00a0density in the map are then extended into the available density, allowing the curvature of the tubes to match the high density in the map, as illustrated for the two tubes of density identified by red spheres in Fig. 1b). To simplify the analysis, this curvature is only allowed in the direction perpendicular to a line connecting the midlines of the two tubes of density at their closest approach. This direction was chosen because the strands in \u03b2-sheets typically have a curvature that is roughly perpendicular to the plane of the \u03b2-sheets.Next, pairs of nearly parallel tubes of density separated by about 4.5\u2005\u00c5 are identified. This is performed by finding two nearby nearly parallel pairs of connected points (representing two tubes of density) with no high-density connections between the pairs  then the tube of density is discarded as a\u00a0candidate \u03b2-strand position. Otherwise, the score for the tube consists of the mean density along the axis of the tube multiplied by the square root of the length of the tube of density. This is similar to the scoring procedure that we have used previously to evaluate the quality of fit of a model to density  shows a close-up view of a model strand and of the curved axis of the tube of density corresponding to it. In this step the goal is to start with the density map and the points marking the tube of density and to end with a strand fitted into the density. One way to do this would be to model a strand in all possible positions near the axis of the tube of density and find the one that fits the best. We chose instead to use a faster but less comprehensive method in which the density near the curve marking the tube of density is examined for periodic patterns corresponding to the pattern of carbonyl O and C\u03b2 atoms along a \u03b2-sheet.Once tubes of density that could represent \u03b2-strands have been identified as described above, they are each considered individually for their fit to a model of a \u03b2-strand, allowing the curvature of the strand to match the curvature of the tube of density. Fig. 1c) illustrates the features of the electron density that we used in this process. The carbonyl O atoms of the strand in the middle of the figure point alternately up towards the \u03b2-\u00adstrand above it and down towards the \u03b2-strand below it in the figure. The C\u03b2 atoms point alternately into the page and out from it. Note that the C\u03b2 atoms have a specific relationship to the direction of the chain and the positions of the carbonyl atoms: they are located about two-thirds of the distance from one carbonyl to the next going from right to left (N-terminus to C-terminus) along the chain in the middle of Fig. 1c). This relationship is what we use to identify the positioning and direction of the \u03b2-strand.Fig. 1c). Note that the red spheres very nearly coincide with the main-chain atoms of the strand. As the periodicity of the \u03b2-strand is known (about 6.7\u2005\u00c5), it is simple and rapid to average the density near the strand over all corresponding locations along the strand. This produces average density for one repeat of the strand. Then, as the direction towards the neighboring strand is already known, the positioning of the carbonyl atoms can readily be identified as being where the density approximately 1.5\u2005\u00c5 from the axis of the strand in the direction of the neighbouring strand is maximal . With the same alignment, another carbonyl O atom points down towards the strand on the other side and this density should be offset by half of the period of the \u03b2-strand. In our approach, if these two estimates of the locations of the carbonyls agree to within approximately 1/12 of the period then the identification of the location is considered to be a possible match.The representation of the density for this strand as a tube is\u00a0marked by the red spheres in Fig. 1\u03b2 atoms and is offset by about 1/3 of a period from that of the carbonyl O atoms . The pattern of high density and direction along the \u03b2-strand going from the N-terminus to the C-terminus can now be readily seen. For the \u03b2-strand in the middle of Fig. 1c), starting at the carbonyl O atom pointing up at the right of the figure and moving to the left one atom at a time, it may be seen that the pattern of high density will be (i) up at position 1 (at the carbonyl C atom), (ii) right at atom 3 (the C\u03b2 atom into the plane of the figure), (iii) down at atom 4 (the next carbonyl), (iv) left at atom 6 (the next C\u03b2 atom) and then up again at atom 7 (the next carbonyl O atom pointing up). Note that if\u00a0the strand were in the opposite direction then the pattern would be different. Consequently, the position and direction of the strand can be identified. In our procedure, if all the positions of highest density in this pattern are aligned within a tolerance of 1/12 of the period of the \u03b2-strand then the position and direction are considered to be likely to be correct .The same approach can then be applied to examine the density, again about 1.5\u2005\u00c5 from the axis of the strand, this time in the directions perpendicular to the plane of the \u03b2-sheet. This density corresponds to that of the Cms Fig. 1c. The pc) and the curve corresponding approximately to the main-chain atoms , an idealized \u03b2-strand can be placed. In cases where the direction cannot be identified using the method described above, two candidate \u03b2-strands are created, one in each direction. Note that if the curvature is substantial then there can be some distortion of the strand.Given the direction and alignment of a strand as in Fig. 12.3.RESOLVE software to assemble these fragments and resolve any overlaps  shows the result of carrying this out when the strands found from analyses of this map using data to a resolution of 2.5, 3 and 4\u2005\u00c5 are merged in this assembly process (the default procedure).The analysis described above yields a group of modelled \u03b2-\u00adstrands that match the electron density. However, these strands may contain overlapping fragments. We use the main-chain assembly routines in the 3.PHENIX structure library previously solved by MAD, SAD, MIR and a combination of SAD and SIR procedures with data extending to high resolutions ranging from 1.5 to 3.8\u2005\u00c5. Maps were calculated with the PHENIX AutoSol wizard , the quality of the map , the r.m.s. coordinate difference between main-chain atoms in the modeled \u03b2-strands compared with those in the refined structure and the correlation between the map and a map calculated from the \u03b2-strand model.Table 1DSSP were built using our approach. Of these, 60% of the residues built were in fact in \u03b2-strands (the C\u03b1 atom was within 3\u2005\u00c5 of a C\u03b1 atom of a \u03b2-strand residue in the refined structure of the protein). The 40% of the residues built by our procedure that did not match \u03b2-strands as identified by DSSP were either incorrectly built (e.g. traced into helices) or were built into less regular secondary structure (such as loop regions). Therefore, the method built \u03b2-sheets reasonably well, but some \u03b2-strands were missed and some residues were identified as \u03b2-strand that were in fact another type of structure. Overall, the r.m.s.d. between modelled \u03b2-strands and refined coordinates was about 1.5\u2005\u00c5. The CPU time required (using 2.9\u2005GHz Intel Xeon processors) to analyze all 42 maps was 66\u2005min or about 0.8\u2005s per residue of \u03b2-strand placed.On average, 58% of the residues in \u03b2-strands as identified by PHENIX AutoBuild wizard  of 0.95\u2005\u00c5 and required 43\u2005h for the entire set of structures.To compare these results with a standard procedure for automated model building, the same 42 maps were analyzed with the 1oel; Braig et al., 1995et al., 2000et al., 1977One structure for which most \u03b2-strand residues were missed was the GroEL structure ; however, there were other places where \u03b2-strands have been built into density that corresponds to \u03b1-helices or to side-chain density .In a few cases significantly more \u03b2-strand residues were built than were identified by ly Fig.\u00a02a; howevty Fig. 2b.1lql; Choi et al., 2003DSSP) with an r.m.s.d. from the refined model of 1.3\u2005\u00c5. The structure has tenfold NCS but this was not used in the model-building process. A ribbon diagram of this model is shown in Fig. 2c).The procedure produced very complete structures of the \u03b2-\u00adsheets in many cases. The largest number of \u03b2-sheet residues built was for the structure 1038B at a resolution of 3\u2005\u00c5  between the electron-density map and the \u03b2-sheet model, only including points in the map that are near (within 2\u2005\u00c5) of an atom in the model. Fig. 3a) illustrates the mean value of the r.m.s.d. between main-chain atoms of the \u03b2-\u00adsheet models built and the corresponding atoms in refined models as a function of this parameter and Fig. 4b) illustrates the number of residues built. The accuracy generally improves with increasing stringency, but as expected the number of residues built decreases. Values of cc_strand_min in the range 0.3\u20130.5 would appear to be reasonable compromises between these competing effects.One adjustable parameter in this procedure that would be expected to affect both the accuracy of the models and the number of residues built is cc_strand_min, the minimum correlation between the density near a potential strand and that of an idealized tube of density. Fig. 44.b), but in general it builds \u03b2-sheets very well .The procedure that we have developed for modelling \u03b2-sheets is quite rapid and reasonably accurate. It identifies most of the\u00a0\u03b2-\u00adsheets in the tests we have carried out. The method does\u00a0show some overprediction and can accidentally build \u03b2-\u00adstructure into helical or side-chain density in some cases Fig. 2b, but ill Fig. 2c.Several improvements can readily be imagined for this procedure. One would be to take account of the hydrogen-bonding pattern in \u03b2-sheets, which would be expected to improve the register and alignment of the models. Another would be to explicitly look for deviations from regular \u03b2-\u00adstructure, such as \u03b2-bulges or the start of helices, so as to more precisely define the start and end of regular \u03b2-strands.c) is not likely to be found unless this is the case. Secondly, the procedure can be part of a rapid scoring procedure for evaluation of electron-density maps by\u00a0analysis of the regular secondary structure evident in the maps. Lastly, the procedure could be used as part of a more complete model-building process in which the secondary structure built with this method is used as a starting point for chain extension and further model building.The method may be useful in several ways. Firstly, it can be a good indicator of whether a structure has been solved, as a picture such as that in Fig. 2"}
{"text": "A method for rapid model building of \u03b1-helices at moderate resolution is presented. A method for the identification of \u03b1-helices in electron-density maps at low resolution followed by interpretation at moderate to high resolution is presented. Rapid identification is achieved at low resolution, where \u03b1-helices appear as tubes of density. The positioning and direction of the \u03b1-helices is obtained at moderate to high resolution, where the positions of side chains can be seen. The method was tested on a set of 42 experimental electron-density maps at resolutions ranging from 1.5 to 3.8\u2005\u00c5. An average of 63% of the \u03b1-helical residues in these proteins were built and an average of 76% of the residues built matched helical residues in the refined models of the proteins. The overall average r.m.s.d. between main-chain atoms in the modeled \u03b1-helices and the nearest atom with the same name in the refined models of the proteins was 1.3\u2005\u00c5. Atomic models can\u00a0be simple and readily visualized representations of the structures of macromolecules and are commonly used as the primary means of conveying structural information about a macromolecule.e.g. O . Additionally, they all become progressively less effective as the resolution of the map decreases, although some progress has recently been made in this regard (DiMaio O software has shown that the direction (and placement) of \u03b1-\u00adhelices in a map can be accurately identified by averaging the electron density near several sequential C\u03b1 positions by applying a transformation corresponding to the relationship between sequential residues in an \u03b1-helix  resolution  Identification of \u03b1-helical density and modeling of \u03b1-\u00adhelical axes and extent using maps with varying low-resolution cutoffs.(ii) Determination of \u03b1-helix placement  using the full available resolution.(iii) Assembly of \u03b1-helices, elimination of overlaps and joining of adjacent segments.The result of this process is a model of the \u03b1-helical portions of the structure that can be used as a starting point for further model building and map interpretation. These steps are described in detail below.Our approach for modeling the \u03b1-helices in an electron-density map of a protein consists of three steps. These are as follows.2.1.a), at a resolution of 7\u2005\u00c5 an \u03b1-\u00adhelix appears as a tube of density , so that finding the \u03b1-helices can be quite straightforward.The first step in our process for modeling \u03b1-helices in the electron-density map of a protein is to identify the \u03b1-helices using a set of maps with low-resolution cutoffs from about 5 to 8\u2005\u00c5. While at high resolution an \u03b1-helix has a rather complicated pattern of density Fig. 1a, at a ty Fig. 1b, so thb) and a set of points is identified along the axis of the tubes of density corresponding to \u03b1-helices. The points are chosen to be a set for which (i) each point is in relatively high density , (ii) no more than one point that is adjacent to a chosen point has an electron-density value that is greater than the value at the chosen point and (iii) each chosen point is at least a specified distance  from each other chosen point. The second criterion is chosen to ensure that the chosen points are either at a peak of density or along a line of high density. A set of points satisfying these criteria for the map in Fig. 1b) is shown in Fig. 1c).A map is calculated  at low resolution  are used to guess the location and direction of the axis of the tube of density. Each point is considered as a possible marker of the center of a tube of density and the directions to every other point  are considered, one at a time, as the direction of the tube of density. The center and direction are scored by calculating the electron density at intervals of typically 2\u2005\u00c5 along the line they define and identifying the longest segment that satisfies the criteria that (i) every point along the line has a density \u03c1 of at least \u03c1mean \u00d7 cut1, where \u03c1mean is the mean density in the segment and cut1 has a typical value of 0.5, and (ii) the points on the ends have densities of at least \u03c1mean \u00d7 cut2, where the value of cut2 is typically 0.75. These are the same criteria as used previously in building protein main-chain segments  are saved.This process is typically repeated with maps with resolution cutoffs from about 5\u20138\u2005\u00c5 and all the resulting \u03b1-helices are considered in the following steps.2.2.The second overall step in \u03b1-helix identification is to use the\u00a0high-resolution electron-density map to determine how an \u03b1-\u00adhelix could be optimally placed in the electron density given the helix axis and the ends of the helical segment. This is performed in three stages. Firstly, the positioning along the helix axis of the tubes of density in the map corresponding to the main-chain atoms in each  helix is determined. The direction of the \u03b1-helix is then identified and finally the positioning of an idealized \u03b1-helix is identified.d) illustrates the approach used to position the helix axis of a segment in ideal \u03b1-helical density. The blue mesh corresponds to a contour of ideal density from an \u03b1-helical segment and the gray helix is an ideal helix with a radius of 2\u2005\u00c5 and a pitch of 5.4\u2005\u00c5. The parameter that is optimized in this step is the translation of the gray ideal helix along the helix axis, with a score given by the mean density along the gray ideal helix multiplied by the square root of its length. As in the previous overall step, the ends of the helix are chosen to maximize its length, while requiring that the density at all intermediate points and at the ends be at least cut1 or cut2 times the mean in the segment, respectively.Fig. 1\u03b2 atoms would be located given the location of the gray helix representing main-chain atoms as identified above. Fig. 1d) illustrates this process. Two helices  are constructed based on the gray helix. Each of these helices has a radius of 4\u2005\u00c5 and a pitch of 5.4\u2005\u00c5. They are offset by \u00b11\u2005\u00c5 along the helix axis from the gray main-chain helix. Depending on the direction of the helix, one of these two helices  will typically be in much higher average density than the other, allowing the direction of the helix to be identified. A Z score is estimated reflecting the confidence in this difference from the ratio of the difference between the scores for the two directions to the estimated standard deviation of this ratio for random helix placements. This standard deviation is estimated from the variance of the values of the scores obtained for both directions, assuming incorrect periodicities of a helix of 80\u00b0, 90\u00b0, 110\u00b0 and 120\u00b0. If the Z score was 2 or larger, the assignment of the direction was considered to be likely to be correct.The direction of the \u03b1-helix is identified by maximizing the density at the positions where Ce) shows the position of the model polymethylalanine \u03b1-\u00adhelix used to generate the density for Fig. 1The positioning and extent of an idealized polyalanine \u03b1-\u00adhelix in the high-resolution electron density is then identified by a simple search over rotations about the helix axis and translations along the helix axis, trimming the ends in the same fashion as described above and scoring by the mean value of electron density at the coordinates of atoms in the idealized \u03b1-\u00adhelix multiplied by the square root of the number of atoms. Fig. 12.3.RESOLVE software  are found. The resulting set of \u03b1-\u00adhelices is saved.The previous steps result in a collection of \u03b1-helices that match the electron density but that may contain overlapping or otherwise incompatible fragments of \u03b1-helix. The assembly of all these fragments and the resolution of overlaps is carried out by the main-chain assembly routines in the 3.et al., 2004PHENIX AutoSol wizard . Tubes of density corresponding to helices are readily identifiable in the map. Fig. 2b) shows the map at high resolution, along with the \u03b1-helices that were identified using the procedure described here (in yellow) and the \u03b1-helices from the refined structure , the quality of the map , the r.m.s. coordinate difference between main-chain atoms in the modeled \u03b1-helices compared with those in the refined structure and the correlation between the map and a map calculated from the \u03b1-helix model.Table 1\u03b1 atom within 3\u2005\u00c5 of a C\u03b1 atom in an \u03b1-helix in the refined structure. The remaining 24% were built into structure that was not identified as \u03b1-helical by DSSP. The overall r.m.s.d. between modeled \u03b1-helices and refined coordinates  was 1.3\u2005\u00c5. The CPU time (using 2.9\u2005GHz Intel Xeon processors) required to analyze all 42 maps was 28\u2005min or about 0.2\u2005s per residue of \u03b1-helix placed. To provide a frame of reference for these results, we carried out one cycle of automated model building applying the PHENIX AutoBuild wizard  of 0.95\u2005\u00c5, requiring 43\u2005h for the 42 maps.Overall, 63% of the 11\u2005233 residues in \u03b1-helices in the refined structures were found. Viewed differently, 76% of the residues that were built using the present method in fact corresponded to \u03b1-helical segments of the refined structures, with a Ca) shows that for this set of maps the quality of the map has only a small effect on the quality of the \u03b1-helices built, as reflected in the r.m.s.d. between the main-chain atoms in the \u03b1-helices found and those in the corresponding refined models. Similarly, the resolution of the map, in the range 1.5\u20133.8\u2005\u00c5, had little effect on the quality of the models . However, it was possible to tell which models were accurate. Fig. 3c) shows that the\u00a0map\u2013model correlation based on the coordinates of the \u03b1-\u00adhelices that were built is inversely related to the r.m.s.d. between those coordinates and those of the corresponding refined structures. Those models with a model\u2013map correlation of greater than about 0.45 generally had an r.m.s.d. of less than about 1.5\u2005\u00c5 and those with lower model\u2013map correlation generally had an r.m.s.d. of greater than 1.5\u2005\u00c5.The maps used in this analysis were of fair to excellent quality, with correlations to model maps based on the corresponding refined structures of 0.53\u20130.89. Fig. 3ls Fig. 3b. Howeva) shows the overall r.m.s.d. of main-chain atoms from those in corresponding refined models and Fig. 4b) shows the total number of residues built. Increasing the threshold correlation results in more accurate models but fewer residues built and the default value of 0.5 appears to be a reasonable compromise between these effects.One parameter that might be particularly important in determining both the accuracy of the procedure and the number of residues built is the map-correlation cutoff used to choose the density at low resolution (cc_helix_min). The default value is a correlation of 0.5. We tested a range of values of cc_helix_min for the set of 42 maps in Table 14.The procedure described here for the rapid placement of \u03b1-\u00adhelices in electron-density maps may be useful in several contexts. Firstly, it may be useful as a method for the evaluation of map quality. Secondly, it may be useful in giving a rapid indication to a crystallographer as to whether they have successfully determined the structure in their crystals. Thirdly, it may be a useful approach to generating a partial model of a protein that can then be extended with other model-building tools."}
{"text": "The hydrogen sulfate\u2013sulfate anion is a hydrogen-bond acceptor for the three independent cations and the uncoordinated water mol\u00adecule, the hydrogen-bonding inter\u00adactions giving rise to a three-dimensional hydrogen-bonded network. In the hydrogen sulfate\u2013sulfate species, one of the sulfate groups is disordered in respect of its O atoms in a 2:1 ratio.In the crystal structure of the title salt, 3C DOI: 10.1107/S1600536809048545/xu2676Isup2.hklStructure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
{"text": "Inflammation and its associated pathologies are increasingly suggested as risk factors for colorectal cancer (CRC) development. Previous research from our group has shown that increased levels of circulating, pro-inflammatory cytokines IL-6 and TNF\u03b1 promote colorectal adenoma risk. Emerging data in mice and humans suggest that Suppressor of Cytokine Signaling 3 (SOCS3) may act as a tumor suppressor in the intestine, and decreased SOCS3 expression may promote CRC. As SOCS3 has been shown to inhibit the actions of IL-6 and TNF\u03b1 in the intestine, we hypothesized that decreased SOCS3 expression in normal mucosa may predispose to adenomas and thus increase risk for CRC.We examined SOCS3 mRNA levels in normal mucosa biopsies of 322 screening colonoscopy patients (93 with adenoma and 229 without adenoma) using real-time qRT-PCR. Logistic regression analysis was used to generate odds ratios (OR) and 95% confidence intervals to determine if low SOCS3 expression was associated with adenoma status. Median SOCS3 values did not differ between patients with or without adenoma. Logistic regression analysis showed no association (unadjusted or adjusted for age and sex) between SOCS3 and colorectal adenomas.Low SOCS3 mRNA expression is not an independent biomarker of colorectal adenoma risk in the normal mucosa. SOCS3 silencing likely occurs later in CRC progression. Recent evidence in mice and humans suggest that the anti-inflammatory protein Suppressor of Cytokine Signaling 3 (SOCS3) may act as a tumor suppressor in the colon ,2. SpeciPrior studies from our group demonstrated that increased systemic levels of pro-inflammatory cytokines IL-6 and TNF\u03b1 correlate with risk of colorectal adenoma ,7-12. BaAll eligible subjects provided written, informed consent. Consenting participants were enrolled in Diet and Health Study IV at University of North Carolina Hospitals as previously described . BrieflyRNA from four pooled, normal colon biopsies per subject was extracted using Qiagen's RNeasy kit  and reverse transcribed with AMV-Reverse Transcriptase (Promega) as previously described .SOCS3 mRNA abundance was determined using the ABI Prism 7900 HT  and Platinum Quantitative PCR SuperMix-UDG . Human SOCS3 (NM_003955.3) was quantified using Applied Biosystem primer/probe set targeting exon 2. The housekeeping gene hydroxymethylbilane synthase  was chosen as a low-abundance, invariant control. Standard curves for each primer/probe set were generated using gel-isolated, sequence-confirmed PCR products. Cycling included initial denaturation at 95\u00b0C for 5 minutes followed by 45 cycles of 95\u00b0C denaturation for 15 seconds and 60\u00b0C annealing for 45 seconds. Threshold cycles analysis was performed using Applied Biosystem SDS v2.2.2 software and values are expressed as copy number relative to HMBS. All PCR runs included standards and inter-run calibrator controls (pooled sample cDNA), as well as non-reverse transcribed (no-RT) and water controls. Samples were run in triplicate.Means and standard errors were generated for continuous variables, and frequencies and percentages were generated for categorical variables. T-tests and Mann-Whitney tests were used to compare cases with controls on continuous variables. SOCS3 values were log-transformed to normalize the distribution. Chi-Square tests were used to compare cases and controls on categorical variables. Logistic regression was used to test for an association between case/control status and SOCS3. Levels of SOCS3 were categorized into tertiles based on control values. Age, race, sex, WHR, NSAIDS, IL-6, TNF\u03b1, and family history were assessed as potential confounders of SOCS3-adenoma association. Each variable was put into a model separately with SOCS3, and if one of the two dummy variables for SOCS3 changed by at least 15% compared to when only SOCS3 was in the model, then that co-variable passed the first stage for being a confounder. All such variables were then entered into a model with SOCS3 and a backwards, stepwise regression was done with the SOCS3 variable being forced into the model. Only age and sex met these criteria for confounding and thus they were included in the final model.Descriptive characteristics of the population in the SOCS3-adenoma study are shown in Table To determine if low SOCS3 is associated with having an adenoma, odds ratios and 95% confidence intervals were generated using logistic regression analysis Table . There wIdentifying local factors that predispose patients to early, pre-cancerous lesions may make it possible to stratify screening based on risk, but risk factors that occur early in CRC development are not well defined. Our group has shown that patients with adenoma have reduced apoptosis in their normal mucosa, demonstrating a field effect that predisposes the individual to a higher risk of developing precancerous adenomas ,15. We hPatients with inflammatory bowel diseases (Crohn's disease or ulcerative colitis) have an increased risk of developing CRC, which is associated with the degree and duration of intestinal inflammation (reviewed in ). In addOne potential limitation of the study is possible effect of standard bowel preparation on SOCS3 expression. While we have not directly tested this for SOCS3, similar studies of other genes have shown that there is no significant change in mucosal gene expression in patients using bisacodyl or polyethylene glycol bowel preparations . AnotherThe authors declare that they have no competing interests.KEH carried out the molecular studies, participated in data analyses, and drafted the manuscript. PKL and RSS participated in the study conception, design, and coordination. JAG performed the statistical analyses. TOK participated in the study conception, design, and coordination, and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "To compare how and to what extent ingestion of hydrogen water and milk increase breath hydrogen in adults.Five subjects without specific diseases, ingested distilled or hydrogen water and milk as a reference material that could increase breath hydrogen. Their end-alveolar breath hydrogen was measured.Ingestion of hydrogen water rapidly increased breath hydrogen to the maximal level of approximately 40 ppm 10\u201315 min after ingestion and thereafter rapidly decreased to the baseline level, whereas ingestion of the same amount of distilled water did not change breath hydrogen (p < 0.001). Ingestion of hydrogen water increased both hydrogen peaks and the area under the curve (AUC) of breath hydrogen in a dose-dependent manner. Ingestion of milk showed a delayed and sustained increase of breath hydrogen in subjects with milk intolerance for up to 540 min. Ingestion of hydrogen water produced breath hydrogen at AUC levels of 2 to 9 ppm hour, whereas milk increased breath hydrogen to AUC levels of 164 ppm hour for 540 min after drinking.Hydrogen water caused a rapid increase in breath hydrogen in a dose-dependent manner; however, the rise in breath hydrogen was not sustained compared with milk. It is widely accepted that breath hydrogen reflects carbohydrate fermentation in the colon.Recent studies revealed that hydrogen gas plays an important role in inactivating oxidative stresses such as hydroxyl radicals in animal models of cerebral infarction,11Since hydrogen solubility in water at 25 \u00b0C is 0.0176 vol gas STP/vol liquid at 1 atm partial pressure,In the present study, in order to examine whether ingestion of commercial hydrogen water increased breath hydrogen and the duration for which it was maintained, the effects of hydrogen water on breath hydrogen was examined. The effect of milk ingestion on breath hydrogen was also examined for comparison as milk increases breath hydrogen.15Commercial hydrogen water was purchased at the general consumer level and fresh hydrogen water (0.6 mM) was obtained from Blue Mercury Inc. . Hydrogen water was made by dissolving hydrogen into water under high pressure, as described by Nagata et al.Five healthy adult volunteers (two men and three women: mean age 29 \u00b1 14 years) participated in this study. They did not have any specific diseases based on detailed questionnaires and examination by physicians. The subjects randomly volunteered to be assigned to consecutive studies from experiment one to three. All the subjects eventually showed lactose deficiency as described below, possibly due to the high incidence of lactose deficiency in Japanese people.18The subjects refrained from food, supplements and drugs, except water, for at least 15 hours before the experiments. On the day of the experiment, the subjects rested in the sitting position for at least 30 min and then drank 300 ml of milk, hydrogen water or distilled water within one min. Immediately after drinking, the subjects rinsed their oral cavity with 50 ml of distilled water. End-alveolar breath was obtained in a breath sampling bag  every 5 min from 30 min before drinking until the end of each experiment as described below. All subjects underwent training to obtain end-alveolar breath before these experiments.For the dose-response experiment, hydrogen water for general consumers was used within one week after shipping. Hydrogen concentration was 0.40 \u00b1 0.07 mM (N = 18). Three subjects had hydrogen water in volumes of 100, 200 and 300 ml every hour, with two repetitions.To confirm that breath hydrogen originates from hydrogen water, five subjects had 300 ml of distilled water and then changes in breath hydrogen were observed for 90 min. After an hour , the same subject ingested hydrogen water (0.4 mM).To compare the hydrogen-producing capability of hydrogen water and milk, four subjects had 300 ml of milk and their breath hydrogen was monitored for up to 540 min. On separate experimental days, the same two subjects drank 300 ml of hydrogen water and repeated the same protocols at three different concentration levels  of hydrogen water.The breath was immediately transferred to a gas-tight glass syringe and 1 ml was injected into the gas chromatograph with a semiconductor detector  to measure breath hydrogen. Breath concentrations of each gas were calculated by subtracting ambient air collected in the same sampling bag. Hydrogen concentration of the milk, distilled or hydrogen water at 25 \u00b0C were measured for each subject by head-space gas sampling in a sealed glass vial with a small amount of the materials. Analysis was performed using the same sensor as mentioned above.Statistical values are expressed as the mean \u00b1 standard deviations of the mean. Statistical analysis was performed by a paired t-test or two-way analysis of variance and significance was accepted at p < 0.05.Hydrogen water significantly increased both hydrogen peak  and the area under the curve (AUC) of breath hydrogen  in a dose-dependent manner .Effects of distilled and hydrogen water on breath hydrogen were compared. Ingestion of hydrogen water (0.4 mM) rapidly increased breath hydrogen to the maximal level of 36 ppm 15 min after ingestion and thereafter rapidly decreased to the baseline level, whereas the same amount of distilled water ingestion did not change breath hydrogen . Furthermore, in the recent experiment, it was estimated that after ingestion of hydrogen water, approximately 0.1% of hydrogen was released from the whole body surface and the amount was considerably negligible, which will be reported elsewhere . On the other hand, it is known that hydrogen produced by colonic fermentation is partially consumed by bacterial flora in the colon.The present study supports the conclusion that ingestion of commercial hydrogen definitely increases hydrogen concentration in the body; however, the rise in breath hydrogen was transient and the hydrogen-producing capability of hydrogen water was less than that of milk in subjects with hypolactasia. Since a higher increase in breath hydrogen was expected, fasted subjects had test items at the rate of 300 ml/60 sec, i.e. 5 ml/sec. However, the rise did not reach the reported level of 55 ppm by ingestion of 300 ml of hydrogen-rich water by a recent clinical trial of Kajiyama et al.On the other hand, Nagata et al.The same group revealed that hydrogen gas plays an important role in inactivating oxidative stresses such as hydroxyl radicals.Ingestion of milk in subjects with hypolactasia caused a marked and sustained rise in breath hydrogen, as shown in the present and previous studies.This study was performed under special conditions, refraining from unabsorbable foods before the experimental days and eating and drinking nothing except water and the test items. However, in everyday life, breath hydrogen levels fluctuate markedly, ranging from several ppm to 50 ppm or more,Hydrogen water caused a rapid increase in breath hydrogen in a dose-dependent manner; however, the rise in breath hydrogen was not sustained compared with the same amount of milk in subjects with milk intolerance."}
{"text": "Allelopathy  has been largely studied as an autecological process, often assuming simplistic associations between pairs of isolated species. The growth inhibition of a species in filter paper bioassay enriched with a single chemical is commonly interpreted as evidence of an allelopathic interaction, but for some of these putative examples of allelopathy, the results have not been verifiable in more natural settings with plants growing in soil.Festuca rubra ssp. commutata. We re-examined the allelopathic effects of m-tyrosine to understand its dynamics in soil environment. Allelopathic potential of m-tyrosine with filter paper and soil (non-sterile or sterile) bioassays was studied using Lactuca sativa, Phalaris minor and Bambusa arundinacea as assay species. Experimental application of m-tyrosine to non-sterile and sterile soil revealed the impact of soil microbial communities in determining the soil concentration of m-tyrosine and growth responses.On the basis of filter paper bioassay, a recent study established allelopathic effects of m-tyrosine, a component of root exudates of F. rubra ssp. commutata rhizosphere. We hope that our study will motivate researchers to integrate the role of soil microbial communities in bioassays in allelopathic research so that its importance in plant-plant competitive interactions can be thoroughly evaluated.Here, we show that the allelopathic effects of m-tyrosine, which could be seen in sterilized soil with particular plant species were significantly diminished when non-sterile soil was used, which points to an important role for rhizosphere-specific and bulk soil microbial activity in determining the outcome of this allelopathic interaction. Our data show that the amounts of m-tyrosine required for root growth inhibition were higher than what would normally be found in  Since 8-hydroxyquinoline has affinity for cations such as aluminum, iron or magnesium, the addition of EDTA (disodium ethylenediaminetetraacetate) to the extraction solution improved the recovery of 8-hydroxyquinoline probably due to dissociation of 8-hydroxyquinoline-metal cation complex C. diffusa-invaded soil and since the influence of microbial communities were excluded from this work, it remains an open question whether 8-hydroxyquinoline is allelopathic in soil.Phytotoxicity of 8-hydroxyquinoline, a root-exuded metabolite from Festuca rubra ssp. commutata. These results were extrapolated to the development of a biorational approach for weed control On the basis of filter paper and agar bioassays, Bertin and colleagues Lactuca sativa), littleseed canarygrass  and bamboo (Bambusa arundinacea) using filter paper and soil (non-sterile or sterile) bioassays. Since m-tyrosine was suggested to be a potent allelopathic and herbicidal compound We tested the phytotoxic effects of m-tyrosine on lettuce  or 30\u00b0C (for bamboo). Three seeds of lettuce, littleseed canarygrass or bamboo were sown in 10 g non-sterile soil and inoculated at 22 (lettuce and littleseed canarygrass) or 30\u00b0C (bamboo). After 8 d of seed germination, the non-sterile soil was treated with 0, 4.25, 8.5, 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil and incubated under same conditions for 24 h. In order to investigate the recovery of m-tyrosine in soil devoid of microbes, sterile and non-sterile soils without assay species were treated with 0, 4.25, 8.5, 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil and incubated at 22 or 30\u00b0C for 24 h. Each m-tyrosine treatment was replicated thrice.After an incubation period of 24 h, soil samples were extracted in 5 ml water, and briefly mixed by vigorous vortexing. After centrifugation for 10 min at 4500 rpm, supernatant was passed through 0.2 \u00b5m filters (Sartorius) and placed in sample vials for high-pressure liquid chromatography (HPLC) analysis. m-Tyrosine recovery was measured by HPLC with an Agilent-HPLC, 1100 series equipped with an ODS inertsil C-18 column  protected by a Phenomenex Security Guard C18 pre-column. The mobile phases were (A) water: 0.05% formic acid and (B) acetonitrile: 0.05% formic acid. The elution system was as follows: 0\u20133 min, 3% of B; 3\u201312 min, 3\u201350% of B; 12\u201315 min, 50% of B. The flow rate was 1 mL/min, the injection volume was 10 \u00b5L, and the column oven was set at 24\u00b0C, and the elutent was monitored at 280 nm. m-Tyrosine concentration among or between treatments was analyzed by means of one-way ANOVAs or t-tests, respectively F. rubra ssp. commutata were sown in 10 g soil at 22\u00b0C. Eight days after the germination of seeds, seedlings were removed, and soil was extracted with 10 mL water. Soil extracts were then subjected to HPLC as described above.In order to examine the root exudation of m-tyrosine in non-sterile soil, seeds  of 2 respiration by chemical titration is an effective method to compare microbial activity in different soils 2. Three replicates were used. Soil was incubated at 22\u00b0C or 30\u00b0C, respectively for 24 h, and was terminated by adding 1 mL of 0.1 N BaCl2 to NaOH. A 10 mL of NaOH taken from blank, control or treatment was titrated against 0.1 N HCl, and amount of CO2 released was calculated Measuring soil COlettuce\u200a=\u200a56.65, df\u200a=\u200a6, 284; P<0.001; Flittleseed canarygrass\u200a=\u200a301.1; df\u200a=\u200a6, 318; P<0.001; Fbamboo\u200a=\u200a16.97, df\u200a=\u200a6, 230, P<0.001) or in sterile soil treated with m-tyrosine   and lettuce  was inhibited in soils amended with 68 or 136 \u00b5g/g tyrosine  . No significant difference in m-tyrosine recovery was observed among three assay species at 34 or 68 \u00b5g m-tyrosine/g soil . HoweverWe also examined the recovery of m-tyrosine in sterile and non-sterile soil without assay species when treated with 0, 4.25, 8.5, 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil and incubated at 22 or 30\u00b0C. A higher availability of m-tyrosine was observed in non-sterile soil, incubated at 22\u00b0C, treated with 17 (12.1%), 34 (22.1%), 68 (29.7%) or 136 (40.3%) \u00b5g m-tyrosine/g non-sterile soil compared to non-sterile soil, incubated at 30\u00b0C, treated with 17 (0%), 34 (13.1%), 68 (18.5%) or 136 (21.8%) \u00b5g m-tyrosine/g non-sterile soil . The rec2 release \u200a=\u200a0.035) compared to untreated soil incubated at 22\u00b0C (2 release in treated soil incubated at 30\u00b0C was significantly (P<0.0001) higher compared to untreated soil incubated at 30\u00b0C. No significant differences (except 4.25 or 8.5 \u00b5g m-tyrosine/g soil) were observed in the CO2 released from m-tyrosine-treated soil incubated at 22\u00b0C compared to untreated soil incubated at 22\u00b0C. A significantly higher CO2 release from soil treated with 17 <0.0001), 34 <0.0001), 68 <0.0001) or 136 <0.0001) \u00b5g m-tyrosine/g soil was observed at 30\u00b0C compared to respective soils incubated at 22\u00b0C  in non-sterile soil with bamboo compared to non-sterile soil with lettuce (31.1%) or littleseed canarygrass (34.1%) . The low2 efflux is a reliable technique for comparing microbial activity in different soils 2 release in untreated and m-tyrosine-treated soil incubated at 22 or 30\u00b0C. We observed a higher CO2 release in the untreated soil incubated at 30\u00b0C (4\u00b10.2 \u00b5g CO2 released/g soil/h) compared to 22\u00b0C (2.6\u00b10.6 \u00b5g CO2 released/g soil/h). A higher m-tyrosine recovery of 12.1, 22.1, 29.7 and 40.3% was observed in non-sterile soil treated with 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil at 22\u00b0C compared to 0, 13.1, 18.5 or 21.8%, respectively in m-tyrosine treated soil at 30\u00b0C. The lower recovery was associated with higher CO2 efflux suggesting higher microbial activity in soil treated with 17 (47.4%), 34 (59.1%), 68 (81.1%) or 136 (61.4%) \u00b5g m-tyrosine/g soil at 30\u00b0C compared to respective soils incubated at 22\u00b0C (2 release (except from the soil treated with 8.5 \u00b5g m-tyrosine/g soil) compared to soil treated with 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil at 22\u00b0C. No differences in the CO2 release were observed among soils treated with 17, 34, 68 or 136 \u00b5g m-tyrosine/g soil at 22\u00b0C  reflect the amount actually released from the plant that could interact with competing plants. Moreover, it is difficult to collect root surface washings in a system without causing physical damage to the roots, which is unlikely to occur in the artificial soil system. In natural conditions, biotic stresses such as herbivory, however, might cause a local release of m-tyrosine. Ecologists have often criticized the extraction procedures used in past experiments claiming the demonstration of allelopathic effects. Harper Almost all species can, by appropriate digestion, extraction and concentration, be persuaded to yield a product that is toxic to one species or another\u201d. These comments hold for most of the recent claims of allelopathic function F. rubra ssp. commutata could have some ecological function, which yet remains to be discovered.We did not detect m-tyrosine in non-sterile soils with 3, 6 or 9 seedlings of While m-tyrosine may exert allelopathic effects at high concentrations, our research suggests that the quantities of m-tyrosine released from the plant are unlikely to persist in soil to exert phytotoxic effects. Soil microbial communities form a major sink that influences accumulation of a metabolite to phytotoxic levels . Microbiin vitro demonstrations of allelopathic activity of a chemical can rarely be applied to field situation, the most recent studies published in high profile journals in vitro experiments. It is our hope that this study will motivate researchers to integrate the role of soil microbial communities in bioassays in allelopathic research so that its importance in plant-plant competitive interactions can be thoroughly evaluated.Bioassays for allelopathy should investigate rhizosphere-specific and bulk soil microbial activity; and also temperature-driven microbial activity. The differences between species that are \u2018sensitive\u2019 or \u2018resistant\u2019 to a putative allelochemical, as is commonly invoked in invasion ecology, may reflect differences in microbial communities harbored by different plant species. Although it is well known that"}
{"text": "The HOX11/TLX1 (hereafter referred to as HOX11) homeobox gene was originally identified at a t translocation breakpoint, a chromosomal abnormality observed in 5-7% of T cell acute lymphoblastic leukemias (T-ALLs). We previously reported a predisposition to aberrant spindle assembly checkpoint arrest and heightened incidences of chromosome missegregation in HOX11-overexpressing B lymphocytes following exposure to spindle poisons. The purpose of the current study was to evaluate cell cycle specific expression of HOX11.Cell cycle specific expression studies revealed a phosphorylated form of HOX11 detectable only in the mitotic fraction of cells after treatment with inhibitors to arrest cells at different stages of the cell cycle. Mutational analyses revealed phosphorylation on threonine-247 (Thr247), a conserved amino acid that defines the HOX11 gene family and is integral for the association with DNA binding elements. The effect of HOX11 phosphorylation on its ability to modulate expression of the downstream target, cyclin B1, was tested. A HOX11 mutant in which Thr247 was substituted with glutamic acid (HOX11 T247E), thereby mimicking a constitutively phosphorylated HOX11 isoform, was unable to bind the cyclin B1 promoter or enhance levels of the cyclin B1 protein. Expression of the wildtype HOX11 was associated with accelerated progression through the G2/M phase of the cell cycle, impaired synchronization in prometaphase and reduced apoptosis whereas expression of the HOX11 T247E mutant restored cell cycle kinetics, the spindle checkpoint and apoptosis.Our results demonstrate that the transcriptional activity of HOX11 is regulated by phosphorylation of Thr247 in a cell cycle-specific manner and that this phosphorylation modulates the expression of the target gene, cyclin B1. Since it is likely that Thr247 phosphorylation regulates DNA binding activity to multiple HOX11 target sequences, it is conceivable that phosphorylation functions to regulate the expression of HOX11 target genes involved in the control of the mitotic spindle checkpoint. Given telopment , consistd TCR\u03b3\u03b4- . Dysregud TCR\u03b3\u03b4- . Additiocultures . The tracultures -15. Addicultures ,17.HOX11 in inducing a tumorigenic state remain unclear, although it is thought that the transactivation of specific downstream genes by HOX11 is responsible, at least in part, for cellular transformation. One-hybrid experiments have elucidated three regions of the HOX11 oncoprotein which are important for optimal transactivation of reporter constructs: an N-terminal glycine/proline rich region, a C-terminal glutamine-rich region, and the homeodomain [HOX11/TLX gene family [HOX11 consensus recognition motif to TAAGTG [Aldh1) [The molecular mechanisms of action of eodomain . A threoeodomain ,20), as  [Aldh1) ,21.Aldh1 [A comprehensive structure-function analysis of the HOX11 protein revealed that the transcriptional transactivation of genes specified by the Thr247 residue of HOX11 was distinct from its immortalizing function, as assayed by the ability to immortalize hematopoietic precursors and generate IL3-dependent myeloid-like cell lines . MutatioAldh1 , but wasAldh1 . Thus, tHOX11 overexpression conferred an ability to aberrantly bypass G2/M cell cycle checkpoint arrest induced by gamma-irradiation [HOX11 exhibit aberrant expression of genes involved in the regulation of the G1/S cell cycle checkpoint, including E2F, c-Myc, and the cAMP-responsive element binding protein (CREBP) [HOX11 demonstrated elevated expression of the cell cycle checkpoint regulators, NFKB2 and SMARCD3 [HOX11 to promote bypass of mitotic checkpoint arrest, leading to chromosome missegregation and aneuploidy [HOX11 overexpression, and may represent a critical mechanism by which HOX11 elicits lymphoma.Several reports have implicated HOX11 in disruptions of various cell cycle checkpoints. In Jurkat T cells, adiation . High th (CREBP) . An inde SMARCD3 . Our andeuploidy -29. ThisGiven the multiple defects in cell cycle regulation subsequent to HOX11 overexpression in several different cellular models, we investigated the expression of the HOX11 protein at various stages of the cell cycle. Surprisingly, we detected a hyperphosphorylation of the HOX11 oncoprotein on the Thr247 residue, which was specific to mitotic cells. The implications of this post-translational modification with respects to cyclin B1 transactivation and mitotic spindle checkpoint were explored.FLAG-tagged wildtype and truncated HOX11 proteins were generated by subcloning polymerase chain reaction (PCR)-amplified fragments, corresponding to the following HOX11 regions in frame with the sequence encoding a FLAG peptide into the HindIII/NotI restriction sites of the p3XFLAG-CMV-7.1 vector : HOX11\u0394260 (amino acids 1-260), HOX11\u0394187 (amino acids 1-187) and HOX11\u0394106 (amino acids 1-106). HOX11 Thr247Ala, Thr247Glu and Thr241Ala were generated using the QuikChange Site-Directed Mutagenesis Kit  prior to cloning as described above. Luciferase reporter constructs were generated by subcloning PCR-amplified fragments corresponding to the following promoter regions upstream of the luciferase reporter gene into the KpnI/HindIII restriction site of the pGL3 vector : CCNB1L-LUC (contains -4902 to +21 relative to TSS of murine cyclin B1 (CCNB1) gene) and CCNB1S-LUC (contains -3310 to +21 relative to TSS of murine cyclin B1 (CCNB1) gene). All constructs were verified by DNA sequencing.6 cells/ml. Relative levels of the HOX11 protein in the different cell lines is shown in Additional file NIH 3T3 fibroblasts stably expressing the HOX11 oncoprotein were generated by transfection of NIH 3T3 cultures with 3 \u03bcg MSCV-HOX11 plasmid constructs using the Polyfect Transfection reagent (QIAGEN), and selecting with 800 \u03bcg/ml G418 (Sigma) for 14 days. Media changes supplemented with fresh G418 were performed every two days. Following 14 days of selection, 24 G418-resistant colonies were picked, expanded and tested for HOX11 positivity by Western immunoblotting with a HOX11-specific antibody . HOX11-3T3 fibroblasts were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FCS, 2 mM L-glutamine and 1% penicillin/streptomycin. The T cell leukemia cell lines Jurkat  and ALL-Nocodazole treatment was performed 24 hours after seeding, on typically ~60-80% confluent cultures. Phosphoenriched lysates following nocodazole treatment were generated using the PhosphoCruz Protein Purification System (Santa Cruz) according to manufacturer's protocols. Staurosporine (Sigma) was added in conjunction with nocodazole at concentrations of 0, 20, 40, 60, 80 and 100 nM. A dose-response experiment using staurosporine concentrations from 0.05 \u03bcM to 500 \u03bcM indicated drug concentrations did not impact cell viability  according to manufacturer's protocols. Immunoblotting analysis was performed on SDS-separated proteins blotted to nitrocellulose membrane, and probed at various dilutions with a primary antibody recognizing HOX11 , FLAG , pSer (1:100), pThr (1:100), PP1 (1:800), PP2A  and \u03b2-actin  for 4 h at room temperature, followed by three washes with PBST for 20 min each. Membranes were subsequently incubated with either anti-mouse  or anti-rabbit  antibody conjugated to horseradish peroxidase (HRP) for 1 h at room temperature. The anti-pSer and anti-pThr antibodies were obtained from Anaspec, the anti-FLAG antibody was obtained from Sigma. All other antibodies were obtained from Santa Cruz Biotechnologies .Chromatin immunoprecipitations were performed using the Chromatin Immunoprecipitation Kit (Upstate) and a HOX11-specific antibody, clone 1D7,  according to manufacturer's protocols. Primers used for ChIP PCR analyses were:CYCB1-1F: ACTTCATGCTATCAACCTCA; CYCB1-1R: CCTCTTCTATAGAAGTGCCA;CYCB1-2F: CCGCGTTAGTGTTACTGAAA; CYCB1-2R: CAAAGATCTCTATTGCAACTCT; CYCB1-3F: TGTAACCTCAACAATGAGGA; CYCB1-3R: ACACCATCCTGTGCTCTCTA;CYCB1-4F: CAGTCTCCGGTGTGACATAA; CYCB1-4R: GAGACAGGGTTTCTCTGTGT;CYCB1-5F: AACAAGTTCCAGCCTCCACA; CYCB1-5R: CCCATTACCAAGCTAGAGAG;CYCB1-6F: AGGAACAGCCAGAGCTGTTT; CYCB1-6R: AAATGCCAATGGTCTCCCTG.NIH 3T3 fibroblasts were seeded in 24-well dishes 24 hours prior to transfection. Cells were transfected with 0.15 \u03bcg FLAG-HOX11 construct and 0.15 \u03bcg promoter-reporter construct using the Polyfect transfection reagent (QIAGEN). Each transfection was performed in triplicate. Luciferase assays were performed using the Luciferase Reagent Kit (Promega), according to manufacturer's protocols. Briefly, cells were lysed by addition of 200 \u03bcL CCNR lysis buffer, cleared by centrifugation and 20 \u03bcL protein lysate was combined with 100 \u03bcL luciferase reagent immediately prior to measurement in the luminometer. For each sample, arbitrary luciferase units were standardized to protein concentrations.Nuclear extracts were derived from Jurkat cell lines stably expressing an empty Flag vector, Flag-HOX11-wt, Flag-HOX11-T247A or Flag-HOX11-T247E. The oligonucleotide probes derived from the CCNB1 promoter and mutant probe were as follows: 5'-TCCATCCCAGTAATAAGTGTTTT-3' and 5'-TCCATCCCAGTAAGGGCCCTTTT-3'. Double-stranded oligonucleotide probes were generated by annealing equimolar quantities of complementary oligonucleotide in 1\u00d7 annealing buffer . Probes were incubated in 1\u00d7 binding buffer  with 6 \u03bcg nuclear extract in a final volume of 10 \u03bcl.The samples were incubated at room temperature for 30 min and resolved by electrophoresis in 6% polyacrylamide nondenaturing gels in 0.5 \u00d7 TBE at 100 voltage for 30 min. Following electrophoresis, the gels were stained using an EMSA staining kit  and photographed using a 300 nm UV transilluminator.Cells were synchronized at the G1/S checkpoint by culturing for 16 h in 100 \u03bcg/ml aphidocolin, released into S phase by feeding with fresh medium containing 10% fetal calf serum for 4 h, arrested at G2/M by culturing with 60 \u03bcg/ml genistein for 16 h, or trapped in mitosis by using 400 \u03bcg/ml colchicine, 50 nM or 100 nM nocodazole  or 3 \u03bcg/ml cytochalasin B (for cytokinesis arrest following telophase) for 16 h. Cell cycle distribution was determined by propidium iodide staining and flow cytometry. For each sample, 20,000 events were recorded.Cells were co-transfected with a pmax GFP-expressing vector (Amaxa) and either an empty vector, a vector expressing a wildtype HOX11 or a vector expressing the HOX11Thr247Glu mutant. After 24 h, cells were synchronized in mitosis by a 17 h exposure to colchicine (40 ng/ml) or (10 ng/ml) and stained with Hoechst 33342 (10 \u03bcM) in 2% FCS/PBS in 37\u00b0C for 10 min. Mitotic indexes of transfected cells were quantified using immunofluorescent microscopy by scoring the nuclear morphology of 200 GFP-expressing cells, with bright-stained nuclei corresponding to prometaphase arrested cells and dull or diffuse-stained nuclei corresponding to cells that had escaped mitotic arrest. Cells were viewed with an Axiovert 200 M epi-fluorescence microscope using Axiovision Rel. 4.5 software . Each experiment was replicated three times.Cell death was monitored by flow cytometric analysis of cells stained by Annexin V (Biovision ) and propidium iodine (PI) (Invitrogen), as per the manufacturer's protocol. 30,000 cells were analyzed.To assess HOX11 expression levels at various stages of the cell cycle, fibroblast cell lines stably expressing the HOX11 oncoprotein (HOX11-3T3) were treated with various inhibitors to induce cell cycle arrest at different stages. HOX11-3T3 cells were synchronized at the G1/S checkpoint by culturing for 16 h in aphidocolin and released into S phase by feeding with fresh medium for 4 h, arrested at G2/M by culturing with genistein for 16 h, blocked in mitosis by exposure to colchicine or nocodazole for 16 h or arrested during cytokinesis following telophase with cytochalasin B for 16 h. While no dramatic cell cycle-related fluctuations in HOX11 expression levels were detected by immunoblotting, we observed the presence of a gel retarded cross-reacting band when HOX11-3T3 cultures were treated with colchicine or nocodazole Figure , but notThe lower mobility band was detected in a nocodazole dose-dependent manner Figure  and in ain vitro with increasing amounts of alkaline phosphatase for 1 h at 37\u00b0C. Western immunoblotting of the entire reaction confirmed the disappearance of the upper HOX11 band upon alkaline phosphatase treatment  diminished HOX11 phosphorylation following nocodazole treatment, indicating that HOX11 was being phosphorylated on threonine-247  with respect to potential HOX11 binding sites. Chromatin immunoprecipitations (ChIPs) were performed to detect direct HOX11 protein association with putative promoter regions up to 5 kb upstream of the transcription start site (TSS) of the CCNB1 locus. Six different regions at intervals of 700-1000 bp upstream of the TSS were analyzed. Whereas there was minimal amplification of any of the six regions in NIH 3T3 cells not expressing HOX11, we detected HOX11-binding to four of six regions upstream of the CCNB1 gene, with the strongest spanning a region of DNA approximately -4500 to -4300 from the TSS  and CCNB1S-LUC (Short), respectively. NIH3T3 cells were cotransfected with a wildtype HOX11 cDNA and either an empty reporter construct or constructs containing CCNB1S-LUC or CCNB1L-LUC and luciferase activity was measured following 24 hours.In addition to association with the promoter, we assessed the ability of HOX11 to transcriptionally transactivate the CCNB1 TSS.Transfection of the empty vector in the absence of HOX11 showed background levels of luciferase activity whereas cotransfection of the CCNB1S-LUC reporter construct with a vector expressing the wild type HOX11 cDNA resulted in a three-fold increase in luciferase activity , demonstrating that the CCNB1 regulatory elements in the presence of HOX11 were active in NIH 3T3 cells. Cotransfection of the CCNB1L-LUC construct with wild type HOX11 significantly enhanced luciferase activity  Figure . Thus, HCCNB1 promoter whereas the HOX11 T247A mutant showed similar association with the CCNB1 promoter as wild type HOX11 , a frequently used technique to partially mimic the negative charge introduced by a phosphate group. This approach has been used to simulate a phosphorylation-induced alteration of DNA binding activity of other homeodomain-containing proteins ,33. West1 Figure . EMSA an1 Figure . In cont+ Jurkat T-ALL cell line [Given the role of HOX11 in T lymphoid diseases, we sought to determine whether this phenomenon could be recapitulated in a T cell system. Using the T-ALL cell line, ALL-SIL, which carries a t translocation concomitant with high levels of HOX11 expression  and the ell line  transfecWe previously reported that dysregulated expression of HOX11 contributed to the development of lymphoma by allowing cells with missegregated chromosomes to aberrantly bypass the spindle checkpoint although it remained unclear whether this effect was dependent on the Thr247 residue ,29. TherOf note, studies assessing cell death by flow cytometry of annexin V and propidium iodide stained cells indicated that Jurkat cells expressing wild-type HOX11 exhibited a reduced frequency of early-stage apoptotic cells relative to mock and HOX11 T247E transfected cells suggesting that HOX11 confers a survival advantage to cells Figure . CombineHOX11 expression [HOX11 gene was constitutively active, we observed a post-translational modification of HOX11 which correlated with increased numbers of mitotic cells following treatment with microtubule destabilizing compounds. Radiolabelling studies using several HOX11 truncation and point mutants revealed that this modification was the result of phosphorylation of the HOX11 protein at Thr247 within the homeodomain.The multiple reports of deregulation of cell cycle checkpoints associated with perturbations in pression ,25,27-29The 60-amino acid homeodomain is a conserved DNA binding protein domain consisting of an N-terminal arm and three \u03b1 helices that are separated by a loop and a turn. DNA binding of the homeodomain is mediated by the third recognition helix and the N-terminal arm with several conserved amino acids, including Arg3, Arg5, Ile47, Gln50 and Asn51, playing a major role in DNA recognition. Three of the residues, Arg5, Gln50 and Asn51, are conserved in the homeodomains of HOX11 gene family members whereas the two other residues are changed from Arg3 to Lys3 and Ile47 to Thr47. Since both Arg3 and Lys3 have side chains with amine groups this change likely does not affect DNA interactions . In contThe data presented in this report indicated that phosphorylation of HOX11 on Thr247 limited the binding of the HOX11 protein to the promoter region of cyclin B1. Furthermore, HOX11 was phosphorylated only during M phase of the cell cycle resulting in transient inhibition of HOX11 DNA binding activity. Since Thr247 makes specific contact with nucleic acids within the major groove of the DNA double helix, phosphorylation of this amino acid residue places a negative charge close to the phosphates of DNA thereby interfering with DNA binding through electrostatic repulsion. Moreover, replacement of Thr247 with glutamic acid to mimic phosphorylation decreased DNA binding activity. Thus phosphorylation of Thr247 provides a mechanism for cells to inactivate target gene expression as cells enter the M phase and reactivate expression as cells undergo cytokinesis and re-enter the G1 phase of the cell cycle.HOXA9 and HOXA10 homeobox genes are frequently over-expressed in acute myeloid leukemias (AMLs). HOXA9 has been reported to be phosphorylated on serine, threonine and tyrosine residues within its homeodomain with phosphorylation correlating with decreased transforming capability in myeloid and murine bone marrow cells [in vitro and in vivo inhibition of DNA binding activity [Phosphorylation represents a common mechanism in regulating the DNA binding capacity of homeodomain-containing transcription factors including the Drosophilia homeodomain proteins Antennapaedia , Engrailow cells ,53. Two ow cells -49,54. Tow cells  and as aow cells -58. Bothow cells -64. PRH ow cells . In otheow cells ,42,65-67ow cells . Moreoveactivity ,42,66. Tvia Thr247-directed interactions with promoter regions containing the HOX11 consensus recognition sequence TAAGTG, and (2) those regulated through association of promoter regions with HOX11-PBX heterodimers [We observed that the transcriptional activity of the HOX11 oncoprotein was modulated by phosphorylation of the Thr247 residue. Specifically, the ability of HOX11 to modulate levels of cyclin B1 expression was impaired by a form of HOX11 that contained an acid amino acid substitution at Thr247 that mimicked a constitutively phosphorylated HOX11. Moreover, we observed that the Thr247-dependent upregulation of cyclin B1 was associated with dysfunction of the spindle assembly checkpoint. In this respect, our findings are consistent with previous studies in delineating an uncoupling between genes targeted by the Thr247 residue associated with deregulating the spindle assembly checkpoint and HOX11 target genes involved in cell immortalization . These drodimers .Aldh1a1, Wt, c-kit and Vegfc [Aldh1a1 and the oncogenic properties of HOX11 are both dependent on an intact homeodomain [On the basis of the DNA binding activity of the HOX11 homeodomain and its ability to transactivate reporter gene expression through both TATA-containing and TATA-less promoters , it has nd Vegfc ,68-70, hnd Vegfc , Meis [7nd Vegfc  or Groucnd Vegfc  and compnd Vegfc . Howevereodomain ,22 suggeThe physiological relevance of HOX11 phosphorylation was demonstrated with respect to its effects on cyclin B1 expression and spindle assembly checkpoint regulation. Expression of wild type HOX11 increased expression of cyclin B1 and this elevated expression was associated with a reduction in transition time through the G2/M checkpoint, a reduced mitotic index and a reduction in the frequency of early apoptotic cells. In contrast, the threonine-to-glutamic acid substitution mutant resulted in a return to normal levels of cyclin B1 expression, cell cycle kinetics, mitotic index and frequency of early apoptotic cells.Cyclin B1 is the regulatory subunit of cyclin dependent kinase (CDK1). The CDK1/cyclin B1 complex is critical for the control of G2/M transition as it controls the centrosome cycle and the onset of mitosis  but no binding of factors present in Jurkat cells stably expressing the HOX11T247E mutant protein . Mutation of the TAAGTG HOX11 binding site in target oligonucleotides prevented factor binding . The presence of the wild type HOX11 protein and the mutant HOX11T247A protein within the factor complex was confirmed by supershift analysis using an anti-flag antibody. Lane 1: free probe. Lane 2: probe + flag-vector. Lane 3: probe + flag-vector + anti-flag antibody. Lane 4: probe + flag-HOX11-wt. Lane 5: probe + flag-HOX11-wt + anti-flag antibody. Lane 6: probe + flag-HOX11-T247A. Lane 7: probe + flag-HOX11-T247A + anti-flag antibody. Lane 8: probe + flag-HOX11-T247E. Lane 9, probe + flag-HOX11-T247E+ anti-Flag antibody.Click here for fileEnhanced viability of Jurkat cells stably expressing HOX11. Jurkat cells stably expressing an empty flag-vector, flag-HOX11-wt or flag-HOX11-T247E cDNA were subjected to mock Amaxa nucleofection in Solution V using program X-001. Cells were stained with Annexin V and propidium iodide (PI) and analyzed by flow cytometry to assess cell death prior to nucleofection and 2 days post nucleofection. Numbers shown in lower right quadrants indicate percentages of early apoptotic cells. The results are representative of three independent experiments.Click here for file"}
{"text": "This formulation is repeated twice in the asymmetric unit as the rubidium cation lies on an inversion centre. Each anion or acid mol\u00adecule is linked to two rubidium cations, while the rubidium cation has close contacts to four symmetry-equivalent organic ligands, with two different coordination modes towards this cation. In addition, each rubidium cation is coordinated by two water O atoms, raising the coordination number to eight. One of the carboxyl groups of the acid holds its H atom, which forms a hydrogen bond to a coordinated water mol\u00adecule. The other carboxyl group is deprotonated in half of the ligands and protonated in the other half, taking part in a strong O\u2014H\u22efO hydrogen bond disordered over an inversion centre. The stabil\u00adization of the crystal structure is further assisted by O\u2014H\u22efO and O\u2014H\u22efN hydrogen-bonding inter\u00adactions involving the water mol\u00adecules and carboxyl\u00adate O atoms.The structural unit of the title compound, [Rb(C DOI: 10.1107/S1600536809002001/hg2450Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "In the ligands, the imidazole units are protonated and two of the hydr\u00adoxy O atoms of the phospho\u00adnate groups are deprotonated and chelate the MnII, thus forming the neutral mol\u00adecule of the title compound. The two protonated O atoms within the phospho\u00adnate groups of one imhedpH3\u2212 ligand act as hydrogen-bond acceptors for a bifurcated hydrogen bond originating from the coordinated water mol\u00adecule. The phospho\u00adnate units of neigboring mol\u00adecules are connected with their equivalents in neighboring mol\u00adecules via two types of inversion-symmetric hydrogen-bonding arrangements with four and two strong O\u2014H\u22efO hydrogen bonds, respectively. The two inter\u00adactions connect mol\u00adecules into infinite chains along [111] and [110], in combination forming a tightly hydrogen-bonded three-dimensional supra\u00admolecular network. This network is further stabilized by additional hydrogen bonds between the protonated imidazole units and one of the coordinated P\u2014O O atoms and by additional O\u2014H\u22efO hydrogen bonds between the water mol\u00adecules and the P=O O atoms of neigboring mol\u00adecules.In the title compound, [Mn(C DOI: 10.1107/S160053680905065X/zl2255Isup2.hklStructure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
{"text": "The hydrogen bond patterns between mainchain atoms in protein structures not only give rise to regular secondary structures but also satisfy mainchain hydrogen bond potential. However, not all mainchain atoms can be satisfied through hydrogen bond interactions that arise in regular secondary structures; in some locations sidechain-to-mainchain hydrogen bonds are required to provide polar group satisfaction. Buried polar residues that are hydrogen-bonded to mainchain amide atoms tend to be highly conserved within protein families, confirming that mainchain architecture is a critical restraint on the evolution of proteins. We have investigated the stabilizing roles of buried polar sidechains on the backbones of protein structures by performing an analysis of solvent inaccessible residues that are entirely conserved within protein families and superfamilies and hydrogen bonded to an equivalent mainchain atom in each family member.We show that polar and sometimes charged sidechains form hydrogen bonds to mainchain atoms in the cores of proteins in a manner that has been conserved in evolution. Although particular motifs have previously been identified where buried polar residues have conserved roles in stabilizing protein structure, for example in helix capping, we demonstrate that such interactions occur in a range of architectures and highlight those polar amino acid types that fulfil these roles. We show that these buried polar residues often span elements of secondary structure and provide stabilizing interactions of the overall protein architecture.Conservation of buried polar residues and the hydrogen-bond interactions that they form implies an important role for maintaining protein structure, contributing strong restraints on amino acid substitutions during divergent protein evolution. Our analysis sheds light on the important stabilizing roles of these residues in protein architecture and provides further insight into factors influencing the evolution of protein families and superfamilies. As Pauling and Corey realised, satisfaction of hydrogen bonding potential of polypeptide mainchain functions is one of the major factors that give rise to the \u03b2-strand and \u03b1-helix ,2. TheseHowever, these elegant architectures still leave many mainchain functions unsatisfied in their potential to form hydrogen bonds: an early survey of hydrogen bonding in proteins revealed that ~40% of mainchain atoms do not form hydrogen bonds with other mainchain atoms . In gene(1) Where strands and helices terminate, requiring \"capping\" -10.(2) Where helices and strands bulge ,12 or be(3) In polyproline or irregular, twisted strands ,16(4) In arches and turns -5,17,18.Water molecules or sidechains can usually satisfy the hydrogen bonding potential of mainchain functions that are at the protein surface in a variety of ways and so the residues are often substituted in evolution. However, in the smaller proportion of functions that must be satisfied from the core of the protein, this is achieved by buried sidechains of polar residues.Analysis of the substitution patterns of amino acids within homologous protein families has revealed that buried polar residues that are hydrogen-bonded to mainchain amide atoms are highly conserved, more so than those polar residues forming hydrogen bonds to mainchain carbonyl atoms or other sidechains ,20. Furtin silico analyses of the stabilizing roles that polar sidechains have on the backbone of protein structures have tended to focus on a particular architectural context [Previous  context ,23,24. B context  identifiIn this report we focus purely on buried polar residues that are entirely conserved within protein families and superfamilies, hydrogen bonding to a mainchain atom in each family member. We hypothesise that such buried sidechain-to-mainchain hydrogen bonds satisfy mainchain hydrogen bonding potential where secondary structures cannot be formed, and in so doing become irreplaceable elements of the overall architecture. In order to test this hypothesis we characterize the nature and tertiary structural context of these conserved and buried polar residues. We show that polar sidechains which bridge to mainchain functions in the cores of proteins have conserved tertiary structural roles in homologues. Like the elements of secondary structure, they are born of the need to satisfy hydrogen bonding but, in achieving this, they become key, conserved structural features of many well-known protein architectures. Some are joists or braces, spanning the helices and strands, while others form truss-like structures that support complex loop structures Figure .In HOMSTRAD , a databFor conserved and buried polar residues making hydrogen bonds to mainchain NH functions in the N-terminal regions of \u03b1-helices, cysteine has the highest propensity to form such interactions, followed by negatively charged aspartate, histidine and glutamate  was used to define solvent inaccessible (buried) residues. In order to avoid redundancy, where protein families overlapped, the family with the highest sequence coverage was chosen for the analysis.Protein families containing five or more members were selected from HOMSTRAD where the family alignment contained a conserved, buried polar residue and where the sidechain of the polar residue forms a hydrogen bond to a mainchain atom in each family member. The JOY alignmenHBOND . HBOND identifies all possible hydrogen bonds based on a distance criterion (3.5\u00c5 between donor and acceptor).Hydrogen bond partner(s) to the conserved, buried polar residues were identified using the program, PROMOTIF, to identify the structural context of the conserved polar residues and their interaction partners [We used the program, partners . The fol1. \u03b1-helices  to N-(N+3) for N-terminal residues and N-3 to N+1 for C-terminal residues (where N is the length of the helix).10 helices2. 33. \u03b2-strands - edge strands were distinguished from centre strands by referring to the number of hydrogen bonding partner strands. Strands defined as having >1 hydrogen bonding partner strand were defined as centre and all others as edge.4. \u03b2-hairpins5. Coil regionsSEGNO[We also identified polyproline helices using the program SEGNO.x to form hydrogen bonds to mainchain atoms in a particular architectural context Parch was calculated using the following equation:The propensity of a particular residue type narch(x) is the number of residues of type x forming hydrogen bonds to mainchain atoms in a particular architectural context, Nx )  is the total number of residues forming hydrogen bonds to mainchain atoms in a particular architectural context and Ntotal)  Polar residues which are entirely conserved, buried in each family member and forming a hydrogen bond to a mainchain atom group in each family member. These numbers were therefore derived from the 233 alignment positions identified in the 66 families.(ii) All polar residues in the 131 family set, regardless of solvent accessibility and conservation but where the polar residue forms a hydrogen bond to a mainchain atom group.CLW participated in the design of the study, performed the computational experiments, analysed the data and drafted the manuscript. TLB conceived of the study, participated in its design and refined the manuscript. Both authors read and approved the final manuscript.Table of the 131 non-redundant families which were used in the analysis.Click here for fileTable of the families and their members that were used in the analysis.Click here for fileFigures S1 to S6 show the propensity of polar amino acids to form hydrogen bonds to mainchain atoms in the various architectural contexts analysed.Click here for file"}
{"text": "To establish the frequency of necrotizing funisitis in congenital syphilis, we conducted a prospective descriptive study of maternal syphilis in Bolivia by testing 1,559 women at delivery with rapid plasma reagin (RPR). We examined umbilical cords of 66 infants whose mothers had positive RPR and fluorescent treponemal antibody absorption tests. Histologic abnormalities were detected in 28 (42%) umbilical cords , and 38 [58%] were normal. Of 22 umbilical cords of infants from mothers without syphilis (controls), only two (9%) showed mild funisitis; the others were normal. Testing umbilical cords by using immunohistochemistry is a research tool that can establish the frequency of funisitis due to Treponema pallidum infection."}
{"text": "MYH3, TNNI2, or TNNT3 have been found in about 50% of cases. These genes encode proteins of the contractile apparatus of fast twitch skeletal muscle fibers. The diagnosis of SHS is based on clinical criteria. Mutation analysis is useful to distinguish SHS from arthrogryposis syndromes with similar features . Prenatal diagnosis by ultrasonography is feasible at 18\u201324 weeks of gestation. If the family history is positive and the mutation is known in the family, prenatal molecular genetic diagnosis is possible. There is no specific therapy for SHS. However, patients benefit from early intervention with occupational and physical therapy, serial casting, and/or surgery. Life expectancy and cognitive abilities are normal.Sheldon-Hall syndrome (SHS) is a rare multiple congenital contracture syndrome characterized by contractures of the distal joints of the limbs, triangular face, downslanting palpebral fissures, small mouth, and high arched palate. Epidemiological data for the prevalence of SHS are not available, but less than 100 cases have been reported in the literature. Other common clinical features of SHS include prominent nasolabial folds, high arched palate, attached earlobes, mild cervical webbing, short stature, severe camptodactyly, ulnar deviation, and vertical talus and/or talipes equinovarus. Typically, the contractures are most severe at birth and non-progressive. SHS is inherited in an autosomal dominant pattern but about half the cases are sporadic. Mutations in either  Sheldon-Hall syndrome (SHS);Distal arthrogryposis type 2B (DA2B);Freeman-Sheldon syndrome variant;Arthrogryposis multiplex congenita, type II.Sheldon-Hall syndrome  or distal arthrogryposis type 2B (DA2B) is an autosomal dominant disorder characterized by congenital contractures of the distal joints of the limbs without a primary neurological defect. SHS is similar to another distal arthrogryposis called Freeman-Sheldon syndrome (FSS or DA2A), first described by Freeman and Sheldon in 1938, but distinguished as a separate entity in 1997 [The prevalence of arthrogryposis is about 1/3000 [The major clinical features of SHS are summarized in Table Among the facial characteristics of SHS the most common finding is a narrow face that is pointed at the chin giving the face a triangular appearance. High arched palate and micrognatia are also very common. Down slanting palpebral fissures are seen in some individuals. Other facial findings include small mouth, high nasal bridge, prominent nasolabial folds, bulbous nose, malar hypoplasia, facial asymmetry, hypertelorism, and posteriorly angulated ears or some other ear abnormalities . Overalle.g., elbow, shoulder, knee, and hip) also can be affected. Contractures of the upper limbs typically manifest as overlapping fingers, camptodactyly, and ulnar deviation. Talipes equinovarus, valgus abnormalities, overlapping toes, vertical talus, and tarsal fusion are the most common findings in the lower limbs. The severity of contractures can vary substantially between upper and lower limbs, and the left and right sides of the body. An affected individual might have both equinovarus and calcaneovalgus abnormalities in his/her feet. Contractures are most severe at birth and non-progressive. However, flexion contractures can worsen over time in the absence of appropriate intervention .In an isolated case, the presence of congenital contractures is mandatory in order to entertain the diagnosis of SHS. The joints of the hands, wrists, feet, and ankles are most commonly involved although more proximal joints  and troponin T (TNNT3), and embryonic myosin (MYH3) [TNNI2, TNNT3, or MYH3, large deletions of these genes, or mutations in other as of yet unidentified genes.SHS is caused by mutations in the genes that encode fast twitch skeletal muscle isoforms of troponin I (n (MYH3) -7. MutatTNNI2 gene which is located on the short arm of chromosome 11 (11p15.5). Troponins are muscle proteins that are part of the contractile apparatus. To date, 4 different TNNI2 mutations have been reported in DA2B patients: p.R156X, p.R174Q, p.E167del, and p.K175del [TNNI2 cause contractures is unclear but troponin I binds to actin and tropomyosin, and in the absence of Ca2+ prevents muscle contraction. In vitro and ex vivo contractility studies of troponin I mutants suggest that p.R156X and p.R174Q increase muscle contractility via increasing Ca2+ sensitivity [2+ levels.The fast twitch skeletal muscle troponin I is encoded by the .K175del . All of TNNT3 gene, which is near TNNI2 on chromosome 11p15.5, was considered a positional and functional candidate [2+-dependent force generation [The andidate . It encoandidate . This muTNNI2 or TNNT3, giving priority to genes expressed during prenatal or perinatal development. This eventually led to the screening of the gene that encodes embryonic myosin heavy chain (MYH3). Mutations in MYH3 were found in 5 of 12 familial (42%) and 7 of 26 sporadic (27%) cases [MYH3 mutations were predicted to affect the formation and stability of the contractile apparatus. Collectively, mutations in the MYH3, TNNI2, and TNNT3 genes account for about half of all studied cases of SHS.After it became evident that SHS was caused by defects of the contractile apparatus of fast-twitch myofibers, we investigated whether SHS could be caused by mutations in genes that encode other proteins of the contractile apparatus . The genTNNI2, TNNT3, or MYH3 have phenotypes that cannot be distinguished from one another. Even individuals with the same mutation exhibit widely variable clinical findings. Nevertheless, an important caveat is that a relatively small number of cases with any specific mutation have been studied, and the phenotypic information from many of these cases is incomplete. Overall, more cases need to be studied to rigorously evaluate if there is a substantial correspondence between genotype and phenotype in individuals with SHS.Extensive within and between family phenotypic variation is observed in SHS. Both the specific joints affected and the degree to which joints are affected varies. The basis of this variability is unclear but could arise by several different mechanisms or a combination thereof as none are mutually exclusive. First, mutation in different genes could cause different phenotypes. However, none of the phenotypic variability between families appears to correspond to disruption of specific proteins much less specific genotypes. In other words, individuals with a mutation in either MYH3 mutations that cause SHS are distinct from those that cause FSS [ause FSS . Almost The diagnosis of SHS is based on clinical characteristics ,4. The mOccasionally women may note decreased fetal movements, but they might also be normal. The clinical findings of SHS can be detected prenatally by ultrasonography. However, detection may not be possible until 18\u201324 weeks of gestation. If the family history is positive and the mutation is known in the family, prenatal molecular genetic diagnosis is possible .de novo mutations. The recurrence risk in such families is low but recurrent \"de novo\" mutations in several families with DA suggest that germline mosaicism does occur in DA.SHS is a monogenic disorder with autosomal dominant inheritance. Affected individuals have a 50% risk of transmitting the disease to their offspring. However, many of the patients reported to date have had e.g., diagnosis is in question). Since the majority of mutations have been found in MYH3, this gene should be screened first. If no mutations are found in MYH3, TNNI2 and TNNT3 genes should also be sequenced.Mutation analysis of the known genes should be offered to affected individuals in certain circumstances , however, SHS does not include trismus of the jaw, which is a unique characteristic of DA7.There is no specific treatment for SHS. The contractures occur early in development and they improve postnatally. Although some spontaneous improvement might be expected, prolonged use of braces and casts, or multiple surgeries to correct the limb contractures are often required. Most patients will benefit from physical therapy, which should start soon after birth.Individuals with SHS have a normal life expectancy. Hearing, vision, speech, and motor development should be checked as appropriate. The majority of the patients will require series of orthodontic treatment as well as prolonged orthopedic management. Surgical procedures can be complicated by difficult intravenous access, laringoscopy, and spinal anesthesia. In addition, there is evidence to suggest that individuals with DA syndromes including SHS are at higher risk for malignant hyperthermia .MYH3, TNNI2, or TNNT3 genes. It needs to be addressed whether these patients have mutations in another gene or mutations in regulatory regions of these genes. With respect to the latter, there are no known families that map to any of the known loci and in whom mutations have not been identified. The molecular mechanism underlying the contractures is not well understood. Some mutations appear to increase contractility, although this has not yet been confirmed in ex vivo studies of myofiber contractility in affected individuals. Finally, the SHS phenotype starts to develop in utero, suggesting that a clear understanding of how muscle development is perturbed in SHS will require studies in animal models.Almost 50% of the patients affected with SHS, do not have mutations in MYH3: embryonic myosin heavy chain; SHS: Sheldon-Hall syndrome; TNNI2: troponin I2; TNNT3: troponin T3.DA: distal arthrogryposis; FSS: Freeman-Sheldon syndrome; MIM: Mendelian Inheritance in Man; Written consent for publication of the clinical picture was obtained from the patient.The authors declare that they have no competing interests.RMT wrote the first draft of the manuscript; both authors revised the manuscript and approved the final version."}
{"text": "Flexible electronics sensors for tactile applications in multi-touch sensing and large scale manufacturing were designed and fabricated. The sensors are based on polyimide substrates, with thixotropy materials used to print organic resistances and a bump on the top polyimide layer. The gap between the bottom electrode layer and the resistance layer provides a buffer distance to reduce erroneous contact during large bending. Experimental results show that the top membrane with a bump protrusion and a resistance layer had a large deflection and a quick sensitive response. The bump and resistance layer provided a concentrated von Mises stress force and inertial force on the top membrane center. When the top membrane had no bump, it had a transient response delay time and took longer to reach steady-state. For printing thick structures of flexible electronics sensors, diffusion effects and dimensional shrinkages can be improved by using a paste material with a high viscosity. Linear algorithm matrixes with Gaussian elimination and control system scanning were used for multi-touch detection. Flexible electronics sensors were printed with a resistance thickness of about 32 \u03bcm and a bump thickness of about 0.2 mm. Feasibility studies show that printing technology is appropriate for large scale manufacturing, producing sensors at a low cost. We also use an algorithm matrix and control system scanning to solve the array matrix for multi-touch switch identification in the tactile sensors. Flexible electronics actuators for realizing large scale and low-cost applications have been gradually developed in recent years ,12. EspeWe have designed a gap between the bottom electrode and the resistance layer to eliminate erroneous signals during bending actions. For optimal flexible structure characteristics, a protrusion (bump) on the top membrane is used to enhance the sensing sensitivity response. A high viscosity thixotropic material is used to print the thick bump structures to reduce the diffusive effects and dimensional shrinkage after printing and curing. Mechanical properties were investigated by analysis of the deflection and stress distributions using finite element analysis (FEA). The feasibility of fabricating low-cost printable sensors for applications in flexible electronics is demonstrated.2.2.1.This study used commercial PI films and screen printing technology to design and fabricate a flexible large area electronics sensor. PI films with copper foils are widely used in flexible electronics sensors for flexible printed circuits -28. The 4 for electroless plating of Au, to a thickness of about 5 \u03bcm, to avoid the oxidation of the copper foil. Next, a cover layer with lattice patterns was laminated on the bottom film using hot pressing to form post structures (II). The hot-press process was performed at a temperature of 180\u00b0C for 20 minutes.First, the electrode patterns on the bottom film with a 12 \u03bcm copper foil (I), were defined for column and sensing electrodes using the photolithography method. The bottom film was then put into a solution of CuSO4cp and a glass transition temperature of 190\u00b0C, was printed on sensing electrode areas using a screen stencil mask. The organic resistance was synthesized using a phenolic resin, organic solvents, filler, and carbon black. The phenolic resin is a bisphenol A (C15H16O2) type of organic compound with two phenol functional groups. The organic solvents included dimethylformamide (formula C3H7NO) and diethylene glycol monobutyl ether (formula CH3CH2OCH2CH2OCH2CH2OH). Dimethylformamide , is a hydrophilic aprotic solvent of the organic compound material that facilitates chemical reactions by polar mechanisms. Diethylene glycol monobutyl ether [2-(2-butoxyethoxy)ethanol], is the main dispersing agent for the synthetic resin and filler. The filler and carbon black are 25.6 wt% and 12.0 wt%, respectively.The second part of the top film, which contains the row electrodes (i), is similar to that of the bottom substrate, except that it has pass-through holes that were drilled using the punching method. Cu was coated on the side of these holes using a chemical plating to transfer the output signal from the back to the top view of top film. An organic resistance material (ii), Model EPO 4X330, with a viscosity of 8 \u00d7 106cp and a glass transition temperature of 150\u00b0C was printed on the top film using a screen stencil mask to form bump structures (iii). The bump structures were formed after being cured at a temperature of 150\u00b0C for 45 minutes. Finally, both PI films were aligned and assembled to form a flexible electronics sensor using adhesive (III), type Cemedine Super-X No.8008  which was printed on the top of the post surface using screen technology.For organic resistance printing, the stencil mask was a stainless steel sheet, which was made using chemical etching techniques. The printing header was a rubber squeegee of type A with a durometer of 70 and a printed angle of 45\u00b0. After top electrode and organic resistance fabrication, the film was turned over. A thixotropic material, type EPO 4X282H, with a viscosity of 102.2.1 to E4 has only an ON/OFF switch function, with R11, R12, R21, and R22 ignored, as shown in the upper left of 1, E2, and E3, then E4 will be misread as also being touched because all column and row electrodes are mutually conductive during the column and row scanning processes. An organic resistance material was printed on the surface of the sensing electrodes and an algorithm matrix and control system scanning were used to solve this problem. The schematic control system for multi-touch switching applications is shown in mnR (m \u00d7 n array elements with a resistance of R) had a pitch of 5 mm with 25 \u00d7 25 elements.In general, in array switch elements for multi-touch use without a resistance layer, it is very difficult to correctly identify which elements are really touched. For example, a 2 \u00d7 2 matrix sensor with elements ED, VG, \u2026, VG,\u201d outputs \u201c1,0, \u2026, 0\u201d for all columns, indicating that only column 1 was driven. Then, port B sets the impedances of all rows to \u201chigh, low, \u2026, low\u201d and is changed to detect all row data. R11 can be detected using algorithm matrix operating. The equivalent circuit of the algorithm matrix for row 1 is shown in In the multi-touch detection process, the parallel buffer IC outputs serial digital data to columns via port A. Only one column is the high bit, 1, and the others are the low bit, 0. Port B first sets the serial data to all rows. One row is high impedance and the others are low impedance. Then, port B is changed to detect all row data to identify which elements were touched. For instance, the serial digital data of port A, \u201cVSimilarly, the serial digital data of port A outputs \u201c0,1,0, \u2026, 0\u201d for all columns.1n=0AY, can be formed as follows:DV is the driving voltage of the microcontroller, entries 11V to 1nV are the voltage values of row 1, and 11Y to 1nY are the conductance values of the resistance at row 1, with 1n=1/R1nY. To solve the linear equations, Gaussian elimination was performed in row-echelon form to reduce the matrix. Then, the back-substitution method was used to solve the final equations of 1nY for multi-touch identification. The average value of resistance of elements after the voltage scanning and calculations was about 2.8 k\u03a9. Similarly, rows 2 to m can be scanned using the same methods to detect the signals. It is noteworthy that the microprocessor for scanning one column and solving the algorithm takes about 0.015 seconds, indicating a response frequency of 150 Hz. The sensor array of our study is 25 \u00d7 25, so this is not a problem for our system. However, we think that solving bigger matrixes will create some problems. Maybe the scanning array matrixes can be segmented and a sub-microprocessor can be used to solve the algorithm equations.Therefore, the algorithm matrix of row 1, 2.3.f, in the z direction, as shown in dx dy, forces of magnitude Pdx and Pdy act on the sides parallel to the y and x axes, respectively. The forces, F, acting along the z direction due to these forces are:P and \u03b4 are the pressure and the deflection at the membrane center, respectively.Consider a square plate for a linear motion equation, simply supported on all edges and subjected to a distributed load, f\u00b7dx\u00b7dy. Hence, the membrane bending by moments distributed can be obtained for the forced transverse vibration in z direction [The pressure force along the z direction is irection ,31:(5)where mt and 0w are the membrane thickness and width, respectively, and E and \u03bd are the material Young's modulus and Possion's ratio, respectively. C and \u03b1 are the coefficients, which are 21.62 \u00d7 (1.41-0.292 \u00d7 \u03bd) and 1.26 \u00d7 10-3 [E = 2.5 GPa, \u03bd = 0.34, mt = 50 \u03bcm, and 0w = 5 mm when a pressure of P = 400 MPa is applied on the membrane. The central deflection is 3.59 \u00d7 10-4 m.The result of the applied pressure and the membrane deflection is given by:3.3.1.The design and simulation of a flexible electronics sensor for static tactile analysis with a large deflection were carried out using commercial FEA, ANSYS v.10.0. The effects of the membranes without bumps, with bumps, and with bumps and a resistance layer were used to analyze the deflection characteristics after a constant force was applied on the top surface. The membranes for the simulations, with a constant thickness of 50 \u03bcm, were square-shaped suspension structures. Bump sizes with width ratios of 0.2 to 1, relative to the membrane width, and with thicknesses of 0.05, 0.2, and 0.5 mm were considered. During the simulation, all elements were defined by eight nodes with three degrees of freedom at each node. A free mesh with tetrahedral-shaped elements was used to simplify the geometry creation.max\u03b4, increased with increasing applied force, as shown in For boundary condition settings, the displacements in the bottom of the posts were fixed in all degrees of freedom and the constant forces from 0.5 to 10 N were applied on the top membrane. Young's modulus, Poisson's ratio, and the density of the PI film were 2.5 GPa, 0.34, and 1.42 g/ml, respectively. The simulation results show that the maximum deflection of all cases, W and bt, are shown in The effects of width and thickness of various bumps, 3, respectively. The maximum deflections and stresses of the membrane with a bump structure after applying a constant force of 5 N were 0.196 mm and 485 MPa, respectively, as shown in The mechanical characteristics analyses, deflections, and von Mises stress distributions of membranes with bumps and of those with bumps and a resistance structure, are shown in 3.2.2, containing 25 \u00d7 25 arrays of sensing pads and bumps, respectively, as shown in The flexible electronics of tactile sensors were successfully fabricated using two PI films. The thicknesses of the top and bottom were 50 and 125 \u03bcm. The effective area was 15 \u00d7 15 cm3, were printed on the top PI film to provide a concentrated force for enhanced touch sensitivity. Results show that bump shapes had excellent morphological profiles, as shown in The bump structures, 2 \u00d7 2 \u00d7 0.2 mmp - WiW) / iW \u00d7 100 %, where iW and pW are the original width and the printed width, respectively. To analyze the printed characteristics, it is necessary to measure the dimensional diffusion and average thickness. The dimensional diffusion ratio of structure dimensions after printing and curing is presented as  with an accuracy of 0.1 N and a cylinder tip with a radius of 0.5 mm, a 6 axis micro-stage, an LCR meter, and a motor controller with a displacement accuracy of 1 \u03bcm.3.3.1.For dynamic response measurement, a trapezoid force with a maximum force of 5 N, parallel to the y-axis in the xy-plane, was applied to the elements. The sensing mechanism of the dynamic response is based on the impedance change of resistance after contact. When a force is applied on a bump and the organic resistance layer is compressed, the sensing electronics of the top and bottom conduct the impedance changes. The equivalent circuit of sensing impedance is similar to a variable resistor. 3.3.2.1 to P5 indicate the measurement points at the center and 4 apexes of the array sensor, respectively. Results show that the impedance values sharply decreased with increasing compression force. The characteristic trend of the resistance material after fabricating was similar at the different measurement points. The characteristic output versus compression forces can approximate to linear logarithm regression. Therefore, for multi-touch switch sensing, the thresholds of the resistance response were determined according to the compression forces.For contact characteristic measurement, an external force, parallel to the y-axis in the xy-plane, was applied at the top center of the membrane. The displacements of the stages were adjusted to test the compression force versus the characteristic output at the operating frequency of 1 kHz, related to the measurement accuracy of sensing material, in ambient conditions, as shown in The effects of temperature variations from 5 to 95\u00b0C on different structures for switch scanning are shown in 3.3.3.The multi-touch testing of the flexible electronics sensors is shown in \u03b5 is the permittivity of free space, \u03b5 = 8.84 \u00d7 10-12 F/m, and d is the distance between the two substrates. The gap distance, at the radius of infinite curvature, is originally about 41 \u03bcm. The results of the bending tests at different curvature radii versus gap distance are shown in For the bending testing, flexible sensors were simply fixed on different curved surfaces of cylinder molds, with curvature radii of 3, 5, and 7 cm, to test the bending response. During experimental measurements, gap distances after differential bending were calculated using the principle of parallel capacitance, C = (\u03b5 \u00d7A)/d. where A is the area of each plate, 4.This study has successfully developed a flexible electronics sensor for multi-touch switch detection using an algorithm matrix and using screen printing technology for large-scale manufacturing. For printing thick structures, materials with higher viscosity can be used to print excellent morphological profiles, which can greatly reduce the dimension effects of diffusion and shrinkage, enhance the printing resolution, and decrease the cohesive force between the stencil mask and the sensor substrate. In addition, printed material on flexible substrates with a high surface roughness had good printed patterns and adhesive force. The gap within sensor structure provided a buffer distance to avoid erroneous contact during bending action. This sensor, with a minimum curvature radius of about 3 cm, is flexible enough to be applied anywhere without being damaged. We believe that the results of this study can be applied to many fields of flexible electronics sensors and that they provide useful information for designing and fabricating flexible large area devices."}
{"text": "About one-third of patients suffering from systemic lupus erythematosus have ocular manifestations. The most common manifestation is keratoconjunctivitis sicca. The most vision threatening are retinal vasculitis and optic neuritis/neuropathy. Prompt diagnosis and treatment of eye disease is paramount as they are often associated with high levels of systemic inflammation and end-organ damage. Initial management with high-dose oral or IV corticosteroids is often necessary. Multiple \u201csteroid-sparing\u201d treatment options exist with the most recently studied being biologic agents. Systemic lupus erythematosus (SLE) is a chronic, autoimmune, connective tissue disorder affecting multiple organ systems often with a relapsing and remitting clinical course. Prevalence, clinical manifestations, and morbidity vary significantly between the developing and industrialized worlds. While SLE is more common in people of African and Asian descent, thrombotic complications are more common in Caucasian patients . The higConcordance rates for SLE among monozygotic and dizygotic twins are 25% and 2%, respectively, suggesting a significant genetic contribution . Major h\u03b1-actinin. Two major theories exist on how these autoantibodies cause tissue damage. The first model suggests that anti-double-stranded DNA antibodies bind to circulating nucleosomes to form immune complexes that then get deposited in end-organ capillary beds such as the renal glomerulus and activate immune/inflammatory responses [SLE is a complex disease process demonstrating dysregulation of the immune system at multiple levels. Autoantibodies against double-stranded DNA were first isolated from kidney specimens in patients with lupus nephritis in 1967 [esponses . The souesponses .\u03b1, INF-\u03b3, IL-10, and B-lymphocyte stimulator. Mass production of autoantibodies relies on multiple factor, which have each independently been targeted as potential immunotherapy in the treatment of lupus. Important steps include T-cell activation via antigen binding to the T-cell receptor and proper costimulation; T-cell activation of B cells; production of cytokines such as TNF-Medications, hormonal influences, and other factors such as sunlight have all been implicated in disease exacerbation. Drug-induced lupus, most commonly due to procainamide, hydralazine, and quinidine, usually presents with disease involving the skin and joints with renal and CNS manifestations being much more rare . HormonaAccording to the 1982 revised criteria for systemic lupus erythematosus, a diagnosis of SLE can be made by the serial or simultaneous presentation of at least 4 of the following 11 criteria: malar rash, discoid rash, photosensitivity, oral ulcers, nonerosive arthritis, serositis, renal dysfunction, neurological derangements , hematologic disorder , immunologic disorder , and presence of antinuclear antibodies. SLE can affect the periorbita, ocular adnexa, eye, and optic nerve. The most common association is keratoconjunctivitis sicca, while the most visually devastating sequelae occur secondary to optic nerve involvement and retinal vaso-occlusion. Orbital involvement is a rare manifestation of SLE. Vasculitis, myositis, and panniculitis have all been described. Signs and symptoms include proptosis, enophthalmos, orbital pain, blurred vision, chemosis, and restriction of extraocular movements. Orbital vasculitis leads to nonperfusion of the globe and extraocular muscles. This has been shown to cause irreversible vision loss secondary to ischemic injury to the optic nerve as well as elevated intraocular pressure from neovascular glaucoma .Orbital myositis is often initially misdiagnosed as bacterial orbital cellulitis, as it usually presents with significant pain, proptosis, periorbital swelling, and globe restriction. CT and orbital ultrasound are both valuable in demonstrating enlargement of one or multiple extraocular muscles. Creatinine kinase, aldolase, and myoglobin levels are markedly elevated. Inflammation and symptoms typically respond to steroids , 13.Subcutaneous inflammation secondary to SLE was first described by Kaposi in 1883, and the term \u201clupus erythematosus panniculitis\u201d was coined in 1940 . It is mPeriorbital edema is an uncommon manifestation of systemic and discoid lupus erythematosus with an overall incidence of 4.8% . It is mTypical lesions of discoid lupus erythematosus are slightly raised, scaly, and atrophic. Most commonly, they occur on the head, face, neck, and other sun-exposed areas. Rarely does it affect the eyelids. Histopathologic study shows a hyperkeratotic epithelium with liquefactive degeneration of the basal layer and a dense perivascular/periappendageal lymphocytic infiltration , 26. DiaThe most common ocular manifestation of SLE is keratoconjunctivitis sicca with the majority of patients endorsing at least one dry eye symptom . DrynessAn abundance of proinflammatory markers such as IL-17 , 32 can Episcleritis is generally a benign inflammation of the episclera. Typically occurring in young women, symptoms include a dull ache, red eye, and tearing. Decreased visual acuity and severe pain are uncommon. Systemic associations are extremely rare in adults, and a systemic workup is not necessary. Incidence in adult patients with SLE has been reported at 2.4% . HoweverScleritis is a more painful and potentially a vision-threatening condition that warrants prompt treatment. Anterior scleritis can be nodular or diffuse and presents with a red, painful eye that is tender to touch. The injected deep episcleral vessels give a violaceous due to the sclera, which is best appreciated in natural light . PosteriCorneal epitheliopathy, scarring, ulceration, and filamentary keratitis can all occur secondary to keratoconjunctivitis sicca. More rare corneal complications include peripheral ulcerative keratitis , which cCorneal biomechanical properties differ in SLE. Yazici et al.  used ReiLupus retinopathy is one of the most common vision-threatening complications of systemic lupus erythematosus with an incidence of up to 29% in patients with active systemic disease. A strong correlation exists between presence of retinopathy and CNS disease . The mosRetinal vasculitis, a subset of retinal vasculopathy featuring inflammation of the retinal arterioles or venules, tends to have poorer visual outcomes and present in an acute onset fashion. A large percentage of these patients have concomitant antiphospholipid antibodies including anticardiolipin and lupus anticoagulant. In one study, 77% of patients with SLE and retinal involvement had positive antiphospholipid antibody titers, whereas only 29% of SLE patients without retinal disease had positive titers . HistopaImmunosuppression has been successful in improving the appearance of the retinopathy; however, visual recovery has only been reported in few cases. The permanent loss of visual acuity is likely due to retinal ischemia. Addition of anticoagulation to immunosuppression helps to stabilize retinal disease and prevent further vascular events . Other tLupus choroidopathy with exudative retinal detachments is a rare ocular manifestation with fewer than 40 patients reported in the literature . It is gRecently, ICG imaging has been used to visualize the choroidal circulation in lupus choroidopathy. Studies have shown focal, transient early-phase hypofluorescence followed by late-phase diffuse hyperfluorescence, distortion of the large choroidal vessels, and also focal clusters of choroidal hyperfluorescence in the intermediate phase. Transient early hypofluorescence and late hyperfluorescence are likely secondary to choroidal vascular perfusion delay with subsequent leakage due to an increase in vascular permeability, which are also observed in other vascular and inflammatory diseases. Unique findings include focal areas of hyperfluorescence in the intermediate frames, which may represent ICG staining of immune complexes . Although it is a marker of high disease activity, lupus choroidopathy has been shown to be responsive to corticosteroids and other forms of immunosuppression. Given its associations with CNS and renal disease, the presence of choroidopathy is likely an indication for aggressive, long-term immunosuppression. Optic nerve disease is a rare manifestation of SLE and consists of optic neuritis and ischemic optic neuropathy . PresentThe neuromyelitis optica spectrum disorders (NMOSDs) are characterized by a combination of optic neuritis and transverse myelitis. Few cases have been reported in the literature of the presentation of NMOSD in SLE \u201368. A reOptic neuropathy in SLE is caused by an ischemic process that affects the small vessels supplying both the optic nerve head and retrobulbar nerve. It usually presents as an acute loss of vision with an altitudinal visual field defect with or without optic disc edema. The disease is most commonly bilateral except in patients with circulating antiphospholipid antibodies. In this subset, a focal thrombotic event in the ciliary vasculature is thought to occur as opposed to a generalized vasculitis . StandarEye movement abnormalities are common in SLE and have been reported in up to 29% of patients . IschemiRetrochiasmal involvement can cause visual hallucinations, visual field defects, nystagmus, and cortical blindness. Few cases of idiopathic intracranial hypertension have been reported. 60% of cases reported in the literature are associated with antiphospholipid antibodies . Treatment options for SLE range from nonsteroidal anti-inflammatory drugs, corticosteroids, antimalarials, immunomodulatory, and biologic agents. Significant ocular involvement\u2014orbital inflammation, scleritis, retinal vasculitis, choroiditis, and optic neuritis\u2014warrants systemic therapy. The goal of treatment is to suppress immune activity, specifically decreasing the level of autoantibodies. Corticosteroids are the mainstay and most effective short-term therapy for SLE . They inSteroid-sparing immunosuppressive agents are used in a large amount of patients secondary to treatment failure or harmful side effects of corticosteroids. Antimalarials such as chloroquine and more commonly hydroxychloroquine are often used. These medications are highly efficacious in curtailing future flares with fewer side effects compared to other immunomodulatory drugs such as alkylating agents. However, ocular effects of these drugs are well known. Irreversible vision loss secondary to a drug-induced maculopathy has been well documented in the literature. Factors associated with high risk of developing maculopathy include greater than 5\u20137 years of therapy, greater than a cumulative dose of 1000\u2009g of hydroxychloroquine, impairment of liver or kidney function, obesity, age greater than 65, and preexisting retinopathy. The American Academy of Ophthalmology recommends a baseline-dilated eye exam on all patients starting hydroxychloroquine followed by annual exams starting at 5 years after initiating therapy. A Humphrey 10\u20132 automated visual field test along with multi-focal electroretinogram, spectral domain optical coherence tomography, or fundus autofluorescence should be performed at each of these visits. Discontinuation of the drug should be recommended at the earliest sign of toxicity . UnfortuMethotrexate, azathioprine, mycophenolate mofetil, cyclosporine A, cyclophosphamide, and chlorambucil have all been employed with varying degrees of success. In the past few years, newer drugs, categorized as biological agents, have emerged targeting specific molecules involved in B- and T-cell activation. One of the first to be utilized in SLE was rituximab, a chimeric murine/human anti-CD20 antibody. Multiple studies have shown clinical improvement in refractory patients , 87. RitIn summary, a myriad of ocular manifestations of systemic lupus erythematosus have been described, and in some patients, these findings may be a presenting sign of systemic disease. Moreover, their presence can be a sign or a marker of disease activity. In the cases of choroidopathy and retinopathy, ophthalmic findings can be a poor prognostic systemic risk factor with the potential for both ophthalmic and systemic morbidity. For this reason, treatment typically involves a considered assessment of both the systemic and ophthalmic findings in determining the proper therapy and duration of treatment. Close communication between the consultant ophthalmologist and treating rheumatologist is critical in the effective management of these complex clinical situations."}
{"text": "Tornadoes can cause catastrophic destruction. Here total kinetic energy (TKE) as a metric of destruction is computed from the fraction of the tornado path experiencing various damage levels and a characteristic wind speed for each level. The fraction of the path is obtained from a model developed for the Nuclear Regulatory Commission that combines theory with empirical data. TKE is validated as a useful metric by comparing it to other indexes and loss indicators. Half of all tornadoes have TKE exceeding 62.1 GJ and a quarter have TKE exceeding 383.2 GJ. One percent of the tornadoes have TKE exceeding 31.9 TJ. April has more energy than May with fewer tornadoes; March has more energy than June with half as many tornadoes. September has the least energy but November and December have the fewest tornadoes. Alabama ranks number one in terms of tornado energy with 2.48 PJ over the period 2007\u20132013. TKE can be used to help better understand the changing nature of tornado activity. On average about 1,000 tornadoes occur each year in the United States; more than in any other country . SimilarStorm Data, which includes all known tornado reports dating back to 1950. Each report in the database gives the tornado touchdown location (latitude and longitude), date, length and width of the damage path, and maximum damage rating on a scale from 0 to 5.Current understanding of tornado destruction comes largely from available data records. The Storm Prediction Center\u2019s (SPC) severe weather database is the most extensive set of historical tornado records in the world. Information in the database is compiled from the National Weather Service\u2019s (NWS) The frequency of tornadoes by damage rating is a way to compare tornado occurrences collectively. For instance, Elsner et al.  show thaBy multiplying the path area by the damage rating and summing over all tornadoes in a given day, Thompson and Vescio  define aThe DPI and TDI are useful for summarizing a collection of tornadoes (tornado days for the DPI and tornado years for the TDI) and for comparing outbreaks. Here interest centers on kinetic energy of individual tornadoes. An estimate of KE is made in Agee and Childs  using thIn this study an estimate of total kinetic energy (TKE) is made for all tornadoes in the SPC database from 2007 when the Enhanced Fujita (EF) scale became operational, through 2013. The method uses the fraction of the tornado path experiencing EF damage and a characteristic wind speed for each EF rating . Since tThe SPC maintains the most readily available tornado database in the world. Tornado reports in the database extend back to 1950. Relevant to this study per-tornado information includes occurrence time, location, damage rating, path width, path length, injuries, fatalities, and property loss. Here all tornadoes between 2007 and 2013 are used. The start year of 2007 coincides with the adoption of the EF Scale by the NWS.\u22121 and EF4 damage corresponds to wind speeds between 75 and 89 m s\u22121 .Post storm surveys of the destruction in the wake of a tornado allow engineers to rate the damage on a scale from zero to five. Historically the damage scale was related physically to the tornado wind speed , 12. TodA tornado\u2019s EF rating is assigned based on the greatest damage observed within the tornado\u2019s path . The EF Estimates of tornado energy are not directly available in the database. The goal of this paper is to improve the understanding of tornado climatology through two objectives. The first is to use the available information to compute total kinetic energy of each tornado in the database. The second is to use the estimated kinetic energy as a basis for an alternative tornado climatology involving energy rather than frequency.J is the highest EF rating, vj is the midpoint wind speed for each rating , wj is the corresponding fraction of path area, and m is the tornado mass, which is estimated as air density (1 kg m\u22123) times the volume . The tornado\u2019s height and the density of air are held constant, thus m is only a function of total path area.The main idea of this paper is to distinguish individual tornadoes based on a metric of destruction that has physical units of energy. Estimates of tornado energy have been made previously following the formula in Schielicke and N\u00e9vir . In part\u22121 (7.5 m s\u22121 above the threshold wind speed consistent with the EF4 midpoint speed relative to its threshold). It is acknowledged that tornado height varies considerably perhaps by as much as a factor of 10 or more, but without other information it is fixed at 1 km.Since there is no upper bound on the EF5 wind speeds, the midpoint wind speed is set at 97 m sSince tornado-specific fractions of path area by EF rating are not available in the SPC database, here the NRC model of the fractions is used instead see . The perThe NRC model combines a Rankine vortex with empirical estimates to determine the fraction of path area associated with each EF rating . Fricker12 joules), five percent have TKE exceeding 5.53 TJ and one percent have TKE exceeding 31.9 TJ. The tornado with the most energy is the Tallulah-Yazoo City-Durant tornado of April 24, 2010 with a TKE of 516.7 TJ. It tracked over 240 km from Louisiana through Mississippi with a width of 2.82 km at its widest. It resulted in ten fatalities and 146 injuries. The most severe damage (EF4) occurred in the Mississippi counties of Yazoo and Holmes.TKE is computed for all 8752 tornadoes in the SPC database over the period 2007\u20132013. There are many more weak tornadoes (EF0) than strong ones (EF2 and higher) so the values are highly skewed with a median TKE of 62.1 gigajoules (GJ) and a interquartile range between 9.1 and 383.2 GJ. On a logarithmic scale the distribution is symmetric . Ten perJ is the highest EF rating and A is the path area estimated by multiplying the path length by the path width. Path width is provided in the SPC database as the maximum width across the tornado path. Per-tornado TDI is computed following Agee and Childs [vJ is the midpoint wind speed for the highest EF rating (J) and W is the path width. Note that TDI and DPI are metrics that have never previously been computed on a per tornado basis.The method to estimate TKE is validated by comparing resulting values with other indexes of tornado destruction and by correlating TKE with casualties and loss variables. This is done on a per-tornado basis. Per-tornado DPI is computed following Thompson and Vescio  asDPI=Ad Childs  asTDI=.A rank of the top ten tornadoes with the most energy shows the tight relationship between TKE and DPI . The topThe top five days with the most energy match the top five days with the highest DPI while the next five days of high energy match the next five high DPI days but in slightly different order. Seven of the top TDI days are in the top ten days with the most energy but not in the same order with the exception of April 27, 2011, which has the largest TDI, DPI, and TKE values.Another validation of TKE as a useful measure of destruction is available by correlating it with fatalities, injuries, and losses . TKE is In the previous section TKE as a metric of tornado destruction is defined with units of energy. Then it is shown that TKE has the same or greater explanatory power  as earlier indexes of destruction including DPI and TDI. Here variations in TKE are examined. Since energy is extensive, the per-tornado TKE values can be summed and averaged. For instance over the period 2007\u20132013 the average energy of the nine EF5 tornadoes is just over 100 TJ . The ave15 joules) or four times the energy of the next most energetic day  for the 8752 tornadoes in the SPC database over the period 2007\u20132013. The main idea is to distinguish individual tornadoes based on a variable of destruction that has physical units of energy. The method uses the fraction of the tornado path experiencing EF damage and the midpoint wind speed for each EF rating. The fraction of the path is obtained from a model developed for the NRC that combines theoretical considerations with empirical data. An earlier study showed estimates of TKE from the model matched well those computed from recent tornado observations.The TKE is validated as a useful metric of destruction by comparing it to other destructive indexes in the literature including the DPI and TDI. Additional validation is demonstrated by correlating it to casualties and loss estimates. TKE is highly correlated with DPI since they are both sensitive to path length and width in the same way (path area). As such TKE offers no statistical advantage over DPI as a single indicator of destruction for individual tornadoes. However, since TKE is based on physical theory and has units of energy it can be more easily understood by scientists outside of meteorology. Moreover, TKE has units of Joules  and can be directly compared with environmental energy variables like CAPE and helicity, which have the same units of J/kg. This is important toward the goal of improving understanding of the relationship between tornadoes and their parent-storm environment. Moreover, TKE can be spatially dis-aggregated. For example, if interest lies in the portion of energy within a county from a tornado passing through several counties, then the county-level TKE can be computed based on the contours by EF rating. In this way maps of TKE by area can be drawn accumulated by month, year, and decades.The per-tornado TKE values are summed and averaged to produce an alternative climatology of tornadoes based on energy rather than frequency. Half of all tornadoes have TKE that exceed 62.1 GJ and a quarter have TKE that exceed 383.2 GJ. Five percent of the tornadoes have TKE that exceed 5.53 TJ. The tornado with the greatest amount of energy is the long-tracked EF4 Tallulah-Yazoo City-Durant tornado of April 24, 2010 with a TKE of 516.7 TJ resulting in ten fatalities and 146 injuries. The single day with the most energy is April 27, 2011 with more than 2.6 PJ from 206 tornadoes.The average energy of the nine EF5 tornadoes is just over 100 TJ and the average energy of the 57 EF4 tornadoes is half of that at just over 50 TJ. The average energy of the EF3 tornadoes is less than half of the EF4 and the average energy of the EF2 tornadoes is much less than half of the EF3. Tornado energy peaks from mid to late spring similar to the peak in tornado frequency. Key new findings are that April has more energy than May with fewer tornadoes; March has more than June with half as many tornadoes. September is the month with the least energy but November and December are months with the fewest tornadoes.Another key finding is that Alabama ranks number one in terms of tornado energy with a total of 2.48 PJ followed by Oklahoma with 1.45 PJ. The next four states in decreasing order are Mississippi, Kansas, Arkansas, and Louisiana. On a per-tornado basis, for those states with more than 100 tornadoes, five of the top six states are in the South. The spatial pattern of TKE at this scale suggests a single tornado threat region encompassing both the traditional alley of the Great Plains and the Dixie alley of the South . The proFinally, recent research shows a future with more days when high wind shear coincides with high values of convective available potential energy  indicati"}
{"text": "Current clinical practices used to functionally classify heart failure (HF) are time-consuming, expensive, or require complex calculations. This study aimed to design an inquiry list from the perspective of traditional Chinese medicine (TCM) that could be used in routine clinical practice to resolve these problems.The severity of documented HF in 115 patients was classified according to their performance in maximal exercise tests into New York Heart Association (NYHA) functional classification (FC) II or NYHA FC III. Concomitantly, the patients were assessed using the new TCM inquiry list and two validated quality of life questionnaires, namely, the Short Form 36 (SF-36) generic scale and the Minnesota Living with Heart Failure Questionnaire (MLHFQ). Factor analysis was applied to extract the core factors from the responses to the items in TCM inquiry list; logistic regression analysis was then used to predict the severity of HF according to the extracted factors.The TCM inquiry list showed moderate levels of correlation with the physical and emotional components of the SF-36 and the MLHFQ, and predicted the functional class of HF patients reliably using logistic regression analysis, with a correct prediction rate with 64.3\u00a0%. Factor analysis of the TCM inquiry list extracted five core factors, namely, Qi Depression, Heart Qi Vacuity and Blood Stasis, Heart Blood Vacuity, Dual Qi-Blood Vacuity, and Yang Vacuity, from the list, which aligned with the perspective of TCM as it relates to the pattern of HF. The correct prediction rate rose to 70.4\u00a0% when Dual Qi-Blood Vacuity was combined with the MLHFQ. The excessive false-negative rate is a problem associated with the TCM inquiry list.The TCM inquiry list is a simple scale and similar to patient-reported subjective measures of quality of life in HF, and may help to classify patients into NYHA FC II or NYHA FC III. Factor 4 addresses dizziness, dizzy vision and general weakness, which are critical parameters that distinguish between NYHA FC II and NYHA FC III. Incorporating these three items into the management of HF may help to classify patients from a functional perspective.The online version of this article (doi:10.1186/s12906-016-1306-7) contains supplementary material, which is available to authorized users. Heart failure (HF) is common and its impact on a patient\u2019s quality of life (QoL) depends on its severity . FindingPhysicians who practice traditional Chinese medicine (TCM) use four diagnostic approaches, i.e., inspection, auscultation and olfaction, interrogation, and palpation to record patients\u2019 information in relation to specific patterns , 4. TCM The aim of this study was to design an inquiry list from the perspective of TCM  that could be used in routine clinical practice to resolve the current problems associated with the FC of HF.The aim of this study was to design a TCM inquiry list that could be used in routine clinical practice to resolve the current problems associated with the FC of HF.This investigation was performed in accordance with the Declaration of Helsinki and was approved by the Institutional Review Board of Chang Gung Memorial Hospital, Taiwan (103-1515B). All of the subjects provided written informed consent after receiving an explanation of the experimental procedures.A TCM inquiry list was created based on the signs and symptoms of HF found in textbooks and reports. Eligible candidates, who had been classified as NYHA FC II or NYHA FC III based on aerobic capacity during CPET, were enrolled to participate in pre-testing of the TCM inquiry list. These subjects were also assessed using the TCM inquiry list and two validated QoL questionnaires, namely, the SF-36 generic scale and the MLHFQ. The TCM inquiry list was validated using the SF-36 and MLHFQ, which are two accepted tools that measure patient-perceived symptom severity and QoL impairment, and have been used in previous studies of HF , 14. FinAn inquiry list was developed as a disease-specific questionnaire to be used when HF patients visit clinics to see TCM physicians. The TCM inquiry list was designed to be simple and self-explanatory for people without a medical background or medical knowledge. Furthermore, the patients were able to complete the questionnaire themselves with little assistance from medical professionals. Each item on the list allowed the patients to respond in a way that reflected the frequency of their symptoms, as follows: 1\u2009=\u2009never, 2\u2009=\u2009rarely, 3\u2009=\u2009sometimes, 4\u2009=\u2009frequently, and 5\u2009=\u2009always, and in accordance with the severity of their symptoms, as follows: 1\u2009=\u2009absent, 2\u2009=\u2009mild, 3\u2009=\u2009moderate, 4\u2009=\u2009severe, and 5\u2009=\u2009catastrophic, to facilitate evaluation of the different levels of severity. Data about all items potentially related to the TCM pattern were collected . The proArrindell et al.  proposed2), carbon dioxide production, peak exercise oxygen consumption (VO2 peak), cardiac output, and changes in tissue oxygenation , and the \u0394total hemoglobin concentration [\u0394THb]) in the left frontal cortex region and the vastus lateralis muscle, using standardized protocols previously described by Fu et al. [The baseline evaluation of each patient included completion of the preliminary TCM inquiry list, an MLHFQ, an SF-36 questionnaire, and a maximal exercise test using metabolic gas analysis , a non-invasive cardiac output monitor , and near infrared spectrometry  to measure the ventilatory and hemodynamic parameters, including minute ventilation, oxygen consumption VO, carbon t-test was used to compare quantitative variables between groups. The chi-squared test and Fisher\u2019s Exact test were used to compare categorical variables between groups. Pearson\u2019s correlation coefficient was used to determine the presence of correlations between scores on the TCM inquiry list and several parameters associated with functional capacity, including QoL and maximal exercise capacity. The inquiry list was investigated by factor analysis to explore possible patterns from the TCM perspective. The ability of the TCM inquiry list to predict HF from a functional perspective was evaluated using logistic regression analysis. Finally, the critical elements needed to distinguish between NYHA FC II and NYHA FC III in a population with HF were determined and possible correlations between these factors and latent physiologic traits were investigated. All of the statistical analyses were performed using IBM\u00aeSPSS\u00ae version 22.0 software .First, the patients\u2019 anthropometric and exercise performance data were analyzed. An independent n\u2009=\u200966) and NYHA FC III (n\u2009=\u200949) groups according to their performance on the maximal exercise test. Patients in the NYHA FC II group had slight  limitations to their physical activity, and those in the NYHA FC III group had marked (>1.5 to \u22645 MET) limitations to their physical activity. The characteristics of the groups are shown in Table\u00a0This study enrolled 115 HF patients who were divided into NYHA FC II (2\u2009=\u20090.967). Both of these parameters demonstrated the stability of the TCM inquiry list.The TCM inquiry list showed a high level of internal consistency . The test-retest-reliability coefficient indicated excellent reliability , a moderate negative correlation with the physical component score (PCS) of the SF-36  and the mental component score (MCS) of the SF-36 , and a mild negative correlation with peak VO2 . These findings were consistent with the original design of the TCM inquiry list in which a higher score indicated greater severity. The rates at which each test correctly predicted NYHA FC II and NYHA FC III are shown in Table\u00a02 achieved a correct prediction rate of 100\u00a0%, because patients were assigned to the NYHA FC II group or the FC III group based on their aerobic capacity. Correct prediction rates for the PCS of the SF-36, the MCS of the SF-36, the MLHFQ, and the TCM inquiry list were 63.5, 60.0, 60.0, and 64.3\u00a0%, respectively. The TCM inquiry list had the best prediction rate of all of the questionnaires used in this study.Table\u00a0\u03c72\u2009=\u20091363 (P\u2009<\u20090.0001), indicating the presence of significant correlations and reinforcing the relevance of the factor analysis.Exploratory factor analysis was conducted to scrutinize the TCM inquiry list and to identify any critical parameters in this list that might distinguish between NYHA FC II and NYHA FC III patients. A value of 0.864 on the Kaiser-Meyer-Olkin test indicated adequate correlation matrices. The Bartlett sphericity test was significant at Exploratory factor analysis extracted five factors without any limit on the possible number of factors in this analysis, for which five-factor varimax rotation explained 69\u00a0% of the total variance Table\u00a0. All of P\u2009=\u20090.025; Table\u00a0All of the factors on the TCM inquiry list were included in the regression model for prediction of NYHA FC. Factors 2 and 4 were incorporated into the prediction model, and only factor 4 yielded a statistically significant difference P\u2009=\u20090.02; Table\u00a05P\u2009<\u20090.0001) when 11.5 was used as the cutoff value for this novel parameter, a value that had the greatest diagnostic power to distinguish between NYHA FC II and NYHA FC III  was largest when the PCS of the MLHFQ and the score for factor 4 on the TCM inquiry list were combined. The AUC was 0.740 , Heart Qi Vacuity and Blood Stasis (factor 2), Heart Blood Vacuity (factor 3), Dual Qi-Blood Vacuity factor 4), and Yang Vacuity factor 5), as shown in Table\u00a0, and Yan, as showWhen the NYHA FC II and NYHA FC III categories were used as binary variables and the five TCM factors were entered into the logistic regression model to predict NYHA FC, only factor 4 was significantly associated with differences between NYHA FC II and NYHA FC III. Hence, factor 4 is the critical parameter from the perspective of TCM that can help to differentiate between NYHA FC II and NYHA FC III in a population with HF.The typical clinical manifestations of HF include dyspnea on exertion, nocturnal dyspnea, and leg swelling, and inquiries about these manifestations often comprise parts of the current questionnaires. Factor 4, which includes Q1 (dizziness), Q2 (dizzy vision), and Q11 , and hints at Dual Qi-Blood Vacuity, which is the key pattern associated with coronary artery disease in TCM , 8, comp2, peak workload, VO2 at the anaerobic threshold, oxygenated hemoglobin levels in muscle at the anaerobic threshold, total cerebral hemoglobin level at peak exercise, and the oxygen uptake efficiency slope, and very weak but significant positive correlations with cerebral and muscle deoxygenated hemoglobin levels during peak exercise. The deoxygenated state of the brain and the low cerebral blood flow during the peak exercise phase may be associated with dizziness and dizzy vision. The deoxygenated state of the muscles during the peak exercise phase may be associated with limb weakness. This indicates that the differences between NYHA FC II and NYHA FC III are associated with the blood supply to the brain and muscles, which is in agreement with previous studies [Table\u00a0 studies . Cardiol2, the MLHFQ score, and the MCS were also noted. Poor correlations between MLHFQ score and CPET parameters have been described in a previous study [This study has several limitations. Our HF population had similar PCS scores, but lower MLHFQ and worse MCS scores than those reported by other researchers , 20. Weaus study ; howeverus study , 20, 22.us study , 24.Q13 was removed from the factor analysis. That means that there is room for improvement in the choice of items included in this inquiry list. The Q13 item was removed from the exploratory factor analysis because of insufficient loading (<0.5 or less) in all factors, or excessive loading (>0.5 or more) in an excessive number of factors (>2 or more). For our purposes, this implies that either Q13 is not an important or common item or that there are surrogate items for Q13 that can be used instead. Therefore, subjects may choose other items first. Deletion of Q13 in this study did not change the final result. Hence, it was reasonable to delete this item.The correlation coefficients demonstrated relationships between the factors, aerobic capacity, and QoL. We found that the factors in the TCM inquiry list had moderate correlations with the QoL questionnaires, but only weak correlations or no correlations at all with aerobic capacity. This may mean that aerobic capacity did not actually correlate with the TCM inquiry list and the QoL; hence, a non-linear relationship may have existed between QoL and the symptoms associated with the TCM inquiry list. Therefore, further analysis of the data is needed. In addition, the sample size in this study was barely adequate for development of a questionnaire, but should not be considered unsatisfactory . MoreoveThe TCM inquiry list is a simple scale and similar to patient-reported subjective measures of quality of life in HF, and may help to classify patients into NYHA FC II or NYHA FC III. Factor 4 addresses dizziness, dizzy vision and general weakness, which are critical parameters that distinguish between NYHA FC II and NYHA FC III. Incorporating these three items into the management of HF may help to classify patients from a functional perspective."}
{"text": "Moringa oleifera leaf extract against aspirin-induced ulcers was investigated in rats. Thirty (30) rats under starvation but with access to drinking water for 48\u00a0h were divided into 6 groups of 5 animals each. Animals in groups 1 and 2 were pretreated with 0.2\u00a0ml normal saline via the oral route. Group 3 received 32\u00a0mg/kg cimetidine while those in groups 4, 5 and 6 received oral Moringa leaf extract treatments at doses 200, 400 and 800\u00a0mg/kg body weight respectively. Thirty minutes after treatment, all animals in groups 2 to 6 were given 800\u00a0mg/kg Aspirin to induce ulcer. Results obtained showed complete erosion of the superficial epithelium with complete loss of the mucus globules and sloughing off of immediate underlying cells and sparsely distributed intraepithelial lymphocytes in the stomach of rats in which no treatment was given and significantly differed from those of the normal control animals which were essentially intact. No significant gastroprotection was observed in rats pretreated with the lowest dose of the extract (200\u00a0mg/kg) as a high degree of intestinal mucosal lesions and complete erosion of the surface epithelium with intraepithelial haemorrhage, moderate inflammation and tissue oedema were observed. Pretreatment with 400\u00a0mg/kg, however, offered a mild degree of protection with patches of surface epithelial protection and mucus globules, even though there was still predominant disintegration and sloughing off of superficial and underlying epithelial cells. The level of protection was sufficiently increased in animals treated with 800\u00a0mg/kg Moringa extract as there was increased protection of surface epithelium with more mucus globules and compared favourably with the effect of Cimetidine in which patches of intact superficial cells were observed. Moringa leaf extract may contain active agents with gastroprotective and mucus enhancing activities and could be harnessed into safe and potent treatment agents for ulcer in addition to providing template for the development of new antiulcer agents.The gastroprotective activity of  Helicobacter pylori  injury and bleeding in more than 50% of its users  has shown that the plant has antioxidant, antimicrobial, anti-inflammatory, antipyretic, antidiabetic, antiulcer, antitumor antidiarrheal and hypocholesteromic properties  rats under starvation but with access to drinking water for 48\u00a0h were divided into 6 groups of 5 animals each. Animals in groups 1 and 2 were pretreated with 0.2\u00a0ml normal saline via the oral route. Group 3 received 32\u00a0mg/kg cimetidine. Groups 4, 5 and 6 received oral Moringa extract treatments at doses of 200, 400 and 800\u00a0mg/kg body weight respectively. Thirty minutes after treatment, all animals in groups 2 to 6 were given 800\u00a0mg/kg Aspirin to induce ulcer. Ulcer was not induced in group 1 rats. All administrations were done via the oral route. Two hours after Aspirin administration, all animals were sacrificed by cervical dislocation. The stomach of each animal was carefully isolated, incised along the greater curvature, rinsed in normal saline and transferred into 10% formalin solution for histological study.Slices of the isolated stomach were fixed in 10% formal saline for 48\u00a0h and were processed by placing them in ascending grades of alcohol in the following order, 50% alcohol for 1\u00a0h, 70% alcohol for 1\u00a0h, first 95% alcohol for 1\u00a0h and second 95% alcohol for 1\u00a0h 15\u00a0min, first absolute alcohol for one and half hours and second absolute alcohol for 2\u00a0h to ensure proper dehydration of the tissues. The dehydrated tissues were then transferred to a mixture of equal volumes of alcohol and xylene where they were left overnight and later cleared with two changes of xylene for 1\u00a0h each. They were then infiltrated twice for 1\u00a0h each with molten paraffin wax in the oven at 60\u00a0\u00b0C. The tissues were then embedded in paraffin wax, trimmed and mounted on wooden chuck, and then taken to the microtome for sectioning at 5\u00a0\u03bcm thickness. The sections were floated in floating-out bath from where they were picked with clean albuminized slides. The slides were placed in a staining dish and excess wax was removed by two changes of xylene, hydrated by descending grades of alcohol in the order absolute alcohol, 95% alcohol and 70% alcohol for 2\u00a0min each. The slides were taken to water and then stained by infiltrated Ehrlich haematoxylin for 15\u00a0min, and then washed in water for 5\u00a0min, differentiated in 10% acid alcohol and blued in running tap for 10\u00a0min. They were then counter stained with filtered eosine for 2\u00a0min. Excess eosine was removed in ascending grades of alcohol in the order 75% alcohol, 95% alcohol and absolute alcohol for 2\u00a0min each. They were then cleared in two changes of xylene and each was cover slipped with depex mountant Clayden . The sliMoringa oleifera extract showed that Aspirin (800\u00a0mg/kg) could successfully induce gastric ulcerations in rats as the stomach of rats in group 2 treated with this induction agent alone had complete erosion of the superficial epithelium with complete loss of the mucus globules and sloughing off of immediate underlying cells and sparsely distributed intraepithelial lymphocytes .The reported antibacterial activity of Moringa leaf extract may suggest another mechanism of antiulcer effects but leaves room for further evaluation of this antibacterial effect in relation to inhibiting the growth of Moringa leaf extract may contain active agents with gastroprotective and mucus-enhancing activities and could be harnessed into safe and potent treatment agents for ulcers and may provide template for the development of new antiulcer agents."}
{"text": "Proton-pump inhibitors (PPIs) seem to increase the incidence of cardiovascular events in patients with coronary artery disease (CAD), mainly in those using clopidogrel. We analysed the impact of PPIs on the prognosis of patients with stable CAD.We followed 706 patients with CAD. Primary outcome was the combination of secondary outcomes. Secondary outcomes were 1) acute ischaemic events  and 2) heart failure (HF) or death.Patients on PPIs were older  and had a more frequent history of stroke  than those from the non-PPI group, and presented no differences in any other clinical variable, including cardiovascular risk factors, ejection fraction, and therapy with aspirin and clopidogrel. Follow-up was 2.2\u00b10.99 years. Seventy-eight patients met the primary outcome, 53 developed acute ischaemic events, and 33 HF or death. PPI use was an independent predictor of the primary outcome , along with hypertension, body-mass index, glomerular filtration rate, atrial fibrillation, and nitrate use. PPI use was also an independent predictor of HF/death , but not of acute ischaemic events. A propensity score showed similar results.In patients with CAD, PPI use is independently associated with an increased incidence of HF and death but not with a high rate of acute ischaemic events. Further studies are needed to confirm these findings. These antiplatelet agents, however, may favour the development of gastrointestinal (GI) complications. Prolonged aspirin therapy is associated with GI ulceration and bleeding, which have been attributed to mucosal injury caused by inhibition of prostaglandin and to systemic inhibition of thromboxane A2 production, respectively. In addition, clopidogrel may impair the healing of gastric erosions, exacerbating GI complications associated with the concomitant administration of aspirin [In patients with coronary artery disease (CAD), aspirin is used to decrease the incidence of cardiovascular events, and in patients who have undergone stent placement or have suffered an acute coronary syndrome, a PClostridium difficile infection, acute interstitial nephritis, and micronutrient deficiencies [PPIs are indicated in CAD patients to decrease the risk of upper GI haemorrhage due to antiplatelet therapy . Howeverciencies ,6. In adciencies \u201311. Althciencies , clinicaciencies ,14.In this study we assessed the potential association between the use of PPIs and adverse outcome in patients with stable CAD who had developed an acute coronary syndrome 6\u201312 months before.The research protocol complies with the Declaration of Helsinki and was approved by the ethics committees of the participating hospitals. All patients included in the study signed informed consent documents. As described in detail previously, the BACS & BAMI  studies included patients admitted to 4 hospitals in Madrid with either non-ST elevation acute coronary syndrome (NSTEACS) or ST elevation myocardial infarction (STEMI) . DetaileBetween July 2006 and April 2010, 1,898 patients were discharged from the study hospitals with a diagnosis of NSTEACS or STEMI . Of thesAs explained previously, at baseline, clinical variables were recorded and twelve-hour fasting venous blood samples were withdrawn and collected in EDTA. Blood samples were centrifuged at 2,500 g for 10 minutes and plasma was stored at \u201380\u00b0C. Patients were seen every year at their hospital. At the end of follow-up (maximum 4.6 years) medical records were reviewed and patient status was confirmed by telephone contact.The primary outcome was the composite of the secondary end points. The secondary outcomes were 1) recurrence of acute ischaemic events such as NSTEACS, STEMI, stroke, or transient ischaemic attack, and 2) incidence of heart failure (HF) or death from any cause. NSTEACS was defined as rest angina lasting more than 20 minutes in the previous 24 hours or new-onset class III-IV angina, along with transient ST-segment depression or T-wave inversion in the electrocardiogram considered diagnostic by the attending cardiologist and/or troponin elevation. STEMI was defined as symptoms compatible with angina lasting more than 20 minutes and ST elevation in 2 adjacent leads in the electrocardiogram without response to nitroglycerin, and troponin elevation. Stroke was defined as rapid onset of a persistent neurologic deficit attributable to a focal vascular cause and lasting more than 24 hours, supported in most cases by imaging studies. A transient ischaemic attack was defined as a stroke with signs and symptoms resolving before 24 hours without acute ischaemic lesions as assessed by imaging studies. The HF end point was assigned to patients hospitalised for this reason. Events were adjudicated by 2 investigators. Cerebrovascular events were adjudicated with the assistance of a neurologist.Laboratory analyses were carried out in the Clinical Biochemistry Laboratory of the IIS-Fundaci\u00f3n Jim\u00e9nez D\u00edaz by investigators who were unaware of the clinical data. As in previous papers studying this population, high-sensitivity C-reactive protein was determined by latex-enhanced immunoturbidimetry  . Lipid, 2 or Fisher exact test when appropriate. Kaplan-Meier curves and the log-rank test were used to compare time to outcome according to therapy with PPIs. Cox proportional hazards modelling was used with forward stepwise selection to assess the variables associated with the primary and secondary outcomes. In model 1, clinical and analytical variables were studied: age, sex, diabetes, smoking status, hypertension, body-mass index, LDL, HDL, triglycerides, previous history of peripheral artery disease, cerebrovascular events, atrial fibrillation or coronary artery by-pass graft; ejection fraction<40%, glomerular filtration rate assessed as Chronic Kidney Disease Epidemiology Collaboration method (CKD-EPI), high-sensitivity C-reactive protein, type of last acute coronary event, number of diseased vessels, percutaneous or surgical revascularisation, use of drug-eluting stents and existence of complete revascularisation at that event. In model 2, treatment with PPIs and other therapies were added: aspirin, clopidogrel, statins, acenocumarol, angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, betablockers, nitrates/nitroglycerin and diuretics. We considered significant when \u201cp\u201d value was lower than 0.05 (two-tailed). Analyses were carried out with SPSS 19.0 .Quantitative data following a normal distribution are presented as mean \u00b1 standard deviation and compared using the Student \u201ct\u201d test. Data that were not normally distributed are displayed as median (interquartile range) and compared using the Mann-Whitney test. Qualitative variables are displayed as percentages and were compared by \u03c7A propensity score adjustment was performed using a multivariable logistic regression model in 2 steps, including clinical variables in the first one and adding the therapies used in the second step.In conclusion, in this study we have followed 706 patients with chronic CAD, assessing the potential relationship of PPI use with the development of acute ischaemic events, heart failure (HF), or death.Mean follow-up was 2.2\u00b10.99 years. Time from the previous acute coronary event was 7.5 \u00b1 3.0 months.2 receptor antagonists, and the remaining patients did not receive gastric protectors. Patients receiving these drugs were older and had a more frequent history of cerebrovascular events than those not receiving them. No differences were observed in cardiovascular therapy or any other clinical or analytical variables  were receiving PPIs. Most of them ) were taking omeprazole, 19 (2.7%) pantoprazole, 6 (0.8%) lansoprazole, and 1 patient (0.1%) was taking rabeprazole. There were 72 (10.2%) patients treated with histamine Hariables .Seventy-eight patients developed the primary outcome of acute ischaemic events, HF, or death. Sixty-three (14.61%) patients taking PPIs and 15 (5.45%) not on PPIs met this outcome. Twelve patients developed 2 events, 5 patients experienced 3 events and, the remainder, one event with a total of 100 events. At multivariable analysis we included the variables displayed in When multivariable Cox regression analysis was performed comparing patients with omeprazol with those no taking this drug (then including 26 patients using other PPIs in this group) omeprazol was an independent risk predictor  along with hypertension , body-mass index , atrial fibrillation , glomerular filtration rate , and use of nitrates . Comparing patients with omeprazol with the remaining cases not on PPIs confirmed that omeprazol  was an independent predictor of the primary outcome along with the same other described variables. Given that the number of cases on anti-H2 and without gastric protectors was very low it was not possible to perform other comparisons.Fifty-three patients developed acute ischaemic events. Forty-two (9.74%) of the patients on PPIs and 11 (4%) of those not receiving these drugs met this end point. There were 4 episodes of STEMI, 22 of NSTEACS, 17 of unstable angina, 8 strokes, and 10 transient ischaemic attacks. Four patients experienced 2 events and 2 patients experienced 3 events. By multivariable analysis, age, body-mass index, and treatment with nitrates, but not with PPIs, were independent predictors of this end point .Thirty-three patients developed HF or death. This end point was met by 28 patients (6.49%) on PPIs, and by 5 patients (1.81%) not receiving this therapy. There were 16 episodes of HF and 23 deaths, with 6 patients experiencing 2 events. Nine deaths were due to cardiovascular causes (3 of them were sudden death) and 4 were due to malignancies. Infection, renal failure, bowel ischaemia, GI bleeding, and pancreatitis accounted for 1 death each. Five deaths were of unknown cause. Therapy with PPIs was also an independent predictor of this outcome .\u201cp\u201d value (p = 0.050) for the secondary outcome of heart failure or death   and a boor death .Finally, we performed a propensity score analysis. In the first step, we included clinical variables, and treatment with PPIs significantly increased the incidence of the primary outcome . The combined outcome of HF or death showed a result in the limit of statistical significance . In the second step, we added concomitant drug therapy, showing that PPI treatment increased the incidence of the primary outcome , although the combination of HF or death lost the statistical significance .It has been suggested that treatment with PPIs are associated with an increased incidence of cardiovascular events in patients with CAD, mainly in those receiving clopidogrel .In the present study, PPI treatment in patients with CAD was associated with a significant increase in the incidence of HF or death. The distribution of clinical and analytical variables across patients taking PPIs was similar to that of patients not taking these drugs, though with 2 exceptions. First, patients on PPIs were older. This is logical, since age is a risk factor for GI bleeding . Second,More than 90% of patients were taking aspirin. Chronic treatment with aspirin is a risk factor for GI bleeding regardless of the dose used . Further-/K+-adenosine triphosphatase (ATPase). This pump is also present in the myocardium of rats [-/K+ ATPase might therefore induce cellular acidosis and a secondary depression in myocardial contractility. However, this was not the mechanism of action of pantoprazole, as no significant changes in intracellular pH could be detected, and all effects occurred at pH 7.3\u20137.4. Two underlying mechanisms for the pantoprazole-dependent inhibition of contractile force have been described [2+ transients due to an impaired sarcoplasmic reticulum Ca2+ uptake and diminished Ca2+ influx via ICa L, and (2) reduced Ca2+ responsiveness of the myofilaments as a consequence of decreased maximal active tension and mildly lower Ca2+ sensitivity. Similar results have been obtained with esomeprazole [The present work shows that PPI use is an independent predictor of HF or death. Although there are no previous studies reporting this association, it is known that pantoprazole may exert negative inotropic effects on isolated myocardium from humans and rabbits . This ef of rats . Inhibitescribed : (1) a deprazole  and omepeprazole , suggestet al did not observe any effect of high doses of intravenous pantoprazole on left ventricular ejection fraction or several hemodynamic parameters in healthy volunteers [et al showed that chronic administration of PPIs in patients with stable angina could be associated with a decrease in ejection fraction and an increase in end-systolic volume index [Although the findings from laboratory studies have been promising, there is controversy regarding the clinical effects of PPIs on myocardial function. Using echocardiography, Schillinger lunteers . On the me index .The increase in mortality associated with PPI use described in the present paper is consistent with previous data. The use of high doses of PPIs has been associated with increased mortality in 491 older patients discharged from acute care hospitals, even when multivariable analysis including predictors of adverse outcomes was carried out . SimilarClostridium difficile infections and community-acquired pneumonia described in long-term PPI users [12 deficiency, thus leading to a poor nutritional status [Several potential mechanisms have been suggested to explain the relationship between PPIs and the risk of death . First, PI users ,27,28. Sl status . In factl status . Third, l status ,32. Thenl status ,34. Nevel status . Althouget al found that PPI use was not associated with all-cause mortality in a cohort of 22,107 patients over age 65 with HF [In contrast to our data, Oudit  with HF . Howeveret al reported an increased incidence of hospitalisation for acute coronary syndromes or death in patients with acute coronary syndrome receiving clopidogrel and PPIs [vs. non-users. What is more, treatment with clopidogrel did not affect the association between therapy with PPIs and the incidence of the primary outcome. It therefore seems reasonable to conclude that PPIs had no effect on the incidence of acute ischaemic events and that clopidogrel use did not affect the association observed with the primary outcome.Use of PPIs was not an independent predictor of acute ischaemic events. Pharmacokinetic and pharmacodynamic studies suggest that use of PPIs may reduce the antiplatelet effects of clopidogrel. The strongest evidence for such an interaction has been found between omeprazole and clopidogrel ,38. Ho eand PPIs . Howeverand PPIs . In addi2 or, alternatively, if this effect was also present when comparing PPI patients with those receiving no gastric protectors. The reason for this is that, in accordance with the current clinical practice, the number of patients without any gastric protector was very low.Finally, we were unable to explore whether adverse prognosis was associated with all PPIs or only with omeprazol, given that the number of patients with other PPIs was low. Similarly, our study did not allow us to analyse whether the adverse effect of PPIs was evident only when comparing these patients to those taking antiHThis work has certain limitations. First, this is a non-randomised study with some significant differences at baseline between patients receiving PPI and those who did not. Although we included these variables in the multivariate and propensity score analysis, the small sample size may have limited the statistical power. Second, excluding patients with clinical instability in the first days after the index event may have introduced a bias, as these patients would probably have evidenced a worse prognosis. Nevertheless, only 9 percent of cases were excluded for this reason and the remaining exclusion criteria were designed to prevent the inclusion of cases that could have yielded confounding information, such as patients with major additional disorders. Third, the number of total events was small, thus limiting the strength of the statistical analysis. Fourth, there were few deaths, making it impossible to test whether there was an association between use of PPIs and some specific cause of death. Fifth, the study quality is modest, as more than 50% of patients discharged from the hospitals with a diagnosis of NSTEACS or STEMI were not included in the study based on the exclusion criteria described in the Methods section. Finally, adherence to medication regimens during follow-up was not addressed.In conclusion, our results suggest an association between use of PPIs and the incidence of death or HF but do not point to an association with incidence of acute ischaemic events. More studies are needed to confirm these data.S1 File(XLSX)Click here for additional data file."}
{"text": "Integrating these data with other bodies of archaeological information, we suggest that the arrival of Baltic amber was part of broader Mediterranean exchange networks, and not necessarily the result of direct trade with the North. From a methodological perspective, thanks to the analyses carried out on both the vitreous core and the weathered surfaces of objects made of Sicilian simetite, we define the characteristic FTIR bands that allow the identification of Sicilian amber even in highly deteriorated archaeological samples.Provenancing exotic raw materials and reconstructing the nature and routes of exchange is a major concern of prehistoric archaeology. Amber has long been recognised as a key commodity of prehistoric exchange networks in Europe. However, most science-based studies so far have been localised and based on few samples, hence making it difficult to observe broad geographic and chronological trends. This paper concentrates on the nature, distribution and circulation of amber in prehistoric Iberia. We present new standardised FTIR analyses of 22 archaeological and geological samples from a large number of contexts across Iberia, as well as a wide scale review of all the legacy data available. On the basis of a considerable body of data, we can confirm the use of local amber resources in the Northern area of the Iberian Peninsula from the Palaeolithic to the Bronze Age; we push back the arrival of Sicilian amber to at least the 4 Amber and other unusual materials such as jade, obsidian and rock crystal, have attracted interest as raw materials for the manufacture of decorative items since Late Prehistory, and indeed amber retains a high value in present-day jewellery. There are many aspects that come into play when assessing the social value of these raw materials, ranging from intrinsic material properties  that can render them appealing for the manufacture of adornments, to other environmental or cultural aspects that may relate, for example, to their relative scarcity and subsequent added value as exotic or 'exclusive'. As such, the circulation of unusual raw materials can be traced back to Prehistory, and the Iberian Peninsula is no exception.th and the 2nd Millennia BC [th Millennium BC [th Millennium BC [For obsidian and jade, this movement is known to have taken place since early dates in the Late Prehistory. For instance, we can mention the Lipari and Pantelleria obsidian circuits in the Central Mediterranean that reached North Africa between the 6ennia BC \u20133; the Annium BC \u20136; or thnnium BC .As for amber, there is evidence of use since the Late Palaeolithic (e.g. ). In a pHere we present a new set of analyses of archaeological and geological amber that greatly expands previous coverage. Taking advantage of the growing body of data, and synthesising all the information available, this paper sets out to provide an up-to-date review of the evidence concerning the nature, distribution and circulation of amber in Prehistoric Iberia. This holistic perspective is contextualised more broadly in current discussion about the circulation of materials, knowledge and people in European Prehistory.In the last five years, there have been major developments in our understanding of Iberian amber. From a geological point of view, we highlight the project 'Iberian Amber: An Exceptional Record of Cretaceous Forests at the Rise of Modern Terrestrial Ecosystems', with the involvement of one of us (E.P.), focused on the palaeoenvironmental reconstruction of the ecosystems that generated the large Cretaceous amber deposits known in the Iberian Peninsula (e.g. ). From a-1, with a resolution of 4 cm-1. All of our raw spectra are included in full as Supporting Information , which is well-established as a reliable technique for the characterisation and sourcing of amber. The spectra obtained were compared with both reference spectra of geological samples previously available, and the new geological spectra presented in this article. The new specimens were analysed using a Perkin Elmer Spectrum Two FTIR spectrometer at the Wolfson Archaeological Science Laboratories of the UCL Institute of Archaeology (UK). This instrument allows for Attenuated Total Reflection (ATR) analyses and hence potentially totally non-invasive analyses. However, most of the archaeological objects studied here are held or exhibited at various museums in Spain and Portugal, and for curatorial concerns the extraction of a very small sample was preferable to moving the whole objects. Therefore, pellets were made using approximately 2 mg of analyte which was ground by hand in an agate mortar and mixed with a small amount of KBr, before pressing the mixture in a 13 mm diameter mould in order to produce 1 mm thick discs. The data were collected as infrared transmission spectra after scanning each specimen 50 times in the range 4000\u2013370 cmormation  to facilthcentury Mr. S. Calder\u00f3n [Around 150 localities with Cretaceous amber have been documented in the Iberian Peninsula , 13. MosCalder\u00f3n  referredCalder\u00f3n .Some of the amber deposits have undergone intense palaeobotanic and geochemical study. There have been systematic studies using FTIR of the most important localities such as Sant Just in the Maestrazgo Basin, or Pe\u00f1acerrada and El Soplao in the Basque-Cantabrian Basin \u201322, to wGeological samples of the main deposits have been selected as references in the present work. One sample from Ja\u00e9n province  has also been included due to its closer proximity to some of the archaeological sites considered. The geological samples analysed are presented in the following sections .There is a large sedimentary basin that developed during the Cretaceous period between the Iberian and European tectonic plates. The main deposits of amber in this area are those of El Soplao and Pe\u00f1acerrada , 21, whiAmber is documented in clayey rocks rich in organic matter from sediments deposited mainly in coastal areas and fluvial channels. There is a large quantity of plant remains, coal and other continental organic material transported by rivers. Some deposits contain remains of marine life as molluscs, which indicate a coastal environment in the area in which the resin was buried .-1, bands at 1460 and 1380 cm-1 because of simple C-H bonds, and bands from the group of carbonyls around 1700 cm-1, with the absence of bands at 3070 cm-1 being consistent with the amber's high degree of maturity.The FTIR spectra for amber from this area had been previously determined through the study of the Pe\u00f1acerrada and El Soplao deposits in particular , 21, and-1, a band with greater or lesser intensity at 1270 \u00b15 cm-1 preceded sometimes by a secondary peak and two secondary bands at 1180 and 1025 \u00b15 cm-1 followed in most instances by a band at 970 \u00b15 cm-1.We selected amber samples from six other localities  to explore variability across the entire area. In general, the spectra have the same characteristics as those already published for El Soplao and Pe\u00f1acerrada, with the sample from Ajo presenting a spectrum that is slightly different from the rest : all theIn the Central Asturian Depression, the main known amber deposits are those documented in the El Caleyu and Ullaga formations. In Pola de Siero, amber occurs, along with pyrite and fossilised plants, in lenses of grey silt within a 50-metre-deep layer of siliceous conglomerates, with a silt-sand matrix deposited on the Palaeozoic levels . In the There are some studies of the bioinclusions of these amber deposits, as well as gemmological studies, although prior to this work no FTIR spectra have been published. For the present research, we selected samples of amber from El Caleyu, whose FTIR spectra were similar to those already published for other Cretaceous Peninsular amber .The Maestrazgo Basin, which reached a sediment thickness of 6.5 km during the Mesozoic, is an intra-continental basin located in the Iberian Range that underwent two significant stages of rift during the Late Jurassic and Early Cretaceous; the rift structure is characterised by a system of faults that divide the Maestrazgo Basin into different blocks . In geneThe San Just deposit has grey-black clay stones with abundant plant remains and fusinised wood. Palynological studies suggest a subtropical hot-humid environment with hot and dry areas .-1 corresponding to the carbonyl group and the simple C-H bond respectively, with another band at 856 cm-1. The absence of the band of the exocyclic methylene group at 1640 and 880 cm-1 is significant, as it indicates a high level of maturity (including diagenetic effects) which would be consistent with its Cretaceous age.The FTIR spectrum from San Just was published by Pe\u00f1alver et al.  and is cThe La Hoya deposit, in Cortes de Arenoso municipality, contains abundant amber combined with coals and other vegetal remains deposited in deltaic environments. Insects have been documented in the amber as bioinclusions . The samIn a stratigraphic cross-section of Navalperal (Ja\u00e9n), near the town of Orcera, in the Prebetic Domain, a few pieces of amber have also been identified, a few centimetres in diameter, in a level of dark limestone with lignite from the Ci3 sequence ; accordTo this day, such discoveries of amber in small quantities are unheard of. During the present research, we carried out FTIR analysis of this locality given its greater proximity to many of the archaeological sites studied, compared to the geological amber deposits previously discussed. However, the FTIR spectrum obtained do not differ qualitatively from those already known for the geological deposits of the Northern half of the Iberian Peninsula  and haveAll in all, therefore, any of these spectra may be taken as characteristic reference spectra of Cretaceous Peninsular amber.The following sections provide some archaeological background to the samples reported here, while our discussion will integrate these new data with results published previously. Further details of archaeological samples analysed previously, and relevant bibliographic references, can be found in our previous publication .The burial monument of La Velilla is a circular chamber of about 9.5 m in diameter in which a minimum of 71 individuals were buried (56 adults and 15 sub-adults) of which only 9 retained anatomical connection . Five amThe five amber beads have a similar barrel shape, ranging between 1.6 and 2.5 cm in length and with a maximum diameter of 1.2\u20131.9 cm . We analth Millennium and the first half of the 3rd Millennium BC  [A recent series of 13 radiocarbon dates  place the use of this monument between the second half of the 4The site of Valencina de la Concepci\u00f3n  holds the greatest number of amber objects known for a single site for all the Late Prehistory of the Iberian Peninsula, and it stands out both for its size and for the uniqueness of some of its graves and materials . The amber object from this monument is a large bead, 3.3 cm in length and 0.9 cm wide, currently on permanent display at the National Archaeological Museum (Madrid) together with 14 green beads . Until tin situ around a cinnabar-covered stele, and a further two individuals in the small chamber whose sex could not be identified. All the women in the large chamber were dressed with costumes made up of more than a million beads of shell (and 251 of amber), covered with red cinnabar and accompanied by impressive grave goods consisting of gold-embossed sheets, carved ivory objects, ostrich eggs, large flint sheets and 2\u20134 mm thick flint arrowheads, rock crystal and amber. Similarly, the orthostats of the tholos were lavishly decorated in shades of red and black on their inner surface [The tholos of Montelirio . This is a huge megalithic structure with a large corridor, 39 m in length and only 1.3 m high, which forces visitors to access the chamber by crawling. At the end of the corridor there is a chamber with a 4.75 m diameter and a second smaller chamber, 2.7 m in diameter. In total, 19 middle-aged women have been documented in the large chamber, recovered  surface . Most of surface  (for a d surface ).Grave 10042\u201310049 . About 200 m North of the tholos of Montelirio is an area called PP4 Montelirio where more than 130 negative structures  have been documented, of which 61 contained human remains and 73 did not . This is a tholos with a circular chamber that is 4.3 m in diameter and with a 3 m long corridor where the remains of 50 individuals were documented. Amongst other grave goods, three amber beads were recovered , althougMound 8(IV). This is a mound with a trapezoidal chamber and a 2.9 m long corridor with burned remains of 20 individuals. The Leisners  do not mMound 12. This is a tholos with a 3.8\u20134 m diameter chamber and a 2.4 m long corridor in which 12 individuals and five pieces of amber were recovered: a fragment of a cylindrical bead; a drop or tear drop-shaped bead with a \"V\" perforation; a smaller cylindrical bead with reddish pigmentation; a disc with an arched surface, and a barrel bead . RegrettMound 63(III). Architecturally, Mound 63(III) is a 4 m long mound with a trapezoidal chamber and a 3.5 m long corridor in which several individuals were documented . Here a Mound 74(XIII). This is a tholos with a chamber 1.6 m high and a diameter of 4 m; the corridor has not been preserved . AmongstAt the set of graves at Llano de la Sabina, the appearance of amber beads is reported for two of them: graves 97 and 99.Llano de la Sabina 97 is a mound with a 2 x 1.7 m quadrangular chamber in which 'remains' of a skeleton were documented . A circuLlano de la Sabina 99 is a mound with a 2.7 m long trapezoidal chamber and a 4 m long corridor in which up to 20 individuals could have been buried . Inside,Although both graves were considered Chalcolithic by the Leisners , accordiThis is a mound with a quadrangular chamber with dimensions 1.8 x 1.7 m and a 2 m long corridor in which the remains of an individual and an amber bead are documented . These aAlthough the Leisners place this tomb within the Chalcolithic period, Siret places it within the Iron Age because of the metallic materials found '0.5 m from the floor', which leads us to think that a subsequent reuse process took place, as might be further evidenced by the presence of bronze bracelets (8\u20139% Sn) and silver beads . The ambTrivia arctica in the whole of the interior Iberian Peninsula.The site of Valle de las Higueras is the largest necropolis of hypogea found so far in the interior part of the Iberian Peninsula. With a C14 series between 2831\u20131511 cal. BC, eight funerary caves with collective burials have been documented . In thesCave 1 has a chamber with a diameter of more than 3 m, with a small passageway on the side that gives access to another smaller chamber. To the West of the main chamber, a niche was dug in the ground where variscite necklace beads and ceramic remains were located. Also in the main chamber variscite and amber beads were recovered, along with Bell Beaker ceramic and two points of flint with cinnabar remains. The radiocarbon date from bones yielded a date between 2470\u20132030 cal. BC . In the rd Millennium BC, between 2460\u20132190 and 2180\u20132140 cal. BC [Cave 3 is the most central one in the necropolis. It has a circular chamber with a narrow corridor that connects it to a rectangular antechamber with rounded sides. At the back of the chamber three niches were documented\u2014they had been dug into the rock and had the most significant grave goods. In the West niche, two children were buried, in the Central niche an adult woman with two children in her arms, and in the East niche, a young adult and another older adult. In front of the niches a dozen individuals were buried, of which only one woman had grave goods, which comprised of a variscite necklace. At least twelve burial sites were documented in the antechamber. A cylindrical amber bead 1.3 cm in length and with a 0.2 cm perforation comes from this set  and was  cal. BC .On the basis of his analysis, Dom\u00ednguez-Bella ruled out a Baltic source but did not go on to propose an alternative origin . In thisrd Millennium BC, although at higher levels there is documented evidence of reuse in the Iron Age and even Roman times. Dating carried out twice on human bone [The artificial cave of Sao Paulo is located in the Portuguese municipality of Almada, on the left bank of the Tagus River. This is a monument dug into the rock, and is part of a necropolis of which only two graves are known to be in artificial caves, although it is possible that the pressure of urban development has destroyed other similar graves. The artificial cave was discovered in 1988 and was excavated by the Department of Archaeology and History of the Municipal Museum of Almada. The hypogeum was dug in calcareous rock and consists of an elliptical chamber, almost circular, 7\u20137.5 m in diameter preceded by a corridor about 2.5 m long . Inside man bone , directlrd Millennium BC. They can be found at the Municipal Museum of Almada.In the course of the excavation, two amber beads were identified in the lower strata, corresponding to the 3The first bead is cylindrical and flattened, about 1.5 cm in diameter with a fine central perforation . The secth and 8th centuries BC [The Quinta do Marcelo archaeological site is located next to the mouth of the Tagus and has been interpreted as one of the first settlements established for exchanges with the Phoenicians . Howeveruries BC , raises uries BC , 52. Theuries BC , 54.The materials are held at the Municipal Museum of Almada, largely unpublished, with partial references in more general works. The amber bead that we are concerned with appeared in a waste pit or \"bag 2\", together with very high-quality materials characteristic of the Late Bronze Age: fine ceramics with internal and external decoration , 54, twoThe amber object is a circular bead of approximately 1.1 cm in diameter, with a central perforation. Although it has light oxidation on the surface, its state of conservation is considerably good .The FTIR spectra obtained for the different samples allow us to confirm that, in all cases, the raw material used is amber. At the same time, they present significantly different patterns, which allow us to note the use of amber with different origins, and exposed to different postdepositional conditions. At least three different geological sources can be identified, which are discussed in turn:-1). The amber spectrum from La Velilla is characterised by five well-defined bands: at 1570 \u00b15 cm-1 by the aromatic double bonds C = C, at 1457 \u00b15 and 1381 \u00b15 cm-1 attributable to alkyl groups, the first the -CH2 and -CH3 flexures  and the second due only to the -CH3 flexure; a band at 1158 \u00b15 cm-1 which can be attributed to the tension of the C-O simple ester bond, and one last band at 1034 \u00b15 cm-1 as well as three secondary peaks at 1411 \u00b15, 1277 \u00b15 and 1230 \u00b15 cm-1 , the archaeological site with amber that is closest to some of the Iberia\u2019s geological amber deposits. In this case, we can see that both the spectrum of the bead and the characteristic spectra of Cretaceous Iberian amber display similar patterns in the diagnostic area of the spectrum (i.e. c. 1600\u2013900 cm-1 (e.g. ) Fig 10-1. The a-1 as well as a secondary peak at 1226 \u00b15 cm-1. The most significant differences in the spectra are the band at 1570 \u00b15 cm-1 and the secondary peak at 1411 \u00b15 cm-1 in the sample from La Velilla, which do not appear in the geological samples, and may be due to oxidation processes . In fact, the spectrum from La Velilla sample is almost identical to the archaeological amber samples from the Palaeolithic settings of La Garma A [This spectrum is similar to the reference spectrum of the Cretaceous Peninsular amber described above, which is characterised by bands at 1457, 1376, 1155, and 1030 \u00b15 cm-1 preceded by a horizontal band between 1250 and 1180 cm-1 \u2013the so-called \u2018Baltic shoulder\u2019. This feature has been documented in only three of the samples studied for this paper: the beads from Llano de la Sabina 97 and 99, and Quinta do Marcelo. In all three cases, the Baltic shoulder can be clearly identified, so we can be confident about their attribution to an exogenous origin  from Los Millares and the artificial cave of Sao Paulo. Guiliano et al. [The spectra of the weathered surface of these same samples present significantly different features in the area between 1800 and 900 cm-1 . In theser (e.g. ), althouo et al.  proposedth Millennium BC [As a matter of fact, this same pattern is also observed in some of the most degraded samples elsewhere, such as those from Valle de las Higueras, Llano de la Teja 18 and Mound 12 from Los Millares ; Table 5nnium BC .All in all, we therefore assume that in all of these cases the original amber would also give spectra similar to those observed in the samples of the vitreous amber cores from the tholos of Montelirio, Mound 74(XIII) from Los Millares and the artificial cave of Sao Paulo. These spectra differ significantly from those of Cretaceous Iberian amber, and they lack the characteristic Baltic shoulder observed\u2013while they retain the typical bands of Sicilian simetite . At pres-1 and they are both characterised by peaks at 1455 and 1392 \u00b15 cm-1 followed by a secondary peak at 1375 \u00b15 cm-1, as well as bands at 1240 and 1043 \u00b15 cm-1. Notably, the characteristic bands of Cretaceous Iberian amber are not present.Lastly, the analysed samples from the Dolmen of La Pastora in Valencina de la Concepci\u00f3n and the beads from burial Mound 63(III) from Los Millares produced very similar spectra, suggesting that they were made of amber of the same origin . None of-1 obliges us to be cautious when proposing Sicily as the source: this band does not appear in other degraded samples, so we cannot confident dismiss it as a result of postdepositional alteration. However, at present, Sicily offers the most similar spectrum we know of. What we can be sure of is that it is exotic material, since it does not resemble the Cretaceous amber spectra of Iberia, where no workable amber deposits of other geological age have been discovered  were the first to be explicitly identified as simetite in several publications [Of these samples, the beads from the Dolmen of Alberite , the loications  does notth Millennium BC) [-1. Although it is true that the peak to which they refer appears displaced (at 1019 cm-1 instead of 1041 \u00b15cm-1 as it is in the reference spectra of simetite), all the bands described coincide with those of simetite . The second peak (887cm-1) cannot be considered a marker of provenance but of postdepositional alteration since, as noted above, this band disappears following thermal exposure [In any case, FTIR spectra matching those of simetite have also been published in the studies of the Mamoa V of Ch\u00e3 de Arcas and Chousa Nova (5nium BC) . The latnium BC)  because simetite , and it exposure .th\u20134th Millennia BC); the results of these analyses have not been published, although it has been confirmed that the amber is not Baltic succinite [th\u20133rd Millennia BC, such as those from the tholos of Montelirio or the artificial cave of Sao Paulo, whose unaltered cores also give the same spectrum as Sicilian simetite. We therefore propose that those samples constitute degraded simetite [Other deposits of Late Neolithic chronology and bearing amber include the Campo de Hockey analyses  points to an Iberian source and thus confirms the strength of regional networks. The use of regional raw materials in the North Peninsular area continued until the 2 Lagos I .The use of these local resources, however, is not documented in the Southern part of the Iberian Peninsula. Outside the Northern region, where geological amber deposits are abundant, the amber objects analysed are, in all cases, foreign. This preference for exogenous raw materials could respond to different causes that are not mutually exclusive. From a technological point of view, the greater age of Iberian amber makes it more fragile and therefore more difficult to carve than succinite or Cenozoic simetite. From a more social perspective, it is worth considering that amber objects may have arrived in Iberia already manufactured; in this case, the choice of foreign objects would be driven not so much (or not just) by the quality of the material, but by the role played by these amber objects in establishing social relations or alliances through exchange or gift policies.rd Millennium BC [rd Millennium BC contexts for the objects from Valencina de la Concepci\u00f3n and those from the artificial cave of Sao Paulo, Valle de las Higueras, Llano de la Teja 18 and Los Millares.This presence of foreign amber materialises in a much more evident way during the 3nnium BC , 70. ThiTrivia arctica is from the Atlantic and the amber from Sicily, an image that is fairly coherent with the central location of this necropolis in the Iberian Peninsula.In the South Plateau, the necropolis of Valle de las Higueras is an exception because of the presence of amber associated to Bell Beaker, something not found in the area\u2019s hypogea , nor in th Millennium BC at least; in parallel, the presence of variscite from the Iberian West in the megaliths of Luffang (North-West France) dated to the 4th Millennium BC [rd Millennium BC is notable and reflected in the greater participation of this region in trans-regional circuits of exchange, as manifest in the fact that all the sites with more abundant amber and other \u2018exotic\u2019 objects are located in this area.Overall, while the sites in the North of the Iberian Peninsula show continuity and the survival of the local networks of exchange, the identification of Sicilian amber in Andalusia demonstrates the beginning of Mediterranean exchange circuits dating back to the 4nnium BC  confirmsth Millennium BC, and possibly earlier. Interestingly, the first amber objects recovered in Sicily and assigned a local origin also date from the 4th Millennium BC [th and 3rd Millennia BC is similar to that of ivory objects [Thus we can confirm the presence of simetite in the Iberian Peninsula as early as the 4nnium BC , 72. Hownnium BC . Even th objects , which cth Millennium BC seems to be interrupted abruptly in the 2nd Millennium BC. With the exception of very late examples addressed below, there are only a few contexts from the 2ndMillennium BC in which amber is documented, and these are more or less restricted to the North-Eastern part of Iberia. It is in this period, however, when we first document Baltic succinite, which from then on will become virtually the only raw material used. A similar situation, namely simetite being the only type of amber deposited, has been described for Italy and Sicily from the Eneolitic to the Middle Bronze Age [nd Millennium BC , although most of the objects, especially in Early Mycenaean contexts, are concentrated in a few of the richest graves [nd Millennium BC samples from Greece analysed by Beck and Hartnett [th century BC [nd Millennium BC is Baltic in origin, evidencing connections between Nordic/Atlantic Europe and the Mediterranean (e.g. [The steady increase in amber consumption we had been observing since the 5onze Age . It shout graves \u201376. SiciHartnett  and the ntury BC . Howeveran e.g. \u201377)..th MilleUnfortunately, the lack of absolute dates in the Bronze Age settings of the North-East part of the Iberian Peninsula where amber is documented prevents us from accurately pinpointing the moment when succinite begins to reach Iberia. The earliest known evidence of Baltic amber may be that of the Dolmen of Larrarte (Guip\u00fazcoa). Published dates for this site range between 5345\u20134051 cal. BC and 4236\u20133542 cal. BC . HoweverIn the Iberian North-East, Baltic amber has been documented in Pedra Cabana, Cabana del Moro de Colomera and Muricecs , 24. Altrd and the 2nd Millennia BC. Archaeologically it is impossible to assign the pieces of amber to any particular chronology but their Baltic origin suggests that they correspond to the later reutilisations. The sample from Llano de la Teja 18, another monument with evidence of reuse, raises more doubts, as the FTIR spectrum for the amber is consistent with Sicilian simetite and hence would suggest a 3rd Millennium BC chronology. We acknowledge, however, the risks of circularity in our argument.In the South-East, we have the samples from Llano de la Sabina 97 and 99, recovered in megalithic monuments with evidence of reuse, with mixed materials from both the 3nd Millennium BC is more significant when placed against the backdrop of other changes: during the 4th and 3rd Millennia BC, amber had been closely linked to megalithic monuments of undeniable symbolic significance, and often accompanied by other special raw materials such as ostrich eggs, ivory, cinnabar or gold; all of these exotic raw materials appear to vanish concurrently [The decline in amber consumption during the 2urrently . This raurrently ). Similaurrently .th-8th centuries BC), Moreirinha (13rd-9th centuries BC) and Senhora da Guia (10th-8thcenturies BC) in Portugal [this paper, st-6th centuries BC) and Herrer\u00edas II (10th century BC) in Spain [th century BC is concentrated close to coastal sites, and the earliest evidence of Baltic succinite in Southern and Western Iberia occurs in association with some of the earliest iron objects, and is hence connected to a technology that likely arrived via the Mediterranean. This is the case of Quinta do Marcelo, Moreirinha, Senhora da Gu\u00eda and Palacio III. Moreover, there are other objects which point to Mediterranean pre-colonial contacts: metal artefacts recovered at Quinta do Marcelo have been related to the Mediterranean [th-13th centuries BC or the wheeled and Cogotas I pottery from Cuesta del Negro (Granada) dated to the 14th century BC, also with a proposed Mycenaean origin , amber will reappear in Iberia in the Late Bronze Age and the Early Iron Age , when Mein Spain , 82. Datin Spain \u201385. Howein Spain , 86. It erranean ; bronze erranean ; and siles Ortiz  for disces Ortiz  for genend Millennium BC, in a phenomenon that is usually connected with Mediterranean rather than Atlantic networks.In the North-Eastern Iberian region, continental contacts through the Pyrenees continued during the Bronze Age  as well as Mediterranean ones, although the latter being seemingly less important. This panorama will change during the Late Bronze Age/Early Iron Age, when Mediterranean contacts become more intense . Based oThe new evidence presented in this paper, brought together with information published previously, has allowed the most comprehensive review to date on the provision and exchange of amber in the Prehistory of Iberia. Several conclusions and priorities for future work can be highlighted:From a methodological perspective, thanks to the analyses carried out on both the core of vitreous amber and the oxidation layers of the objects from the tholos of Montelirio, Mound 74(XIII) from Los Millares and the artificial cave of Sao Paulo, we have been able to define the characteristic FTIR spectrum resulting from degraded Sicilian simetite. These spectra can be used as a reference to identify Sicilian amber even in highly deteriorated archaeological samples.The local origin of the amber from La Velilla emphasises the continued use of local resources from the Palaeolithic to the Bronze Age in the Northern region of Iberia, in stark contrast with the picture obtained from the South.th Millennium BC at least, and that it was likely integrated in broader Mediterranean exchange networks that intensified during the 3rd Millennium BC, as attested to by amber finds as well as other exotic materials.We can verify that the arrival of Sicilian amber in the Iberian Peninsula started in the 4nd Millennium BC, as evidenced by the analysis of Quinta do Marcelo and other sites; the more significant influx of Baltic amber will take place from the turn of the Millennium.After an apparent decline in the use of amber, Baltic succinite appears to replace Sicilian simetite in the Iberian Peninsula in the second half of the 2th\u20133rd Millennia BC and its archaeometric characterisation, not least considering the possible involvement of this region in the Mediterranean exchange network. Relatedly, a systematic exploration of North African amber resources should be warranted; there are currently no known geological deposits of amber in North Africa, except for a locality with amber in Tunisia that remains to be confirmed [The new results thus fill some of the research gaps highlighted in our 2012 publication , while tonfirmed . AnotherS1 File(XLSX)Click here for additional data file."}
{"text": "Mother of FT and TFL1 (MFT) belongs to phosphatidylethanolamine-binding protein (PEBP) family, which plays an important role in flowering time regulation, seed development, and germination. To gain insight into the molecular function of DlMFT in Dimocarpus longan Lour., we isolated DlMFT and its promoter sequence from longan embryogenic callus (EC). Bioinformatic analysis indicated that the promoter contained multiphytohormones and light responsive regulatory elements. Subcellular localization showed that the given the DlMFT signal localized in the nucleus, expression profiling implied that DlMFT showed significant upregulation during somatic embryogenesis (SE) and zygotic embryogenesis (ZE), and particular highly expressed in late or maturation stages. The accumulation of DlMFT was mainly detected in mature fruit and seed, while it was undetected in abortive seeds, and notably decreased during seed germination. DlMFT responded differentially to exogenous hormones in longan EC. Auxins, salicylic acid (SA) and methyl jasmonate (MeJa) suppressed its expression, however, abscisic acid (ABA), brassinosteroids (BR) showed the opposite function. Meanwhile, DlMFT differentially responded to various abiotic stresses. Our study revealed that DlMFT might be a key regulator of longan somatic and zygotic embryo development, and in seed germination, it is involved in complex plant hormones and abiotic stress signaling pathways. Dimocarpus longan Lour.) is a famous subtropical economic fruit tree in Southeast Asia. Embryogenesis is an important factor associated with fruit output quantity and quality in longan [Longan -like, TERMINAL FLOWER1 (TFL1)-like, and MFT-like [MFT-like clade seems to be the phylogenetically ancestral to other clades [FT and TFL1 are two regulators with antagonistic functions in controlling flowering time and plant architecture, FT acts as the floral activator, but TFL1 acts as inhibitor [MFT shows high similarity to both FT and TFL1, the function of MFT in controlling flowering time might be different from FT/TFL1. Overexpression of MFT in Arabidopsis caused slightly early flowering under long days, but its function in determination of flowering time was redundant [PopMFT did not identify a function in controlling flowering time [Arabidopsis indicates MFT was a potential candidate gene for altered flowering time at an increased atmospheric (CO2) [The plant phosphatidylethanolamine binding protein (PEBP) family was divided into three main clades, MFT-like ,12,13,14r clades ,15,16. Fnhibitor ,18,19. Inhibitor . Althougedundant , whereasing time ,22. Idenic (CO2) .MFT in several plants were very similar; Arabidopsis thaliana MFT [Vitis vinifera MFT [Populus nigra MFT [Citrus unshiu MFT [Zea mays MFT [Triticum aestivum MFT [Jatropha curcas MFT [Glycine max MFT [Hevea brasiliensis MFT1 [Gossypium hirsutum MFT1 and MFT2 were mainly expressed in flowers and low-transcribed in other tissues [SrMFT were constitutively expressed in various tissues and developmental stages in Symplocarpus renifolius, although the expression of SrMFT in female-stage spadices was higher than in other stages, whereas overexpression SrMFT in Arabidopsis did not show the function in earlier flowering [AcMFT showed a distinct decrease from the young frond stage to the sori development and maturation stages, and was regulated by photoperiod in Adiantum capillus-veneris, introduced AcMFT in Arabidopsis promoted flowering [Arabidopsis, MFT promoted embryonic growth during seed germination by directly repressing ABI5 expression, it played a critical role in seed germination via a negative regulation of abscisic acid (ABA) signaling pathway [MFT promoted primary dormancy during seed development, and enhanced germination in after-ripened imbibed seeds with exogenous ABA in Arabidopsis [TaMFT, an MFT homolog in wheat (Triticum aestivum) acted as a positive regulator of seed dormancy, while a negative regulator of seed germination [MFT in soybean responded to exogenous applied ABA and gibberellin (GA), ectopic expression of GmMFT in Arabidopsis did not affect the flowering time but suppressed seed germination [HbMFT1 in Arabidopsis inhibited seed germination, seedling growth, different with previous studies, it delayed flowering time [FvMFT located in the nucleus and cytoplasmic membranes, ectopic expression of FvMFT in Arabidopsis also inhibited seed germination through integrating ABA and GA signaling, FvMFT could notably promote the primary root growth under sugar-deficient conditions [The expression pattern of iana MFT , Vitis vfera MFT , Populusigra MFT , Citrus shiu MFT , Zea maymays MFT , Triticuivum MFT , Jatrophrcas MFT , Glycine max MFT  and Hevesis MFT1  were mai tissues . SrMFT wlowering . In addilowering . In Arab pathway , it also pathway . Meanwhibidopsis . Conversmination . The hommination . Ectopicing time . FvMFT lnditions .MFT during SE and ZE, and its signaling pathways involved in the response to hormones and environmental cues in embryogenic calli are still fragmented. In addition, the function of MFT homolog in longan has not been investigated. In our study, we isolated DlMFT and its promoter, and found that DlMFT was a seed-specific gene, and might play an important role in longan embryogenesis, seed development, and germination. DlMFT also involved in complex hormones and stress responses. The information provided by our study may help to illuminate the biological functions of DlMFT in longan.At present, the expression profile of DlMFT from embryogenic callus of Dimocarpus longan. The amplified 866 bp region of DlMFT cDNA contained a 519 bp protein coding sequence flanked by a 54 bp 5\u2032-untranslated region and a 312 bp 3\u2032-untranslated region (GenBank accession No. KP861622). The gDNA sequence of DlMFT was cloned from longan EC DAN with specific primer and submitted to GenBank (GenBank accession No. KY968646), the comparative analysis of MFT genomic organization indicated that the MFT contained three introns and four exons, and owned the same number of nucleotides in exons (The RT-PCR (reverse transcription polymerase chain reaction) combined with RACE (rapid amplification of cDNA ends) strategy was used to obtain the complete cDNA (complementary DNA) and gDNA (genomic DNA) sequences of in exons a.Arabidopsis MFT, Malus domestica MFT and Citrus clementina MFT, respectively (http://blast.ncbi.nlm.nih.gov). Two highly conserved DPDxP and GIHR motifs between the PEBP families were identified  and H (His-88) were possibly the most critical for distinguishing FT and TFL1 function on flowering regulation [DlMFT does not play a central role in flowering time regulation. A phylogenetic tree for the PEBP family was constructed using several amino acid sequences of other MFT orthologs  was isolated from embryogenic callus gDNA by genome walking. The PLACE database was used to analysis the putative cis-acting elements in this promoter, and the sequences on both strands were considered. The putative regulatory elements are show in DlMFT promoter contained multiple regulatory elements, including the AACA core (AACAAAC), (CA)n element (CNAACAC), DOF core (AAAG), E box (CANNTG), RY repeat (CATGCA) and SEF1, SEF3, SEF4 motifs , which were involved in seed-specific transcriptional regulation [DlMFT may be regulated by ABA, GA3, SA and MeJa. Furthermore, there were 22 light-responsiveness elements, including GT1-motif (3), SP1 (3), GA-motif (3), GAG-motif (3), Box-I (2), G-box (2), ACE (1), AE-box (1), ATCT-motif (1), GATA-motif (1), I-box (1), and TCT-motif (1).Base on the gDNA sequence, a 1.85-kb gulation . MeanwhiDlMFT pro:GUS fusion  scale leaf epidermis cells, 4\u2032,6-diamidino-2-phenylindol (DAPI) was used as a maker of nuclear localization. As shown in The subcellular localization of DlMFT:mGFP was examined through a transient expression of DlMFT:mGFP in onion  during SE and ZE . As shown in Figure 7B, DlMFT was minimally expressed in non-embryogenic callus (NEC), embryogenic callus (EC) and incomplete compact pro-embryogenic cultures (ICpEC), but highly expressed in latter stages, and showed continuous up-regulation from ICpEC stage to cotyledonary embryos (CE) stages, and peaked at CE stage. Meanwhile, DlMFT mRNA was detected in all examined zygotic embryo development stages of \u2018Honghezi\u2019 longan , its expression level was very low in S1 and S2 stages, and continuously increased during the embryo development stages, and showed a peak in mature zygotic embryo stage (S7). The results showed that DlMFT exhibited a similar expression pattern during longan SE and ZE, the expression profile implied a promotion role of DlMFT during longan SE and ZE, especially, at the late embryogenesis stages.To better understand the transcription regulation of DlMFT in longan, we examined the levels of DlMFT transcript in different tissues, including roots, stems, leaves, vegetative buds, floral buds, inflorescence, flower buds, male flowers, filaments, anthers, female flowers, young fruits, ripe fruits, pericarp, pulp and seeds of \u2018Honghezi\u2019 longan  after flowering, and checked the expression of DlMFT in these seeds. The result showed that DlMFT was highly expressed in normal development seeds, but was undetected in abortive seeds of \u2018Quanlong baihe\u2019 longan  with quantitative real-time PCR. The expression level of DlMFT was significantly decreased at 4-day and 8-day periods, and then kept at a relatively stable and low level at 8, 12 and 16 day periods, finally markedly decreased at 20-day period , auxin transport inhibitor (NPA), PP333, MeJa, SA, BR, ABA, kinetin (KT) and ethylene (ETH) for 24 h. Among the treatments, exogenous 2,4-D inhibited its expression, and higher concentration of 2,4-D induced a more significantly expression decline , ABA, BR and PP333 did the opposite function, and KT and ETH showed no significantly function on DlMFT expression.Taken together, our results revealed the transcription mechanism of DlMFT is affected by abiotic stress, we detected the mRNA level of DlMFT in longan EC exposed to 150 mM NaCl and PEG-4000 for different time, and treated with different concentration of sucrose, KClO3 at 110 rpm at 25 \u00b0C under dark conditions for 24 h. In addition, longan EC was treated under different temperature and light qualities conditions for 24 h to define whether DlMFT responded to temperature and light. The results revealed that treatment with 150 mM NaCl for 1, 2, and 4 h induced a significant expression increase as the treatment time increased, and the highest transcript level (~32.4-fold of the control) of DlMFT was observed at 4 h; then, as the treatment time increased, the transcript level declined, but still higher than the control . However, it showed an arresting decline in the 40 \u00b0C treatment  and plant growth inhibitor (PP333) in longan EC. During longan SE, high dose of 2,4-D was essential for SE induction [DlMFT accumulation facilitated the morphogenesis in the middle and late SE and ZE stages, which suggested that DlMFT might involved in auxin signaling pathway during longan SE. ABA is an important plant growth regulator that is involved in embryo formation and maturation [DlMFT was promoted by ABA, consistent with the study that the expression of AtMFT was induced by ABA during seed germination [DlMFT was promoted by exogenous GA3, and inhibited by SA and MeJa. In addition, DlMFT promoter contained multiple elements related to hormone signals, including ABRE for ABA responsiveness, CGTCA-motif for MeJa responsiveness, TCA-element for SA responsiveness, TATC-box and GARE-motif for GA responsiveness. Thus, it was suggested that DlMFT was involved in various hormones signaling during longan SE.In our study, ibitor PP33 in lonturation ,39,40. Dturation ,42, but turation ,44,45,46mination . Plus th3 could increase the accumulation of DlMFT. Relatively high temperature was effective to induce secondary somatic embryos, while a low temperature was more suitable for further embryo development [DlMFT was inhibited with 40 \u00b0C treatment, while no significant change of the expression was found when treated with 32, 34 and 36 \u00b0C.Stress acts as an embryogenic stimulus, which plays an important role in plant SE . In citrelopment . The expDlMFT were observed, which might involve in transcriptional regulations of DlMFT gene. We found that DlMFT responded differently to various light treatments, all the light treatments up-regulated the expression of DlMFT, especially, with the yellow and blue light treatments. These results indicated that DlMFT might be involved in complicated light signaling pathways during longan SE.Light and temperature are the key abiotic modulators of plant gene expression . Light qFvMFT in Arabidopsis notably promoted the primary root growth under sugar-deficient condition [MFT might be involved in sugar signaling. In the present research, compared with 2% sucrose (control), the transcription level of DlMFT was promoted at higher and lower concentration of sucrose, while inhibited under sucrose-deficient condition, which indicated that DlMFT was included in sugar signaling pathway. All these results indicate that DlMFT, at least in part, take part in the abiotic stress response.In addition, sugars have important hormone-like functions as primary messengers in signal transduction, sugar signaling is yet another potential source for regulation of nuclear genes . High coondition , which sThe synchronized embryogenic cultures at different developmental stages, including the non-embryogenic callus (NEC), friable-embryogenic callus (EC), incomplete compact pro-embryogenic cultures (ICpEC), globular embryos (GE), heart-shape embryos (HE), cotyledonary embryos (CE) were obtained by the following previously published methods ,4. \u2018HongN-1-Naphthylphthalamic acid  , Paclobutrazol  , KClO3   with agitation at 110 rpm at 25 \u00b0C under dark conditions for 24 h, with 3 replicates. EC culture in MS liquid medium as control. EC treated with 1 mg/L IAA for different time , treated with 150 mM NaCl for different time  and treated with PEG-4000 for different time  in liquid MS medium with agitation at 110 rpm at 25 \u00b0C under dark conditions, EC culture in MS liquid medium as control. EC treated with different light qualities  was carried out at 25 \u00b0C for 24 h. Frozen all samples in liquid nitrogen immediately for 5 min after collecting, then stored at \u221280 \u00b0C for isolating the total RNA.Transferred 0.2 g 18-day subculture longan EC to MS liquid basal medium (2% sucrose) supplemented with ABA  , 2,4-D  , BR  , IAA  , SA  , MeJa  , GA3  , MFT from longan embryo callus transcriptome (SRR accession number: SRA050205), specific primers DlMFT-GSP1 and DlMFT-GSP2 couple with 3\u2032-primer and 3\u2032-Nest primer, respectively, were used for 3\u2032-RACE, DlMFT-GSPa and DlMFT-GSPb couple with 5\u2032-primer and 5\u2032-Nest primer, respectively, were used for 5\u2032-RACE, DlMFT-F/R were used for Splice verification and gDNA amplification, all primers are list in The cDNA was synthesized from total RNA of embryo callus using GeneRacer\u2122 Kit (RLM-RACE)  according to the manufacturer\u2019s protocol. Base on the sequence of DlMFT, specific primers SP1, SP2 and SP3 and the adaptor primers AP1 and AP2 were used for cloning the promoter by Tail-RCR  protocol of genome walking Kit (Takara) from embryogenic callus DNA. The PLACE (https://sogo.dna.affrc.go.jp/cgi-bin/sogo.cgi?lang=en&pj=640&action=page&page=newplace) database and the PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) database were used to analyze the putative cis-acting regulatory elements. The primers used in promoter cloning are list in Based on the gDNA sequence of DlMFT without a terminator codon (TAA) was sub-cloned in BglII sites of pCAMBIA1302-GFP vector for investigating the subcellular localization of DlMFT in Allium cepa. The pCAMBIA1302-GFP vector (served as the positive control) was co-transformed into Allium cepa. 4\u2032,6-diamidino-2-phenylindole (DAPI) was used as a maker of nuclear localization. Transient transformation of onion (Allium cepa) scale leaf epidermis cells was performed using the agrobacterium-mediated gene expression system and analyzed by laser scanning con-focal microscopy . The protocols were similar to transient transformation of onion scale leaf epidermal cells described previously [In order to generate DlMFT: GFP fusion protein, the coding sequence (CDS) of eviously , with soN. Benthamiana were extracted with TransZol Up Plus RNA Kit . Samples were then treated with DNase I to remove any genomic DNA. RNA was quantified by NanoDrop Lite spectrophotometer  and checked the integrality using 1.0% agarose gel electrophoresis.Total RNA of longan embryogenesis cultures and EC under various treatments were extracted by means of TriPure Isolation Reagent . Total RNA was isolated from longan tissues and different germination stages with the Universal Plant Total RNA Extraction Maxi Kit (Spin-column) . Total RNA of TM (Takara), 1 \u03bcL of 10\u00d7 diluted cDNA, and 0.8 \u03bcL specific primer pairs , the amount of RNA was 500 ng in 10 \u03bcL reaction system. qRT-PCR was performed on the Lightcycler 480 system  in a 20 \u03bcL final volume containing 10 \u03bcL of 2\u00d7 SYBR Premix Ex Taqes of SE , differees of SE . The expDlMFT pro:GUS plasmid, a 1.85-kb BamHI (5\u2032)-NcoI (3\u2032) DlMFT promoter fragment was subcloned into the BamHI-NcoI site of pCAMBIA1301, and designated this recombinant plasmid as DlMFT pro:GUS, used pCAMBIA1301 as control, then transferred DlMFT pro:GUS and pCAMBIA1301 into A. tumefaciens EHA105, respectively. Transient transformed the resulting A. Tumefaciens EHA105 in N. Benthamiana leaves by the injection method, then cultured the transformation plant in the greenhouse at 25 \u00b0C under dark conditions for three days. The injected part of the leaves was then harvested for verifying the activity of 35S and DlMFT promoter by qRT-PCR.To generate the"}
{"text": "The time-dependent oxygen absorption of aqueous GA solutions (pH 2.9\u201313.8) was determined and the results were described using a second-order kinetic model. We calculated the degree of deprotonation (DoD) of GA in the solutions from the species distribution curves, and assessed the effect of the DoD on the reaction kinetics. This revealed that both the reaction rate coefficient k and the scavenger capacity n were significantly affected by the DoD. If the DoD fell below 0.25, there was no significant reaction. Although k increased with the DoD, n reached a maximum at DoD = 0.6\u20130.7. In principle, target DoD values can be achieved using any base, but a strong base is more efficient because lower quantities are required. In our experiments, the amount of Na2CO3 required to reach the maximum DoD was more than twice that of NaOH. Our results provide the basis for the functional design of active packaging systems incorporating optimized GA-based oxygen scavengers.Oxygen scavengers based on gallic acid (GA) usually contain a base that establishes the alkaline conditions necessary for the humidity-induced scavenger reaction. Here we measured the effect of sodium carbonate (Na Water-free sodium carbonate  was used as a reference.To prepare aqueous GA solutions at different pH values, samples of 0.040 g GA powder and the appropriate amount of base were mixed with 5 mL destilled water in a Petri dish at 23 \u00b0C. Solutions were prepared with NaOH at pH 5.7, 7.9, 9.1, 11.1, 13.0, 13.8. Solutions were prepared with NaK, as shown in Equations (1)\u2013(5).An aqueous solution of GA includes several acid-base equilibria, each characterized by its corresponding equilibrium constant 4A, 3\u2212, and A4\u2212 denote the GA species with 4, 3, 2, 1, and 0 acidic protons, respectively. Equations (1)\u2013(4) describe the GA deprotonation equilibria characterized by the equilibrium constants pKa1 = 4.39 which is related to the carboxylic proton and pKa2 = 8.50, pKa3 = 10.38, pKa4 = 13  and the charge balance (Equation 7):A is the initial GA concentration and [A4\u2212], [HA3\u2212], 4A], [H3O+], [OH\u2212], [Na+] are the equilibrium concentrations of the different GA species and the hydronium, hydroxide and sodium ions, respectively.where cfsolve function. The pH \u2013(7) was solved in MATLAB R2014a  using the + refers to the total amount of acidic H+ available from the GA molecules in the solution, and donated H+ refers to the total amount of acidic H+ transferred to the solution at a certain pH.where total acidic H2CO3, a biprotic base, is added to the solution, additional equilibria have to be considered as shown in Equations (9) and (10).If Na2. The equilibrium constants we used were pKb1 = 10.3 and pKb2 = 6.3  was monitored for 30 days at 23\u00b0C using Fibox 4 Trace, a luminescence-based O2 detection system . To minimize the effect of O2 transport limits in the solution, the Petri dishes were only partially filled.The absorption of Of 88 cm3 . The Petp2O absorption data in hPa were converted to concentrations c2O using the ideal gas law (Equation 11).The n2O is the amount of substance of O2, VHS is the headspace volume of the cell, R = 8.314 J mol\u22121K\u22121 is the ideal gas constant, and T is the temperature in Kelvin.where Each experiment was carried out at least three times and the results are presented as the arithmetic mean with standard deviations.exp) of the observed O2 concentrations was calculated as shown in Equation (12):The mean square error   we do not differentiate between the different GA species; (ii) the oxygen uptake is irreversible; and (iii) all oxidation products are summarized as GAox.where GA represents all non-oxidized GA species, r was expressed as shown in Equation (14):The kinetic law of this reaction was approximated as a second-order elementary reaction and the reaction rate 2] denote the concentrations of GA and O2, respectively [mol m\u22123] and k is the reaction rate coefficient [m3 mol\u22121 s\u22121]. Based on this kinetic law, the net consumption rates of GA and O2 were described with the system of ordinary differential equations (ODEs) shown as Equations (15) and (16)where [GA] and [Oode15s. The model was fitted to the experimental data to determine the kinetic parameters k and n. The fit was optimized using a downhill simplex method as described by Pant and Reinelt  was described using Equations (1)\u2013(10). GA is present as a range of deprotonated GA species that depend on the pH of the solution. The equilibrium concentrations of the different GA species at a given pH are determined by the acidity constants of the acidic protons. on of GA . The DoD2CO3 is necessary to achieve a certain DoD according to the simulation. Due to the different strength of the two bases, the amounts differ significantly and the difference in the quantity of each base required becomes larger as the DoD increases. For example, to achieve a DoD of 0.75 using Na2CO3, base:GA weight ratio is 2, but this falls to only 0.8 when using NaOH.2 scavengers can absorb O2 if water is present, i.e., in aqueous solutions comprising GA and a base. We assessed the effect of the base on the ability of GA to absorb O2 in solutions at different pH values, prepared by adding either NaOH : The necessary quantities to achieve higher pH values would not dissolve in the GA solution.The reference solution with no base added (pH = 2.9) did not absorb any On et al.  also rep2 absorption must reflect a pH-dependent effect on the mechanism of the oxidation reaction, leading to different ways of incorporating O2 and thereby to different oxidation products. This was confirmed by the color development of the samples. t = 0), the solutions were almost colorless with a slight yellow tint. Between days 1 and 30, the solutions at pH 7.2 and 11.1 changed from green to brown, whereas the solution at pH 13.0 change from organge to yellow. For autoxidation experiments in the pH range 2.6\u201311, T\u00f3th et al. (The experiment was stopped after 30 days, but not all samples reached their maximum absorption capacity during this period because the scavenging reaction was too slow. The observed differences in Oh et al.  reportedh et al. . Further2 absorption measurements clearly demonstrated that pH has an effect on scavenger kinetics. However, the pH only provides information about conditions external to the reaction and, strictly speaking, the concept of pH can only be used to describe dilute aqueous solutions. For the design of O2 scavenger mixtures for packaging applications, it therefore seems more reasonable to describe the autoxidation process as a function of an intrinsic property of GA, the DoD.The Ok and n were determined for each experimental dataset by fitting a second-order kinetic model (exp. The fitted curves are shown in 2 uptake by GA under diverse conditions.The kinetic parameters ic model . For mosk and the absorption capacity n in the presence of each base. We found that k increased in line with the DoD, but that n reached a maximum at a DoD value of 0.6\u20130.7 equating to a pH of 10\u201311 under our experimental conditions. When the DoD fell below 0.2\u20130.3 there was no significant O2 absorption. At a DoD value of 0.6\u20130.7 the predominant species in the solution are HA3\u2212 and 4\u2212 is likely to involve a different reaction pathway leading to a lower absorption capacity.nd H2A2- . These s2CO3 required to achieve a certain DoD in the solution and this relationship is the basis for the development of an optimized scavenger composition. For maximum O2 scavenger capacity, the DoD should be 0.6\u20130.7. This requires a base:GA mass ration of ~1.8:1 for Na2CO3 and ~0.8:1 for NaOH. As expected, a much smaller amount of the strong base NaOH is required to reach any given DoD compared to the weaker base Na2CO3. In terms of the design and processing of packaging materials incorporating scavengers based on GA, the amount of base required is important in terms of the precessability of the packaging material and the cost efficiency of the process.2 absorption properties of the system in terms of the reaction rate constant and also the maximum absorption capacity. The addition of a base changes the acid-base equilibrium of the solution and therefore the type and amount of GA species that are present, which in turn influences the autoxidation reaction and ultimately the absorption of O2. The key property that must be targeted when designing O2 scavengers based on GA is therefore the DoD. We found that no reaction occurred at DoD values below 0.25. The absorption capacity n reaches its maximum value when the DoD is 0.6\u20130.7 whereas the reaction rate constant k increases with the DoD. Accordingly, the optimum DoD can be achieved by adding either NaOH or Na2CO3, but a strong base is more efficient because a lower quantity is required to reach the desired DoD value. These results, together with the models describing the GA solution and the autoxidation reaction, provide guidance for the development of packaging systems incorporating O2 scavengers based on GA.In this study, we found that the amount and type of base added to an aqueous GA solution changes the OThe datasets generated for this study are available on request to the corresponding author.AP conceived and designed the experiments, performed some of the oxygen absorption measurements, conducted the simulations and parameter estimations, and wrote the paper. D\u00d6 contributed to the experimental design and performed some of the oxygen absorption measurements. SF contributed to the analysis and interpretation of the results and helped to write and revise the paper. MR contributed to the experimental design as well as modeling and simulation techniques and revised the paper.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Diagnostic radiology examinations are generally very efficient processes optimized for high throughput and for serving the needs of physicians. On the downside, streamlined examinations disrupt the personal relationship between diagnosticians and patients. The radiology associations RSNA and ACR consider low visibility of radiologists a threat to the profession. Therefore, they launched counter-acting initiatives that aim at increasing patient satisfaction by providing more personal attention and care, and by raising knowledge about the discipline. However, they did not formulate concrete instructions on how to integrate care by radiologists into the examination process while inhibiting the flow minimally. From an internal patient satisfaction survey, we have seen that patients rated satisfaction with care and attention by physicians relatively low, indicating that patients would welcome a possibility to communicate with radiologists. In a controlled experimental setting, we have then changed our process to include a short medical history interview. Thereby we could corroborate that lack of educated communication is the primary cause of diminished satisfaction and could establish that the duration of the encounter is not critical to achieving improvement. Importantly, the interview also helped to improve the quality of the examination. Thus, short medical history interviews are a very efficient way to increase value by maximizing patient satisfaction and examination quality. Our approach is easy to implement in other radiology clinics that are interested in becoming more patient-centered and in raising patient satisfaction. Radiology examinations constitute an essential and indispensable part of modern medicine and accordingly cause a considerable fraction of health care costs ,2. HenceIt is well established that communication between patients and physicians influences the quality of medical care . PatientGiven the importance of patient involvement in the medical care process, the lack of possibilities for patients to talk to the radiologists seems to be detrimental. The radiological associations ACR and RSNA consider this shortcoming a potential threat to the profession and therefore promote a more patient-centered radiology , 12. HenFor internal purposes, we conducted a patient satisfaction survey and became aware that patients rated attention and care by physicians low when they had no contact with radiologists. We tried to address that problem in a controlled experimental setting by imposing a patient-doctor interaction that was minimally interruptive for radiologists. This change in the diagnostic radiology process raised patient satisfaction to a level that was comparable to much longer interactions and incidentally improved the quality of radiologic examinations. Thus, we describe an approach to reconcile the need of patients to communicate with the need of process optimization in diagnostic radiology and provide a blueprint for a patient-centered and efficient radiology.We performed the study in accordance with the policy of the Institutional Review Board  of the Kanton of Bern (Switzerland). As we documented neither the patients\u2019 names, birth dates, nor their sex or other parameters that could identify the individual patient, an informed signed consent was waived by KEK-Bern (Reg-2016-00729).For internal organizational purposes, we wanted to conduct a patient survey in order to get objective data on what is going well and where there is room for improvement in our radiologic examination processes, putting emphasis on magnetic resonance imaging. The composition of the survey was based on the prime consideration that patients want to be treated competently, quickly, friendly, and caringly , 12, 16.In order to be all-embracing and meaningful, the survey was intended to cover all steps of the examination that are visible to patients. On the other hand, being considerate of the target group we also put emphasis on a clear design according to the corporate design guidelines of our hospital, good readability, and big font size, thus limiting the amount of questions . TherebyOverall, we formulated two questions about general satisfaction and fifteen questions about relevant steps of the radiologic examination process , accountAn accompanying message of greeting asked the patients to answer the questionnaire truthfully and informed that the answers would not have any influence on the medical treatment whatsoever . After tThe questionnaire was validated in 2013 when a big internal survey was conducted within 5 weeks comprising about 600 patients, who had been examined by 6 different modalities . The colAn apparent correlation of satisfaction with care by physicians and the visibility of radiologists led us to hypothesize that satisfaction of patients with their attending radiologists is not only based on a basic trust in the medical expertise, but also on the possibility to communicate about their medical state. However, it was not clear to what extent a radiologist would have to engage in patient care in order to reach levels that are associated with a 30-minutes (ultrasound-) exam. We also were undecided whether it would be better to communicate a provisional diagnosis after the exam or discuss the medical history prior to the exam. Organizational constraints led to the plan to introduce a medical history interview for MRI-patients prior to the exam. One year later in 2014, we implemented this process change. The survey was conducted concomitantly with the implementation of interviews for about one month and was performed as a prospective, observational, and mono-center study.In 2015, we repeated the survey again and questioned both MRI- and ultrasound-patients throughout the year Since when does the ailment exist?[Place for] Description of the ailment/sketchBesides, a check box about the need to change the original MRI protocol was introduced. The percentage of such adaptations due to insights from the interviews was taken as a quality measure .The study was conducted at the Institute of Diagnostic Radiology at the Inselspital Bern, the largest radiology practice in Switzerland. Inclusion criteria were non-restrictive: the patients had to be adult, to be willing to participate, and to be able to read and to understand the questionnaire. Participants were both in- and out-patients and examined by either MRI, CT, ultrasound, conventional X-ray, angiography, or fluoroscopy. The present study summarizes results from three rounds/years of interrogations conducted between 2013 and 2015 Tables .left blank or answered. Potential differences in the distribution of those classes were tested by chi-square statistics and expressed as derived P-values. Statistical significance was set at P values <0.01. The calculations were performed with the statistics program STATA2, version 12.1 .Survey data are expressed as percentages of answers with positive grading, i.e. as the relative occurrence of grades 6, 5, and 4. A 95% Wilson confidence interval was determined for those values. For each question, grades were then categorized into positive  and negative  classes. Besides, we classified responses as either We designed an anonymous patient survey that depicted the most relevant steps of the radiological exam process from the patient\u2019s perspective , proper information (three questions), care and empathy (two questions), and waiting times (three questions) see . Besidesphysicians (rather than radiologists) and about the quality of care that they have received by physicians.As we did not have empirical data about how informed our patients are about the occupational profile of technologists and radiologists and about their knowledge of radiologists being physicians, we were especially interested in questions 9 and 13. There we asked whether they have had contact with Additionally, we queried three general subjects by multiple choice to record the modality, the type of stay, and the perceived absolute waiting time (questions 1 to 3).We asked patients to grade akin to the Swiss school grading system on a sexpartite scale from maximally 6 points to minimally 1 point; they were also free not to answer a question. In the Swiss school system, grades equal or greater than 4 are positive and grades smaller than 4 are negative.In the first year, 93% of the questionnaires handed out were returned, in the second year 91%, and in the third year 94% .As we conducted the survey anonymously, we could not link the obtained results to age groups, sex, or diseases.The total study population comprised of 761 out- and 215 in-patients and the status was unknown in 27 participants. Most patients underwent MRI-scans (n = 438), followed by conventional X-ray scans (n = 195), and ultrasound examinations (n = 183) Tables , derivedOverall, patients graded very approvingly such that survey results were highly skewed to grade 6 or 5 , Table 121.3% of the participants rated uniformly with the highest grade \u201c6\u201d, one-third of them answering all questions .Usually, patient satisfaction is highly dependent on the waiting time . To testLikewise, it is conceivable that satisfaction with the hospital in general would have an impact on the satisfaction with radiology. E.g., it has been shown that the objective physical environment affects satisfaction levels in in-patients and outpatients divergently . We therA closer analysis of our first-year survey results revealed in part significant differences in the average satisfaction between ultrasound and MRI patients .This result was to be expected for two questions: 1) question 5 relating to an MRI-safety questionnaire handed out to MRI patients only and 2) question 11 concerning the pleasantness of the exam, which is perceived inconvenient by many MRI patients. Moreover, ultrasound patients significantly rated contact with and care by physicians (questions 9 and 13) better than patients who underwent MRI . At our We therefore hypothesized that satisfaction with physicians was dependent on their presence and visibility to patients.very much to none at all) for esthetical reasons. We scrutinized that statement and additionally interrogated in a structured manner 38 ultrasound patients (who had continuous contact with radiologists) and asked the 22 patients rating lower than 6 about their motivation , we were wondering about the apparent negative rating of question 9 enquiring contact with physicians , Fig 1. tivation . Each 10We noticed that patients left some questions unanswered , Table 5We, therefore, stratified our sample and classified responses as being answered or being void. Potential deviations in the distributions were assessed by chi-square statistics . Especially, we were interested in whether response rates correspond to peculiarities of the radiology exam process. For example, question 5 was specifically created for MRI patients and was answered by more than 96% of the MRI patients, but by less than 75% of the ultrasound patients who did not get the enquired MRI safety questionnaire. There was also a significant difference in the response rate for questions about contact with and care by physicians: e.g., MRI patients without contact had lower response rates than ultrasound patients . We hypoFace of Radiology and 5 Patients per Day campaigns [The survey data suggested to us that patients would appreciate a personal contact with a radiologist. Based on experience and processual needs we decided that a patient-to-radiologist contact should be best in the context of a short interview prior to the exam. A medical interview would create more patient value than a mere \u201cmeet and greet\u201d introduction of the examiner as suggested by the ampaigns , 15. TheConcomitant to the introduction of interviews by radiologists we surveyed our MRI-patients using the same questionnaire . In the first round, 86% of 182 surveyed MRI-patients had short medical interviews prior to the scan. In the consecutive year, we surveyed a group of 47 MRI patients who had an interview and an even group without interview , S1 Fig.Patients rated care by physicians significantly better when they had an interview and the increase in grading was even more accentuated in question 9 about contact with physicians as discussed before . StrikinIf the appearance of a radiologist leaves such an impression on the patients, one might argue that a simple \u201cmeet and greet\u201d would have a similar effect on patient satisfaction and thereby would be even more effective. In order to scrutinize that possibility, we conducted an analysis of 2700 medical history protocols of MRI-patients authored from introduction of interviews upon the end of surveying.Overall, we found 27 (1%) cases where the originally specified MRI examination protocol  had to be changed due to information from the medical interview. The reasons for the alterations have been extracted from the respective patient records and are listed in Presumably, protocol changes related to choosing another body region would not have remained undetected by our radiology technologists, but most of the other adaptations required medical competence.Radiology Cares, Patient-Centered Radiology, Face of Radiology, Five Patients a Day, or Imaging 3.0 [Radiology Cares initiative stresses patient experience and advocates a \u201cmeet and greet\u201d prior to the exam and a discussion of results after the exam. It is conceivable that the campaign has not been rigorously implemented, because exact instructions on how to introduce such drastic changes in the examination process and outcome measurements about the respective impact and usefulness of such measures were not given.Possibly, radiology is the medical discipline most affected by technological advances . Technolging 3.0 \u201315. E.g.To the best of our knowledge, this is the first systematic study to confirm the importance of a medical interview prior to diagnostic radiology exams for both patient satisfaction and examination quality. Others have addressed the interesting questions whether radiologists should communicate the findings of the examination and their impressions directly to patients and thereby communicate with their patients after the exam \u201323 or haWhen we started with an ordinary patient satisfaction survey in our diagnostic radiology department, we first noticed that patients rated contact with and care by physicians relatively low when compared to calibrator questions that allowed us to establish base levels in grading:Interrogation about the subjectively perceived examination comfort or about waiting time defined the baseline of patient satisfaction, even though there was a very positive prevailing mood in the replies with 21% of the responders giving only maximal scores. It was therefore unexpected that the question about contact to physicians was skewed towards seemingly negative values. A sample testing then revealed that patients were in part confused about the apparently ambiguously phrased question and gave a quantitative assessment rather than a grade.We further noticed that a majority of patients answered a question addressing a MRI-safety questionnaire, even when they were examined by another modality and did not receive a questionnaire. A closer analysis revealed that although a majority of our patients responded to every question, the response rate about the MRI-questionnaire was only high for MRI-patients and significantly lower amongst other patients Tables  and 7. SIn summary, we concluded that both the rating and the withheld answers indicate that patients would welcome an opportunity to discuss and share their history with a radiologist.After an internal discussion involving all stakeholders, covering all aspects of the examination process, and respecting spatial conditions, we decided to introduce a short medical history interview for MRI patients prior to the exam. We chose the modality because of a convenient proximity of the diagnostic workstations and the tomographs and because of a manageable number of patients.Approximately one year after the first round of surveying the mandatory implementation of a medical history interview with our MRI-patients was established. The radiologists received a \u201cmedical history questionnaire\u201d, which provided structure for the interview and included a check box about the need to change the originally scripted MRI protocol. The fraction of protocols that were adapted due to information from the interview was taken as a medical quality indicator. Independently, we repeated the survey amongst some MRI-patients. In the following year, we conducted the survey again amongst ultrasound-patients and one group of MRI-patients receiving a medical interview and another group of MRI-patients who had no interview.Strikingly, over the years there was a remarkably constant appraisal of our services. Satisfaction with the friendliness and competence of our staff, waiting times, as well as potential recommendation and general satisfaction did not vary throughout the survey period and were independent of the examination modality. Likewise, modality-specific deviations or the marred attitude of patients with long waiting times prevailed over the years.Only when the process changed, patients gave the respective feedback. As expected from the scrutinized first-year survey results, patients appreciated the attention by radiologists. What was surprising, however, was the extent of patient value achieved by a medical history interview lasting for approximately 3 minutes. Approval rating achieved levels typical of examinations requiring constant, ca. 30-minute care by a radiologist.We interpret this result to mean that it is the mere existence and the resulting quality of radiologist-to-patient contact that increases patient satisfaction to a quantitatively maximal level. In other words, 3 minutes patient care are as effective in achieving patient satisfaction as a 30-minute close encounter during an ultrasound examination.Our work may be seen in the context of ample of literature on the importance of patient satisfaction in radiology and its economic value , therebyThere are many possibilities where radiologists could interact and communicate with their patients and create trust. We have chosen a way that fits into the constraints imposed by a high-throughput hospital and believe it is generally applicable. Our fundamental hypothesis is that the mere possibility to get sympathetic personal attention of a physician increases patient satisfaction. This would imply that interactions ranging from low-threshold handshakes to communication of diagnoses would have similar impacts. However, there are more dimensions beyond the scope of this study to the abstract value of \u201csatisfaction\u201d and the reduction to a sexpartite scale may not be an adequate tool to cover the whole spectrum. In this context, it would be interesting to validate the quality of the radiologist-patient communication, e.g. by differentiating between verbal, non-verbal communication, and clinical empathy.We only evaluated patient feedback in a single institution and hence we cannot completely exclude that variable local practice patterns and traditions could influence the impression of medical interviews on patients. However, the Bernese might be a little bit slower, but they are not fundamentally different. In this respect, we would encourage other clinics to conduct similar initiatives in order to understand patient experiences better in their own setting.In addition, our evaluation of the patient experience largely related to experiences occurring during the patient\u2019s time in the radiology department. The total patient experience may be considered more widely to encompass a broader spectrum of contexts, ranging from the time when the examination is first ordered, to the referring physician receiving the results and taking the appropriate action for the patient.Further limitations are the missing information of age/sex of the included patients and that though we explored associations between various themes and patient satisfaction, these were not associated with downstream health outcomes.Based on our findings we suggest implementing medical history interviews as a better alternative to \u201cmeet and greet\u201d style \u201cRadiology Cares\u201d encounters, because interviews have a specific, additional, and beneficial effect on the conformity of the examination protocol. Thus, a medical interview increases patient value by affecting both patient satisfaction and the planning quality of radiologic examinations.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file.S5 Table(DOCX)Click here for additional data file.S6 Table(DOCX)Click here for additional data file.S7 TableSatisfaction with radiologists was significantly higher amongst patients who had a personal contact.(DOCX)Click here for additional data file.S8 TableSatisfaction with radiologists was significantly higher amongst patients who had a personal contact.(DOCX)Click here for additional data file.S1 Fig(PDF)Click here for additional data file.S2 Fig(PDF)Click here for additional data file."}
{"text": "Engaging in effortful self-control can sometimes impair people\u2019s ability to resist subsequent temptations. Existing research has shown that when chronic dieters\u2019 self-regulatory capacity is challenged by prior exertion of effort, they demonstrate disinhibited eating and altered patterns of brain activity when exposed to food cues. However, the relationship between brain activity during self-control exertion and subsequent food cue exposure remains unclear. In the present study, we investigated whether individual differences in recruitment of cognitive control regions during a difficult response inhibition task are associated with a failure to regulate neural responses to rewarding food cues in a subsequent task in a cohort of 27 female dieters. During self-control exertion, participants recruited regions commonly associated with inhibitory control, including dorsolateral prefrontal cortex (DLPFC). Those dieters with higher DLPFC activity during the initial self-control task showed an altered balance of food cue elicited activity in regions associated with reward and self-control, namely: greater reward-related activity and less recruitment of the frontoparietal control network. These findings suggest that some dieters may be more susceptible to the effects of self-control exertion than others and, whether due to limited capacity or changes in motivation, these dieters subsequently fail to engage control regions that may otherwise modulate activity associated with craving and reward. Broadly defined, self-regulation refers to the human capacity to flexibly regulate thoughts, emotions, and behaviors. Self-control, in particular, describes those situations in which self-regulatory processes are engaged to inhibit prepotent or automatic impulses, especially when these impulses conflict with other goals . In situMost recently, the consensus appears to be that the available evidence, in favor of and/or against self-regulatory depletion effects, is inconclusive . Howeversome dieters may be more prone to self-control failure than others. For example, prior work in our lab has shown that those dieters who experience weaker food cravings and more positive mood in daily life are also most successful in controlling impulses to eat  as they frequently demonstrate weight fluctuations, weight gain, and self-control lapses , includis to eat . Anothers to eat . HoweverTo address these questions, we used functional neuroimaging in the present study to examine individual differences in the neural correlates of effortful self-control among chronic dieters and related activation in prefrontal regions associated with response inhibition to subsequent recruitment of control and reward-related brain areas during exposure to appetitive food commercials. In addition to their constant deployment of self-control, the dieting population is characterized by a motivation to regulate food intake, allowing for cleaner operationalization of self-control success and failure. In a recent brain imaging study, dieters randomly assigned to first complete an effortful self-control task showed, on average, significantly higher activity in orbitofrontal cortex (OFC), a key region in the brain\u2019s reward system;  during sWork in cognitive neuroscience has identified lateral prefrontal cortex as a robust neural correlate of self-control, indexing one\u2019s capacity to engage in response inhibition see\u00a0. Additioa priori regions/systems of interest, namely the frontoparietal control network, which enables flexible exertion of self-control  altered brain responses during subsequent exposure to food commercials, and (2) ad libitum eating patterns following a later diet breaking episode. To test these hypotheses, we first measured brain activity as dieters performed an effortful self-control task in which they were required to actively inhibit reading a series of words that appeared on the screen over the course of seven minutes. Following this, participants engaged in a food-cue reactivity task involving food commercials that has previously been shown to reliably recruit the brain\u2019s reward system . This du-control , and key-control .more recruitment of prefrontal cortex during effortful self-control, indexing task difficulty and/or the experience of effort, would subsequently show less recruitment of the frontoparietal control network and therefore more reward-related activity in OFC and VS when viewing food commercials\u2014thus serving as evidence of a failure to appropriately engage self-control systems when confronted with appetitive food stimuli. Finally, we also hypothesized that higher PFC activity during effortful self-control, and/or lower frontoparietal (vs. reward) balance scores, would be associated with more disinhibited eating following a diet breaking episode\u2014as measured in separate experimental session with the same participants.To constrain our hypotheses about potential relationships between PFC activity during effortful self-control and subsequent recruitment of control (vs. reward) regions during food cue exposure, we based our hypotheses on prior neuroimaging studies  that sugage\u00a0=\u00a019.48, SDage\u00a0=\u00a01.11) were recruited from the Dartmouth community to participate in a two-part neuroimaging study for course credit. Dieting status was assessed by the Restrained Eating Scale  commercials that were matched for duration and level of engagement and interest . At the conclusion of the scanning session, we asked participants to report on their experiences of the effortful self-control control task. Specifically, they provided ratings on a 1\u20137 scale in response to questions that asked: \u201cHow difficult did you find this task?\u201d and \u201cHow much did this task \u2018tire you out\u2019 or make you feel mentally exhausted/fatigued afterwards?\u201dApproximately one week after the scanning session, participants returned to the lab for a follow-up behavioral session, consisting of a commonly used milkshake preload manipulation  followedhttp://github.com/ddwagner/SPM8w). First, we carried out standard preprocessing procedures for both inhibitory control and cue reactivity tasks, to account for motion related artifact (by including six motion regressors in first-level GLM model specifications) and increase images\u2019 signal-to-noise ratio via spatial smoothing (8-mm FWHM kernel). Between the two tasks, five participants\u2019 data were excluded due to excessive motion, defined as \u2265 2 instances of \u2265 2 millimeters of movement in the x,\u00a0y, or z plane . In the case of the main analysis (relating DLPFC activity to subsequent food cue reactivity), there were 26 participants who had complete data across those two measures. So, for those reported analyses, N\u00a0=\u00a026.All analyses of neuroimaging data were conducted using SPM8 , along with tools for batch preprocessing and analysis  and using spatial autocorrelation function parameters (via 3dClustSim\u2019s \u201cacf\u201d option)\u2014as per recent recommendations .Brain data for the two tasks were separately modeled and analyzed. First, for the effortful self-control task, we ran a whole-brain univariate GLM analysis at the first (subject) level, with two regressors specifying when words appeared on the screen and when words were absent . The main contrast of interest (words present vs. absent) identified period of the task when participants were actively engaging in self-control. Group-level T-maps were then generated using random effects analysis of all subjects\u2019 word present-versus-word absent contrast images. To correct for multiple comparisons, we performed cluster-based correction via the AFNI tool ndations . These sX\u00a0=\u00a030, Y\u00a0=\u00a042, Z\u00a0=\u00a024) using a spherical ROI with a 6-millimeter radius. Additionally, given the role the frontoparietal network plays in cognitive control generally, and self-regulation of eating more specifically  and control (product) events. Next, contrast images were calculated to compare activity when food events occurred relative to that when control events occurred. Other commercial content  were modeled as baseline. We extracted food cue related activity from these contrast images using independently defined, -control ; and two-control . We sele-control . HoweverN\u00a0=\u00a0828;  to re-coZ-scored), averaged activity in the frontoparietal control network and activity in reward regions . Higher balance scores represent relatively greater recruitment of the frontoparietal control network, whereas lower balance scores represent relatively greater recruitment of reward regions; this procedure and operationalization of a brain-based balance measure followed that of Lopez and colleagues\u2019  during food cue exposure in the second fMRI task. This relative recruitment was captured by regulation\u2013reward balance scores, which were calculated on a subject by subject basis by taking the difference of standardized , SD\u00a0=\u00a01.21, t(26)\u00a0=\u00a03.99, p\u00a0<\u00a0.001, Cohen\u2019s d\u00a0=\u00a00.77; this value was significantly greater than dieters in a control condition from a similar study, t(26)\u00a0=\u00a03.09, Cohen\u2019s d\u00a0=\u00a00.60, p\u00a0=\u00a0.005. The self-reported measures of difficulty and tiredness were not correlated with one another, r(25)\u00a0=\u00a00.004, t\u00a0=\u00a00.02, p\u00a0=\u00a0.985, so they were entered in as separate covariates in multiple regressions models described below. Next, we observed that across all 8 nodes of the FP network, there was significant activity in the first fMRI task during effortful self-control , mean parameter estimate = 0.159 (95% CI [0.092\u20130.226]), SD = 0.169, t(26)\u00a0=\u00a04.89, Cohen\u2019s d\u00a0=\u00a00.941, p\u00a0<\u00a0.001.First, as a manipulation check, we examined participants\u2019 ratings of their experience of the first (effortful self-control) task they completed in the scanning session. On average, participants found the task to be difficult, as inferred from a one-sample r(24)\u00a0=\u00a0\u00a0\u2212\u00a00.574 , b\u00a0=\u00a0\u00a0\u2212\u00a02.30, p\u00a0=\u00a0.002 , t(19)\u00a0=\u00a0\u00a0\u2212\u00a03.445, p\u00a0=\u00a0.003. In this multiple regression model, neither task difficulty \u00a0=\u00a0\u00a0\u2212\u00a00.261, p\u00a0=\u00a0.797) nor tiredness \u00a0=\u00a00.630, p\u00a0=\u00a0.536) was associated with balance scores. Additionally, upon examining zero-order correlations, self-reported difficulty was not associated with DLPFC activity during the effortful self-control task  or balance scores during food cue reactivity . This was also true for self-reported tiredness, which did not correlate with DLPFC activity  or balance scores .To relate brain activity during effortful self-control to subsequent food cue reactivity, we first calculated the correlation between brain activity in this region and the relative balance of activity in frontoparietal (vs. reward) regions during exposure to food commercials. There was a significant negative association, such that those participants who more readily recruited the DLPFC during the effortful self-control task had lower balance scores when viewing food commercials, .002 see . Importar(24)\u00a0=\u00a0\u00a0\u2212\u00a00.403 , b\u00a0=\u00a0\u00a0\u2212\u00a00.302, p\u00a0=\u00a0.041, and this relationship remained after controlling for self-reported difficulty and tiredness and BMI, b\u00a0=\u00a0\u00a0\u2212\u00a00.339 , t(19)\u00a0=\u00a0\u00a0\u2212\u00a02.168, p\u00a0=\u00a0.043. Critically, the association between frontoparietal network recruitment during effortful self-control was only observed with balance scores during food cue-exposure. Specifically, there was no relationship between FP network activity during self-control and subsequent FP network activity during cue-reactivity, r(24)\u00a0=\u00a0\u00a0\u2212\u00a00.206, t\u00a0=\u00a0\u00a0\u2212\u00a01.03, p\u00a0=\u00a0.313, nor was initial FP network recruitment associated with reward system activity during cue reactivity, r(24)\u00a0=\u00a0\u00a0\u2212\u00a00.081, t\u00a0=\u00a00.40, p\u00a0=\u00a0.693. To rule out influences of nuisance variables  we extracted parameter estimates based on an anatomical mask of the hippocampus (a region not engaged by either task) and found no relationship during the first self-control task and balance scores in the cue reactivity task, r(24)\u00a0=\u00a0\u00a0\u2212\u00a00.09, t\u00a0=\u00a0\u00a0\u2212\u00a00.444, p\u00a0=\u00a0.661.Next, consistent with the negative association between DLPFC activity during effortful self-control and balance scores during subsequent exposure to food cues, there was also a significant negative relationship between average recruitment of the frontoparietal network activation during effortful self-control and balance scores in the cue reactivity task, SD\u00a0=\u00a040.8, range: 9\u2013158 grams), and there was a positive  correlation between recruitment of DLPFC during effortful self-control and grams of ice-cream consumed, r(24)\u00a0=\u00a00.319, t\u00a0=\u00a01.647, p\u00a0=\u00a0.112. There was also a negative, non-significant relationship between balance scores and grams of ice-cream consumed, r(24)\u00a0=\u00a0\u00a0\u2212\u00a00.309, t\u00a0=\u00a0\u00a0\u2212\u00a01.594, p\u00a0=\u00a0.124.Finally, we examined links between activity in the effortful self-control/cue reactivity tasks and ad libitum ice-cream eating from the behavioral session. On average, participants consumed 71.1 grams of ice-cream  while performing an effortful self-control task was subsequently associated with the balance of activity between brain regions implicated in self-control and reward during exposure to food commercials. Consistent with our hypothesis, greater recruitment of DLPFC\u2014as well as the frontoparietal network as a whole\u2014during effortful self-control was associated with less recruitment of the frontoparietal network and more reward related activity whenever food items appeared on the screen in the cue reactivity task. This suggests that more (or less) brain activity during an initial task requiring self-control exertion may serve to characterize the different response profiles that dieters may show when exposed to appetitive food cues.Notably, we only observed a significant, negative relationship between FP recruitment during effortful self-control and subsequent balance scores during exposure to food commercials. There was no such relationship between control-related FP recruitment in the first task and activity in either FP or reward systems, respectively, during food cue reactivity (second task). This is consistent with theorizing that suggests taking both impulsive and inhibitory processes into account to characterize self-control outcomes , as wellreduced brain activity in lateral prefrontal cortex when performing cognitive tasks  ve tasks .Without In addition, we examined the relationship between these neural measures and ad libitum eating of ice cream following a diet breaking episode in a separate experiment. Although the relationships were in the expected direction , the overall correlations with neural measures were not significant. Whether this reflects a true null effect, or instead that the mechanisms underlying individual differences in neural activity we observed following self-control exertion do not translate to disinhibited eating following a diet breaking episode, remains an open question.also calls for spontaneous regulation of prepotent responses\u2014is arguably more ecologically valid than previous studies that have examined effortful self-control. Although speculative, we would argue that the sequence and nature of the two self-control tasks used here  instances that also require self-control) may mimic dieters\u2019 experiences in daily life. For example, a dieter might exert self-control to block out distraction during an intense time of study or work. And, the extent to which they find this sustained inhibition taxing, they may have little self-control capacity to call upon when they are suddenly faced with a dessert tray at a restaurant later that day.There are several strengths to our study design and approach. First, our overall analysis approach\u2014linking brain activity from an effortful self-control task to activity in a subsequent task that Second, the current study\u2019s design may reliably identify those individuals who experience more (or less) success adhering to their dieting goals. For example, a dieter who more readily recruits certain cognitive control regions  during an effortful self-control task may be actively maintaining the task set , but such task engagement may be more cognitively demanding and render the frontoparietal network less able to exert control over the reward system during future exposure to food cues cf. . Indeed,Additionally, if it is true that greater recruitment of brain regions during an effortful self-control task can undermine future self-control attempts, then it means that more control-related activity  is not necessarily conducive to dieters\u2019 self-regulatory goals. Indeed, and consistent with prior behavioral work on limited self-regulatory capacity e.g., , controlDespite the implications discussed thus far, the current study has some limitations that are worth mentioning. First, the self-control task we administered was somewhat short in length , so it is not clear how long effects of effortful self-control on cue reactivity might persist. Second, even though our participants gave ratings of difficulty and fatigue during the effortful self-control task, we did not have an independent measure of participants\u2019 objective performance on the task . A future study would benefit from incorporating eye-tracking or another validation measure to calculate, on a subject-by-subject basis, successful inhibition of the impulse to read the words. And even though we used a validated diet-breaking procedure for the behavioral session, using a self-control exertion task would have led to more construct validity and may help explain why we did not find a relationship between the brain data and overeating after the milkshake preload.We should also note that, in comparison to behavioral work, the sample size was relatively small and thus was not powered for the detection of moderate correlations. This may place a limit on our ability to detect small to moderate effects of self-control exertion . Although to remain consistent with prior work, with recruitment necessarily constrained to female dieters, future work would benefit from either expanding beyond this population in order to increase sample sizes and test generalizability to other populations.SD\u00a0=\u00a040.8 grams) compared to previous studies that also measured disinhibited ice-cream eating in dieters , as well as a more restricted range (123.8 in . Also, iTo conclude, we probed the neural mechanisms of repeated self-control exertion among dieters, using a reasonably naturalistic dual-task paradigm that coupled an initial, effortful self-control task with subsequent exposure to appetitive food cues as presented in real-world food commercials. We extended past work, which took a brain-as-predictor approach  using th10.7717/peerj.6550/supp-1Supplemental Information 1Click here for additional data file."}
{"text": "This study investigated nutritional, physicochemical, and sensory characteristics of coffee brewed with conventional and high-oleic peanut extracts. Compared to normal coffee, peanut coffee exhibited more diverse amino acids compositions. In constituent amino acids composition, peanut coffee exhibited increased proportions of glutamic and aspartic acids but decreased phenylalanine. Peanut coffee had higher thiamin, niacin, and sugar contents, improved antioxidant capacity, and lower caffeine contents. In electronic tongue analysis, peanut coffee showed an increased intensity of sweetness and umami taste but decreased bitterness, corresponding to the result of amino acids compositions and caffeine and sugar contents. In volatile compounds analysis using gas chromatography-mass spectrometry (GC/MS) with the sniffing test, peanut coffee had high concentrations of 2-ethyl-3,6-dimethylpyrazine, 2,2\u2032-methylenebis-furan, and furfuryl propionate, which were perceived as peanut and roasted odors in the sniffing test. This study will provide informative data in extending the application of peanut to coffee and developing novel coffee, with added peanut, that is nutritionally beneficial. In recent years, consumers have raised their interest to gourmet coffee such as owntrend ,2.Peanut is a legume rich in lipids (50%), proteins (25%), carbohydrates 13%), and vitamins and minerals. Physiologically, peanut is effective in decreasing body weight %, and vi. For theVolatile compounds are of paramount importance in developing coffee flavor. Coffee includes over 1000 volatile compounds, among which 300 homo- and hetero- cyclic compounds are responsible for the unique coffee flavor. Volatile compound profiles vary upon roasting intensity, variety, and origin of coffee beans ,5. Commoth taste, recently identified [Taste is another critical sensory characteristic in coffee. Basic tastes consist of saltiness, sweetness, bitterness, sourness, and umami taste, with fat taste, which is known as the 6entified . Electroentified . Electroentified .Many studies have investigated different aspects of coffee: antioxidant capacities of coffee bean and coffee residues , enhanciWhereas many studies investigated volatile compounds, antioxidant capacities, physicochemical properties, and hazard substances with variations in coffee bean types and extraction methods, only few studies demonstrated changes in nutritional and physicochemical properties and tastes/flavors by adding other food sources  to coffee. As aforementioned, peanut is a nutritionally and physiologically exceptional food source, but its utilization is somewhat limited to mostly snacks. Therefore, in this study, coffee was prepared with peanut extracts using conventional peanut and high-oleic peanut, and comparisons were made in terms of amino acids compositions, water-soluble vitamins contents, physicochemical characteristics, tastes by electronic tongue, and volatile compounds with the sniffing test. This study will be an exemplary attempt at extending the utilization of peanut to coffee and developing novel coffee with peanut added.Daekwang) and high-oleic peanut variety (K-ol) were provided from National Institute of Crop Science .Coffee bean used in this study (Columbia) was produced by Bean Market  and purchased in a local grocery store in Jinju, Republic of Korea (Item number: 2012036853615). Conventional peanut variety . Coffee bean was ground using a coffee grinder  into medium size (600 \u03bcm). Peanut extract (5 g/100 mL) was prepared with water using a coffee maker . Coffee (3.75 g/100 mL) was extracted with the prepared peanut extract using the same coffee maker for 20 min. Three kinds of samples  were prepared upon extraction of solvent .Constituent amino acids were analyzed via a acid hydrolysis method using hydrochloric acid (HCl). One hundred milligrams of sample was added to 3 mL of 6 N HCl in a test tube. Acid hydrolysis was carried out at the following conditions: 110 \u00b0C for 24 h while stirring (150 rpm). The mixture (10 \u03bcL) was then diluted with sodium dilution buffer (990 \u03bcL) and filtered using a 0.2 \u03bcm membrane filter. An amino acid analyzer  was utilized to analyze the constituent amino acid profiles . Free am2PO4 at pH 5.5 and methanol , and the analysis was flowed at a rate of 0.8 mL/min in an isocratic elution condition [Agilent 1100 infinity HPLC with a diode array detector  was utilized to determine the contents of water-soluble vitamins with a column, YMC-Pack octadecylsilyl silica gel (ODS) AM   at 40 \u00b0C. The detector was set at 270 nm. The mobile phase solvents were prepared as follows: solvent A was prepared with 7.5 mL acetic acid, 0.2 mL triethylamine, and 5 mM sodium 1-hexanesulfonate, and solvent B was methanol. A linear gradient elution was taken for this analysis. The mobile phase was flowed at 0.8 mL/min and then subsequently flowed at the following conditions: 0 min: 100% solvent A, 8 min: 100% solvent A, 20 min: 75% solvent A and 25% solvent B, 30 min: 55% solvent A, 31 min: 100% solvent A, 45 min: 100% solvent A. The same instrument with an identical column to that used in water-soluble vitamins analysis was used to analyze riboflavin.. The wavelengths of the detector were set to 445 nm for excitation and 530 nm for emission. The mobile phase was prepared with 10 mM NaHondition .Glucose and sucrose contents were determined using the Agilent 1260 high-performance liquid chromatography (HPLC) system  with a ZORBAX Carbohydrate  column. Tertiary distilled water was used as mobile phase at 0.5 mL/min. The column was set at 50 \u00b0C and an refractive index (RI)  detector was used. Caffeine contained in coffee was determined using high performance liquid chromatography (HPLC) . Samples required no pretreatment for HPLC analysis. The column used was a ZORBAX Eclipse XDB-C18 , which was used at 40 \u00b0C. The detector was set at 270 nm. Sixty percent acetonitrile was used as mobile phase at 0.5 mL/min.Antioxidant capacity was measured by 2,2 diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and total phenolic contents. DPPH radical scavenging activity was measured by a method outlined by Blois . The sam50  was calculated.Based on the radical scavenging activity (%), SC2CO3 and 160 \u03bcL of distilled water were then added to the solution and incubated at room temperature for 2 h. Total phenolic content was determined at 750 nm. As a standard, gallic acid (0\u2013500 \u03bcg/mL) was utilized. Total phenolic content was calculated based on the calibration curve.The Folin\u2013Ciocalteu\u2019s method was employed to determine total phenolic content . After dFor pH measurement, 5 mL of sample was added to 45 mL of distilled water and 10 mL of the mixture was used to measure pH using a pH meter .x is RI of the unknown compound, tRx is retention time of the unknown compound, tRn is retention time of the n-alkane, and tRn+1 is retention time of the next n -alkane. tRx is between tRn and tRn+1 (n = number of carbon atoms).Volatile compounds in coffee samples were collected by solid phase microextraction (SPME) fiber coated with 100 \u03bcL polydimethylsiloxane (PDMS) . Pentadecane (10 \u03bcg in 1 mL of ethyl ether) was used as an internal standard. A total of 115 g of coffee sample was heated in a 60 \u00b0C heating block for 20 min and the volatile compounds were collected for 30 min in the SPME fiber. The collected compounds were introduced to desorption for 12 min, and then analyzed by gas chromatography-mass spectrometry (GC-MS) (Agilent 7890A and 5975C) with HP-5MS column (30 m \u00d7 0.25 mm i.d. \u00d7 0.25 \u03bcm film thickness). Oven temperature was maintained at 40 \u00b0C for 5 min and then increased to 200 \u00b0C at a rate of 5 \u00b0C/min, with the inlet temperature at 220 \u00b0C. Helium carrier gas was flowed at 1.0 mL/min with the split ratio of 1:10. The mass spectrum library (NIST 12), ion fragmentation pattern, and a reference were utilized to identify the volatile compounds separated from the total ionization chromatogram (TIC) . RelativGC/MS using GC-olfactometry (olfactory detection port (ODP) 3, Gerstel Co., Linthicum, MD, USA) mounted to the spectrometer was used for the sniffing test of the volatile compounds present in the coffee samples. The sniffing test was performed under the same GC/MS conditions as those of volatile compound analysis, and the test was conducted simultaneously with GC/MS analysis. Due to the solvent elution time (5 min) and possible olfactory tiredness of the panelists, the sniffing test was performed between 5 and 25 min only. Three panelists participated in the sniffing test and recorded the levels of olfactory intensity and subjectively described the characteristics of the odors. Olfactory intensities perceived by the panelists were expressed in the numbers 1 to 4 and a higher number indicates stronger olfactory intensity. .Electronic tongue analysis of coffee samples was conducted using an electronic tongue module  with seven sensors attached. These include two reference sensors, SPS (spiciness) and GPS  sensors, as well as 5 basic taste sensors, SRS (sourness), STS , UMS (umami), SWS (sweetness) and BRS (bitterness). Each coffee sample, 50 mL, was diluted with 50 mL of distilled water and the analysis was performed in 7 repetitions. Multivariate analysis was conducted to analyze the taste patterns, and the outcomes from the sensors were expressed in relative taste scores .p < 0.05).The results of this study were presented as means and standard deviations. Differences among treatments were tested using one-way analysis of variance, Tukey\u2019s post-hoc 194 test, by SAS version 9.0  package . This may be due to addition of high-oleic peanut extract that is thermally more stable than conventional peanut. A consistent result was observed by Kim et al. [p < 0.05), showing that peanut coffee possessed significantly higher niacin content than normal coffee (p < 0.05), albeit no significant difference between the peanut coffees was found (p > 0.05). Such higher niacin content in peanut coffee than normal coffee is attributed to niacin present in peanut, which was also confirmed by Kim et al. [Water-soluble vitamin contents in the coffee samples were determined and the results were described in m et al. , reportim et al. ,26. Ribom et al. . As showm et al. , riboflam et al. ,28. Niacm et al. . The niam et al.  in conveGlucose and sucrose content in the coffee samples were measured and the results were demonstrated in Caffeine content in the coffee samples were analyzed and the results are shown in 50 showed 61 \u00b1 3.93, 55 \u00b1 3.28, and 54 \u00b1 0.67 mg/mL, in normal coffee, conventional peanut coffee, and high-oleic peanut coffee, respectively, indicating that antioxidant capacity is relatively higher in peanut coffee than normal coffee. Hydrogen atoms in peanuts provide reductones and decompose active oxygen chains, resulting in an increased antioxidant capacity [Cheonggukjang with peanu (Arachis hypogaea L.) powder added [Antioxidant capacity was measured by DPPH radical scavenging activity and total phenolic content and the results are shown in capacity . Such a er added . Total per added  that anaThe pH in the present study was higher in peanut coffee  compared to normal coffee (4.37 \u00b1 0.07). pH is not influenced by extraction rate but by extraction conditions and roasting conditions . Such pHVolatile compound analysis and the sniffing test were performed by GC/MS, and the results are shown in Platycodon grandiflorum roots [As shown in um roots .Platycodon grandiflorum roots and peanut sprout extracts [Platycodon sample. The taste result by electronic tongue not only comes from major taste components of peanut but is an expression of a complex interaction of tastes from coffee and peanuts [Electronic tongue analysis was performed to investigate the chemical sensors-assisted taste differences among the coffee and the results are shown in extracts ,30. Peanextracts . Kato etextracts  suggesteextracts ,20,22. Pextracts  reported peanuts . Electro peanuts . HoweverIn order to broaden the utilization of peanut that possesses potential nutritional and health benefits, this study prepared coffee with conventional peanut and high-oleic peanut extracts by hot water extraction and investigated nutritional and physicochemical parameters, volatile compounds, taste, and flavor. Overall, peanut coffee was superior in type and content of amino acids, thiamin and niacin content, glucose and sucrose content, and antioxidant capacity in comparison to normal coffee. Furthermore, peanut coffee showed an increased sweetness and umami taste and possessed volatile compounds that induced roasted and peanut odors. To our knowledge, this is the first study that prepared coffee with peanut extracted water and determined various parameters from a nutrition and food chemistry perspective. Future studies need to optimize the extraction conditions to generate desirable sensory characteristics and confirm detailed mechanisms of volatile compound generation in developed coffee. More studies are also warranted, in the investigation of sensory attributes of the developed coffee, with sensory panels. This study will be useful for researchers who are interested in creating coffee flavors, understanding the nutritional quality of peanuts from breeding improvement, and broadening peanut utilization other than snacks."}
{"text": "Coffee is a widely consumed beverage, both in Europe, where its consumption is highest, and on other continents. It provides many compounds, including phenolic compounds. The aim of the study was to assess the effect of various brewing methods on the total phenolic content (TPC) in the infusion. Research material comprised commercially available coffees: Instant Arabica and Robusta, freshly ground Arabica and Robusta , ground Arabica and Robusta, decaffeinated Arabica, and green Arabica and Robusta. The following preparation methods were used: Pouring hot water over coffee grounds or instant coffee, preparing coffee in a percolator and using a coffee machine. Additional variables which were employed were water temperature (90 or 100 \u00b0C) and its type (filtered or unfiltered). In order to determine the impact of examined factors, 225 infusion were prepared. Total phenolic content was determined by the spectrophotometric method using the Folin-Ciocalteu reagent and the obtained results were expressed in mg gallic acid (GAE) per 100 g of brewed coffee. The highest value was obtained for 100% Arabica ground coffee prepared in a coffee percolator using unfiltered water at a temperature of 100 \u00b0C: 657.3 \u00b1 23 mg GAE/100 g of infusion. High values were also observed for infusions prepared in a coffee machine, where the highest TPC value was 363.8 \u00b1 28 mg GAE/100 g for ground Arabica. In turn, the lowest TPC was obtained for Arabica green coffee in opaque packaging, brewed with filtered water at a temperature of 100 \u00b0C: 19.5 \u00b1 1 mg GAE/100 g of infusion. No significant effect of temperature and water type on the TPC within one type of coffee was observed. Due to its high content of phenolic compounds, Arabica coffee brewed in a coffee percolator should be the most popular choice for coffee drinkers. Coffee is a widely consumed beverage, drunk primarily for its stimulating effect and aroma. Due to its worldwide popularity, it occupies an important place in international trade. The 2018 data show that the total production of coffee beans exceeded 10 million tons, an increase of 4.6% compared to the previous year. The leading producer of coffee is Brazil, where 3.8 million tons of beans were produced in 2018   ,20,21.In order to estimate the daily consumption of phenolic compounds with coffee, the infusion with the highest TPC value was selected for each type of coffee. The value was multiplied by four cups (average coffee consumption per day) .The results of analyses of the total content of phenolic compounds depending on the method of brewing in various types of coffee were statistically analyzed using Statistica 13.3 and Excel.p < 0.05. Additionally, descriptive statistics were determined: arithmetic means, standard deviations, minimum and maximum values, medians as well as lower (Q1) and upper (Q3) quartiles and the range between them (IQR). Additionally, Principal Components Analysis (PCA) was performed to reduce data and identify main factors responsible for variability.The normality of the data distribution was verified by appropriate tests: Shapiro-Wilk, Ko\u0142mogorow-Smirnow and Lilliefors. The Wilcoxon sequence test was used to assess differences in TPC values between individual coffee brews. The level of significance in the analyses was Brewing methods\u2014using a coffee machine, a coffee percolator and pouring water from a kettle\u2014have a significant impact on the total phenolic content in a coffee brew, which was confirmed by the PCA analysis. The most recommended method for all ground and freshly ground coffee is a coffee percolator. TPC values for instant coffee infusions were higher in comparison to those for ground and freshly ground coffee brewed by pouring water over coffee grounds. The infusion prepared from green coffee was characterized by a lower TPC value than that from roasted coffee, while higher TPC values were observed for coffee in transparent packaging in comparison to opaque packaging. Water temperature and type of water used had no effect on TPC."}
{"text": "People with dementia are not routinely offered rehabilitation services despite experiencing disability associated with the condition and accumulating evidence for therapies such as exercise, occupational therapy, and cognitive or physical rehabilitation. It is important to understand the needs and preferences of people with dementia regarding rehabilitation services. The aim of this study was to explore thoughts and beliefs about rehabilitation amongst people with dementia and their families.Interviews with people with dementia and family members regarding their experience of care following diagnosis and their attitudes and beliefs about rehabilitation for dementia. Surveys with older people with cognitive impairment and/or a diagnosis of dementia to determine preferences for services and understanding of rehabilitation programs.n\u2009=\u20096 people living with dementia with mean age 60 and n\u2009=\u20097 care partners) revealed gaps in care post diagnosis. People reported having to seek out services and frequently sought out services which were rehabilitative in nature. Survey data  showed that most people had heard of rehabilitation (92%) or had experience of rehabilitation (49%) at some point. There was a wide range of services identified as being beneficial. Rehabilitative interventions including case management, exercise and memory strategies were considered desirable.Interviews with 13 participants (People with dementia report having a wide variety of needs. There are gaps following diagnosis where people with dementia report having to seek out their own services. Some interview participants (who tended to be younger) clearly articulated the need for tailored interventions which maximised independence and quality of life. Survey participants, who were on average older, reported that they would participate in individually applicable rehabilitative therapies if they were available. The global prevalence of dementia is rising sharply and is expected to exceed 131 million by 2050 , 5, faciDespite these recommendations, multidisciplinary rehabilitation programs are not a part of the usual treatment pathway for dementia. This is unlike other chronic neurological conditions (like multiple sclerosis) and acquired brain injuries, for which rehabilitation is more accepted in the clinical pathway . People Health professionals have questioned the potential goals and benefits of rehabilitation in dementia care, citing concerns about the potential for meaningful outcomes for this population and the ability for people with dementia to master new learning . HoweverWhile there are increasing calls for rehabilitation to be available for people with dementia, there has been less exploration of how these services might be delivered or which elements are of highest priority. Dementia Alliance International, an advocacy body run by people living with dementia, have argued that access to rehabilitation is a human right under the Convention on the Rights of Persons with Disabilities . ResearcThe aim of this study was to examine understanding of rehabilitation among people with dementia and their families, assess whether this approach is desirable and/or consistent with their beliefs about best-practice care provision, and examine their perspectives about how, when, and why rehabilitation should be delivered.A interpretive descriptive approach  was applA convenience sample of 13 interview participants were recruited through social media, dementia advocacy organisation newsletters, email invitations through existing networks of the research team, and snowball sampling. Eligible participants had a diagnosis of dementia or provided informal (i.e. unpaid) care to a person with dementia, spoke fluent English, were living in the community  and were able to provide informed consent. Dementia diagnoses were self-reported and were not verified by the research team. One-off semi-structured qualitative interviews were conducted by MCa, who has many years of experience working with people with dementia in both clinical and research settings. She had only worked directly with one participant, who had contributed expertise to a previous research project. Interviews were private and confidential, conducted either in the participant\u2019s home or over the phone. The interview asked the person with dementia to describe their experiences of care following diagnosis, attitudes towards rehabilitation in general, and beliefs about rehabilitation for people with dementia. Where participants had favourable attitudes toward rehabilitation for dementia, they were asked to consider how they would prefer these services be delivered. Questions were open to reduce the risk of imposing the interviewer\u2019s assumptions and beliefs (which have been published ). IntervQuantitative survey participants were recruited via an aged care assessment service and from a Geriatric Evaluation and Management (GEM) ward in a large hospital in metropolitan Adelaide. Patients admitted to the GEM ward were eligible to complete the survey if they had a score of 19\u201324 (indicating dementia or mild cognitive impairment) on the Mini Mental State Examination , usuallyThe survey, which was specifically designed for this research project, .n\u2009=\u00a06), frontotemporal dementia (n\u2009=\u00a06) and Lewy Body disease (n\u2009=\u00a01), diagnosed on average 6 years prior to the interview (range 1\u20139\u2009years). Nine of the 13 people with dementia (interview participants or care recipients of interview participants) received a disability or aged care pension while the remaining four relied on private income. Eleven received funding for services under the aged care (n\u2009=\u20097) or disability systems (n\u2009=\u20094).Six people living with dementia and seven care partners of people living with dementia participated in a qualitative interview. Interview participants with dementia included four women and were aged 60\u2009years on average (range 50 to 67\u2009years). All the care partner participants were women. Six provided care to their male spouse with dementia and one provided care to her mother. The people with dementia they cared for were aged 65\u2009years on average (range 60 to 79\u2009years). Dementia diagnoses included Alzheimer\u2019s disease  experiences with post-diagnostic care, referring to the existing context that shapes their views toward rehabilitation; (b) highly conceptual understanding of rehabilitation; (b) mixed views about rehabilitation for people with dementia in a general or theoretical sense, and; (c) engagement in rehabilitative services.\u201cIt was medical, very medical \u2026. \u2026 I wasn\u2019t referred to anybody \u2026 .apart from see you in six months \u2026. There wasn\u2019t a brochure from Alzheimer\u2019s Australia in his office, nothing\u201d (PWD1)\u201cThey gave me a piece of paper \u2026 it was basically the dementia nurses within the hospital system, as it were, and suggested that I ring one of those locally with no real indication of why I\u2019d want to ring them\u201d (PWD4).Most interview participants reported that they had been diagnosed with dementia by a specialist medical practitioner , but few participants were linked with dementia specific supports beyond the appointment.\u201cThe key worker actually rang me once or twice to see if there was anything. But it\u2019s one of these catches of is there anything we can do, but you don\u2019t know what they can do so there\u2019s no real way of answering that, or asking those questions without that sort of knowledge\u201d (PWD4).Some had been linked with services that, at the time, were available only for people with YOD to help identify suitable community supports. These services were highly valued by those who could access them and missed by those who could not. However, there were some limitations to the service even when it was available as some participants felt that more continuity of care was required. Other issues related to difficulty communicating needs with the key worker and turnover of staff.\u201cI found my own merry way to the Alzheimer\u2019s Association\u201d (PWD2).\u201cI\u2019m pretty resourceful myself, so I started hunting down things on Google and started out hunting down various peak bodies and all of that sort of thing\u201d (Carer8).Participants in the study were receiving a variety of services including community-based groups run through councils or carer organisations. Several people had utilised social and day respite programs. In most cases participants had initiated these services themselves through their own research.\u201cIt was only because I went through someone I knew. Otherwise I think I would still be struggling\u201d (PWD1).\u201cYou are literally pushing at the system every step of the way. Why on earth does the government make it this difficult?\u201d Carer8.This process of discovery was described as a \u201cbattle\u2019 for an outsider to the health and aged care system. One participant reported that they turned to people they knew in health and aged care through their social networks to help understand the system.People with dementia who completed the quantitative survey reported similarly inconsistent experiences with care Table\u00a0, with 36\u201cRehabilitation is, my understanding, is getting back to some sort of semblance of what might have been a normal lifestyle\u201d Carer10.Interview participants overall had a comprehensive understanding of rehabilitation. They understood it to be focused on enhancing independence and quality of life, and that it was individualised and tailored to the needs and goals of the individual.A support team to assess difficulties and help you achieve goals\u201d, \u201cHelping people get back onto their feet, back into the world\u201d), while others were more generic (e.g. \u201cTo help you get better\u201d) or specifically referenced illness or injury (e.g. \u201cTime to recover after being ill or injured\u201d).However, a coherent understanding of rehabilitation was less common among the people with dementia who completed the quantitative survey as presented in Table\u00a0\u201cDoesn\u2019t mean that I\u2019ll get completely better. It means I can maintain independence in as many areas as possible for as long as possible\u201d (PWD1).\u201cI see it as providing people with coping mechanisms to keep their lives as positive and fulfilling for as long as they can\u201d (PWD2).\u201cOf course with dementia they can\u2019t ever be the person that they were before, but, you know, I can see this even as rehabilitation because it\u2019s getting him to be \u2013 keeping him the best that he can be\u201d (Carer9).Most interview participants agreed with taking a rehabilitative approach to care for people with dementia. Indeed all agreed that it was important for dementia care to be individualised, to focus on the person\u2019s strengths and what the person can do and maintaining that focus where possible and promoting quality of life from early dementia symptoms until the end.\u201cI\u2019m never going to be rehabilitated to back where I was prior to my diagnosis. However, there are certain skills and certain abilities that I have now post-diagnosis that I want to maintain, to keep intact. And though I\u2019m not going to call it rehabilitation I like the word reablement.\u201d (PWD3).\u201cThe term sounds a bit strange partly because it\u2019s something that, I think maybe it\u2019s one of those terms that needs a new word because realistically rehabilitation to regain skills that you\u2019re losing is not going to happen\u201d (PWD4).While some participants could relate this approach of maximising independence and quality of life with the term rehabilitation, others struggled with the terminology. Often, participants had perceptions of rehabilitation which involved recovery to pre-morbid function. People used examples such as recovering after a broken leg or recovering from substance addiction.\u201cIt gives a false hope \u2026 And that\u2019s very dangerous. It can be very dangerous. Moreso, for the family \u2026. Probably just calling it \u2018therapy\u2019 or just something \u2013 keeping it deliberately vague could probably be the most helpful (PWD5).One participant was cautious that offering rehabilitation services may offer false hope:\u201cA major issue is that there isn\u2019t any hope given. That is a major thing. If the people who diagnose can\u2019t actually give particularly younger people who are usually in the mild stages still some hope that they can perhaps continue to work with support, they can continue to do their hobbies and still continue with their interests and whatever but they\u2019re not given any \u2026\u201d (Carer7).Whereas others reported that a major problem with current services is that they didn\u2019t offer any hope:\u201cEveryone gives up on them when they go into residential care, and particularly when their mobility becomes impaired, they\u2019re just left and they just go downhill like a rocket\u201d (Carer6).There was also discussion about the timing of rehabilitation and when it might be most appropriate. One participant suggested that there was a role for rehabilitation for people in residential care.\u201cI feel like if someone was early stage dementia, that it\u2019s probably a lot more applicable because it may be in helping them pre-plan and adjust\u201d (Carer8).Whereas another participant felt that rehabilitation would not be beneficial for people with more severe symptoms but was appropriate in the early stages.\u201cWe just want to be supported to live our lives, whatever our lives are and I think that\u2019s a fairly basic human right to do that\u201d (PWD1).\u201cI was absolutely gobsmacked that there were no designated rehab type services for people with dementia, which is basically a neurological disability, that what it is, we know. And why it was viewed and treated differently to every other neurological disability I could not understand.\u201d (Carer6).Participants described access to rehabilitation as being a human rights issue and felt that there were inequities between the care offered for people with dementia and the care offered for people with other conditions.\u201cAll she could suggest that was available would be a monthly morning coffee meeting which was only 80 kilometres away\u201d (PWD4).Inequities in accessing services were also present for people living in regional areas. Travelling to access services was considered a great challenge.\u201cWhen therapies start coming online of any kind, it\u2019ll be so welcome\u201d (PWD5).Two participants described how telehealth options could overcome this challenge.\u201cI think what you have to remember is the carer. So, you could have the best rehabilitative, you know, things and programs, but without looking after the carer it\u2019s not going to work, you know\u201d (Carer9).Participants who were care partners spoke of the need for rehabilitation programs to incorporate carers. This could either be through participating in activities together or using the time and opportunity to connect carers and provide each other with peer support.\u201cI\u2019ve made up my own little \u2013 I guess you might call it program\u201d (PWD5).\u201cI\u2019ve just recently signed up for  drawing classes \u2026 And I cannot tell you how much I love this group \u2026. I could just feel my brain like really working hard to do that. And I\u2019ve really loved it\u201d (PWD2).Most qualitative interview participants described how they had sought out activities and services which they felt would enhance their independence and quality of life or that of the person with dementia they provided care for. Their choice of activities and services suggest that rehabilitative approaches focussing maintaining independence are sought after following a diagnosis of dementia.However, quantitative survey participants provided mixed responses when asked to indicate how likely they would be to use a range of rehabilitative services Table\u00a0. While sThis multi-methods study draws together findings from interviews with people with dementia and family members of people with dementia and surveys with older people with cognitive impairment or dementia. Our aim was to understand the attitudes and beliefs of these cohorts towards rehabilitation and to explore preferences for different types of services. People who responded to our advertisements inviting people with dementia to talk about rehabilitation tended to be younger (with average age 60\u2009years) and due to our method of recruitment were likely more familiar with dementia services and progressive in their views about dementia care. Most participants had a good understanding of rehabilitation as maximising independence and quality of life and felt that this was an important goal of care for people with dementia. However, not all participants agreed that rehabilitation was the most appropriate term given that it was often associated with recovery-oriented programs. In contrast, participants who completed the survey were approached via health services and offered a broader range of views on rehabilitation. Survey respondents were also considerably older (average age 82\u2009years). Although this cohort were familiar with the concept of rehabilitation, they tended to consider rehabilitation programs as focussed on regaining lost function (such as after injuring oneself). Family members of people with dementia were also supportive of therapies to enhance quality of life and maintain function. Survey respondents identified a wide range of services that they may use, and these depended on their needs and goals. Despite the differences in sample selection, age, and beliefs about rehabilitation we found that people from both cohorts felt that gaps in care exist and there is a need for individualised services which promote independence and quality of life.The World Health Organisation describes rehabilitation as a holistic approach to optimise function and reduce the experience of disability. Furthermore, the Organisation describes rehabilitation as being necessary not just for those recovering from injury or illness but for those with detriments in function linked to ageing. This more contemporary description of rehabilitation would be unfamiliar to the general public and it would not have previously occurred to many of our survey participants that rehabilitation for disability associated with ageing or dementia could be beneficial. Providing survey participants with education around what can be offered and the associated benefits and then asking them about their needs may have resulted in different answers. Furthermore, without direct experience of a therapy or intervention it can be difficult to make a judgement about whether that therapy or intervention may be beneficial. Several of our interview participants described seeking out rehabilitative services or therapies and experiencing benefits.The findings of this study have some similarities to our earlier work in which we interviewed health professionals to understand their attitudes and beliefs about rehabilitation for people with dementia . Health There is increasing evidence that rehabilitative interventions are of benefit for people with dementia. Rehabilitation has been shown to help people with dementia achieve their nominated goals , can delOur use of multi methods with different sampling strategies and populations provided us with the opportunity to compare and contrast. However, use of social media to recruit interviewees introduce a sampling bias in favour of younger people with dementia, with lower levels of cognitive impairment, and higher digital literacy. People were included in the interviews if they had a self-reported diagnosis of dementia and we did not verify the diagnosis. These participants gave rich and detailed descriptions of their process of being diagnosed with dementia and we have no reason to doubt the accuracy of their diagnosis. These participants also opted into an interview about rehabilitation for people with dementia, and so were found to have a personal interest in the topic. It is also possible that the interviewer\u2019s views about the potential value of rehabilitation for people with dementia  influencSurvey participants were approached via a health service and therefore offer a more representative sample of older people with cognitive impairment or dementia. However, a larger population including those not accessing health services and those with more severe cognitive impairments would have increased generalisability. Recruiting from one single health service also limits generalisability. Another limitation is that changes in the aged care environment have been made since we completed data collection, including the introduction of new quality standards and an upgraded platform for accessing services. We are unable to comment on whether these changes resulted in improved services for people with dementia and easier navigation of services.Our research shows that rehabilitative interventions and therapies are valued by a wide range of people with dementia and their families although the types and level of services desired varies. Research is now required to determine how rehabilitation can be offered in a way that reaches those in need, that leads to beneficial outcomes for the person and that is cost effective.Additional file 1."}
{"text": "Improving public knowledge and understanding about dementia has been identified as a priority area by people living with the condition, researchers, educators, and policymakers for several years. Societies that have a better understanding of the condition are more likely to enable people living with dementia to enjoy a better quality of life. The aim of this study was to explore current public perceptions of dementia along with the facilitators and barriers to living well from the perspective of people living with the condition in Northern Ireland.Four focus group interviews were conducted with a total of 20 people living with dementia across three Northern Irish Counties in June 2019. These interviews were audio-recorded, transcribed verbatim and analysed using thematic analysis. Ethical approval was obtained for this study prior to data collection.Following thematic analysis, three themes emerged in relation to barriers and facilitators to living well with dementia. These were: \u2018Emphasis on Disability NOT Capability\u2019, which highlighted societal misconceptions about the activities and modes of life which people with dementia could or could not do; \u2018Normalise Dementia \u2013 We Don\u2019t Want a Fool\u2019s Pardon\u2019, which focused on how the public could encourage people living with the condition to enjoy greater independence, and \u2018Dementia isn\u2019t a Death Sentence\u2019, which considered how professionals, family members and friends treated the person after diagnosis.Public perceptions about dementia have the potential to act as both facilitators and barriers to living well with dementia. People with dementia stated that they are more likely sustain wellbeing when they are valued and can maintain independence. On the contrary, poor public and professional attitudes to dementia had the potential to disempower people living with dementia. More than 850,000 people live with dementia in the United Kingdom and this number is expected to surpass one million in the next 5 years . NortherThe challenges people with dementia may face can manifest in a variety of ways. Arguably the biggest misconception the public have about dementia is that the disease is a normal part of the ageing process . This miThere have been several international research studies which have sought to explore public perceptions of dementia and all have concluded that interventions to improve public knowledge about dementia are a priority \u201321. If pwww.dementiagame.comThe aim of this study was to explore current public perceptions of dementia along with the facilitators and barriers to living well from the perspective of people living with the condition in Northern Ireland. The reported study findings have been used to inform another project being led by the authors; the co-development of a digital game to improve public perception of dementia: An interpretive qualitative approach was used based on the belief that social reality is shaped by both human experience and social context . TherefoThis study received ethical approval by Queen\u2019s University Belfast, School of Nursing and Midwifery Research Ethics Committee in April 2019 (Reference: CBrownWilson 03.19\u2009M2.V1).https://www.dementiani.org/). Dementia NI have several local empowerment groups that are comprised solely of people living with dementia and their overall function is to contribute to improving services for people with dementia. Dementia NI shared information about the study with members during local empowerment group meetings. People with dementia who were interested in participating in this study attended a focus group meeting 2 weeks later. Immediately prior to the focus group, all participants met with the researcher (GM) who provided information about the study, the structure of the interview and what would happen with the data. The consent processes were guided by Dewing  when you go back into it, they\u2019ve moved the stuff all around\u2019FG4P7\u2018Just when you\u2019re used to a thing, the next week it\u2019s all moved around\u2019FG1P5One local intervention, which participants thought was extremely useful, was the JAM card (https://jamcard.org/). The JAM acronym means \u2018just a minute\u2019 and the laminated card has been designed to support people with dementia in telling others that they need \u2018Just a Minute\u2019 in a discrete manner. People throughout the four focus-group interviews expressed how the JAM card made life easier, particularly when paying for items at a shop, using public transport or becoming lost in a familiar place.\u2018The JAM card would be used when you\u2019re trying to count out your money out in a shop\u2026and you just show them [the shop keeper] your pass and then they would say \u2018oh hold on yes\u2019 and they will give you a bit of time to get yourself organised\u2019.FG3P1\u2018The JAM Card alone has helped me. It is a little comforter that I don\u2019t always need, but if things are racing a bit, I just take the card out [and show this to the service-provider] and that helps put the brakes on\u2019FG1P3The JAM card was a tangible example how local communities could enable people living with dementia to be independent through focusing on their capability, not their disability. People who participated in the focus-groups also stated that people\u2019s attitude was a major facilitator in supporting independence.Another aspect discussed within these groups was the capability of performing the task of shopping and dealing with money. In terms of shopping, most people living with dementia stated that they often had to shop with a partner/family or friend due to their own concerns about confusion, anxiety or getting lost during busier times. One key challenge which led people with dementia to feel more dependent on family or friends related to the frequently changing location of items in shops.viewed as an illness, much like heart failure or cancer. These people living with dementia also wanted the public to be aware of the symptoms of dementia and use this knowledge to help make their life more manageable. One aspect which people with dementia found particularly distressing was the potential of being labelled as a \u2018fool\u2019 due to the symptoms of the disease.One significant barrier to \u2018living well\u2019 was the general public\u2019s interpretation of what dementia is and how they believe it affects people living with the disease. Focus group participants wanted dementia to be normalised and \u2018I thought it was fantastic! It was nice to see just how they [the public] were reacting, and I mean they [people with dementia] were just normal, you know?\u2019 It was very positive\u2026It\u2019s not something you need to hide\u2019.FG4P1People with dementia also discussed the positivity of recent local public health campaigns that had promoted awareness about the condition to the public. In Northern Ireland, the \u2018Still Me\u2019 campaign was a media campaign produced by the Public Health Agency to raise awareness of the signs of dementia and to reduce stigma about the condition. People living with dementia felt a sense of empowerment with the campaign as stated below:\u2018It [the campaign] was letting more people know, don\u2019t be scared, if you\u2019ve got dementia don\u2019t be scared.\u2019FG2P4While participants were keen to describe the positive contributions that the media could make to improving public awareness of dementia, many also highlighted the negative media portrayals. They felt this exacerbated stigma associated with dementia and disempowered participants. Participants consistently noted obstructive language used, in particular the use of labels such as \u2018sufferer\u2019, \u2018demented\u2019, \u2018crazy\u2019, \u2018not-all-there\u2019 and \u2018child-like\u2019 were extremely upsetting.While the task of normalising dementia often rested on key members of each person\u2019s local community, like shop-keepers, law enforcement and health services, participants collectively asserted that the media had a huge part to play in positively influencing or informing the views of the wider public. Multiple participants spoke of the positive portrayal of dementia in a recent UK television documentary. The documentary, entitled \u2018our dementia choir\u2019 followed the journey of people living with dementia who formed a choir.\u2018Losing your job? That\u2019s the biggest thing, that was a really REALLY hard thing to have happen to you\u2026losing work was like losing a limb. You\u2019ve now lost everything\u2019.FG4P4Many participants felt that their formal diagnosis of dementia did not immediately change their level of function and often felt surprised when asked to give up work. They conveyed a sense of abandonment and confusion but strongly concluded that having the right to employment, or modification of one\u2019s work role, was a pre-requisite for the normalisation of dementia. One person with dementia provided the following advice regarding employment:\u2018Learn about dementia to start with\u2026that is what I would say and see what causes it and then make a decision as to why you should employ someone or not. Meet the person and actually see what stage of the dementia they are at\u2019FG2P2Participants agreed that to normalise dementia the general public needed to see that people living with the condition can enjoy life through work and activity. The participants did acknowledge that the symptoms of dementia were often invisible earlier in the disease and independent living would become more difficult in time. While public support was always advantageous, participants unanimously agreed that never wanted to receive a \u2018fool\u2019s pardon\u2019 because they lived with dementia.Focus-group participants also pointed to local employers as another key group that could do much more to normalise dementia. Several participants in the focus-group stated that the worst thing about being diagnosed with dementia was being forced by their employers to give-up their work.\u2018They [healthcare professionals] really ought to know better, right? I mean\u2026my GP [General Practitioner] has been great, but the people I visit at the memory clinics\u2026well, I am just a number. The information is all about future planning, worsening symptoms and what have you. What I really want to talk about is how I can live life to the fullest!\u2019FG4P1These sentiments were echoed by several participants. Collectively, there appeared to be a professional focus on symptoms of dementia and a consistent reinforcement that dementia is a progressive incurable condition. One participant stated that she was advised by healthcare professionals that she should begin to put an advance care plan in place, a technique that is recommended by several clinical guidelines.\u2018I mean for God\u2019s Sake\u2026I had only just been diagnosed with dementia and they were talking about Power of Attorney this and write a Will that\u2026I was so overwhelmed and I was just sat there thinking \u2013 how long have I got left [to live]? It took me a few months myself to realise, actually dementia isn\u2019t a death sentence and there is plenty of fun still to be had!\u2019FG1P3There were some positive accounts of healthcare professional interactions with participants, but portrayals of their input were often negative. Although the important role their family members and friends played in facilitating and enabling them to live well was widely acknowledged, at times many people with dementia perceived their family members to be, like healthcare professionals, looking too far ahead into the future. One example of this comes from a participant who, after being diagnosed, was taken by her family to a nursing home to have a look around.\u2018Visiting the home\u2026kind of left me a bit stunned. I\u2019m not there yet, my head was shouting at them, but I couldn\u2019t say anything. I know they are trying to help me and wrap me in cotton wool to protect me because they are afraid\u2026but I am ok. I can still go out to the pub and have a drink and a dance. I don\u2019t particularly want to live in a place with people who I don\u2019t know \u2013 I don\u2019t need care yet!\u2019FG3P2The role of the family member and healthcare professional was important to people living with dementia. These individuals could support people to overcome challenges in society or could behave in a way which inadvertently perpetuates societal stigma of dementia.The final theme that emerged from the focus-group data was around healthcare professional and family member treatment of people living with dementia post-diagnosis. The participants across all focus-groups expressed their surprise and dissatisfaction about how healthcare professionals\u2019 treatment of people with dementia often lacked understanding or empathy. The participants collectively felt that healthcare professionals perceived dementia as a death sentence.The participants in this study have identified several facilitators and barriers to living well with dementia. This study demonstrates that people living with dementia often experience members of the public who believe they are no longer capable of managing their everyday lives. Whilst dementia does place limitations on their lives, there is still much people with dementia can do and have to offer, a fact that society may ignore. These findings are not unique when considering the global evidence-base. For example, most of the participants identified how they had to give up their job as soon as they received a diagnosis of dementia rather than being offered alternative opportunities within their place of employment \u201329. OtheThe participants in this study identified the role of the media in promoting the normalisation of dementia and considered how these positive messages might encourage positive changes in attitude. The Dementia Engagement and Empowerment Project (DEEP) is an organisation which have taken an active approach to this issue and have produced guidelines on language about dementia for journalists, organisations, and communication departments . Indeed,Healthcare professionals that people with dementia encounter during their journey play a key role in their experience. In the current study, people living with dementia were shocked and distressed by the focus of health care professionals and subsequently by their families on the end stages of the condition. As potential societal role-models, due to their medical knowledge of the condition, many participants expressed disappointment about how these professionals appeared to prioritise medical needs and focus on long-term planning. Participants articulated that they did not perceive that living with dementia was a death sentence because there was still much to be enjoyed. Medicalised and paternalistic approaches to people with dementia are commonly discussed in the literature. A recent Irish study found that many people living with dementia were excluded from care-planning and decision-making due to assumptions they lacked capacity or because of family member preference . Some paFacilitating people to live well with dementia in their local communities requires improvements in public perceptions and meaningful behavioural change. Participants in this study have spoken about the facilitators to living well in their community and the positive impact this had. It appears that participants who can continue to do what they are capable of are probably more likely to experience higher levels of wellbeing. This concept, known as the capabilities approach, developed by Nussbaum , assertsThe strength of this paper was that it engaged people living with dementia offering them a voice to describe facilitators and barriers to living well with the condition based on their own experience. Whilst this paper has illuminated public perceptions of dementia from people living with the condition across Northern Ireland, it might not be reflective of the views of people living with dementia in other parts of the UK. Whilst authors made every attempt to engage people with dementia as widely as possible across the region, the sample was only drawn from people attending Dementia NI empowerment groups. A consequence of this approach to recruitment is that this study represents the voices of people living with mild symptoms of dementia who can maintain a high-level of independence. While the views of these participants are valid, it is unlikely these views represent people living with advanced dementia. It was also apparent from the focus group interviews that some participants had been involved in local media campaigns to promote awareness about the condition.Public perception and knowledge about dementia are improving but people living with the condition still face significant challenges in their daily lives. There is substantial evidence to suggest that local communities can facilitate people with dementia to live well with their condition. On the contrary, the converse is also equally true. Improving how people think about dementia has been a priority for many years, however despite notable improvements there are still many people living with dementia that face significant barriers to living well in their local communities."}
{"text": "The current spread of dementia is engendering an emergency that is not limited to the medical issues but also involves its social dimension. Accordingly, it is necessary to promote a perspective change about the disease that supports a more inclusive view of people with dementia. To ensure this, Dementia-Friendly Communities (DFCs) have recently been developed. Nonetheless, it is not always effortless to deal with people with dementia in an inclusive way because of misconceptions about how they perceive everyday contexts and react in everyday situations. We asked 170 individuals (aged between 13 and 75) to \u201cput themselves in the shoes of a person with dementia\u201d for a few minutes, facilitating this through the use of a 360\u00b0 video, and to try to experience how activities such as going shopping feel from the first-person perspective. Before and after the experience, participants expressed their opinions about the needs and the autonomies that are deemed to be granted to a person with dementia. The results revealed changes to social perspective after having experienced firsthand what living with dementia could be like. A deeper comprehension of what it is like to live with dementia appeared to be gained, and participants\u2019 beliefs about the needs and daily autonomies of those with dementia were modified after the experience. It is possible to conclude that, through the change of perspective, people are more willing to be inclusive toward people with dementia, as is wished for in the DFC approach, although a wider formative intervention on how to be really inclusive still seems to be required. The latest research developments on dementia have shown that there are still no unequivocal data about the causes of this disease . Nor is Consequently, in parallel with research on maximizing the effects of prevention strategies  and to sDespite this effort, the concrete actions that support the community of citizens in becoming Dementia-Friendly clash daily with the misconception of dementia , which f\u00ae has been widespread in the United States for many years; this is mainly aimed at caregivers and family members of people with dementia, showing them how some sensory and motor limitations can compromise the ability to solve simple problems The need for continuous assistances after the dementia diagnosis.(b)The possibility of having a large amount of autonomy in daily activities.(c)The exclusive role of professionals in supporting dementia people.2.What the demands of people with dementia are, in terms of those expressed by (a)To have basic needs  granted.(b)To have psychological needs  granted.(c)To have self-actualization needs granted.3.What the possibilities of becoming Dementia-Friendly are through(a)Improved knowledge about dementia.(b)Modification of the perceived difficulty of being a friend to a person with dementia.All participants were volunteers attending a public event in which the VideDe project was presented.M = 39.29, SD = 17.78). Additionally, 99 participants declared that no relative of theirs was diagnosed with any form of dementia, whereas the remaining 71 did have such a relative.In total, 170  took part in the experiment, with ages ranging from 13 to 76 years  took approximately 20 minutes. The experiment timeline is depicted in Data were collected in an anonymous form through the use of an interactive table placed at the entrance of the experimental setting. By clicking on the touch screen, participants provide to the experimenter information about their age and familiarity with dementia (Do they work with dementia? Are they relatives of people with dementia?).Moreover, in order to explore the research hypothesis, on the interactive table participants have to:1.Answer three questions to provide their opinions about the prerogatives of people with dementia. The questions are answered on a five-point Likert scale. The questions are about:(a)Assistance: Do you think that people with dementia need to have continuous familiar assistance during everyday activities?(b)Autonomy: Do you think that people can continue to autonomously meet their personal needs (such as going out to purchase goods or doing their housekeeping) just after a dementia diagnosis?(c)Institutionalization: Do you think people with dementia have to immediately ask for support from institutional welfare  after their first diagnosis?2.Click on a pyramid image that represents the five levels of individual needs defined by 3.Answer two questions to provide their opinion about the perceived difficulty of becoming Dementia Friendly, in particular in terms of taking care of people diagnosed with dementia (\u201cPlease indicate on the depicted line a point that corresponds to how demanding you think it is to live with a person with dementia\u201d) and in terms of the knowledge on dementia they believe they have (\u201cPlease indicate on the depicted line a point that corresponds to your knowledge on what dementia is\u201d). The questions are answered on a 10-point Likert scale .2) and a set of headphones. Participants immersively experienced a 360\u00b0 video downloadable on their smartphone from the www.vivede.it website. The video provides a six-minute experience of a person with dementia doing their daily shopping at the neighborhood bakery and greengrocer. In the video, a typical daily situation is represented . A video snapshot is provided in https://youtu.be/A15h8_UHWE4.After the touch-screen phase, participants were conducted to a separate dark room within which they had the ViveDe experience. The experience was made possible through the use of the Homido virtual reality Headset V2 . Moreover, the participants can hear firsthand the voice of a person with dementia as if it is their \u201cthoughts.\u201d The video, like the others developed in the ViveDe project, is the upshot of a previous research phase in which people with dementia, caregivers, and urban communities were involved in providing qualitative and quantitative information about how difficult is it to face everyday challenges when living with dementia (The 360\u00b0 video is fully explorable on the dementia .The only factor was \u201cTime.\u201d All participants filled the questions before and after the ViveDe experience. The dependent variables were:(a)Prerogatives of people with dementia. Three questions measured on a five-point Likert scale  exploring the perceived need for assistance in dementia patients, the perceived right for autonomy, and the perceived need to be relocated to specialist health and social structures.(b)Demands of people with dementia. The eight clusters reported in (c)Possibility of becoming Dementia-Friendly. The perceived knowledge of the respondent about what dementia is and their perception of the difficulty of living with a person diagnosed with dementia, on a Likert scale ranging from 1 to 10, with no specific label.The hypotheses concerning participants\u2019 opinions about the prerogatives of people with dementia and participants\u2019 opinions about the perceived difficulty of becoming Dementia-Friendly were explored by using SPSS 22 statistical software.To explore participants\u2019 opinions about the individual demands of people with dementia, analyses were conducted using Sleipner 2.1, which is a statistical package used for typological analyses and for studying individual development, that is, stability vs. change . An indiThe five levels of Maslow\u2019s pyramid of needs were grouped into three possible levels: a base level (basic needs) including physiological needs and safety, a second level  including social belonging and esteem, and a third level  focusing on self-actualization only , 1954. IThe analysis was conducted using the EXACON module of Sleipner, which produces a contingency table for two categorical variables, in our case, cluster membership at T1 and T2. The EXACON procedure focuses on cell-wise analysis of types based on exact tests. Specifically, a type is said to occur in a cell if the observed frequency is much larger than the expected frequency and the associated hypergeometric probability is low; that is, we observe a significantly larger frequency than we expect to observe by chance alone. In the opposite case, an antitype is said to occur. In other words, this analysis evaluates the T1-to-T2 sequences of clusters for perceived needs to verify whether these sequences occur differently than expected by chance.F, Wilks\u2019 \u03bb = 14.10, p < 0.001. At a univariate level, the effect for the question concerning assistance was not significant, F = 2.77, p = 0.09, partial \u03b72 = 0.02. On the contrary, the effect was significant for autonomy, F = 34.65, p < 0.001, partial \u03b72 = 0.17, and for institutionalization, F = 11.25, p < 0.01, partial \u03b72 = 0.06. As Before running any analysis, correlations among the three questions were evaluated. As p = 0.02, cluster 4, p < 0.01, cluster 7, p < 0.001, and cluster 8, p < 0.001. Four cells show that more participants than expected re-emerged in a different cluster at T2. This happened, for example, for changes from cluster 2 to cluster 3, p = 0.03, for changes from cluster 3 to cluster 5, p < 0.01, for changes from cluster 5 to cluster 3, p < 0.05, and for changes from cluster 6 to cluster 8, p < 0.05. Four cells show that fewer participants than expected re-emerged in a different cluster at T2. This happened for example for changes from cluster 3 to cluster 8, p < 0.05, for changes from cluster 7 to cluster 8, p < 0.001, for changes from cluster 8 to cluster 3, p = 0.02, and for changes from cluster 8 to cluster 7, p < 0.001.These results illustrate that: (a) the majority of participants tended to recognize that all of the three levels of needs described by Maslow\u2019s pyramid should be granted to people with dementia and (b) there is a general trend to \u201cmove up\u201d toward the higher level of needs represented in the pyramid from pre- to post-experience.r = 0.13, n = 170, p = 0.09. The correlation post-experience was significant, r = 0.19, n = 170, p = 0.01. Due to this last correlation, a MANOVA with Time  as the factor and perceived difficulty and perceived knowledge as dependent variables was run. There was a significant multivariate effect, F, Wilks\u2019 \u03bb = 53.88, p < 0.001. At a univariate level, the effect for knowledge was significant, F = 107.64, p < 0.001, partial \u03b72 = 0.39. Participants increased their perceived knowledge from M = 4.71 (SD = 2.08) pre-experience to M = 6.06 (SD = 2.08) post-experience. In contrast, the change in perceived difficulty from pre-experience, M = 7.94 (SD = 1.66) to post-experience, M = 8.04 (SD = 1.64) was not significant, F = 0.60, p = 0.43, partial \u03b72 = 0.00.The correlation between the question about the perceived difficulty of taking care of people diagnosed with dementia and the question about perceived knowledge about dementia was explored. Such a correlation was not significant before the ViveDe experience, The results showed that the ViveDe experience had an impact on how participants considered dementia. Although the idea of needing assistance is not changed by the first-person experience, it significantly reduces the idea that assistance should be delegated to welfare professionals . We could consider this as a greater positive disposition toward the autonomy of a person with dementia, but we see, however, that this was not confirmed by the analysis. The disposition toward autonomy, though it changes significantly, appears to become more negative. This result is apparently not consistent with the assumptions but can be understood in the light of the firsthand experience provided by ViveDe 360\u00b0 video.Precisely because, in an everyday life situation considered to be simple to manage (like buying bread and fruit in a neighborhood shop), the participants felt like they were not able to complete the task without the collaboration of others (the shop managers and the attending customers), a \u201cstereotyped\u201d idea of autonomy materialized from the experience of \u201cfrustration\u201d in autonomy. This was to such an extent as to lead participants to change their opinion toward the conception of autonomy to become more restrictive. Therefore, though, on the one hand, this fact confirms the transformative potential of the immersive experience, it also leads us to expand the educational pathways about conceptions of autonomy and the effort required to give assistance to people with dementia within a really inclusive urban community. Indeed, in a Dementia-Friendly perspective, citizens are informed and trained about inclusive behaviors that can best support the autonomy of the person with dementia by avoiding the spontaneous errors of interaction that the participants probably experienced within the video.This finding appeared to be confirmed by the answers to the knowledge/difficulty questions, in which participants after the experience significantly changed their evaluation of what they knew about dementia but not on the estimated difficulty of being Dementia-Friendly. ViveDe video appears to be successful in being informative about how people with dementia live and how they experience the urban surroundings, but the participants did not receive any new insights into how to supportively interact with and on how to include people with dementia in a daily situation. This suggests the direction in which the interactive dimension of the next ViveDe videos has to be more carefully developed.Finally, one of the clearest unexpected findings was provided by the positioning on Maslow\u2019s needs pyramid both pre- and post-experience. Not only did the majority of the participants \u201crecognize\u201d that people with dementia have the right to have their basic needs  fulfilled \u2013 by highlighting the \u201cwelfare\u201d nature of the caregiving relationship \u2013 but it appears clear that the participants recognized from the beginning that they also have the higher-level needs  that are generally the needs of any person, regardless of illness. Probably, precisely because the sampling of the participants was on a voluntary basis and the ViveDe experience was proposed indiscriminately to a wide audience, the individuals who participated in the experience did so already thinking that people with dementia have a wide range of needs. In addition, after the ViveDe experience, the urge to consider the needs of a person with dementia appeared even stronger in our participants. In fact, they significantly revised their choices by adding the needs at the higher positions in the pyramid, even when they had not done so previously.In conclusion, our participants showed they took part in the research with an already assimilated idea of \u201cbeing a person with dementia\u201d (as advocated by Kitwood\u2019s perspective) and were predisposed, before the ViveDe experience, to be in some way Dementia-Friendly. Moreover, having the opportunity to understand what it could mean to be in that situation by taking a firsthand perspective on dementia enabled participants to revise some opinions about the challenges and skills that an observer generally tends to attribute to a person with dementia when watching a daily interaction from a third-person perspective. This perspective change definitely produced new familiarity with dementia, but it also raised new questions about what daily practices are more suitable to being faced by a person with dementia. Our participants, in fact, significantly modified their understanding of dementia but not their estimation of the difficulties of becoming inclusive toward people with dementia. It must be borne in mind, however, that one important limitation of this study was the lack of a control group and/or a longitudinal measure; hence, the results must be taken with caution. Concerning the former, it is possible that a control group would not be of much help to understand the change of perspective, as control participants would just answer the same questions twice in a very short time-window. As far as the latter, future research should also explore how the change in perspective is affected after longitudinal and repeated exposure to the experience. Future studies could have different aims: to evaluate whether longer exposures to the experience may reinforce its positive effect, as suggested by post hoc focus on how to convey effective community change that directs toward full inclusion of people with dementia.Furthermore, the findings presented in this study, even if it could be considered as one of the first significant results in this field, still leave open the question of how to strongly convey a social perspective change that really takes us in the direction of the construction of a stable Dementia-Friendly Community. We acknowledge that ours was a temporally circumscribed intervention, but it had a high experiential and transformative potential. Unfortunately, we cannot measure this change through follow-up monitoring of our participants or explore whether their future actions changed toward being more Dementia-Friendly when they returned home. Thus, although it has shown to be effective, the ViveDe experience still needs a Data access is restricted to protect confidential information about a personal point of view on dementia that can be erroneously considered outside the research context. To access the dataset contact the corresponding author. Data will be available on request with the permission of the third party.This study involving human participants was reviewed and approved by University of Bergamo. Written informed consent to participate in this study and for the publication of any potentially identifiable images or data included in this article was provided by the participants.FM ideated the research. FM, PS, and NP conducted the experiment. FM and NP wrote the manuscript. FM, NP, and AG collaborated on data analysis. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Approximately one-third of people with dementia in the United Kingdom live alone. People living alone with dementia may receive different treatment for dementia and may have different comorbidities compared to people who live with a caregiver. This study explored differences in medication and demographic characteristics between people living alone with dementia and those living with a caregiver in Northern Ireland. People with dementia were identified through the first date that a dementia management medication was prescribed between 2010 and 2016. In total, 25,418 people were prescribed a dementia management medication. Data for whether people with dementia lived alone was extracted through the National Health Application and Infrastructure Services and from national datasets through the Honest Broker Service. Approximately 35%  of people with dementia in Northern Ireland lived alone. People with dementia who lived alone were younger  compared to people who lived with a caregiver . Binary logistic regression highlighted that people who lived alone were more likely to be treated with donepezil medication for dementia and less likely to receive antidepressants. These findings indicate that living alone did not affect treatment for dementia and comorbidity medication in people on dementia medication. Approximately one-third of community-dwelling people with dementia in the United Kingdom and the United States live alone; these rates, however, are higher in other countries, such as Germany 51%) and Sweden (46%) % and Swe. In 2010The presence of a caregiver is likely to affect therapeutic decisions as informal primary caregivers can help ensure that the person with dementia receives treatment, help with drug adherence and help with the management of side effects of treatments . ConversOne study exploring differences between people with dementia living alone with those who live with an informal caregiver found no differences in the management of medication-related problems, such as adverse reactions, as well as in nutrition, quality of life, or cognitive and functional impairment . Other sAlthough past research has explored the unmet needs for people with dementia who live alone , includiFrom 25,418 people with dementia , 8,828 people lived alone and 12,200 people lived with another person in January 2010 . The remThe binomial regression model Model 1, , when co2(1)= 153.516, p< 0.001], were less likely to live in rural areas , less likely to be married  and more likely to receive donepezil . In comparison to people living with a non-adult, people living alone with dementia were less likely to receive medication for hypercholesterolemia  and hypertension , as well as less likely to receive anxiolytics , antidepressants  and antipsychotics .Analysis between people living alone and people living with a non-adult  showed that the former group were significantly younger , were more frequently females , married , lived in rural areas , and lived in more deprived areas  compared to people living with another person with dementia. People living alone were less likely to receive memantine , but more likely to receive medication for hypercholesterolemia .Finally, analysis was carried out between people living alone and people living with another person with dementia (n=278). People living alone were younger , more frequently females [65% and 59%, \u03c7This study explored whether people living alone with dementia had differences with respect to their demographic parameters and comorbidity medications in comparison to people with dementia who lived with at least one other person. Almost 35% of people with dementia in Northern Ireland live alone in their own home. This rate is similar to the one-third of people living alone with dementia in the whole United Kingdom and in the United States , but lowSimilar to past research, our results showed that people living alone with dementia were more likely to be female, were less likely to be married and more likely to be widowed , 2, 4. MIn contrast to research evidence from Sweden, Germany and France , 2, 4, 6Furthermore, the younger age of people who lived alone may also explain why they received medication for less comorbidities compared to people who lived with a caregiver. Another possible explanation is that the presence of a caregiver is associated with better treatment adherence and management of any side effects  and thusPeople with dementia who lived alone were more likely to receive Donepezil; this may be because of their younger age and fewer comorbidities hence they may be able to tolerate it better . Past reAlthough the results from this study contribute to important findings about drug treatment in dementia, several limitations should be considered. People with dementia were identified through their dementia medication and thus, our sample potentially included mainly people with Alzheimer\u2019s disease, mixed dementia and Lewy Body dementia. In addition, people who lived alone could receive care from friends and relatives who did not live with them. Research has shown that people who live alone with dementia are often supported by their siblings, children and grandchildren . The EPDTo conclude, the present study showed that people living alone with dementia are equally or even less likely to be prescribed medication for comorbidities compared with people who lived with someone else. This can be explained by the absence of a caregiver as well as by the support provided by health and social care services in Northern Ireland. The present results should be considered by local authorities in health services for future planning. Finally, the public and voluntary sectors should continue to provide vital information for people who live alone with dementia, such as for staying safe and dealing with loneliness and depression .Similar to previous studies, people with dementia  were identified using data which was extracted from the Enhanced Prescribing Database (EPD). The first date that a dementia management medication was prescribed was used as a proxy for a dementia diagnosis , 9. The Dementia and comorbidity medications were extracted through the EPD and are explained in our past research . ComorbiDescriptive information is presented as frequency , means and standard deviation (SD). Comparisons between people who lived alone and people who lived with another person were conducted with chi-square tests for categorical variables, and with independent-samples t-tests for continuous variables. Chi-square and t-tests were also conducted to compare data between people living alone and people living with an adult, a non-adult or another person with dementia. A binary logistic regression model was used to estimate the odds ratios (ORs) and the 95% confidence intervals (CIs) for the relationship between living alone, demographic characteristics and medication use. A significance level of <0.05 was assumed for all statistical analyses. We analysed the data based on complete case analysis to deal with missing data."}
{"text": "BAT is activity . Howeveractivity . We induEQUIPMENT: Albira Si PET/SPECT/CT (Bruker), Xtreme II optical imaging system (Bruker)REAGENTS: XenoLight RediJect 2-DeoxyGlucosone (DG) (PerkinElmer), CL316,243 (Sigma)"}
{"text": "This paper reports on the long-term effectiveness of a non-formal co-curricular educational program based on a campus ecogarden at a Hong Kong university in developing pro-sustainability awareness, attitudes and behavior among undergraduate students. This service-based, nature-based experiential learning program, termed the Ecogarden Farmer and Biodiversity Surveyor, has been running at the university since 2015. The program is divided into two consecutive phases: a training phase comprising various learning activities and a successive internship phase consisting of the all-round practical tasks involved in managing the garden. A retrospective evaluation of the program using phenomenographic approach and content analysis was adopted to reveal the diversity of students\u2019 learning experience, as the indicators of the success of the program. Of 112 participants from 4 cohorts, 32 completed online questionnaires, and semi-structured interviews were successfully conducted with twelve participants, three from each of the four cohorts. The results indicated that the program\u2019s outcomes could be categorized into five themes. Most outcomes fit into the theme \u2018an increase in knowledge and skill level,\u2019 followed by \u2018rise in environmental awareness,\u2019\u2018facilitation of personal growth,\u2019 and \u2018enhancement of career development.\u2019 Many structural experiences revealed may suggest the success of the program. The longer the participants had participated in the program, the more in-depth and diversified reflection of the senior participants relating to personal development were mentioned. This study provides critical insights into the validity of retrospective program evaluation for assessing the long-term impact of EfS programs by introducing a cross-sectional study of different cohorts as a serial time-point sampling strategy. Higher education institutions (HEIs) play a critical role in education for a just and sustainable future . Non-forAs Indeed, innovative teaching methods are needed to facilitate students\u2019 learning and experience of concepts of sustainability and to foster a pro-sustainability attitude amongst them . In recePlanting a garden was cited by In higher education, GBL has commonly been adopted in non-formal contexts. This approach is appealing to HEIs, as it is effective in altering students\u2019 attitudes without requiring them to possess prior gardening experience or high environmental motivation . With teSeveral characteristics of GBL make it a good model for EfS. The experiential nature of GBL is undoubtedly the most important component of any garden-related EfS program. Student-oriented or student-initiated programs can strengthen students\u2019 problem-solving ability and arouse in them a sense of belonging to their university . The reaTo further enhance GBL on a university campus in Hong Kong, To nurture the pro-environmental awareness, attitudes and behavior of undergraduates at a university in Hong Kong with an ecogarden on campus, a non-formal co-curricular educational program was implemented at the university. GBL is the overarching pedagogy of this ongoing program, with nine sub-pedagogies , such asSeveral studies have focused on how long participants retain the impact of an environmental program  program at an HEI. A wilderness orientation program conducted at a university left a positive impact on the participants as long as 17 years after their graduation . Dvorak As Considering the very limited studies on the long-term effects of EfS programs at HEIs, the current cross-sectional study of participants from different cohorts aimed to evaluate the long-term (up to 4 years) effectiveness of an EfS program in nurturing participants\u2019 pro-sustainability knowledge, skills and attitudes, by revealing the experience of the participants and its association with the program. A matrix matching the sub-pedagogies involved in the program with the outcomes observed in the participants was created to serve as a reference for other co-curricular GBL modules of higher education to be implemented in the future.per se  enrolled in the program, including both alumni and current students studying diverse educational  and non-educational major subjects  in four cohorts, were invited to take part in an online questionnaire survey. 32 participants completed online questionnaires were received, giving a response rate of 28%. The respondents of online questionnaire were consisted of 9 males and 23 females. To further explore the views of participants from different cohorts, follow-up semi-structured interviews were successfully conducted on twelve of the participants with 3 males and 9 females (three from each cohort), based on their preferences as indicated in the online survey. The majority (66.67%) of the interviewees studied education-related fields, including English Language Education and General Studies etc. The sample size is more than what The protocol of the study reported was approved by the Human Research Ethics Committee of the Education University of Hong Kong (Ref. No.: 2019-2020-0312). The participants were informed of all relevant information on the study before taking part. They understood their right to withdraw from the study at any time point if they chose not to participate. For the online questionnaire, all of the participants gave their consent to participate by proceeding from a consent statement shown in a webpage before filling out the questionnaire. For the video-conferencing interviews, written consent to take part in the study was obtained.Invitations to join the study were sent via the alumni and current students\u2019 e-mail addresses, as registered on their first enrolment in the program. All of the participants were invited to complete an online questionnaire directed at collecting their views on the program. Demographic data, as well as information on self-perceived degree of participation in the program, given on a 5-point Likert scale (where 5 indicated the most active participation), were collected from the respondents. The other questions asked were all open questions aimed at understanding why the participants had joined the program, how the participants reviewed the program and what impact the program had had on the participants .In addition to the online questionnaire, follow-up semi-structured interviews were conducted on 12 students via online videoconferencing. Each interview lasted for 30 minutes. Any particular view on or impact of the program was further elaborated in these interviews. The interview questions were open-ended and were based on the responses to questions that the students had provided in the online questionnaire. The basic approach in the interview was to ask \u2018Why\u2019 and reveal more in-depth latent contents and impact from the students\u2019 perspective. Some example questions are listed in Each interview was video-recorded, and the conversations were all transcribed. The text from both the online questionnaire and the transcription of the interviews was inductively analyzed according to the two data-analyzing approaches described below.We adopted the phenomenographic method of The process of categorization is iterative in nature. Refinement and modification, if needed, were taken place in order to generate a final set of categories, which would best represent the diversity of the participants\u2019 experience. For the categorization, we follow the three requirements, the distinctness, parsimony and logical relationship of categories, as stated by The categorization was conducted by one experienced researcher. A second experienced researcher independently checked the coding and categorization and deliberated with the first researcher in cases of inconsistency. A third researcher was consulted if the inconsistency could not be resolved.The latent content in our conversations with the interviewees and their responses to the online survey were coded inductively. The codes were regarded as the experience related to the long-term program outcomes. They were reviewed, decontextualised, categorized, and reorganized into themes to explore any hidden or shared points of view and/or structures of the interrelated codes among different interviewees . EventuaAs for content analysis, the occurrences of the codes (outcomes) and themes were analyzed using the computer software NVivo 11 Pro. To elucidate the outcomes and thus the effectiveness of the program, the relationships among the codes and themes were referred to the documented psychological constructs.The data from the content analysis were shown in the form of descriptive statistics, with graphs constructed using the software GraphPad Prism 8. Maps showing the psychological constructs described by the participants were generated using VUE Version 3.3.0. The corresponding experiences of/pedagogies experienced by the participants in the program were also mapped on to those psychological constructs to synthesize a general model of the pedagogical devices used in the program and their respective outcomes.Four themes of outcomes could be categorized from both the questionnaires and the semi-structured interviews: \u2018increase in knowledge and skill level,\u2019 \u2018rise in environmental awareness,\u2019 \u2018facilitation of personal growth,\u2019 and \u2018enhancement of career development,\u2019 with miscellaneous outcomes being classified as \u2018others,\u2019 as revealed from both phenomenographic studies and content analysis. Based on the content analysis, on average, two to three codes per participant were mentioned by the respondents to the online survey. The codes recorded in the online survey were generally simple and superficial, without much elaboration and example illustration. The outcomes collected from the interviewees ranged from 8 to more than 20 codes per participant. The experienced shared by the interviewees appeared more in-depth and reflective, with more supporting examples.Albeit with the slight actual percentages difference between the online survey and videoconferencing interviews, the theme \u2018increase in knowledge and skill level\u2019 is the theme with the most codes, followed by the theme \u2018rise in environmental awareness,\u2019 \u2018enhancement of career development,\u2019 and \u2018facilitation of personal growth\u2019 .Within the theme of \u2018increase in knowledge and skill level,\u2019 the codes that could be recalled by the participants were essentially aligned with what had been taught in the training workshops. The subthemes identified included the knowledge on organic farming, aquaponics, ecology, environmental sustainability and energy, as well as, the skills on ecogarden management, farming, species identification, docent, presentation and classroom management for junior students .Most of the knowledge that the participants described was examples of system knowledge , such asThere were some examples of effectiveness knowledge, which were related to the facilitation of sustainability decision making, such as the importance of healthy soil, pest control and aquaponics. Interviewee 6 mentioned that \u201cThe practical skill (that I learnt) is the operation of an aquaponics equipment. I needed to consider water and other hardware. The ratio of fish to vegetables is important. For farming, I saw (learnt about) many tools, such as pots, hoes, and pesticides, and considered the weather (for farming) as well.\u201d Systems-thinking competence was also reflected in the interviews. The response of Interviewee 10 stated that \u201c(I learnt about) The relationship between the ecology of the insects, butterflies and plants in Hong Kong, their overall distribution in Hong Kong, the concept of farming, and the aquaponic system. I think it\u2019s very comprehensive.\u201dWithin the environmental themes, the codes could be broadly classified into two subthemes attitudinal and behavioral changes , which wOn the attitudinal change, many participants have reflected the latent content about environmental empathy and attitude toward gardening , which wOn the behavioral change, actual change on knowledge enhancement such as \u201cI have downloaded an app to understand different types of plants.\u201d (Interviewee 5) and change to a more environmentally friendly behavior for instance \u201cI tried to plant more. See whether I can create a similar program, as my home is adjacent to a farm.\u2026 We can also collect food waste in the school, and I have more awareness on it.\u201d (Interviewee 7) were commonly recorded in the interviews. Some of the behaviors reported were not just restricted to the self-competence for environmental protection, but also on the influence to the surrounding people, \u201cI can share my experience with others to promote organic farming and sustainable development.\u201d (Online survey).It is worth-noting that many of the outcomes recorded, such as \u2018develop a thankful heart,\u2019 \u2018being willing to work outdoors,\u2019 \u2018share ecological knowledge with friends,\u2019 and \u2018treasure food\u2019 , were neThe content of the outcomes under the themes \u2018Facilitation of personal growth\u2019 varied from subthemes of becoming more considerate, independent and confident, to the subthemes on the willingness to strengthen students\u2019 own social ties, accepting new challenges and even the attempt to live a simple lifestyle .For instances, Interviewee 2 gained a significant pleasant experience in teaching an ecogarden-based lesson which boosted up his self-confidence. \u201cThis was the first time I had taught a class of students. I had a bad experience when leading a tour in the Wetland Park (in the past). This time I did better and inspired my students to learn more. This increased my self-confidence as I had seldom talked in front of a large number of people before\u2026 I will not be shy anymore in the future, or in workplace, as well as other activities. I can have more ways to develop myself.\u201dBecoming more open to accept new challenges were recorded in both the online survey and interviews, for example, \u201cI became more likely to think and practice when facing new things.\u201d (Online survey), \u201cI have been more confident to step out of my comfort zone (after participating the program).\u201d (Interviewee 11).New perspectives have been reflected by and introduced to the participants. A significant perceptual change on the interviewee\u2019s ability to solve problem has been documented. Interviewee 1 described her experience as below \u201cUsing planting as an example, sometimes we think this crop cannot be grown, but actually it can grow very fast. We face different difficulties and need to try our best to face (and address) them.\u201dAll of the codes recorded under the theme of personal development were not explicitly taught or mentioned in the courses during the training stage of the program. Those were instead the outcomes that the students experienced implicitly from the program or generated upon reflection after graduating from the university.Similar to the theme on personal growth, the content of the outcomes under the themes \u2018Enhancement of career development\u2019  was not The codes under the subtheme \u2018being teacher\u2019 were commonly found in the participants, especially for those who were studying education major. \u201cI will introduce myself (for having farming experience) when I obtain opportunities in teaching\u2026 Plant-related topic are usually covered in the curriculum of the primary school. I can inspire kids through this (ecogarden-related) knowledge if it fits the teaching plan. If not, I will show the content as supplementary knowledge.\u201d Interviewee 5 reflected. She also made in-depth reflection about how the experience gained from the program facilitated her teaching: \u201cI need to have more preparation as children would ask me many extra questions which are out of the books (during the tours).\u201d Another online reply also mentioned that \u201cEducation in mainland China does not pay much attention to environmental education. So, (this experience) helped me (as a foreign student coming from mainland China) to prepare for teaching by using eco-garden as a tool (when I come back to China to teach).\u201dOn the subtheme \u2018being farmer\u2019, the main impacts of the program were to change the perception of the participants on the agriculture of Hong Kong and to equip the students with the necessary skills in farming. Interviewee 1 stated that \u201cThis (experience) affected my choice of firm for my placement. I wanted to further explore farming or eco-tourism.\u201dOther themes such as mental health, sense of belonging to the universities were recorded. Volunteerism  was reflCodes about improving mental health were encountered more than once. Interviewee 1 mentioned about the function of planning in relieving her negative feeling. Data from the online survey also highlighted that \u201cIrrigating plants in the eco-garden can help relieve my anxiety and depression.\u201d Apart from getting rid of negative emotion, Interviewee 11 regarded the farming experience a very happy one. \u201cI loosened the soil at university on a very hot day. When people passing by there, I was a bit embarrassed, and yet happy. The reason is that I like to do these things (farming)\u2026 And I will continue to do so.\u201d There was one interesting finding from the interviews. Interviewee 5 particularly pointed out that \u201cI have more interaction with parents about planting.\u201d due to the development of common hobby in their leisure time with her parents.All of the nine sub-pedagogies were found to be related to the outcomes reported by the participants .Direct instruction, hands-on learning, nature-based learning and place-based learning were the sub-pedagogies most commonly associated with an increase in knowledge and skills . For exaField trips, hands-on learning, nature-based learning and place-based learning were more closely associated with the change in environmental awareness or attitude theme . InterviFor personal growth, collaborative learning was the sub-pedagogy related to most of the representative experiences, followed by hands-on learning, nature-based learning, place-based learning and service-based learning . InterviOn the career development, students gained authentic experience through direct instruction, nature-based, service-based and self-directed learning . InterviIn particular, place-based and service-based learning pedagogies, with the recognition of the symbolic role of the ecogarden for the university, seemed to nurture in the students a sense of belonging to the university. As shown before, Interviewee 3 stressed that \u201cI am proud of myself for contributing to my university by serving at the pond (in the ecogarden)\u2026 My sense of belonging to the university was increased.\u201dExamining the relationship between the learning experience (outcomes) under different themes and the cohort of enrolment based on content analysis, we can observe that more codes were recorded for the senior cohorts from the interview dataset , but notPhenomenographically speaking, reflections on personal growth coming from the senior cohort during interview were, indeed, more in-depth and diversified. For instance, Interviewee 1 coming from cohort of \u201816/\u201917 did not just discuss about the local agriculture, but also extended her awareness on the situation of agriculture in other area. \u201cOrganic farming is about eating crops in the right season\u2026 Understanding the scenarios involved in growing vegetables in China, such as the shortage of water in Yin Chuan, I thought further about sources of food and ways of farming.\u201d She is also the one who expressed a deep reflection on her current living style and was eager to make a change, \u201cFarmers live and work on farms without switching on air conditioners. I think that this kind of lifestyle is good. I am willing to try this simple life by living on the farm. I can try to have a lifestyle of \u201chalf farming, half working\u201d.\u201d Interviewee 2 from the same cohort could explain clearly how the experience gained from the program changed himself: \u201cThis was the first time I had taught a class of students. I had a bad experience when leading a tour in the Wetland Park (in the past). This time I did better and inspired my students to learn more. This increased my self-confidence as I had seldom talked in front of a large number of people before\u2026 I will not be shy anymore in the future, or in workplace, as well as other activities. I can have more ways to develop myself.\u201d Interviewee 2 is also the one who ascertained the role of corporative learning in enhancing his social skill with clear justifications: \u201c(I learnt) social skills, like how to cooperate with others through making teaching plans and discussion. This program required us to work together so that I could discover different problems when I worked on the tasks.\u201dIn contrast, the participants from junior cohort focused on more practical issues and environmental issues. For example, Interviewee 6 from cohort \u201818/\u201919 remembered the practical skill he learnt about aquaponics: \u201cThe practical skill (that I learnt) is the operation of an aquaponics equipment. I needed to consider water and other hardware. The ratio of fish to vegetables is important. For farming, I saw (learnt about) many tools, such as pots, hoes, and pesticides, and considered the weather (for farming) as well.\u201d Interviewee 5 from the same cohort have downloaded an app to understand different types of plants.The students rated themselves to have deep engagement with the program did not demonstrate a higher number of recorded codes in both interview  and onliIn fact, Interviewee 5 who discussed in-depth how the program experience helped with her teaching duty has rated herself 4 out of the 5 Likert scale in terms of self-perceived participation: \u201cI will introduce myself (for having farming experience) when I obtain opportunities in teaching\u2026 Plant-related topic are usually covered in the curriculum of the primary school. I can inspire kids through this (ecogarden-related) knowledge if it fits the teaching plan. If not, I will show the content as supplementary knowledge.\u201d In contrast, Interviewee 6, who rated himself 2 out of 5 in participation, did not mention much on career development, despite of the fairly reflective content was recorded from him, e.g., \u201cI have a thankful heart now, as different types of crops are not easy to grow. I eat different types of crops with gratitude now,\u201d My deepest impression I gained about farming is that I was planting too many seeds, so they could not grow healthily. Different farming methods deepened my impression etc.From the phenomenographic perspective, the experience gained in the learning process could be \u201cdissected\u201d into referential and structural aspects . Han andBoth referential and structural aspects of experience could be identified in all the themes, and yet many of the online data seemed to be the referential ones, such as \u201c(I learnt about) the campus\u2019s ecology and biodiversity.\u201d As shown by the dataset in the results, many structural aspects of experience were reflected by the interviewees. For instance, Interviewee 5 described how the experience in organizing teaching activity in ecogarden strengthened her competency in organizing similar activity in local school , Interviewee 1 extrapolated what she learnt about farming and local agriculture to comment on the agriculture oversea , Interviewee 6 recalled the requirements and conditions for aquaponic farming  etc.The participants\u2019 in-depth reflections exhibiting various structural experience have provided evidence to prove the success of the program. The experience under the themes, \u2018Facilitation of personal growth\u2019 and \u2018Enhancement of career development,\u2019 which were not explicitly mentioned or taught in the workshop, in fact, hints on the possibility that factors other than curriculum, such as the diverse sub-pedagogies applied, the field-based and authentic service-based working environment etc., could facilitate the gaining of structural experience. The probability for the students to apply the learning experience in other personal context, such as Interviewee 5 practicing planting with her parents and applying her teaching experience in her own working school, would enhance the structural experience being extrapolated to external horizon.The curriculum developed in the current co-curricular program relied heavily on scientific, more specifically biological, content. This is in line with the review of A distinctive characteristic of the current program is the inclusion of training in presentation and docent skills, which has relatively rarely been mentioned in the literature. The usefulness of the knowledge and skills learnt by the participants to their career development was frequently acknowledged in the dataset. The success of this part of the training can be attributed to the abundance of opportunities for the participants to guide authentic tours during the practical internship stage.Compared with other studies adopting GBL, we found that the GBL approach induced all four types of outcome : (1) perApart from cognitive outcomes, we were able to identify affective responses from the participants, in particular from the interview data. We found evidence from the participants regarding the self-determination model of motivation . The stuRegarding the literature gaging the long-term impact of an EfS/EE program by retrospective assessment, the outcomes revealed by the current study were found to be comparable to psychological constructs or competencies found in other studies. We recorded experiences, such as \u2018Increased social interactions,\u2019 \u2018Opportunities for personal growth,\u2019 \u2018More positive environmental attitudes,\u2019 \u2018Self-confidence,\u2019 that have also been reported in previous studies . For insFocusing on HEIs, we identified competencies that resemble those elucidated by Our results not only echoed the findings of previous studies demonstrating the long-term effect of the EfS program, but also revealed a likely time-dependent increase in the codes under the personal growth theme after the completion of the program. Besides, the participants who did rate themselves as actively involved in the program reflected more content on the occupational theme. Indeed, none of the codes recorded in the personal growth and occupational themes, were found to be explicitly taught in the program.The more in-depth and diversified reflection of the senior participants implies that the participants had \u2018discovered\u2019 or \u2018evaluated\u2019 the outcomes of the program independently after joining the workforce in the community. It could be a results of a self-reflection on the part of the participants and metacognitive reflection on the experience that they had accumulated in the co-curricular program. The findings of this study suggested that, rather than taking place immediately after the participants\u2019 completion of the program, this reflection may happen 3\u20134 years later, in their current occupation. The experience gained from the program resembles a seed planted in the heart of the participants and waiting to be nurtured for their career development and personal growth in the future. Indeed, the more senior participants provided more in-depth reflection not just on the outcomes related to personal growth but also environmental awareness and attitude.This study provides critical insight into the use of retrospective program evaluation to assess the long-term impact of EfS programs. Although this study was not a longitudinal study following the same batch of participants, its cross-sectional examination of different cohorts could serve as a serial time-point sampling approach. Compared with a cross-sectional study for a single cohort, this serial time-point sampling approach can provide more information on the outcomes of an EfS program in the long term. Certainly, the applicability of such an approach depends on whether the EE/EfS program examined was run repeatedly for cohorts. Indeed, many EfS programs are organized in a repetitive manner, which can be assessed by this approach.The hierarchical organization of the pedagogy of GBL with the sub-pedagogies implemented in the program provides a pedagogically diverse approach to nurture students. The outcomes described by the students for multiple sub-pedagogies imply that the pedagogies might operate in a collective, rather than an idiosyncratic manner. For example, the whole team of students serving in the ecogarden engaged in both collaborative and service-based learning. The students worked together to tackle all of the problems encountered during the management of the garden, gaining learning experience through problem-based, nature-based and collaborative learning. This organization of multiple sub-pedagogies may serve as a multi-pedagogical model or reference for future GBL or other place-related pedagogies.The non-formal nature of the program exerted no stress on the students. Such stress may interfere with students\u2019 motivation to learn, as indicated in the findings. The 1-year program also gave the students plenty of time to gain experience. The ample time allowed enhanced relationship building among participants, as well as between the teachers and the participants. The close relationships between the members of the whole team (including the teachers) facilitated the overall management of the ecogarden. Indeed, an interviewee commented that she would like to meet the teachers of the program again, years after she had graduated.Moreover, the training provided by the program in both the cognitive and psychomotor domains, such as knowledge and skills in farming and presentation, facilitated the students\u2019 career development, as suggested by the survey data. The benefits were particularly apparent for pre-service teachers. The alignment of learning content with what is needed for one\u2019s potential career development is another important benefit of this program.The major limitation of the current study was the relatively small sample involved in the semi-structured interviews. Nevertheless, our findings indicate a relationship between the length of time since completing the program and the number of outcomes described that relate to personal growth, which warrants further comprehensive and vigorous study. The interplay between the experience accumulated in the GBL program and the potential for metacognitive reflection should also be studied further.To conclude, the study showed that the annual co-curricular ecogarden-based program in Hong Kong HEIs adopting GBL as the overarching pedagogy with diverse sub-pedagogies could sustain the knowledge and skills learnt by the participants for up to 4 years after the completion of the program. Furthermore, the program aroused environmental awareness and nurtured a positive attitude toward sustainability. The more senior a cohort of participants was, the more in-depth and diversified reflections they had on their personal growth. This result is probably related to the participants\u2019 metacognition of the experience gained in the program during their current occupations. This study provides critical insights into the use of retrospective program evaluation to assess the long-term impact of an EfS program by introducing a cross-sectional study of different cohorts as a serial time-point sampling strategy.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.The studies involving human participants were reviewed and approved by Human Research Ethics Committee of the Education University of Hong Kong (Ref. No.: 2019-2020-0312). The patients/participants provided their written informed consent to participate in this study.C-CC, K-HT, and W-CL were the project leaders and contributed to the conception of the study. C-CC was the corresponding author. C-CC, K-HT, and W-CL designed and implemented the co-curricular program with technical and logistical assistance from W-KN. W-KN collected most of the data. W-KN and Y-SW worked with C-CC on data analysis before the writing. All of the authors contributed to the manuscript revision and read and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Uncaria rhynchophylla, which have pharmacological effects such as antihypertension, anti-infection, and heart protection. An ultrahigh-performance liquid chromatography-mass spectrometry was established for the determination of hirsutine and hirsuteine in tissues , and their absorption, distribution, and metabolism were studied for providing information on its pharmacological mechanism. UPLC BEH C18 column  was used for chromatographic separation. The mobile phase was acetonitrile-0.1% formic acid, with a gradient elution, and the total run time was 4\u2009min. Electrospray was used in the positive ion mode, and the multiple reaction monitoring (MRM) mode was for quantification. The acetonitrile precipitation method was used to remove protein-treated mouse plasma and tissue homogenate samples. In the concentration range of 2\u20135000\u2009ng/g, hirsutine and hirsuteine in tissues showed good linearity (r\u2009>\u20090.995), and the lower limit of quantification was 2\u2009ng/g. In the plasma and liver tissues, the interday and intraday precision of hirsutine and hirsuteine was less than 15%, the accuracy was between 90.9% and 110.1%, and the average recovery was better than 73.0%. The matrix effect was between 86.2% and 104.7%. The results showed that the precision, accuracy, recovery, and matrix effects meet the requirements for the study on the distribution of hirsutine and hirsuteine. After intraperitoneal administration of 10\u2009mg/kg hirsutine and hirsuteine in mice, the distribution levels were highest in liver and kidney tissues, followed by the spleen and lung. Hirsutine and hirsuteine were low in brain tissue, but had obvious distribution, suggesting that they may pass through the blood-brain barrier.Hirsutine and hirsuteine were two alkaloid monomers extracted from the traditional Chinese medicine  Uncaria rhynchophylla\uff08Miq.\uff09Miq. ex Havil. is a commonly used Chinese medicine and belongs to the Uncaria Schreber nom. cons. [Uncaria rhynchophylla has an antagonistic effect on Ca2+, which can block external Ca2+ influx and release of internal Ca2+ [Uncaria rhynchophylla are the main active ingredients.m. cons. \u20133. Pharmnal Ca2+ . It has nal Ca2+ \u20137. It canal Ca2+ \u201312. The The distribution of drugs in the body is closely related to the pharmacological effects of drugs, and their distribution determines the strength and duration of the effect \u201315. It iTissue distribution is an indispensable part of pharmacokinetic research, and it can clarify the change trend of tissue drug concentration with time of administration, and then evaluate the targeting and tissue accumulation of the drug in the body, and judge the safety and effectiveness of the drug \u201318. In tHirsutine and hirsuteine (purity >98%) and diazepam  were purchased from Chengdu Munster Pharmaceutical Co., Ltd . Chromatographically pure acetonitrile, methanol, and formic acid were purchased from Tedia . Ultrapure water was prepared by a Millipore purification system . ICR mice  were provided by the Animal Experiment Center of Wenzhou Medical University.ACQUITY H-Class UPLC and XEVO TQS-micro Triple Quadrupole Mass Spectrometer . Masslynx 4.1 software (Waters Corp.) was used for data acquisition and instrument control.\u03bcm), and the column temperature was 40\u00b0C. The mobile phase consisted of 0.1% formic acid-acetonitrile, and the flow rate was 0.4\u2009mL/min. The gradient elution procedure was: 0\u20130.2\u2009min, acetonitrile 10%; 0.2\u20131.5\u2009min, acetonitrile 10%\u201380%; 1.5\u20132.0\u2009min, acetonitrile 80%; 2.0\u20132.5\u2009min, acetonitrile 80%\u201310%; and 2.5\u20134.0\u2009min, 10% acetonitrile.The chromatographic column was Waters UPLC BEH C18  m/z 285.1\u27f6193.3.The mass spectrometry parameters were set to a capillary voltage of 2.5\u2009kV, a source temperature of 150\u00b0C, a desolvation temperature of 500\u00b0C, and nitrogen as the desolvation gas (900\u2009L/h) and cone gas (50\u2009L/h). The MRM mode was used to quantitatively analyze hirsutine m/Hirsutine and hirsuteine were accurately weighed into 10\u2009mL volumetric flasks, and hirsutine and hirsuteine (1.0\u2009mg/mL) stock solution was prepared with methanol-water (50\u2009:\u200950). Diazepam was accurately weighed into a 10\u2009mL volumetric flask, and a diazepam (1.0\u2009mg/mL) stock solution was prepared with methanol-water (50\u2009:\u200950). The stock solution was diluted with methanol to a working solution of various concentrations, stored in a refrigerator at 4\u00b0 C, and kept at room temperature during use.\u03bcL of internal standard (50\u2009ng/mL) acetonitrile was added. After vortexing for 1.0\u2009min, it is placed in a low-temperature high-speed centrifuge  for 10\u2009min. Then, 150\u2009\u03bcL of the supernatant is taken and placed it in a cannula into a sample bottle, and 2\u2009\u03bcL is taken for injection for UPLC-MS/MS detection.Tissue samples are taken out of the refrigerator and thawed. The tissue is ground and then weighed (50\u2009mg). The weighed tissue was placed in a 1.5\u2009mL centrifuge tube, and 200\u2009Proper amount of hirsutine and hirsuteine working solution is added to blank tissue  to prepare hirsutine and hirsuteine standard curve. The concentration is in the range of 2\u20135000\u2009ng/g, and the concentrations are 2, 5, 20, 100, 200, 500, 1000, 2000, and 5000\u2009ng/g. In the same way as the standard curve, quality control samples (QC) were prepared at three concentrations .For the analysis of blank tissue and blank tissue spiked with hirsutine, hirsuteine, and internal standard, tissue samples were administered intraperitoneally at 10\u2009mg/kg in mice to evaluate the selectivity of the method.Standard working solutions were prepared into different standard series with standard concentrations ranging from 2 to 5000\u2009ng/g. Under the same conditions as the tissue samples to be measured, the peak area of each peak is measured, and the ratio of the peak area to the internal standard peak area is used to draw a standard curve for the sample concentration.Precision and accuracy were assessed by measuring tissue samples of these three QC sample concentration levels  in 6 replicates. Intra- and interday precision is determined by measuring QC samples at three concentration levels for three consecutive days. The intraday and interday accuracy were determined by measuring the consistency of the average value of the QC samples at three concentration levels with the true value for three consecutive days.The recovery was evaluated by comparing the measured peak areas of low, medium, and high concentration QC samples with the corresponding standard peak areas. The peak areas obtained by preparing blank plasma or tissue after sample processing and adding standard solutions to prepare low, medium, and high concentrations  were compared with the corresponding standard peak areas by using acetonitrile-0.1% formic acid  to assess matrix effects.The mouse QC samples were analyzed at low, medium, and high concentrations  by placing them in three storage conditions to investigate trichostine and dehydropilus in mouse plasma or tissue, respectively. Stability in injection vials, short-term stability (2 hours at room temperature), long-term stability , freeze-thaw stability (\u221220\u00b0C to room temperature), and 3 concentrations of freshly prepared  standard samples were compared for peak area to investigate stability.Thirty mice were injected intraperitoneally with 10\u2009mg/kg hirsutine and hirsuteine, and then at 0.25, 0.5, 2, 4, 6, and 12\u2009h, with 4% chloride, 5 mice were sacrificed after being subjected to aldehyde anesthesia, and tissue samples were collected . After collection, the surface was washed with ice-cold saline and dried with filter paper. Tissue samples were then stored at \u221220\u00b0C.z 369.2\u27f6226.0 for hirsutine, and m/z 367\u27f6169.9 for hirsuteine.Electrospray ESI positive and negative electrode selection was often evaluated in methodological studies . In this\u03bcm) can obtain satisfactory peak time and peak shape. We also tried different mobile phases, such as acetonitrile-water, methanol-water, acetonitrile-0.1% formic acid, and methanol-0.1% formic acid, and found that the peak shape and sensitivity of acetonitrile-0.1% formic acid were the best. Therefore, a BEH C18  column was used in this work, and acetonitrile-0.1% formic acid was used.HPLC conditions were as far as possible from separating endogenous interfering substances from analyte and internal standard, and the chromatographic behavior of the column and mobile phase plays a decisive role \u201322. BEH \u03bcL acetonitrile precipitation. As a result, it was found that the direct protein precipitation method can obtain acceptable extraction recovery and matrix effect.Prior to UPLC-MS/MS analysis, removal of proteins and potential interference was a key point in method development \u201325. In oIn the concentration range of 2\u20135000\u2009ng/g, the peak area ratio and concentration linearly regress. The linear equations of various tissues are shown in The data in Mouse tissue samples were tested at room temperature for 2 hours, at \u221220\u00b0C for 30 days, and freeze-thaw stability tests were also conducted. The results showed that the variation of hirsutine and hirsuteine was within \u00b115%, and RSD was within 15%, indicating that they were stable.After intraperitoneal injection of 10\u2009mg/kg hirsutine and hirsuteine to mice, the mean time distribution curve of tissues are shown in \u03bcL plasma, and needed 4\u2009min for one sample [\u03bcL plasma [\u03bcL plasma or brain [Although some literature studies have reported the pharmacokinetics of hirsutine or hirsuteine in rats \u201329, no le sample . Wu et aL plasma . KushidaIt was rapidly distributed in various tissues and organs through blood circulation, and the highest level was distributed in liver and kidney tissues, followed by spleen and lung. This phenomenon indicates that it was widely distributed in mice, which may be related to the higher lipid solubility of hirsutine and hirsuteine. With the extension of the administration time, the drug concentrations of hirsutine and hirsuteine in each tissue decreased rapidly, and the concentration of each tissue was already low at 6\u2009h. The highest concentration is in liver and kidney tissues. Metabolism of hirsutine and hirsuteine mainly occurs in liver tissues, which were excreted in renal tissues, and may be related to large blood flow and good circulation in liver and kidney tissues. Hirsutine and hirsuteine are low in brain tissue but have obvious distribution, suggesting that the drug may pass through the blood-brain barrier.We established a method based on UPLC-MS/MS for the detection of hirsutine and hirsuteine in tissues, with a linear range of 2\u20135000\u2009ng/g. The UPLC-MS/MS was simple and sensitive, and 50\u2009mg of tissue was required. After mice were injected intraperitoneally with 10\u2009mg/kg hirsutine and hirsuteine, the distribution levels were highest in liver and kidney tissues, followed by spleen and lung. The results of this study also help to better understand the pharmacological mechanisms of hirsutine and hirsuteine."}
{"text": "Irritable bowel syndrome (IBS) is a common chronic medical condition, in both children and adults. Despite the availability of effective (non)pharmacological treatments, symptoms persist in a significant amount of patients with IBS. Faecal microbiota transplantation (FMT) may be an effective alternative treatment in adolescents with refractory IBS through manipulation of the intestinal microbiota.This randomised, placebo-controlled single-centre pilot study will assess feasibility and efficacy of FMT in 30 adolescents (16\u201321 years) with refractory IBS. Patients will be randomly allocated (1:1) to receive two allogeneic  or two autologous (own) faecal infusions at baseline and after 6 weeks. Primary outcomes will assess feasibility, including patient and donor recruitment, adherence and incidence rates of adverse events. To evaluate clinical efficacy, secondary outcomes will include the proportion of patients with at least >50% reduction of their abdominal pain intensity and frequency 12 weeks after the first FMT, and after 6-month and 12-month follow-up. Other outcomes comprise changes in faecal gut microbiota composition, quality of life, depression and anxiety, school or work absenteeism and adequate relief, measured directly after FMTs and after 6 and 12 months of follow-up.This randomised controlled trial will investigate the feasibility and effectiveness of repetitive FMTs in adolescents with refractory IBS.The study is approved by the Medical Research Ethics Committees AMC (MEC-AMC) in the Netherlands.NCT03074227. It is suggested that irritable bowel syndrome (IBS) symptoms are generated through an effect of the microbiome on the intestinal barrier, enteroendocrine system, the immune system and the gut\u2013brain axis.Faecal microbiota transplantation (FMT), administered via a nasoduodenal tube, is a new treatment regimen which modifies the gut microbiome through replacement of the patient microbiome by that of a healthy donor.This randomised controlled trial will investigate the feasibility and effectiveness of repetitive FMTs in adolescents with refractory IBS.This study will enable us to analyse in detail which microbiota components might predict a positive response to FMT.Irritable bowel syndrome (IBS) according to the Rome IV criteria  is a com9 10Box 1Abdominal pain at least 4 days per month associated with one or more of the following:Related to defecationA change in frequency of stoolA change in form (appearance) of stoolIn children with constipation, the pain does not resolve with resolution of the constipation .After appropriate evaluation, the symptoms cannot be fully explained by another medical condition.*Criteria fulfilled for at least 2 months before diagnosis.Clostridium difficile infectionStandard medical care for IBS consists of education, reassurance and simple dietary and behavioural advices.The Faecal Administration in refractory Irritable bowel Syndrome trial is a double-blind, randomised, placebo-controlled single-centre pilot study. We aim to enrol 30 adolescents aged between 16 and 21 years, with refractory IBS . After rBox 2IBS according to the Rome IV criteria.Symptoms are present for \u226512 months.Patients received adequate explanation, reassurance and dietary advice for their symptoms.There is an absence of response to a minimum of six sessions of psychological treatment, like hypnotherapy or cognitive\u2013behavioural therapy.There is an absence of response to an adequate dose of at least one pharmacological agent tried for a minimum of 6\u2009weeks.There was no involvement of patients or the public in the design of this RCT.Patients from the outpatient clinic of the Amsterdam University Medical Centre (AUMC) will be recruited by their treating gastroenterologist. Furthermore, patients from other hospitals can be referred to the AUMC for participation in this study. In addition, patients will be recruited throughout the Netherlands with help of online advertisement through IBS patient associations. Patient enrolment began in September 2018.Healthy faecal donors will be recruited through advertisement in the form of posters, intranet network and emails, and via word by mouth.Eligible patients will be invited for a screening visit. Informed consent from the participants will be obtained by the clinical research coordinator. During the screening visit, adolescents will undergo routine laboratory testing to exclude underlying organic disorders . FurtherPotential donors will be thoroughly screened according to the screenings protocol of the Netherlands Donor Faeces Bank.Age 16\u201321 years.Non-smokers.Ability to give informed consent.IBS diagnosis .Refractory symptoms .Average daily pain rate \u226530\u2009mm on the pain component scale of the Irritable Bowel Syndrome Severity Scoring System (IBS-SSS).33Exclusion criteria are presented in 10.1136/bmjpo-2020-000689.supp1Supplementary dataAge\u226516 years.Non-smokers.Ability to give informed consent.2.Body mass index 18\u201325\u2009kg/mRegular morning stool pattern.Exclusion criteria are presented in Randomisation will be done by a computerised random-number generator in the Electronic Data Capture system Castor EDC in a 1:1 ratio to one of the following two treatment arms:Allogeneic faecal infusions at t=0 weeks and t=6 weeks.Autologous faecal infusions at t=0 weeks and t=6 weeks.Randomly permuted blocks of size 2 and 4 will be used with no stratification. On the day of faecal transplantation, both patient and donors will deliver faeces produced that morning. Randomisation will be performed by one of the \u2018randomisation assistants\u2019, who is designated to this task. To guarantee blinding, the randomisation assistant will make sure the randomised treatment is not traceable to the donor or the patient. The blinded faeces will be brought to the laboratory, where the preparation of the faeces will be done by one of the investigators. Detailed information about the preparation process is outlined under \u2018FMT procedure\u2019. During the second FMT at 6 weeks, faeces will be processed according to the randomisation performed on the first transplantation day. The randomisation assistant is the only person who will know which treatment the patient will be given and will have no role in further parts of the study. The randomisation list will be kept under secured access by Castor EDC. In case of an emergency, the study treatment can be unblinded after consultation of the principal investigator.At baseline and at 6 weeks, patient and donor will collect a fresh morning stool sample in a small container and bring this to the AUMC for processing. On arrival of the patient in the hospital, a nasoduodenal tube will be positioned under direct imaging, with the Cortrak electromagnetic sensing device.On the day of infusion, a fresh faeces sample (100\u2013200\u2009g on average) of either the donor  or patient (autologous) will be used. In case a patient is not able to provide a fresh morning faeces sample, the first faecal production after the start of bowel lavage with Klean-Prep is used as suitable faecal sample for further processing. Time of collection will be recorded. The faeces will be weighted and mixed with 200\u2013400\u2009mL saline (0.9% NaCl) until fully homogenised. Next, the faeces solution is poured through a double gauze and debris of large size will be removed. This step will be repeated. Afterwards, the homogenised solution will be decanted through a metal funnel into a 200 ml sterile plastic bottle. All steps are performed under a fume hood by one of the coinvestigators. Within 6\u2009hours after production by the donor, the faeces will be installed through the nasoduodenal tube in the patient.All below-mentioned outcome measures apply to patients.The primary objective of this RCT is to assess the feasibility of our study protocol. This will be assessed by evaluating the process of patient recruitment and screening, the patient drop-out rate and the incidence rates of adverse events (AEs). Secondary objectives include the proportion of patients with >50% reduction of their abdominal pain intensity and pain frequency compared with baseline at t=12 weeks after the first FMT. This will be assessed with the pain component of the IBS-SSS.Since this is a pilot study, a reliable sample size calculation is not feasible. In accordance with recruitment recommendations,All data will be analysed according to the intention-to-treat principle. Feasibility outcome measures will be presented as proportions at each time point throughout the trial. To assess the efficacy outcomes group differences will be calculated by a mean difference with a 95%\u2009CI, using an independent t-test for continuous variables with a parametric distribution or Mann-Whitney U test for continuous variables with a non-parametric distribution. Group differences for categorical variables will be calculated using Fisher\u2019s exact statistics. In addition, data of continues variables will be analysed using mixed models to account for correlations of measurements within the same individual on several time points. Due to the small sample size, baseline values will not be incorporated in these analyses. Significance is set at \u03b1=0.05 in all analyses.Microbiota composition of the faecal samples will be measured by 16S rRNA sequencing and specific genera/species are screened by qPCR. Alfa and beta diversity of faecal samples will be calculated. Cluster analysis and similarity of the microbiota profiles, expressed as Pearson correlation, will be assessed and compared between patients with IBS and healthy donors, between treatment groups and between responders and non-responders. In addition, short-chain fatty acids composition of the faecal samples will be measured.In order to optimise safety of the study during inclusion, patient data will be disclosed to a data safety monitoring board (DSMB) when 50% of the intended sample size is attained and has reached 12 weeks follow-up. The advice(s) of the DSMB will be notified on receipt by the sponsor to the METC  that approved the protocol. With this notification, a statement will be included indicating whether the advice will be followed.The risks associated with participation in this RCT can be considered moderate, because of the minimal invasive treatment. Nasoduodenal tube positioning through a Cortrak electromagnetic sensing device carries a little risk of complications like aspiration, perforation or malpositioning. If there is any doubt of malposition of the tube, a plain abdominal X-ray will be performed. To prevent complications, patients with swallowing disorders will not be included in this study.Recent meta-analyses on clinical outcomes of FMT in general concluded that no serious AEs were attributable to FMT.On 23 November 2017, the first study participant (in particular donor) was included in the trial. Until today, 58 potential donors were recruited of which 39 were included and started the screening procedure. Finally, a total of five donors were eligible to donate faeces. The first patient signed informed consent in August 2018. At time of writing, 15 adolescents were recruited and a total of 19 faecal transplantations have been performed.IBS is a chronic and disabling condition, which can pose great impact on daily life of patients, reflected in decreased quality of life,23Up to now, six RCTs have been performed to assess the effect of FMT in IBS in adults. Two trials assessed the effect of FMT administered by capsules, two evaluated the effect of FMT delivered by colonoscopy, one via gastroscope and one by nasojejunal tube.30The present pilot study assesses the feasibility of FMT in adolescents with refractory IBS according to the Rome IV criteria. Furthermore, the efficacy of FMT on abdominal pain symptoms in these patients is explored. By designing this specific treatment protocol, a unique opportunity is created to investigate potential beneficial effects of restoring the gut microbiota composition on abdominal pain problems. Data of this study will help determine optimal study conditions and inform the choice of endpoints for future, larger size, double-blind RCTs on FMT in adolescents with IBS. Furthermore, this study will define preliminary efficacy results of the use of FMT in these patients. In addition, this study will enable us to analyse in detail which microbiota components might predict a positive response to FMT.Our study has several strengths. First, the FMT will be administered via a nasoduodenal tube and it will be performed twice, since it has been demonstrated that this might enhance the effect of the FMT.A limitation of our study is the small sample size, which allows us to only encounter major effects of the FMT treatment. Furthermore, we decided to include patients with IBS regardless of subtype, leading to a heterogeneous patient population which may affect the efficacy results. Moreover, it is unclear what the effect of bowel lavage is on the efficacy of FMT and on microbiome composition. Studies with and without bowel preparations before FMT demonstrate great efficacy.In conclusion, the results of this trial will provide preliminary evidence for the use of FMT in adolescents with refractory IBS. The results will inform future larger, double-blind, placebo-controlled trials on the right sample size, on the feasibility of this study design, on efficacy outcome measures and on the potential of the microbiome to be a therapeutic target in IBS."}
{"text": "Rotating hinge knee prostheses are typically used in revision and severe primary total knee arthroplasty (TKA). For these challenging patient groups, currently only few studies with mid- or even long-term follow-up and adequate patient numbers are available. In addition, a more specific definition is needed of the indications for a rotating hinge prothesis in primary patients beyond the use in bone defects.  In this prospective study, 170 primary and 62 revision TKA patients were included who received a rotating hinge knee prosthesis at the study centre between the years 2009 and 2014. Of these, 98 primary and 22 revision TKA patients were available for 5-year functional and clinical follow-up examinations. Prosthesis survival in both patient groups could be compared up to a 9-year follow-up.  Postoperatively, functional results including range of motion (ROM) and clinical scores like the Oxford Knee Score (OKS) and subscales of the Knee Society Score (KSS) improved better in patients treated for primary knee arthroplasty than for revision patients. Besides the patient group (primary vs. revision TKA), no overall influencing factors  regarding functional results could be identified in a multiple linear regression analysis. The revision rate of primary patients was significantly lower than in the revision patients, with an 8-year Kaplan-Meier prosthesis survival of 88% in the Primary and 60% in the Revision group.  The prosthesis provides promising results in severe primary and revision knee arthroplasty. In addition to commonly agreed recommendations regarding the use of rotating hinge knee prostheses for primary surgery, six specific indications are proposed and discussed here as a base for scientific debate. Total knee arthroplasty (TKA) is a frequently performed surgery with an increasing number of interventions , 2. The In the beginning, hinged knee prostheses were only designated for severe revision cases and salvage therapy. Today, the deployment of a rotating hinge prosthesis also in primary TKA is a matter of debate amongst the orthopaedic society , 11. ConIn this publication, functional and survival results of the EnduRo rotating hinge prosthesis are presented from a prospective patient cohort. The hypothesis was that EnduRo obtains reliable results in primary and revision TKA patients. Short-term results of a part of this patient cohort and a second study centre were already published by Giurea et al. , when a This study was a prospective single centre study, performed according to the Declaration of Helsinki. Eligibility criteria were limited to patients in the clinic of the principal investigator treated with the EnduRo rotating hinge prosthesis for primary or revision TKA for all indications except bone tumours. Between March 2009 and February 2014, 290 patients were treated with the prosthesis in the clinic of the principal investigator; thereof 232 patients could be included into the study. Patients were contacted annually for follow-up examinations . At time of the 5-year follow-up, the number of patients discontinuing the study due to withdrawal, revision, loss to follow-up, death, and other reasons was 72 patients in the Primary group and 40 patients in the Revision group see . At studThe modular rotating hinge prosthesis system EnduRo  was used in all patients. The hinge mechanism is not primary weight bearing as force is transmitted from the femoral component to the tibial component via the polyethylene insert with high contact area. An offset option and wedges for the tibial and femoral components are available to cover specific anatomical characteristics. As a unique feature, EnduRo contains flanges and bushings that are made of carbon-fibre reinforced poly-ether-ether-ketone (CFR-PEEK) .All surgeries were performed by four orthopaedic expert surgeons; the majority (91 of 120 patients) was performed by the principal investigator (Hans-Joachim Neuhaus). Surgeries were performed according to the procedure described by Giurea et al., and the method description partly reproduces their wording . BrieflyIn addition to the documentation of baseline demographic data, medical history, and perioperative assessment, a yearly follow-up of the patients was carried out, which is at time of this report still ongoing until a planned physical follow-up examination after 10 years.Physical examinations were performed at the time points 1, 2, and 5 years in the outpatient department of the principal investigator's clinic. All other yearly follow-up time points were conducted by telephone interview only. The 5 year follow-up was completed in 2019. Primary outcomes obtained during follow-up were functional and clinical results. These were assessed using the knee (kKSS) and functional (fKSS) KSS subscales , the OKSThe revision rate was defined as secondary outcome variable. Complications resulting in revisions were categorized into 3 types according to Giurea et al. and B\u00f6hler et al. , 17. TypSurvival data  were collected to the best of our knowledge, also in case of deceased patients or patients who were not able or not willing to participate in the yearly phone interviews. All survival-related data until database lock in 2019 were included into revision analysis and Kaplan-Meier calculation. Ethical approval was received from the regional institutional review board, and all patients provided written informed consent.t-tests were used for comparison of continuous outcomes between groups; differences were considered significant at p values below 0.05. As all analyses were explorative, this level does not apply in a confirmative sense, and no multiplicity adjustments were made.Statistical analysis was performed using the SAS software version 9.4 . Patients with completed 5-year follow-up were included in the analysis of functional and clinical outcome. p = 0.05. All survival-related data which were available until the time of completion of the 5-year follow-up were included for calculation of survival rates.Kaplan-Meier method was used for analysis of the prosthesis survival rate; point-wise 95% confidence intervals were calculated according to Agresti and Coull . PatientMultiple linear regression repeated measure models with prespecified set of impacting variables were used to analyse the risks for continuous outcomes. The variable set consisted of age, gender, BMI, baseline score, visit ID, and patient group (primary vs. revision TKA).Of the 170 primary and 62 revision TKA patients which were prospectively included in the study, 98 primary and 22 revision TKA patients were still available for the 5-year follow-up examinations. For the analysis of survival rates, additionally data from the yearly telephone follow-up time points of up to 9 years were used.Patient characteristics of both groups are provided in The main indication in the Revision group  was instThe performance of the prosthesis was assessed using ROM, functional, and clinical scores. Results of the Primary and Revision groups in terms of ROM, OKS, fKSS, and kKSS are provided in p \u2264 0.05) at all time points. Conclusively, compared to the preoperative state, the implantation of EnduRo achieved an improvement of ROM, OKS, kKSS, and fKSS values, with better results in the Primary than in the Revision group.No statistically significant difference was present between Primary and Revision groups for preoperative ROM, OKS, and kKSS, whereas preoperative fKSS was significantly lower in the Revision group compared to the Primary group. Postoperatively, ROM was significantly higher in the Primary group only 1 year postoperatively, whereas all other scores were significantly higher in the Primary group in comparison to the Revision group  was performed see . In addiRevision was defined as exchange of one or more prosthesis components, excluding patella resurfacing due to secondary retropatellar arthrosis and prophylactic exchange of polyethylene components. At database lock in 2019, which corresponds to a mean follow-up of 57.1 and 43.7 months of the Primary and Revision group, 15 primary patients  and 13 revision patients (20%) had to be revised see .Complications resulting in revision were categorized into type 1, infection; type 2, periprosthetic complications ; and type 3, implant complications .The most frequent reason for revision in the Primary group was infection (7 patients) and patella-related problems (4 patients). Type 3 complications in the Primary group included aseptic loosening and instability (1 patient each).In the Revision group, six patients were revised due to infection, six patients were revised due to aseptic loosening, and one patient was revised due to poor function.p = 0.0004).Kaplan-Meier analysis was performed to assess survival of the prosthesis in the Primary and Revision group. Survival probabilities after 1 year in the Primary and Revision group were 93% and 91%, respectively see . Values The most important finding of the current study is that the EnduRo rotating hinge system achieves good results in primary and revision TKA. Comparison between the Primary and Revision group showed better postoperative functional results and survival rates in the Primary group.B\u00f6hler et al.  presenteOchs et al. presented the results of primary and revision TKA with EnduRo, which was implanted using a navigation system . In thisFurther studies directly comparing the functional results of rotating hinge prostheses in primary and revision TKA are rare and based on small patient cohorts. Efe et al. found no significant differences of kKSS, fKSS, and ROM in primary and revision TKA treated with Endo-Modell . However, there were clearly more complications and a lower survival rate in the Revision group . In anotIn the current study, the revision rate of the Revision group was about twice as much as that of the Primary group. In the Primary group, the most prevalent type of complications was infection, followed type 2: periprosthetic complications, especially patella problems. Type 1 and type 2 complications are not directly associated with the prosthesis itself but rather with the surgical technique and tissue quality , 17.Revision was necessary in 9.7% of the Primary group patients and 20% of the Revision group patients after 9 years. Failure probability of hinged knee prostheses in the EPRD after 4 years is just below 7%, whereas for standard nonconstrained TKA it is about 3.5% . The AusIn the study by Efe et al. with a mean follow-up of 56 months of 21 primary TKA and 28 revision TKA cases with rotating hinge prothesis Endo-Modell , (re-)revision rates of 5% in primary and 24% in revision TKA were reported . LikewisIn the current study, the major reasons for revision in the Primary group were infection and patella problems, whereas re-revision in the Revision group was mostly necessary due to infection and aseptic loosening. In the EPRD, aseptic loosening and infection are the most prevalent causes for revision of primary TKA with 24% and 14.5% . LikewisAnother important point regarding the learning curve concerns the preoperative planning of the tibia and femur stems. During this critical step, it has to be assessed whether the scheduled stem fits the intramedullary canal. Especially in older patients, the bone may be deformed, resulting in a curved intramedullary canal. In these cases, a too long stem would make excessive contact with the cortical bone, inducing high levels of stress and bone remodelling, which can eventually cause aseptic loosening. If preoperative planning shows that a cementless stem cannot be implanted without too much contact with the cortical bone, a short cemented stem is chosen. This stem is implanted eccentric in a large diameter hole, which is filled with bone cement to prevent cortical bone overstressing.In the study patients, no case of loosening due to shearing forces on the prosthesis was observed. This may be attributed to our surgical technique regarding the collateral ligaments: We do not trim the collateral ligaments but rather peel them from the femoral epicondyle before implanting the prosthesis. Afterwards, the collateral ligaments place back into position on the epicondyles and grow onto them (which we see in patients where early reoperations were required). Our hypothesis is that the ongrown collateral ligaments partially gain back function and therefore reduce shearing forces on the prosthesis. This technique and the potential partial recovery of function of the collateral ligaments may contribute to the improvement of functional results up to the two-year follow-up.This study has some limitations. First, there was a high number of patients who dropped out of the study, and some of the patients did not participate in all follow-up examinations. However, the number of included patients was sufficient for statistical analysis. If possible, the implantation status of patients who were not able or not willing to participate and of deceased patients was documented for the calculation of survival. However, the number of revisions may still be underestimated. Second, the period in which the index surgeries were performed is rather long. Therefore, the effects of a learning curve are included in this study. Third, the reasons for revision surgery are very specific and may have an influence on the results in the Revision group. However, from a statistical perspective, it was not reasonable to study this influence. Fourth, the study was performed with a specific rotating hinge prosthesis brand, and the transferability of the results to other rotating hinge knee systems in general has to be proven.Although the EnduRo prosthesis is intended for revision surgery or primary TKA with bone defects, in our clinic, it is frequently used also for primary TKA with specific indications. These include excessive varus (\u226520\u00b0) and valgus (\u226515\u00b0) deformities and ligamentous instability, especially instability of the medial collateral ligament, which is in line with current publications , 30.Insufficient Posterior Cruciate Ligament. During preparation of the tibia for a cruciate-retaining prosthesis, there is a distinct risk of injuring the root of the ligament, especially with increasing tibial slope [al slope Severe Extension or Flexion Deficit (\u226520\u00b0). Extension deficits may be induced by fibrotic changes of the dorsal capsule [ capsule . In suchKnees Designated for Unconstrained TKA, Which Cannot Be Balanced Intraoperatively by Navigation Technology. Intraoperative switch to a rotating hinge prosthesis is performed to achieve a well-stabilized postoperative resultRheumatic Patients. Bone and soft tissue quality is often compromised, and ligaments are frequently insufficient, so that stability can only be achieved via constrained prostheses on the long termPatients with Neurologic Disorders, Especially Spasticity. The need for TKA often derives from an inability to stabilize the joint; therefore, more constrained prostheses shall be used from our point of view to obtain sufficient stability, especially on the long termObese Patients. It was shown that in flexion extreme forces are transmitted to the distal femoral bone, which may result in loosening at the bone-implant interface [nterface , 34. A rFurther specific indications are proposed from the point of view of the first author and presented below:We aim to highlight our specific views as a base for scientific debate. It has to be considered that rotating hinge TKA has higher complication and lower survival rates in comparison to unconstrained TKA. Furthermore, revision of a rotating hinge prosthesis is more challenging than revision of unconstrained TKA. Therefore, the benefits and potential disadvantages of such a treatment have to be weighed carefully for each patient, and preoperative planning has to be accomplished accurately. In all cases, the least invasive option of the rotating hinge prosthesis system is chosen, with short stems and cementless fixation with rather gliding-fit than press-fit anchorage.To the best of our knowledge, the current study includes the largest patient cohort at a 5-year follow-up for the direct comparison of rotating hinge prostheses for primary and revision TKA regarding functional results. In addition, survival data are presented with a maximum follow-up of nine years. Therefore, this study has an impact on the scientific assessment of the controversy topic of rotating hinge knee prostheses for primary TKA.In conclusion, the rotating hinge prosthesis system provides good medium-term results in severe primary and revision TKA. Functional results significantly improved compared to the preoperative state. In primary TKA patients, significantly better functional results and survival rates were obtained than in revision patients. Specific indications for primary TKA with rotating hinge prostheses are presented and act as a base for scientific discussion."}
{"text": "The purpose of this study was to determine the mid-term clinical, radiographic and health-related quality of life (HRQoL) outcomes and define the survival rate in patients who had undergone revision total knee arthroplasty (TKA) using the single rotating hinged knee (RHK) design.Between January 2004 and December 2013, 125 revision TKAs were performed at our institution using the single RHK implant. We conducted both a retrospective analysis of prospectively collected outcome data of these patients and a prospective follow-up study of all 39 living patients (41 knees). The follow-up phase included an optional extra follow-up visit, PROM questionnaires, and plain radiographs.The ten-year Kaplan-Meier survival rate of the revision RHK knees was 81.7% (95% CI 71.9\u201391.6%) with re-revision for any reason as the endpoint. Overall, 15 knees  underwent re-revision surgery during the follow-up. The median follow-up was 6.2\u2009years  post-operatively for the baseline group. One mechanical hinge mechanism-related failure occurred without any history of trauma or infection. At the time of the final follow-up, the majority of patients evinced a fairly good clinical outcome measured with patient-reported outcome measures and none of the components were radiographically loose.We found that in patients undergoing complex revision TKA, fairly good functional outcome and quality of life can be achieved using an RHK implant. Further, it seems that in this type of patient cohort, revision TKA using an RHK implant relieves pain more than it improves ability to function. The NexGen\u00ae RHK design can be regarded as a suitable option in complex revision TKA.The online version contains supplementary material available at 10.1186/s12891-021-04205-9. In recent years, the incidence of total knee arthroplasty (TKA) has increased worldwide \u20134. Some Instability is one of the most frequent causes of knee revision and re-revision along with aseptic loosening and infections , 4, 8, 9Historically, aseptic loosening occurred more often with hinged knee implants that prohibited rotational motion. These models caused much unwanted stress at the prosthesis-bone interface or on the implant itself, leading to implant failure , 11. To In the literature, recently published rotating hinged knee implant studies are difficult to compare because of their heterogeneity , 13. IndThe purpose of this study was to determine the mid\u2013term clinical, radiographic, and health-related quality of life (HRQoL) outcomes in patients who underwent revision TKA using the single rotating hinged knee (RHK) design at our institution between January 2004 and December 2013.From January 2004 to December 2013, 125 revision TKAs were performed at our institution using the NexGen\u00ae RHK implant. The study site is an academic high-volume tertiary referral center with an annual volume of approximately 150 revision TKAs.This study comprised three phases: first, a prospective follow-up study of all the surviving patients of this cohort was conducted. Second, a retrospective analysis of the prospectively collected outcome data recorded into the electronical joint replacement database at our institution was carried out. Third, information on possible revision surgeries that might have been performed elsewhere, and thus not recorded into our own database, was cross-checked from the Finnish Arthroplasty Register.All RHK revision knee arthroplasties were performed using the medial parapatellar approach and a tourniquet was also routinely used. TKAs were carried out under spinal anesthesia in combination with intravenous sedation. General anesthesia was only used if there was a contraindication to spinal anesthesia. Immediate, full weight-bearing was allowed, and all patients were mobilized on the first postoperative day. An antithrombotic prophylaxis with low-molecular-weight heparin, enoxaparin, was administered for 4\u2009weeks postoperatively. All details of perioperative care and possible complications were recorded in the hospital\u2019s electronical database in a routine manner. In 48 knees (38%), the patella was resurfaced in the revision TKA. In 25 knees (20%), the patella had already been resurfaced in the primary TKA operation. Cemented femoral and tibial components were used in all operations, and the choice between cemented and uncemented stems was based on surgeon preference. The trabecular metal cones were used in 13 cases (10%). At the baseline of the study, 119 patients (125 knees) were included in the retrospective analysis, where all the demographics, surgery reports, first post-operative visits (at 2\u20133\u2009months), possible post-operative complications, and adverse events as well as reasons for revisions were obtained from the medical records and the hospital\u2019s electronical clinical database. Information on possible revision surgeries performed on patients elsewhere who were lost to follow-up  was cross-checked from the Finnish Arthroplasty Register [In the prospective study phase, an extra follow-up visit was scheduled between 4 and 14\u2009years post-operatively, depending on the year of the index operation. All of the 59 living and unrevised patients (61 knees) were recruited by telephone for an extra follow-up visit at our outpatient clinic  of the pre-operative radiographs was later reviewed by an experienced orthopaedic surgeon who was blinded to the original measurements.Radiographic findings, such as osteolytic defects and stability of the patella, were evaluated from the pre-operative radiographs. Pre-revision bone defects were classified according to Anderson Orthopaedic Research Institute (AORI) classification  and thesAll postoperative plain radiographs from the extra follow-up were evaluated by two senior orthopaedic surgeons (co-authors JN and AE). Radiographic evaluation was performed from standardized weight-bearing antero-posterior (AP), lateral, and skyline patellar views. Radiographs were assessed for the presence of radiolucent lines or osteolytic defects.Health-related quality of life (HRQoL) was measured using the comprehensive generic 15D instrument. The instrument combines the advantages of a profile and a preference-based single index measure. The 15D instrument includes the following 15 dimensions: mobility, vision, hearing, breathing, sleeping, eating, speech, excretion, usual activities, mental function, discomfort and symptoms, depression, distress, vitality, and sexual activity. For each dimension, the respondent chooses one of the five ordinal levels that best describe their state of health at the time . The single index score (15D score) represents the overall HRQoL on a 0\u20131 scale . The dimension level values reflect the goodness of the levels relative to no problems on the dimension (=1) and to being dead (=0). These values are then calculated from the health state descriptive system (questionnaire) by using a set of population-based preference or utility weights. Mean dimension level values are used to draw 15D profiles for groups .n\u2009=\u20094052) taken from the Health 2011 Survey carried out by the National Institute for Health and Welfare of Finland [We compared our study population\u2019s 15D results to those of an age- and gender-standardized sample of the general Finnish population . Competing risk analysis was performed with R (version 4.0.2). The study was funded by an institutional grant from Zimmer Biomet Inc. . The study was approved by the local ethical committee (R17010).The Kaplan-Meier (K-M) analysis was performed to assess the survival rate of the RHK implant. Both survival rates and 95% confidence intervals (CI) were derived from K-M models. The independent samples t-test was used to test the statistical significance of the differences in the mean 15D results between the groups. Statistical significance was set at n\u2009=\u200928/39). The median follow-up was 7.3\u2009years  at the time of the final follow-up. Demographics, revision indications, and pre-revision bone defects are summarized in Table\u00a0n\u2009=\u200954, 43.2%). Pre-revision bone defects were mostly grade 1 both on the tibial  as well as on the femoral side  according to the AORI classification.The baseline study group consisted of 86 women 91 knees) and 33 men (34 knees) with a median age of 71.7\u2009years  at the time of revision TKA. Five females and one male patient underwent bilateral revision TKA (RHK on both sides). In the final follow-up group, most of the patients were women . The median KOOS for Pain was 75 , Symptoms 73 , ADL 69 , Sport/Rec 18 , and QOL 44  at the time of final follow-up. The median FJS was 33 .OKS was good or excellent in a slight majority of patients , moderate in 6 knees, and poor in 14 knees at the time of the extra follow-up visit. The median OKS was 29 (p\u2009=\u20090.002). The mean level values of the dimensions of the patients compared to those of the age- and the gender-standardized general population are shown in Fig.\u00a0The mean 15D score of the patients was 0.806  at the time of the final follow-up. The age- and gender-standardized control population average was 0.877 . This difference is both clinically important and statistically significant (p\u2009=\u20090.098). RHK patients were, however, statistically significantly worse off than the control population on the dimensions of mobility (p\u2009<\u20090.001), usual activities (p\u2009<\u20090.001), and discomfort and symptoms (p\u2009=\u20090.008).On average, there was a trend for RHK patients to be better off than the control population on the dimension of mental function, but the difference was not statistically significant . One patient (1 knee) had a radiolucent line in the cement-bone interface next to the medial condyle of the tibia; components were stable and no osteolysis was seen. Two patients (2 knees) had mild radiolucencies around the proximal part of the femoral stem, and one of them also had distal pedestal bone formation, which is typical for uncemented stems. None of the components were radiographically loose.In total, 15 knees  underwent re-revision surgery during the follow-up  with revision for any reason as the endpoint. The ten-year\u2009K-M survival rate was 82.4% (95% CI 72.6\u201392.2%) when those revisions, in which only patellar resurfacing was performed, were excluded. Competing risk analysis for overall survival probability of arthroplasty (40.0% at 10\u2009years) and probability of re-revision (12.0% at 10\u2009years) and death (36.8% at 10\u2009years) as competing events is shown in Fig.\u00a0During the follow-up, 31 postoperative complications were recorded  of the patients described their knee pain as either non-existent or very mild. However, HRQoL was worse in these patients than in the control population as measured with the 15D instrument. The ten-year\u2009K-M survival rate was 81.7% with revision for any reason as the endpoint. Overall, 15 knees  underwent re-revision surgery during the follow-up, and the most common reason for re-revision was prosthetic joint infection . One mechanical failure of the hinge mechanism led to re-revision. None of the RHK implants were radiographically loose at the time of the final follow-up.In our study, we demonstrated a fair mid-term clinical outcome and also acceptable implant survivorship in patients undergoing complex revision arthroplasty using the NexGen\u00ae RHK implant. A slight majority of the patients reported good or excellent OKS at the time of the final follow-up. Moreover, 39%  for revision arthroplasty in five-year mid-term follow-up for different single rotating hinge knee implants [n\u2009=\u200962) after two-year follow-up [The final follow-up group reported variable OKS results. It must be noted, however, that a slight majority reported good or excellent OKS, but the total median score was 29, which can be categorized as fair . Our OKSimplants . FurtherHelito et al. investigated single rotating hinge knee implants prospectively and reported the KOOS after one-year follow-up. The study included only nine patients, however, and six of them were primary rotating hinge knee implants, and therefore it is difficult to compare them with KOOS . We are There is a paucity of reported FJS in rotating hinge knee patients. R\u00f6hner et al. studied single hinge knee implants in primary arthroplasty and reported an FJS of 39 in the mean 20-months follow-up . This isn\u2009=\u2009731) at the time of 12\u2009month follow-up [The mean 15D score of our RHK cohort was statistically significantly and clinically importantly worse than in the control population. The patients were worse off, especially on the dimensions of mobility, usual activities, and discomfort and symptoms. It is reasonable therefore to assume that these kinds of complex revision arthroplasty patients have difficulties when compared with the age- and gender-standardized general population. Further, RHK patients were better only on the dimension of mental function. However, the difference was not statistically significant and this might be attributable to selection bias. Patients with severe neurodegenerative diseases were lost to follow-up and this could have biased our HRQoL results. Miettinen et al. reported a retrospective study, in which QoL was assessed the 15D instrument before and after primary TKA, but the type of implants remained unknown. After TKA, mean 15D score was 0.870  and of all the revisions 60% (n\u2009=\u20099/15). Moreover, 32% (n\u2009=\u200910/31) of all complications were related to extensor apparatus complications. It should be noted that only two of these had a preoperative well-functioning extensor mechanism  bears comparison with the current literature. In the current study, infections were a notable part of all the complications 29% n\u2009=\u20099/3 and of aThe 10-year implant survival rate of 81.7% is comparable with the rates reported in other rotating hinge knee studies. In their meta-analysis that included 12 different studies, Yoon et al. compared the survivorships and outcomes of RHK and condylar constrained knee prostheses. The rotating hinge knee implant models were variable. The meta-analysis revealed an overall survival rate of 81.3% for all RHK implants at the mid-term (5\u201310\u2009years) follow-up .To conclude, we found the NexGen\u00ae RHK design to be a suitable option in complex revision TKA. This implant provided fairly good functional outcome and quality of life in our cohort of patients, and the mid-term implant survivorship was acceptable in this challenging patient group. Also mechanical problems in the hinge mechanism were rare. However, Nexgen RHK should only be used in complex cases, as complications are still frequent, and the results of this design are comparable, not superior, to those previously published of other rotating hinge knee designs.Additional file 1. Postoperative revision surgeries."}
{"text": "Inactivated coronaviruses, including severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) and Middle East respiratory syndrome coronavirus (MERS-CoV), as potential vaccines have been reported to result in enhanced respiratory diseases (ERDs) in murine and nonhuman primate (NHP) pneumonia models after virus challenge, which poses great safety concerns of antibody-dependent enhancement (ADE) for the rapid wide application of inactivated SARS-CoV-2 vaccines in humans, especially when the neutralizing antibody levels induced by vaccination or initial infection quickly wane to nonneutralizing or subneutralizing levels over the time. With passive transfer of diluted postvaccination polyclonal antibodies to mimic the waning antibody responses after vaccination, we found that in the absence of cellular immunity, passive infusion of subneutralizing or nonneutralizing anti-SARS-CoV-2 antibodies could still provide some level of protection against infection upon challenge, and no low-level antibody-enhanced infection was observed. The anti-SARS-CoV-2 IgG-infused group and control group showed similar, mild to moderate pulmonary immunopathology during the acute phase of virus infection, and no evidence of vaccine-related pulmonary immunopathology enhancement was found. Typical immunopathology included elevated MCP-1, IL-8 and IL-33 in bronchoalveolar lavage fluid; alveolar epithelial hyperplasia; and exfoliated cells and mucus in bronchioles. Our results corresponded with the recent observations that no pulmonary immunology was detected in preclinical studies of inactivated SARS-CoV-2 vaccines in either murine or NHP pneumonia models or in large clinical trials and further supported the safety of inactivated SARS-CoV-2 vaccines. Antibody-dependent enhancement (ADE) effect, defined as the antibodies induced by initial infection or vaccination binding to viral surface proteins and promote viral invasion of host cells, is a major concern for all vaccine developers. Inactivated coronaviruses, including severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV), as potential vaccines have been reported to result in enhanced respiratory diseases (ERDs) in murine and nonhuman primate (NHP) pneumonia models after virus challenge, which poses great safety concerns for the rapid wide application of inactivated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccines in humans ,2. No ER5 TCID50. Samples, including nasal swabs, pharyngeal swabs and blood samples, were collected daily for viral shedding and neutralizing titre analyses. Four days after SARS-CoV-2 infection, all animals were sacrificed after anesthesia. Bronchoalveolar lavage fluid (BALF) and the main tissues and organs were collected for proinflammatory mediator, viral load and histopathology analyses.Anti-serum with a neutralizing antibody geometric mean titre (GMT)\u2009>\u20091:128 was collected from rhesus macaque intramuscularly injected on days 0 and 28 with a formaldehyde and \u03b2-propiolactone double-inactivated SARS-CoV-2 vaccine developed by the Institute of Medical Biology, Chinese Academy of Medical Sciences (IMBCAMS) based on the KMS-1 strain (GenBank accession number MT226610.1) ,12. Six Although neutralization titres were detected only in 2 (No. 19256 and No. 19060) of the 4 passively immunized monkeys before virus challenge b, all ofAmong all of the inflammatory cytokines  and chemokines  tested in BALF, some monkeys in the anti-SARS-CoV-2 IgG-infused group showed relatively higher levels of MCP-1, IL-8 and IL-33 than the control group d, S1, alOne way in which SARS-CoV-2 is different from SARS and MERS is the prevalence of a large number of asymptomatic and mild infections. Studies have shown that asymptomatic and mild patients are also capable of producing neutralizing antibodies, the levels of which are positively correlated with disease severity . Recent Our study demonstrated that the antibodies purified in vitro from anti-serum of inactivated SARS-CoV-2 vaccination at subneutralizing or even nonneutralizing levels could offer protection from SARS-CoV-2 infection in vivo c. This r5 TCID50) administered in rhesus macaque pneumonia models may lead to excessive activation of the immune cascade in lung tissues, which results in pulmonary pathology. Studies of SARS immunization in animal models have yielded widely varying results in terms of protective efficacy and potential ADE, and different vaccine strategies may lead to differences in whether the vaccine enhances the disease. There is a general consensus that inducing higher titres of antibodies as well as antibodies that target the S protein more effectively can reduce the risk of ADE. It is encouraging, however, that the inactivated SARS-CoV-2 vaccine, which targets the full antigen of the virus, provides dose-dependent protection in a variety of animal models without producing evidence of enhanced immunopathological damage [On the other hand, the elimination of SARS-CoV-2 by macrophages is reported to be associated with the production of multiple antiviral and proinflammatory cytokines , which il damage . Our stuIn conclusion, our results showed that in the absence of cellular immunity, passive infusion of subneutralizing or nonneutralizing anti-SARS-CoV-2 antibodies could still provide some level of protection against infection upon challenge, and no low-level antibody-enhanced infection was observed. The anti-SARS-CoV-2 IgG-infused group and control group showed similar, mild to moderate pulmonary immunopathology during the acute phase of virus infection, and no evidence of vaccine-related pulmonary immunopathology enhancement was found. There results corresponded with the recent observations that no pulmonary immunology was detected in the preclinical studies of inactivated SARS-CoV-2 vaccines in both murine and NHP pneumonia models or in large clinical trials. Although more evidence is needed to confirm or deny the existence of ADE in SARS-CoV-2 infection and the immune damage caused by it, the available evidence has further supported the safety of the SARS-CoV-2 vaccine.Click here for additional data file.Click here for additional data file."}
{"text": "The absence of dystrophin has gave a massive impact on myotube development in Muscular Dystrophy pathogenesis. One of the conserved signaling pathways involved in skeletal muscle differentiation is the PI3K/Akt/mTOR pathway that plays a vital role in autophagy regulation. To further understand and establish targeted therapy in dystrophin-deficient myoblasts, protein expression profiling has been determined which provides information on perturbed autophagy modulation and activation.In this study, a dystrophin-deficient myoblast cell line established from the skeletal muscle of a dystrophic (mdx) mouse was used as a model. The dfd13 (dystrophin-deficient) and C2C12 (non-dystrophic) myoblasts were cultured in low mitogen conditions for 10\u00a0days to induce differentiation. The cells were subjected to total protein extraction prior to Western blotting assay technique. Protein sub-fractionation has been conducted to determine protein localization. The live-cell analysis of autophagy assay was done using a flow cytometer.In our culture system, the dfd13 myoblasts did not achieve terminal differentiation. PTEN expression was profoundly increased in dfd13 myoblasts throughout the differentiation day subsequently indicates perturbation of PI3K/Akt/mTOR regulation. In addition, rictor-mTORC2 was also found inactivated in this event. This occurrence has caused FoxO3 misregulation leads to higher activation of autophagy-related genes in dfd13 myoblasts. Autophagosome formation was increased as LC3B-I/II showed accumulation upon differentiation. However, the ratio of LC3B lipidation and autophagic flux were shown decreased which exhibited dystrophic features.Perturbation of the PTEN-PI3K/Akt pathway triggers excessive autophagosome formation and subsequently reduced autophagic flux within dystrophin-deficient myoblasts where these findings are of importance to understand Duchenne Muscular Dystrophy (DMD) patients. We believe that some manipulation within its regulatory signaling reported in this study could help restore muscle homeostasis and attenuate disease progression.Video AbstractThe online version contains supplementary material available at 10.1186/s12964-021-00785-0. DMD is romosome . The absignaling , 4. One ignaling \u20137. PTEN  muscles , 9. The  muscles .mdx mouse [Similarly, PTEN has been reported to contribute to the DMD phenotype. A study by Feron et al. (2009) on the Golden Retriever muscular dystrophy (GRMD) dog demonstrated that PTEN was present at high levels, which led to a reduction of Akt1, GSK3\u03b2 and p70S6K, also, ERK1/2 displayed decreased phosphorylation levels in GRMD dog muscle. The GRMD dog is characterized by rapidly progressive clinical dysfunction, severe muscle weakness, and displays a disease progression that is more similar to human DMD compared to the dx mouse .mdx mouse [mdx/utr\u2212/\u2212 mouse model [mdx/utr\u2212/\u2212 mice (\u03b17\u03b2X2-mdx/utr-/-) showed increased phosphorylation of Akt at Ser473, indicating that \u03b1-integrin expression is connected to Akt. The mdx/utr\u2212/\u2212 mouse lacks both dystrophin and utrophin and develops a severe pathology that closely resembles that seen in DMD [Akt plays a major role in cell signaling and its impairment leads to various defects in downstream protein signaling, including cell proliferation, differentiation, and apoptosis, autophagy, and protein synthesis perturbation. Activation of Akt is higher in the dx mouse , 11 as wdx mouse . Akt hasse model . Boppartn in DMD . That DMAutophagy is the process of engulfment of cargo into the double lipid formation known as an autophagosome, which eventually fuses with a lysosome and is degraded . Autophamdx mice [Col6a1\u2212/\u2212 animals and long-term exposure to a low-protein diet [Col6a1\u2212/\u2212 animals display impairment of basal autophagy, which determines the persistence of dysfunctional organelles in muscle fibers leading to muscle degeneration [Autophagy is defective in mdx mice  and DMD mdx mice . Restoraein diet , 15 can neration .Over a decade, many researchers have reported on impairment of Igf-1 pathway and its downstream protein regulation in muscular dystrophy. However, to further understand the impaired regulation of autophagy in dystrophin-deficient myoblast, the protein profiling of this pathway has been determined which sequentially provides information on autophagy modulation and activation. In the beginning, we reported the capacity of dystrophin-deficient myoblasts differentiation via analysis of myotube formation and the expression of specific myosin heavy chain as a terminal differentiation marker. Furthermore, we showed the elevation of PTEN perturbed PI3K/Akt/mTOR signaling thus excessively activate autophagy-related genes via FoxO3 but subsequently showed a reduction of autophagic flux in dystrophin-deficient myoblast. Overview of this event as illustrated at the end of this article.mdx mouse [The C2C12 myoblast cell line was used in this study and was established from an adult mouse myoblast C2 cell line derived from the thigh muscle of 2-month-old mice . The dfddx mouse , 22. MouProtein was extracted from cells cultured in a 10\u00a0cm dish. The medium was removed and the cells washed twice with PBS before adding approximately 300 \u00b5L of lysis buffer  containing a protease inhibitor . The cells were scraped and collected into a tube before being subjected to centrifugation at 14,000\u00a0rpm for 15\u00a0min at 4\u00a0\u00b0C. The pellet was discarded and the supernatant transferred to a new tube and stored at \u2212 20\u00a0\u00b0C.The rapid efficient and practical (REAP) protocol was used for protein sub-fractionation . All reaEqual protein loading was prepared before resuspending with 2\u2009\u00d7\u2009Laemmli sample buffer. The mixture was collected by short spin centrifugation and boiled for 5\u00a0min before loaded into SDS\u2013polyacrylamide gel electrophoresis. Lysate was separated on SDS\u2013polyacrylamide gel electrophoresis  with 200\u00a0V for 1\u00a0h. The separated protein was transferred onto the nitrocellulose membrane using the Transblot Turbo\u00ae Transfer System . The membranes were blocked in 5% reduced-fat milk for 1\u00a0h before incubate with primary antibodies. The antibodies are Fast-MyHC, \u03b1-tubulin, SSRP-1 (1:1000) and Desmin, (1:2000), from Sigma-Aldrich, UK. PTEN (1:1000) . PI3K, phospho-PI3K (Tyr458), Akt, phospho-Akt (Ser473), mTOR, phospho-mTOR (Ser2448), p70S6 Kinase, phospho-p70S6 Kinase, Rictor, phospho-rictor (Thr1135) and FoxO3a (1:1000) from Cell Signalling Technology, UK. Beclin1, Atg5, Atg7, and LC3B (1:1000) .The coverslips were acid-etched for 5\u00a0min with nitric acid. This will help myoblasts firmly attached to the coverslips before immunofluorescence. It has been sent for sterilization before myoblasts were seeded onto it. The myoblasts/myotubes were fixed using 4% PFA. After fixation cells were permeabilized with 0.25% Triton X-100 for 5\u00a0min to allow the antibody to bind specifically. The cells were then washed three times for 5\u00a0min with PBS before blocking with 5% BSA at room temperature for 30\u00a0min. The blocking solution was removed and the cells incubated with the primary antibody Fast-MyHC at 4\u00a0\u00b0C overnight. The primary antibody was removed the next day and the cells washed before probed using a secondary antibody (biotinylated) for 1\u00a0h at room temperature. After washing, the cells were incubated with streptavidin-Texas red (1:1000) at room temperature for 1\u00a0h in the dark. The cells were then counterstained with DAPI (1:100) and mounted onto slides using DakoCytomation. The slides were wrapped in aluminum foil and stored at 4\u00a0\u00b0C.5/mL myoblasts were added to every well in a 24-well plate and maintained via standard tissue culture practice. Cells were grown in a humidified incubator at 37\u00a0\u00b0C and 5% CO2; cells were not allowed to become over-crowded and the density should not exceed 1\u2009\u00d7\u2009106 /mL. In this experiment, 60\u00a0mM of chloroquine was used as a positive control, while unstained cells were utilized as a negative control. Myoblasts were treated with chloroquine for 4\u00a0h in a humidified incubator at 37\u00a0\u00b0C and 5% CO2. At the end of the treatment, cells were trypsinized and collected into a fresh 1.5\u00a0mL microtube. Cells were subjected to centrifugation for 5\u00a0min at1000 rpm at room temperature and washed by re-suspending in 1\u2009\u00d7\u2009assay buffer and the centrifugation step was repeated. Each cell pellet was then re-suspended in 250 \u00b5L of 1\u2009\u00d7\u2009assay buffer. Approximately 250 \u00b5L of the diluted CYTO-ID Green stain solution was added to all the cells except the negative control and incubated for 30\u00a0min at room temperature in the dark. The cells were collected by centrifugation, washed with 1\u2009\u00d7\u2009assay buffer, and the pelleted cells resuspended in 500 \u00b5L of 1\u2009\u00d7\u2009assay buffer. The samples were analyzed using the green (FL1) channel of a flow cytometer.An autophagy assay was performed using a CYTO-ID Autophagy Detection Kit  and 1\u2009\u00d7\u200910Experiments were performed using a FACS Analyser CyAn B  at the Institute of Biomedical Research, University of Birmingham. Samples were run using Summit V4.3 software and all data were saved in the FCS format developed by the Society of Analytical Cytology, thereby allowing further analysis using other software packages. Data were analyzed using the software FCS Express 6 Plus  for three parameters; side scatter (SS), forward scatter (FS), and Fluorescein Isothiocyanate (FITC). Gating was performed based on the size and complexity of the myoblasts as illustrated in density plots. Gated data were further analyzed to count myoblasts labeled with FITC and the results presented in a histogram format.All Western blots and flow cytometry were repeated at least three times for each experiment. Statistical analyses were carried out using the student t-test (Microsoft Excel) and one-way ANOVA. The differences were considered significant when p\u2009<\u20090.05 and p\u2009<\u20090.01.In vitro differentiation of myoblasts can be induced in culture through the use of a low mitogen medium  for a few days. In this study, both C2C12 (non-dystrophic) and dfd13 (dystrophin-deficient) myoblasts were cultured in low mitogen medium  for 10\u00a0days before determining their terminal differentiation capacity. Immunofluorescence analyses  and then normalized against total nuclei. F-MyHC, also called \u2018fast-twitch\u2019 fibers, were chosen as the terminal differentiation marker based on the existence of a spectrum of fiber types, with type II being the most developed form of myosin: type 1\u2009\u2194\u20091/2A\u2009\u2194\u20092A\u2009\u2194\u20092A/2X\u2009\u2194\u20092X\u2009\u2194\u20092X/2B\u2009\u2194\u20092B . The numImmunoblotting for F-MyHC, pan-myosin, and desmin was performed on days 4, 7, and 10 of differentiation  and day 10 (p\u2009<\u20090.01) when compared to the non-differentiated dfd13 myoblasts. There was no significant difference in total PI3K expression in C2C12 myoblasts throughout the differentiation period compared to non-differentiated myoblasts. Densitometry analysis showed that there were significant differences in total PI3K expression in dfd13 myoblasts on day 4 (p\u2009<\u20090.05), day 7 (p\u2009<\u20090.01), and day 10 when compared to differentiating C2C12 myoblasts , which is a target protein of Akt. FoxO3 is a transcription factor responsible for the activation of autophagy genes involved in the autophagy machinery. A previous study showed that FoxO3 controls autophagy in skeletal muscle in vivo and induced multiple autophagy genes, including LC3B transcription in skeletal muscle . In thisImmunoblot analyses Fig.\u00a0a showed Akt plays a role in inhibiting FoxO3 through phosphorylation at Thr24, Ser256, and Ser319, which leads to nuclear exclusion and activation. As Akt is inactivated in dfd13 myoblasts, it is thought that FoxO3 is not phosphorylated. Therefore, the non-phosphorylated FoxO3 is translocated to the nucleus and activates the gene involved in autophagy. Akt represses FoxO3 via phosphorylation resulting in nuclear exclusion. As Akt is not activated in dfd13 myoblasts, it was speculated that unphosphorylated-FoxO3 translocates into the nucleus and binds to the promoter, thus up-regulating autophagy-related genes such as LC3B, Atg5, and Atg7. Therefore, FoxO3 expression and localization needed to be examined within subcellular fractions, i.e. the nucleus and cytoplasm.FoxO3 was found to be localized more to the nucleus of dfd13 myoblasts Fig.\u00a0c, with aIt has been shown that FoxO3 is highly expressed and primarily localized to the nucleus of differentiating dfd13 myoblasts. Within the nucleus, FoxO3 acts as a transcriptional activator that can recognize and bind to DNA sequences resulting in the activation of genes involved in autophagy, such as those for Beclin1 and Atgs . It was Figure\u00a0Atg5 was found to be not/less expressed in C2C12 myoblasts (C). It can be seen that Atg5 expression was increased upon differentiation in dfd13 myoblasts, and expression was significantly increased on days 4, 7, and 10 compared to the non-differentiated stage. Densitometry analysis also showed significant differences (p\u2009<\u20090.01) for dfd13 myoblasts at every time point compared to C2C12 myoblasts Fig.\u00a0c.Densitometry analysis of Atg7 expression in dfd13 myoblasts showed its accumulation throughout the differentiation period; however, there was no significant difference in expression when compared to the non-differentiated stage in C2C12 myoblasts. Expression showed a significant increase in dfd13 myoblasts when compared to the non-differentiated stage and also significant on days 4, 7, and 10 compared to C2C12 myoblasts Fig.\u00a0d.Autophagy related genes were highly activated, and the next step was to determine whether a double-membrane vesicle, known as autophagosome, had been formed. The conversion of Light Chain-3B (LC3B-I) to LC3B-II can be considered to represent total autophagosome formation in myoblasts during differentiation.As shown in Fig.\u00a0LC3B-II levels correlate with the number of autophagosomes formed; however, this could indicate either the up-regulation of autophagosome formation or a blockage in autophagic degradation. Besides, it does not conclusively indicate autophagic degradation. Therefore, further analysis was performed to determine autophagic flux, with a lysosome inhibitor used as a positive control.To accurately determine autophagic activity, measuring the increase in the number of autophagosomes is required. Previous data showed that LC3B conversion was increased in C2C12 but reduced in dfd13 myoblasts upon differentiation; however, the results from measuring LC3B conversion alone could be inappropriately interpreted. LC3B-II itself has been reported to be degraded by autophagy and also tends to be more sensitive than LC3B-I during immunoblotting analysis . Autopha1\u2013103) (X-axis) and then the percentage obtained.Figure\u00a0Generally, both treated and non-treated myoblasts showed a reduction in autophagosome counts after 10\u00a0days of differentiation. Non-treated myoblasts had fewer autophagosomes when compared to treated myoblasts, which is due to chloroquine acting as a lysosome inhibitor, preventing autophagosome from fusing with lysosomes and causing the accumulation of autophagosomes . As illustrated in Fig.\u00a0From these results, autophagic flux can be determined. Autophagic flux can be calculated by subtracting the chloroquine-treated from the untreated myoblasts, which enables the total number of non-fused autophagosomes to be measured and also the total number of autophagosomes formed. As depicted in Fig.\u00a0Overall, autophagy activity was decreased upon differentiation in dystrophin-deficient myoblasts. Based on the flow cytometry analysis, autophagic flux was decreased, as the total number of autophagosomes detected was higher in dfd13 myoblasts (both non-differentiated and differentiated) when compared to C2C12 myoblasts. Besides, autophagy was twofold higher in non-differentiated myoblasts (proliferation state) compared to the differentiated state.In this experiment, it has been established that dystrophin-deficient myoblast differentiation is impaired when in a low mitogen medium for 10\u00a0days based on morphological analysis  inhibitor p21 and retinoblastoma protein (Rb) have been shown to play a critical role in establishing the post-mitotic state by permitting the transcription of the S-phase promoting gene during myogenesis . Most mi3 to produce PIP2. In contrast, PI3K reverses this event by phosphorylating PIP2 to become PIP3.The PI3K/Akt pathway is a highly conserved pathway for the regulation of skeletal muscle growth and is activated by the binding of Igf-1 to its receptor, Igf1-r. This binding leads to intrinsic tyrosine kinase activation, as well as auto-phosphorylation, thus activating PI3K/Akt signaling for myoblast differentiation via a series of phosphorylation events. This signaling is negatively regulated by PTEN. In this study PTEN was shown to be elevated in dfd13 myoblasts, which affected PI3K activation, as it was found to be decreased during differentiation Fig.\u00a0d, indica2 phosphorylation. PIP3 helps to recruit Akt by binding the plekstrin homolog (PH) domain at the N-terminal of Akt to the cell membrane. PTEN in turn acts as a negative regulator by dephosphorylating PIP3 to form PIP2, and thereby reduces the available docking sites for Akt to bind to before activation. PTEN is mainly found in the cytosol and nucleus. The N-terminal possesses a PIP2-binding motif while the C-terminal contains a serine/threonine phosphorylation, Ser380, which regulates its stability and activity, as well as membrane recruitment. The main C2 domain contains basic residues that are essential for membrane binding. Phosphorylation of PTEN is considered to result in a closed conformation which is the inactive form. In this conformation, it has been proposed that the phosphorylated C-terminal interacts with the positively charged C2 domain and remains in the cytoplasm [2. From this data, it seems that high PTEN expression decreased PI3K activity, thus affecting its downstream protein activation.PI3K exists as a heterodimer consisting of two subunits; regulatory and catalytic. When cells are stimulated, p85 binds to tyrosine-phosphorylated IRS, and phosphorylated-p85 changes the conformation of p110 and thus mediates the p110 subunit to translocate to the membrane and increases its enzymatic activity such as PIPytoplasm . As the Feron and colleagues (2009) reported that increased PTEN expression caused the deregulation of the PI3K/Akt pathway in dystrophin-deficient muscle present in GRMD dogs. This was also observed in muscle sections from 3- to 36-month old animals and indicates that the PI3K/Akt pathway is a long-term alteration. A more recent study by Alexander et al. (2014) proposed that overexpression of micro-RNA-486 improved muscle physiology and performance in dystrophin-deficient mice . Micro-R3. Once bound, the conformation is changed and this event unmasks two residues for phosphorylation, Ser473, and Thr308. In this study, fewer Akt-phosphorylated at Ser473 was detected in dystrophin-deficient myoblasts, indicating that Akt is inactivated/less activated. According to Sarbassov et al. (2005), PDK1 has a better target on Akt phosphorylated at Ser473 than non-phosphorylated Akt [In this study, it was found that Akt is not/less activated in dfd13 myoblasts, as phosphorylation at Ser473 or Thr308 was not detected. However, in C2C12 myoblasts Akt was phosphorylated at Ser473, and the activated form accumulated upon differentiation. Immunofluorescence analysis showed that phosphorylated-Akt (Ser473) is localized to the membrane of C2C12 myotubes but found less often in dfd13 myoblasts. During biosynthesis, nascent Akt is phosphorylated at Thr450 within the turn motif site and localized to the cytosol when in its inactive conformation. In the presence of signals via PI3K activation, Akt is recruited to the membrane through the binding of plekstrin homolog (PH) to PIPated Akt . In lineAkt is a downstream protein of PI3K. It plays an important role and is recognized as one of the most critical pathways in the regulation of cell viability and maintenance in skeletal muscle mass . Therefo, and this facilitated Thr308 phosphorylation by PDK1 in drosophila [Since Akt was found to only be phosphorylated at Ser473 the protein responsible for this phosphorylation event was investigated. It is known that mTORC2, specifically, rictor, can directly phosphorylate Akt at Ser473 in vitroosophila . In thisosophila , HEK293 osophila . Recentlosophila . As PTENIn skeletal muscle, autophagy is transiently activated and continues for only a few days , 50; it In this study, it can be seen that autophagosome formation is modulated via FoxO3 in dfd13 myoblasts. Inactivation of Akt allowed the active-form of FoxO3 (unphosphorylated) to translocate into the nucleus and trigger the expression of autophagy-related genes. FoxO3 is required for the transcriptional regulation of LC3B and also for transcriptional regulation of MAFbx and MuRF1. This transcriptional regulation leads to protein degradation via the autophagy-lysosome pathway and the ubiquitin-proteosome pathway, respectively. However, autophagy in C2C12 myoblasts seems to be only partially FoxO3-mediated, as subsequent activation of Akt inhibited FoxO3 and suppressed its translocation to the nucleus and the targeting of autophagy-related gene activation. Activated-Akt, through phosphorylation at Ser473 by rictor-mTORC2, also contributes to autophagy activation during C2C12 myoblast differentiation , 51.Autophagy is responsible for removing unfolded proteins as well as dysfunctioning organelles and has been reported to be constantly active within skeletal muscle. Recently, increased autophagy has been reported to protect differentiating myoblasts from apoptotic cell death . SeveralLC3B is a subunit of microtubule-associated protein 1 (MAP1LC3B), and LC3 is cleaved by Atg4 to become cytosolic LC3B-I. LC3B-I is then converted to lipidated-LC3B-II through the conjugation of membrane lipid phosphatidylethanolamine (PE), which involves the E1-like enzyme ubiquitin, Atg7, and the E2-like enzyme, Atg10. LC3B-II then binds to the isolation membrane and mediates membrane elongation until the edges fuse to form an autophagosome. The isolation membrane appears when cells are placed under starvation conditions. Atg7 also conjugate Atg5 to Atg12 to form the Atg5-Atg12 complex and then bind to the isolation membrane with Atg16. This complex binding is necessary for autophagosome formation.In this study, the results showed that LC3B-I was increased in both types of myoblast due to the up-regulation of Beclin1 by nuclear-FoxO3, which is increased in dystrophin-deficient myoblasts. Beclin1 forms a complex with Vsp34 and becomes a core component during the pre-autophagosome stage. This complex then binds to the ULK1/Atg13/FIP200/Atg101 complex before entering the elongation stage, when Atg7 catalyzes the ligation of Atg5 to Atg12 to become the Atg5-Atg12 complex. With the aid of the Atg5-Atg12 complex, Atg7 catalyzes the transfer of PE to LC3B-I, converting it to LC3B-II, resulting in the accumulation of LC3B-II within dfd13 myoblasts  demonstrates excessive autophagosome formation in dfd13 myoblasts during differentiation; however, the conversion ratio of LC3B-I to LC3B-II was reduced in dystrophin-deficient myoblasts. Furthermore, although activation was higher, autophagic flux analysis showed a reduction upon differentiation and revealed that autophagy activity is decreased upon differentiation in dfd13 myoblasts Fig.\u00a0. TherefoDMD is mostly characterized by\u2009~\u20092\u00a0years of age and it progresses until the early 20\u00a0s. Therefore, the applicability of this finding to the understating of DMD patients may fit with the actual scenario. During the early stage of life (newborn to below 2\u00a0years), deficient myoblasts survive as most cells are actively proliferating and high levels of autophagy activation can prevent apoptosis. As age increases (>\u20092\u00a0years old), most of the deficient myoblasts have been triggered for differentiation as the body develops and muscle size and functionality increase, but now autophagy starts to decrease and apoptosis begins. This is the most common period for when DMD is diagnosed. At the later stage (~\u200910\u00a0years-old), there is a progressive disruption to the muscle due to loss/damage, and support (wheelchair) is needed for mobility and undertaking daily life tasks. This state will worsen and patients will eventually die, commonly as a complication of respiratory muscle damage and cardiomyopathy.PTEN-PI3K/Akt and its downstream proteins are perturbed in dystrophin-deficient myoblasts. From the data obtained, dystrophin-deficient myoblasts exhibit the high expression of autophagy-related proteins. However, a reduction in autophagy activity, as well as autophagy flux upon differentiation, indicates that autophagy is defective. This finding suggests a new mechanism for the reduction of autophagy in dystrophin-deficient myoblasts. All in all, we have come out with a schematic of autophagy modulation in dystrophin-deficient myoblasts Fig.\u00a0. We show"}
{"text": "Vandenboschia speciosa (Willd.) G. Kunkel). In addition to being a rare endangered Macaronesian-European endemism, this species has a huge genome (10.52 Gb) as well as particular biological features and extreme ecological requirements. These characteristics, together with the systematic position of ferns among vascular plants, make it of high interest for evolutionary, conservation and functional genomics studies. The transcriptome was constructed de novo and contained 36,430 transcripts, of which 17,706 had valid BLAST hits. A total of 19,539 transcripts showed at least one of the 7362 GO terms assigned to the transcriptome, whereas 6547 transcripts showed at least one of the 1359 KEGG assigned terms. A prospective analysis of functional annotation results provided relevant insights on genes involved in important functions such as growth and development as well as physiological adaptations. In this context, a catalogue of genes involved in the genetic control of plant development, during the vegetative to reproductive transition, in stress response as well as genes coding for transcription factors is given. Altogether, this study provides a first step towards understanding the gene expression of a significant fern species and the in silico functional and comparative analyses reported here provide important data and insights for further comparative evolutionary studies in ferns and land plants in general.We sequenced the sporophyte transcriptome of Killarney fern ( Vandenboschia speciosa (Willd.) G. Kunkel (=Trichomanes speciosum Willd.), is a tetraploid species  [V. speciosa is considered one of the most vulnerable fern species in Europe since it is threatened by habitat destruction and excessive collection and is listed in Annex I of the Berne Convention and Annex II of the Habitats Directive. At the national level, it is considered vulnerable in the Red List of Spanish Vascular Flora 2000. The two phases of its life cycle are perennial and capable of reproducing by vegetative propagation [Vittaria appalachiana, Hymenophyllum tayloriae and Vandenboschia intrincatum, the sporophytic phase of the life cycle has been completely eliminated, with the gametophyte surviving for a great length of time [The family Hymenophyllaceae has its origin in the Triassic and currently contains about 600 species, most of which emerged approximately 160 million years ago during the Jurassic period  and show0.52 Gb) ,8 that cpagation . The spopagation ,10,11. Tpagation ,10,11. Tpagation . The adapagation ,13,14,15 of time ,13,14,15V. speciosa would represent an important scientific resource for gene discovery and functional genomics studies. These studies might shed light on the knowledge of the genetic regulation of the adaptive response of both the sporophyte and the gametophyte and could be of use on the conservation genetics of this and similar species. In this context, the identification of the genes that regulate the growth and development of both phases of this species is also of special importance as it entails learning the genetic control of the transition between the vegetative and reproductive phases and the alternation between sporophyte and gametophyte. Here, we provide the de novo assembly and characterization of the sporophyte transcriptome of this vulnerable species, which represents an important step towards understanding the gene expression associated with phenotypes in a species with singular sporophytes and gametophytes, extreme ecological requirements and populations composed of independent gametophytes. In addition, the sporophyte transcriptome data and the functional analyses reported here provide an important platform for comparative evolutionary studies in ferns and land plants in general.A comprehensive transcriptome analysis in V. speciosa sporophytes were collected in April 2014 at one out of the seven populations located in the Alcornocales Natural Park : Valdeinfierno (VDI). We chose a population with a regular fern lifecycle of two free-living generations, gametophyte, and sporophyte. Sporophytes were frozen in liquid nitrogen in the field and stored at \u221280 \u00b0C. RNA was isolated from five sporophyte specimens using Spectrum\u2122 Plant Total RNA Kit . RNAs were pooled and Next Generation Sequencing was carried out at Macrogen Inc.  based on the Illumina HiSeq 2000 Paired-end approach . Illumina sequencing data can be accessed at Short Read Archive (SRA) ENA database under the accession number ERX2079928.https://www.bioinformatics.babraham.ac.uk/projects/fastqc/; accessed on 10 April 2019). De novo transcriptome assembly was performed using Trinity v2.8 [Quality assessment of the resulting sequenced reads was performed using FastQC  [www.orthodb.org; accessed on 10 February 2021) to provide quantitative measures of the completeness of transcriptome assemblies in terms of expected gene content. We analyzed the percentage of conserved single-copy orthologues represented in three datasets , using the OrthoDB sets: Eukaryota_odb10, Viridiplantae_odb10 and Embryophyta_odb10. Plotting of the BUSCO results was performed using the script generate_plot.py\u2014provided as companion script to BUSCO  that uses ggplot2 [We measured the completeness of the filtered transcriptome assembly using BUSCO v. 4.1.4  through ry 2021) . BUSCO s ggplot2  in R [28We estimated transcript abundance in a genome-free manner  with the \u201calign_and_estimate_abundance\u201d Perl script, using bowtie2  for the Candidate coding domain sequences (cds) within transcript sequences were identified with TransDecoder  using deV. speciosa generated after assembly and filtering was analyzed with BLASTx [https://www.ncbi.nlm.nih.gov/; accessed on 27 July 2020). Following the recommended default parameters [\u22123 e-value threshold. BLAST annotation was exported as a FASTA file to generate an annotated transcript database. The resulting database was deposited in FigShare . Gene Ontology (GO) terms  associated with the obtained BLAST hits were retrieved and GO annotation was carried out with BLAST2GO . In addition, InterPro annotations in BLAST2GO allowed retrieval of domain/motif information in a sequence-wise manner. Corresponding GO terms associated to InterPro results were then transferred to the sequences and merged with already existing GO terms. Augmented annotation by Annex was carried out. BLAST2GO integrates the second layer concept developed by the Norwegian University of Science and Technology [We used BLAST2GO software  for funch BLASTx  against rameters ,33, BLASchnology  for augmV. speciosa and a selected group of the following land plant species: the mosses Ceratodon purpureus (Hedw.) Brid.  and Physcomitrella patens (Hedw.) Bruch. and Schimp. , the ferns Azolla filiculoides Lam. and Salvinia cucullata Roxb. ex Bory  as well as Ceratopteris richardii Brongn. , the lycophyte Selaginella moellendorffii Hieron. , and the seed plant Arabidopsis thaliana (L.) Heynh., . Using reciprocal best-hits by the BLAST all-v-all algorithm, Orthofinder determined the number of shared putative orthologues between the eight species as well as species-specific transcripts. Orthofinder also infers gene trees for all orthogroups and a rooted species tree for the species being analyzed. Phylograms were visualized with Dendroscope [We used Orthofinder ,36 to iddroscope .Sequencing statistics are displayed in De novo transcriptome assembly statistics are shown in Polypodium amorphum Suksd. [Prunus salicina Lindl. [Ceratopteris richardii [V. speciosa transcripts gave identity to 7851 proteins of which 3196 (40.7% of transcripts) were covered in more than 90% of their lengths and 6444 (82% of transcripts) were covered in more than 50% of their lengths . Redundancy was further eliminated by clustering the filtered assembled transcripts using CD-HIT-EST at a nucleotide identity of 95%. Fewer than 22% of the transcripts were redundant and were therefore removed. The final filtered assembly contains 36,430 transcripts, with median and average transcript lengths of 1197 and 1437.37 nucleotides, respectively . Fifty pm Suksd.  and wereichardii . The N50 lengths .V. speciosa since there was a high recovery of conserved orthologues from eukaryotes in general and from plants in particular. However, the alignment against Embryophyta core genes was at the lower end of what it is considered a good quality transcriptome. This might be because we analyzed only the sporophyte phase, whereas complete general species transcriptomes should include sequencing from multiple tissues [V. speciosa sporophyte transcriptome is one of the most complete fern transcriptome hitherto published. Transcriptome assemblies from combined fern gametophyte and sporophyte tissues of Polypodium amorphum [Ceratopteris richardii [Lygodium japonicum (Thunb.) Sw. [Completeness of the filtered transcriptome assembly was measured using BUSCO . A total tissues ,46. Thusamorphum  and Ceraichardii  recoverenb.) Sw. ,47.TransDecoder determined that the total number of protein-coding transcripts among the final non-redundant transcripts was 29,220. Approximately 59.8% of the coding sequences were complete, 21.4% were 5\u2032 partial, 10.4% were 3\u2032 partial, and 8.4% were internal.e-values  genes involved in the vegetative growth in flowering plants were abundant within this list; (b) there is a remarkable presence of transcripts from genes involved in the synthesis of glucomannans, which constitute the type III primary cell wall in vascular plants and that are exclusively reported in some fern species ,51; (c) In addition to the annotated transcripts, 18,724 transcripts remained anonymous (not annotated using BLASTx). The latter had TPM values higher than 47.73 among the 1000 most expressed transcripts. Furthermore, the first four transcripts showed TPM values above the highest value among annotated transcripts and 449 transcripts had TPM higher than 88.11 . Seventy-nine of these transcripts had GO term annotation. In fact, 2816 of the total 18,724 anonymous transcripts showed an assigned GO term. Therefore, there is a number of potentially important hitherto unknown transcripts that merit future research\u2014especially those with high TPM values.V. speciosa) were assigned to 26,875 orthogroups  from eight plant transcriptomes (including hogroups . Therefohogroups . Howeverectively . This isSellaginela moellendorffii) from the euphylophytes, which diverge in two major clades\u2014the monilophytes or ferns (represented here by four species) and the spermatophytes or seed plants  [Azolla filiculoides and Salvinia cucullata), Cyatheales (tree ferns) and Polypodiales , form the large monophyletic clade of core leptosporangiates [V. speciosa), Gleicheniales and Schizaeales. The species tree based on single-copy orthologues of V. speciosa as a lineage that separates early from core leptosporangiate ferns [Azolla filiculoides and 0.25 Gb in the case of Salvinia cucullata, for example) [V. speciosa is an allotetraploid species with 2n = 144 chromosomes, which in part would explain its large genome (1C = 10.52 Gb) [A phylogenomic analysis based on the substitution rates of single-copy orthologues resulted in the species tree shown in haliana) . Among tangiates . The reste ferns ,57,58,59te ferns , whereasexample) . Polyploexample) ,62. In tV. speciosa transcriptome, a species that has biological and ecological relevance. The progressive accumulation of more information about the genomes of ferns and organisms from other basal branches of land plants will favor more accurate phylogenetic analyses [V. speciosa sporophyte transcriptome. Similarly, Sigel et al. [Monilophytes represent a phylogenetically important branch within the land plant lineage. However, there are few fern genomic studies, probably due to the huge sizes of fern genomes, especially in the case of leptosporangiate ferns (most ferns). In fact, there are only two complete fern genome assemblies, both belonging to two heterosporous ferns which have much smaller genomes  and someanalyses  as well analyses ,52,67,68analyses  analyzedanalyses , and frol et al.  also conA total of 5102 of the orthogroups (19%) were shared among the eight species. Of these, 101 were single-copy orthogroups, i.e., orthogroups with exactly one protein from each species . A totalV. speciosa (82%) were assigned to one of the 11,195 orthogroups  between analyzed . The resn mosses , but conn mosses . For exaichardii , 85% in aponicum  and 97.7amorphum . AdditioV. speciosa had an enriched number of transcripts. Among these orthogroups, transcripts representing genes encoding pentatricopeptide repeat-containing proteins were especially over-represented (1787), although they probably belong to a lower number of genes. Notwithstanding, Li et al. [Azolla (over 2000 PPR proteins) and Salvinia (over 1700 PPR proteins) genomes. They found that the large repertoire of PPRs correlates well with the extensive RNA editing observed in the organellar genomes of Salviniales [V. speciosa plastome [V. speciosa includes some other genes with interesting products, such as proteins involved in disease resistance, chromatin organization, several classes of transcription factors, different proteins controlling cell division, cell differentiation, cell wall formation, plant growth and plant development, proteins regulating dormancy or response to water deprivation, spliceosomal complex components or enzymes involved in lignin and mannan biosynthesis.We therefore focused our analysis specifically in those orthogroups for which i et al.  found thviniales , a phenoplastome . The lisA. thaliana transcriptome  against the V. speciosa transcriptome gave 456,516 significant hits at a 10\u22125 evalue cutoff  and 10,294 V. speciosa transcripts out of the 17,706 annotated transcripts of that species transcriptome (58.14%)\u201428.26%% if we consider all the 36,430 transcripts that form the whole V. speciosa transcriptome that we assembled as reference (annotated and with no known annotation). Such a large number of shared transcripts reflect the completeness of our transcriptome, whereas the transcripts of the A. thaliana transcriptome that do not appear in the V. speciosa transcriptome are very likely to be transcripts usually expressed in specific A. thaliana tissues, or developmental/physiological states not covered in our material. On the other hand, the transcripts present in our fern transcriptome but not in A. thaliana\u2019s are probably fern specific genes. To that, we have to include the transcripts of proteins that have diverged too much as to be picked by our blast search. In fact, the mean percentage identity between the blast high-scoring parts of the sequences of both species is 47.68%, which reflects the evolutionary distance between both species.tBlastx of the e cutoff . When coV. speciosa. This is the first step towards understanding gene expression in a species that presents extreme ecological restrictions and biological particularities. Our study has unveiled outstanding clues about the transcriptomics of the adaptative response to hydric stress, the genetic control of sporophyte growth and development and the alternation between the vegetative and reproductive phases of this species. These results provide an important resource for further RNA sequencing studies of other fern transcriptomes, including that of the gametophyte of this species, to better understand the conservation genetics of ferns in general and, specifically, of V. speciosa.High-throughput RNA sequencing has emerged as a powerful tool for gene identification and gene expression analyses. In this work, we characterized and analyzed the transcriptome of the sporophyte (one of the two phases) of an endangered fern species,"}
{"text": "Ultrasonic welding of thermoplastics is widely applied in automobile and aerospace industries. Increasing the weld area and avoiding thermal decomposition are contradictory factors in improving strength of ultrasonically welded polymers. In this study, relations among the loss modulus of carbon-fiber-reinforced polyamide 66 composite (CF/PA 66), time for obtaining stable weld area, and time for CF/PA 66 decomposition are investigated systematically. Then, a double-pulse ultrasonic welding process (DPUW) is proposed, and the temperature evolutions, morphologies and structures of fractured surfaces, and tensile and fatigue properties of the DPUWed joints are measured and assessed. Experimental results show the optimal welding parameters for DPUW include a weld time of 2.1 s for the first pulse, a cooling time of 12 s, and a weld time of 1.5 s for the second pulse. The DPUW process enlarged the weld area while avoided decomposition of CF/PA 66 under appropriate welding parameters. Compared to the single-pulse welded joint, the peak load, weld area, and endurance limit of the DPUWed joint increased by about 15%, 23% and 59%, respectively. DPUW also decreases the variance in strengths of the joints. Polymer composites play an increasingly significant role in automobile and aerospace industries due to low density, high specific strength, and corrosion resistance . JoiningIn ultrasonic welding of polymers without energy directors, the energy is not concentrated, and coulombic friction at the faying interface is less than that of the joint with energy directors. As a result, the workpieces need a longer time to melt, and the corresponding weld time is prolonged for UWed joints without energy directors ,8,9. HowIt is known that heat generation during ultrasonic welding depends on the loss modulus of polymer, while the loss modulus is closely related to temperature ,4,18. ThThe present study was undertaken to develop a method of double-pulse ultrasonic welding (DPUW) for improving the weld quality of carbon-fiber-reinforced polyamide 66. The mechanism of DPUW is evaluated thoroughly by analyzing the relations among the loss modulus of the material, time for obtaining stable weld area, and time for decomposition occurrence. The temperature evolution, peak load, and fatigue properties of the DPUWed joint are assessed systematically.3, and the injected CF/PA 66 exhibited a tensile strength of 99.2 MPa. During the ultrasonic welding process, a KZH 2026 welder with a nominal power of 2.6 kW, nominal frequency of 20 kHz, amplitude of 25 \u03bcm, and circular aluminum horn with a diameter of 18 mm were utilized. Time mode was chosen as welding mode.The material used in this research was carbon-fiber-reinforced polyamide 66 composite with 30 wt% fiber (CF/PA 66) , where the carbon fiber was about 2 mm in length with a diameter of 7 \u03bcm. All the coupons were injection-molded with dimensions of 132 \u00d7 38 \u00d7 4.0 mmTo analyze the weld formation during ultrasonic welding, temperature evolutions near the faying interface and in the middle of upper workpiece were measured. 3 were subjected to three-point bending with a span length of 20 mm. An oscillating force (\u22644 N) was applied to give constant deflection amplitude of 30 \u03bcm. Measurements were conducted in the temperature range of 23\u2013200 \u00b0C with a heating rate of 2 \u00b0C/min and fixed frequencies . The loss modulus at 20 kHz was extrapolated by the time temperature superposition. The cross-sectioned morphologies of the welds were characterized by scanning electron microscopy . All samples were sputter-coated with platinum for 50 s before SEM to induce conductivity. Chemical structures of the polymer were characterized using Fourier transform infrared spectroscopy (FTIR)  Perkin Elmer Spectrum One. Pellets made of CF/PA 66 powder were diluted in KBr, and FTIR spectra were recorded between 4000 and 400 cm\u22121. The powder was obtained by grinding in an agate mortar with a pestle under an infrared lamp. Shear tensile and fatigue tests were performed on an MTS 810 servohydraulic testing machine. To minimize the bending stresses inherent in the testing of single-lap weld specimens, filler plates were attached to both ends of the specimen using masking tape to accommodate the sample offset. The stroke rate was 2.0 mm/min for the tensile test, while the cyclic frequency was 30 Hz, and sinusoidal load cycles with a load ratio R = 0.1 were applied in fatigue test. Three replicates were tested, and the average values were reported for each welding condition.Loss modulus of CF/PA 66 was carried out by dynamic mechanical analysis . Specimens with dimensions of 38 \u00d7 8.5 \u00d7 4.0 mms and td, are also given in d is defined as the time when the workpiece starts to decompose and forms a porous area, while ts is the time when the joint obtains stable weld area. Numerous studies have shown that the weld area of the joints increases rapidly with weld time, and the weld area remains stable at a certain weld time [s, and the corresponding joint exhibits the highest strength. Further increasing the weld time, thermal decomposition emerges in the joint and the weld strength drops.There are two leading heating systems during ultrasonic welding of polymer composites: surface friction and viscoelastic dissipation. The loss modulus of CF/PA 66 composite is closely related to the condition of CF/PA 66, while the condition of CF/PA 66 rests on temperature. For ultrasonic welding process, the weld time only takes several seconds and the state transformation does not take place; therefore, the initial loss modulus at the very beginning of welding is identified as the loss modulus of CF/PA 66 during welding. The loss modulus of CF/PA 66 composite at 20 kHz (black curve) as a function of temperature is shown in eld time ,8,16. Ths and td are the results of extensive experiments (from preheating temperatures of 25 \u00b0C to 175 \u00b0C) [s and td decrease as the preheating temperature rises, and the peak values occur at approximately 75 \u00b0C, which is likely correlated with the preheating temperature and corresponding loss modulus of the workpiece. The decreases in ts and td are mainly because the preheating treatment provides energy for weld formation and workpiece decomposition. The peak and valley located at 75 \u00b0C are present because the maximum loss modulus of CF/PA 66 is at this temperature. The larger loss modulus leads to higher energy dissipation in the workpiece and relatively lower heat generation at the faying interface. Therefore, time for obtaining stable weld area prolongs, and the time for thermal decomposition shortens.t 175 \u00b0C) . Generals is smaller than td, implying the joint achieves its maximum weld area before thermal decomposition occurs in the joint. Accordingly, R1 and R3 are the appropriate regions, and ts is the proper weld time for joints with preheating temperatures ranging from 25\u201355 \u00b0C and from 95\u2013145 \u00b0C. In regions R2 and R4, ts is larger than td, indicating the composite decomposes before the joint obtains stable weld area. Assuming the workpiece does not decompose, then the weld area of the joint is smaller, and the joint strength is lower [Based on the curves of time for stable weld area and time for CF/PA 66 decomposition in is lower . ConsequIn practical production, ultrasonic welding usually operates at room temperature, and the ambient temperature of 25 \u00b0C, which lies in R1, is selected for the first ultrasonic vibration. As shown in It takes about 8 s for the middle of the upper workpiece to cool to R3 region, as shown in Temperature histories for DPUWed joint at the faying interface and middle of the upper workpiece are measured, and the results are displayed in 2. After the applications of weld time for 2.9 s, preheating at 125 \u00b0C, and DPUW, the weld areas increase when compared to that of the joint welded with 2.1 s. Moreover, DPUWed joint exhibits increased peak load (higher by about 15%) and limited scatter, while the peak loads drop for the other two groups. These characteristics are probably related to the morphologies of the joints.\u22121 and N-H stretching at around 3300 and 3400 cm\u22121 decrease primarily, which indicates that these groups fracture, and the polymer decomposes severely [3, CO2, CO, which results in a fragile porous area and deteriorates the joint strength [Fractured surfaces of these joints are carefully examined and presented in severely ,24. The strength ,25.Similar to the joint with 2.9 s weld time, a porous area shows at the faying interface for the preheated joint, and peak load of the joint decreases. It is seen that extending the weld time and preheating treatment cannot enlarge the weld area significantly and improve weld quality. The weld area of the DPUWed joint increases by about 23% compared with that of the joint welded for 2.1 s. This phenomenon indicates the double-pulse ultrasonic welding process indeed increases the energy dissipation at the faying interface. In addition, overheating does not emerge, and no porous area occurs in the joint due to controlling the temperature distribution. These results indicate the selection of DPUW parameters based on the temperature in upper workpiece is reasonable. It is worth mentioning that the double-pulse ultrasonic welding process not only improves the weld quality but also decreases the variance in peak load, which is beneficial for producing continuous solid joints. This result is likely correlated with the contact condition at the faying interface. It is difficult to guarantee absolute flatness of the workpiece during manufacturing. Thus, the contacts between workpieces differ at the initial stage of welding. Surfaces with higher asperities usually generate more heat and obtain intimate contact between workpieces. By contrast, heat generation becomes limited for joints with loose contact and results in insufficient welds. However, the asperities suffer from melting and solidifying after application of the first ultrasonic pulse, which results in a relatively flat faying interface; thus, the second ultrasonic energy can be evenly distributed at the faying interface. Hence, the stable weld seam is obtained with the DPUW process and the spread in peak load narrows. The specific mechanism for the decreased scatter in double-pulse ultrasonic welding process will be further studied in future research.fN > 5 \u00d7 106. A decreasing trend in fatigue lives with increasing mean stresses is observed under all weld conditions. A power law relation between the S and fN is assumed in line with Basquin equation and can be expressed as [S is the stress, fN is the number of cycles to failure, and A and b are the fatigue strength coefficient and exponent, respectively. The approximated values of these coefficients, endurance limits, and correlation coefficients (R2) are summarized in 2 are close to 1, which shows good correspondence between tested and fitted results. The endurance limits of the joints mentioned above are 1.25 kN, 0.52 kN, 0.69 kN, and 1.99 kN. It is evident from The fatigue property of a joint is primarily important, because it inevitably suffers from complex and repeated mechanical loading during service. essed as ,27,28:S f), cooling time (Tc) and weld time of the second pulse (Ts). Three levels of 1.5 s, 2.1 s, 2.7 s for Tf; 6 s, 12 s, 28 s for Tc; and 0.9 s, 1.5 s, 2.1 s for Ts are adopted. Parametric values for each experimental run and the average peak load, weld area, and existence of an obvious porous area are given in f of 2.7 s irrespective of the cooling time and second weld time. This characteristic indicates that the weld time for the first ultrasonic pulse should be shorter than 2.7 s, and weld time of 1.5 s and 2.1 s are appropriate. It is seen from samples 12 to 18 that peak loads of joints with cooling intervals of 12 s are higher than those with cooling intervals of 6 s and 28 s. Combined with the temperature evolutions in To validate the correctness of the above analysis and results, experiments with three process parameters with three levels are conducted. The process parameters are weld time of the first pulse (T2, is 0.976, indicating the fitting is reliable. The relation can be described as:Normally, the peak load of a joint is proportional to the weld area for joint without porous area ,19,21,29Increasing the weld area and avoiding thermal decomposition are contradictory factors in improving strength of ultrasonically welded CF/PA 66. Ultrasonic welding of CF/PA 66 with different preheating temperatures was investigated thoroughly. The time for obtaining stable weld area and time for decomposition of CF/PA 66 decreased with increasing preheating temperature except for temperature around 75 \u00b0C. The occurrences of peak and valley values were mainly because the maximum loss modulus of CF/PA 66 was at this temperature. The proper temperature range for ultrasonic welding was R1 and R3, and the optimum temperature before application of the second ultrasonic pulse lay in the R3 region, i.e., 95\u2013145 \u00b0C.A method of double-pulse ultrasonic welding of CF/PA 66 is proposed based on the relations among loss modulus of CF/PA 66, time for obtaining stable weld area and time for material decomposition. The appropriate welding parameters for DPUW include a weld time of 2.1 s for the first pulse, 12 s cooling, and a weld time of 1.5 s for the second pulse. Results show that the DPUW process enlarged the weld area and avoided decomposition of CF/PA 66 in the meantime. Compared with welds made with prolonged weld time and preheat treatment, DPUWed weld exhibits higher peak load, larger weld area, more compact microstructure, and better fatigue property. The DPUW schedule not only improves the weld quality of ultrasonically weld CF/PA 66 but also decreases the spread in tensile and fatigue properties."}
{"text": "Background: Positive airway pressure can be an effective and safe therapy for children with obstructive sleep apnea syndrome (OSAS). Few studies have assessed the safety and efficacy of autoCPAP in pediatric patients with obesity. Methods: This was a retrospective chart review of children with obesity (Body Mass Index (BMI) > 99th percentile), ages 2\u201318, diagnosed with OSAS (Obstructive Apnea-Hypopnea Index (OAHI) > 1/h) and used autoCPAP with 30-day adherence. Exclusion criteria included patients with complex comorbidities. Adherence was defined as autoCPAP use \u22654 h/night for at least 21/30 days. Baseline PSG OAHI was compared to the AHI from the 30-day autoCPAP compliance report. We also compared autoCPAP 30-day 95th percentile pressures with the pressures from PAP titration. Results: The study included 19 children, ranging 5\u201315 years old. The median BMI was 99.6th percentile and average adherence was 25/30 nights with mean of 7.3 h/night. The median OAHI was 12.3/h on baseline PSG and the 30-day autoCPAP download AHI decreased to 1.7/h. No adverse outcomes were identified. The average difference between 95th percentile autoCPAP pressure and PAP titration pressure was 0.89 cmH20. Conclusion: Our study suggests autoCPAP is effective and safe for the treatment of OSAS in pediatric patients with obesity. Using autoCPAP may reduce delays in treatment. Additional research is needed to verify the long-term effectiveness of autoCPAP in this population. Obstructive sleep apnea syndrome (OSAS) affects an estimated 2\u20134% of the general pediatric population . The cauIt is important to ensure that those patients who are already affected with obesity and OSAS are adequately screened, diagnosed and treated in order to maintain good health and avoid any of the associated disease. Untreated OSAS in children can lead to neurocognitive issues, behavior problems, difficulties in school, poor growth and increased cardiovascular risks ,8,9,10. The recommended first-line treatment for pediatric patients is tonsillectomy and adenoidectomy (T&A) in patients with adenoid and tonsillar hypertrophy ; howeverAutoCPAP is widely used in the adult population in place of in-laboratory PSG titration studies and has been shown to effectively decrease (Apnea-Hypopnea Index) AHI and improve symptoms related to OSA. It can provide variable pressure delivery to accommodate detected changes in flow limitation in the upper airway ,22. The A retrospective chart review was performed for children with obesity using autoCPAP at Valley Children\u2019s Hospital between May 2016 to April 2021 (four patients before 2018 and the remaining from 2019 to present). The study was approved by the Valley Children\u2019s Hospital institutional review board.Inclusion criteria were as follows: patients with OSAS and obesity, ages 2 to 18 years without significant comorbidities. OSAS was defined as an obstructive apnea-hypopnea index (OAHI) with more than one event per hour, obtained by in-lab diagnostic polysomnography using SomnoStar sleep system (PSG). PSG was scored, based on the most recent American Academy of Sleep Medicine (AASM) scoring rules. Obesity was defined as body mass index (BMI) at or above the 95th percentile. Patients were also required to have autoCPAP use greater than or equal to four hours per night for greater than or equal to 21 days out of a total 30-day period. The adherence criteria was based on adult health-insurance guidelines for compliance, which is defined as use of CPAP greater than or equal to four hours per night for greater than 70% of a given time frame (21 days out of a 30-day period). Pediatric adherence criteria are not established. Exclusion criteria were patients with complex comorbidities, including unrepaired congenital heart disease, chromosomal anomalies, and neuromuscular disorders.We then accessed the Cloud-based PAP compliance and therapy monitoring software from ResMed AirView to determine which patients were compliant to therapy for at least a 30-day period, using the criteria for adherence noted above. Among patients who had been adherent to therapy, the baseline PSG, PAP titration study and medical records were reviewed. All patients that met criteria were included in the study.We compared baseline polysomnography OAHI with the autoCPAP derived 30-day mean OAHI, reported via the cloud-based therapy data system. In order to compare the autoCPAP 95th percentile pressure to the in-lab PSG titration recommended pressure, we determined the mean difference between the autoCPAP-derived 95th percentile pressure and the PSG PAP titration pressure.There were 19 children who met the criteria aged from 5 to 15 years old with adherent autoCPAP use. The median BMI was in the 99.6th percentile. There were 15 patients that met criteria for severe obesity with BMI greater than or equal to the 99th percentile. Average autoCPAP use was 7.3 h per night, for an average of 25 days in a 30-day period. Each patient\u2019s OAHI was obtained from their initial baseline polysomnography and compared to their autoCPAP 30-day compliance and therapy download. The comparison for these values can be seen in The cloud-based PAP compliance and therapy monitoring software-downloaded reports included the 95th percentile pressure from the patients\u2019 autoCPAP use for 30 days. This value indicates that 95% of the time spent on autoCPAP is at this pressure or below. These pressures were compared to the PAP pressure settings recommended from the in-lab PSG PAP titration  for thosThe results from this study demonstrate that the use of autoCPAP among children with OSAS and obesity can reduce the number of obstructive apnea\u2013hypopnea events. OSAS was defined as an OAHI of more than 1 event per hour, per the International Classification of Sleep Disorders by the American Academy of Sleep Medicine . Our stuGiven the growing prevalence of obesity among the pediatric population, this is a population that will need more and more attention. Effectively treating OSAS in pediatric patients with obesity should be considered as part of the overall medical treatment plan for these patients. In adult patients with OSAS and obesity, there is a correlation in the reduction of visceral fat  after CPAP treatment . While tTreatment with autoCPAP for OSAS can provide a wide range of pressures to facilitate adjustments for growth in children, weight changes, increase upper airway resistance against allergies and respiratory infections, and positional changes . The accAn abstract by DelRosso et al. found that autoCPAP use was well tolerated in 11 pediatric obese patients with adherent days of use ranging (use of 4+ h a night) from 53\u2013100%, with an average of 5.5 h per night . In our Our study demonstrates that autoCPAP-derived pressures correlate with the titration PSG-derived pressures. The recommended PAP pressures obtained during in-lab PAP titration PSG were \u22642.1 (with six of the patients having \u22641 cmH20) pressure with a mean difference of 0.89 (0.1\u20132.1) when compared to the 95th percentile obtained on autoCPAP therapy download. Other studies in children have shown similar results, demonstrating a strong correlation between autoCPAP pressures and in-lab PSG PAP titration derived pressures ,24.Currently, the standard approach to starting children on CPAP therapy is to perform an in-lab PSG PAP titration study and then to prescribe a set CPAP pressure based on titration results . In-lab There were no adverse outcomes or side effects identified upon chart review during our study. This suggests that autoCPAP treatment can be both safe and effective when treating even severe OSAS in pediatric patients with obesity. Safety of autoCPAP use in the pediatric population has been established by previous studies ,24, in aLimitations of the study include that this is a retrospective study, and that the participant group is small. Some study subjects were excluded based on significant comorbidities, which makes this study useful for obese pediatric OSA patients without other complex health issues. We also studied compliance and therapy data for a 30-day period only, and did not study long term benefits and adherence. This study is also limited as it did not include patient\u2019s satisfaction. A future study should not only include effectiveness but should also include patient\u2019s comfort and satisfaction. Identifying barriers for adherent autoCPAP use in obese pediatric patients would be an important clinical problem to address in future studies.AutoCPAP use by pediatric patients with OSAS and obesity was associated with a significant reduction in OAHI in this study. The use of autoCPAP appears safe and tolerated in this population. There is also concordance between the optimal pressures obtained from the in-lab PSG PAP titration study to the autoCPAP 95th percentile pressure. Long wait times for PSG evaluation and subsequent PAP titration studies can delay the diagnosis and management of OSAS, which can increase patient risk for associated sequelae. AutoCPAP use can mitigate these issues. Additional research is needed to establish the long-term effectiveness, safety, and tolerability of autoCPAP in children with obesity."}
{"text": "Bio-effects following thermal treatments are a function of the achieved temperature profile in tissue, which can be estimated across tumor volumes with real-time MRI thermometry (MRIT). Here, we report on expansion of a previously developed small-animal microwave hyperthermia system integrated with MRIT for delivering thermal ablation to subcutaneously implanted tumors in mice.ex-vivo tissues were heated to temperatures in the range 47\u201367 \u00b0C with custom-made microwave applicators for validating MRIT with the proton resonance frequency shift method against fiberoptic thermometry. HAC15 tumors implanted in nude mice (n = 6) were ablated in vivo and monitored with MRIT in multiple planes. One day post ablation, animals were euthanized, and excised tumors were processed for viability assessment.Computational models were employed to assess suitability of the 2.45 GHz microwave applicators for delivering ablation to subcutaneous tumor targets in mice. Phantoms and ex-vivo ablations. During in-vivo experiments, tumors with volumes ranging between 5.4\u201335.9 mm3 (mean 14.2 mm3) were ablated (duration: 103\u2013150 s) to achieve 55 \u00b0C at the tumor boundary. Thermal doses \u2265240 CEM43 were achieved across 90.7\u201398.0% of tumor volumes for four cases. Ablations were incomplete for remaining cases, attributed to motion-affected thermometry. Thermal dose-based ablative tumor coverage agreed with viability assessment of excised tumors.Average absolute error between temperatures from fiberoptic sensors and MRIT was 0.6 \u00b0C across all in-vivo.We have developed a system for delivering microwave ablation to subcutaneous tumors in small animals under MRIT guidance and demonstrated its performance  Small animal tumor models are common and widely accepted as important tools for the evaluation of various therapeutic approaches \u20134. Thermvia a percutaneous approach [a ~1.5\u20132 mm device results in a substantial fraction of the tumor volume affected by mechanical trauma. A limitation of most studies is the lack of information regarding the thermal profiles in tissues, with few studies reporting temperature data measured or anticipated within tumors and surrounding tissue. Knowledge of thermal dose delivered to tumor and adjacent tissue may be especially important for studies investigating combination of ablation with other therapeutic modalities [While there are several studies employing microwave ablation (MWA) in small animal tumor targets, there are few reports describing technical details about the instrumentation used for delivering heating, which would be important for characterizing the power absorption and thermal profiles. Since MWA devices designed for ablation of human tumors typically yield >15 mm long ablation zones , due to approach \u201322, or iapproach \u201325. For dalities .et al reported on a broadband planar coaxial microwave applicator [et al designed a 1.2 mm diameter dual slot antenna operating at 8 GHz with the goal of achieving spherical ablation zones for treatment of ~1 cm diameter tumors in mice [Some studies have described the design and characterization of thermal ablation devices specific for use in experimental studies in small animals. Yoon plicator  which wa in mice , with th in mice  and ultr in mice .in vivo small-animal investigations. Similarly, MR thermometry with the proposed sequence was not previously validated for ablative heating at high-fields; since data acquired with this system will be used to quantitatively assess thermal profiles in future studies, we believe it is important to benchmark thermometry accuracy, even in the event that the accuracy is similar to that at lower temperature ranges.Our group has previously developed a system for MRI thermometry (MRIT) guided delivery of microwave-induced hyperthermia to experimental small animals ,31. The ex vivo tissue and 3) to demonstrate use of the system for delivering ablation to subcutaneous HAC15 tumors in nude mice in vivo.The objectives of this work were 1) to expand the previously developed system for MRIT guided hyperthermia for the thermal ablation studies in small animals and characterize thermal profiles, 2) to validate the accuracy of volumetric temperature readings from MRIT at 14.1 T by comparison with temperature data from fiber optic sensors during heating in phantom and via Paravision 6.01 software. Specific details of imaging sequences, which were used to acquire anatomic images of ex vivo and in vivo samples are provided in sections \u2018System integration and evaluation in tissue phantoms and ex vivo tissue\u2019 and \u2018In Vivo heating procedure\u2019, respectively.The small-animal ablation system is comprised of a custom 2.45 GHz microwave ablation platform integrated with a high-field small-animal MRI scanner. The overall schematic of the system is shown in via ethernet cable to a monitoring and control computer with Thermoguidetm software , where phase images are used to estimate transient temperature profiles with the proton resonance frequency shift (PRFS) technique [ex vivo tissue\u2019. Since the PRFS technique provides estimates of relative change in temperature, rather than absolute temperature, a fiber-optic temperature measurement probe was utilized to measure the core temperature of the small animal prior to heating, and thus serve as the baseline temperature.During microwave heating exposure, acquired magnitude and phase images are transmitted echnique ,35. ImagThe microwave heating platform consists of a solid-state microwave generator , MRI compatible directional microwave applicator, and a power meter  for monitoring transmitted and reflected power. A 4 ft long RG393 coaxial cable, with approximate attenuation ~0.12 dB/ft at 2.45 GHz, was used to connect the generator to the power meter, and 6 ft long RG400 coaxial cable, with approximate attenuation ~0.22 dB/ft at 2.45 GHz (Pasternack RF), was used to connect the power meter to the applicator. Details of utilized MWA applicator are provided in the following section. A peristaltic pump (Masterflex L/S 7015\u201320) was used to circulate water through the applicator from a temperature-controlled water reservoir.We investigated the feasibility of delivering microwave ablation to subcutaneously implanted experimental tumors in small-animals using a water-cooled microwave applicator previously developed for mild-hyperthermia applications , 31. Theex vivo chicken breast and compared temperature changes from MRIT against fiber optic measurements. Even though the temperature profiles in phantoms and ex vivo tissues are expected to be different from heating profiles in tumor in vivo (due to the lack of blood flow and heterogeneities), these experiments are informative to assess the system integration and MRIT monitoring accuracy ahead of in vivo studies. Transient temperature profiles in phantoms as well as ex vivo samples were measured with the use of the proton resonance frequency shift technique during microwave heating. We used a FLASH protocol, with TR = 30.1 ms, TE = 4 ms, FA = 15\u00b0, FOV = 30 \u00d7 30 mm2, slice thickness = 1 mm, three axial slices, and in-plane pixel size 0.2344 \u00d7 0.2344 mm2.The accuracy of MRIT with the 14.1 T high-field scanner at temperatures in the range 40\u201344 \u00b0C was previously found to be on the order of 0.4 \u00b0C . Temperaex vivo chicken breast samples. The sample is loaded from the top  under protocol number 4451. A mouse model of aldosterone producing adenoma was prepared by injecting six million HAC15 cells  subcutaneously in the right hind flank of nude mice . Starting at day seven post-injection, the 2-dimensional tumor size was estimated using calipers. When the tumor size reached 5 mm in one direction, the mice were treated. A total of six nude mice were selected for heating procedures. On the day of experiment, the mice were anesthetized using isoflurane  and maintained under anesthesia for the duration of the treatment.h = 200 W/m2/K and external temperature 20 \u00b0C.To evaluate the suitability of the directional microwave applicator for heating of subcutaneous tumors, observed tumor shapes and sizes as illustrated in For the time stepping scheme, we used low order (maximum 2) backward differentiating formula (BDF) with relative tolerance within time domain solver was set to 0.005 to aid the convergence of numerical computations. We used a free tetrahedral mesh with the smallest element size of 0.1 mm around the input port to the applicator, gradually increasing the size to 0.25 mm around the applicator shaft and allowing the element size to be gradually increasing up to 3 mm for space more than 1 cm away from the applicator shaft. These parameters were chosen based on the result-convergence method, where the changes in simulated temperature and electric profiles were monitored for simulations with decreasing mesh size and relative tolerance and the parameters resulting in output changes smaller than 1% of initial differences were employed.ex vivo liver, due to lack of data on HAC15 tumors in literature, and liver being commonly accepted as a surrogate tissue for performance evaluation of ablation devices. Baseline properties of tissue were taken from IT\u2019IS tissue database [The tissue block around the applicator was modeled with dielectric and thermal properties of database , temperadatabase , and temdatabase . The ablvia MRIT.After inducing anesthesia, the mice were placed in an acrylic fixture which allows for positioning of the small animal, temperature sensor, breathing mask, and microwave applicator in a defined relationship within MRI probe, which is to be loaded to the 14.1 T MRI scanner. The microwave applicator was then positioned on the skin of the mouse next to the subcutaneous HAC15 tumor and fixed with the tape such that the tumor was in the direction of the applicator\u2019s heating pattern. A rectal thermocouple probe  was used to capture the core temperature of the mouse just before starting the heating procedure to allow absolute temperature measurements ex vivo samples .Once the MRI probe was loaded in the scanner, initial T2-TurboRARE scans were obtained in the axial, sagittal and coronal view to verify the position of the microwave applicator with respect to the tumor as shown in Prior to the initiation of microwave heating, we selected several points along the tumor boundary as regions of interest (ROI), where temperature was monitored in real time. Four points were assigned along the tumor boundary in each of the 3 slices shown in As can be seen in ex vivo tissue. Heating times were in range of 4\u20135 min with an average 4.58 min. The update time between subsequent images was 3.86 s based on used sequence parameters. The results of MRIT validation in agar phantom and chicken breast are shown in To validate the MRI thermometry, we performed three heating procedures in agar phantom and another three procedures in ex vivo tissue, peak temperatures of 67 \u00b0C were observed, with average mean absolute error (MAE) between fiber-optic thermometry and MRI of 0.86 \u00b0C across all samples. During heating phantoms and ex vivo experiments.Simulations predicted that the full coverage of tumors with minimum thermal damage 240 CEM43 is attainable in each tumor case in less than 140 s for 30 W and less than 66 s for 50 W input power. Furthermore, comparison between shape of simulated ablation zone and target subcutaneous tumor shapes from anatomical MRI scans at the time of full tumor ablation yielded average DSC 0.65 ranging from 0.48 to 0.77 for 30 W and average DSC 0.62 with range 0.53\u20130.72 for 50 W input power. DSC value of 0.7 was previously suggested as an indication of conformity between target shape and thermal contour approximating ablation . The ranex vivo liver to assess general ablation shape. The actual heating profiles might be even more favorable for targeted tumor heating in terms of shape similarity, because of possible contrast in dielectric and thermal properties between tumor and fat, where more microwave energy is deposited in volumes with higher dielectric properties  and heat is preserved in tumor area due to thermal insulation of surrounding fat layer.However, MR images as well as visual assessment after tumor extraction following euthanasia indicated tumors were exclusively surrounded by a layer of fat, which is not a critical structure and can tolerate thermal damage without safety concerns. Moreover, since the target tumor biophysical properties are unknown, simulations were performed in homogenous ex vivo chicken breast heating demonstrated the ability of system to heat tissue in regions up to 12 mm from the surface of the applicator to ablative temperatures . In one case of chicken breast tissue  of the tumor volume  was heated to thermal doses exceeding 240 CEM43. In one experiment temperatures recorded over 250 s did not exceed 50.5 \u00b0C. In another experiment, MR thermometry data were unusable because of animal movement leading to substantial motion artifacts. In the five experiments, where usable thermometry data was available, thermal dose-based assessment of ablative coverage was in agreement with viability assessment based on TTC staining.During 5 out of 6 in vivo scenario, for instance the dielectric and thermal properties of this specific tumor type are not known. Nevertheless, the model is instructive for characterizing the approximate thermal profiles in soft tissue and thereby provide complementary information to the temperature profiles acquired during MR thermometry. While we have developed a suitable antenna for ablation of small tumor targets and characterized its performance, it is possible, that other applicator designs with different radiation patterns might also be appropriate for ablation of small tumor targets, and characterization of such devices is warranted ahead of their use in experimental studies.A limitation of the presented system is that it remains susceptible to large errors in temperature estimation due to motion. Presently, motion is managed by appropriately securing the animal within the imaging coil. Future studies may incorporate motion compensation techniques to further improve the robustness of MRI thermometry. We note that the utilized computational model is not a perfect representation of the ex vivo tissue, with an average mean absolute error of 0.86 \u00b0C across all samples. The system was further applied for in vivo heating of subcutaneously implanted HAC15 tumors in nude mice, where the ability to monitor temperatures at the tumor boundary allowed us to terminate the heating at a time specific to the geometry of each targeted tumor, and therefore to deliver target specific energy.We have developed a system for delivering microwave ablation to subcutaneous tumors in small animals integrated with MRI for real-time volumetric thermometry. We verified the accuracy of MRI-derived temperature measurements in agar phantom and Supplementary material"}
{"text": "Aims: The objective of this study was to assess the efficacy and potential mechanisms of Chinese herbal medicine (CHM) for treating coronary heart disease (CHD) patients with anxiety or depression.Methods: A systematic literature search was performed. Screening studies, extracting data, and assessing article quality were carried out independently by two researchers. The active ingredients of CHM for the treatment of CHD with anxiety or depression were analyzed by the network pharmacology, and the main potential mechanisms were summarized by the database of Web of Science.Results: A total of 32 studies were included. The results showed that compared with the blank control groups, CHM was more beneficial in treating anxiety or depression in patients with CHD , and the efficacy of CHM was not inferior to that of Western medicine (WM) . Additionally, CHM also showed a significant advantage in improving angina stability (AS) in CHD patients with anxiety or depression compared with blank groups  and WM groups . Angina frequency (AF) and electrocardiogram (ECG) analysis after using CHM demonstrated similar trends. Based on the network pharmacology, quercetin, kaempferol, luteolin, beta-sitosterol, puerarin, stigmasterol, isorhamnetin, baicalein, tanshinone IIa, and nobiletin were most closely and simultaneously related to the pathological targets of CHD, anxiety, and depression. The main underlying mechanisms might involve anti-damage/apoptosis, anti-inflammation, antioxidative stress, and maintaining neurotransmitter homeostasis.Conclusion: CHM exhibited an obvious efficacy in treating CHD patients with anxiety or depression, especially for improving the symptom of angina pectoris. The most active compounds of CHM could simultaneously act on the pathological targets of CHD, anxiety, and depression. Multiple effective components and multiple targets were the advantages of CHM compared with WM. Anxiety and depression are commonly found in patients with coronary heart disease (CHD), and the prevalence of CHD complicated with anxiety or depression is 21 and 13%, respectively . Percutavia which CHM treats CHD patients with anxiety or depression is still needed to be clarified. Therefore, by comprehensively analyzing published studies, a meta-analysis and systematic review were performed to assess the efficacy of CHM and the underlying mechanisms in the treatment of CHD patients with anxiety or depression, which might provide an essential clinical value for the disease management in the future.As an important treatment strategy, Chinese herbal medicine (CHM) is characterized by multiple components, multiple targets, and multiple channels. It has been verified that CHM had a satisfactory efficacy and fewer adverse effects on CHD with anxiety or depression . HoweverThis meta-analysis and systematic review were performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses Guidelines .Published articles were searched comprehensively in electronic databases  up to October 2021. \u201cCoronary disease OR coronary artery disease OR myocardial infarction OR acute coronary syndrome\u201d AND \u201canxiety OR depression OR depressive disorder\u201d AND \u201ctraditional Chinese medicine OR herbal medicine\u201d AND \u201crandomized controlled trial\u201d and their common synonyms were used for the searching strategy. The detailed searching strategy was shown in supplementary material.The inclusion criteria of the articles were as follows: 1) all participants met the diagnostic criteria of CHD with anxiety or depression; 2) the number of subjects in each group was not less than 30; 3) CHD patients in control and trial groups received basic treatments, with antianxiety or antidepressant Western medicine (WM) used (WM groups) or not (blank control groups) in control groups, and oral CHM was used in trial groups; 4) Hamilton anxiety scale (HAMA) and Hamilton depression scale (HAMD) were used to evaluate patients\u2019 anxiety and depression, respectively; and 5) the efficacy index of CHD included one of the following: \u2460 electrocardiogram (ECG); \u2461 angina stability (AS) and angina frequency (AF) come from Seattle Angina Questionnaire; and \u2462 traditional Chinese medicine syndrome (TCMS) score.The exclusion criteria of the studies were as follows: 1) Nonclinical study and irrelevant research; 2) CHM was used in control groups, antianxiety or antidepressant WM was used in trial groups; 3) articles with incomplete data; 4) articles more than one high-risk item; and 5) review, meta-analysis, and conference abstracts.Retrieved articles were assessed independently by two researchers (YT and SL) according to the inclusion and exclusion criteria. Data, including first authors\u2019 name, year of publication, sample size, age, gender, diseases, therapeutic regimen, final duration of treatment, dosage form and compositions of TCM, and the outcome index, were extracted from the included studies. The CHM was reported in scientific name, not the Latin name in pharmacopeia to avoid confusion  Rivera . Any disTwo authors (YL and YT) independently assessed the methodological quality according to the Cochrane risk-of-bias tool . Suffici2 < 50%), the fixed effect model was selected to analyze the data; otherwise, a random-effects model was applied. The subgroups analysis was based on whether control groups used WM or not. Sensitivity analysis was performed to explore potential effect modification. Also, funnel plots were used to assess publication bias. p < 0.05 was considered statistically significant.RevMan 5.3 software provided by the Cochrane Collaboration was used for meta-analysis. The odds ratio (OR) and standard mean difference (SMD) were used to analyze the pooled effects of dichotomous outcomes and continuous variable, respectively. When the heterogeneity of included studies was low  were summarized by the database of Web of Science.A total of 2,102 records were identified from eight electronic databases. Thirty-two studies met the inclusion criteria, and 2070 studies were excluded due to 1) irrelevant studies; 2) nonclinical studies; 3) review, meta-analysis, and conference abstracts; 4) sample size was less than 30; 5) using WM in trial groups; 6) non-HAMA or HAMD for evaluating the efficacy of anxiety or depression; 7) non-ECG or AS or AF or TCMS score for evaluating the efficacy of CHD; and 8) articles with incomplete data or more than one high-risk item. The specific screening process is illustrated in Thirty-two studies included 15 studies on CHD with anxiety  and 17 sFor control groups of CHD with anxiety, four studies used flupentixol and melitracen tablets , diazepaThe study methodological quality is concluded in As shown in p < 0.00001, I2 = 0%] , p = 0.52, I2 = 67%]. Moreover, a repetitive meta-analysis by consecutively excluding each study in WM groups was performed. The study by Qi et al. was the main source of heterogeneous, but it was not removed because of reasonable research design.In I2 = 0%] , and thep = 0.0002, I2 = 0%] , p = 0.002, I2 = 0%] , I2 = 0%] . In addiI2 = 0%] .p < 0.00001, I2 = 45%; AF: SMD = 0.71, 95%CI , p < 0.0001, I2 = 64%] , p < 0.0001, I2 = 62%], and WM groups  , 2 = 64%] , 5, blanI2 = 0%] , 5.As shown in p = 0.0003, I2 = 0%] , p = 0.18, I2 = 33%] , I2 = 0%] . The res2 = 33%] .p = 0.004, I2 = 0%] , p = 0.10, I2 = 0%] , I2 = 0%] . In addiI2 = 0%] .p < 0.00001, I2 = 0%; AF: SMD = 11.13, 95%CI , p < 0.00001, I2 = 6%] , p < 0.0001, I2 = 0%; AF: SMD = 10.34, 95%CI , p < 0.0001, I2 = 48%] , I2 = 6%] , 9, blan2 = 48%] , 9.Bupleurum chinense DC. , Glycyrrhiza uralensis Fisch. ex DC. , Ligusticum chuanxiong Hort. , Salvia miltiorrhiza Bunge , Angelica sinensis (Oliv.) Diels , Paeonia lactiflora Pall. , Pinellia ternata (Thunb.) Makino , Curcuma aromatica Salisb. , and Citrus\u00d7aurantium L.  were commonly used for treating CHD with anxiety or depression  were searched in the Web of Science database. As shown in \u03b2/6, tumor necrosis factor-\u03b1, vascular cell adhesion molecule-1, intercellular adhesion molecule-1, E-selectin, or elevating the IL-10 level in CHD patients. The anti-inflammatory role of quercetin, puerarin, or nobiletin was reported in anxiety or depression. Additionally, almost all active ingredients except stigmasterol and nobiletin possessed the functions of antioxidative stress and balancing level of reactive oxygen species, malondialdehyde, myeloperoxidase, and catalase, superoxide dismutase, glutathione. Quercetin, tanshinone IIa, and nobiletin were reported to reduce the levels of \u03b1-smooth muscle actin, angiotensin II, collagen I/III, matrix metalloproteinases 2/9, transforming growth factor (TGF)-\u03b2, and Smad7 to prevent myocardial fibrosis, which was one of the complications associated with myocardial infarction. Besides, the imbalance of adrenocorticotropic hormone, 5-hydroxytryptamine, brain-derived neurotrophic factor (BDNF), acetylcholine, noradrenaline, dopamine, and gamma-aminobutyric acid, which caused anxiety or depression, could be regulated by quercetin, kaempferol, luteolin, beta-sitosterol, puerarin, stigmasterol, baicalein, tanshinone IIa, or nobiletin. Isorhamnetin and baicalein could improve the depression by inducing neuronal differentiation and protecting synaptic plasticity, respectively. The roles of active compounds in regulating autophagy and improving mitochondria were also reported. Overall, the related mechanisms of TCM-active compounds in treating CHD with anxiety or depression contained a variety of signaling pathways, such as nuclear factor-kappa B, mitogen-activated protein kinase, Jun N-terminal kinase, extracellular signal-regulated kinase1/2, signal transducers and activators of transcription3, TGF-\u03b21/Smad3, phosphatidylinositol 3-kinase/protein kinase B, and BDNF.The related mechanisms of these top 10 active ingredients in CHD, anxiety, and depression are summarized in There is accumulating evidence showing high prevalence of anxiety and depression comorbidities in patients with CHD. SSRIs and benzodiazepines are frequently used for treating depression or anxiety disorders, and the effectiveness of these drugs on psychiatric disorders has also been acknowledged . HoweverTCM has been reported to be effective in treating CHD, anxiety, and depression with a less adverse effect, and might be a potential therapeutic option for patients with subsyndromal anxiety or depression. However, the efficacy and benefit of CHM in treating CHD with anxiety or depression still need to be further verified due to poor methodological quality and potential confounding factors. This meta-analysis and systematic review was performed to provide the evidence for the application of CHM in CHD patients with anxiety or depression. Thirty-two studies  were included for the evaluation of the efficacy of CHM. The results showed that CHM had a significant benefit on anxiety and depression in CHD patients, and its efficacy was not inferior to that of WM. Importantly, CHM also had a significant advantage to alleviate the angina symptom compared with blank control and WM groups. Besides that, there were no obvious adverse effects of CHM in the included studies .Bupleurum chinense DC. , Glycyrrhiza uralensis Fisch. ex DC. , Ligusticum chuanxiong Hort. , Salvia miltiorrhiza Bunge , Angelica sinensis (Oliv.) Diels , Paeonia lactiflora Pall. , Pinellia ternata (Thunb.) Makino , Curcuma aromatica Salisb. , and Citrus\u00d7aurantium L.  were commonly used for CHD with anxiety and depression. The phytochemicals identified in the CHM could act on the pathological targets of CHD, anxiety, and depression simultaneously.Furthermore, the frequency of CHM used in the included studies was analyzed, and the commonly used drugs were analyzed by network pharmacology. The results concluded that the CHM regulating Qi and promoting blood circulation, including Inflammatory response to vascular injury participates in the pathological processes of the atherosclerosis and CHD, and is associated with the increased risk of cardiovascular events and recurrent myocardial infarction . OxidatiOverall, these findings reveal that the CHM has a satisfactory efficacy for CHD with anxiety and depression, especially for improving the symptom of angina pectoris. Of importance, CHM itself contains multiple components that play critical functions in a large number of signaling pathways involved in distinct biological processes of CHD with anxiety or depression mainly including anti-damage/apoptosis, anti-inflammation, antioxidative stress, and maintaining neurotransmitters homeostasis. Compared with WM\u2019s single effect on the nervous system, CHM may extert its functions in multiple places and systems by targeting distinct factors in CHD with anxiety or depression to improve both CHD and anxiety/depression syndromes.First, the sample size in each group of included studies was not more than 50, except the study by CHM had a significant efficacy for the treatment of CHD patients with anxiety or depression. Particularly, CHM could improve the symptoms of angina pectoris while alleviating anxiety and depression. The main mechanisms underlying the functions of these CHM-active ingredients might involve anti-damage/apoptosis, anti-inflammation, antioxidative stress, antifibrosis, maintaining neurotransmitters homeostasis, and regulating autophagy."}
{"text": "To develop and make available, at no cost to the user, Information and Communications Technology (ICT) tools for Dentistry, providing dental information and advice geared toward patients undergoing orthodontic treatment with fixed appliances.A Dentistry-based content that contemplated information and advice concerning orthodontic treatment with fixed appliances was elaborated. The materials, which included instructions on oral hygiene and treatment strategies when faced with possible complications, were evaluated and validated by specialists, whose assessments reached a 85% approval. From the validated content, products using four distinct ICT tools were formulated.The following technological products were developed: a program for community radios, three blog posts, four educational and informative videos, and a smartphone application - using texts, as well as images and videos. These ICT tools, geared toward patients wearing fixed orthodontic appliances, were made available by internet at no cost to the user, and the number of accesses is already expressive.These technological-scientific tools, developed and provided freely to the population, can aid patients during their treatment with fixed orthodontic appliances, contributing to the dissemination of reliable information, and clarifying doubts that may arise during orthodontic therapy. These free ICT tools serve to facilitate access to scientific knowledge, thereby favoring social inclusion, bearing in mind that this educational and informative material was offered in a simple and accessible manner to the general population. In this context, and resisting to decades of change, radio programs continue to be a widely renowned communication strategy for social, cultural, and healthcare development of many communities.,Dental professionals need to instruct their patients, help them to understand the importance of the recommendations given, and motivate them to maintain treatment adherence. In practice, this need has proven to be particularly difficult in Orthodontics, due mainly to the young age of most patients, and to the long period of time required for treatment.,However, the variety of content related to Dentistry disseminated on the internet present a questionable quality of information, which is often unreliable.Pontif\u00edcia Universidade Cat\u00f3lica de Minas Gerais (CAAE #11137119.7.0000.5137).Among a wide range of information and guidelines related to orthodontic treatment with fixed appliances - considering its pertinence, the greater amplitude provided, and thinking about the different steps of the process -, a content was created, based on scientific evidence, which contemplated guidelines including recommendations on patients\u2019 collaborative behavior, instructions on oral hygiene, and procedures to be taken when faced with unfavorable orthodontic complications. The present study was approved by the Research Ethics Committee of In an attempt to make a truly appropriate content available, its validation was conducted by means of an analysis performed by a committee of specialists, Masters and Doctors in Orthodontics, members of the Brazilian Association of Orthodontics , who were lecturers or consultants in post-graduate programs in different universities. This process was based on a prior study, which reported that at least six specialists, called \u201cjudges\u201d, should examine the following criteria:\u00bb Clarity of language: analyze if the textual content is clear, easily understandable, and appropriate for the target population.\u00bb Theoretical relevance: consider the association between content and theory.\u00bb Practical pertinence: evaluate if the content is appropriate for the public for which it has been created.\u00ae, were sent, via e-mail, to 10 possible judges. The answers for the questionnaire were constructed following the Likert scale, with five alternatives: 1) Strongly disagree, 2) Disagree, 3) Neither agree nor disagree, 4) Agree, 5) Strongly agree. In addition to the use of this scale, a space was also created for the judges to provide criticisms, suggestions, and recommendations, which is a common procedure in validation studies.,,Invitation letters, together with the elaborated material  and a virtual validation questionnaire , createdBearing in mind that the evaluation reached an average of 85% approval among the specialists , a new vFrom the validated material, ICT tools for Dentistry were developed, enabling the production of: one community radio program; three blog posts; four videos; and, considering the broad popularity of mobile devices with internet access, one smartphone application.The community radio program scripts were drafted  using thA smartphone application was also developed, seeking to surpass physical and management barriers of dental care. One prototype was designed, considering functionalities, layout, and content. Among the functionalities, features such as the patient\u2019s intuitive navigation and easy interaction were added. The layout was idealized to be \u201csimple\u201d and \u201cpractical\u201d, facilitating the navigation. As regards the provided information, the validated content was organized using not only texts, but also images and videos.The application was developed for the Android platform, which is an operational system that is highly compatible with smartphones of different brands. Tools made available by Google, such as the Android Studio development environment, were used. In addition to this environment, the Firebase development platform was also used, which is also provided by Google. The source code of the algorithms for the application was written in Java language. As user data were obtained, the SHA and MD5 algorithms  were also used. The graphics were generated in XML (Extensible Markup Language), producing a great capacity of interaction with the user.As the layout is the visual part of the system, menu items, buttons, and so forth were used, as is recommended by Google in its development documentation. The images and icons were generated according to the Google documentation specifications. The source project of the application was then stored in a closed repository in GitHub. Both the prototype and the development source code were registered at the National Institute of Industrial Property , and the name \u201cOrthoHelp\u201d was chosen for the application.During all stages of development of these technological tools, it was valued that, in addition to being reliable, the content should be accessible. In this way, all the tools were made available for free.The drafted and validated content was made available using the following ICT tools: radio, blog, videos, and smartphone application.\u201cI\u2019m undergoing orthodontic treatment with braces. What should I be doing in terms of oral hygiene?\u201d .,,The content was also structured to attend to the specificities of a blog. In the field of health, blogs have become quite widespread as a means of communication since 2010.-,TM.TM about the specialty are weak. More accessible information, such as oral health care during orthodontic treatment, can be easily disclosed and shared by any user on YouTubeTM, and the fact that the information is often not provided by a dental professional confers a high probability of imprecision and unreliability to the recommendations provided.,,TM can improve the knowledge of the patient about the orthodontic treatment, when compared with information provided in leaflets or by verbal communication, and have the advantage of being able to be accessed at any time on any mobile device with internet connection, such as smartphones.The use of educational videos for health promotion has been investigated.,Mobile technology has become a common reality in daily life and has been influencing a new way of exchanging information and interactivity among its users. Smartphones and its applications have very quickly become accessible to the majority of the population, and the development of an application for mobile telephones in the field of health explores the possibility of crossing geographic and cultural barriers.Participants of a study that evaluated preferences related to the use of applications, such as educational aids for patients undergoing orthodontic treatment, reported that the applications for dental education should be used for a better communication between dentist and patient, and to increase the patients\u2019 understanding of the dental procedures that they are undergoing.,,Notably, oral hygiene conducted in an appropriate manner can be used as an effective preventive measure against caries and to control periodontal disease and, even though it is a relatively simple action, it is constantly neglected.ICTs are widely used in health, even among the less favored social classes, and faced with this social relevance, the dissemination of reliable and precise information in oral health care needs to be encouraged and expanded.Technological products, provided at no cost to the users through specific free ICT tools, make it possible to facilitate the access to scientific knowledge, which is of utmost importance, especially in terms of social inclusion. In addition, they provide alternative and complementary means of education and encouragement of health care, which can contribute to the quality of life of patients undergoing treatment with fixed orthodontic appliances.By providing a wide range of technical tools created in this study , it is our intent to contribute to advances in the concession of information to the general population, fact that can be corroborated by the large number of accesses, downloads and views  to the content developed here. These tools can favor the patient\u2019s understanding of the explanations provided by dentists, which can instill a greater peace of mind, security, and comfort during orthodontic therapy for both patients and dental professionals."}
{"text": "Bladder cancer has the characteristics of high morbidity and mortality, and the prevalence of bladder cancer has been increasing in recent years. Immune and autophagy related genes play important roles in cancer, but there are few studies on their effects on the prognosis of bladder cancer patients.Using gene expression data from the TCGA-BLCA database, we clustered bladder cancer samples into 6 immune-related and autophagy-related molecular subtypes with different prognostic outcomes based on 2208 immune-related and autophagy-related genes. Six subtypes were divided into two groups which had significantly different prognosis. Differential expression analysis was used to explore genes closely related to the progression of bladder cancer. Then we used Cox stepwise regression to define a combination of gene expression levels and immune infiltration indexes to construct the risk model. Finally, we built a Nomogram which consist of risk score and several other prognosis-related clinical indicators.The risk model suggested that high expression of C5AR2, CSF3R, FBXW10, FCAR, GHR, OLR1, PGLYRP3, RASGRP4, S100A12 was associated with poor prognosis, while high expression level of CD96, IL10, MEFV pointed to a better prognosis. Validation by internal and external dataset suggested that our risk model had a high ability to discriminate between the outcomes of patients with bladder cancer. The immunohistochemical results basically confirmed our results. The C-Index value and Calibration curves verified the robustness of Nomogram.Our study constructed a model that included a risk score for patients with bladder cancer, which provided a lot of helps to predict the prognosis of patients with bladder cancer.The online version contains supplementary material available at 10.1186/s12863-022-01073-7. Bladder cancer (BLCA) is a high-incidence tumor which has high morbidity and mortality. According to statistics, BLCA ranks ninth in the prevalence of malignant diseases and 13th among the most common causes of cancer death [For the past decades, BLCA has made many advances in clinical treatment. Gene sequencing technology has identified the most mutated genes in BLCA. Many studies have researched the treatment of BLCA at the level of cells and molecular mechanism . MeanwhiMost of the immunomodulatory effects of immunotherapy are achieved by enhancing T cell responses. Although immunotherapy has brought many new breakthroughs to the treatment of tumors, only a small proportion of patients profit from it, which highlight the necessity of identifying new cells and new molecules , 5. For In many cancers, the regulations of autophagy play important roles. Autophagy plays dynamic inhibitory or promotion effects in different stages of tumors. Therefore, understanding how autophagy regulates metabolism and tumor growth is essential for tumor treatment , 8.In recent years, methods of bioinformatics and data mining have been increasingly applied to various medical researches. In the field of oncology, researchers have achieved many clinically meaningful results using these methods. Xie et al. found and confirmed the significant role of ITPA in uveal melanoma through bioinformatics analysis and cell experiments, which provided a certain reference for the diagnosis and treatment of uveal melanoma .In the present study, immune genes and autophagy genes were collected. We utilized gene expression data from two commonly used databases (The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO)) to construct BLCA molecular subtypes based on immune-related and autophagy-related genes. It showed that these subtypes distinguished well among patients with different prognosis of BLCA , 11. Thrhttps://portal.gdc.cancer.gov/). The gene expression data consisted of 166, 116 BLCA samples from GSE13507 and GSE48276 datasets were downloaded from GEO database (http://ncbi.nlm.nih.gov/geo/), respectively. We conducted preliminary screening of the downloaded original data according to the following criteria: (1) genes with zero expression in more than 30% of the samples were excluded; (2) excluding the genes whose expression values were lost; (3) excluding the samples without related clinical data; (4) excluding the samples with OS <\u200930\u2009days; (5) excluding non-tumor tissue samples. We divided the TCGA-BLCA dataset into two random cohorts according to the ratio of 3 to 1: training cohort (n\u2009=\u2009307) and internal validation dataset (n\u2009=\u2009102). GSE13507 and GSE48276 datasets were regarded as external validation cohorts. Then, we downloaded 2208 human immune genes and autophagy genes from the Reactome database (https://reactome.org/) [The TCGA-BLCA dataset included the RNA-seq data of 410 BLCA and 37 adjacent normal samples was downloaded from the TCGA database (me.org/) .Based on the 2208 genes selected above, those screened training cohort samples were clustered according to the non-negative matrix factorization (NMF) in R package \u201cNMF\u201d. Moreover, we used Cibersort to calculate the immune infiltration scores of the subtypes for molecular subtype analysis .P\u00a0<\u00a00.05 and FDR\u2009<\u00a00.25).We utilized the R package \u201cDESeq2\u201d to compute the differentially expressed genes (DEGs) according to the criteria FDR\u2009<\u00a00.05 and FC\u2009>\u00a01.5. Gene Ontology (GO) Term Enrichment Analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Analysis were conducted based on the DEGs \u201316. MoreP\u2009<\u20090.05 was considered significant statistically. Then, we utilized Cox stepwise regression to further narrow the variables obtained above. Finally, a risk score model including variables weighted by their Cox stepwise coefficients was established. According to the formula: risk score\u2009=\u2009h0(t)*\u03b2variable(n)), we figured up the risk score for each sample, separately. A TCGA-BLCA internal verification cohort and two GEO external verification cohorts were used to verify the credibility of the model, respectively. In order to further evaluate the robustness of the model, we used the R package of \u201cpROC\u201d to plot the risk score distribution of each cohort according to the risk score of each sample. According to the different risk scores of samples, samples with scores greater than zero were put in high-risk group, samples with scores less than zero were put in low-risk group. The Kaplan-Meier (KM) survival curve was used to perform the OS of each group and the log-rank test was used to compare the survival differences between the samples of high-risk group and low-risk group.We used above DEGs expression data to build a risk score model. Univariate Cox survival analysis in R studio was used to analyze the correlation between each DEG, immune infiltration score and OS of the BLCA patients. Wald test P\u2009<\u20090.001). We analyzed the pTNM staging of patients in high-risk group and low-risk group. After excluding patients without pTNM staging and TX, NX, and MX staging, we found no significant difference in pTNM staging between the two groups. (P\u00a0>\u20090.05) (Table SP\u00a0<\u20090.01)  Table S. T cellsStaphylococcus aureus infection . Then, we used the ROC curve to test the prediction efficiency of the risk model. Fig. P\u00a0<\u20090.05). Except that the influences of the expression levels of FBXW10 and IL10 on prognosis were inconsistent with our conclusion, the other results above all confirmed our view.According to the training cohort of TCGA-BLCA dataset, the risk model was constructed. By performing univariate Cox regression analysis for each variable, we found that a total of 29 variables were significantly associated with the prognosis of BLCA patients. To establish our risk model, Cox stepwise regression was used to further screen the variables. Finally, a model with 15 variables was selected. Risk score of each sample is shown in Table SP\u00a0<\u20090.001), and the low-risk group was better than the high-risk group. Then, we drew ROC curve of the risk model, AUC of the model was 0.815 . Then we further performed Cox stepwise regression analysis on the above four risk factors, and the results showed that age, tumor stage and risk score were independent risk factors for OS. The nomogram was shown in Fig.\u00a0We screened for prognostic risk factors from clinical information collected from the training cohort samples. After univariate Cox regression analysis, Age, tumor stage, N stage and risk score were found to be risk factors for OS  mediates multiple immune system functions, including degranulation, endocytosis, phagocytosis, cytokine synthesis, and cytokine release . As a reGHR may be implicated in many types of cancer. Studies related to gastric cancer have shown that GHR regulated the G1 cell cycle progression by mediating the PI3K/AKT signaling pathway, thereby regulating the growth and apoptosis of gastric cancer cells . Strous IL10 is thought to have the ability to suppress antitumor T cell responses in cancer, but several researches have also suggested that IL10 took part in some inherent antitumor T cell responses. It indicates that IL10 may play a dual regulatory role in cancer . In our Studies related to chronic non-bacterial osteomyelitis indicated that the frequency of MEFV gene mutations increased in the disease, and the disease phenotype was more severe in patients with MEFV gene mutations . In addiLOX-1 encoded by the OLR1 gene is involved in the pathogenesis of atherosclerosis, and activation of LOX-1 is an important mechanism leading to plaque instability and progression to acute coronary syndrome . MeanwhiAt present, there are relatively few studies on PGLYRP3. According to research, PGLYRP3 acted a pivotal part in antibacterial immunity and inflammatory responses , 40. In According to research, RASGRP4 was significantly overxpressed in diffuse large B cell lymphoma. Meanwhile, knockdown of RASGRP4 significantly inhibited tumor formation . StudiesS100A12 was proved to be a useful biomarker in inflammatory conditions. And some studies suggest that it might also take part in cardiovascular disease . In cancImmunity and autophagy play important roles in tumors. Our study identified twelve genes associated with immunity and autophagy and three Cibersort immune infiltration scores that were significantly associated with bladder cancer prognosis. On this basis, we established a model to predict survival in patients with BLCA. There are some limitations to our study. First, the genes we defined were validated only by immunohistochemistry in the HPA database. Although the immunohistochemical data in the HPA database and the gene expression data in the TCGA are of relatively high quality, the data we used were from urothelial carcinoma and were not 100% representative of bladder cancer. Second, immunohistochemical information of FBXW10, MEFV, OLR1 and RASGRP4 were missing in HPA. The high expression of IL10 was detrimental to prognosis, which was inconsistent with our findings. Besides, the functions of these genes in bladder cancer need to be further explored. For BLCA patients with T1G3 stage, Bacillus Calmette-Guerin (BCG) treatment and response to BCG have important influence on the prognosis of patients. Unfortunately, our study did not have enough data at this point to make a credible statistical analysis, which was one of the limitations of this study. At the same time, genetic mutations may also have a significant impact on the prognosis of patients with bladder cancer. In many tumors, mutations in one or more genes have been shown to be significantly associated with prognosis. Unfortunately, we did not explore the genetic mutations in high-risk and low-risk patients.Additional file 1: Table S1. The difference of pTNM staging between high-risk group and low-risk group was significant.Additional file 2: Table S2. The difference of immune infiltration index between high-risk group and low-risk group was significant.Additional file 3: Table S3. 2208 immune-related and autophagy-related genes.Additional file 4: Table S4. Differentially expressed genes.Additional file 5: Table S5. GSEA KEGG enrichment.Additional file 6: Table S6. Risk score of each sample from the training cohort.Additional file 7: Table S7. Regression coefficient for each variable."}
{"text": "Kidney cancer is one of the most common urological cancers worldwide, and kidney renal clear cell cancer (KIRC) is the major histologic subtype. Our previous study found that von-Hippel Lindau (VHL) gene mutation, the dominant reason for sporadic KIRC and hereditary kidney cancer-VHL syndrome, could affect VHL disease-related cancers development by inducing telomere shortening. However, the prognosis role of telomere-related genes in kidney cancer has not been well discussed. In this study, we obtained the telomere-related genes (TRGs) from TelNet. We obtained the clinical information and TRGs expression status of kidney cancer patients in The Cancer Genome Atlas (TCGA) database, The International Cancer Genome Consortium (ICGC) database, and the Clinical Proteomic Tumor Analysis Consortium (CPTAC) database. Totally 353 TRGs were differential between tumor and normal tissues in the TCGA-KIRC dataset. The total TCGA cohort was divided into discovery and validation TCGA cohorts and then using univariate cox regression, lasso regression, and multivariate cox regression method to conduct data analysis sequentially, ten TRGs  risk model had been constructed finally. The kidney patients in the high TRGs risk group represented a worse outcome in the discovery TCGA cohort (p<0.001), and the result was validated by these four cohorts . In addition, the TRGs risk score is an independent risk factor for kidney cancer in all these five cohorts. And the high TRGs risk group correlated with worse immune subtypes and higher tumor mutation burden in cancer tissues. In addition, the high TRGs risk group might benefit from receiving immune checkpoint inhibitors and targeted therapy agents. Moreover, the proteins NEK6, RF2, and ISG15 were upregulated in tumors both at the RNA and protein levels, while PLCL1 and PRKCQ were downregulated. The other five genes may display the contrary expression status at the RNA and protein levels. In conclusion, we have constructed a telomere-related genes risk model for predicting the outcomes of kidney cancer patients, and the model may be helpful in selecting treatment agents for kidney cancer patients. Kidney cancer is one of the most common urological cancers worldwide, and kidney renal clear cell cancer (KIRC) is the major histologic subtype , 2. The Telomeres are regions composed of repetitive TTAGGG DNA sequences and shelterin complex located at the end of chromosomes . TelomerMoreover, many studies have been conducted to investigate the role of telomeres in the development and progression of cancers. Recent findings suggest that the shortening telomeres can affect the process of cancer development in two different ways. First, telomere shortening might play a tumor-suppressive role by arresting cell proliferation. On the other hand, telomere shortening could also result in extensive genome instability, which promotes cancer progression. In breast cancer, long telomere lengths correlated with a better prognosis . A meta-Previous studies have focused on the telomere length in cancers and its role in the prognosis of cancers. There has been no study done to investigate telomere-related genes in the prognosis of cancers. Herein, we constructed a risk model using telomere-related genes to predict the prognosis of kidney cancer and then evaluated the potential role of this risk model in selecting treatment agents.http://www.cancertelsys.org/telnet/ (Kidney cancer patients\u2019 data files from The Cancer Genome Atlas (TCGA) dataset (TCGA-KIRC cohort), The International Cancer Genome Consortium (ICGC) database (RECA-EU cohort), and Clinical Proteomic Tumor Analysis Consortium (CPTAC) database (PDC000127) were downloaded and processed according to the operational processes of the public data provider. All the data in the TCGA-KIRC cohort were enrolled in this study to screen the differential expression genes. The analysis included the mRNA expression data and exact clinical features in all patients from these three datasets, including the survival time and tumor characteristics. The tumor mutation burden (TMB) data of the TCGA-KIRC cohorts were also downloaded and processed. In addition, the protein expression status of the CPTAC cohort and the immunohistochemical (IHC) data of renal cancer in the Human Protein Atlas (HPA) database were also acquired. In addition, the telomere-related genes were obtained from /telnet/ .The RNA sequence profiles of 533 kidney cancer tissues and 72 adjacent normal kidney tissues were used for screening the differential genes using the limma package . TelomerThe TCGA-KIRC cohort was randomly divided into the discovery TCGA cohort and the validation cohort in a 1:1 ratio. The discovery TCGA cohort was analyzed sequentially through univariate cox regression, Lass regression, and multivariate cox regression. Subsequently, the risk model was constructed based on the genes\u2019 expression value and the coefficient, which were acquired in the multivariate cox regression using the Akaike Information Criterion (AIC) method. The risk score of each patient was calculated in these five cohorts: discovery TCGA cohort, validation TCGA cohort, total TCGA cohort, ICGC cohort, and CPTAC cohort. Each cohort was divided into two groups, the high-risk group, and the low-risk group, according to the median risk score, and the prognosis of each risk group was examined using the log-rank test. The risk score was also evaluated using univariate and multivariate cox regression to determine its role in predicting the overall survival of kidney cancer patients in the five cohorts. In addition, the receiver operating characteristic (ROC) curve was used to check the accuracy of the risk model in predicting the prognosis. Finally, a nomogram was constructed to predict the 1-, 3-, and 5-year survival rates using the risk score based on the total TCGA cohort.https://cibersort.stanford.edu/) (https://tide.dfci.harvard.edu/)  . The immrd.edu/) . Additiord.edu/) .The targeted drugs\u2019 half-maximal inhibitory concentrations (IC50) were predicted using the gene expression level to reflect the treatment sensitivity. This was done using the R package named \u201cpRRophetic\u201d , 24.\u2212\u0394\u0394Ct method and normalized with the beta-actin  and six RCC cell lines  were used to investigate the telomere-related gene expression status. Among these cell lines, 769-P, A498, 786-O, and OSRC-2 were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum. While HK2, Caki-1, and ACHN were cultured in DMEM medium with 10% fetal bovine serum. TRIZOL reagent  was used to extract the total RNA, and the reverse transcription reactions were carried out using a qPCR RT Kit . Expression levels of telomere-related genes were detected by qRT-PCR). The human beta-actin gene was used as a reference gene. The primers were shown in ta-actin .The expression of proteins encoded by the genes included in the telomere-related genes model in the CPTAC cohort was compared using the limma package. In addition, the protein expression status of renal cancer and kidney tissues in the HPA database was accessed and analyzed using the \u201cHPAanalyze\u201d package . Continu2 = 0.84, P<0.001, The detailed characteristics of the three cohorts are summarized in the Among the 353 differential expression genes, 47 genes correlated with kidney cancer patients\u2019 overall survival in the discovery TCGA cohort. Then 19 genes in these 47 genes were finally screened by Lasso regression. Finally, ten telomere-related genes  in these 19 genes were identified as independent risk factors through the multivariate cox regression and were used to format the risk model, telomere related genes (TRGs) risk model. And the TRGs risk score formula was as follows: risk score=0.005134398*ISG15 +0.047733021*RFC2-0.071026696*TRIM15-0.0203981*NEK6-0.133649782*PRKCQ-0.007396692*A TP1A1+0.700714514*ELOVL3+0.206037577*TUBB2B-0.148322187*PLCL1+0.070770091*NR1H3. The risk score of patients in five cohorts was computed, and the patients in each cohort were divided into a high and low-risk group according to each cohort\u2019s median risk score value. The patients in the high-risk group represent the worse outcomes in all these five cohorts, discovery TCGA cohort (p<0.001), validation TCGA cohort (p<0.001), total TCGA cohort (p<0.001), ICGC cohort (p=0.018) and CPTAC cohort (p=0.003) 3. In adThe patients in the high-risk group showed a higher TMB (P=0.0023) than those in the low-risk group , and macrophages M0 had a higher rate of infiltration in the high-risk group than in the low-risk group. T cells CD4 memory resting, monocytes, macrophages M2, dendritic cells resting, and mast cells resting showed less infiltration in the high-risk group than in the low-risk group , C2 (IFN-g dominant), C3 (inflammatory), C4 (lymphocyte depleted), C5 , and C6 (TGF-b dominant) . The immThe TIDE score was significantly higher in the high-risk group than in the low-risk group  with a worse outcome than in the low-risk group (3%). In addition, the high-risk group showed a high TIDE score, indicating that the high-risk group patients may be more likely to experience an immune escape. Overall, the results suggest that the differences in prognosis between the high and low-risk groups might be partly due to the different immune statuses of the patients.High TMB has been identified as a biomarker to predict the potential benefit of immune checkpoint blockade (ICB) therapy. Our study showed that the high-risk group was associated with a high TMB . The dru+/K+ATPase. Studies have found that ATP1A1 mutations could cause aldosterone-producing adenoma (APA). Inhibiting ATP1A1 expression in pancreatic ductal adenocarcinoma (PDAC) cells can suppress the tumor invasion. In kidney cancer, the promoter methylation rate of ATP1A1 was about 15.8% . We have discussed the protein and RNA expression status of these genes in kidney cancer; however, there were no experiments to validate our findings. The model we have constructed may be helpful in the selection of treatment agents for kidney cancer patients.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.Conceived and designed the experiment: X-HN, S-CL. Performed the experiments and analyzed the data: X-HN, S-CL, Z-KJ. Interpretation of the findings: X-HN, S-CL, Z-KJ and J-JY. All authors contributed to the article and approved the submitted version.This work was supported by the Postdoctoral Research Grant in Henan Province (grant number 1901004), the Henan Science and Technology Research Program (grant number 2018020142), and The Natural Science Foundation of Henan Province (212300410265). The funders had no role in study design, data collection and analysis, decision to publish, or manuscript preparation.https://www.cancer.gov/tcga), ICGC database (https://dcc.icgc.org/), and CPTAC (https://proteomic.datacommons.cancer.gov/pdc/study/PDC000127).The results shown here are in whole or part, based upon data generated by the TCGA Research Network (The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Background and Aims: Heart rate variability (HRV), i.e., the beat-by-beat fluctuations in heart rate (HR) reflecting the autonomic nervous system balance, is altered in patients with diabetes. This has been associated with arterial aging (stiffer arteries) and differs in men and women. The present study hypothesized that the impact of HRV on arterial aging, indexed as carotid\u2013femoral pulse wave velocity (PWV), differs in a gender-specific manner and is affected by diabetes mellitus. Method: A total of 422 outpatients (187 women and 235 men) were studied. PWV was measured using the validated SphygmoCor device . Time-domain and frequency-domain parameters were measured to assess HRV. Results: The prevalence of diabetes was 30.8% with a slight, but nonsignificant, greater prevalence in men. Both age and SBP were independent determinants of PWV in each of the four groups (men and women with or without diabetes). Low-frequency activity was inversely correlated with PWV. It was greater in women without diabetes, but it was not significant in men regardless of the presence of diabetes. Conclusions: Beyond age, blood pressure, and diabetes, impaired cardiac autonomic function assessed by determination of HRV was significantly associated with arterial aging. The association between lower sympathetic and parasympathetic activity and stiffer arteries was significant in women, but not in men. An aging population is accompanied by emerging cognitive impairment  and a drThe prevalence of type 2 diabetes mellitus is increasing worldwide and significantly impacts on CV mortality . PreviouTo better characterize factors contributing to the modulation of arterial stiffness, we studied heart rate variability (HRV), i.e., the beat-by-beat fluctuations in heart rate (HR). HRV reflects the autonomic nervous system balance on the heart and is an indicator of CV risk  and mortAlterations in HRV are common in diabetes  and haveThe aim of the present study was to characterize gender-differences with regard to the impact of HRV on arterial stiffness and whether they differ according to the presence of diabetes.The study population consisted of subjects who visited our Outpatient Clinic for evaluation of their blood pressure levels. Therefore, the study population resulted in a combination of subjects who resulted hypertensive and/or were undergoing a periodic follow-up of their condition and of subjects who were \u201cunaffected\u201d/healthy, often undergoing the visit as requested by their fitness center. Patients were excluded if they had cancer, acute myocardial infarction in the previous 6 months, hepatic or cardiac failure, serum creatinine \u22652 mg/dL, secondary hypertension, or thyroid disease. Additional exclusion criteria were a previous large vessel stroke and atrial fibrillation, since its presence interferes with the accuracy of aorta stiffness measurement.After informed consent was given, all patients underwent a medical history, a clinic visit, urinalysis, electrocardiography, and traditional CV risk factor measurements.We analyzed 422 patients presenting complete measurements of all the parameters investigated. All the measurements were collected at the same visit. These patients will represent the study population of the current study.2.Hypertension was defined as the intake of antihypertensive medications and/or if the average of three blood pressure (BP) measurements taken at 5 min interval was \u2265140 for SBP or \u226590 mm Hg for DBP. Diabetes was defined as the previous diagnosis and/or use of antidiabetic medications. Body mass index (BMI) was calculated as body weight (kg)/height (m)Aorta stiffness was assessed non-invasively by the carotid\u2013femoral PWV. PWV was measured using the validated SphygmoCor device , whose validation and reproducibility have been previously published . Pulse tHRV was measured with the AtCor Medical HRV software to assess sympathetic/parasympathetic autonomic function. A standard 2 min electrocardiogram recording was performed with the patient in the supine position, with a regular and calm breathing pattern (5 min resting study) in a quiet room.Time domain measures are the mean and standard deviations of RR intervals recorded by the continuous electrocardiogram, where NN intervals represent all the RR intervals. The time domain of HRV was evaluated using the root mean square of successive differences between normal heartbeats (RMSSD) (m/s), which provides an estimate of the short-term components of HRV; the lower this vagal index, the greater the CV burden and the percentage of adjacent NN intervals that differ from each other by more than 50\u2009m (pNN50) (%), which reflects alterations in autonomic function that are primarily vagally mediated and that are virtually independent of circadian rhythms.\u2212power spectral density at the high-frequency (HF) range (0.15\u20130.4 Hz);\u2212power spectral density at the low-frequency (LF) range (0.04\u20130.15 Hz);\u2212the LF/HF ratio.The frequency domain of HRV consists of the spectral analysis of a series of consecutive RR intervals in order to quantify sympathetic and vagal influences on the heart. The evaluated parameters were:Vagal activity is the major contributor to the HF component and to the time-domain parameters, while LF reflects both sympathetic and vagal activity; the ratio LF/HF is considered to mirror sympathovagal balance .All analyses were performed using SAS University Edition.PROC UNIVARIATE was adopted to test for normality. Both the Kolmogorov\u2013Smirnov test and Shapiro\u2013Wilk test revealed that the measured variables were not normally distributed; therefore, differences between men and women were compared by the Wilcoxon rank sum test or Mann\u2013Whitney U test (PROC NPAIR1WAY wilcoxon).Multiple linear regression models were constructed to identify the association of HRV with PWV\u2014separately in men and women, with and without diabetes\u2014independent of age, hypertension, and BMI. SBP, DBP, HR, RMSDD, LF, HF, and LF/HF were all introduced as covariates. Backward elimination was adopted to achieve a more parsimonious model.An ANCOVA analysis was employed to test for interaction between sex and diabetes.p value < 0.05 indicated statistical significance.A two-sided The study population consisted of 422 patients (187 women and 235 men). The prevalence of diabetes was 30.8% with a slight, but nonsignificant, greater prevalence in men.As illustrated in Multiple linear regression models were constructed to identify the significant determinants of arterial stiffness, indexed as PWV, according to sex and diabetic status. Regression model were adjusted for age, hypertension, and BMI. SBP, DBP, HR, RMSDD, LF, HF, and LF/HF were all introduced as covariates. Backward elimination of nonsignificant variables was adopted to achieve a more parsimonious model.The regression coefficient (with standard error) between the statistically significant factors in multivariable regression models and PWV are illustrated in To identify whether the impact of LF on PWV differed in men and women with or without diabetes, an ANCOVA analysis was conducted with interaction terms: sex \u00d7 LF (does the correlation between LF and PWV differ in men and women?); diabetes \u00d7 LF (does the correlation between LF and PWV differ in diabetic and nondiabetic patients?); sex \u00d7 diabetes \u00d7 LF (does the correlation between LF and PWV differ in men and women depending on their diabetic status?) .In the present study, we showed that beyond age, blood pressure, and diabetes, impaired cardiac autonomic function assessed by determination of HRV was significantly associated with abnormal PWV. The association between lower sympathetic and parasympathetic activity and stiffer arteries was affected by the presence of diabetes, and it was significant in women, but not in men.High sympathetic activity has been associated with stiffer arteries in patients with and without diabetes . This haA previous study reported that in diabetic patients, the presence of cardiac autonomic neuropathy was associated with reduced aortic distensibility , an assoFactors modulating and/or impacting on HRV, arterial stiffness, and their relationship are complex. They include smoking, dyslipidemia, level of physical activity, comorbidities, medication for diabetes, and coexisting disease. The TODAY Study reported that glycemic control in younger diabetic subjects was associated with greater sympathetic activity (LF/HF) and stiffer arteries . AdditioGender differences have been reported for several conditions affecting arterial stiffness and/or the autonomic control of the heart: BP ,22 and hConcerning the observed gender differences in the association between HRV, namely lower low-frequency activity and PWV, it has been previously reported that, despite greater resting HR in women than in men, heart rate does not have the same predictive power for CV mortality and morbidity in women as it does in men ,29. TherCharacterization of mechanisms underlying the observed gender differences in the association between the low-frequency domain of HRV and arterial stiffness is beyond the design of the present study. A better characterization of the underlying mechanism may improve management and therapeutic indications and pharmacological treatment to reduce the CV burden in diabetes.The present study has some limitations. The first is the cross-sectional design that does not allow determination of a causal relationship between PWV and cardiac autonomic. Another limitation is that we did not adequately characterize metabolic control in diabetic patients nor the full spectrum of drugs taken by the recruited patients. Given the high percentage of patients with hypertension, several medications  could interfere with HRV and with its association with arterial stiffness.To summarize, the results of the present study suggest that the impact of HRV, i.e., the differences in the autonomic regulation of mean HR, on PWV, a parameter that reflects arterial aging, differs in men and women with or without diabetes. Research on HRV needs to emphasize and report sex differences in healthy as well as in population affected by CV conditions."}
{"text": "The appropriate management of patients with Dravet Syndrome (DS) is challenging, given the severity of symptoms and the burden of the disease for patients and caregivers. This study aimed to identify, through a qualitative methodology and a Delphi consensus-driven process, a set of recommendations for the management of DS to guide clinicians in the assessment of the clinical condition and quality of life (QoL) of DS patients, with a special focus on patient- and caregiver-reported outcomes (PROs).This study was conducted in five phases, led by a multidisciplinary scientific committee (SC) including pediatric neurologists, epileptologists, a neuropsychologist, an epilepsy nurse, and members of DS patient advocates. In phases 1 and 2, a questionnaire related to patients' QoL was prepared and answered by caregivers and the SC. In phase 3, the SC generated, based on these answers and on a focus group discussion, a 70-item Delphi questionnaire, covering six topic categories on a nine-point Likert scale. In phase 4, 32 panelists, from different Spanish institutions and with a multidisciplinary background, answered the questionnaire. Consensus was obtained and defined as strong or moderate if \u226580% and 67\u201379% of panelists, respectively, rated the statement with \u22657. Phase 5 consisted of the preparation of the manuscript.The panelists agreed on a total of 69 items (98.6%), 54 (77.14%), and 15 (21.43%) with strong and moderate consensus, respectively. The experts' recommendations included the need for frequent assessment of patient and caregivers QoL parameters. The experts agreed that QoL should be assessed through specific questionnaires covering different domains. Likewise, the results showed consensus regarding the regular evaluation of several clinical parameters related to neurodevelopment, attention, behavior, other comorbidities, and sudden unexpected death in epilepsy (SUDEP). A consensus was also reached on the instruments, specific parameters, and caregivers' education in the routine clinical management of patients with DS.This consensus resulted in a set of recommendations for the assessment of clinical and QoL parameters, including PROs, related to the general evaluation of QoL, neurodevelopment, attention, behavior, other comorbidities affecting QoL, SUDEP, and QoL of caregivers/relatives and patients with DS. SCN1A gene  and the genetic syndrome with febrile seizures (FS or FS+) (Dravet syndrome (DS) is a life-threatening epilepsy syndrome that begins in infancy or early childhood and includes a wide spectrum of symptoms ranging from mild to severe . AdditioN1A gene , which e or FS+) \u20138.Dravet syndrome, first described in 1978 , althougSeveral guidelines and recommendations on DS are available, including a recently published European treatment guideline . HoweverThe Delphi technique is a structured method broadly used to collect relevant information on a specific issue and consists of a series of questionnaires or \u201crounds\u201d targeted to experts . The keyad hoc questionnaire was designed for this project to assess the views of the patients and the scientific committee regarding aspects related to QoL, the impact of comorbidities on QoL, and caregivers' QoL. The coordinator of the project (Dr. Aledo) was in charge of designing the questionnaire. In the beginning, the QoL-related publications found by the literature search were examined. Relying on literature and clinical experience, the questions were developed , one neuropsychologist, one epilepsy nurse, one neuroscientist specialized in DEEs and working with patient organizations, and two members of DS patient advocates.The scientific committee selected a group of 32 epilepsy experts with a multidisciplinary background as participants . The criAn item or statement was considered consensual when there was \u201cagreement\u201d of opinion in the panel. This happens when the panelists' votes outside one of the three-point regions  containing the median were less than one-third of the answers (<33.3%). The median value determines the group consensus: majority \u201cdisagreement\u201d if the median was within 1\u20133 and majority \u201cagreement\u201d if the median was within 7\u20139. Cases where the median was within the 4\u20136 region were considered \u201cdoubtful\u201d. Conversely, \u201cdiscordance\u201d was considered when the scores of one-third or more of the panelists were in the \u20139] contaSPSS Statistics version 20 by IBM  was used to create and analyze the database. The median and the percentage of responses in the 7\u20139 range were calculated, and their values were used to define consensus.This study was performed following the Helsinki Declaration. Data from the Delphi questionnaire were anonymized for the analysis. All the personal data were dissociated from the results in compliance with the EU General Data Protection Regulation (GDPR).The 70 statements developed by the scientific committee covered a total of six categories: (1) general aspects of the QoL evaluation of patients with DS (15 items), (2) evaluation of neurodevelopment (24 items), (3) assessment of attention and behavior (9 items), (4) evaluation of other comorbidities affecting QoL (14 items), (5) Sudden unexpected death in epilepsy (SUDEP) (4 items), and (6) assessment of the QoL of caregivers/relatives (3 items). Of the 32 DS experts invited to participate in the Delphi process, a total of 28 (87.5%) answered the questionnaire . The panA 100% consensus was obtained across category 1 with an agreement on all the 15 statements, although 4 (26.7%) were categorized into the moderate consensus range . The panRegarding the content of the QoL questionnaires used to monitor patients, the experts reached a consensus that these tools should be specific to the syndrome and should consider the biological or chronological age of the patients. The questionnaires should include aspects related to the patient's physical health, the psychological status, the social environment and functioning, the economic situation, housing conditions and supporting material, adverse effects of pharmacological treatment, and the relationships of the patient and caregivers with healthcare professionals and the healthcare system.To conclude this category, the panelists reached a consensus agreement regarding the administration and assessment of the QoL questionnaire. The experts stated that an electronic format is an optimal method and that the questionnaire should be administered and evaluated by healthcare professionals, always in communication and coordination with each other and with the patient's family and caregivers.The panelists reached a consensus agreement on all 24 statements (100%) of category 2, of which 6 (25.0%) had a moderate consensus . In theiThe panelists agreed on the importance of assessing several comorbidities or complications related to cognitive impairment. Likewise, experts agreed on recommendations related to the evaluation and study of gait and ataxia, including the frequency of evaluation.Experts agreed on the likely suitability of a series of scales to measure neurological and motor development in patients with DS, including Bayley-III Cognitive Scale, Wechsler Intelligence Scale for Children-V, Peabody 2 Developmental Motor Scale-2, Behavior Rating Scale of Executive Function-2 (BRIEF-2), Gross Motor Function Classification System (GMFCS), Gillette Functional Assessment Questionnaire, and Pediatric Evaluation of Disability Inventory Computer Adaptive Test (PEDI-CAT). These scales should be used considering the specific objectives proposed by the adult/pediatric neurologist in collaboration with the neuropsychologist. Finally, the experts agreed on other parameters to be considered when assessing motor development, as well as on the frequency of these measurements.All the initial nine statements proposed in category 3 reached consensus agreement status , althougThe panelists overall agreed on category 4 items, obtaining consensus agreement on 13 of the 14 statements (92.86%), as shown in Overall, the panelists agreed on various recommendations related to the assessment of sleep-related problems , with the exception of the actigraphy study, for which consensus was undetermined. Additionally, the experts recommended spending time specifically explaining to the family and/or caregivers the potential comorbidities associated with seizures during sleep.Experts also recommended assessing other comorbidities at least every 3\u20136 months, including digestive and respiratory disorders, and available specific guidelines for vaccination periods and infectious processes for both family members and the physicians of the Healthcare Center.Consensus was reached on all 4 items in category 5 (100%), with a strong consensus for all of them . The panThe results of the category regarding the assessment of the QoL of caregivers/relatives are shown in To our knowledge, this is the first study to establish recommendations regarding QoL and PROs assessment and the main comorbidities in DS, using a Delphi technique and qualitative methodology, including caregivers and a multidisciplinary group of experts. Caregivers with a variety of familiar relationships and providing care to patients with a wide range of ages were included, and experts represented highly qualified professionals involved in the treatment and care of DS patients in Spain. The experts reached a consensus on recommendations for the management and follow-up of DS, focusing on the assessment of patients' and caregivers' QoL and other outcomes. The high degree of consensus reached by the panelists is noteworthy, with consensus agreement reached for 69 of the total 70 items proposed , coverinAppropriate assessment of clinical and QoL parameters of patients with DS is crucial due to the importance of the symptoms and burden of the disease , 30, 31.The recommendations regarding general aspects of QoL evaluation of patients with DS indicate that experts overall consider the evaluation of the patient's QoL at each visit with the clinician to be of great importance. This opinion is supported by several publications indicating an association between clinical parameters and the QoL status of patients with DS , 30, 34.For neurodevelopmental evaluation in patients with DS, the panelists recommended that assessments be conducted at each visit with the specialist, with varying frequencies depending on the patient's age. Given the neurodevelopmental delay in DS children \u201340, the Regarding the assessment of attention and behavior in patients with DS, the panelists recommended evaluating the behavior of patients with DS in the educational/stimulation center at each consultation with the specialist, with a frequency of at least 3\u20136 months. For this statement, the percentage of consensus reached 67.9%, close to the limit of agreement, which may be due to the indicated follow-up time. Several panelists commented that a follow-up of 6 months is sufficient and more in line with the reality of clinical practice, with limited time for each patient visit. The motivation for this recommendation is that behavioral problems in DS are very common and have a tremendous impact on these patients' lives . PatientDuring the assessment of other comorbidities affecting QoL in patients with DS, a total of 13 statements of the 14 proposed obtained a consensus agreement. The only item not validated in the entire Delphi questionnaire was the one related to the use of actigraphy study for evaluating a sleep disorder. The reason for this may be the scarcity of studies on this subject conducted in the SD population . The remSUDEP is the leading reported cause of death reported in DS, accounting for nearly half of all premature deaths . The expDS is a disease with a significant impact on patients' caregivers and relatives , 54. ForThe Delphi technique is widely used in health studies as a method to obtain useful information from experts when the published body of evidence is incomplete , 28, 55.The high burden on QoL for DS patients and their caregivers, as well as the lack of concise guidelines on the evaluation of various clinical parameters, makes it necessary to issue expert recommendations to fill these gaps. The present study intended to meet these needs through an expert consensus, which may be a useful guide for clinicians involved in the routine follow-up and management of patients with DS. In particular, this study focused on PROs, which constitute a patient-centered alternative to incorporate into future clinical practice of patients with DS, as classical measures fail to cover all aspects of the disease . FurtherThe original contributions presented in the study are included in the article/Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. Written informed consent from the patients/participants or patients/participants' legal guardian/next of kin was not required to participate in this study in accordance with the national legislation and the institutional requirements.Adri\u00e1n Garc\u00eda-Ron, Alberto Vieco, Alfonso Amado Puentes, Helena Alarc\u00f3n Mart\u00ednez, Irene Garc\u00eda Morales, Javier Aparicio Calvo, Jes\u00fas Eir\u00eds Pu\u00f1al, Juan Jes\u00fas Rodriguez Uranga, Juan Jos\u00e9 Poza Aldea, Juli\u00e1n Lara Herguedas, Julio Ramos-Lizana, Merc\u00e8 Falip Centelles, Mercedes Garc\u00e9s S\u00e1nchez, Miquel Raspall Chaure, Patricia Smeyers Dura, Rafael Toledano Delgado, Roc\u00edo Calvo Medina, Salvador Ib\u00e1\u00f1ez Mic\u00f3, Sergio Aguilera Albesa, V\u00edctor Soto Insuga, and Xiana Rodr\u00edguez Osorio.\u00c1A-S has contributed to the design and conception of the study. All authors have contributed to the acquisition, analysis, interpretation of the data, have participated in the drafting and reviewing of the manuscript, and approving the submitted version.This study was funded and promoted by Zogenix Spain, now a part of UCB.Author \u00c1A-S has received funding for educational and research activities from Angelini, Zogenix, UCB, PTC pharma, Blueprint genetics, GW, Eisai. Author AG-N has received advisory or research funds by Arvelle/Angelini, Bial, Biocodex, EISAI, Esteve, GW Pharma, Jazz Pharmaceuticals, PTC Therapeutics, Stoke, UCB Pharma and Zogenix. Author JA is president of the Dravet Syndrome Foundation Spain (DSF). He and/or the DSF have received grants and/or financial support from GW Pharma, Zogenix, Ovid Therapeutics, Encoded Therapeutics, Biocodex, Praxis, Health in Code, Takeda, UCB, Epygenix, Jazz Pharmaceuticals and StrideBio to help carry out some of the DSF's foundational activities or provide consulting services. Author JA honoraria have always been donated directly or indirectly to the DSF. Author RS-C has been a trial investigator for GW Pharmaceuticals, Takeda Pharmaceutical Company Ltd. Author and Zogenix and has served on advisory boards for Novartis, GW Pharmaceuticals, Biocodex and Zogenix. Author JG-P has received advisory or lecture funds by BIAL, EISAI, GW, NUTRICIA, SANOFI, UCB and ZOGENIX. VV has participated in advisory boards and symposia organized by Angellini, Bial, Eisai Inc., GW pharma, Novartis, Takeda, UCB, Zogenix. Author AM was employed by Dracaena Consulting SL. Author LA was employed by Apoyo Dravet. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Cardiovascular system and its functions under both physiological and pathophysiological conditions have been studied for centuries. One of the most important steps in the cardiovascular research was the possibility to record cardiac electrical activity. Since then, numerous modifications and improvements have been introduced; however, an electrocardiogram still represents a golden standard in this field. This paper overviews possibilities of ECG recordings in research and clinical practice, deals with advantages and disadvantages of various approaches, and summarizes possibilities of advanced data analysis. Special emphasis is given to state-of-the-art deep learning techniques intensely expanded in a wide range of clinical applications and offering promising prospects in experimental branches. Since, according to the World Health Organization, cardiovascular diseases are the main cause of death worldwide, studying electrical activity of the heart is still of high importance for both experimental and clinical cardiology. Cardiovascular disorders are the major cause of death in developed countries. Due to the change of lifestyle, their incidence increases recently also in countries where cardiovascular morbidity and consequent mortality have not been considered a problem until now. Enormous economic and social burden of such situation promotes further research of both physiological and pathophysiological cardiovascular processes.Cardiac action starts with electrical event\u2014membrane depolarization\u2014which is then followed by a mechanical response, e.g., cardiac muscle contraction. After this event, called systole, the cardiac cycle continues with diastole (membrane repolarization and consequent muscle relaxation). Obtaining quite detailed information about electrical activity of the heart seems to be technically easier than obtaining comparably detailed information about mechanical events.The first attempts to study electrical processes related to cardiac action were performed already in the 19th century , based ovia a cannula inserted into the aorta of the fully explanted heart. The hydrostatic pressure of the solution closes the aortic valve, and solution enters the coronary arteries, leaves via sinus coronarius, and drips off.Concurrently to above-described milestones of ECG development and its establishment into routine clinical use, researchers were interested in electrical changes accompanying the heart activity other than whole-body models. The fundamental approach in this area is the isolated heart model. First, successful isolation and perfusion of frog heart were achieved by Elias Cyon and Carl Ludwig . Then, aA model of isolated heart perfused according to Langendorff  is the first experimental setting which enables recording of electrical activity of the heart in the style which resembles the ECG . Of courFrom Einthoven\u2019s first ECG recording system till now, ECG recording has undergone huge transformation from a full-analog system to fully computerized ECG recorders . RegardlThe 12-lead ECG configuration gives spatial information about the cardiac electric activity . Since EReconstruction of the cardiac vector movement from the 12-lead ECG is\u2014despite all modifications\u2014arduous and imagination-demanding. For such analysis, orthogonal leads are much more useful. Orthogonal leads record the electric activity from three perpendicular axes of the body . Frank leads are one of the most clinically relevant orthogonal systems.The standard 12-lead system is mostly used for ambulatory ECG recording. Also, such recording is used during the exercise stress test. Ambulatory 24\u00a0h ECG monitoring\u2014Holter monitor\u2014is employed in diagnostics of paroxysmal cardiac events . The Holter monitor may use a 12-lead system; however, modern devices record two or three modified leads only . In caseA typical ECG curve shows five deflections labeled P, Q, R, S, and T. The P wave reflects depolarization of the atria. Deflections Q, R, and S create a thin complex\u2014QRS complex, which represents ventricular depolarization. The R peak is always positive (pointing upward). Deflection Q is always the negative deflection preceding R peak. Deflection S is always the negative deflection following R peak. Depending on the orientation of ECG lead, some of the deflections of the QRS complex may not be expressed. The fifth deflection\u2014the T wave\u2014reflects repolarization of the ventricles. Between the end of P wave and the onset of QRS complex, a period of isoelectric line called the PQ segment is found. The PQ segment represents atrioventricular (AV) conduction or AV delay. The PQ segment together with the P wave forms a PQ interval. The PQ interval duration reflects propagation of depolarization from the atria to the ventricles. Between the end of QRS complex and the onset of T wave, there is a period of isoelectric line called the ST segment. During the ST segment, all the ventricular cardiomyocytes are fully depolarized, resting in the plateau phase of the action potential. Complete electric revolution of the ventricle is represented by a QT interval\u2014the period from the onset of the QRS complex to the end of the T wave. The distance of two consecutive R peaks\u2014RR interval\u2014represents the duration of one electric cycle of the heart; therefore, it defines the heart rate. The amplitude of deflections as well as polarity of P and T waves depends on the orientation of ECG lead. This topic is out of the scope of this article, and therefore, it is not discussed here.ECG recording plays an irreplaceable role in diagnostics of various cardiovascular diseases. Diagnostics of arrhythmias is completely based on an ECG record. Moreover, the QT interval prolongation\u2014an independent risk factor for ventricular arrhythmias\u2014can be detected exclusively from an ECG. Typical ECG changes, such as the ST segment elevation and T wave alteration, are related to coronary artery disease and myocardial infarction. According to the specific changes in the 12-lead ECG record, an occlusion of coronary artery can be localized. Also, left ventricular hypertrophy can be diagnosed with high sensitivity and specificity from the ECG record . Also, oECG may also help in diagnostics of numerous non-cardiovascular diseases . TypicalInnovative approaches of ECG recording bring new challenges in ECG interpretation. Reduction of the employed electrodes leads to the reduction of ECG lead number. Recently, diagnostic potential of reduced-lead ECG was discussed during the PhysioNet/Computing in Cardiology Challenge . The resThe quality (sampling rate and resolution) of the ECG record is important particularly in animals of high heart rate .If the electric activity is recorded directly from the surface of the heart, the term \u201celectrogram\u201d (EG) should be preferred. In isolated heart models, originally the electric activity was recorded by needle or hook electrodes attached directly into the cardiac muscle. However, mechanical irritation caused by electrode attachment may induce ventricular arrhythmias. To minimize it, only one pair of electrodes is usually attached, and thus, one EG lead is recorded. A less-invasive approach is possible if the isolated heart is immersed into the bath containing saline . Then, an EG is recorded contact-less by electrodes placed on the inner surface of the bath . VariousTo study more complex responses of the cardiovascular system including neuro-humoral regulatory mechanisms, a whole-body animal model has to be engaged. Various animal species are used to study heart electric activity\u2014including zebrafish, small rodents , rabbit, dog, pig, and others. A broad range of methods are used to record the ECG in animals. Generally, the methods can be divided into two groups: 1) methods used in anesthetized animals and 2) methods enabling ECG recording in conscious animals.In small animals, including rodents and rabbit, the ECG is frequently recorded in general anesthesia . In anesECG recording in zebrafish represents a specific chapter. In the last two decades, zebrafish became a valuable model in experimental cardiology due to its fast reproduction, low maintenance cost, easy breeding, possibility of genetic manipulation, extensive developmental characterization, and optical transparency . MoreoveIf the unwanted effect of general anesthesia may interfere with the experimental purpose, ECG recording in conscious animals is preferred. Even in small animals, the ECG can be recorded using telemetric monitoring . TelemetIf a short-term ECG record is required, non-invasive methods are a good choice. In large well-trainable animals, it is possible to record the ECG by standard stick-on electrodes. Such procedure requires specific training, during which the animal learns to remain motionless for several minutes. In small animals, non-invasive devices usually consist of a platform equipped with electrodes, on which an animal puts its paws . In suchIn experimental animals, interpretation of the ECG is usually more challenging than the recording. Lack of standardization in animal ECG recording and less evidence of normal  values of ECG parameters make the interpretation difficult. The differences in cardiac electric activity among various species also must be considered\u2014especially differences in body size, heart anatomy, and cardiac ionic channel types and their distribution and regulation. The most striking difference in ECG among the species is the RR interval duration . In mammThe ECG of the most frequently used laboratory animals\u2014rat and mouse\u2014is quite distinct from that of humans. There is no distinct ST segment in rat and mouse ECG curves due to short ventricular action potential with minimal plateau phase. The T wave begins immediately after QRS complex. Also, the resting heart rate is significantly higher than that of humans . Moreover, significant differences between various strains of the same species were repeatedly reported .After the ECG is recorded, its pre-processing and analysis may start. The ECG analysis is meant to be a process which gives valuable information about the examined subject  in terms of cardiac electrophysiology. The early analyses of ECG in the beginning of the 20th century were performed only for measuring time relations in the signal. The introduction of computer technology in the middle of the 20th century opened new possibilities for the analysis of ECG. Despite all the advantages of computer technology, manual evaluation of the ECG by a cardiologist remains an indispensable part of diagnosis. The following paragraphs briefly summarize the development of ECG analysis, the basic principles of the main techniques in clinical and experimental perspectives, and, finally, the main current issues and future directions in this field. Many physiologists at the end of the 19th century were convinced that the mechanical contraction of the heart is preceded by an electrical action that could be measured. In the first attempts to record electrical potentials of the heart muscle, only heart depolarization and repolarization were recognizable . This leAlong with the improvement of electrical activity recording, the first attempt to quantitatively describe how the heart function is transcribed into the ECG has been done. Numerous equations have been developed to identify the relationships between the heart function and ECG patterns. These equations helped to discover phenomena, which were not visible at the first glance. One of such measures, outlasting in the clinical and experimental use to present, is the QT interval corrected by Bazett\u2019s formula . It reflFrom today\u2019s perspective, these pioneers have come a long way. The foundations laid by them made it possible to develop the robust and reliable computational methods in the second half of the 20th century.Rapid development of computer technologies in the second half of the 20th century led to the extensive automation of various processes traditionally performed by human experts. In medicine, along with analysis of complex imaging data , the diagnostics of cardiac disorders intensely uses advanced, highly intelligent computer-aided systems. Probably, the most evident benefit of the computer algorithms is in their ability to process a huge amount of data in a very short time e.g., , a proceFrom medical point of view, use of the most advanced methods for ECG analysis offers a simple, widely available, cheap diagnostics tool. By accurate, sensitive, fast, and robust detection of pathological patterns in the ECG, these methods contribute to early diagnosis, selecting the correct treatment strategy, better outcomes, and improved life quality of the patients on the one side and to minimized mental and time demands of clinical staff and decreased national healthcare financial resources on the other side. Automatic prediction systems are also useful in preventive medicine.Of course, computer algorithms make errors, especially when a low-quality signal or signal with unknown  abnormality is analyzed. The computer more likely fails when similar manifestations correspond to different pathologies. In contrast to the computer algorithms, human experts use clinical information about the patient and intuition. Therefore, all statements of the computer systems must be over-read by skilled physicians . Neverthvia decision rules pre-determined in cooperation with clinician experts; 3) by using machine learning (ML) tools\u2014so-called supervised learning algorithms, which are able to learn the interpretations from training data equipped with ground truth labels with no need for expert rules; and 4) by using state-of-the-art tools\u2014so-called deep learning (DL) models.Traditional computer-aided ECG interpretation consists of the following steps: pre-processing, computation of so-called features, selection of the most relevant ones, and, finally, decision-making , top. ECFeature-based decision-making is usually provided by ML models, from simple linear discriminant analysis (LDA) or logistic regression to more advanced k-nearest neighbor (k-NN), decision tree, random forest, support vector machine (SVM), multiple-layer perceptron (MLP), etc. From mathematical background, most are based on using one or combination of several linear or non-linear equations, which map current input data (ECG samples or features) into the predicted output (label/diagnosis)  with feedforward information flow and recurrent neural net (RNN) with some feedback connections\u2014are mostly used. CNNs process the input with a set of special filters to extract hidden, high-resolution patterns . RNNs caThe clinical ECGs are usually corrupted with various types of noise, which may lead to errors in visual inspection and to inaccurate function of automatic delineation and interpretation algorithms. The low-frequency baseline wander, power-line interference (50/60\u00a0Hz), and high-frequency noise are those seen in raw ECG. The first one is primarily caused by respiratory movements or poor skin\u2013electrode contact and may cause inaccurate measurement of ST segment, wave amplitudes, R-peak detection, etc. The power-line interference of high magnitude makes the analysis of low-voltage P waves impossible. The high-frequency noise, representing the myopotentials generated during skeletal muscle contraction, complicates the ECG delineation. Digital filters, implemented in a high-pass, band-pass, or low-pass mode with appropriate cut-off frequencies, are usually used to suppress above disturbances in the ECG . The desAfter proper noise elimination, the R peaks and/or other fiducial points can be detected. Probably, the most famous and frequently used is the rather robust and simple Pan\u2013Tompkins algorithm . Many otComplete delineation of ECG can be performed by the CNN\u2013LSTM model with a sensitivity of 97.95% . AnotherAnother interesting study was focused on creating the mathematical models able to \u201cextract\u201d the waves from the ECG to make further detection of the fiducial points easier . This meAlmost all existing methods for ECG pre-processing and analysis have been initially established for human signals. The morphology characteristics of animal ECG are like human ones. However, some differences in heart rate and ECG wave amplitudes and duration exist due to differences in ion channel expression  as well The median filter can be successfully applied on clinical and experimental ECG data to remove low-frequency baseline wander, which complicates the signal delineation and decreases the reliability of morphology features . For elimination of broad-band noise (such as muscle activity) in the ECG, the above-mentioned decomposition of the entire signal by discrete wavelet transform and reconstruction of \u201cclean\u201d ECG after removing some components containing noise is more suitable than standard linear filtration . This meThe narrow-band signals created by ECG wavelet decomposition are often used for accurate detection of waves and QRS complexes. First, signals with well prominent waves of interest are selected, and then the complexes are detected by threshold, which can be constant or adaptively changing according to current signal maximum amplitude or variability. This QRS detection technique was shown as more effective and accurate  than the Pan\u2013Tompkins algorithm  in equine ECGs . This technique can be used for complete delineation of the entire ECG , as presented by The first derivative of ECG and further searching for rapid deviations can be used for complete delineation of the signal as shown in detail by - Time-domain features primarily representing 1) the rhythm character of the signal in terms of heart rate and duration of some important intervals , 2) the morphology of ECG curve in terms of amplitude, duration, area under the curve, direction, and other shape-related characteristics of the particular waves, and 3) the statistical characteristics of ECG distribution .- Frequency-domain or time\u2013frequency domain features creating the new representation of ECG by using special transformation (such as Fourier transform (FT), short-term Fourier transform (STFT), and continuous or discrete wavelet transform (CWT/DWT)) and exploring the ECG spectral content and its changes in time.- Non-linear features revealing non-linear, complex, dynamic character of ECG (hidden to the above methods) based on the chaos theory and information theory .Features should represent well ECG patterns characteristic for investigated phenomenon . The quantitative representation of heart electrical activity by a limited number of highly specific features allows to construct the efficient, robust, fast, and reliable methods for automatic identification and differentiation of various cardiac conditions, as will be shown below. Generally, three main groups of \u201chand-crafted\u201d ECG features are used in computer-aided systems e.g., :- Time-dSignificant temporal features, intensely used in various areas, are those describing the heart rate variability (HRV). Initially, HRV analysis was introduced to investigate the vago-sympathetic balance and corresponding phenomena . These ft-test and others), or their combinations , decision tree, etc.) or searches among the feature set until the combination leading to the best performance of the model is found  , etc.), discriminating abilities of separate features  .Feature-based diagnostics tools have been used for several decades and still play a crucial role in clinical and experimental research, primarily due to their transparency. Below, recent ECG applications intensely using these methods are reported.Multi-lead ECG can be used to accurately detect left ventricular hypertrophy, which is a less expensive, less time-consuming, and widely available alternative to the golden standard imaging techniques. Morphological features  extracted from CWT-transformed ECGs perform well with ML classifiers, with the most promising accuracy (up to 97.8%) using multi-layer perceptrons .One example of using the morphology features derived from P\u2013QRS\u2013T segments is the recognition of different beat types, such as normal, supraventricular, and ventricular ectopic beats and fusion of ventricular and normal beats. The SVM model trained on these features performs with overall accuracy 97.8% . The arrA novel tool based on the multi-lead ultra-high-frequency ECG and QRS complex features has been recently introduced. It provides the quantitative description of ventricular dyssynchrony with a great potential for selecting the patients for cardiac resynchronization therapy and improving the therapy application . One of A recent prospective study presents temporal, spectral, and non-linear HRV parameters as the valuable prognostic tool for evaluation of mortality risks in patients with coronary artery disease .The most challenging recent application using HRV features is atrial fibrillation (AFIB) detection e.g., . Timely Novel multi-scale entropy has been shown as an accurate HRV-based tool for prediction of the malignant ventricular arrhythmia, even using a simple random forest classifier . StandarA method based on only six time- and frequency-domain HRV features and a simple k-NN classifier can predict the sudden cardiac death from five-minute RR interval signals recorded by an implantable cardioverter defibrillator with an accuracy of 91.5% .The random survival forest (RSF) ML model was used to predict spontaneous ventricular tachycardia and ventricular fibrillation events in young and adult patients with long QT syndrome (LQTS) . The modThe basic temporal ECG features such as heart rate and PR and QT interval duration as well as QRS complex duration are routinely used to monitor the character of impulse conduction through different parts of the heart. The assessment of the combination of these features is especially useful when evaluating the possible effects of drugs.Detailed analysis of QT duration in rabbit protocols with drug-induced long-QT or short-QT syndrome indicated the possible effect of acute mechano-electrical function on long-QT syndrome\u2013related arrhythmogenesis . GeneralHRV in the isolated heart model can serve to investigate the intrinsic mechanisms of the cardiac rhythm regulation with no effect of sympathetic/parasympathetic factor . SpectraAccording to comprehensive overview by The TINN feature has been found as associated with severity of myxomatous mitral valve disease in dogs  and was Morphological features were found to accurately detect ischemia in the Langendorff-perfused isolated rabbit heart with normal anatomy as well as spontaneously increased left ventricular mass . The rhyThe use of ML-based methods in experimental or veterinary context is usually limited by a small amount of collected data. In case of long-term experiments, however, these techniques could be very helpful to carry out fast, robust, and reliable analysis. For example, Many \u201call-in-one\u201d solutions are working with a raw ECG or the pre-processed, noise-free ECG or 2D \u201cimage\u201d representations of ECG created by converting the 1D signal into the so-called spectrogram  or, more straightforwardly, by saving the ECG segments in some image format for further analysis. These solutions often use the hybrid model, when the first part  extracts the most reliable features from the input and the second part  provides the final decision-making .Here, the overview of the most recent DL approaches is introduced. To our best knowledge, there is no all-in-one DL solution in experimental physiology applications due to limited data sources. We believe that this gap will be removed soon due to transfer of learning techniques we address in the last section and illustrate the example from the veterinary field.Many approaches are focused on specific problems, which allows to reach promising results with a relatively simple model architecture and low time and computational requirements even in case of limited data amount. Great improvements based on DL method use were achieved in the detection of acute myocardial infarction and stable ischemic heart disease, with the detection accuracy in the range of 83\u201399.9% for different model configurations  . MyocardThe accuracy of left ventricular hypertrophy detection reaches up to 85.8% when using CNN-extracted ECG features in combination with six-layer-perceptron\u2013extracted demographic features, which outperform routine Sokolow-Lyon criteria and visual inspection  . KhurshiLeft ventricular systolic dysfunction (LVSD) in critically ill patients can be accurately (71\u201376%) detected from ECG, which is less time-consuming and less expensive than usually used transthoracic echocardiography. Additional benefit of the DL method is its robustness and efficiency in both patients with and without atrial fibrillation, which is commonly associated with LVSD . The latAccording to recent meta-analysis , CNN or AFIB detection and differentiation between terminating and non-terminating AFIB episodes were recently performed via time\u2013frequency ECG representation (by chirplet transform) and 2D CNN\u2013biLSTM classifier with an accuracy of 99 and 75.9%, respectively . The autvia the ResNet model with the accuracy of 79.4%. This approach offers fast, inexpensive identification of the patients with a high likelihood of AFIB by timely revealing of the structural changes in atria before the presence of any symptoms.According to interesting retrospective research , an eighDetection of abnormal cardiac rhythms , which can respond to electrical shock therapy with further expected restoration of normal sinus rhythm and, consequently, normal cardiac pump function, achieved the best accuracy (91.14%) for the CNN model .Recently, there is an effort to design approaches for differentiation of dozens of arrhythmias in ECG by only one complex model. The 1D-CNN proposed by According to Compared to the CNN, ResNet, and CNN\u2013biLSTM, the hybrid CNN\u2013transformer model combined with temporal ECG features achieved higher performance in recognizing nine different beat types . The traHowever, adaptation of existing complex architectures, initially proposed for image  or natural language  analysis, has strong limitations as reported by the systematic study of Transfer learning is a research method in machine learning, where knowledge from one area is applied to solve the different, but still relevant issue. Transfer learning, when applying by proper way, may solve many different problems. One of them is a problem with heterogeneity of patients\u2019 data. It would be practically useful, if once the model is trained on some data , so that it could be directly applied on data with different diagnostics background . Most probably, however, this will not work well due to highly inconsistent character of patterns from two datasets. Nevertheless, successful results can be obtained when training model on one (freely available and extended) dataset and re-training it later on the other dataset consisting of samples of interest . In this case, the knowledge learned during the first training and saved in the network weights is used for analysis of the second dataset. During the re-training procedure, the weights from the first layers of the pre-trained model (extracting the relevant features from input data) remain with no changes, and only last layers (providing the classification or prediction itself) are re-trained using new data, which is computationally effective. This transferring of knowledge between the domains seems to be a way for effective usage of the models, well-established in other areas, directly in medical applications, with no extra time and source investments. It could be of special importance in problems, where there are not enough data for efficient training of the model.DL architectures, initially proposed for image analysis, speech recognition, and other data, can be successfully used for ECG interpretation after appropriate modifications, as has been shown in clinical applications. The most exciting and beneficial application of transfer learning was shown in animal data analysis, when the standard use of DL methods is strongly limited by a small amount of available data. A few published reports using DL for animal data analysis are focused mainly on image processing, e.g., detection of canine mammary tumor , detectivia a newly proposed symmetric projection attractor calculated from two-lead ECG. They were used to distinguish between wild-type mice and Scn5+/\u2212 mutant mice suffering from impaired function of cardiac sodium channel.From all the above, it seems that DL models can learn not only general but also more specific patterns during transfer learning. Although the DL methods have been recently applied exclusively in veterinary medicine where relatively large amounts of data are available, it seems to be reasonable\u2014due to transfer learning technique\u2014to expect expansion of DL models in experimental cardiology.The lack of data often concerns only certain groups of arrhythmias, such as those with rare incidence in the population or paroxysmal ones, where the ECG manifestation cannot be easily recorded during standard clinical examination. During the training process, the model extracts important information from input samples and uses it for final decision-making. In case of a severely imbalanced train dataset , the model will \u201cfocus\u201d on the abnormalities from the majority group(s) and will ignore those from the minority group(s). Most of available ECG databases include much more normal sinus rhythm data than abnormal ones and, thus, are imbalanced. There are some techniques which reduce or eliminate this problem and, thus, ensure effective training of the model.The simplest way to make the size of particular categories equal is resampling of the training dataset, where the majority class is reduced by random selection of the desired number of samples (undersampling) or the minority class is extended by random repeating of selected samples (oversampling). However, removing of samples from the training set may lead to loss of important information. Simple repeating of minority samples will not make the dataset variable and representative and may not ensure effective model training. Therefore, more sophisticated\u2014so-called augmentation\u2014methods are usually applied.Augmentation techniques generate new training samples by adding some perturbation in data resulting in improved robustness of the model. First, some manipulations can be applied on initial data, such as random scaling, flipping, shifting, and noising ECG, to achieve accurate detection of multiple arrhythmias . The samFrom above reports, synthetic ECGs are realistic enough to be used in practice and, consequently, contribute to the expansion of high-performance ML or DL techniques in a wide range of clinical and experimental applications. In the latter area, besides all the above, augmentation approaches, based on data generated by mathematical computational models, seem to have special potential. Models of different complexity\u2014from molecular to organ levels\u2014are available  for generating the relevant, realistic, clearly interpretable electrophysiological data.Effective interaction of a human expert  with the computer-aided system requires trust in the computer\u2019s decision-making. Therefore, an adoption of DL-based diagnostic systems in the routine clinical practice is limited, despite their high performance. As a result, there is a big effort in creating the tools helping to uncover the processes behind the model\u2019s prediction. Such \u201cexplaining\u201d methods may help the experts to understand the computer-aided tools and to \u201csafely\u201d use their output to make the final decision. Of course, rather transparent feature-based methods with simple ML models  can be used. These are, however, less successful as DL-based systems (see above). It seems to be more suitable to use the high-performance, though non-transparent, DL algorithms and apply additional techniques to \u201copen\u201d the black box. Many different methods and algorithms have been proposed in the last decade to solve this issue.Probably, the easiest solution is to visualize the outputs from those layers of deep networks, which generate the features from input data . The generated feature maps can indicate the parts of the ECG playing the most important role in resulting diagnosis , etc.. TMost comprehensive explanation can be obtained by special algorithms, such as Shapley Additive Explanations (SHAP), which assigns the importance weight to each sample by exploring the gradient, calculated when the sample enters the model . These wA huge amount of long-term ECG data requires a lot of time for detailed data labeling, which is crucial for accurate diagnosis and for potential use when creating the ML- or DL-based computer-aided systems. The labeling process is extremely time-consuming and expensive. Especially when each beat should be labeled separately, the risk of misinterpretations due to intensive cognitive load or poor experience of the physician is high. Therefore, multiple-instance learning (MIL) enabling model training using only global labels with no beat-wise annotations can be very useful. MIL is a type of supervised learning, which works with labeled bags of data (instead of the labeled instances) . When prThe number of DL studies focused on cardiac arrhythmia detection and classification has intensively grown during the last five years, most probably due to the PhysioNet/Computing in Cardiology Challenge conducted in 2017, where an extended, highly variable database was introduced to the wide audience . Many chAnother issue, which needs to be solved soon, is a lack of the guidelines for creating and evaluating the diagnostic ML and DL algorithms. The present article reviews current perspectives of ECG recording and analysis. It presents a unique combination of clinical and experimental points of view. This approach may attract a broad range of readers\u2014not only researchers in the area of cardiology but also biomedical engineers, mathematicians, and last but not least clinicians. Looking at the same topic from various angles and summarizing information obtained from various models may help interested readers of numerous specializations understand each other better. As a result, it might help to plan future research activities of multidisciplinary teams, consisting of both researchers and clinicians.In the 21st century, recording of electrical activity of the heart muscle in the form of electrocardiogram may appear rather obsolete. The truth is that numerous sophisticated methods enable the researchers and clinicians to obtain information about electrical and mechanical activities of the heart and visualize these processes. On the contrary, new ways of ECG recording together with advanced methods of its analysis open new possibilities for its use."}
{"text": "Information on electrocardiogram (ECG) has not been quantified in obstructive coronary artery disease (ObCAD), despite the deep learning (DL) algorithm being proposed as an effective diagnostic tool for acute myocardial infarction (AMI). Therefore, this study adopted a DL algorithm to suggest the screening of ObCAD from ECG.ECG voltage-time traces within a week from coronary angiography (CAG) were extracted for the patients who received CAG for suspected CAD in a single tertiary hospital from 2008 to 2020. After separating the AMI group, those were classified into ObCAD and non-ObCAD groups based on the CAG results. A DL-based model adopting ResNet was built to extract information from ECG data in the patients with ObCAD relative to those with non-ObCAD, and compared the performance with AMI. Moreover, subgroup analysis was conducted using ECG patterns of computer-assisted ECG interpretation.The DL model demonstrated modest performance in suggesting the probability of ObCAD but excellent performance in detecting AMI. The AUC of the ObCAD model adopting 1D ResNet was 0.693 and 0.923 in detecting AMI. The accuracy, sensitivity, specificity, and F1 score of the DL model for screening ObCAD were 0.638, 0.639, 0.636, and 0.634, respectively, while the figures were up to 0.885, 0.769, 0.921, and 0.758 for detecting AMI, respectively. Subgroup analysis showed that the difference between normal and abnormal/borderline ECG groups was not notable.ECG-based DL model showed fair performance for assessing ObCAD and it may serve as an adjunct to the pre-test probability in patients with suspected ObCAD during the initial evaluation. With further refinement and evaluation, ECG coupled with the DL algorithm may provide potential front-line screening support in the resource-intensive diagnostic pathways. Electrocardiogram (ECG) is a mainstay in the diagnosis of acute myocardial infarction (AMI) with biomarkers: a rise in troponin with at least one value\u2009>\u200999th percent upper reference limit \u20133. In emOn the other hand, the resting 12-lead ECG has not been critical for screening and diagnosing coronary artery disease (CAD) in patients with stable chest pain and suspected angina pectoris, but it remains an indispensable component of an initial evaluation . AccordiRecently, deep learning (DL) algorithms have demonstrated good to excellent performance in detecting AMI using ECG signals. A review study revealed the accuracy ranged from 80.6 to 99.9% for normal versus AMI detection in 11 DL-based models, and the other review study showed it from 83 to 99.9% in six DL models , 8. AlthTherefore, a DL-based model was developed using ECG to suggest the need for further investigation for ObCAD in patients with chest pain and suspected ObCAD. Moreover, the performance of the model was evaluated to test the validity for screening ObCAD and compare it with that of AMI.This investigation was a retrospective observational study of consecutive patients who received coronary angiography (CAG) for suspected CAD in a single tertiary hospital. The patients were eligible if they were aged 18 years or older and underwent CAG due to suspected ObCAD from October 27, 2008, to August 21, 2020, at the Inha University Hospital, which was a university teaching hospital in Incheon, which had a population of 2,922,121 inhabitants in 2020, in South Korea. It has Regional Cardiocerebrovascular Centers (RCCVCs), established by the Ministry of Health and Welfare in the Incheon district.The digital, standard 10-second, 12-lead ECG was acquired in the supine position during the study period. ECG was acquired at a sampling rate of 500\u00a0Hz using a GE-Marquette ECG machine , and the raw data on ECG were extracted from the MUSE data management system .The ECG was selected in a window of interest for each participant for analysis because most of the study participants had multiple ECG records over the study period. The index date and time were defined as the date and time when CAG started, and the window of interest was defined as the preceding seven days before the index date. The ECG within a week before CAG was selected for analysis. This window of interest was chosen under the assumption that the ECG within a week would have clues on the quantitative coronary angiography (QCA) stenosis in patients with ObCAD. Any patient who did not have an ECG in the window of interest was excluded. If patients had multiple ECGs in the preceding seven days, the most recent ECG, for which physicians decided whether to provide diagnostic CAG, was selected. Figure\u00a0For the comparison of data distribution among the non-ObCAD, ObCAD, and AMI groups, 31 electrocardiographic patterns and eight quantitative ECG measurements were extracted from the ECG data and summarized for each group . The eigThe CAG reports were extracted from the electronic medical system. The dataset was divided into acute myocardial infarction and suspected angina pectoris to compare the performances between the DL models of ObCAD and AMI. After excluding the patients finally diagnosed with AMI, ObCAD was defined as the stenosis\u2009\u2265\u200950% luminal narrowing of any major vessel in QCA, and non-ObCAD as <\u200950%; it was defined to identify patients whose QCA showed significant stenosis more than 50% and those who could have benefited from further non-invasive diagnostic tests and CAG \u201317.1D ResNet was suggested as a useful architecture for classifying ECG \u201320. The A resting ECG consists of 12 vectors with 5,000 dimensions per sample, which is a very large input dimension compared to the number of training samples. Therefore, raw ECG signal is not suitable for use in traditional ML classifiers such as LR and RF. We used a fast Fourier transform (FFT) to extract the 10\u2013100\u00a0Hz range from each lead in 10\u00a0Hz intervals to transform it into a dimensionality suitable for use with traditional ML classifiers. This was finally transformed into a vector with a total of 120 dimensions for the 12 leads. Then, ECG transformed by FFT was used as input for LR and RF. Using grid search, we set the hyperparameters of the RF model: number of estimators, minimum number of samples required to split, and minimum number of samples required to be at a leaf node to 100, 2, and 2, respectively. Bi-LSTM used L2 kernel regularizer, dropout 0.2, and ReLU activation function. In this study, we did not use the Transformer Encoder immediately before the Fully Connected (FC) Layer as in the study for ECG Arrhythmia Classification to identify the ECG pattern of ObCAD, but adopted the method of analyzing the time series with LSTM by determining and weighting the importance through self-attention to the extracted convolutional neural network (CNN) features. The ECG signal is compressed to a size of  through 1D CNN, and the same size  data is extracted through MultiHeadAttention. Finally, it was classified by sequentially passing the LSTM layer, FC layer, and sigmoid function.The eight physical leads  were used in the 12-lead ECG because the four augmented leads  were produced by a linear function of leads I and II. The horizontal long axis (10\u00a0s at 500\u00a0Hz) was denoted as the temporal axis to extract the morphological and temporal features, while the short axis  represented the spatial axis to use layers from all the leads.The ECG DL models were cross-validated using stratified 5-fold to estimate the average predictive performance. The validation set was randomly selected from the train set and the dataset was divided into train, validation, and test sets with an 3:1:1 ratio. The training dataset was used to train the DL model and optimize the hyperparameters with a validation dataset. The test dataset containing the remaining patients not used in the training or validation was used to evaluate the performance of the ECG-based DL algorithm. A diagnostic threshold was selected using the area under the curve (AUC) of the receiving operating characteristic (ROC) curve for the validation set. The threshold was then applied to the test dataset to calculate the precision, recall, accuracy, and F1 score.The hyperparameters were compared among the following options: ResNet with the residual blocks , kernel size , batch size , initial learning rate , optimization algorithms , and dropout rate . The best hyperparameters achieving the highest F1-score in the validation set were 4, 16, 8, 0.001, and 0.3, respectively, for residual blocks, kernel size, batch size, initial learning rate, and dropout rate with optimization algorithms of the Adam optimizer.Subgroup analysis was performed to get insight into whether the performance depended on the ECG diagnostic abnormalities in the interpretation which were provided by the GE-Marquette ECG machine.After excluding the CAG unmatched with ECG and duplicated reports, 14,080 CAG reports were included with matched 41,355 ECG data  in the review, which performed as well as six models for detecting AMI . HoweverIn this study, the performance of the DL model for screening ObCAD was modest compared to that of the model for diagnosing AMI. The ECG findings of AMI were more remarkable because AMI causes more irreversible tissue damage to the myocardium than ObCAD with stable chest pain. In contrast, the ECG perturbations tend to be subtle and have difficulty classifying ObCAD . AlthougCurrent practice depends on the clinician\u2019s interpretation on ECG when the patient with stable chest pain and suspected ObCAD is evaluated. Therefore, it is subjective according to the knowledge and experience of the clinician and requires time and effort in the field. It also could not be quantified and integrated into any quantitative estimation of risk stratification. In contrast, the DL-based ECG model could contribute to automated ECG interpretation and risk quantification. Furthermore, while ECG may be a poor predictor from the perspective of the human eye and computer-assisted ECG features provided by GE machine, ECG characteristics have been demonstrated to be related to the prediction of ObCAD , 34\u201336. In this study, the proposed model adopting 1D ResNet was superior to other ML and DL models. It may be because LR and RF cannot reflect time series features when learning ECG signals. In particular, although RF improves generalization performance by preventing overfitting of decision trees through ensembles, we experimentally confirmed that it still tends to overfit in high-dimensional data . To prevThe main strength of this study was the inclusion of a contemporary population with suspected ObCAD and who received CAG. Therefore, there is little risk of misclassification because the classification was based on the CAG reports. Moreover, the number of the subjects was higher than those of previous experiments, which offers more variation in the ECG data and is close to the real world. Furthermore, the DL-based model could help more people receive an earlier diagnosis and treatment compared to traditional ECG interpretation and help to reduce unnecessary diagnostic tests in the current practice. Compared to traditional ECG interpretations, the DL-based model could lead to the earlier diagnosis of 58% more people with CAG and the earlier treatment of patients with stable chest pain and suspected ObCAD: 646 (15%) of the traditional interpretation vs. 3,050 (73%) of the DL model in 4,178 patients with QCA stenosis. Furthermore, 62% of the 4,293 patients with a low probability of ObCAD by the DL model could be excluded from unnecessary non-invasive diagnostic tests and CAG.This study had some limitations. This was a retrospective study based on subjects who were not all comers with chest pain but had received CAG. Therefore, the enrolled subjects were the selected patients considered high-risk by a physician, which may limit generalization. Second, these results need to be transformed into applications in the future, such as being implemented in a prospective study, to confirm the performance. Third, although the DL algorithm showed good performance in automatically detecting AMI, it still showed fair accuracy and sensitivity in screening for ObCAD. Therefore, the results of this study should be interpreted with caution in clinical practice, and the DL-based ECG model should be innovatively improved for practical use in the future. Fourth, the characteristics of symptoms, which were critical in clinical practice, could not be covered by a better ECG interpretation. Finally, it is important to explore further the ECG components that contribute to the classification. Recently, efforts have been made to develop new technologies that could make machine-learning models interpretable or explainable.This study examined the possibility of adopting a DL algorithm to ECG for screening ObCAD and compared the performance of the ObCAD model with that of the AMI model. Although the model showed good to excellent performance in detecting AMI, it demonstrated only modest performance in suggesting the probability of ObCAD and required further enhancement. Nevertheless, information from ECG extracted by the DL algorithm may serve as an adjunct to an initial assessment by clinicians in addition to the pre-test probability. With further refinement and evaluation, ECG coupled with the DL algorithm may provide potential front-line screening support to assist clinicians in the resource-intensive diagnostic pathways."}
{"text": "Wilde was highly preceptive especially in his views on the recording of medical data and outcomes in clinical practice. We argue that Wilde was probably unmatched in the variety of his talents but was also perplexing in the various actions he took during his life and that indeed Wilde was an enigma.William Wilde, father of Oscar Wilde, made a significant contribution to ophthalmology and otology. Qualified as a surgeon. educated in statistics and showing sympathy for the Irish population, Wilde was appointed a Commissioner for the 1851 Census, which covered the time of the Irish Famine (1845\u20131852). Wilde, steeped in Irish mythology, used his knowledge to develop a close rapport with the Irish peasantry. However, his life was a paradox; he supported the British Government's approach to the Famine and at the same time he showed humanity to the Irish peasantry. In his personal life he was implicated in an abortive libel case involving a young female patient who had accused him of rape. Wilde lived as though he had two separate lives By today's standards Wilde's education was somewhat unconventional. He did not attend university though he understood the importance of such institutions. As a precocious 23-year-old he criticized Trinity College Dublin for not investing in studies including natural sciences, philology, Semitic languages, and Oriental studies. Wilde's encyclopedic knowledge of subjects ranging from medicine to natural sciences, art, archeology, Celtic folklore, literature, and statistics singles him out as a man with an avaricious appetite for knowledge enhanced by travel and interactions with the intellectuals of his time.Many of William Wilde's achievements have been over-shadowed by the success and notoriety of his son, Oscar (1854\u20131900). However, although William Wilde was an innovator in the field of medicine and surgery, historians hesitate to rank him as a true academic physician scientist.In this paper, we seek to evaluate the influence of his background and education on his medical, sociopolitical, and artistic achievements. We argue that, while his background and intellectual gifts helped make him ahead of his time, it also resulted in a complex conflicted personality creating an enigma. We also suggest that, despite major upheavals in his life, Wilde was a sympathetic doctor and a kind, committed humanitarian. In their journeys, the Wildes would have encountered the underlying agrarian agitation in these deprived, dispossessed people which frequently exploded into rebellion by organized militant groups including the \u201cRibbonmen\u201d, a 19th-century movement of poor Catholics in Ireland. These encounters and rural experiences armed William with valuable insights, setting him apart from his urban middle-class Dublin colleagues.William Wilde grew up in rural County Roscommon where he frequently accompanied his father Dr Thomas Wilde (1760\u20131838) on his daily rounds. Apart from influencing his choice of career, these childhood experiences offered William the opportunity to become acquainted with the rural poor, including their ideologies, diet and living conditions. He befriended many and enjoyed listening to their tales of witches, ghosts, saints, and fairies, resulting in a life-long interest in Celtic folklore. This elderly Augustinian cleric, a fluent Irish speaker, lived on the lands owned by his mother's family. At that time Father Patrick had in his possession priceless antiquities which are now to be seen in Dublin's National Museum. Wilde received his early formal education at the Banagher Royal School, in County Offaly, which had been given its royal charter by Charles I. The school was finally established in 1806 and in Wilde's time the Master was the Reverend Dr Alan Bell (1789\u20131839) a graduate of Trinity College Dublin and Glasgow University. There were 30 to 35 pupil's half of whom were boarders and half day boys. The pupils were the sons of clergymen of the Established Church, of army officers, doctors and other children of the wealthier middle classes of Connaught. The curriculum included Latin and Greek, French, Hebrew and English, algebra, Euclid (geometry), arithmetic ), geography, and history. Later Wilde attended at the Elphin Diocesan School, Co Roscommon, which had been founded in 1685 by Doctor John Hodson (1604\u20131686) Anglican Bishop of Elphin. When Wilde attended the school, the Master was the Reverend William Smith (1801\u20131841), who was the curate of Elphin and the Vicar General of the Diocese. The curriculum at the Elphin school also included Euclid, algebra, and arithmetic as well as Latin and Greek along with English and bookkeeping, with the pupils aiming for entrance to Trinity College Dublin. Interestingly, at the Elphin school in 1826 there were 19 pupils in attendance of whom 10 were of the Established Church and nine were Roman Catholics and of the total number of 19, 11 were educated for free. It is therefore clear that William Wilde had an all-round education, learning Irish and about the antiquities from Father Patrick and the classics and mathematics along with history and English from the two schools, which must have laid a sound basis for his future scholarship.William Wilde's earliest interests in education, archaeology, and natural sciences were provided by private tutorials, given to him by a retired monk, the Lord Abbott Cong, Father Patrick Prendergast (1741\u20131829). In 1837 Wilde was licensed to practice surgery by the Royal College of Surgeons in Ireland and shortly afterwards travelled abroad, chaperoning a wealthy patient of Dr Graves on a Mediterranean cruise. After leaving the patient Wilde spent several months in Egypt which had a defining influence on his life. His interests in botany, zoology and, more significantly, archaeology were stimulated, and he recorded his European travels and explorations in a two-volume book. Wilde's curiosity in ophthalmology was aroused when in Alexandria and Cairo he encountered the effects of trachoma, a Chlamydial bacterial eye infection that led to partial or complete blindness.At the age of 17 years, Wilde enrolled as a medical student at Dublin's Park Street Medical School and Dr Steevens\u2019 Hospital where he was apprenticed to the surgeon Abraham Colles (1773\u20131843) and was taught by the physicians Robert Graves (1793\u20131853) and William Stokes (1804\u20131877). By all accounts he was an exceptional student, submitting a prize-winning paper on spina bifida while on his obstetric rotation at the Rotunda Hospital. and had treated the poet John Keats (1795\u20131821) during Keats\u2019 illness in Rome. Through Clark, Wilde was introduced to William Farr (1807\u20131883), epidemiologist and one of the founders of medical statistics.Following his travels to Egypt, to gain further experience in diseases of the eye, Wilde went to London in 1840, spending six months at Moorfield's Eye Hospital. With the help of letters of introduction from the author Maria Edgeworth (1768\u20131849), he quickly accumulated a group of influential friends including Sir James Clark, (1788\u20131870), Queen Victoria's physician. Clark, like Wilde, had written a book on his European travels He made full use of his time in Vienna and recorded his experiences in a book, Austria: Its Literary, Scientific and Medical Institutions, in which, using the new statistical skills he had acquired, Wilde analyzed the Austrian Government's medical, social, and educational polices. Emer O'Sullivan writes in The Fall of the House of Wilde (2016) that Wilde was \u201can intellectual voicing his opinion in Austria's Civil Rights as well as charging the Church and Monarchy with interference in scientific inquiry.\u201d In Vienna, Wilde demonstrated his qualities of clinical observation when he noted the extremely high rate of puerperal sepsis in the obstetric wards. Wilde believed that the Austrian doctors did not consider puerperal fever infectious, writing \u201cI myself have seen a newly-delivered woman placed in a bed scarcely yet cold, in which a death from puerperal fever had taken place two hours before!\u201d He was especially critical of the Viennese doctors, castigating them for not taking such elementary precautions, including cleansing, fumigating, whitewashing, and closing infected wards, when managing patients where there was puerperal sepsis.Intent on furthering his knowledge of ophthalmology and to gain experience in diseases of the ear, in 1840 Wilde travelled to Vienna where he enrolled as an observer at the Allgemeines Krankenhaus. Semmelweis introduced hand washing with chlorinated lime water dramatically reducing the incidence of puerperal sepsis. These methods were similar to those that Wilde's made seven years earlier when as a medical student he used comparable protocols following the death, from cholera, of a patient he had nursed in Galway. Both Wilde and Semmelweis's observations were made 20 years before Joseph Lister's (1827\u20131912) seminal publication on antiseptics in surgery in 1867. In 1840\u20131841 Wilde travelled further in Europe, visiting surgical centres and meeting with intellectuals and royalty, showing his ability to be equally at ease with European aristocrats and Irish peasants. In Berlin, he studied with the pioneering plastic surgeon Johann Friedrich Dieffenbach (1792\u20131847). Later in 1841 he returned to Dublin where he established his first clinic at St Mark's Hospital, dedicated to the treatment of diseases of both the eye and the ear, and largely for poor patients. The hospital had 20 public and three private inpatient beds and became so successful that in 1850 he purchased the recently vacated Park Street Medical School, where he had been a medical student, and transferred St Mark's to that site. This hospital became the premier eye infirmary and one of the only hospitals in the British Isles specializing in diseases of the ear. Wilde attracted patients to the clinic from all over Ireland, along with students from Europe and North America.Some years later, in 1847, Ignaz Semmelweis (1818\u20131865), who became a life-long friend of Wilde and who also worked at Allgemeines Krankenhaus, took this further. Semmelweis noticed there was an association between contaminated tissue, transported from the autopsy room to the labor ward and borne on the hands of medical students and doctors, and puerperal sepsis.Practical Observations on Aural Surgery, he wrote.statistical tables and calculations are really valuable only when we can rely upon the original investigations from which they were deduced; if the materials have been loosely collected, or for any special purpose, or support any preconceived theory, such circumstances naturally influence the value to be set upon all subsequent arrangements, no matter how ingenious.This observation remains relevant today, as data input into an analysis has to be accurate or else it has no value and preconceived ideas of the outcome leads to bias.One of Wilde's significant medical contributions was the introduction of meticulous documentation involving the demographics, diagnosis, treatment of patients and, most important, outcomes. In his publications Wilde continued to emphasize the necessity for documentation as well as long-term follow up. In Dublin Journal of Medical Science, which enhanced both Dublin's medical reputation and promoted Wilde's career. In the journal, Wilde reported on progress in ophthalmology, citing articles published in the previous 12 months from both home and around the world, based on their scientific qualities.In 1846, Wilde was appointed editor of the Wilde's Worlds (2016), the historian James McGeachie states that the medicine practiced by Wilde and his colleagues was not by today's standards truly scientific. However, the 1830s were the turning point in the importance of the microscope in studying organs and tissues of the body. Microscopy was being developed particularly in Europe and many students from Britain travelled to Europe, notably to Paris, to acquire expertise in this new technology. In Edinburgh in the 1830\u2032s Allen Thompson (1809\u20131884) was probably the first person to introduce microscopy to medical student teaching and John Goodsir (1814\u20131867) conservator of the Museum of the Royal College of Surgeons of Edinburgh and later Professor of Anatomy at Edinburgh University, developed his theory about the nature and structure of cellular life and organization based on microscopic evaluation of tissues. Later, this new science of microscopy became widely available for the study of gross pathological features following the seminal work of Rudolf Virchow (1821\u20131902) in 1858. Hence, the scientific revolution in medicine was on its way and Wilde recognized the importance of understanding anatomy and pathology, particularly of the organs of hearing. He collaborated with the London otologist Joseph Toynbee (1815\u20131866), who had dedicated his life to the study of the anatomy and pathology of the ear, and it is apparent that Toynbee's talents as a scientist complemented the clinical expertise of Wilde. Wilde's understanding of the role of a physician are to be found in his book Practical, Observations on Aural Surgery in which he wrote \u201cThe practitioner of aural surgery ought to be a well-educated surgeon or physician who applies the well-recognized principles of medicine to the organ of hearing.\u201d Wilde paid great attention to the classification and tabulation of diseases of the eye and ear, as well as reporting the outcomes of these conditions. Fifty years later Ernest Armory Codman (1869\u20131940), a surgeon in Boston, Massachusetts, USA, devoted much of his life to advocating the accountability of hospitals and physicians \u2018The End Result Idea\u2019 (1918). Controversial at that time, the concepts of these two pioneers have become the standard practice for hospitals and physicians and surgeons today. Wilde also made substantial contributions to advances in surgical practice by inventing instruments for use in otology and describing a post-auricular incision for draining periosteal mastoid abscesses, Wilde's Incision. Further evidence of his progressive scientific views was his early adaption of chloroform anaesthesia and the use of atropine eyedrops in the management of inflammatory diseases of the eye. In 1850 he championed the empirical use of cod liver oil, a dietary supplement rich in vitamins A and D, in the management of xerophthalmia, a condition characterized by progressive dryness of the eye, which can lead to blindness and is now known to be due to vitamin A deficiency.In Wilde's scientific approach to the practice of surgery could however be seen to be at odds with his strongly held beliefs in mythology and folklore. It would appear though that he was at ease with these disparate topics, dealing with these conflicting positions entirely separately. Wilde's medical qualifications, statistical knowledge, familiarity with the Irish language and folklore along with publications on social issues all made him an ideal choice. As a young doctor, Wilde also welcomed the added income. He was first appointed to the Commission as a medical advisor and compiler of the causes of death from the 1841 Census. The Commissioner at that time, Sir Thomas Lorcan (1801\u20131879), was impressed by Wilde's work and appointed him Assistant Commissioner for the 1851 Census, a position he held for the rest of his life.The historian Peter Froggatt asserted that the appointment of Wilde to the Irish Census Board was inspirational. In the report, Wilde also recorded the incidence of blindness on 31 March 1851 in both adults and children as one person in 864, later using this information to draw the attention of the authorities to provide more facilities for the care of blind patients. Also, at Wilde's insistence the 1851 Census included the inhabitants of both the workhouses and hospitals who had been ignored in previous censuses.Wilde approached the Herculean task of conducting the 1851 Census, which covered the years of the Great Famine, with his usual vigor, presenting a detailed completed report in 1856. This is the only official audit of the Great Famine carried out by the British State and Froggatt wrote that it was one of the greatest national Censuses ever produced, including details of the incidence of impaired hearing and sight as well as mental disabilities, which was unique at the time.Dublin Quarterly Journal, he circulated questionnaires to local doctors to improve the accuracy of the data.However, despite Wilde's best organization and analytical endeavors, the Census Reports were flawed. They relied primarily on the honesty and memory of an exhausted and sometimes hostile population stretching back over 10 years during which time many families had died or emigrated. Wilde appears to have been aware of these shortcomings, now known as bias, but was not deterred by them. He used his rural background knowledge to interpret and enhance the value of the information he collected. Also, as editor of the  Later though in 2002, the economic historians Joel Mokyr and Cormac O\u2019Grada applied mathematical modeling to Wilde's data and concluded that the Census reflected the conditions of that time. In Power and Popular Culture (2010), Peter Gray discussed the accuracy of Wilde's figures and noted that, before his publication of the tables of deaths in the General Census Report in 1856, there was wide variation in the mortality reported by the press. The Times of London, for example, estimated that there were about 20,000 deaths from the famine, while the nationalist Irish Freeman's Journal put the figure at 4.75 million. Wilde in the final Census reported a decline in the general population of 2.5 million with deaths accounting for one million, and emigration accounting for much of the remainder. These estimates were accepted later by both The Times and the Freeman's Journal. The latter publication admired Wilde's work but was highly critical of his failure to lay blame for the catastrophe on the British Government. Indeed, at that time the liberal Irish press, notably The Nation, championed the writings of the radical John Mitchel (1815\u20131875) who wrote \u201cThe Almighty, indeed, sent the potato blight, but the English created the Famine\u201d. Wilde though in his Census Report, had defended the policies of both the Dublin and the London Governments and, in The Food of the Irish published in 1854, stated that the Famine had cleared the way for the modernization of Irish society and its diet, especially the potato that supported it. Wilde concluded that the substantial reduction in the population produced by the famine led to improvement in agriculture, living conditions and literacy of the Irish poor. He strongly criticized the dependency of the Irish peasantry on the potato because when it was plentiful it made them lazy and nonproductive, which fuelled agitation. Wilde asked, \u201cHave we lost a man too many? The best friends of Ireland and her people would say not,\u201d revealing a remarkable lack of empathy toward the Irish peasantry. This paradox in Wilde's personality is perpetuated throughout his life.However, William MacArthur, the historian, in 1956 commented that many historians placed little credence on the usefulness of Wilde's tables.In the 1850s and early 1860s, William Wilde was at the zenith of his fame. He was an internationally recognized doctor and had written successful books on surgery, antiquities, and folklore. Wilde was also the author of a National Census Report unequalled internationally, and he was awarded a knighthood of the Order of St Patrick for this work in 1864. Wilde himself concludes that all this work had been done at a risk to his life. and Froggatt posits that it was the beginning of his mental and physical decline.In March 1857 he undertook the massive project of cataloguing, describing and illustrating some 10,000 antiquities in the museum of the Royal Irish Academy. He successfully completed this task in four months, which a committee of experts had failed to accomplish in four years. The publication of this catalogue for which he received the Academy's highest award, the Cunningham Medal, marked the end of the greatest productive period of Wilde's life.Despite this success Wilde displayed a somewhat reckless side to his character. He had several illegitimate children, and it was common knowledge that he was a philanderer. Though The Lancet in London, Saunders's Newsletter in Dublin, and most of the medical fraternity, supported him, after the court case Wilson notes that Wilde lost his enthusiasm for surgery and that his clinical practice suffered irrevocably following the trial. Following the court case Wilde departed Dublin for Moytura near the village of Cong in County Mayo, leaving his practice in the care of Henry Wilson who was widely thought to be Wilde's illegitimate son.Furthermore, in the mid-1864 his career suffered a severe blow which could be attributed to irresponsible behaviour. He had developed an unprofessional relationship with a young female patient named Mary Travers who became so demanding that Wilde tried to end the relationship. Determined to ruin Wilde, Mary Travers circulated leaflets suggesting he had raped her while she was under the influence of chloroform. Lady Jane Wilde (1821\u20131986), William's wife and writer, known as Speranza, was incensed by these accusations and wrote to Mary's father protesting at these allegations. Mary, though, read the letter and started proceedings to sue Lady Jane for libel, thereby implicating William Wilde. The court found in favour of Mary Travers and ruled that Wilde was not without fault, but only awarded damages of one farthing. However, Wilde was left with legal fees of \u00a32000 on behalf of Lady Jane.The Parents of Oscar Wilde (1967) Terence de Vere White wrote that even before the trial Wilde \u201chad taken to escaping to Cong whenever he could\u201d, indicating that his medical interests were already waning. Richard Ellman, Oscar Wilde's biographer, suggests that Wilde showed his indifference to the outcome of the lawsuit \u201cby writing his most cheerful book Lough Corrib (1867).\u201dIn  and then three years later his two illegitimate daughters died in a fire. Wilde had been suffering from asthma and bronchitis for many years and his general health started to deteriorate significantly in late 1875, although Froggatt suggested that his decline dated back to the mid-1850s. Wilde died on 19 April 1876 aged 61 years.Unfortunately, Wilde suffered further anguish when in 1867 his daughter Isola, died in her tenth year, most likely from meningoencephalitis, a fatal brain complication of typhus, This characteristic was highlighted in an obituary in the Journal of the Archeological Society in October 1876 which reportedDoctor mor  would certainly restore the blessed light of heaven to blind-struck eyes.By the peasantry he was particularly loved and trusted, for he had brought back joy and hope to many households. How gratefully they remembered his professional skill, always so generously given, and how, in the remote country districts, he would often cross moor and mountain at the summons of some poor sufferer, who believed with simple faith that the The literature is replete with reports of Wilde the humanitarian, an example of which is when as a medical student he travelled to Connaught and nursed a terminally ill man suffering from cholera, whom he personally arranged to be buried.Quarterly Journal, he highlighted the appallingly high mortality among dispensary doctors, who were contracted to give medical care to the poor, by publishing an article by the surgeon James Cusack (1778\u20131861) and the physician William Stokes. The article used figures derived from Wilde's Tables of Deaths in the 1841 Census and these data were presented to a Select Committee of the House of Commons. Wilde also published a letter by Robert Graves, which severely criticized the Board of Health for its treatment of dispensary doctors who at that time were dying at an alarming rate. Wilde, Cusack, and Stokes established a medical relief committee which distributed money to the families of those doctors who had experienced hardship. Moreover, he demonstrated his generosity by opening St Mark's Hospital largely for poor patients and in 1862 he bequeathed his hospital to the city, for the use of the poor of Ireland, probably the greatest example of his philanthropy.Wilde also showed real concern for the health of his medical colleagues, especially those working in the Poor Law Service. As editor of the William Robert Wilde's life included many major achievements, some of which were influenced by his background and early education. His considerable accomplishments though could not have occurred without an insatiable appetite for knowledge in many diverse spheres of life, combined with an enthusiasm and determination to make advances in the fields of otology and ophthalmology. His insistence on the accurate documentation of clinical data, the use of statistical methods, and the early introduction of the concept of evidence-based medicine, shows him to have been much ahead of his time. Some of Wilde's observations were prescient, including the infectious nature of puerperal fever and the treatment of xerophthalmia. These contributions to medicine rank him as an original physician scientist.Wilde also demonstrated a keen sense of scholarship from his earliest days, not only in medicine but also in such divergent disciplines as archaeology and mythology. His accomplishments as a Census Commissioner and his classification of the antiquities in the Royal Irish Academy show the breadth of his interests and intellect. His reliance on common sense and proven practices in running his hospital contrasts with his beliefs in mythological events such as the Battle of Moytura in 3303 BC. These apparent paradoxes may be explained by understanding that Wilde's primary vocation was as a scientific physician while his genuine interest in Celticism and folklore was romantic and can best be described as an avocation.By contrast, it has to be acknowledged however that Wilde's life was full of conflicts and contradictions. On the one hand in his professional career, he was a strong advocate of evidence-based medicine, on the other, in his writing on mythology, he recommended folk remedies.The Irish Crisis 1848\u2019 which attributed the catastrophic effects of the famine to Divine intervention. However, McGeachie notes that while writing the 1851 Census report,Wilde's authorial voice moved from being a government-appointed exponent of one the key legacies in Ireland of the Enlightenment State \u2013 the tabulating of public health \u2013 to that of the narrator of a tragedy, the massive human, social and cultural catastrophe of the famine.However, the fact that he largely absolved the British Government of blame is difficult to understand, coming from a man with firsthand experience of British oppression of the Irish peasants in his youth. Possible explanations for this dichotomy are that he was acting as an insensitive civil servant, unwilling to bite the hand that fed him, an explanation that would suggest a certain weakness of character. This fault may also have accounted for the fact that he did not defend himself in the Mary Travers case, and also that later he avoided discussion with his family about his precarious financial status, which condemned his widow to a life of genteel poverty. Another possible explanation was that although he genuinely believed what he wrote, he modified his beliefs over the passage of time. In the last speech of his life, delivered in 1874 to the Anthropological Section of the Royal Academy in Belfast, Wilde stated bluntly that Ireland was not defeated by Henry II but by the Great Famine which was made worse by British Government policy.It would also appear that his reports on the Great Famine were surrounded by an internal conflict. For example, in the 1851 Census Wilde defended the Whig Government's management of the disaster, even lending support to Charles Trevelyan's (1807\u20131886) \u2018Wilde's conventional public lifestyle contrasts with his private behaviour such as demonstrated by his illicit affairs. To explain his complexities and eccentric conduct, it has been suggested that Wilde had a form of Asperger's Syndrome, a neurodevelopmental disorder characterized by difficulties in social interaction and nonverbal communication, believed to be common in Irish artists of his time. although the evidence might suggest otherwise. It would appear that his interest in surgery diminished, possibly as early as 1862 when he handed over the management of St Mark's to a board of trustees and his son, Henry Wilson, alleged to be Oscar's half-brother, took over a large part of Wilde's ophthalmological practice. Froggatt argued coherently though that Wilde's decline probably began even earlier and could be traced to the physical and psychological exhaustion he suffered after completing the classification of antiquities for the Royal Irish Society in 1857. It is conceivable that after more than 20 years of stressful medical practice and running a hospital Wilde suffered from a condition now known as \u201cmedical burn out.\u201d Nonetheless, Wilde continued with his non-medical interests, even writing his Lough Corrib. Its Shores and Islands, thought by many to be his finest work, suggesting that burn out only affected his medical practice.Wilson states that the loss of his court case in 1864 was a severe blow from which Wilde's medical career never recoveredWhat is also fascinating is that, in addition to his liberal humanitarian qualities, Wilde was an outspoken advocate for racial equality and supported the principles of crossbreeding. This was at a time when many Europeans were promoting racial purity and white superiority.In conclusion, we would argue that William Wilde was a thoughtful, kind, humane doctor although his interpretation of the effects of the Irish Famine being of benefit to the Irish people would not sit comfortably with modern opinions. He was a true medical scientist who could empathize with both the medical elite in Dublin's Merrion Square and with the peasants in Moytura.Let us then remember William Wilde: certainly not just as the father of Oscar, but as a great humanitarian, a great doctor, a unique statistician, an investigator in many fields, and also as one who loved to fish in Connemara, to study his country's archaeology, but who loved perhaps best of all the company of his friends.In reality Wilde was an enigma. He promoted his wide-ranging ideas in articles and books, primarily to make advances in his specialty. He understood statistics and the need for outcome data to be recorded in order to improve the management of patients. He delighted in the study of architecture as well as cataloguing the antiquities. However, he lived an alternative life embedded in mysticism and romanticism and was reckless with his social life and finances. We would suggest however, that without such innovators and Enlightenment figures as Wilde, who are in turn extremely individualistic, single-mindedly pursuing their ideals, the world would be a far poorer place.Perhaps his life is best summed up by LB Somerville-Large (1901\u20131966) who wrote."}
{"text": "Multiple sclerosis (MS) is the most common non-traumatic cause of disability in young people, with vision loss in the disease representing the second largest contributor to disability. In particular, African-American patients with MS are noted to have lower vision than their Caucasian counterparts. In this review, we examine the disparities in eye diseases in the MS population with our gaps in knowledge and discuss the underlying nature of pathological disparities. Disability accumulates by two separate components of the disease. Primarily, there is the relapsing form of the disease, where neurological symptoms often develop subacutely through inflammatory demyelinating plaques of the central nervous system with subsequent disability accumulation from incomplete recovery. Secondarily, there is an increased risk of neurodegeneration in a significant subpopulation of the disease, where neurologic disability accumulates independent of relapses, often termed the progressive form of the disease. Both forms of the disease can overlap and often lead to progressive neurological disability, often including vision loss.4Multiple sclerosis (MS) is a demyelinating disease of the central nervous system and is the most common cause of non-traumatic disability in young people.6 Historical literature in the field indicates that MS occurs more commonly in Caucasian patients; however, recent studies have demonstrated that the prevalence is higher than previously reported in African-American populations and possibly comparable when compared to Caucasian populations.710 The prevalence of MS among those who identify as Hispanic, Latino, and/or Latinx varies, but is lower than what is seen in African-American and Caucasian populations.8 However, this number is expected to grow as these populations now represent the most rapidly growing minority in the United States.Epidemiologically, MS affects 2.8\u2009million people in the world and approximately 1\u2009million people in the United States.12 In addition to rising numbers, it has also been well demonstrated that both African-American patients with MS (AAwMS) and HwMS have more aggressive disease courses and are more likely to suffer severe disability.13 Symptomatically, this disability accumulation manifests with a variety of neurological symptoms, including cognitive dysfunction, gait dysfunction, motor dysfunction, and sensory dysfunction; however, vision loss remains one of the most common symptoms of the disorder. There are some data to suggest that optic neuritis is a more common manifestation of the disease among both HwMS and AAwMS. In this narrative review, we summarize the neuro-ophthalmic manifestations in HwMS and AAwMS, inequities that are present in the literature, as well as underlying possible mechanisms.While Hispanic, Latino, and/or Latinx are often used interchangeably when describing patient ethnicity, it should be noted that these terms have variable meanings. For this paper, we will refer to those who identify as Hispanic, Latino, and/or Latinx as Hispanics with MS (HwMS). Often characterized by the subacute development of vision loss , pain with eye movement, and dyschromatopsia color desaturation, inflammation and demyelination within the optic nerve cause delay of action potentials through the optic nerve, and secondary axonal block with eventual axon loss. While there is a strong association between MS and optic neuritis, there are a wide variety of etiologies to optic neuritis, with up to 31% of patients suffering from recurrent vision loss.Broadly, optic neuritis is one of the most common neuro-ophthalmic diagnoses associated with MS. In approximately 20% of patients, optic neuritis is the initial presentation and is thought to occur in roughly 50% of patients in their lifetime. Visual evoked potentials have provided a technology to measure the space constant of the optic nerves and have robust diagnostic and prognostic value.1719 Optical coherence tomography (OCT) is another noninvasive technology that provides a great spatial resolution of the retina and has been used as a highly sensitive diagnostic evaluation for optic neuritis both in acute and chronic settings.2023 Given the increasing precision of ophthalmic imaging technologies and increased availability, it is becoming an advantageous medium to detect pathological variability between minorities and non-minorities with MS.Notably, given the association of optic neuritis and MS, the visual system has often been used as a window into the mechanisms of disease activity. In this pivotal trial, there was no difference between sex, age, presence of disc edema, or fulfillment for MS at presentation between African Americans and Caucasians, but African-American patients had more frequent severe vision loss, both at presentation and at follow-up. This discrepancy was at least partially attributed to the increased prevalence of the \u2018neuromyelitis optica\u2019 presentation of neurological deficits, which occurred in 58% of the AAwMS studied. This hypothesis for the discrepancy remained as anti-aquaporin-4 (AQP4) antibody assays were not commercially available at the time of the study; however, anti-AQP4 was not detected in any of the 116 serological samples from the ONTT that were tested, making this hypothesis less likely. Over time, the differences in vision loss between AAwMS and Caucasians with multiple sclerosis (CAwMS) were felt to reflect the differentiation of risk for \u2018opticospinal MS\u2019 in African Americans relative to their Caucasian counterparts. As neuromyelitis optica spectrum disorder (NMOSD) became more differentiated from MS by the commercial availability and utilization of the anti-AQP4 assay, differences in vision loss between AAwMS and CAwMS became partially explained, but not fully accounted for. As serological positivity for the anti-AQP4 assay is now synonymous with NMOSD, a distinct demyelinating disease from MS, whether similar disparities exist for NMOSD remains an active area of research.Historically, differences between African-American and Caucasian patients with optic neuritis have been noted back to the optic neuritis treatment trial (ONTT). This is perhaps partially explained by retinal neurodegeneration in the fellow, non-optic neuritis eye.29 Patients who identify as AAwMS and HwMS have been shown to have higher rates of disability when looking at the Patient-Derived Multiple Sclerosis Severity Score. There is frankly a dearth of neuro-ophthalmic data for HwMS, both in terms of specifics of structural and functional assessments of visual function.Not only did those AAwMS suffer from increased risk of disability accumulation through optic neuritis but also in global disability.31 Understanding the disparities between the neuro-ophthalmic findings in this population yields insight into the different pathological mechanisms.Why AAwMS and HwMS suffer from increased visual disability and inflammatory disease activity is not fully understood. As historical data from MS suggest the disorder is underdiagnosed in racial and ethnic minorities, their disability data are not proportionally represented in the literature prior to recent efforts. Investigations into socioeconomic status have yielded some data to suggest an increased risk of disability accumulation; however, these covariates do not explain racial and/or ethnic disparities. MME could represent the microscopic precursor to macular edema, which in itself is associated with vision loss through a direct maculopathy. Although this direct comparison is controversial, longitudinal data do support this hypothetical spectrum of disease, although such data are limited. While MME is nonspecific, occurring in a multitude of disorders, it has a strong association with optic neuropathies such as optic neuritis and is well described in the MS literature.3436One glaring disparity in neuro-ophthalmic disease in MS is microcystic macular edema (MME). While technically a misnomer, MME is defined as cystic, lacunar areas of hyporeflectivity with clear boundaries within the inner nuclear layer (INL) of the retina, shown in  Optic neuritis seems to be highly coincident with, but not sufficient, for the development of MME in MS. Interestingly, most cases of MME are transient, with only 16% remaining over a mean follow-up of 233\u2009days in one study. There are some data to suggest that MME is associated with a higher risk of disease in MS patients, although it is less clear whether this is independent of race and/or ethnicity itself.In the MS population, both MME and macular edema have been described. Of particular concern among AAwMS, the MME incidence is reported to be approximately 12% over a mean follow-up of 4\u2009years, where overall frequency in the entire MS population is estimated to be anywhere from 1% to 6% over a slightly longer follow-up duration. The inflammatory activity of optic neuritis being highly coincident in its development does suggest that inflammation, either chronic or acute, plays a significant role. Analogous to MS, MME is also strongly associated with NMOSD, where its mechanism was posited to involve direct insult to M\u00fceller cells  through a direct astrocytopathy. Interestingly, there are conflicting OCT data to support this hypothesis, perhaps again emphasizing multifocal mechanisms.4042 While transsynaptic degeneration is increasingly appreciated in MS, a transsynaptic retrograde maculopathy is an unlikely explanation for its mechanism given the temporal dynamics of the disease.4345 This, in combination with the lower prevalence of macular edema (1\u20136%) in contrast to highly prevalent neurosensory retinal loss appreciated with optic neuritis (60%), makes this similar at best a partial explanation.The mechanism(s) of MME in MS is not precisely clear but were hypothesized to reflect dynamic fluid shifts, either through vascular permeability and/or M\u00fcller cell dysfunction, or perhaps non-inflammatory changes including mechanical traction or retrograde maculopathy. These risk factors for S1P-associated MME furthered the hypothesis that vascular permeability may be playing a significant role in the pathophysiology of MME for most MS patients. As such, screening for macular edema and MME became integral to S1P prescription, as some patients have developed the adverse event 24\u2009h following therapy initiation. Given the high prevalence of MME noted in AAwMS, initiation of S1P modulation should follow local prescribing regulations, with careful consideration of MME risk, as this finding is transitory in the majority of cases. Whether those with a history of MME that has resolved are at risk of MME and/or macular edema following S1P modulation has not been examined.Most pertinent in the therapeutic realm of MS was the early realization of an increased risk of MME following S1P modulation in patients with MS. The absolute risk of MME was low with fingolimod, the originally FDA-approved S1P modulator, at 1% annual incidence with exposure, with both diabetes and uveitis identified as risk factors for its development.48 In addition, MME has been encountered in S1P modulation in other non-neurological conditions, such as ulcerative colitis, which argues against a direct neuroinflammatory effect underlying its pathogenesis. There are data to suggest that nonselective S1P modulation may be associated with an increase in macular volume, which could represent subclinical macular edema, although this hypothesis was limited by the single-center design, and did not report measures of the INL, where the majority of MME presents. Despite the risk of macular edema associated with S1P modulators, a systematic review indicated that a favorable outcome was observed in select cases with continuation of this therapy with concomitant macular edema treatment when alternative therapies were untenable, although extreme caution is highly encouraged in such cases.The mechanism of MME as an adverse of S1P modulation is similarly unclear. It was originally hypothesized that S1P3 modulation at the orbital vascular endothelial junctions was directly responsible, although macular edema has been reported as an adverse event with ponesimod, a highly selective S1P1 modulator.While MME represents a relatively uncommon neuro-ophthalmic finding in MS, it has significant implications both diagnostically and therapeutically for most patients with MS. A variety of mechanisms have been posited to explain its mechanism(s), shown diagrammatically in  Indeed, neurosensory retinal loss measured in a variety of ways is accelerated in those who identify as African American relative to Caucasian, primarily within the inner retina. In addition, macular volume loss correlates well with global brain volume loss, serum neurofilament light chain levels,51 as well as with visual function, including low contrast visual acuity.5254 Taken cumulatively, there are data to suggest the cross-sectional volume of the macula has significant prognosis value, with lower macular volumes being predictive of an increased risk of disability accumulation at 10\u2009years, regardless of optic neuritis. In this way, measurement of retinal structure and function captures \u2018silent progression\u2019 in MS, what is globally being described as progression independent of relapse activity.As MS has both an inflammatory and neurodegenerative component, the visual system has been used to capture quantitative measures of disease activity. Disease activity was primarily appreciated through disease within the optic nerve itself. The retinal nerve fiber layer thickness, an OCT metric often taken as a surrogate for axons within the optic nerve, has captured neurosensory retinal loss, known to occur in patients with MS at an average rate of 0.4\u2009\u00b5m/year, whereas healthy controls lose on average 0.2\u2009\u00b5m/year.58 In terms of health disparities, there is evidence that obesity may have differential effects in racial subgroups. Investigation into the socioeconomic subgroups independent of race has shown a similar relationship of higher neurosensory retinal loss with lower socioeconomic status measured by a variety of variables, including median household income, education level, and state area deprivation index.52Analogous to brain volumetric studies, it is known that several variables, such as inflammatory disease activity and obesity, can affect neurosensory retinal loss. The quantitative methodologies available to neuro-ophthalmology make the incorporation of immunological, environmental, and socioeconomic covariates into disease models of disability ultimately highly tenable.As the mechanisms of disability accumulation in MS are multifactorial, further study into the dynamics of both structure and function through the visual system yields the opportunity to understand the disease in a more diverse patient population. Indeed, as OCT-based diagnostic criteria are considered potential diagnostics criteria for MS, incorporating ethnically and racially diverse patient cohorts will be critical to their generalization.60 Studies evaluating the specific roles in AAwMS have demonstrated that there is a difference in these previously established genetic risk variants among AAwMS with both HLA-DRB1*15:01 and HLA-DRB1*15:03 inferring an increased risk of developing MS consistent with other populations, but HLA-DQB1*06:02 having no association with increased risk.62 Within certain Latin American populations, HLA-DRB1*15:01, HLA-DRB1*15:03, and HLA-DQB1*06:02 have shown an association with increased risk similar to what is seen in other populations. Studies have also demonstrated that there is a genetic influence on the age of onset in HwMS leading to MS presenting at earlier ages; however, there is conflicting data surrounding this idea in AAwMS.While the pathogenesis of MS is complex, it has been well documented that genetics play a role in the development of MS, with the class II region of human leukocyte antigen (HLA) having the largest effect, in addition to a growing number of almost 200 other genetic loci. In a 2018 study, Amezcua et al. demonstrated regional differences in the development of optic neuritis in HwMS, with those with Native American ancestry in the southwestern United States having higher rates of optic neuritis relative to CAwMS.65 Similar studies have not been replicated in AAwMS.More interesting and specific to this current narrative review, there appears to be a genetic influence on the development of optic neuritis as a presenting symptom in MS among Hispanics based on genetic admixture, the interbreeding of individuals from isolated lineages. The humoral immune system is highly active in both AAwMS and HwMS, as there are increased levels of antibody-secreting cells in peripheral blood samples. Furthermore, it is now known that AAwMS have higher levels of intrathecal humoral inflammatory changes based on higher levels of IgG synthesis rate and IgG index. It has also been demonstrated that the presence of oligoclonal bands is associated with higher levels of disability among this patient population, and so one possible explanation for the disparate disability could relate to this immunological heterogeneity.70 There is further anatomic evidence to support this hypothesis, as there is also an association with cerebral gray matter volume loss and the presence of an elevated cerebrospinal fluid (CSF) IgG index in AAwMS.The answer to why there is an interethnic and interracial difference in disease aggressiveness is likely complex, with influence from genetics, environmental exposures, immunological variations, as well as social determinants of health. Specific to immunological mechanisms, one possible explanation relates to the differing pathological phenotypes of MS. The four classic pathologically determined lesion types, from type I to type IV, are based on different immune system characteristics. Of specific relevance are type II lesions, which are characterized by antibody deposition, and thus directly implicating the humoral immune system in the development of MS lesions.Post hoc analysis of the EVIDENCE trial, which evaluated the efficacy of interferon-\u03b2-1a in treatment-na\u00efve MS patients, demonstrated that AAwMS treated with interferon-\u03b2-1a suffered from a higher number of exacerbations were more likely to have a relapse, and developed a higher number of new T2 lesions at 48\u2009weeks compared to CAwMS. This differing treatment response was further illustrated in a retrospective review comparing treatment response to interferon-\u03b2-1a or interferon-\u03b2-1b, glatiramer acetate, as well as natalizumab in AAwMS compared to CAwMS suggesting this relationship is not DMT specific among the early DMTs. There is currently very limited data evaluating DMT exposure in HwMS, making analogous comparisons untenable.Another argument for an immunological disparity can be made by exploring the interracial data on exposure to disease-modifying therapies (DMTs), as AAwMS have been shown to have a less robust therapeutic response to certain DMTs. 75 While early data identified that those with African ethnicity are more likely to have these uveitis, in recent literature, the prevalence of uveitis in MS has decreased to 0.51%. In addition, in the large UK Biobank study, 87.5% with both MS and uveitis identified as White. In the modern era, given the relatively low incidence of uveitis, it is difficult to understand the contribution of both race and ethnicity to this disease pathophysiology. In addition, the uveitis is often anterior or intermediate, for these reasons, is beyond the scope of this narrative review.Historically, there has long been an appreciated relationship between uveitis and MS, where the incidence varied between 10% and 23%. There is a dearth of literature examining ethnic and racial disparities in these findings, which is worth mentioning, particularly as there is literature suggesting that structurally the brainstem regions controlling these functions are selectively vulnerable in those with African-American ancestry. Further study is needed on this topic.Similarly, ocular dysmotility, including internuclear ophthalmoplegia (INO) and wall-eyed bilateral INO, are highly prevalent in MS.et al. found that less than 1% of the 60,000 publications on MS were focused on minority populations. The lack of minority representation in clinical trials is even more concerning, with a recent review highlighting that less than 10% of patients in these trials were representative of minority backgrounds. As mentioned previously, it has been shown that AAwMS have less robust responses to early DMTs, but whether this relationship continues among the more recent DMTs remains unknown. Furthermore, similar relationships are not known to exist between HwMS and CAwMS.Despite the increased prevalence and higher risk for aggressive disease in AAwMS and HwMS, both populations are grossly underrepresented in research efforts. A PubMed review completed in 2014 by Khan  In addition, the results of the FLUENT study, which investigated the change in peripheral lymphocyte dynamics in patients with relapsing forms of MS treated with fingolimod, demonstrated a reduction in both T cells (CD4+ and CD8+) and B cells (CD19+ na\u00efve and memory) in a patient treated with fingolimod. While not directly aimed at evaluating treatment responses in minority MS patient populations, these results highlight that the S1P receptor modulator class of medications could be particularly beneficial in AAwMS given the higher level of B-cell activity noted in the peripheral blood of these patients. Ultimately, we must continue to broaden our understanding of DMT use in these patient populations to have a better understanding as to why these patient populations accumulate greater visual and global disability.Given the increasing attention to representation disparities, there have been more recent efforts to bridge this gap. The CHIMES trial is a phase IV clinical trial evaluating the efficacy and safety of ocrelizumab in minority patients with relapsing forms of MS. The findings from this trial will broaden our knowledge of disparate pathology among AAwMS and HwMS.While MS is the most disabling non-traumatic cause of young people, there are disparities and inequities that require both scientific and social attention. There are a number of lines of evidence that AAwMS and HwMS are at increased risk of disability accumulation. This can be seen in markers of clinical disability, radiographic outcomes, and visual outcomes, shown diagrammatically in Lastly, while there are relationships between the neuro-ophthalmic findings among AAwMS relative to CAwMS, analogous data for HwMS are desperately needed. As this represents a binarization of a variable of interest, a robust relation is likely subject to both type I and type II errors. If interethnic neuro-ophthalmic disease supports a similar disparity, this may provide the data needed for proposed universal mechanisms, and garner a greater understanding of how their participation in future therapy development will affect outcomes.This review has a number of limitations. First and foremost is its narrative format. There is both diverse and comprehensive literature on disparities in MS, and so the narrative format permits the appreciation of a number of topics, but should not be considered exhaustive in its coverage. The authors refer the reader to a number of the references for additional reading."}
{"text": "However, for neutral rings, the maximal value of \u201cn\u201d to which H\u00fcckel\u2019s rule applies remains unknown. Large macrocycles exhibiting global ring current can serve as models for addressing this question, but the global ring current are often overshadowed in these molecules by the local ring current of the constituent units. Here, we present a series of furan-acetylene macrocycles, ranging from the pentamer to octamer, whose neutral states display alternating contributions from global aromatic and antiaromatic ring currents. We find that the odd-membered macrocycles display global aromatic characteristics, whereas the even-membered macrocycles display contributions from globally antiaromatic ring current. These factors are expressed electronically , optically (emission spectra), and magnetically , and DFT calculations predict global ring current alternations up to 54 \u03c0-electrons.Aromaticity can be assigned by H\u00fcckel\u2019s rule, which predicts that planar rings with delocalized  \u03c0-electrons are aromatic, whereas those with 4n \u03c0-electrons are antiaromatic, but for neutral rings the maximum value of n for which H\u00fcckel\u2019s rule applies remains unclear. Here, the size-dependency of H\u00fcckel\u2019s rule is studied in a series of furan-acetylene macrocycles whose neutral states display alternating contributions from global aromatic and antiaromatic ring currents. While aromaticity is expressed in energetic, geometric, and optical terms3, it is most commonly quantified in magnetic terms, with either diatropic or paratropic ring currents for aromatic or antiaromatic compounds, respectively5. It is estimated that, for neutral annulenes, H\u00fcckel\u2019s rule is effective for \u226430 \u03c0-electrons, but theoretically it can also be valid for larger annulenes7. However, distortion from planarity with increased degrees of freedom, as well as increasing numbers of stereoisomers, prevents the experimental validation of this assumption. \u03c0-Conjugated macrocycles, which are composed of smaller aromatic rings in a cyclic arrangement, are shape-persistent, often more stable than annulenes, and are expected to show similar trends and thus produce aromatic or antiaromatic global ring currents11.Planar cyclic molecules with \u03c0-conjugation display aromaticity or antiaromaticity depending on their number of \u03c0-electrons, 412. Consequently, they show aromatic or antiaromatic global ring currents, depending on their size14. For example, Wu\u2019s group demonstrated that for [m]-cycloparaphenyl-methines 27, shorter interring distances24, as well as in magnetic ring currents. The exo angle of furan is predicted to favor macrocycles with significantly smaller sizes than can be obtained from thiophenes28. Macrocyclic furans , photophysical (absorption and fluorescence spectra), and electrochemical properties of these furan-acetylenes indicate a contribution from global antiaromaticity in even-membered macrocycles, whereas odd-membered macrocycles are globally aromatic. Nucleus independent chemical shifts (NICS) calculations support this trend, predicting that the contribution of the global ring current is significant up to 54 \u03c0-electrons in neutral Cm. Overall, this work highlights the prospect of furan serving as a probe for global aromatic effects in macrocycles.Here, we introduce a series of furan-acetylene macrocycles, ngs Fig.\u00a0. Unlike Cm series, comprising both odd- and even-membered macrocycles, we adopted the monomer rather than the oligomer approach. For [m]TA 35, was coupled to triisopropylsilyl-acetylene by Sonogashira coupling using triethylamine as a solvent in the presence of bis(triphenylphosphine)palladium(II) dichloride or copper iodide to obtain 2 with a 78% yield. The hexyl-groups were found to be important for the solubility of both the intermediates during the macrocyclization step and the final macrocycles. Lithiation of 2 with lithium-diisopropylamine followed by dropwise addition of a solution of I2 in tetrahydrofuran afforded 3, and the triisopropylsilyl group was subsequently removed with tetra-n-butylammonium fluoride to afford 4 with an overall yield of 60%.The synthesis of 4 using Sonogashira coupling, we attempted modification of several parameters, including solvent, base, temperature, and reactant concentration (see Supplementary Table\u00a04 (22\u2009mM) to 60\u2009\u00b0C with palladium-tetrakis(triphenylphosphine) (10% mol) and copper (I) iodide (3% mol) for four days produced C5\u2013C8 with an overall yield of 35%. The macrocycles were then separated using size exclusion chromatography. The size distribution is in-line with the calculated strain  and highest yield (13%) and C5 displays the highest strain energy  and lowest yield (<1%).For the macrocyclization of ) iodide % mol forC6 and C7 were grown by slow evaporation from hexane and chloroform solutions. The solid-state structures are displayed in Fig.\u00a0C6 is 26\u00b0, and in the solid state it adopts a chair conformation, similar to cyclohexane. C7 is significantly more planar, with an average dihedral angle of 12\u00b0, which also corresponds to the abovementioned lower strain energy. The calculated structures for Cm are nearly planar for all sizes, with an average dihedral angle of 1\u00b0 or less. We note that, as the barrier to rotation around the triple bond is low, the average conformation in solution is also expected to be planar or nearly-planar, as indicated by the calculated structures. The C\u2009\u2261\u2009C bond lengths do not display any significant changes  between the different members of the Cm series, and this also applies to other bond distances in the \u03c0-conjugated backbone. This is consistent with previously reported examples, in which alternating global aromaticity in large (>20 \u03c0-electrons) \u03c0-conjugated macrocycles was not expressed in the bond distances20.Crystals of Cm in dichloromethane. The oxidation potential  of C5 is 0.25\u2009V higher compared with C6 . C6 displays two distinct reversible oxidation peaks. C7 also exhibits a higher oxidation state compared with C6, although the difference is only 0.07\u2009V (Epa\u2009=\u20090.59\u2009V) and the oxidation potential for C8 is again lower than C7 (Epa\u2009=\u20090.52\u2009V). C6 stands out as the only member of the Cm series that exhibits two distinct reversible oxidation peaks, and we have previously observed similar behavior from the antiaromatic 8-membered furan macrocycle30. Therefore, C6 is the only member that exhibits a significant contribution from global antiaromatic ring current. The antiaromatic character of C6 is quite pronounced, whereas the cyclic voltammogram of C8 is not affected significantly by the global antiaromaticity.Figure\u00a0Cm are expected to exhibit higher oxidation potentials compared with their even-membered analogs, since oxidation to the cation is expected to result in the loss of aromaticity, and further oxidation to the dication is expected to result in the emergence of an antiaromatic contribution. Thus, the alternating trend of the oxidation potentials is consistent with the expected trend of global aromaticity/antiaromaticity. We note that the redox potential of charged macrocycles was previously suggested as a tool to probe global antiaromaticity36.As a result of their global aromatic character, odd-membered C5 is c.a.\u00a00.3\u2009eV lower than that of C6 , which corresponds to the abovementioned trend in the experimentally observed oxidation potentials. The HOMO of C7 (\u22125.27\u2009eV) is even lower compared with C6 and the HOMO of C8 (\u22125.11\u2009eV) is higher compared with C7. Overall, the alternating behavior of the HOMO energy levels with size matches the trends observed experimentally in the electrochemical oxidation. The difference between the oxidation potentials of C6 and C8 can be explained by the difference between their calculated HOMOs, which is 0.3\u2009eV higher for C8. It is interesting to note that macrocycles with formal antiaromatic systems were previously applied as active materials in batteries since they display stable redox states37.The calculated (M06/6-311\u2009G(d)) energy of the highest occupied molecular orbital (HOMO) of Cm with an excess of nitrosonium hexafluoroantimonate (NOSbF6), which was found to be an effective oxidant of macrocyclic furans28. Oxidation of C6 resulted in two sets of spectra, depending on the amount of oxidant added. The first set of spectra, showing a broad absorption band at 1744\u2009nm, and can be attributed to the cation radical, whereas the second set with bands at 1130\u2009nm and 550\u2009nm, can be attributed to the dication , with no apparent absorption bands that can be attributed to cationic or dicationic species. The greater stabilization upon oxidization of C6 and C8 compared with C5 and C7 is further evidence of the aromatic character of dicationic C6 and cationic C8.To study further the stability of the oxidized species, we attempted to chemically oxidize Cm are depicted in Fig.\u00a0C5 and C6 display relatively sharp absorption bands, with a weak S0\u2192S1 transition. For C5, the vibronic shoulders for the S0\u2192S1 transition can be observed at 415\u2009nm and 431\u2009nm. We note that, although C5 is more rigid than C6, the relative intensity of the S0\u2192S1 transition is stronger (by 15% for C5 and 8% for C6) compared with the S0\u2192Sn transition (n\u2009>\u20091). This indicates the involvement of additional factors in the oscillator strength. C7 and C8 display broader absorption spectra, corresponding to their more flexible structures. In chloroform, the absorption spectra of C6 and C7 exhibit concentration dependence above 10\u22125\u2009M  for C5 is 490\u2009nm, there is a significant bathochromic shift of 72\u2009nm (0.32\u2009eV) for C6. This also manifests in a clear difference in color upon irradiation in black light . We note that, although the differences are large, this should be taken with caution, as increasing macrocycle size also results in increased flexibility, which in turn affects the emission properties. The fluorescence quantum efficiencies are small (5\u20136%) for the rigid C5 and C6, and increase significantly for C7 and C8 . In addition, the emission maxima seem to occur in different vibronic states. Nevertheless, time-dependent density functional theory (TD-DFT) calculations display the same alternating trend as observed experimentally, with S1\u2192S0 transitions at longer wavelengths for even-membered macrocycles  level). The green trace in Fig.\u00a0Cm, showing the same alternating trend as the experimental emission maxima (gray trace). Overall, the emission spectra show alternating behavior, with even-membered rings bathochromically-shifted compared with the odd-membered rings.The emission spectra for Cm series to understand better the alternating behavior of its members. The frontier molecular orbitals for Cm are depicted in Fig.\u00a038.We utilized DFT to calculate the behavior of the C5 and C7) display degenerate HOMO and LUMO levels, and even-membered macrocycles (C6 and C8) displayed degeneracy of the HOMO-1 and LUMO\u2009+\u20091 levels. This is consistent with the trend for expanded porphyrins previously observed by Sessler and Kim39, who suggested optical properties as a parameter for aromaticity, and reported that the difference between aromaticity and antiaromaticity is expressed in red-shifted and weaker emission in globally antiaromatic macrocycles compared with globally aromatic macrocycles.As can be observed in Fig.\u00a040. The HOMO\u2013LUMO gap also alternates between odd and even Cm, with the odd-membered (aromatic) C5 and C7 displaying larger gaps  compared with the even-membered (antiaromatic) C6 and C8 . We note that for even Cm, both the HOMO and LUMO levels have the same number of nodal planes, as expected for antiaromatic compounds on the basis of basic symmetry arguments41.The difference in degeneracy is explained by the localized \u03c0-electron character of the structures with antiaromatic contribution compared with the delocalized electron structure of aromatic macrocycles 1H-NMR spectra of Cm show the dependency of the chemical shifts on macrocycle size. In particular, the protons located at the \u03b2-position of the furan rings experience an upfield shift of 0.28\u2009ppm for C6 (6.41\u2009ppm) compared with C5 . The calculated chemical shifts at the M06-2X/6-311\u2009G(d) level show the same trend, with the even-membered Cm members experiencing an upfield shift , whereas positive values suggest a paratropic ring current (an antiaromatic system)42.\u00a0We have chosen to monitor the NICS(1)zz values for the furan rings, since the comparison of ring current for different ring sizes will necessarily result in different NICS values, as the distance from the dummy atom varies. First, the NICS(1)zz values for each member of the Cm series were calculated. Figure\u00a0C5,C6, and C7 are clearly observed in the interior area of the macrocycles: C5 and C7 show very weak aromatic (negative) values, whereas the larger red area in C6 indicates a contribution from global antiaromatic current. The same trend also applies to C8, although in a lesser extent. We note that the aromatic furan units should induce an external deshielding, which can explain why the internal space of the odd-membered macrocycles is not aromatic zz calculations, plots of the anisotropy of the current (induced) density (ACID) only show global ring currents for the macrocycles in their dicationic states (Cm2+). Unlike Cm, the NICS(1)zz maps for [m]CPPA do not display any visible global aromaticity or antiaromaticity regardless of their size n\u2009+\u20092 rule applies to small annulenes, the critical value of n is still debatable. For example, the aromatic stabilization energy of neutral annulenes is effective up to n\u2009=\u20096\u20137 (26\u201330 \u03c0-electrons)6. However, although magnetic criteria are perhaps the commonly applied tool for the quantification of aromaticity, the attenuation of chemical shifts with size was not reported for neutral macrocycles. In the current work, we show that, although the properties are clearly attenuated, alternation in magnetic and electronic properties can be observed experimentally in the Cm series up to 48 \u03c0-electrons (m\u2009=\u20098). To gain insight into the rate of attenuation for sizes larger than m\u2009=\u20098, the NICS(1) values of Cm members were calculated for m\u2009=\u20095\u201312. For comparison, we also calculated the NICS(1) for the same sized [m]CPPA series members . This is a significantly larger value than was observed previously for neutral macrocycles in the S0 state. By contrast, alternation in the NICS(1) values of [m]CPPA attenuates rapidly with size, and no effective change can be observed beyond m\u2009=\u20097. The difference between the two systems can be attributed to the lower local aromaticity of furan amplifying the global properties. It is interesting to analyze these results in the context of \u2018concealed aromaticity\u2019 as recently coined by Gl\u00f6cklhofer45. The global properties of Cm are revealed predominantly upon oxidation  and in the excited state (by fluorescence maxima), and can therefore be categorized as both type-I and type-II concealed aromaticity. However, in contrast to the [m]CPPA series, the aromatic character of Cmis also revealed in the neutral state , highlighting the importance of lowering local aromaticity to reveal global properties.The average NICS(1) values for the furan rings are more negative for odd-members n\u2009+\u20092 \u03c0-electrons, show a global aromatic character whereas the even membered macrocycles (4n \u03c0-electrons) show a global antiaromatic character. These effects are expressed electronically , optically  and magnetically . NICS(1) calculations support the experimental observations. The differences are more pronounced for the smaller macrocycles, C5 and C6, and are attenuated, yet still observable, for C7 and C8. We show that the size-dependency of H\u00fcckel\u2019s rule derives from the local aromaticity of the constituent unit. For macrocyclic furan acetylenes, this dependency can theoretically proceed up to 54 \u03c0-electrons, whereas for [m]CPPA, the alternation decays rapidly, and the effective size is 42 \u03c0-electrons. Overall, this work shows the first example of global aromaticity switching in neutral non-quinoidal macrocycles, and highlights the potential of macrocyclic furans to serve as shape persistent models for large annulenes.In summary, we have introduced a series of \u03c0-conjugated furan-acetylene macrocycles in which the low aromaticity of furan manifests as distinct global effects in the neutral state. The odd-membered macrocycles, consisting of 42 columns. 1H and 13C NMR spectra were recorded in solution on Brucker-AVIII 400\u2009MHz and 500\u2009MHz spectrometers using tetramethylsilane as the external standard. The spectra were recorded using chloroform-d as the solvent. Chemical shifts are expressed in \u03b4 units. High resolution mass spectra were measured on a high resolution quadrupole time-of-flight liquid chromatograph mass spectrometer (MS) and Waters Micromass GCT_Premier MS using electrospray ionization. Matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) spectra were acquired using an MALDI-TOF/TOF autoflex speed MS , which is equipped with a smartbeam-II solid-state laser . The instrument was operated in positive ion, reflectron mode. The accelerating voltage was 21.0\u2009kV. The delay time was 130\u2009ns. Laser fluence were optimized for each sample. The laser was fired at a frequency of 2\u2009kHz and spectra were accumulated in multiples of 500 laser shots, with 1500 shots in total. 2-[(2E)-3-(4-tert-Butylphenyl)-2-methylprop2-enylidene] malononitrile (DCTB) matrix solutions were prepared to a concentration of 20\u2009mg\u2009mL\u22121 in dichloromethane (DCM). Sample solutions were prepared to an approximate concentration of 5\u2009mg\u2009mL\u22121 in DCM. Sample and matrix solutions were premixed at a ratio of 1:9 or 1:40 (v/v). A volume of 1\u2009\u03bcL of this mixture was disposed on a MALDI steel target plate. After evaporation of the solvent, the target was inserted into the mass spectrometer. Preparative size exclusion chromatography was performed in chloroform solution at room temperature using a Recycling Preparative HPLC LaboACE LC-7080 through JAIGEL-2HR and JAIGEL-2.5HR columns connected in series. 2-Bromo-3-hexylfuran (1) was synthesized according to literature procedures35. Absorption spectra were recorded on an Agilent Technologies Cary 5000 UV-Vis-NIR spectrophotometer. Fluorescence and excitation spectra were performed on Horiba Scientific Fluoromax-4 spectrofluorometer. All spectroscopic experiments were performed using standard quartz cuvettes of path length 1\u2009cm and solutions prepared in spectroscopic grade solvents. The excitation laser used was 330\u2009nm with a pulse width of less than 1.4\u2009ns. The synthetic pathway for 4 is described in the Supplementary Synthesis section  , tetrakis(triphenylphosphine)palladium  and CuI  were dissolved in a mixture of 75\u2009mL of dry toluene and 75\u2009mL of distilled N,N-diisopropylethylamine under an inert atmosphere, heated to 60\u2009\u00b0C, and the reaction mixture was stirred for 3 days. Afterward, the reaction mixture was allowed to reach room temperature and was subsequently filtered over celite. The filtrate was evaporated and the residue obtained was purified by flash column chromatography on silica gel using a mixture of DCM and hexane (9:1) as eluent to give a mixture of macrocycles. The mixture was separated using gel permutation chromatography and chloroform as the eluent to give C5 , C6 , C7 , and C8 .2-Ethynyl-3-hexyl-5-iodo-furan (Supplementary InformationDescription of Additional Supplementary FilesSupplementary Data 1Supplementary Data 2Supplementary Data 3"}
{"text": "An omission to the funding section of the original article was made in error. The following sentence has been added: \u201cOpen access funding was provided by the \u00c9cole Polytechnique F\u00e9d\u00e9rale de Lausanne.\u201dThe publisher apologizes for this mistake. The original article has been updated."}
{"text": "Fagopyri Dibotryis Rhizoma (FDR) is an effective Chinese herbal medicine with a long history of use in China. FDR is effective in heat clearing and detoxifying, promotion of blood circulation, relieving carbuncles, dispelling wind, and removing dampness. Its seeds also have high nutritional value, are rich in protein, and contain a variety of mineral elements and vitamins. Therefore, FDR is considered a natural product with medical and economic benefits, and its chemical composition and pharmacological activity are of interest to scientists. The current review provides an overview of the available scientific information on FDR, particularly its botany, chemical constituents, and pharmacological activities. Various sources of valid and comprehensive relevant information were consulted, including the China National Knowledge Infrastructure, Web of Science, and PubMed. Among the keywords used were \u201cFagopyri Dibotryis Rhizoma\u201d, \u201cbotanical features\u201d, \u201cchemical composition\u201d, and \u201cpharmacological activity\u201d in combination. Various ailments are treated with FDR, such as diabetes, tumor, sore throat, headache, indigestion, abdominal distension, dysentery, boils, carbuncles, and rheumatism. FDR is rich in organic acids, tannins, flavonoids, steroids, and triterpenoids. Experiments performed in vitro and in vivo showed that FDR extracts or fractions had a wide range of pharmacological activities, including antitumor, anti-inflammatory, immunomodulatory, antioxidant, antimicrobial, and antidiabetic. The current review provides an integrative perspective on the botany, phytochemistry and pharmacological activities of FDR. FDR may be used as a medicine and food. Based on its chemical composition and pharmacological effects, the main active ingredients of FDR are organic acids, tannins, and flavonoids, and it has obvious antitumor pharmacological activity against a variety of malignant tumors. Therefore, FDR is worthy of further study and application as a potential antitumor drug. Chinese herbal medicine plays a crucial role in the prevention and treatment of diseases as a drug resource for the traditional medical system and as an important raw material for chemical drugs, international botanicals, and the food industry. A significant amount of evidence suggests that medicinal plants may be used to treat a variety of diseases and for the discovery of novel pharmacologically active molecules. The phytochemicals identified from medicinal plants have provided promising lead compounds for effective new drugs . MedicinFagopyrum dibotrys (D. Don) Hara is a perennial herb of the genus Fagopyrum in the family Polygonaceae, and it is widely distributed in the Sichuan Basin, the hills of Guangdong and Guangxi, and the Yunnan-Guizhou Plateau in China and Thailand, Nepal, India and other countries (Fagopyri Dibotryis Rhizoma (FDR) has been widely used as a folk medicine to cure forms of chronic bronchitis, lung cancer, sore throat, rheumatic disease, dysentery, and enteritis  Hara is a perennial herb that is native to eastern, central and southwestern China, India, Nepal, Vietnam, Thailand, and other countries. The habitat of Fagopyrum dibotrys (D. Don) Hara is 250\u20133,200\u00a0m above sea level in valley wetlands and hillside forests. The rhizomes are black\u2012brown, stout, and ligneous, and the stems are long and erect, green, or brownish, 40\u2013100\u00a0cm high, branched, striate, and glabrous. The petiole is 2\u201310\u00a0cm, and the leaf blade is triangular at 4-12 \u00d7 3\u201311\u00a0cm. Both surfaces are papillate, the base is nearly hastate, the leaf margin is entire, and the apex is acuminate. The ocrea is brown, 5\u201310\u00a0mm, membranous, and oblique, and the apex is truncate, not ciliate. Plants have terminal, axillary or corymbose inflorescence. Bracts are ovate-lanceolate, ca. 3\u00a0mm, with membranous margins, and an acute apex, each 4-flowered and rarely 6-flowered. Pedicels are in equaling bracts that articulate at the middle. Perianth are white, and tepals are narrowly elliptical, ca. 2.5\u00a0mm. Stamens are included. The styles are free, and stigmas are much longer than the persistent perianth, capitate, and opaque. During April-August, the chenes are blackish brown, dull, broadly ovoid, 6\u20138\u00a0mm long, trigonous, sometimes narrowly winged, with smooth to repandous angles, and an acute apex -epicatechin -epicatechin , 3,5-dimcatechin .Flavonoids are widely present in naturally growing plants and refer to a class of compounds with two benzene rings connected by three carbon atoms that create the C6-C3-C6 structure . QuercetTannins are phenolic compounds with complex structures that are widely distributed in plants. Procyanidin b2, procyanidin c1 , procyan\u03b2-sitosterol and \u03b2-daucosterol from FDR , phosphorylated-protein kinase B (p-Akt) and phosphorylated-mammalian target of rapamycin (p-mTOR) of the PI3K/Akt pathway (\u03baB) to DNA in the H-RS cell line and inhibited NF-\u03baB-driven genes, including anti-apoptotic proteins  and inhibition of the anti-apoptotic factor B-cell lymphoma-2 (Bcl2). The extract of FDR can also activated caspase-8, caspase-9, and caspase-3 and released mitochondrial cytochrome C . Some exer model . Fr4 proer model . The FDRpression .in vitro via the dual action of PG cells and HUVECs, which inhibited tumor cell metastasis in the blood channel , interleukin-1 and interleukin-6 (IL-6) and inhibition of the expression of nitric oxide synthase, phosphorylation of p38 mitogen-activated protein kinase (p-p38MAPK), extracellular signal regulated kinases 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK) (\u03baB transcription factors and activating JNK and p38 MAPK (Various extracts . The effse (JNK) . Differese (JNK) . Protocap38 MAPK . Rhamnetp38 MAPK .\u03baB and activator protein 1 and suppressing the phosphorylation of PI3K/Akt and MAPK, chrysoeriol inhibited the inflammatory response of LPS-stimulated RAW 264.7 cells /Nrf-2 pathways to inhibit arthritis.By inhibiting the TLR4-mediated activation of NF-.7 cells . Gallic .7 cells . The ant.7 cells . Byun et.7 cells  indicateg et al.  demonstr\u03baB and the induced production of TNF-\u03b1, interleukin-8, IL-6, transforming growth factor-\u03b21 and precollagen peptide III activity in chronic obstructive pulmonary disease rats, which improves lung tissue inflammation  were more effective than SASP alone in ulcerative colitis (UC), and the mechanism may be the anti-inflammatory and immunomodulatory effects of intervening in UC  pathway . FDR tab pathway . The eff pathway . Some st pathway .via multiple pathways, links, and targets -Epiiability . Procyane damage . Procyane damage . Kim et e damage  confirmeFDR leaf tea has significant antioxidant scavenging ability against DPPH radicals, ABTS radicals and hydroxyl radicals . FDR ext\u03b2 Hemolyticus Streptococcus and Streptococcus pneumoniae in vitro and inhibited infections caused by strains of Streptococcus pneumoniae in mice in vivo  mice and regulated lipid metabolism and oxidative stress levels in model animals . FDR leain vitro, and its active ingredient is the flavonoid of FDR, which is concentration dependent . Downregulation of transient receptor potential vanilloid 1 (TRPV1) expression also had a therapeutic effect on hyperalgesia in IBS rats -epicatechin and genkwanin show significant antitumor activity. However, whether the antitumor effects of FDR are the result of the joint action of various components and the specific antitumor mechanism are not clear. Therefore, there is a need for in-depth research on the following aspects. According to pharmacodynamic studies, the effective site of the antitumor effect of FDR must be clarified"}
{"text": "Dentin hypersensitivity is an oral health concern affecting a large percentage of the world's adult population. Occlusion of the exposed dentinal tubules is among the treatment options available, and silver diammine fluoride (SDF) is an occluding agent used for interrupting or dampening the stimulus of the dental pulp nerves that produce pain. In addition to dentin permeability testing, the evaluation of desensitizing agents occluding dentinal tubules strongly relies on microscopic techniques, such as scanning electron microscopy (SEM). Limitations of SEM are that it provides only surface images that lack detailed information on the depth of penetration and amount of material present within the treated specimen, and it is prone to sample preparation artifacts. Here, we present high-resolution X-ray computed tomography (nano-CT) as a potential method for investigating dentin specimens with occluded tubules. We studied human dentin treated with SDF as an exemplary dentinal occlusion treatment option. We evaluated the silver deposits formed on the dentin surface region near the dentinal tubules and in the tubular regions using cross-section SEM, Energy Dispersive X-ray (EDX) analysis, and nano-CT. The resulting images obtained by SEM and nano-CT had comparable resolutions, and both techniques produced images of the tubules' occlusion. Nano-CT provided three-dimensional images adequate to quantitate tubule size and orientation in space. Moreover, it enabled clear visualization of dentinal tubules in any virtual plane and estimation of the amount and depth of occluding material. Thus, nano-CT has the potential to be a valuable technique for evaluating the occluding effects of virtually any material applied to dentinal tubules, supporting deciding between the best occluding treatment options. The occlusion of dentinal tubules\u2019 apertures by desensitizing agents is the primary strategy currently used by clinicians to prevent the pain11. In vitro models are usually used to understand the occlusion efficacy of desensitizing agents12, assessed by morphological analysis of precipitates formed in the dentinal tubules through microscopic methods17.Silver diammine fluoride (SDF) solution is used for preventing and arresting carious lesions in adults and children20, which can be combined with Energy Dispersive X-ray (EDX) analysis to provide surface morphological information, and the identity and ratio of chemical elements on and in the dentinal tubules21. SEM cross-section imaging provides additional information on occluding material penetration depth within the exposed imaged surface22. Different approaches can expose a cross-section of dentin specimens, such as fracturing the sample18, or using a Focused Ion Beam (FIB)24. These preparation techniques, however, are not free from artifacts. Fracturing the sample may add debris to the tubules that could be mistaken as occluding material, and FIB-SEM produces a three-dimensional image from serial two-dimensional SEM images24 in a process that is often challenging, time-consuming and requires post-acquisition image processing, which is limiting to most users25. Thus, the assessment of occlusion depth and the identification of different occluding materials in treated dentin specimens through morphological data can be difficult, either by limitations related to sample preparation or intrinsic to the microscopic imaging technique itself.Those methods include Scanning Electron Microscopy (SEM)26. Micro-computed tomography (micro-CT) was used to investigate the effect of SDF on carious lesions27 and on the enamel surface28. High-resolution CT (nano-CT) was already used to produce images of the dentin, giving details of the architecture of the dentinal tubules in different species at the nanometer scale34. Additionally, it can often access the distribution of the electron density, enabling quantitative analysis of the features observed in the specimens analyzed34. Nano-CT requires sample preparation that can create artifacts in the area where the specimen is processed, but the region of interest for imaging can remain unaffected and artifacts-free. To the best of our knowledge, nano-CT has not been used for the visualization of the occlusion of dentinal tubules after a treatment. Thus, here we show the potential of this technique for assessing dentinal tubule occlusion. We used two different SDF formulations to illustrate the ability of nano-CT to detect their occlusion efficacy and we discuss nano-CT benefits and disadvantages when compared to traditional microscopic methods.X-ray computed tomography (CT) is a cutting-edge imaging technology able to produce volumetric information that has been successfully applied to image small features in biomaterials19. Briefly, eighteen specimens of 4\u00a0mm\u2009\u00d7\u20094\u00a0mm dentin from human tooth roots were prepared to mimic exposed dentin after gingival recession. Human dentin specimens were prepared at Indiana University from human tooth roots. Ethical approval for use of the extracted teeth was given by the Indiana University Institutional Review Board (NSO 911-07). The specimens were polished and, to open their dentinal tubules, all specimens were immersed in a 17% EDTA solution  for 5\u00a0min, then rinsed with running deionized water for 5\u00a0s. They were then randomly allocated in equal amounts to three test groups (n\u2009=\u20096 for each group). Specimens in test group 1 were treated with one drop (c.a. 50\u00a0\u03bcL) of a standard commercial 38% SDF formulation  applied with a micro-brush. The same procedure was done in test group 2, in which the specimens were treated with an experimental SDF formulation  that contains 38% SDF but with a higher viscosity (~\u200930 cP at room temperature). In test group 3, specimens were treated with a placebo solution, free from fluoride or silver, that was freshly prepared and certified by an FDA-regulated laboratory independent of the investigators. The solutions applied onto the specimens remained on the exposed dentin surfaces undisturbed for 1\u00a0min, then rinsed with running deionized water for 5\u00a0s. The specimens were then immersed in artificial saliva  for 2\u00a0h35, rinsed again with running deionized water for 5\u00a0s and the vials with excess moisture were sealed and shipped to the imaging facility.The samples were prepared as described previouslyA total of four specimens from each of the three groups were prepared as illustrated in the supplementary information Fig. 36. Each cone was then glued onto the top of a metallic pin and imaged using ZEISS Xradia 810 Ultra nanoscale X-ray microscope operating with a chromium X-ray source (5.4\u00a0keV). Samples were imaged using absorption-contrast. A total of 901 projections were obtained over 180\u00b0, a camera binning of 2  and exposure time of 30\u00a0s per projection. Image reconstruction was performed by a filtered back-projection algorithm using the software XMReconstructor integrated into the device. Volumetric data was visualized either in Avizo  or VGStudio (version 2022.2). For the estimation of silver within the tubules, data were processed in Avizo, first matching the contrast between the two datasets  to assure that the signal from silver was comparable between datasets. Then, a median filter was applied for image correction, followed by segmentation using interactive threshold, with the threshold defined by the clear boarders seen in the tomograms . The nano-CT 3D image of the conical specimen treated with placebo solution Fig.\u00a0 shows tu3) and the volume occupied by the silver-containing particles (4.8\u00a0\u00b5m3). This information enabled the estimation of the silver percentage in relation to the tubules volume, which is equal to 0.63% for this specimen.Different than the placebo formulation-treated sample, the volumetric images of SDF-treated samples Figs.\u00a0 and S3 s3) and the volume occupied by the silver-containing particles (6.9\u00a0\u00b5m3). Assuming that the particles are composed purely by silver, this information enabled the estimation of the silver percentage in relation to the tubules volume, which is equal to 1.68% for this specimen.The volumetric reconstruction of the sample treated with the experimental SDF formulation shows silver agglomeration in the tubules Fig.\u00a0a, besideWe show in Fig.\u00a038. In part the difference may be because the teeth studied in this earlier work had large natural caries lesions with greater destruction of the tubule architecture than the sound dentin treated with EDTA in this study. With EDX analysis  SEM combined with EDX, and nano-CT. We evaluated silver deposits formed on the dentin surface near the dentinal tubules and in the tubular regions. Our findings show that nano-CT is a useful method for studying dentin. It produces high-resolution 3D images that enable clear visualization of dentinal tubule detail, showing features as small as a few hundred nanometers. Though we used the widely adopted SDF as an example, nano-CT can be used to image all types of materials that produce X-ray contrast against the dentin composition. Our data illustrates that nano-CT is a powerful technique for non-destructive imaging within the volume analyzed, enabling detailed characterization of tubule obstruction. Moreover, it can produce volumetric quantitative data when statistical analysis is of interest, such as when comparing different dentin treatments. Nano-CT enables quantitative evaluation of tubule size and orientation in space, allowing estimation of the volume occupied by occluding particles within the tubules. Thus, nano-CT has the potential to be one alternative methodology for the evaluation of tubular occlusion. We anticipate that it will benefit the evaluation of the occluding effects of virtually any material applied to dentinal tubules, showing the penetration depth of the material within an entire volume of tens of micrometers, thus aiding in the development of more effective interventions for preventing dentin hypersensitivity.Supplementary Video 1.Supplementary Video 2.Supplementary Video 3.Supplementary Information."}